Prion protein and scrapie susceptibility
Smits, M.A.; Bossers, A.; Schreuder, B.E.C.
1997-01-01
This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a
Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John
2013-11-01
Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.
Immunohistochemical detection of prion protein in lymphoid tissues of sheep with natural scrapie
Keulen, van L.J.M.; Schreuder, B.E.C.; Meloen, R.H.; Mooij-Harkes, G.; Vromans, M.E.W.; Langeveld, J.P.M.
1996-01-01
The scrapie-associated form of the prion protein (PrP(Sc)) accumulates in the brain and lymphoid tissues of sheep with scrapie. In order to assess whether detecting PrP(Sc) in lymphoid tissue could he used as a diagnostic test for scrapie, we studied the localization and distribution of PrP(Sc) in
Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks
Acutis, P.L.; Bossers, A.; Priem, J.; Riina, M.V.; Peletto, S.; Mazza, M.; Casalone, C.; Forloni, G.; Ru, G.; Caramelli, M.
2006-01-01
Susceptibility to scrapie in sheep is influenced by polymorphisms of the prion protein (PrP) gene, whereas no strong association between genetics and scrapie has yet been determined in goats due to the limited number of studies on these animals. In this case¿control study on 177 goats from six
Determining the relative susceptibility of four prion protein genotypes to atypical scrapie
Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...
Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.
1997-01-01
Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.
Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I
2016-09-01
Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.
Scrapie prion liposomes and rods exhibit target sizes of 55,000 Da
International Nuclear Information System (INIS)
Bellinger-Kawahara, C.G.; Kempner, E.; Groth, D.; Gabizon, R.; Prusiner, S.B.
1988-01-01
Scrapie is a degenerative neurologic disease in sheep and goats which can be experimentally transmitted to laboratory rodents. Considerable evidence suggests that the scrapie agent is composed largely, if not entirely, of an abnormal isoform of the prion protein (PrPSc). Inactivation of scrapie prions by ionizing radiation exhibited single-hit kinetics and gave a target size of 55,000 +/- 9000 mol wt. The inactivation profile was independent of the form of the prion. Scrapie agent infectivity in brain homogenates, microsomal fractions, detergent-extracted microsomes, purified amyloid rods, and liposomes exhibited the same inactivation profile. Our data are consistent with the hypothesis that the infectious particle causing scrapie contains approximately 2 PrPSc molecules
Directory of Open Access Journals (Sweden)
Kohtaro Miyazawa
Full Text Available In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.
Cali, I.; Castellani, R.; Alshekhlee, A.; Cohen, Y.; Blevins, J.; Yuan, J.; Langeveld, J.P.M.; Parchi, P.; Safar, J.G.; Zou, W.Q.; Gambetti, P.
2009-01-01
Five phenotypically distinct subtypes have been identified in sporadic Creutzfeldt-Jakob disease (sCJD), based on the methionine/valine polymorphic genotype of codon 129 of the prion protein (PrP) gene and the presence of either one of the two protease K-resistant scrapie prion protein (PrPSc) types
Rigter, A.; Bossers, A.
2005-01-01
Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and
Directory of Open Access Journals (Sweden)
Ciriaco Ligios
Full Text Available Prions have been documented in extra-neuronal and extra-lymphatic tissues of humans and various ruminants affected by Transmissible Spongiform Encephalopathy (TSE. The presence of prion infectivity detected in cervid and ovine blood tempted us to reason that kidney, the organ filtrating blood derived proteins, may accumulate disease associated PrP(Sc. We collected and screened kidneys of experimentally, naturally scrapie-affected and control sheep for renal deposition of PrP(Sc from distinct, geographically separated flocks. By performing Western blot, PET blot analysis and immunohistochemistry we found intraepithelial (cortex, medulla and papilla and occasional interstitial (papilla deposition of PrP(Sc in kidneys of scrapie-affected sheep. Interestingly, glomerula lacked detectable signals indicative of PrP(Sc. PrP(Sc was also detected in kidneys of subclinical sheep, but to significantly lower degree. Depending on the stage of the disease the incidence of PrP(Sc in kidney varied from approximately 27% (subclinical to 73.6% (clinical in naturally scrapie-affected sheep. Kidneys from flocks without scrapie outbreak were devoid of PrP(Sc. Here we demonstrate unexpectedly frequent deposition of high levels of PrP(Sc in ovine kidneys of various flocks. Renal deposition of PrP(Sc is likely to be a pre-requisite enabling prionuria, a possible co-factor of horizontal prion-transmission in sheep.
Directory of Open Access Journals (Sweden)
Achim Thomzig
2007-05-01
Full Text Available Prion infectivity and its molecular marker, the pathological prion protein PrP(Sc, accumulate in the central nervous system and often also in lymphoid tissue of animals or humans affected by transmissible spongiform encephalopathies. Recently, PrP(Sc was found in tissues previously considered not to be invaded by prions (e.g., skeletal muscles. Here, we address the question of whether prions target the skin and show widespread PrP(Sc deposition in this organ in hamsters perorally or parenterally challenged with scrapie. In hamsters fed with scrapie, PrP(Sc was detected before the onset of symptoms, but the bulk of skin-associated PrP(Sc accumulated in the clinical phase. PrP(Sc was localized in nerve fibres within the skin but not in keratinocytes, and the deposition of PrP(Sc in skin showed no dependence from the route of infection and lymphotropic dissemination. The data indicated a neurally mediated centrifugal spread of prions to the skin. Furthermore, in a follow-up study, we examined sheep naturally infected with scrapie and detected PrP(Sc by Western blotting in skin samples from two out of five animals. Our findings point to the skin as a potential reservoir of prions, which should be further investigated in relation to disease transmission.
Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...
Detection of prions in the faeces of sheep naturally infected with classical scrapie
Directory of Open Access Journals (Sweden)
Terry Linda A
2011-05-01
Full Text Available Abstract Classical scrapie is a naturally transmitted prion disease of sheep and goats. Contaminated environments may contribute to the spread of disease and evidence from animal models has implicated urine, blood, saliva, placenta and faeces as possible sources of the infection. Here we sought to determine whether sheep naturally infected with classical scrapie shed prions in their faeces. We used serial protein misfolding cyclic amplification (sPMCA along with two extraction methods to examine faeces from sheep during both the clinical and preclinical phases of the disease and showed amplification of PrPSc in 7 of 15 and 14 of 14 sheep respectively. However PrPSc was not amplified from the faeces of 25 sheep not exposed to scrapie. These data represent the first demonstration of prion shedding in faeces from a naturally infected host and thus a likely source of prion contamination in the environment.
Directory of Open Access Journals (Sweden)
Sandra Pritzkow
Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological
Accumulation and dissemination of prion protein in experimental sheep scrapie in the natural host
Directory of Open Access Journals (Sweden)
Warner Richard
2009-02-01
Full Text Available Abstract Background In order to study the sites of uptake and mechanisms of dissemination of scrapie prions in the natural host under controlled conditions, lambs aged 14 days and homozygous for the VRQ allele of the PrP gene were infected by the oral route. Infection occurred in all lambs with a remarkably short and highly consistent incubation period of approximately 6 months. Challenge of lambs at approximately eight months of age resulted in disease in all animals, but with more variable incubation periods averaging significantly longer than those challenged at 14 days. This model provides an excellent system in which to study the disease in the natural host by virtue of the relatively short incubation period and close resemblance to natural infection. Results Multiple sites of prion uptake were identified, of which the most important was the Peyer's patch of the distal ileum. Neuroinvasion was detected initially in the enteric nervous system prior to infection of the central nervous system. At end stage disease prion accumulation was widespread throughout the entire neuraxis, but vacuolar pathology was absent in most animals that developed disease at 6–7 months of age. Conclusion Initial spread of detectable PrP was consistent with drainage in afferent lymph to dependent lymph nodes. Subsequent accumulation of prions in lymphoid tissue not associated with the gut is consistent with haematogenous spread. In addition to macrophages and follicular dendritic cells, prion containing cells consistent with afferent lymph dendritic cells were identified and are suggested as a likely vehicle for carriage of prions from initial site of uptake to the lymphoreticular system, and as potential carriers of prion protein in blood. It is apparent that spongiform change, the characteristic lesion of scrapie and other prion diseases, is not responsible for the clinical signs in sheep, but may develop in an age dependent manner.
Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Serrano, Carmen; Acín, Cristina; Badiola, Juan J; Bossers, Alex; Bolea, Rosa
2012-08-16
The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new biomarkers for diagnosis and therapy. This study is the first to focus on the identification of genes regulated during the preclinical phases of natural scrapie in the ovine medulla oblongata (MO) and the association of these genes with prion deposition, astrocytosis and spongiosis. A custom microarray platform revealed that 86 significant probes had expression changes greater than 2-fold. From these probes, we identified 32 genes with known function; the highest number of regulated genes was included in the phosphoprotein-encoding group. Genes encoding extracellular marker proteins and those involved in the immune response and apoptosis were also differentially expressed. In addition, we investigated the relationship between the gene expression profiles and the appearance of the main scrapie-associated brain lesions. Quantitative Real-time PCR was used to validate the expression of some of the regulated genes, thus showing the reliability of the microarray hybridization technology. Genes involved in protein and metal binding and oxidoreductase activity were associated with prion deposition. The expression of glial fibrillary acidic protein (GFAP) was associated with changes in the expression of genes encoding proteins with oxidoreductase and phosphatase activity, and the expression of spongiosis was related to genes encoding extracellular matrix components or transmembrane transporters. This is the first genome-wide expression study performed in naturally infected sheep with preclinical scrapie. As in previous studies, our findings confirm the close relationship between scrapie and other neurodegenerative diseases.
Huyben, David; Boqvist, Sofia; Passoth, Volkmar; Renström, Lena; Allard Bengtsson, Ulrika; Andréoletti, Olivier; Kiessling, Anders; Lundh, Torbjörn; Vågsholm, Ivar
2018-02-08
Yeasts can be used to convert organic food wastes to protein-rich animal feed in order to recapture nutrients. However, the reuse of animal-derived waste poses a risk for the transmission of infectious prions that can cause neurodegeneration and fatality in humans and animals. The aim of this study was to investigate the ability of yeasts to reduce prion activity during the biotransformation of waste substrates-thereby becoming a biosafety hurdle in such a circular food system. During pre-screening, 30 yeast isolates were spiked with Classical Scrapie prions and incubated for 72 h in casein substrate, as a waste substitute. Based on reduced Scrapie seeding activity, waste biotransformation and protease activities, intact cells and cell extracts of 10 yeasts were further tested. Prion analysis showed that five yeast species reduced Scrapie seeding activity by approximately 1 log10 or 90%. Cryptococcus laurentii showed the most potential to reduce prion activity since both intact and extracted cells reduced Scrapie by 1 log10 and achieved the highest protease activity. These results show that select forms of yeast can act as a prion hurdle during the biotransformation of waste. However, the limited ability of yeasts to reduce prion activity warrants caution as a sole barrier to transmission as higher log reductions are needed before using waste-cultured yeast in circular food systems.
Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Lyahyai, Jaber; Zaragoza, Pilar; Pumarola, Martí; Badiola, Juan J.; Bossers, Alex; Bolea, Rosa
2011-01-01
The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify disease-associated alterations in the gene expression profiles of the caudal medulla oblongata (MO) in sheep presenting the symptomatic phase of natural scrapie. The gene expression patterns in the MO from 7 sheep that had been naturally infected with scrapie were compared with 6 controls using a Central Veterinary Institute (CVI) custom designed 4×44K microarray. The microarray consisted of a probe set on the previously sequenced ovine tissue library by CVI and was supplemented with all of the Ovis aries transcripts that are currently publicly available. Over 350 probe sets displayed greater than 2-fold changes in expression. We identified 148 genes from these probes, many of which encode proteins that are involved in the immune response, ion transport, cell adhesion, and transcription. Our results confirm previously published gene expression changes that were observed in murine models with induced scrapie. Moreover, we have identified new genes that exhibit differential expression in scrapie and could be involved in prion neuropathology. Finally, we have investigated the relationship between gene expression profiles and the appearance of the main scrapie-related lesions, including prion protein deposition, gliosis and spongiosis. In this context, the potential impacts of these gene expression changes in the MO on scrapie development are discussed. PMID:21629698
Prions: Beyond a Single Protein
Das, Alvin S.
2016-01-01
SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089
Recombinant human prion protein inhibits prion propagation in vitro.
Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan
2013-10-09
Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.
Goldmann, W.; Stewart, P.; Marier, E.; Konold, T.; Street, S.; Windl, O.; Ortiz-Pelaez, A.; Langeveld, J.
2016-01-01
Scrapie in goats is a transmissible, fatal prion disease, which is endemic in the British goat population. The recent success in defining caprine PRNP gene variants that provide resistance to experimental and natural classical scrapie has prompted the authors to conduct a survey of PRNP genotypes
IMPY, a potential β-amyloid imaging probe for detection of prion deposits in scrapie-infected mice
International Nuclear Information System (INIS)
Song, P.-J.; Bernard, Serge; Sarradin, Pierre; Vergote, Jackie; Barc, Celine; Chalon, Sylvie; Kung, M.-P.; Kung, Hank F.; Guilloteau, Denis
2008-01-01
Introduction: A potential single-photon emission computed tomography imaging agent for labeling of Aβ plaques of Alzheimer's disease, IMPY (2-(4'-dimethylaminophenyl)-6-iodo-imidazo[1,2-a]pyridine), would be effective in detection of prion amyloid deposits in transmissible spongiform encephalopathies (TSEs). Methods: In vitro autoradiographic studies were carried out with [ 125 I]IMPY on brain sections from scrapie-infected mice and age-matched controls. Competition study was performed to evaluate the prion deposit binding specificity with nonradioactive IMPY. Results: Binding of [ 125 I]IMPY was observed in infected brain sections, while on age-matched control brain sections, there was no or very low labeling. Prion deposit binding was confirmed by histoblots with prion protein-specific monoclonal antibody 2D6. In the presence of nonradioactive IMPY, the binding of [ 125 I]IMPY was significantly inhibited in all regions studied. Conclusions: These findings indicate that IMPY can detect the prion deposits in vitro in scrapie-infected mice. Labeled with 123 I, this ligand may be useful to quantitate prion deposit burdens in TSEs by in vivo imaging
A bovine cell line that can be infected by natural sheep scrapie prions.
Directory of Open Access Journals (Sweden)
Anja M Oelschlegel
Full Text Available Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice. We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.
Directory of Open Access Journals (Sweden)
Acutis Pier Luigi
2012-02-01
Full Text Available Abstract Susceptibility of sheep to scrapie, a transmissible spongiform encephalopathy of small ruminants, is strongly influenced by polymorphisms of the prion protein gene (PRNP. Breeding programs have been implemented to increase scrapie resistance in sheep populations; though desirable, a similar approach has not yet been applied in goats. European studies have now suggested that several polymorphisms can modulate scrapie susceptibility in goats: in particular, PRNP variant K222 has been associated with resistance in case-control studies in Italy, France and Greece. In this study we investigated the resistance conferred by this variant using a natural Italian goat scrapie isolate to intracerebrally challenge five goats carrying genotype Q/Q 222 (wild type and five goats carrying genotype Q/K 222. By the end of the study, all five Q/Q 222 goats had died of scrapie after a mean incubation period of 19 months; one of the five Q/K 222 goats died after 24 months, while the other four were alive and apparently healthy up to the end of the study at 4.5 years post-challenge. All five of these animals were found to be scrapie negative. Statistical analysis showed that the probability of survival of the Q/K 222 goats versus the Q/Q 222 goats was significantly higher (p = 0.002. Our study shows that PRNP gene mutation K222 is strongly associated with resistance to classical scrapie also in experimental conditions, making it a potentially positive target for selection in the frame of breeding programs for resistance to classical scrapie in goats.
Mapping of possible prion protein self interaction domains using peptide arrays
Rigter, A.; Langeveld, J.P.M.; Timmers-Parohi, D.; Jacobs, J.G.; Moonen, P.L.J.M.; Bossers, A.
2007-01-01
Background The common event in transmissible spongiform encephalopathies (TSEs) or prion diseases is the conversion of host-encoded protease sensitive cellular prion protein (PrPC) into strain dependent isoforms of scrapie associated protease resistant isoform (PrPSc) of prion protein (PrP). These
Energy Technology Data Exchange (ETDEWEB)
Song, P.-J. [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Bernard, Serge [IFR135, F-37000 Tours (France); INRA, UR1282, IASP, 37380 Nouzilly (France)], E-mail: bernard@tours.inra.fr; Sarradin, Pierre [INRA, UR1282, IASP, 37380 Nouzilly (France); Vergote, Jackie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Barc, Celine [INRA, UR1282, IASP, 37380 Nouzilly (France); Chalon, Sylvie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Kung, M.-P.; Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Guilloteau, Denis [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France)
2008-02-15
Introduction: A potential single-photon emission computed tomography imaging agent for labeling of A{beta} plaques of Alzheimer's disease, IMPY (2-(4'-dimethylaminophenyl)-6-iodo-imidazo[1,2-a]pyridine), would be effective in detection of prion amyloid deposits in transmissible spongiform encephalopathies (TSEs). Methods: In vitro autoradiographic studies were carried out with [{sup 125}I]IMPY on brain sections from scrapie-infected mice and age-matched controls. Competition study was performed to evaluate the prion deposit binding specificity with nonradioactive IMPY. Results: Binding of [{sup 125}I]IMPY was observed in infected brain sections, while on age-matched control brain sections, there was no or very low labeling. Prion deposit binding was confirmed by histoblots with prion protein-specific monoclonal antibody 2D6. In the presence of nonradioactive IMPY, the binding of [{sup 125}I]IMPY was significantly inhibited in all regions studied. Conclusions: These findings indicate that IMPY can detect the prion deposits in vitro in scrapie-infected mice. Labeled with {sup 123}I, this ligand may be useful to quantitate prion deposit burdens in TSEs by in vivo imaging.
Variation in the prion protein sequence in Dutch goat breeds
Windig, J.J.; Hoving, R.A.H.; Priem, J.; Bossers, A.; Keulen, van L.J.M.; Langeveld, J.P.M.
2016-01-01
Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined
Quantitating PrP Polymorphisms Present in Prions from Heterozygous Scrapie-Infected Sheep.
Silva, Christopher J; Erickson-Beltran, Melissa L; Hui, Colleen; Badiola, Juan José; Nicholson, Eric M; Requena, Jesús R; Bolea, Rosa
2017-01-03
Scrapie is a prion (PrP Sc ) disease of sheep. The incubation period of sheep scrapie is strongly influenced by polymorphisms at positions 136, 154, and 171 of a sheep's normal cellular prion protein (PrP C ). Chymotrypsin was used to digest sheep recombinant PrP to identify a set of characteristic peptides [M 132 LGSXMSRPL 141 (X = A or V), Y 153 XENMY 158 (X,= H or R), and Y 166 RPVDXY 172 (X = H, K, Q, or R)] that could be used to detect and quantitate polymorphisms at positions 136, 154, and 171 of sheep PrP C or PrP Sc . These peptides were used to develop a multiple reaction monitoring method (MRM) to detect the amounts of a particular polymorphism in a sample of PrP Sc isolated from sheep heterozygous for their PrP C proteins. The limit of detection for these peptides was less than 50 attomole. Spinal cord tissue from heterozygous (ARQ/VRQ or ARH/ARQ) scrapie-infected Rasa Aragonesa sheep was analyzed using this MRM method. Both sets of heterozygotes show the presence of both polymorphisms in PrP Sc . This was true for samples containing both proteinase K (PK)-sensitive and PK-resistant PrP Sc and samples containing only the PK-resistant PrP Sc . These results show that heterozygous animals contain PrP Sc that is composed of significant amounts of both PrP polymorphisms.
Prions in milk from ewes incubating natural scrapie.
Directory of Open Access Journals (Sweden)
Caroline Lacroux
2008-12-01
Full Text Available Since prion infectivity had never been reported in milk, dairy products originating from transmissible spongiform encephalopathy (TSE-affected ruminant flocks currently enter unrestricted into the animal and human food chain. However, a recently published study brought the first evidence of the presence of prions in mammary secretions from scrapie-affected ewes. Here we report the detection of consistent levels of infectivity in colostrum and milk from sheep incubating natural scrapie, several months prior to clinical onset. Additionally, abnormal PrP was detected, by immunohistochemistry and PET blot, in lacteal ducts and mammary acini. This PrP(Sc accumulation was detected only in ewes harbouring mammary ectopic lymphoid follicles that developed consequent to Maedi lentivirus infection. However, bioassay revealed that prion infectivity was present in milk and colostrum, not only from ewes with such lympho-proliferative chronic mastitis, but also from those displaying lesion-free mammary glands. In milk and colostrum, infectivity could be recovered in the cellular, cream, and casein-whey fractions. In our samples, using a Tg 338 mouse model, the highest per ml infectious titre measured was found to be equivalent to that contained in 6 microg of a posterior brain stem from a terminally scrapie-affected ewe. These findings indicate that both colostrum and milk from small ruminants incubating TSE could contribute to the animal TSE transmission process, either directly or through the presence of milk-derived material in animal feedstuffs. It also raises some concern with regard to the risk to humans of TSE exposure associated with milk products from ovine and other TSE-susceptible dairy species.
Objects in contact with classical scrapie sheep act as a reservoir for scrapie transmission
Directory of Open Access Journals (Sweden)
Timm eKonold
2015-09-01
Full Text Available Classical scrapie is an environmentally transmissible prion disease of sheep and goats. Prions can persist and remain potentially infectious in the environment for many years and thus pose a risk of infecting animals after re-stocking. In vitro studies using serial Protein Misfolding Cyclic Amplification (sPMCA have suggested that objects on a scrapie-affected sheep farm could contribute to disease transmission. This in vivo study aimed to determine the role of field furniture (water troughs, feeding troughs, fencing and other objects that sheep may rub against used by a scrapie-infected sheep flock as a vector for disease transmission to scrapie-free lambs with the prion protein genotype VRQ/VRQ, which is associated with high susceptibility to classical scrapie. When the field furniture was placed in clean accommodation sheep became infected when exposed to either a water trough (four out of five or to objects used for rubbing (four out of seven. This field furniture had been used by the scrapie-infected flock eight weeks earlier and had previously been shown to harbor scrapie prions by sPMCA. Sheep also became infected (20 out of 23 through exposure to contaminated field furniture placed within pasture not used by scrapie-infected sheep for 40 months, even though swabs from this furniture tested negative by PMCA. This infection rate decreased (1 out of 12 on the same paddock after replacement with clean field furniture. Twelve grazing sheep exposed to field furniture not in contact with scrapie-infected sheep for 18 months remained scrapie-free.The findings of this study highlight the role of field furniture used by scrapie-infected sheep to act as a reservoir for disease re-introduction although infectivity declines considerably if the field furniture has not been in contact with scrapie-infected sheep for several months. PMCA may not be as sensitive as VRQ/VRQ sheep to test for environmental contamination.
Polymorphisms of the prion protein gene Arabi sheep breed in Iran
African Journals Online (AJOL)
Novin
2011-11-09
Nov 9, 2011 ... Key words: Prion protein gene (Prnp), polymorphisms, susceptibility, scrapie. INTRODUCTION. Scrapie is an invariably fatal .... consists of a DNA denaturation step (5 min at 95°C), followed by 30 amplification cycles ...
Enzymatic formulation capable of degrading scrapie prion under mild digestion conditions.
Directory of Open Access Journals (Sweden)
Emeka A Okoroma
Full Text Available The prion agent is notoriously resistant to common proteases and conventional sterilisation procedures. The current methods known to destroy prion infectivity such as incineration, alkaline and thermal hydrolysis are harsh, destructive, environmentally polluting and potentially hazardous, thus limit their applications for decontamination of delicate medical and laboratory devices, remediation of prion contaminated environment and for processing animal by-products including specified risk materials and carcases. Therefore, an environmentally friendly, non-destructive enzymatic degradation approach is highly desirable. A feather-degrading Bacillus licheniformis N22 keratinase has been isolated which degraded scrapie prion to undetectable level of PrP(Sc signals as determined by Western Blot analysis. Prion infectivity was verified by ex vivo cell-based assay. An enzymatic formulation combining N22 keratinase and biosurfactant derived from Pseudomonas aeruginosa degraded PrP(Sc at 65 °C in 10 min to undetectable level -. A time-course degradation analysis carried out at 50 °C over 2 h revealed the progressive attenuation of PrP(Sc intensity. Test of residual infectivity by standard cell culture assay confirmed that the enzymatic formulation reduced PrP(Sc infectivity to undetectable levels as compared to cells challenged with untreated standard scrapie sheep prion (SSBP/1 (p-value = 0.008 at 95% confidence interval. This novel enzymatic formulation has significant potential application for prion decontamination in various environmentally friendly systems under mild treatment conditions.
McLeod, Neil P; Nugent, Philip; Dixon, Douglas; Dennis, Mike; Cornwall, Mark; Mallinson, Gary; Watkins, Nicholas; Thomas, Stephen; Sutton, J Mark
2015-10-01
The P-Capt prion reduction filter (MacoPharma) removes prion infectivity in model systems. This independent evaluation assesses prion removal from endogenously infected animal blood, using CE-marked P-Capt filters, and replicates the proposed use of the filter within the UK Blood Services. Two units of blood, generated from 263K scrapie-infected hamsters, were processed using leukoreduction filters (LXT-quadruple, MacoPharma). Approximately 100 mL of the removed plasma was added back to the red blood cells (RBCs) and the blood was filtered through a P-Capt filter. Samples of unfiltered whole blood, the prion filter input (RBCs plus plasma and SAGM [RBCPS]), and prion-filtered leukoreduced blood (PFB) were injected intracranially into hamsters. Clinical symptoms were monitored for 500 ± 1 day, and brains were assessed for spongiosis and prion protein deposit. In Filtration Run 1, none of the 50 challenged animals were diagnosed with scrapie after inoculation with the RBCPS fraction, while two of 190 hamsters injected with PFB were infected. In Filtration Run 2, one of 49 animals injected with RBCPS and two of 193 hamsters injected with PFB were infected. Run 1 reduced the infectious dose (ID) by 1.467 log (>1.187 log and <0.280 log for leukoreduction and prion filtration, respectively). Run 2 reduced prion infectivity by 1.424 log (1.127 and 0.297 log, respectively). Residual infectivity was estimated at 0.212 ± 0.149 IDs/mL (Run 1) and 0.208 ± 0.147 IDs/mL (Run 2). Leukoreduction removed the majority of infectivity from 263K scrapie hamster blood. The P-Capt filter removed a proportion of the remaining infectivity, but residual infectivity was observed in two independent processes. © 2015 AABB.
Changes in HSP gene and protein expression in natural scrapie with brain damage
2011-01-01
Heat shock proteins (Hsp) perform cytoprotective functions such as apoptosis regulation and inflammatory response control. These proteins can also be secreted to the extracellular medium, acting as inflammatory mediators, and their chaperone activity permits correct folding of proteins and avoids the aggregation of anomalous isoforms. Several studies have proposed the implication of Hsp in prion diseases. We analysed the gene expression and protein distribution of different members of the Hsp27, Hsp70, and Hsp90 families in the central nervous system of sheep naturally infected with scrapie. Different expression profiles were observed in the areas analysed. Whereas changes in transcript levels were not observed in the cerebellum or medulla oblongata, a significant decrease in HSP27 and HSP90 was detected in the prefrontal cortex. In contrast, HSP73 was over-expressed in diencephalons of scrapie animals. Western blotting did not reveal significant differences in Hsp90 and Hsp70 protein expression between scrapie and control animals. Expression rates identified by real-time RT-PCR and western blotting were compared with the extent of classical scrapie lesions using stepwise regression. Changes in Hsp gene and protein expression were associated with prion protein deposition, gliosis and spongiosis rather than with apoptosis. Finally, immunohistochemistry revealed intense Hsp70 and Hsp90 immunolabelling in Purkinje cells of scrapie sheep. In contrast, controls displayed little or no staining in these cells. The observed differences in gene expression and protein distribution suggest that the heat shock proteins analysed play a role in the natural form of the disease. PMID:21314976
Changes in HSP gene and protein expression in natural scrapie with brain damage
Directory of Open Access Journals (Sweden)
Serrano Carmen
2011-01-01
Full Text Available Abstract Heat shock proteins (Hsp perform cytoprotective functions such as apoptosis regulation and inflammatory response control. These proteins can also be secreted to the extracellular medium, acting as inflammatory mediators, and their chaperone activity permits correct folding of proteins and avoids the aggregation of anomalous isoforms. Several studies have proposed the implication of Hsp in prion diseases. We analysed the gene expression and protein distribution of different members of the Hsp27, Hsp70, and Hsp90 families in the central nervous system of sheep naturally infected with scrapie. Different expression profiles were observed in the areas analysed. Whereas changes in transcript levels were not observed in the cerebellum or medulla oblongata, a significant decrease in HSP27 and HSP90 was detected in the prefrontal cortex. In contrast, HSP73 was over-expressed in diencephalons of scrapie animals. Western blotting did not reveal significant differences in Hsp90 and Hsp70 protein expression between scrapie and control animals. Expression rates identified by real-time RT-PCR and western blotting were compared with the extent of classical scrapie lesions using stepwise regression. Changes in Hsp gene and protein expression were associated with prion protein deposition, gliosis and spongiosis rather than with apoptosis. Finally, immunohistochemistry revealed intense Hsp70 and Hsp90 immunolabelling in Purkinje cells of scrapie sheep. In contrast, controls displayed little or no staining in these cells. The observed differences in gene expression and protein distribution suggest that the heat shock proteins analysed play a role in the natural form of the disease.
Polymorphisms of the prion protein gene Arabi sheep breed in Iran ...
African Journals Online (AJOL)
Ovine scrapie is a neurodegenerative disease caused by polymorphisms of the prion protein gene (Prnp); especially the amino acid residue alterations at codons 136, 154, and 174, in sheep have been found to be associated with susceptibility to scrapie disease. We studied Prnp polymorphisms in local sheep of ...
Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce
2015-06-01
Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by
International Nuclear Information System (INIS)
Yang Chiming
2003-01-01
Owing to the high oxygen-respiration in the brain of mammals, oxidative damage to prion protein has been suggested to be an additional factor. A large body of intriguing features of scrapie and prion diseases have provided multiple lines of indirect chemistry evidence, suggesting that the infectious agents may be putative forms of sequence-specific prion radicals (SSPR) and/or their immediate precursors in the transmissible spongiform encephalopathies (TSE). Here a molecular mechanism corresponding to the self-replication of scrapie protein mediated by prion free-radical processes, consonant with 'protein-only' hypotheses is proposed. This new theory may not only aid our understanding of the occurrence of prions, but also provides new insight into the possible chemistry principles underlying the neutrodegenerative disorders. It is anticipated that future studies based on this suggestion and chemistry principles of genetic diseases may allow us to determine an effective approach to stop mad cow disease and its human version, new variant of Creutzfeldt-Jakob disease (v CJD)
Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Serrano, C.; Acín, C.; Badiola, J.J.; Bossers, A.; Bolea, R.
2012-01-01
Background The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new
Cytosolic PrP Can Participate in Prion-Mediated Toxicity
Thackray, Alana M.; Zhang, Chang; Arndt, Tina
2014-01-01
ABSTRACT Prion diseases are characterized by a conformational change in the normal host protein PrPC. While the majority of mature PrPC is tethered to the plasma membrane by a glycosylphosphatidylinositol anchor, topological variants of this protein can arise during its biosynthesis. Here we have generated Drosophila transgenic for cytosolic ovine PrP in order to investigate its toxic potential in flies in the absence or presence of exogenous ovine prions. While cytosolic ovine PrP expressed in Drosophila was predominantly detergent insoluble and showed resistance to low concentrations of proteinase K, it was not overtly detrimental to the flies. However, Drosophila transgenic for cytosolic PrP expression exposed to classical or atypical scrapie prion inocula showed a faster decrease in locomotor activity than similar flies exposed to scrapie-free material. The susceptibility to classical scrapie inocula could be assessed in Drosophila transgenic for panneuronal expression of cytosolic PrP, whereas susceptibility to atypical scrapie required ubiquitous PrP expression. Significantly, the toxic phenotype induced by ovine scrapie in cytosolic PrP transgenic Drosophila was transmissible to recipient PrP transgenic flies. These data show that while cytosolic PrP expression does not adversely affect Drosophila, this topological PrP variant can participate in the generation of transmissible scrapie-induced toxicity. These observations also show that PrP transgenic Drosophila are susceptible to classical and atypical scrapie prion strains and highlight the utility of this invertebrate host as a model of mammalian prion disease. IMPORTANCE During prion diseases, the host protein PrPC converts into an abnormal conformer, PrPSc, a process coupled to the generation of transmissible prions and neurotoxicity. While PrPC is principally a glycosylphosphatidylinositol-anchored membrane protein, the role of topological variants, such as cytosolic PrP, in prion-mediated toxicity and
Johnson, Christopher J.; Morawski, A.R.; Carlson, C.M.; Chang, H.
2013-01-01
Background: Transmissible spongiform encephalopathies (TSEs) affect both domestic sheep (scrapie) and captive and free-ranging cervids (chronic wasting disease; CWD). The geographical range of bighorn sheep (Ovis canadensis; BHS) overlaps with states or provinces that have contained scrapie-positive sheep or goats and areas with present epizootics of CWD in cervids. No TSEs have been documented in BHS, but the susceptibility of this species to TSEs remains unknown. Results: We acquired a library of BHS tissues and found no evidence of preexisting TSEs in these animals. The prion protein gene (Prnp) in all BHS in our library was identical to scrapie-susceptible domestic sheep (A136R 154Q171). Using an in vitro prion protein conversion assay, which has been previously used to assess TSE species barriers and, in our study appears to recollect known species barriers in mice, we assessed the potential transmissibility of TSEs to BHS. As expected based upon Prnp genotype, we observed BHS prion protein conversion by classical scrapie agent and evidence for a species barrier between transmissible mink encephalopathy (TME) and BHS. Interestingly, our data suggest that the species barrier of BHS to white-tailed deer or wapiti CWD agents is likely low. We also used protein misfolding cyclic amplification to confirm that CWD, but not TME, can template prion protein misfolding in A136R 154Q171genotype sheep. Conclusions: Our results indicate the in vitro conversion assay used in our study does mimic the species barrier of mice to the TSE agents that we tested. Based on Prnp genotype and results from conversion assays, BHS are likely to be susceptible to infection by classical scrapie. Despite mismatches in amino acids thought to modulate prion protein conversion, our data indicate that A136R154Q171 genotype sheep prion protein is misfolded by CWD agent, suggesting that these animals could be susceptible to CWD. Further investigation of TSE transmissibility to BHS, including
Directory of Open Access Journals (Sweden)
Nicola Franscini
Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.
Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Lyahyai, J.; Zaragoza, P.; Pumarola, M.; Badiola, J.J.; Bossers, A.; Bolea, R.
2011-01-01
The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify
Membrane toxicity of abnormal prion protein in adrenal chromaffin cells of scrapie infected sheep.
Directory of Open Access Journals (Sweden)
Gillian McGovern
Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases are associated with accumulations of disease specific PrP (PrP(d in the central nervous system (CNS and often the lymphoreticular system (LRS. Accumulations have additionally been recorded in other tissues including the peripheral nervous system and adrenal gland. Here we investigate the effect of sheep scrapie on the morphology and the accumulation of PrP(d in the adrenal medulla of scrapie affected sheep using light and electron microscopy. Using immunogold electron microscopy, non-fibrillar forms of PrP(d were shown to accumulate mainly in association with chromaffin cells, occasional nerve endings and macrophages. PrP(d accumulation was associated with distinctive membrane changes of chromaffin cells including increased electron density, abnormal linearity and invaginations. Internalisation of PrP(d from the chromaffin cell plasma membrane occurred in association with granule recycling following hormone exocytosis. PrP(d accumulation and internalisation from membranes is similarly associated with perturbations of membrane structure and trafficking in CNS neurons and tingible body macrophages of the LRS. These data suggest that a major toxic effect of PrP(d is at the level of plasma membranes. However, the precise nature of PrP(d-membrane toxicity is tissue and cell specific suggesting that the normal protein may act as a multi-functional scaffolding molecule. We further suggest that the co-localisation of PrP(d with exocytic granules of the hormone trafficking system may provide an additional source of infectivity in blood.
The placenta shed from goats with classical scrapie is infectious to goat kids and lambs.
Schneider, David A; Madsen-Bouterse, Sally A; Zhuang, Dongyue; Truscott, Thomas C; Dassanayake, Rohana P; O'Rourke, Katherine I
2015-08-01
The placenta of domestic sheep plays a key role in horizontal transmission of classical scrapie. Domestic goats are frequently raised with sheep and are susceptible to classical scrapie, yet potential routes of transmission from goats to sheep are not fully defined. Sparse accumulation of disease-associated prion protein in cotyledons casts doubt about the role of the goat's placenta. Thus, relevant to mixed-herd management and scrapie-eradication efforts worldwide, we determined if the goat's placenta contains prions orally infectious to goat kids and lambs. A pooled cotyledon homogenate, prepared from the shed placenta of a goat with naturally acquired classical scrapie disease, was used to orally inoculate scrapie-naïve prion genotype-matched goat kids and scrapie-susceptible lambs raised separately in a scrapie-free environment. Transmission was detected in all four goats and in two of four sheep, which importantly identifies the goat's placenta as a risk for horizontal transmission to sheep and other goats.
Maestrale, Caterina; Cancedda, Maria G.; Pintus, Davide; Masia, Mariangela; Nonno, Romolo; Ru, Giuseppe; Carta, Antonello; Demontis, Francesca; Santucciu, Cinzia
2015-01-01
ABSTRACT Thirty-seven goats carrying different prion protein genotypes (PRNP) were orally infected with a classical scrapie brain homogenate from wild-type (ARQ/ARQ) sheep and then mated to obtain 2 additional generations of offspring, which were kept in the same environment and allowed to be naturally exposed to scrapie. Occurrence of clinical or subclinical scrapie was observed in the experimentally infected goats (F0) and in only one (F1b) of the naturally exposed offspring groups. In both groups (F0 and F1b), goats carrying the R154H, H154H, R211Q, and P168Q-P240P dimorphisms died of scrapie after a longer incubation period than wild-type, G37V, Q168Q-P240P, and S240P goats. In contrast, D145D and Q222K goats were resistant to infection. The immunobiochemical signature of the scrapie isolate and its pathological aspects observed in the sheep donors were substantially maintained over 2 goat generations, i.e., after experimental and natural transmission. This demonstrates that the prion protein gene sequence, which is shared by sheep and goats, is more powerful than any possible but unknown species-related factors in determining scrapie phenotypes. With regard to genetics, our study confirms that the K222 mutation protects goats even against ovine scrapie isolates, and for the first time, a possible association of D145 mutation with scrapie resistance is shown. In addition, it is possible that the sole diverse frequencies of these genetic variants might, at least in part, shape the prevalence of scrapie among naturally exposed progenies in affected herds. IMPORTANCE This study was aimed at investigating the genetic and pathological features characterizing sheep-to-goat transmission of scrapie. We show that in goats with different prion protein gene mutations, the K222 genetic variant is associated with scrapie resistance after natural and experimental exposure to ovine prion infectivity. In addition, we observed for the first time a protective effect of the D145
Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro
2018-01-01
Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of
Directory of Open Access Journals (Sweden)
Cristina Acín
Full Text Available Classical scrapie is a neurological disorder of the central nervous system (CNS characterized by the accumulation of an abnormal, partially protease resistant prion protein (PrP(sc in the CNS and in some peripheral tissues in domestic small ruminants. Whereas the pathological changes and genetic susceptibility of ovine scrapie are well known, caprine scrapie has been less well studied. We report here a pathological study of 13 scrapie-affected goats diagnosed in Spain during the last 9 years. We used immunohistochemical and biochemical techniques to discriminate between classical and atypical scrapie and bovine spongiform encephalopathy (BSE. All the animals displayed PrP(sc distribution patterns and western blot characteristics compatible with classical scrapie. In addition, we determined the complete open reading frame sequence of the PRNP in these scrapie-affected animals. The polymorphisms observed were compared with those of the herd mates (n = 665 and with the frequencies of healthy herds (n = 581 of native Spanish goats (Retinta, Pirenaica and Moncaina and other worldwide breeds reared in Spain (Saanen, Alpine and crossbreed. In total, sixteen polymorphic sites were identified, including the known amino acid substitutions at codons G37V, G127S, M137I, I142M, H143R, R151H, R154H, R211Q, Q222K, G232W, and P240S, and new polymorphisms at codons G74D, M112T, R139S, L141F and Q215R. In addition, the known 42, 138 and 179 silent mutations were detected, and one new one is reported at codon 122. The genetic differences observed in the population studied have been attributed to breed and most of the novel polymorphic codons show frequencies lower than 5%. This work provides the first basis of polymorphic distribution of PRNP in native and worldwide goat breeds reared in Spain.
Directory of Open Access Journals (Sweden)
James B Stanton
Full Text Available Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C to disease-associated prion protein (PrP(Sc. Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772, which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ and Rov9 cultures (VRQ-ovinized RK13 cells. We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C expression is not the mechanism of PrP(Sc inhibition. PrP(Sc accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc activity was independent of anti-pestivirus activity. The anti-PrP(Sc selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.
Goldmann, W; Marier, E; Stewart, P; Konold, T; Street, S; Langeveld, J; Windl, O; Ortiz-Pelaez, A
2016-02-13
Scrapie in goats is a transmissible, fatal prion disease, which is endemic in the British goat population. The recent success in defining caprine PRNP gene variants that provide resistance to experimental and natural classical scrapie has prompted the authors to conduct a survey of PRNP genotypes in 10 goat breeds and 52 herds to find goats with the resistant K222 allele. They report here the frequencies in 1236 tested animals of the resistance-associated K222 and several other alleles by breed and herd. Eight animals were found to be heterozygous QK222 goats (0.64 per cent genotype frequency, 95 per cent CI 0.28 to 1.27 per cent) but no homozygous KK222 goats were detected. The K222 allele was found in Saanen, Toggenburg and Anglo-Nubian goats. The fact that only a few goats with the K222 allele have been identified does not preclude the possibility to design and implement successful breeding programmes at national level. British Veterinary Association.
Directory of Open Access Journals (Sweden)
Samuel E Saunders
2011-04-01
Full Text Available Prion interactions with soil may play an important role in the transmission of chronic wasting disease (CWD and scrapie. Prions are known to bind to a wide range of soil surfaces, but the effects of adsorption solution chemistry and long-term soil binding on prion fate and transmission risk are unknown. We investigated HY TME prion protein (PrP(Sc adsorption to soil minerals in aqueous solutions of phosphate buffered saline (PBS, sodium chloride, calcium chloride, and deionized water using western blotting. The replication efficiency of bound prions following adsorption in these solutions was also evaluated by protein misfolding cyclic amplification (PMCA. Aging studies investigated PrP(Sc desorption and replication efficiency up to one year following adsorption in PBS or DI water. Results indicate that adsorption solution chemistry can affect subsequent prion replication or desorption ability, especially after incubation periods of 30 d or longer. Observed effects were minor over the short-term (7 d or less. Results of long-term aging experiments demonstrate that unbound prions or prions bound to a diverse range of soil surfaces can readily replicate after one year. Our results suggest that while prion-soil interactions can vary with solution chemistry, prions bound to soil could remain a risk for transmitting prion diseases after months in the environment.
DEFF Research Database (Denmark)
Bergström, Ann-Louise; Jensen, Tim Kåre; Heegaard, Peter M. H.
2006-01-01
The disease-associated prion protein (PrPSc) has been detected in the ileal Peyer's patches of lambs as early as one week after oral exposure to scrapie. In hamsters, the earliest reported time of PrPSc detection in the Peyer's patches after oral exposure to scrapie is 69 days post-infection. To ......The disease-associated prion protein (PrPSc) has been detected in the ileal Peyer's patches of lambs as early as one week after oral exposure to scrapie. In hamsters, the earliest reported time of PrPSc detection in the Peyer's patches after oral exposure to scrapie is 69 days post...
Greenlee, Justin J; Kunkle, Robert A; Richt, Jürgen A; Nicholson, Eric M; Hamir, Amir N
2014-01-01
Sheep scrapie is a transmissible spongiform encephalopathy that can be transmitted horizontally. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent and the tissue levels and distribution of PrPSc in affected sheep. The purpose of this study was to compare the survival time and PrPSc tissue distribution in sheep with highly resistant and highly susceptible PRNP genotypes after intracranial inoculation of the agent of scrapie. Five sheep each of genotype VRQ/VRQ, VRQ/ARR or ARQ/ARR were inoculated. Sheep were euthanized when clinical signs of scrapie became severe. Clinical signs, microscopic lesions, and western blot profiles were uniform across genotypes and consistent with manifestations of classical scrapie. Mean survival time differences were associated with the 171 polymorphic site with VRQ/VRQ sheep surviving 18 months, whereas VRQ/ARR and ARQ/ARR sheep survived 60 and 56 months, respectively. Labeling of PrPSc by immunohistochemistry revealed similar accumulations in central nervous system tissues regardless of host genotype. Immunoreactivity for PrPSc in lymphoid tissue was consistently abundant in VRQ/VRQ, present but confined to tonsil or retropharyngeal lymph node in 4/5 VRQ/ARR, and totally absent in ARQ/ARR sheep. The results of this study demonstrate the susceptibility of sheep with the ARQ/ARR genotype to scrapie by the intracranial inoculation route with PrPSc accumulation in CNS tissues, but prolonged incubation times and lack of PrPSc in lymphoid tissue.
Genotyping and surveillance for scrapie in Finnish sheep
Directory of Open Access Journals (Sweden)
Hautaniemi Maria
2012-07-01
Full Text Available Abstract Background The progression of scrapie is known to be influenced by the amino acid polymorphisms of the host prion protein (PrP gene. There is no breeding programme for TSE resistance in sheep in Finland, but a scrapie control programme has been in place since 1995. In this study we have analysed PrP genotypes of total of 928 purebred and crossbred sheep together with the data of scrapie survey carried out in Finland during 2002–2008 in order to gain knowledge of the genotype distribution and scrapie prevalence in Finnish sheep. Results The ARQ/ARQ genotype was the most common genotype in all breeds studied. ARR allele frequency was less than 12% in purebred Finnish sheep and in most genotypes heterozygous for ARR, the second allele was ARQ. The VRQ allele was not detected in the Grey race sheep of Kainuu or in the Aland sheep, and it was present in less than 6% of the Finnish Landrace sheep. Leucine was the most prominent amino acid found in codon 141. In addition, one novel prion dimorphisms of Q220L was detected. During the scrapie survey of over 15 000 sheep in 2002–2008, no classical scrapie cases and only five atypical scrapie cases were detected. Conclusions The results indicate that the Finnish sheep populations have genetically little resistance to classical scrapie, but no classical scrapie was detected during an extensive survey in 2002–2008. However, five atypical scrapie cases emerged; thus, the disease is present in the Finnish sheep population at a low level.
Directory of Open Access Journals (Sweden)
Sarah Vascellari
Full Text Available Different transmissible spongiform encephalopathy (TSE-associated forms of prion protein (e.g. PrP(Sc can vary markedly in ultrastructure and biochemical characteristics, but each is propagated in the host. PrP(Sc propagation involves conversion from its normal isoform, PrP(C, by a seeded or templated polymerization mechanism. Such a mechanism is also the basis of the RT-QuIC and eQuIC prion assays which use recombinant PrP (rPrP(Sen as a substrate. These ultrasensitive detection assays have been developed for TSE prions of several host species and sample tissues, but not for murine models which are central to TSE pathogenesis research. Here we have adapted RT-QuIC and eQuIC to various murine prions and evaluated how seeding activity depends on glycophosphatidylinositol (GPI anchoring and the abundance of amyloid plaques and protease-resistant PrP(Sc (PrP(Res. Scrapie brain dilutions up to 10(-8 and 10(-13 were detected by RT-QuIC and eQuIC, respectively. Comparisons of scrapie-affected wild-type mice and transgenic mice expressing GPI anchorless PrP showed that, although similar concentrations of seeding activity accumulated in brain, the heavily amyloid-laden anchorless mouse tissue seeded more rapid reactions. Next we compared seeding activities in the brains of mice with similar infectivity titers, but widely divergent PrP(Res levels. For this purpose we compared the 263K and 139A scrapie strains in transgenic mice expressing P101L PrP(C. Although the brains of 263K-affected mice had little immunoblot-detectable PrP(Res, RT-QuIC indicated that seeding activity was comparable to that associated with a high-PrP(Res strain, 139A. Thus, in this comparison, RT-QuIC seeding activity correlated more closely with infectivity than with PrP(Res levels. We also found that eQuIC, which incorporates a PrP(Sc immunoprecipitation step, detected seeding activity in plasma from wild-type and anchorless PrP transgenic mice inoculated with 22L, 79A and/or RML
White blood cell-based detection of asymptomatic scrapie infection by ex vivo assays.
Directory of Open Access Journals (Sweden)
Sophie Halliez
Full Text Available Prion transmission can occur by blood transfusion in human variant Creutzfeldt-Jakob disease and in experimental animal models, including sheep. Screening of blood and its derivatives for the presence of prions became therefore a major public health issue. As infectious titer in blood is reportedly low, highly sensitive and robust methods are required to detect prions in blood and blood derived products. The objectives of this study were to compare different methods--in vitro, ex vivo and in vivo assays--to detect prion infectivity in cells prepared from blood samples obtained from scrapie infected sheep at different time points of the disease. Protein misfolding cyclic amplification (PMCA and bioassays in transgenic mice expressing the ovine prion protein were the most efficient methods to identify infected animals at any time of the disease (asymptomatic to terminally-ill stages. However scrapie cell and cerebellar organotypic slice culture assays designed to replicate ovine prions in culture also allowed detection of prion infectivity in blood cells from asymptomatic sheep. These findings confirm that white blood cells are appropriate targets for preclinical detection and introduce ex vivo tools to detect blood infectivity during the asymptomatic stage of the disease.
2013-01-01
The molecular pathogenic mechanisms of prion diseases are far from clear. Genomic analyses have revealed genetic biomarkers potentially involved in prion neuropathology in naturally scrapie-infected sheep, a good animal model of infectious prionopathies. However, these biomarkers must be validated in independent studies at different stages of the disease. The gene and protein expression profiles and protein distribution of six potential genetic biomarkers (i.e., CAPN6, COL1A2, COL3A1, GALA1, MT2A and MTNR1B) are presented here for both the early and terminal stages of scrapie in five different brain regions. Gene transcription changes were confirmed in the medulla oblongata, and the expression profiles were generally similar in other central nervous system regions. The changes were more substantial in clinical animals compared to preclinical animals. The expression of the CAPN6 protein increased in the spinal cord and cerebellum of the clinical and preclinical brains. The distribution of the GALA1 was identified in glial cells from the cerebellum of scrapie-infected animals, GALA1 protein expression was increased in clinical animals in the majority of regions, and the increase of MT2A was in agreement with previous reports. The downregulation of MTNR1B was especially marked in the Purkinje cells. Finally, although collagen genes were downregulated the protein immunostaining did not reveal significant changes between the scrapie-infected and control animals. In conclusion, this study of gene transcription and protein expression and distribution confirm CAPN6, GALA1, MTNR1B and MT2A as potential targets for further prion disease research. PMID:23497022
Differential effects of divalent cations on elk prion protein fibril formation and stability
Misfolding of the normally folded prion protein of mammals (PrPC) into infectious fibrils causes a variety of different diseases, from scrapie in sheep to bovine spongiform encephalopathy in cattle to chronic wasting disease (CWD) in deer and elk. The misfolded form of PrPC, termed PrPSc, or in this...
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Windig, J.J.; Meuleman, H.; Lansbergen, L.M.T.E.
2007-01-01
Scrapie is a fatal infectious neurodegenerative disease for which susceptibility is associated with polymorphisms in the ovine prion protein (PrP) gene. Scrapie-eradication programmes are based on eliminating the susceptible VRQ allele and/or breeding for the resistant ARR allele. In rare breeds or
Directory of Open Access Journals (Sweden)
Jean-Noël Arsac
Full Text Available Transmissible spongiform encephalopathies (TSEs are a group of fatal neurodegenerative diseases associated with a misfolded form of host-encoded prion protein (PrP. Some of them, such as classical bovine spongiform encephalopathy in cattle (BSE, transmissible mink encephalopathy (TME, kuru and variant Creutzfeldt-Jakob disease in humans, are acquired by the oral route exposure to infected tissues. We investigated the possible transmission by the oral route of a panel of strains derived from ruminant prion diseases in a transgenic mouse model (TgOvPrP4 overexpressing the ovine prion protein (A136R154Q171 under the control of the neuron-specific enolase promoter. Sources derived from Nor98, CH1641 or 87V scrapie sources, as well as sources derived from L-type BSE or cattle-passaged TME, failed to transmit by the oral route, whereas those derived from classical BSE and classical scrapie were successfully transmitted. Apart from a possible effect of passage history of the TSE agent in the inocula, this implied the occurrence of subtle molecular changes in the protease-resistant prion protein (PrPres following oral transmission that can raises concerns about our ability to correctly identify sheep that might be orally infected by the BSE agent in the field. Our results provide proof of principle that transgenic mouse models can be used to examine the transmissibility of TSE agents by the oral route, providing novel insights regarding the pathogenesis of prion diseases.
Zabel, Mark D.; Reid, Crystal
2015-01-01
Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713
Epigenetic dominance of prion conformers.
Directory of Open Access Journals (Sweden)
Eri Saijo
2013-10-01
Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to
Genetic Resistance to Scrapie Infection in Experimentally Challenged Goats
Lacroux, Caroline; Perrin-Chauvineau, Cécile; Corbière, Fabien; Aron, Naima; Aguilar-Calvo, Patricia; Torres, Juan Maria; Costes, Pierrette; Brémaud, Isabelle; Lugan, Séverine; Schelcher, François; Barillet, Francis
2014-01-01
In goats, several field studies have identified coding mutations of the gene encoding the prion protein (I/M142, N/D146, S/D146, R/Q211, and Q/K222) that are associated with a lower risk of developing classical scrapie. However, the data related to the levels of resistance to transmissible spongiform encephalopathies (TSEs) of these different PRNP gene mutations are still considered insufficient for developing large-scale genetic selection against scrapie in this species. In this study, we inoculated wild-type (WT) PRNP (I142R154R211Q222) goats and homozygous and/or heterozygous I/M142, R/H154, R/Q211, and Q/K222 goats with a goat natural scrapie isolate by either the oral or the intracerebral (i.c.) route. Our results indicate that the I/M142 PRNP polymorphism does not provide substantial resistance to scrapie infection following intracerebral or oral inoculation. They also demonstrate that H154, Q211, and K222 PRNP allele carriers are all resistant to scrapie infection following oral exposure. However, in comparison to WT animals, the H154 and Q211 allele carriers displayed only moderate increases in the incubation period following i.c. challenge. After i.c. challenge, heterozygous K222 and a small proportion of homozygous K222 goats also developed the disease, but with incubation periods that were 4 to 5 times longer than those in WT animals. These results support the contention that the K222 goat prion protein variant provides a strong but not absolutely protective effect against classical scrapie. PMID:24284317
Prion protein degradation by lichens of the genus Cladonia
Bennett, James P.; Rodriguez, Cynthia M.; Johnson, Christopher J.
2012-01-01
It has recently been discovered that lichens contain a serine protease capable of degrading the pathogenic prion protein, the etiological agent of prion diseases such as sheep scrapie and cervid chronic wasting disease. Limited methods are available to degrade or inactivate prion disease agents, especially in the environment, and lichens or their serine protease could prove important for management of these diseases. Scant information is available regarding the presence or absence of the protease responsible for degrading prion protein (PrP) in lichen species and, in this study, we tested the hypothesis that PrP degradation activity in lichens is phylogenetically-based by testing 44 species of Cladonia lichens, a genus for which a significant portion of the phylogeny is well established. We categorized PrP degradation activity among the 44 species (high, moderate, low or none) and found that activity in Cladonia species did not correspond with phylogenetic position of the species. Degradation of PrP did correspond, however, with three classical taxonomic characters within the genus: species with brown apothecia, no usnic acid, and the presence of a cortex. Of the 44 species studied, 18 (41%) had either high or moderate PrP degradation activity, suggesting the protease may be frequent in this genus of lichens.
Directory of Open Access Journals (Sweden)
Wagner Wibke
2012-12-01
Full Text Available Abstract Background It has been widely established that the conversion of the cellular prion protein (PrPC into its abnormal isoform (PrPSc is responsible for the development of transmissible spongiform encephalopathies (TSEs. However, the knowledge of the detailed molecular mechanisms and direct functional consequences within the cell is rare. In this study, we aimed at the identification of deregulated proteins which might be involved in prion pathogenesis. Findings Apolipoprotein E and peroxiredoxin 6 (PRDX6 were identified as upregulated proteins in brains of scrapie-infected mice and cultured neuronal cell lines. Downregulation of PrP gene expression using specific siRNA did not result in a decrease of PRDX6 amounts. Interestingly, selective siRNA targeting PRDX6 or overexpression of PRDX6 controlled PrPC and PrPSc protein amounts in neuronal cells. Conclusions Besides its possible function as a novel marker protein in the diagnosis of TSEs, PDRX6 represents an attractive target molecule in putative pharmacological intervention strategies in the future.
Kittelberger, R.; McIntuyre, L.; Watts, S.; MacDiarmid, S.; Hannah, M.J.; Jenner, J.; Bueno, R.; Swainsbury, R.; Langeveld, J.P.M.; Keulen, van L.J.M.; Zijderveld, van F.G.; Wemheuer, W.M.; Richt, J.A.; Sorenson, S.J.; Pigott, C.J.; O'Keefe, J.S.
2014-01-01
AIMS: To estimate the number of cases of scrapie that would occur in sheep of different prion protein (PrP) genotypes if scrapie was to become established in New Zealand, and to compare the performance of two commercially available, rapid ELISA kits using ovine retro-pharyngeal lymph nodes (RLN)
A closer look at prion strains
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828
Directory of Open Access Journals (Sweden)
Maxime Belondrade
Full Text Available The prevalence of variant Creutzfeldt-Jakob disease (vCJD in the population remains uncertain, although it has been estimated that 1 in 2000 people in the United Kingdom are positive for abnormal prion protein (PrPTSE by a recent survey of archived appendix tissues. The prominent lymphotropism of vCJD prions raises the possibility that some surgical procedures may be at risk of iatrogenic vCJD transmission in healthcare facilities. It is therefore vital that decontamination procedures applied to medical devices before their reprocessing are thoroughly validated. A current limitation is the lack of a rapid model permissive to human prions. Here, we developed a prion detection assay based on protein misfolding cyclic amplification (PMCA technology combined with stainless-steel wire surfaces as carriers of prions (Surf-PMCA. This assay allowed the specific detection of minute quantities (10-8 brain dilution of either human vCJD or ovine scrapie PrPTSE adsorbed onto a single steel wire, within a two week timeframe. Using Surf-PMCA we evaluated the performance of several reference and commercially available prion-specific decontamination procedures. Surprisingly, we found the efficiency of several marketed reagents to remove human vCJD PrPTSE was lower than expected. Overall, our results demonstrate that Surf-PMCA can be used as a rapid and ultrasensitive assay for the detection of human vCJD PrPTSE adsorbed onto a metallic surface, therefore facilitating the development and validation of decontamination procedures against human prions.
Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid.
Directory of Open Access Journals (Sweden)
Andrew G Hughson
2016-09-01
Full Text Available Hypochlorous acid (HOCl is produced naturally by neutrophils and other cells to kill conventional microbes in vivo. Synthetic preparations containing HOCl can also be effective as microbial disinfectants. Here we have tested whether HOCl can also inactivate prions and other self-propagating protein amyloid seeds. Prions are deadly pathogens that are notoriously difficult to inactivate, and standard microbial disinfection protocols are often inadequate. Recommended treatments for prion decontamination include strongly basic (pH ≥~12 sodium hypochlorite bleach, ≥1 N sodium hydroxide, and/or prolonged autoclaving. These treatments are damaging and/or unsuitable for many clinical, agricultural and environmental applications. We have tested the anti-prion activity of a weakly acidic aqueous formulation of HOCl (BrioHOCl that poses no apparent hazard to either users or many surfaces. For example, BrioHOCl can be applied directly to skin and mucous membranes and has been aerosolized to treat entire rooms without apparent deleterious effects. Here, we demonstrate that immersion in BrioHOCl can inactivate not only a range of target microbes, including spores of Bacillus subtilis, but also prions in tissue suspensions and on stainless steel. Real-time quaking-induced conversion (RT-QuIC assays showed that BrioHOCl treatments eliminated all detectable prion seeding activity of human Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, cervine chronic wasting disease, sheep scrapie and hamster scrapie; these findings indicated reductions of ≥103- to 106-fold. Transgenic mouse bioassays showed that all detectable hamster-adapted scrapie infectivity in brain homogenates or on steel wires was eliminated, representing reductions of ≥~105.75-fold and >104-fold, respectively. Inactivation of RT-QuIC seeding activity correlated with free chlorine concentration and higher order aggregation or destruction of proteins generally, including prion
Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro
2012-01-01
Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.
Selective breeding for scrapie resistance in sheep
Directory of Open Access Journals (Sweden)
Cristina Santos Sotomaior
2012-11-01
Full Text Available It is well known that the susceptibility of sheep to scrapie is determined by the host’s prion protein gene (PRNP. PRNP polymorphisms at codons 136 (alanine, A/valine, V, 154 (histidine, H/arginine, R and 171 (glutamine, Q/histidine, H/arginine, R are the main determinants of sheep susceptibility/resistance to classical scrapie. There are four major variants of the wild-type ARQ allele: VRQ, AHQ, ARH and ARR. Breeding programs have been developed in the European Union and the USA to increase the frequency of the resistant ARR allele while decreasing the frequency of the susceptible VRQ allele in sheep populations. In Brazil, little PRNP genotyping data are available for sheep, and thus far, no controlled breeding scheme for scrapie has been implemented. This review will focus on important epidemiological aspects of scrapie and the use of genetic resistance as a tool in breeding programs to control the disease.
Prions and prion-like proteins.
Fraser, Paul E
2014-07-18
Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Lifeng Yang
2017-05-01
Full Text Available Prion diseases are neurodegenerative pathologies characterized by the accumulation of a protease-resistant form of the cellular prion protein named prion protein scrapie (PrPSc in the brain. PrPSc accumulation in the endoplasmic reticulum (ER result in a dysregulated calcium (Ca2+ homeostasis and subsequent initiation of unfolded protein response (UPR leading to neuronal dysfunction and apoptosis. The molecular mechanisms for the transition between adaptation to ER stress and ER stress-induced apoptosis are still unclear. Mitogen-activated protein kinases (MAPKs are serine/threonine protein kinases that rule the signaling of many extracellular stimuli from plasma membrane to the nucleus. However the identification of numerous points of cross talk between the UPR and MAPK signaling pathways may contribute to our understanding of the consequences of ER stress in prion diseases. Indeed the MAPK signaling network is known to regulate cell cycle progression and cell survival or death responses following a variety of stresses including misfolded protein response stress. In this article, we review the UPR signaling in prion diseases and discuss the triad of MAPK signaling pathways. We also describe the role played by MAPK signaling cascades in Alzheimer’s (AD and Parkinson’s disease (PD. We will also overview the mechanisms of cell death and the role of MAPK signaling in prion disease progression and highlight potential avenues for therapeutic intervention.
Scrapie infectivity is quickly cleared in tissues of orally-infected farmed fish
Directory of Open Access Journals (Sweden)
Faoro Franco
2006-06-01
Full Text Available Abstract Background Scrapie and bovine spongiform encephalopathy (BSE belongs to the group of animal transmissible spongiform encephalopathy (TSE. BSE epidemic in the UK and elsewhere in Europe has been linked to the use of bovine meat and bone meals (MBM in the feeding of cattle. There is concern that pigs, poultry and fish bred for human consumption and fed with infected MBM would eventually develop BSE or carry residual infectivity without disease. Although there has been no evidence of infection in these species, experimental data on the susceptibility to the BSE agent of farm animals other than sheep and cow are limited only to pigs and domestic chicken. In the framework of a EU-granted project we have challenged two species of fish largely used in human food consumption, rainbow trout (Oncorhynchus mykiss and turbot (Scophthalmus maximus, with a mouse-adapted TSE strain (scrapie 139A, to assess the risk related to oral consumption of TSE contaminated food. In trout, we also checked the "in vitro" ability of the pathological isoform of the mouse prion protein (PrPSc to cross the intestinal epithelium when added to the mucosal side of everted intestine. Results Fish challenged with a large amount of scrapie mouse brain homogenate by either oral or parenteral routes, showed the ability to clear the majority of infectivity load. None of the fish tissues taken at different time points after oral or parenteral inoculation was able to provoke scrapie disease after intracerebral inoculation in recipient mice. However, a few recipient mice were positive for PrPSc and spongiform lesions in the brain. We also showed a specific binding of PrPSc to the mucosal side of fish intestine in the absence of an active uptake of the prion protein through the intestinal wall. Conclusion These results indicate that scrapie 139A, and possibly BSE, is quickly removed from fish tissues despite evidence of a prion like protein in fish and of a specific binding of Pr
Directory of Open Access Journals (Sweden)
Gordon Hayward
2016-12-01
Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor
Prion protein accumulation in lipid rafts of mouse aging brain.
Directory of Open Access Journals (Sweden)
Federica Agostini
Full Text Available The cellular form of the prion protein (PrP(C is a normal constituent of neuronal cell membranes. The protein misfolding causes rare neurodegenerative disorders known as transmissible spongiform encephalopathies or prion diseases. These maladies can be sporadic, genetic or infectious. Sporadic prion diseases are the most common form mainly affecting aging people. In this work, we investigate the biochemical environment in which sporadic prion diseases may develop, focusing our attention on the cell membrane of neurons in the aging brain. It is well established that with aging the ratio between the most abundant lipid components of rafts undergoes a major change: while cholesterol decreases, sphingomyelin content rises. Our results indicate that the aging process modifies the compartmentalization of PrP(C. In old mice, this change favors PrP(C accumulation in detergent-resistant membranes, particularly in hippocampi. To confirm the relationship between lipid content changes and PrP(C translocation into detergent-resistant membranes (DRMs, we looked at PrP(C compartmentalization in hippocampi from acid sphingomyelinase (ASM knockout (KO mice and synaptosomes enriched in sphingomyelin. In the presence of high sphingomyelin content, we observed a significant increase of PrP(C in DRMS. This process is not due to higher levels of total protein and it could, in turn, favor the onset of sporadic prion diseases during aging as it increases the PrP intermolecular contacts into lipid rafts. We observed that lowering sphingomyelin in scrapie-infected cells by using fumonisin B1 led to a 50% decrease in protease-resistant PrP formation. This may suggest an involvement of PrP lipid environment in prion formation and consequently it may play a role in the onset or development of sporadic forms of prion diseases.
Directory of Open Access Journals (Sweden)
James F Graham
Full Text Available Transmissible spongiform encephalopathies are characterised by widespread deposition of fibrillar and/or plaque-like forms of the prion protein. These aggregated forms are produced by misfolding of the normal prion protein, PrP(C, to the disease-associated form, PrP(Sc, through mechanisms that remain elusive but which require either direct or indirect interaction between PrP(C and PrP(Sc isoforms. A wealth of evidence implicates other non-PrP molecules as active participants in the misfolding process, to catalyse and direct the conformational conversion of PrP(C or to provide a scaffold ensuring correct alignment of PrP(C and PrP(Sc during conversion. Such molecules may be specific to different scrapie strains to facilitate differential prion protein misfolding. Since molecular cofactors may become integrated into the growing protein fibril during prion conversion, we have investigated the proteins contained in prion disease-specific deposits by shotgun proteomics of scrapie-associated fibrils (SAF from mice infected with 3 different strains of mouse-passaged scrapie. Concomitant use of negative control preparations allowed us to identify and discount proteins that are enriched non-specifically by the SAF isolation protocol. We found several proteins that co-purified specifically with SAF from infected brains but none of these were reproducibly and demonstrably specific for particular scrapie strains. The α-chain of Na(+/K(+-ATPase was common to SAF from all 3 strains and we tested the ability of this protein to modulate in vitro misfolding of recombinant PrP. Na(+/K(+-ATPase enhanced the efficiency of disease-specific conversion of recombinant PrP suggesting that it may act as a molecular cofactor. Consistent with previous results, the same protein inhibited fibrillisation kinetics of recombinant PrP. Since functional interactions between PrP(C and Na(+/K(+-ATPase have previously been reported in astrocytes, our data highlight this molecule as
Prion structure investigated in situ, ex vivo, and in vitro by FTIR spectroscopy
Kneipp, Janina; Miller, Lisa M.; Spassov, Sashko; Sokolowski, Fabian; Lasch, Peter; Beekes, Michael; Naumann, Dieter
2004-07-01
Syrian hamster nervous tissue was investigated by FTIR microspectroscopy with conventional and synchrotron infrared light sources. Various tissue structures from the cerebellum and medulla oblongata of scrapie-infected and control hamsters were investigated at a spatial resolution of 50 μm. Single neurons in dorsal root ganglia of scrapie-infected hamsters were analyzed by raster scan mapping at 6 μm spatial resolution. These measurements enabled us to (i) scrutinize structural differences between infected and non-infected tissue and (ii) analyze for the first time the distribution of different protein structures in situ within single nerve cells. Single nerve cells exhibited areas of increased β-sheet content, which co-localized consistently with accumulations of the pathological prion protein (PrPSc). Spectral data were also obtained from purified, partly proteinase K digested PrPSc isolated from scrapie-infected nervous tissue of hamsters to elucidate similarities/dissimilarities between prion structure in situ and ex vivo. A further comparison is drawn to the recombinant Syrian hamster prion protein SHaPrP90-232, whose in vitro transition from the predominantly a-helical isoform to β-sheet rich oligomeric structures was also investigated by FTIR spectroscopy.
Plasminogen stimulates propagation of protease-resistant prion protein in vitro.
Mays, Charles E; Ryou, Chongsuk
2010-12-01
To clarify the role of plasminogen as a cofactor for prion propagation, we conducted functional assays using a cell-free prion protein (PrP) conversion assay termed protein misfolding cyclic amplification (PMCA) and prion-infected cell lines. Here, we report that plasminogen stimulates propagation of the protease-resistant scrapie PrP (PrP(Sc)). Compared to control PMCA conducted without plasminogen, addition of plasminogen in PMCA using wild-type brain material significantly increased PrP conversion, with an EC(50) = ∼56 nM. PrP conversion in PMCA was substantially less efficient with plasminogen-deficient brain material than with wild-type material. The activity stimulating PrP conversion was specific for plasminogen and conserved in its kringle domains. Such activity was abrogated by modification of plasminogen structure and interference of PrP-plasminogen interaction. Kinetic analysis of PrP(Sc) generation demonstrated that the presence of plasminogen in PMCA enhanced the PrP(Sc) production rate to ∼0.97 U/μl/h and reduced turnover time to ∼1 h compared to those (∼0.4 U/μl/h and ∼2.5 h) obtained without supplementation. Furthermore, as observed in PMCA, plasminogen and kringles promoted PrP(Sc) propagation in ScN2a and Elk 21(+) cells. Our results demonstrate that plasminogen functions in stimulating conversion processes and represents the first cellular protein cofactor that enhances the hypothetical mechanism of prion propagation.
Aulić, Suzana; Masperone, Lara; Narkiewicz, Joanna; Isopi, Elisa; Bistaffa, Edoardo; Ambrosetti, Elena; Pastore, Beatrice; De Cecco, Elena; Scaini, Denis; Zago, Paola; Moda, Fabio; Tagliavini, Fabrizio; Legname, Giuseppe
2017-08-30
The precise molecular mechanism of how misfolded α-synuclein (α-Syn) accumulates and spreads in synucleinopathies is still unknown. Here, we show the role of the cellular prion protein (PrP C ) in mediating the uptake and the spread of recombinant α-Syn amyloids. The in vitro data revealed that the presence of PrP C fosters the higher uptake of α-Syn amyloid fibrils, which was also confirmed in vivo in wild type (Prnp +/+ ) compared to PrP knock-out (Prnp -/- ) mice. Additionally, the presence of α-Syn amyloids blocked the replication of scrapie prions (PrP Sc ) in vitro and ex vivo, indicating a link between the two proteins. Indeed, whilst PrP C is mediating the internalization of α-Syn amyloids, PrP Sc is not able to replicate in their presence. This observation has pathological relevance, since several reported case studies show that the accumulation of α-Syn amyloid deposits in Creutzfeldt-Jakob disease patients is accompanied by a longer disease course.
Dysfunction of mitochondrial dynamics in the brains of scrapie-infected mice
International Nuclear Information System (INIS)
Choi, Hong-Seok; Choi, Yeong-Gon; Shin, Hae-Young; Oh, Jae-Min; Park, Jeong-Ho; Kim, Jae-Il; Carp, Richard I.; Choi, Eun-Kyoung; Kim, Yong-Sun
2014-01-01
Highlights: • Mfn1 and Fis1 are significantly increased in the hippocampal region of the ME7 prion-infected brain, whereas Dlp1 is significantly decreased in the infected brain. • Dlp1 is significantly decreased in the cytosolic fraction of the hippocampus in the infected brain. • Neuronal mitochondria in the prion-infected brains are enlarged and swollen compared to those of control brains. • There are significantly fewer mitochondria in the ME7-infected brain compared to the number in control brain. - Abstract: Mitochondrial dysfunction is a common and prominent feature of many neurodegenerative diseases, including prion diseases; it is induced by oxidative stress in scrapie-infected animal models. In previous studies, we found swelling and dysfunction of mitochondria in the brains of scrapie-infected mice compared to brains of controls, but the mechanisms underlying mitochondrial dysfunction remain unclear. To examine whether the dysregulation of mitochondrial proteins is related to the mitochondrial dysfunction associated with prion disease, we investigated the expression patterns of mitochondrial fusion and fission proteins in the brains of ME7 prion-infected mice. Immunoblot analysis revealed that Mfn1 was up-regulated in both whole brain and specific brain regions, including the cerebral cortex and hippocampus, of ME7-infected mice compared to controls. Additionally, expression levels of Fis1 and Mfn2 were elevated in the hippocampus and the striatum, respectively, of the ME7-infected brain. In contrast, Dlp1 expression was significantly reduced in the hippocampus in the ME7-infected brain, particularly in the cytosolic fraction. Finally, we observed abnormal mitochondrial enlargement and histopathological change in the hippocampus of the ME7-infected brain. These observations suggest that the mitochondrial dysfunction, which is presumably caused by the dysregulation of mitochondrial fusion and fission proteins, may contribute to the
Dysfunction of mitochondrial dynamics in the brains of scrapie-infected mice
Energy Technology Data Exchange (ETDEWEB)
Choi, Hong-Seok [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Choi, Yeong-Gon; Shin, Hae-Young; Oh, Jae-Min [Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Park, Jeong-Ho [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Kim, Jae-Il [Department of Food Science and Nutrition, Pukyong National University, 599-1 Daeyeon-3-dong, Nam-gu, Busan 608-737 (Korea, Republic of); Carp, Richard I. [New York State Institute for Basic Research in Developmental Disabilities, 1050 Forest Hill Road, Staten Island, NY 10314 (United States); Choi, Eun-Kyoung, E-mail: ekchoi@hallym.ac.kr [Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Kim, Yong-Sun, E-mail: yskim@hallym.ac.kr [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of)
2014-05-30
Highlights: • Mfn1 and Fis1 are significantly increased in the hippocampal region of the ME7 prion-infected brain, whereas Dlp1 is significantly decreased in the infected brain. • Dlp1 is significantly decreased in the cytosolic fraction of the hippocampus in the infected brain. • Neuronal mitochondria in the prion-infected brains are enlarged and swollen compared to those of control brains. • There are significantly fewer mitochondria in the ME7-infected brain compared to the number in control brain. - Abstract: Mitochondrial dysfunction is a common and prominent feature of many neurodegenerative diseases, including prion diseases; it is induced by oxidative stress in scrapie-infected animal models. In previous studies, we found swelling and dysfunction of mitochondria in the brains of scrapie-infected mice compared to brains of controls, but the mechanisms underlying mitochondrial dysfunction remain unclear. To examine whether the dysregulation of mitochondrial proteins is related to the mitochondrial dysfunction associated with prion disease, we investigated the expression patterns of mitochondrial fusion and fission proteins in the brains of ME7 prion-infected mice. Immunoblot analysis revealed that Mfn1 was up-regulated in both whole brain and specific brain regions, including the cerebral cortex and hippocampus, of ME7-infected mice compared to controls. Additionally, expression levels of Fis1 and Mfn2 were elevated in the hippocampus and the striatum, respectively, of the ME7-infected brain. In contrast, Dlp1 expression was significantly reduced in the hippocampus in the ME7-infected brain, particularly in the cytosolic fraction. Finally, we observed abnormal mitochondrial enlargement and histopathological change in the hippocampus of the ME7-infected brain. These observations suggest that the mitochondrial dysfunction, which is presumably caused by the dysregulation of mitochondrial fusion and fission proteins, may contribute to the
Effects of polymorphisms in ovine and caprine prion protein alleles on cell-free conversion
Directory of Open Access Journals (Sweden)
Eiden Martin
2011-02-01
Full Text Available Abstract In sheep polymorphisms of the prion gene (PRNP at the codons 136, 154 and 171 strongly influence the susceptibility to scrapie and bovine spongiform encephalopathy (BSE infections. In goats a number of other gene polymorphisms were found which are suspected to trigger similar effects. However, no strong correlation between polymorphisms and TSE susceptibility in goats has yet been obtained from epidemiological studies and only a low number of experimental challenge data are available at present. We have therefore studied the potential impact of these polymorphisms in vitro by cell-free conversion assays using mouse scrapie strain Me7. Mouse scrapie brain derived PrPSc served as seeds and eleven recombinant single mutation variants of sheep and goat PrPC as conversion targets. With this approach it was possible to assign reduced conversion efficiencies to specific polymorphisms, which are associated to low frequency in scrapie-affected goats or found only in healthy animals. Moreover, we could demonstrate a dominant-negative inhibition of prion polymorphisms associated with high susceptibility by alleles linked to low susceptibility in vitro.
Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.
Directory of Open Access Journals (Sweden)
Jae-Kwang Jin
Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.
Prion Protein Self Interactions; a gateway to novel therapeutic strategies?
Rigter, A.; Langeveld, J.P.M.; Zijderveld, van F.G.; Bossers, A.
2010-01-01
Transmissible spongiform encephalopathies (TSEs) or prion diseases are fatal neurodegenerative disorders and include among others Creutzfeldt–Jakob disease in humans, bovine spongiform encephalopathy (BSE) in cattle, and scrapie in sheep. The central event in disease development in TSEs is the
The first report of prion-related protein gene (PRNT) polymorphisms in goat.
Kim, Yong-Chan; Jeong, Byung-Hoon
2017-06-01
Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.
Insights into alternative prion protein topologies induced under high hydrostatic pressure
International Nuclear Information System (INIS)
Torrent, Joan; Alvarez-Martinez, Maria Teresa; Heitz, Frederic; Liautard, Jean-Pierre; Balny, Claude; Lange, Reinhard
2004-01-01
The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP C ) into a misfolded isoform (PrP Sc ). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal α-helical structure is changed into a highly aggregated β-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures
Insights into alternative prion protein topologies induced under high hydrostatic pressure
Energy Technology Data Exchange (ETDEWEB)
Torrent, Joan [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Alvarez-Martinez, Maria Teresa [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Heitz, Frederic [CRBM, CNRS-UPR 1086, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Liautard, Jean-Pierre [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Balny, Claude [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Lange, Reinhard [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France)
2004-04-14
The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP{sup C}) into a misfolded isoform (PrP{sup Sc}). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal {alpha}-helical structure is changed into a highly aggregated {beta}-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures.
Directory of Open Access Journals (Sweden)
Gabriele Giachin
Full Text Available Humic substances (HS are the largest constituent of soil organic matter and are considered as a key component of the terrestrial ecosystem. HS may facilitate the transport of organic and inorganic molecules, as well as the sorption interactions with environmentally relevant proteins such as prions. Prions enter the environment through shedding from live hosts, facilitating a sustained incidence of animal prion diseases such as Chronic Wasting Disease and scrapie in cervid and ovine populations, respectively. Changes in prion structure upon environmental exposure may be significant as they can affect prion infectivity and disease pathology. Despite its relevance, the mechanisms of prion interaction with HS are still not completely understood. The goal of this work is to advance a structural-level picture of the encapsulation of recombinant, non-infectious, prion protein (PrP into different natural HS. We observed that PrP precipitation upon addition of HS is mainly driven by a mechanism of "salting-out" whereby PrP molecules are rapidly removed from the solution and aggregate in insoluble adducts with humic molecules. Importantly, this process does not alter the protein folding since insoluble PrP retains its α-helical content when in complex with HS. The observed ability of HS to promote PrP insolubilization without altering its secondary structure may have potential relevance in the context of "prion ecology". These results suggest that soil organic matter interacts with prions possibly without altering the protein structures. This may facilitate prions preservation from biotic and abiotic degradation leading to their accumulation in the environment.
Fragkiadaki Eirini G; Vaccari Gabriele; Ekateriniadou Loukia V; Agrimi Umberto; Giadinis Nektarios D; Chiappini Barbara; Esposito Elena; Conte Michela; Nonno Romolo
2011-01-01
Abstract One hundred and four scrapie positive and 77 negative goats from 34 Greek mixed flocks were analysed by prion protein gene sequencing and 17 caprine scrapie isolates from 11 flocks were submitted to molecular isolate typing. For the first time, the protective S146 variant was reported in Greece, while the protective K222 variant was detected in negative but also in five scrapie positive goats from heavily infected flocks. By immunoblotting six isolates, including two goat flockmates ...
Wilson, Rona; Plinston, Chris; Hunter, Nora; Casalone, Cristina; Corona, Cristiano; Tagliavini, Fabrizio; Suardi, Silvia; Ruggerone, Margherita; Moda, Fabio; Graziano, Silvia; Sbriccoli, Marco; Cardone, Franco; Pocchiari, Maurizio; Ingrosso, Loredana; Baron, Thierry; Richt, Juergen; Andreoletti, Olivier; Simmons, Marion; Lockey, Richard; Manson, Jean C; Barron, Rona M
2012-07-01
The association between bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) has demonstrated that cattle transmissible spongiform encephalopathies (TSEs) can pose a risk to human health and raises the possibility that other ruminant TSEs may be transmissible to humans. In recent years, several novel TSEs in sheep, cattle and deer have been described and the risk posed to humans by these agents is currently unknown. In this study, we inoculated two forms of atypical BSE (BASE and H-type BSE), a chronic wasting disease (CWD) isolate and seven isolates of atypical scrapie into gene-targeted transgenic (Tg) mice expressing the human prion protein (PrP). Upon challenge with these ruminant TSEs, gene-targeted Tg mice expressing human PrP did not show any signs of disease pathology. These data strongly suggest the presence of a substantial transmission barrier between these recently identified ruminant TSEs and humans.
A closer look at prion strains: characterization and important implications.
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.
Ferrucci, M; Ryskalin, L; Biagioni, F; Gambardella, S; Busceti, C L; Falleni, A; Lazzeri, G; Fornai, F
2017-07-01
The cellular prion protein (PrPc) is physiologically expressed within selective brain areas of mammals. Alterations in the secondary structure of this protein lead to scrapie-like prion protein (PrPsc), which precipitates in the cell. PrPsc has been detected in infectious, inherited or sporadic neurodegenerative disorders. Prion protein metabolism is dependent on autophagy and ubiquitin proteasome. Despite not being fully elucidated, the physiological role of prion protein relates to chaperones which rescue cells under stressful conditions.Methamphetamine (METH) is a widely abused drug which produces oxidative stress in various brain areas causing mitochondrial alterations and protein misfolding. These effects produce a compensatory increase of chaperones while clogging cell clearing pathways. In the present study, we explored whether METH administration modifies the amount of PrPc. Since high levels of PrPc when the clearing systems are clogged may lead to its misfolding into PrPsc, we further tested whether METH exposure triggers the appearance of PrPsc. We analysed the effects of METH and dopamine administration in PC12 and striatal cells by using SDS-PAGE Coomassie blue, immune- histochemistry and immune-gold electron microscopy. To analyze whether METH administration produces PrPsc aggregates we used antibodies directed against PrP following exposure to proteinase K or sarkosyl which digest folded PrPc but misfolded PrPsc. We fond that METH triggers PrPsc aggregates in DA-containing cells while METH is not effective in primary striatal neurons which do not produce DA. In the latter cells exogenous DA is needed to trigger PrPsc accumulation similarly to what happens in DA containing cells under the effects of METH. The present findings, while fostering novel molecular mechanisms involving prion proteins, indicate that, cell pathology similar to prion disorders can be mimicked via a DA-dependent mechanism by a drug of abuse.
Fragkiadaki, Eirini G; Vaccari, Gabriele; Ekateriniadou, Loukia V; Agrimi, Umberto; Giadinis, Nektarios D; Chiappini, Barbara; Esposito, Elena; Conte, Michela; Nonno, Romolo
2011-09-30
One hundred and four scrapie positive and 77 negative goats from 34 Greek mixed flocks were analysed by prion protein gene sequencing and 17 caprine scrapie isolates from 11 flocks were submitted to molecular isolate typing. For the first time, the protective S146 variant was reported in Greece, while the protective K222 variant was detected in negative but also in five scrapie positive goats from heavily infected flocks. By immunoblotting six isolates, including two goat flockmates carrying the K222 variant, showed molecular features slightly different from all other Greek and Italian isolates co-analysed, possibly suggesting the presence of different scrapie strains in Greece.
Directory of Open Access Journals (Sweden)
Fragkiadaki Eirini G
2011-09-01
Full Text Available Abstract One hundred and four scrapie positive and 77 negative goats from 34 Greek mixed flocks were analysed by prion protein gene sequencing and 17 caprine scrapie isolates from 11 flocks were submitted to molecular isolate typing. For the first time, the protective S146 variant was reported in Greece, while the protective K222 variant was detected in negative but also in five scrapie positive goats from heavily infected flocks. By immunoblotting six isolates, including two goat flockmates carrying the K222 variant, showed molecular features slightly different from all other Greek and Italian isolates co-analysed, possibly suggesting the presence of different scrapie strains in Greece.
Escandón-Vargas, Kevin; Zorrilla-Vaca, Andrés; Corral-Prado, Raúl Heli
2016-02-24
Prion diseases are rare neurodegenerative disorders occurring worldwide and affecting both humans and animals. Herein, we present the case of a patient diagnosed with definite sporadic Creutzfeldt-Jakob disease in Cali, Colombia. Besides neurological examination, 14-3-3 and tau proteins were valuable tools supporting the diagnosis. We also present a brief perspective of the prion diseases reported in Colombia to date. Although the incidence of prion diseases is unknown in Colombia, our literature review revealed that one case of scrapie in 1981 and 29 human sporadic cases of Creutzfeldt-Jakob disease have been documented and published in our country.
Extraneural manifestations of prion infection in GPI-anchorless transgenic mice
International Nuclear Information System (INIS)
Lee, Andrew M.; Paulsson, Johan F.; Cruite, Justin; Andaya, Abegail A.; Trifilo, Matthew J.; Oldstone, Michael B.A.
2011-01-01
Earlier studies indicated that transgenic (tg) mice engineered to express prion protein (PrP) lacking the glycophosphatidylinositol (GPI -/- ) membrane anchor formed abnormal proteinase-resistant prion (PrPsc) amyloid deposits in their brains and hearts when infected with the RML strain of murine scrapie. In contrast, RML scrapie infection of normal mice with a GPI-anchored PrP did not deposit amyloid with PrPsc in the brain or the heart. Here we report that scrapie-infected GPI -/- PrP tg mice also deposit PrP and transmissible infectious material in the gut, kidneys, and islets of Langerhans. Similar to previously reported amyloid deposits in the brain and heart, amyloid deposits were found in the gut; however, no amyloid deposited in the islets. By high-resolution electron microscopy, we show PrP is located primarily in α cells and also β cells. Islets contain abundant insulin and there is no abnormality in glucose metabolism in infected GPI -/- PrP tg mice.
Correlation of cellular factors and differential scrapie prion permissiveness in ovine microglia
Prion diseases are fatal neurodegenerative disorders by which the native cellular prion protein (PrP-C) is misfolded into an accumulating, disease-associated isoform (PrP-D). To improve the understanding of prion pathogenesis and develop effective treatments, it is essential to elucidate factors con...
Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.
Workman, Rob G; Maddison, Ben C; Gough, Kevin C
2017-07-04
Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.
Wang, Hui; Tian, Chan; Sun, Jing; Chen, Li-Na; Lv, Yan; Yang, Xiao-Dong; Xiao, Kang; Wang, Jing; Chen, Cao; Shi, Qi; Shao, Qi-Xiang; Dong, Xiao-Ping
2017-08-01
Polo-like kinase 3 (PLK3) is the main cause of cell cycle reentry-related neuronal apoptosis which has been implicated in the pathogenesis of prion diseases. Previous work also showed the regulatory activity of exogenous PLK3 on the degradation of PrP (prion protein) mutants and pathogenic PrP Sc ; however, the precise mechanisms remain unknown. In this study, we identified that the overexpression of PLK3-mediated degradation of PrP mutant and PrP Sc was repressed by lysosome rather than by proteasomal and macroautophagy inhibitors. Core components of chaperone-mediated autophagy (CMA) effectors, lysosome-associated membrane protein type 2A (LAMP2a), and heat shock cognate protein 70 (Hsc70) are markedly decreased in the HEK293T cells expressing PrP mutant and scrapie-infected cell line SMB-S15. Meanwhile, PrP mutant showed ability to interact with LAMP2a and Hsc70. Overexpression of PLK3 sufficiently increased the cellular levels of LAMP2a and Hsc70, accompanying with declining the accumulations of PrP mutant and PrP Sc . The kinase domain (KD) of PLK3 was responsible for elevating LAMP2a and Hsc70. Knockdown of endogenous PLK3 enhanced the activity of macroautophagy in the cultured cells. Moreover, time-dependent reductions of LAMP2a and Hsc70 were also observed in the brain tissues of hamster-adapted scrapie agent 263K-infected hamsters, indicating an impairment of CMA during prion infection. Those data indicate that the overexpression of PLK3-mediated degradation of abnormal PrP is largely dependent on CMA pathway.
DEFF Research Database (Denmark)
Bergstrøm, Linda Alice; Hvass, Henriette Cordes; Zsurger, N.
2005-01-01
One of the major pathological hallmarks of transmissible spongiform encephalopathies (TSEs) is the accumulation of a pathogenic (scrapie) isoform (PrPSc) of the cellular prion protein (PrPC) primarily in the central nervous system. The synthetic prion peptide PrP106-126 shares many characteristics...
Detection of PrPres in genetically susceptible fetuses from sheep with natural scrapie.
Directory of Open Access Journals (Sweden)
María Carmen Garza
Full Text Available Scrapie is a transmissible spongiform encephalopathy with a wide PrPres dissemination in many non-neural tissues and with high levels of transmissibility within susceptible populations. Mechanisms of transmission are incompletely understood. It is generally assumed that it is horizontally transmitted by direct contact between animals or indirectly through the environment, where scrapie can remain infectious for years. In contrast, in utero vertical transmission has never been demonstrated and has rarely been studied. Recently, the use of the protein misfolding cyclic amplification technique (PMCA has allowed prion detection in various tissues and excretions in which PrPres levels have been undetectable by traditional assays. The main goal of this study was to detect PrPres in fetal tissues and the amniotic fluid from natural scrapie infected ewes using the PMCA technique. Six fetuses from three infected pregnant ewes in an advanced clinical stage of the disease were included in the study. From each fetus, amniotic fluid, brain, spleen, ileo-cecal valve and retropharyngeal lymph node samples were collected and analyzed using Western blotting and PMCA. Although all samples were negative using Western blotting, PrPres was detected after in vitro amplification. Our results represent the first time the biochemical detection of prions in fetal tissues, suggesting that the in utero transmission of scrapie in natural infected sheep might be possible.
Prenatal transmission of scrapie in sheep and goats: A case study ...
African Journals Online (AJOL)
... or unwashed in vivo derived embryos are hazards for the transmission of scrapie. Evidence from causal reasoning, including experience from other prion diseases, shows that mechanisms exist for prenatal transmission and transmission by semen and embryos in both sheep and goats. Keywords: Goat, Prenatal, Scrapie, ...
Aerosols transmit prions to immunocompetent and immunodeficient mice.
Directory of Open Access Journals (Sweden)
Johannes Haybaeck
Full Text Available Prions, the agents causing transmissible spongiform encephalopathies, colonize the brain of hosts after oral, parenteral, intralingual, or even transdermal uptake. However, prions are not generally considered to be airborne. Here we report that inbred and crossbred wild-type mice, as well as tga20 transgenic mice overexpressing PrP(C, efficiently develop scrapie upon exposure to aerosolized prions. NSE-PrP transgenic mice, which express PrP(C selectively in neurons, were also susceptible to airborne prions. Aerogenic infection occurred also in mice lacking B- and T-lymphocytes, NK-cells, follicular dendritic cells or complement components. Brains of diseased mice contained PrP(Sc and transmitted scrapie when inoculated into further mice. We conclude that aerogenic exposure to prions is very efficacious and can lead to direct invasion of neural pathways without an obligatory replicative phase in lymphoid organs. This previously unappreciated risk for airborne prion transmission may warrant re-thinking on prion biosafety guidelines in research and diagnostic laboratories.
Martin, Gary R; Sharkey, Keith A; Jirik, Frank R
2015-05-01
The oral uptake of infectious prions represents a common way to acquire a prion disease; thus, host factors, such as gut inflammation and intestinal "leakiness", have the potential to influence infectivity. For example, the ingestion of nonsteroidal anti-inflammatory drugs (NSAIDs) is known to induce intestinal inflammation and increase intestinal permeability. Previously, we reported that normal cellular prion protein (PrP(C)) expression was increased in experimental colitis, and since the level of PrP(C) expressed is a determinant of prion disease propagation, we hypothesized that NSAID administration prior to the oral inoculation of mice with infectious prions would increase intestinal PrP(C) expression and accelerate the onset of neurological disease. In the long-term experiments, one group of mice was gavaged with indomethacin, followed by a second gavage with brain homogenate containing mouse-adapted scrapie (ME7). Control mice received ME7 brain homogenate alone. Brain and splenic tissues were harvested at several time points for immunoblotting, including at the onset of clinical signs of disease. In a second series of experiments, mice were gavaged with indomethacin to assess the acute effects of this treatment on intestinal PrP(C) expression. Acutely, NSAID treatment reduced intestinal PrP(C) expression, and chronically, there was a modest delay in the onset of neurological disease. In contrast to our hypothesis, brief exposure to an NSAID decreased intestinal PrP(C) expression and led to a modest survival advantage following oral ingestion of infectious prions.
Inactivation of Template-Directed Misfolding of Infectious Prion Protein by Ozone
Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Belosevic, Miodrag
2012-01-01
Misfolded prions (PrPSc) are well known for their resistance to conventional decontamination processes. The potential risk of contamination of the water environment, as a result of disposal of specified risk materials (SRM), has raised public concerns. Ozone is commonly utilized in the water industry for inactivation of microbial contaminants and was tested in this study for its ability to inactivate prions (263K hamster scrapie = PrPSc). Treatment variables included initial ozone dose (7.6 to 25.7 mg/liter), contact time (5 s and 5 min), temperature (4°C and 20°C), and pH (pH 4.4, 6.0, and 8.0). Exposure of dilute suspensions of the infected 263K hamster brain homogenates (IBH) (0.01%) to ozone resulted in the in vitro destruction of the templating properties of PrPSc, as measured by the protein misfolding cyclic amplification (PMCA) assay. The highest levels of prion inactivation (≥4 log10) were observed with ozone doses of 13.0 mg/liter, at pH 4.4 and 20°C, resulting in a CT (the product of residual ozone concentration and contact time) value as low as 0.59 mg · liter−1 min. A comparison of ozone CT requirements among various pathogens suggests that prions are more susceptible to ozone degradation than some model bacteria and protozoa and that ozone treatment may be an effective solution for inactivating prions in water and wastewater. PMID:22138993
Variation in the prion protein sequence in Dutch goat breeds.
Windig, J J; Hoving, R A H; Priem, J; Bossers, A; van Keulen, L J M; Langeveld, J P M
2016-10-01
Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined for six goat breeds in the Netherlands. Overall frequencies in Dutch goats were determined from 768 brain tissue samples in 2005, 766 in 2008 and 300 in 2012, derived from random sampling for the national scrapie surveillance without knowledge of the breed. Breed specific frequencies were determined in the winter 2013/2014 by sampling 300 breeding animals from the main breeders of the different breeds. Detailed analysis of the scrapie-resistant K222 haplotype was carried out in 2014 for 220 Dutch Toggenburger goats and in 2015 for 942 goats from the Saanen derived White Goat breed. Nine haplotypes were identified in the Dutch breeds. Frequencies for non-wild type haplotypes were generally low. Exception was the K222 haplotype in the Dutch Toggenburger (29%) and the S146 haplotype in the Nubian and Boer breeds (respectively 7 and 31%). The frequency of the K222 haplotype in the Toggenburger was higher than for any other breed reported in literature, while for the White Goat breed it was with 3.1% similar to frequencies of other Saanen or Saanen derived breeds. Further evidence was found for the existence of two M142 haplotypes, M142 /S240 and M142 /P240 . Breeds vary in haplotype frequencies but frequencies of resistant genotypes are generally low and consequently selective breeding for scrapie resistance can only be slow but will benefit from animals identified in this study. The unexpectedly high frequency of the K222 haplotype in the Dutch Toggenburger underlines the need for conservation of rare breeds in order to conserve genetic diversity rare or absent in other breeds. © 2016 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Katsufumi Tomobe
2016-05-01
Full Text Available The conformational change from the cellular prion protein (PrPc to scrapie prion protein (PrPsc is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.
Tomobe, Katsufumi; Yamamoto, Eiji; Akimoto, Takuma; Yasui, Masato; Yasuoka, Kenji
2016-05-01
The conformational change from the cellular prion protein (PrPc) to scrapie prion protein (PrPsc) is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT) PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.
Directory of Open Access Journals (Sweden)
Walker S Jackson
Full Text Available Prion diseases induce neurodegeneration in specific brain areas for undetermined reasons. A thorough understanding of the localization of the disease-causing molecule, the prion protein (PrP, could inform on this issue but previous studies have generated conflicting conclusions. One of the more intriguing disagreements is whether PrP is synthesized by astrocytes. We developed a knock-in reporter mouse line in which the coding sequence of the PrP expressing gene (Prnp, was replaced with that for green fluorescent protein (GFP. Native GFP fluorescence intensity varied between and within brain regions. GFP was present in astrocytes but did not increase during reactive gliosis induced by scrapie prion infection. Therefore, reactive gliosis associated with prion diseases does not cause an acceleration of local PrP production. In addition to aiding in Prnp gene activity studies, this reporter mouse line will likely prove useful for analysis of chimeric animals produced by stem cell and tissue transplantation experiments.
Brain delivery of AAV9 expressing an anti-PrP monovalent antibody delays prion disease in mice.
Moda, Fabio; Vimercati, Chiara; Campagnani, Ilaria; Ruggerone, Margherita; Giaccone, Giorgio; Morbin, Michela; Zentilin, Lorena; Giacca, Mauro; Zucca, Ileana; Legname, Giuseppe; Tagliavini, Fabrizio
2012-01-01
Prion diseases are caused by a conformational modification of the cellular prion protein (PrP (C)) into disease-specific forms, termed PrP (Sc), that have the ability to interact with PrP (C) promoting its conversion to PrP (Sc). In vitro studies demonstrated that anti-PrP antibodies inhibit this process. In particular, the single chain variable fragment D18 antibody (scFvD18) showed high efficiency in curing chronically prion-infected cells. This molecule binds the PrP (C) region involved in the interaction with PrP (Sc) thus halting further prion formation. These findings prompted us to test the efficiency of scFvD18 in vivo. A recombinant Adeno-Associated Viral vector serotype 9 was used to deliver scFvD18 to the brain of mice that were subsequently infected by intraperitoneal route with the mouse-adapted scrapie strain RML. We found that the treatment was safe, prolonged the incubation time of scrapie-infected animals and decreased the burden of total proteinase-resistant PrP (Sc) in the brain, suggesting that scFvD18 interferes with prion replication in vivo. This approach is relevant for designing new therapeutic strategies for prion diseases and other disorders characterized by protein misfolding.
Khalifé, Manal; Reine, Fabienne; Paquet-Fifield, Sophie; Castille, Johan; Herzog, Laetitia; Vilotte, Marthe; Moudjou, Mohammed; Moazami-Goudarzi, Katayoun; Makhzami, Samira; Passet, Bruno; Andréoletti, Olivier; Vilette, Didier; Laude, Hubert; Béringue, Vincent; Vilotte, Jean-Luc
2016-02-01
Mammalian prions are proteinaceous infectious agents composed of misfolded assemblies of the host-encoded, cellular prion protein (PrP). Physiologically, the N-terminal polybasic region of residues 23 to 31 of PrP has been shown to be involved in its endocytic trafficking and interactions with glycosaminoglycans or putative ectodomains of membrane-associated proteins. Several recent reports also describe this PrP region as important for the toxicity of mutant prion proteins and the efficiency of prion propagation, both in vitro and in vivo. The question remains as to whether the latter observations made with mouse PrP and mouse prions would be relevant to other PrP species/prion strain combinations given the dramatic impact on prion susceptibility of minimal amino acid substitutions and structural variations in PrP. Here, we report that transgenic mouse lines expressing ovine PrP with a deletion of residues 23 to 26 (KKRP) or mutated in this N-terminal region (KQHPH instead of KKRPK) exhibited a variable, strain-dependent susceptibility to prion infection with regard to the proportion of affected mice and disease tempo relative to findings in their wild-type counterparts. Deletion has no major effect on 127S scrapie prion pathogenesis, whereas mutation increased by almost 3-fold the survival time of the mice. Deletion marginally affected the incubation time of scrapie LA19K and ovine bovine spongiform encephalopathy (BSE) prions, whereas mutation caused apparent resistance to disease. Recent reports suggested that the N-terminal polybasic region of the prion protein could be a therapeutic target to prevent prion propagation or toxic signaling associated with more common neurodegenerative diseases such as Alzheimer's disease. Mutating or deleting this region in ovine PrP completes the data previously obtained with the mouse protein by identifying the key amino acid residues involved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Lichens: Unexpected anti-prion agents?
Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.
2012-01-01
The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.
Evidence of scrapie transmission to sheep via goat milk.
Konold, Timm; Thorne, Leigh; Simmons, Hugh A; Hawkins, Steve A C; Simmons, Marion M; González, Lorenzo
2016-09-17
Previous studies confirmed that classical scrapie can be transmitted via milk in sheep. The current study aimed to investigate whether scrapie can also be transmitted via goat milk using in vivo (new-born lambs fed milk from scrapie-affected goats due to the unavailability of goat kids from guaranteed scrapie-free herds) and in vitro methods (serial protein misfolding cyclic amplification [sPMCA] on milk samples). In an initial pilot study, new-born lambs of two different prion protein gene (PRNP) genotypes (six VRQ/VRQ and five ARQ/ARQ) were orally challenged with 5 g brain homogenate from two scrapie-affected goats to determine susceptibility of sheep to goat scrapie. All sheep challenged with goat scrapie brain became infected based on the immunohistochemical detection of disease-associated PrP (PrP(sc)) in lymphoid tissue, with an ARQ/ARQ sheep being the first to succumb. Subsequent feeding of milk to eight pairs of new-born ARQ/ARQ lambs, with each pair receiving milk from a different scrapie-affected goat, resulted in scrapie in the six pairs that received the largest volume of milk (38-87 litres per lamb), whereas two pairs fed 8-9 litres per lamb, and an environmental control group raised on sheep milk from healthy ewes, did not show evidence of infection when culled at up to 1882 days of age. Infection in those 12 milk recipients occurred regardless of the clinical status, PrP(sc) distribution, caprine arthritis-encephalitis virus infection status and PRNP polymorphisms at codon 142 (II or IM) of the donor goats, but survival time was influenced by PRNP polymorphisms at codon 141. Serial PMCA applied to a total of 32 milk samples (four each from the eight donor goats collected throughout lactation) detected PrP(sc) in one sample each from two goats. The scrapie agent was present in the milk from infected goats and was able to transmit to susceptible species even at early preclinical stage of infection, when PrP(sc) was undetectable in the brain of the
Physical, chemical and kinetic factors affecting prion infectivity.
Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C; Wadsworth, Jonathan D F; Clarke, Anthony R; Jackson, Graham S; Collinge, John
2016-05-03
The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process.
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.
Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L
2001-04-06
The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
Role of galectin-3 in prion infections of the CNS
International Nuclear Information System (INIS)
Mok, Simon W.F.; Riemer, Constanze; Madela, Kazimierz; Hsu, Daniel K.; Liu, Fu-Tong; Gueltner, Sandra; Heise, Ines; Baier, Michael
2007-01-01
Galectin-3 is a multi-functional protein and participates in mediating inflammatory reactions. The pronounced overexpression of galectin-3 in prion-infected brain tissue prompted us to study the role of this protein in a murine prion model. Immunofluorescence double-labelling identified microglia as the major cell type expressing galectin-3. Ablation of galectin-3 did not affect PrP Sc -deposition and development of gliosis. However, galectin-3 -/- -mice showed prolonged survival times upon intracerebral and peripheral scrapie infections. Moreover, protein levels of the lysosomal activation marker LAMP-2 were markedly reduced in prion-infected galectin-3 -/- -mice suggesting a role of galectin-3 in regulation of lysosomal functions. Lower mRNA levels of Beclin-1 and Atg5 in prion-infected wild-type and galectin-3 -/- -mice indicated an impairment of autophagy although autophagosome formation was unchanged. The results point towards a detrimental role of galectin-3 in prion infections of the CNS and suggest that endo-/lysosomal dysfunction in combination with reduced autophagy may contribute to disease development
Insights into the physiological function of cellular prion protein
Directory of Open Access Journals (Sweden)
Martins V.R.
2001-01-01
Full Text Available Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie, appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.
Reduction of prion infectivity in packed red blood cells
International Nuclear Information System (INIS)
Morales, Rodrigo; Buytaert-Hoefen, Kimberley A.; Gonzalez-Romero, Dennisse; Castilla, Joaquin; Hansen, Eric T.; Hlavinka, Dennis; Goodrich, Raymond P.; Soto, Claudio
2008-01-01
The link between a new variant form of Creutzfeldt-Jakob disease (vCJD) and the consumption of prion contaminated cattle meat as well as recent findings showing that vCJD can be transmitted by blood transfusion have raised public health concerns. Currently, a reliable test to identify prions in blood samples is not available. The purpose of this study was to evaluate the possibility to remove scrapie prion protein (PrP Sc ) and infectivity from red blood cell (RBC) suspensions by a simple washing procedure using a cell separation and washing device. The extent of prion removal was assessed by Western blot, PMCA and infectivity bioassays. Our results revealed a substantial removal of infectious prions (≥3 logs of infectivity) by all techniques used. These data suggest that a significant amount of infectivity present in RBC preparations can be removed by a simple washing procedure. This technology may lead to increased safety of blood products and reduce the risk of further propagation of prion diseases.
Direct Detection of Soil-Bound Prions
Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro
2007-01-01
Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252
Direct detection of soil-bound prions.
Directory of Open Access Journals (Sweden)
Sacha Genovesi
Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.
Repetitive immunization enhances the susceptibility of mice to peripherally administered prions.
Directory of Open Access Journals (Sweden)
Juliane Bremer
Full Text Available The susceptibility of humans and animals to prion infections is determined by the virulence of the infectious agent, by genetic modifiers, and by hitherto unknown host and environmental risk factors. While little is known about the latter two, the activation state of the immune system was surmised to influence prion susceptibility. Here we administered prions to mice that were repeatedly immunized by two initial injections of CpG oligodeoxynucleotides followed by repeated injections of bovine serum albumin/alum. Immunization greatly reduced the required dosage of peripherally administered prion inoculum necessary to induce scrapie in 50% of mice. No difference in susceptibility was observed following intracerebral prion challenge. Due to its profound impact onto scrapie susceptibility, the host immune status may determine disease penetrance after low-dose prion exposure, including those that may give rise to iatrogenic and variant Creutzfeldt-Jakob disease.
Directory of Open Access Journals (Sweden)
Carol L Ladner-Keay
Full Text Available The formation of β-sheet rich prion oligomers and fibrils from native prion protein (PrP is thought to be a key step in the development of prion diseases. Many methods are available to convert recombinant prion protein into β-sheet rich fibrils using various chemical denaturants (urea, SDS, GdnHCl, high temperature, phospholipids, or mildly acidic conditions (pH 4. Many of these methods also require shaking or another form of agitation to complete the conversion process. We have identified that shaking alone causes the conversion of recombinant PrP to β-sheet rich oligomers and fibrils at near physiological pH (pH 5.5 to pH 6.2 and temperature. This conversion does not require any denaturant, detergent, or any other chemical cofactor. Interestingly, this conversion does not occur when the water-air interface is eliminated in the shaken sample. We have analyzed shaking-induced conversion using circular dichroism, resolution enhanced native acidic gel electrophoresis (RENAGE, electron microscopy, Fourier transform infrared spectroscopy, thioflavin T fluorescence and proteinase K resistance. Our results show that shaking causes the formation of β-sheet rich oligomers with a population distribution ranging from octamers to dodecamers and that further shaking causes a transition to β-sheet fibrils. In addition, we show that shaking-induced conversion occurs for a wide range of full-length and truncated constructs of mouse, hamster and cervid prion proteins. We propose that this method of conversion provides a robust, reproducible and easily accessible model for scrapie-like amyloid formation, allowing the generation of milligram quantities of physiologically stable β-sheet rich oligomers and fibrils. These results may also have interesting implications regarding our understanding of prion conversion and propagation both within the brain and via techniques such as protein misfolding cyclic amplification (PMCA and quaking induced conversion (QuIC.
Efficient prion disease transmission through common environmental materials.
Pritzkow, Sandra; Morales, Rodrigo; Lyon, Adam; Concha-Marambio, Luis; Urayama, Akihiko; Soto, Claudio
2018-03-02
Prion diseases are a group of fatal neurodegenerative diseases associated with a protein-based infectious agent, termed prion. Compelling evidence suggests that natural transmission of prion diseases is mediated by environmental contamination with infectious prions. We hypothesized that several natural and man-made materials, commonly found in the environments of wild and captive animals, can bind prions and may act as vectors for disease transmission. To test our hypothesis, we exposed surfaces composed of various common environmental materials ( i.e. wood, rocks, plastic, glass, cement, stainless steel, aluminum, and brass) to hamster-adapted 263K scrapie prions and studied their attachment and retention of infectivity in vitro and in vivo Our results indicated that these surfaces, with the sole exception of brass, efficiently bind, retain, and release prions. Prion replication was studied in vitro using the protein misfolding cyclic amplification technology, and infectivity of surface-bound prions was analyzed by intracerebrally challenging hamsters with contaminated implants. Our results revealed that virtually all prion-contaminated materials transmitted the disease at high rates. To investigate a more natural form of exposure to environmental contamination, we simply housed animals with large contaminated spheres made of the different materials under study. Strikingly, most of the hamsters developed classical clinical signs of prion disease and typical disease-associated brain changes. Our findings suggest that prion contamination of surfaces commonly present in the environment can be a source of disease transmission, thus expanding our understanding of the mechanisms for prion spreading in nature. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Prion protein β2–α2 loop conformational landscape
Caldarulo, Enrico; Wüthrich, Kurt; Parrinello, Michele
2017-01-01
In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal “cellular” prion protein (PrPC) is transformed into amyloid aggregates representing the “scrapie form” of the protein (PrPSc). Continued research on this system is of keen interest, since new information on the physiological function of PrPC in healthy organisms is emerging, as well as new data on the mechanism of the transformation of PrPC to PrPSc. In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of PrPC. The focus of the data analysis was on an 11-residue polypeptide segment in mouse PrPC(121–231) that includes the β2–α2 loop of residues 167–170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse PrPC and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on PrPC, providing quantitative insights into the nature of the structural transition-related function of the β2–α2 loop. PMID:28827331
Choi, Yeong-Gon; Kim, Jae-Il; Choi, Eun-Kyoung; Carp, Richard I; Kim, Yong-Sun
2016-01-01
Previous studies have shown that the Nε-carboxymethyl group is linked to not only one or more N-terminal Lys residues but also to one or more Lys residues of the protease-resistant core region of the pathogenic prion isoform (PrPSc) in prion-infected brains. Using an anti-advanced glycation end product (AGE) antibody, we detected nonenzymatically glycated PrPSc (AGE-PrPSc) in prion-infected brains following concentration by a series of ultracentrifugation steps with a sucrose cushion. In the present study, the levels of in vitro nonenzymatic glycation of PrPSc using sucrose were investigated to determine whether sucrose cushion can artificially and nonenzymatically induce in vitro glycation during ultracentrifugation. The first insoluble pellet fraction following the first ultracentrifugation (PU1st) collected from 263K scrapie-infected brains was incubated with sucrose, glucose or colloidal silica coated with polyvinylpyrrolidone (percoll). None of the compounds in vitro resulted in AGE-PrPSc. Nonetheless, glucose and percoll produced AGEs in vitro from other proteins within PU1st of the infected brains. This reaction could lead to the AGE-modified polymer(s) of nonenzymatic glycation-prone protein(s). This study showed that PrPSc is not nonenzymatically glycated in vitro with sucrose, glucose or percoll and that AGE-modified PrPSc can be isolated and enriched from prion-infected brains.
Prions And Prion Diseases | Obi | African Journal of Clinical and ...
African Journals Online (AJOL)
Patients also may experience involuntary jerking movements called myoclonus, unusual sensation, insomnia, and confusion or memory problems. In the later stages of the disease, patients may have severe mental impairment (dementia) and may lose the ability to move or speak. Well known prion diseases include scrapie ...
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Prion protein β2-α2 loop conformational landscape.
Caldarulo, Enrico; Barducci, Alessandro; Wüthrich, Kurt; Parrinello, Michele
2017-09-05
In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal "cellular" prion protein ([Formula: see text]) is transformed into amyloid aggregates representing the "scrapie form" of the protein ([Formula: see text]). Continued research on this system is of keen interest, since new information on the physiological function of [Formula: see text] in healthy organisms is emerging, as well as new data on the mechanism of the transformation of [Formula: see text] to [Formula: see text] In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of [Formula: see text] The focus of the data analysis was on an 11-residue polypeptide segment in mouse [Formula: see text](121-231) that includes the [Formula: see text]2-[Formula: see text]2 loop of residues 167-170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse [Formula: see text] and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on [Formula: see text], providing quantitative insights into the nature of the structural transition-related function of the [Formula: see text]2-[Formula: see text]2 loop.
Leliveld, S. R.; Dame, R.T.; Wuite, G.J.L.; Stitz, L.; Korth, C.
2006-01-01
Insertion of additional octarepeats into the prion protein gene has been genetically linked to familial Creutzfeldt Jakob disease and hence to de novo generation of infectious prions. The pivotal event during prion formation is the conversion of the normal prion protein (PrP
Directory of Open Access Journals (Sweden)
Kurt C VerCauteren
Full Text Available Avian scavengers, such as American crows (Corvus brachyrhynchos, have potential to translocate infectious agents (prions of transmissible spongiform encephalopathy (TSE diseases including chronic wasting disease, scrapie, and bovine spongiform encephalopathy. We inoculated mice with fecal extracts obtained from 20 American crows that were force-fed material infected with RML-strain scrapie prions. These mice all evinced severe neurological dysfunction 196-231 d postinoculation (x =198; 95% CI: 210-216 and tested positive for prion disease. Our results suggest a large proportion of crows that consume prion-positive tissue are capable of passing infectious prions in their feces (ˆp=1.0; 95% CI: 0.8-1.0. Therefore, this common, migratory North American scavenger could play a role in the geographic spread of TSE diseases.
Currently, there is a lack of pathologic landmarks to describe the progression of prion disease in vivo. The goal of this work was to determine the temporal relationship between the transport of misfolded prion protein from the brain to the retina, the accumulation of PrPSc in the retina, the respon...
Yeast prions and human prion-like proteins: sequence features and prediction methods.
Cascarina, Sean M; Ross, Eric D
2014-06-01
Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.
Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.
Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc
2011-10-01
Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.
An Enzymatic Treatment of Soil-Bound Prions Effectively Inhibits Replication ▿
Saunders, Samuel E.; Bartz, Jason C.; Vercauteren, Kurt C.; Bartelt-Hunt, Shannon L.
2011-01-01
Chronic wasting disease (CWD) and scrapie can be transmitted through indirect environmental routes, possibly via soil, and a practical decontamination strategy for prion-contaminated soil is currently unavailable. In the laboratory, an enzymatic treatment under environmentally relevant conditions (22°C, pH 7.4) can degrade soil-bound PrPSc below the limits of Western blot detection. We developed and used a quantitative serial protein misfolding cyclic amplification (PMCA) protocol to characterize the amplification efficiency of treated soil samples relative to controls of known infectious titer. Our results suggest large (104- to >106-fold) decreases in soil-bound prion infectivity following enzyme treatment, demonstrating that a mild enzymatic treatment could effectively reduce the risk of prion disease transmission via soil or other environmental surfaces. PMID:21571886
Inactivation of prion infectivity by ionizing rays
Energy Technology Data Exchange (ETDEWEB)
Gominet, M. [Ionisos, ZI les Chatinieres, F01120 Dagneux (France); Vadrot, C.; Austruy, G. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France); Darbord, J.C. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France)], E-mail: darbord@pharmacie.univ-paris5.fr
2007-11-15
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination.
Inactivation of prion infectivity by ionizing rays
International Nuclear Information System (INIS)
Gominet, M.; Vadrot, C.; Austruy, G.; Darbord, J.C.
2007-01-01
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination
Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures
Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi
2013-01-01
The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992
Prion pathogenesis is unaltered in the absence of SIRPα-mediated "don't-eat-me" signaling.
Directory of Open Access Journals (Sweden)
Mario Nuvolone
Full Text Available Prion diseases are neurodegenerative conditions caused by misfolding of the prion protein, leading to conspicuous neuronal loss and intense microgliosis. Recent experimental evidence point towards a protective role of microglia against prion-induced neurodegeneration, possibly through elimination of prion-containing apoptotic bodies. The molecular mechanisms by which microglia recognize and eliminate apoptotic cells in the context of prion diseases are poorly defined. Here we investigated the possible involvement of signal regulatory protein α (SIRPα, a key modulator of host cell phagocytosis; SIRPα is encoded by the Sirpa gene that is genetically linked to the prion gene Prnp. We found that Sirpa transcripts are highly enriched in microglia cells within the brain. However, Sirpa mRNA levels were essentially unaltered during the course of experimental prion disease despite upregulation of other microglia-enriched transcripts. To study the involvement of SIRPα in prion pathogenesis in vivo, mice expressing a truncated SIRPα protein unable to inhibit phagocytosis were inoculated with rodent-adapted scrapie prions of the 22L strain. Homozygous and heterozygous Sirpa mutants and wild-type mice experienced similar incubation times after inoculation with either of two doses of 22L prions. Moreover, the extent of neuronal loss, microgliosis and abnormal prion protein accumulation was not significantly affected by Sirpa genotypes. Collectively, these data indicate that SIRPα-mediated phagocytosis is not a major determinant in prion disease pathogenesis. It will be important to search for additional candidates mediating prion phagocytosis, as this mechanism may represent an important target of antiprion therapies.
Directory of Open Access Journals (Sweden)
Gillian McGovern
2009-12-01
Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases are infectious neurological disorders of man and animals, characterised by abnormal disease-associated prion protein (PrP(d accumulations in the brain and lymphoreticular system (LRS. Prior to neuroinvasion, TSE agents often accumulate to high levels within the LRS, apparently without affecting immune function. However, our analysis of scrapie-affected sheep shows that PrP(d accumulations within the LRS are associated with morphological changes to follicular dendritic cells (FDCs and tingible body macrophages (TBMs. Here we examined FDCs and TBMs in the mesenteric lymph nodes (MLNs of scrapie-affected mice by light and electron microscopy. In MLNs from uninfected mice, FDCs could be morphologically categorised into immature, mature and regressing forms. However, in scrapie-affected MLNs this maturation cycle was adversely affected. FDCs characteristically trap and retain immune complexes on their surfaces, which they display to B-lymphocytes. In scrapie-affected MLNs, some FDCs were found where areas of normal and abnormal immune complex retention occurred side by side. The latter co-localised with PrP(d plasmalemmal accumulations. Our data suggest this previously unrecognised morphology represents the initial stage of an abnormal FDC maturation cycle. Alterations to the FDCs included PrP(d accumulation, abnormal cell membrane ubiquitin and excess immunoglobulin accumulation. Regressing FDCs, in contrast, appeared to lose their membrane-attached PrP(d. Together, these data suggest that TSE infection adversely affects the maturation and regression cycle of FDCs, and that PrP(d accumulation is causally linked to the abnormal pathology observed. We therefore support the hypothesis that TSEs cause an abnormality in immune function.
The Structural Stability of Wild-type Horse Prion Protein - Molecular Dynamics Studies
Zhang, Jiapu
2011-01-01
Prion diseases {\\it (e.g. Creutzfeldt-Jakob disease (CJD), variant CJD (vCJD), Gerstmann-Str$\\ddot{\\text{a}}$ussler-Scheinker syndrome (GSS), Fatal Familial Insomnia (FFI) and Kuru in humans, scrapie in sheep, bovine spongiform encephalopathy (BSE or `mad-cow' disease) and chronic wasting disease (CWD) in cattles)} are invariably fatal and highly infectious neurodegenerative diseases affecting humans and animals. However, by now there have not been some effective therapeutic approaches or med...
Hannaoui, Samia; Maatouk, Layal; Privat, Nicolas; Levavasseur, Etienne; Faucheux, Baptiste A; Haïk, Stéphane
2013-03-01
Prion diseases, or transmissible spongiform encephalopathies (TSEs), are fatal neurodegenerative disorders that occur in humans and animals. The neuropathological hallmarks of TSEs are spongiosis, glial proliferation, and neuronal loss. The only known specific molecular marker of TSEs is the abnormal isoform (PrP(Sc)) of the host-encoded prion protein (PrP(C)), which accumulates in the brain of infected subjects and forms infectious prion particles. Although this transmissible agent lacks a specific nucleic acid component, several prion strains have been isolated. Prion strains are characterized by differences in disease outcome, PrP(Sc) distribution patterns, and brain lesion profiles at the terminal stage of the disease. The molecular factors and cellular mechanisms involved in strain-specific neuronal tropism and toxicity remain largely unknown. Currently, no cellular model exists to facilitate in vitro studies of these processes. A few cultured cell lines that maintain persistent scrapie infections have been developed, but only two of them have shown the cytotoxic effects associated with prion propagation. In this study, we have developed primary neuronal cultures to assess in vitro neuronal tropism and toxicity of different prion strains (scrapie strains 139A, ME7, and 22L). We have tested primary neuronal cultures enriched in cerebellar granular, striatal, or cortical neurons. Our results showed that (i) a strain-specific neuronal tropism operated in vitro; (ii) the cytotoxic effect varied among strains and neuronal cell types; (iii) prion propagation and toxicity occurred in two kinetic phases, a replicative phase followed by a toxic phase; and (iv) neurotoxicity peaked when abnormal PrP accumulation reached a plateau.
Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.
Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W
1992-11-23
Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.
International Nuclear Information System (INIS)
Kim, Chan-Lan; Umetani, Atsushi; Matsui, Toshio; Ishiguro, Naotaka; Shinagawa, Morikazu; Horiuchi, Motohiro
2004-01-01
We established a panel of monoclonal antibodies (mAbs) against prion protein (PrP) by immunizing PrP gene-ablated mice with the pathogenic isoform of prion protein (PrP Sc ) or recombinant prion protein (rPrP). The mAbs could be divided into at least 10 groups by fine epitope analyses using mutant rPrPs and pepspot analysis. Seven linear epitopes, lying within residues 56-90, 119-127, 137-143, 143-149, 147-151, 163-169, and 219-229, were defined by seven groups of mAbs, although the remaining three groups of mAbs recognized discontinuous epitopes. We attempted to examine whether any of these epitopes are located on the accessible surface of PrP Sc . However, no mAbs reacted with protease-treated PrP Sc purified from scrapie-affected mice, even when PrP Sc was dispersed into a detergent-lipid protein complex, to reduce the size of PrP Sc aggregates. In contrast, denaturation of PrP Sc by guanidine hydrochloride efficiently exposed all of the epitopes. This suggests that any epitope recognized by this panel of mAbs is buried within the PrP Sc aggregates. Alternatively, if the corresponding region(s) are on the surface of PrP Sc , the region(s) may be folded into conformations to which the mAbs cannot bind. The reactivity of a panel of mAb also showed that the state of PrP Sc aggregation influenced the denaturation process, and the sensitivity to denaturation appeared to vary between epitopes. Our results demonstrate that this new panel of well-characterized mAbs will be valuable for studying the biochemistry and biophysics of PrP molecules as well as for the immuno-diagnosis of prion diseases
The real-time quaking-induced conversion (RT-QuIC) is a rapid, specific, and sensitive prion seeding activity detection assay that uses recombinant prion protein (rPrPSen) to detect sub-infectious levels of the abnormal isoforms of the prion protein (PrPSc). Although RT-QuIC has been successfully us...
Disturbed vesicular trafficking of membrane proteins in prion disease.
Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro
2013-01-01
The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.
Enzymatic Digestion of Chronic Wasting Disease Prions Bound to Soil
SAUNDERS, SAMUEL E.; BARTZ, JASON C.; VERCAUTEREN, KURT C.; BARTELT-HUNT, SHANNON L.
2010-01-01
Chronic wasting disease (CWD) and sheep scrapie can be transmitted via indirect environmental routes, and it is known that soil can serve as a reservoir of prion infectivity. Given the strong interaction between the prion protein (PrP) and soil, we hypothesized that binding to soil enhances prion resistance to enzymatic digestion, thereby facilitating prion longevity in the environment and providing protection from host degradation. We characterized the performance of a commercially available subtilisin enzyme, the Prionzyme, to degrade soil-bound and unbound CWD and HY TME PrP as a function of pH, temperature, and treatment time. The subtilisin enzyme effectively degraded PrP adsorbed to a wide range of soils and soil minerals below the limits of detection. Signal loss occurred rapidly at high pH (12.5) and within 7 d under conditions representative of the natural environment (pH 7.4, 22°C). We observed no apparent difference in enzyme effectiveness between bound and unbound CWD PrP. Our results show that although adsorbed prions do retain relative resistance to enzymatic digestion compared with other brain homogenate proteins, they can be effectively degraded when bound to soil. Our results also suggest a topical application of a subtilisin enzyme solution may be an effective decontamination method to limit disease transmission via environmental ‘hot spots’ of prion infectivity. PMID:20450190
Controlling the prion propensity of glutamine/asparagine-rich proteins.
Paul, Kacy R; Ross, Eric D
2015-01-01
The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.
Porcine prion protein amyloid.
Hammarström, Per; Nyström, Sofie
2015-01-01
Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.
Detection of prion infectivity in fat tissues of scrapie-infected mice.
Directory of Open Access Journals (Sweden)
Brent Race
2008-12-01
Full Text Available Distribution of prion infectivity in organs and tissues is important in understanding prion disease pathogenesis and designing strategies to prevent prion infection in animals and humans. Transmission of prion disease from cattle to humans resulted in banning human consumption of ruminant nervous system and certain other tissues. In the present study, we surveyed tissue distribution of prion infectivity in mice with prion disease. We show for the first time detection of infectivity in white and brown fat. Since high amounts of ruminant fat are consumed by humans and also incorporated into animal feed, fat-containing tissues may pose a previously unappreciated hazard for spread of prion infection.
Thermodynamic Stabilization of the Folded Domain of Prion Protein Inhibits Prion Infection in Vivo
Directory of Open Access Journals (Sweden)
Qingzhong Kong
2013-07-01
Full Text Available Prion diseases, or transmissible spongiform encephalopathies (TSEs, are associated with the conformational conversion of the cellular prion protein, PrPC, into a protease-resistant form, PrPSc. Here, we show that mutation-induced thermodynamic stabilization of the folded, α-helical domain of PrPC has a dramatic inhibitory effect on the conformational conversion of prion protein in vitro, as well as on the propagation of TSE disease in vivo. Transgenic mice expressing a human prion protein variant with increased thermodynamic stability were found to be much more resistant to infection with the TSE agent than those expressing wild-type human prion protein, in both the primary passage and three subsequent subpassages. These findings not only provide a line of evidence in support of the protein-only model of TSEs but also yield insight into the molecular nature of the PrPC→PrPSc conformational transition, and they suggest an approach to the treatment of prion diseases.
Glypican-1 mediates both prion protein lipid raft association and disease isoform formation.
Directory of Open Access Journals (Sweden)
David R Taylor
2009-11-01
Full Text Available In prion diseases, the cellular form of the prion protein, PrP(C, undergoes a conformational conversion to the infectious isoform, PrP(Sc. PrP(C associates with lipid rafts through its glycosyl-phosphatidylinositol (GPI anchor and a region in its N-terminal domain which also binds to heparan sulfate proteoglycans (HSPGs. We show that heparin displaces PrP(C from rafts and promotes its endocytosis, suggesting that heparin competes with an endogenous raft-resident HSPG for binding to PrP(C. We then utilised a transmembrane-anchored form of PrP (PrP-TM, which is targeted to rafts solely by its N-terminal domain, to show that both heparin and phosphatidylinositol-specific phospholipase C can inhibit its association with detergent-resistant rafts, implying that a GPI-anchored HSPG targets PrP(C to rafts. Depletion of the major neuronal GPI-anchored HSPG, glypican-1, significantly reduced the raft association of PrP-TM and displaced PrP(C from rafts, promoting its endocytosis. Glypican-1 and PrP(C colocalised on the cell surface and both PrP(C and PrP(Sc co-immunoprecipitated with glypican-1. Critically, treatment of scrapie-infected N2a cells with glypican-1 siRNA significantly reduced PrP(Sc formation. In contrast, depletion of glypican-1 did not alter the inhibitory effect of PrP(C on the beta-secretase cleavage of the Alzheimer's amyloid precursor protein. These data indicate that glypican-1 is a novel cellular cofactor for prion conversion and we propose that it acts as a scaffold facilitating the interaction of PrP(C and PrP(Sc in lipid rafts.
Cleaning, disinfection and sterilization of surface prion contamination.
McDonnell, G; Dehen, C; Perrin, A; Thomas, V; Igel-Egalon, A; Burke, P A; Deslys, J P; Comoy, E
2013-12-01
Prion contamination is a risk during device reprocessing, being difficult to remove and inactivate. Little is known of the combined effects of cleaning, disinfection and sterilization during a typical reprocessing cycle in clinical practice. To investigate the combination of cleaning, disinfection and/or sterilization on reducing the risk of surface prion contamination. In vivo test methods were used to study the impact of cleaning alone and cleaning combined with thermal disinfection and high- or low-temperature sterilization processes. A standardized test method, based on contamination of stainless steel wires with high titres of scrapie-infected brain homogenates, was used to determine infectivity reduction. Traditional chemical methods of surface decontamination against prions were confirmed to be effective, but extended steam sterilization was more variable. Steam sterilization alone reduced the risk of prion contamination under normal or extended exposure conditions, but did show significant variation. Thermal disinfection had no impact in these studies. Cleaning with certain defined formulations in combination with steam sterilization can be an effective prion decontamination process, in particular with alkaline formulations. Low-temperature, gaseous hydrogen peroxide sterilization was also confirmed to reduce infectivity in the presence and absence of cleaning. Prion decontamination is affected by the full reprocessing cycle used on contaminated surfaces. The correct use of defined cleaning, disinfection and sterilization methods as tested in this report in the scrapie infectivity assay can provide a standard precaution against prion contamination. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent
Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...
Directory of Open Access Journals (Sweden)
Héllen M. Martins
2012-12-01
of scrapie in sheep from Mato Grosso do Sul (MS, Brazil, and to investigate by immunohistochemistry (IHC the presence of PrPsc in samples from the CNS of sheep examined during 2003 and 2010. The study was conducted in two stages; the first was the observation of two sheep with typical clinical signs of scrapie that underwent clinical examination with emphasis on neurological parameters, epidemiological data collection, necropsy and collection of samples in duplicate forwarded to the diagnosis of rabies, and for the IHC diagnosis of Transmissible Spongiform Encephalopathies. In the second part of the study, a survey was made the necropsy reviewing gross findings and histopathological diagnoses in sheep from May 2003 to March 2010. Samples of the central nervous system of fifty-one cases, including the two sheep mentioned above were subjected to IHC for detection of prion protein. The other 49 sheep, although displaying neurological-disease which should be included as scrapie differential diagnosis, had their tissues submitted to IHC resulting negative.
Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity
Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.
2009-01-01
Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.
De novo generation of infectious prions with bacterially expressed recombinant prion protein.
Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan
2013-12-01
The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.
Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P
2014-07-01
Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.
Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788
Ai Tran, Hoang Ngoc; Sousa, Fernanda; Moda, Fabio; Mandal, Subhra; Chanana, Munish; Vimercati, Chiara; Morbin, Michela; Krol, Silke; Tagliavini, Fabrizio; Legname, Giuseppe
2010-12-01
Gold nanoparticles coated with oppositely charged polyelectrolytes, such as polyallylamine hydrochloride and polystyrenesulfonate, were examined for potential inhibition of prion protein aggregation and prion (PrPSc) conversion and replication. Different coatings, finishing with a positive or negative layer, were tested, and different numbers of layers were investigated for their ability to interact and reduce the accumulation of PrPSc in scrapie prion infected ScGT1 and ScN2a cells. The particles efficiently hampered the accumulation of PrPSc in ScN2a cells and showed curing effects on ScGT1 cells with a nanoparticle concentration in the picomolar range. Finally, incubation periods of prion-infected mice treated with nanomolar concentrations of gold nanoparticles were significantly longer compared to untreated controls.
An ancient conserved role for prion protein in learning and memory
Directory of Open Access Journals (Sweden)
Patricia L. A. Leighton
2018-01-01
Full Text Available The misfolding of cellular prion protein (PrPC to form PrP Scrapie (PrPSc is an exemplar of toxic gain-of-function mechanisms inducing propagated protein misfolding and progressive devastating neurodegeneration. Despite this, PrPC function in the brain is also reduced and subverted during prion disease progression; thus understanding the normal function of PrPC in healthy brains is key. Disrupting PrPC in mice has led to a myriad of controversial functions that sometimes map onto disease symptoms, including a proposed role in memory or learning. Intriguingly, PrPC interaction with amyloid beta (Aβ oligomers at synapses has also linked its function to Alzheimer's disease and dementia in recent years. We set out to test the involvement of PrPC in memory using a disparate animal model, the zebrafish. Here we document an age-dependent memory decline in prp2−/− zebrafish, pointing to a conserved and ancient role of PrPC in memory. Specifically, we found that aged (3-year-old prp2−/− fish performed poorly in an object recognition task relative to age-matched prp2+/+ fish or 1-year-old prp2−/− fish. Further, using a novel object approach (NOA test, we found that aged (3-year-old prp2−/− fish approached the novel object more than either age-matched prp2+/+ fish or 1-year-old prp2−/− fish, but did not have decreased anxiety when we tested them in a novel tank diving test. Taken together, the results of the NOA and novel tank diving tests suggest an altered cognitive appraisal of the novel object in the 3-year-old prp2−/− fish. The learning paradigm established here enables a path forward to study PrPC interactions of relevance to Alzheimer's disease and prion diseases, and to screen for candidate therapeutics for these diseases. The findings underpin a need to consider the relative contributions of loss- versus gain-of-function of PrPC during Alzheimer's and prion diseases, and have implications upon the prospects of several
Neurotoxic Antibodies against the Prion Protein Do Not Trigger Prion Replication.
Directory of Open Access Journals (Sweden)
Karl Frontzek
Full Text Available Prions are the infectious agents causing transmissible spongiform encephalopathies (TSE, progressive, inexorably lethal neurological diseases. Antibodies targeting the globular domain (GD of the cellular prion protein PrPC trigger a neurotoxic syndrome morphologically and molecularly similar to prion disease. This phenomenon raises the question whether such antibodies induce infectious prions de novo. Here we exposed cerebellar organotypic cultured slices (COCS to the neurotoxic antibody, POM1. We then inoculated COCS homogenates into tga20 mice, which overexpress PrPC and are commonly utilized as sensitive indicators of prion infectivity. None of the mice inoculated with COCS-derived lysates developed any signs of disease, and all mice survived for at least 200 days post-inoculation. In contrast, all mice inoculated with bona fide prions succumbed to TSE after 55-95 days. Post-mortem analyses did not reveal any signs of prion pathology in mice inoculated with POM1-COCS lysates. Also, lysates from POM1-exposed COCS were unable to convert PrP by quaking. Hence, anti-GD antibodies do not catalyze the generation of prion infectivity. These data indicate that prion replication can be separated from prion toxicity, and suggest that anti-GD antibodies exert toxicity by acting downstream of prion replication.
Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B
2016-11-01
The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for
A systematic investigation of production of synthetic prions from recombinant prion protein.
Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John
2015-12-01
According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.
Protease-resistant prions selectively decrease Shadoo protein.
Directory of Open Access Journals (Sweden)
Joel C Watts
2011-11-01
Full Text Available The central event in prion diseases is the conformational conversion of the cellular prion protein (PrP(C into PrP(Sc, a partially protease-resistant and infectious conformer. However, the mechanism by which PrP(Sc causes neuronal dysfunction remains poorly understood. Levels of Shadoo (Sho, a protein that resembles the flexibly disordered N-terminal domain of PrP(C, were found to be reduced in the brains of mice infected with the RML strain of prions [1], implying that Sho levels may reflect the presence of PrP(Sc in the brain. To test this hypothesis, we examined levels of Sho during prion infection using a variety of experimental systems. Sho protein levels were decreased in the brains of mice, hamsters, voles, and sheep infected with different natural and experimental prion strains. Furthermore, Sho levels were decreased in the brains of prion-infected, transgenic mice overexpressing Sho and in infected neuroblastoma cells. Time-course experiments revealed that Sho levels were inversely proportional to levels of protease-resistant PrP(Sc. Membrane anchoring and the N-terminal domain of PrP both influenced the inverse relationship between Sho and PrP(Sc. Although increased Sho levels had no discernible effect on prion replication in mice, we conclude that Sho is the first non-PrP marker specific for prion disease. Additional studies using this paradigm may provide insight into the cellular pathways and systems subverted by PrP(Sc during prion disease.
Directory of Open Access Journals (Sweden)
K Marie McIntyre
Full Text Available Most previous analyses of scrapie outbreaks have focused on flocks run by research institutes, which may not reflect the field situation. Within this study, we attempt to rectify this deficit by describing the epidemiological characteristics of 30 sheep flocks naturally-infected with classical scrapie, and by exploring possible underlying causes of variation in the characteristics between flocks, including flock-level prion protein (PrP genotype profile. In total, the study involved PrP genotype data for nearly 8600 animals and over 400 scrapie cases.We found that most scrapie cases were restricted to just two PrP genotypes (ARQ/VRQ and VRQ/VRQ, though two flocks had markedly different affected genotypes, despite having similar underlying genotype profiles to other flocks of the same breed; we identified differences amongst flocks in the age of cases of certain PrP genotypes; we found that the age-at-onset of clinical signs depended on peak incidence and flock type; we found evidence that purchasing infected animals is an important means of introducing scrapie to a flock; we found some evidence that flock-level PrP genotype profile and flock size account for variation in outbreak characteristics; identified seasonality in cases associated with lambing time in certain flocks; and we identified one case that was homozygous for phenylalanine at codon 141, a polymorphism associated with a very high risk of atypical scrapie, and 28 cases that were heterozygous at this codon.This paper presents the largest study to date on commercially-run sheep flocks naturally-infected with classical scrapie, involving 30 study flocks, more than 400 scrapie cases and over 8500 PrP genotypes. We show that some of the observed variation in epidemiological characteristics between farms is related to differences in their PrP genotype profile; although much remains unexplained and may instead be attributed to the stochastic nature of scrapie dynamics.
Directory of Open Access Journals (Sweden)
Lisa eGasperini
2014-08-01
Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and
Directory of Open Access Journals (Sweden)
Mauricio Torres
2010-12-01
Full Text Available Prion-related disorders (PrDs are fatal neurodegenerative disorders characterized by progressive neuronal impairment as well as the accumulation of an abnormally folded and protease resistant form of the cellular prion protein, termed PrP(RES. Altered endoplasmic reticulum (ER homeostasis is associated with the occurrence of neurodegeneration in sporadic, infectious and familial forms of PrDs. The ER operates as a major intracellular calcium store, playing a crucial role in pathological events related to neuronal dysfunction and death. Here we investigated the possible impact of PrP misfolding on ER calcium homeostasis in infectious and familial models of PrDs. Neuro2A cells chronically infected with scrapie prions showed decreased ER-calcium content that correlated with a stronger upregulation of UPR-inducible chaperones, and a higher sensitivity to ER stress-induced cell death. Overexpression of the calcium pump SERCA stimulated calcium release and increased the neurotoxicity observed after exposure of cells to brain-derived infectious PrP(RES. Furthermore, expression of PrP mutants that cause hereditary Creutzfeldt-Jakob disease or fatal familial insomnia led to accumulation of PrP(RES and their partial retention at the ER, associated with a drastic decrease of ER calcium content and higher susceptibility to ER stress. Finally, similar results were observed when a transmembrane form of PrP was expressed, which is proposed as a neurotoxic intermediate. Our results suggest that alterations in calcium homeostasis and increased susceptibility to ER stress are common pathological features of both infectious and familial PrD models.
Protein Misfolding Cyclic Amplification of Infectious Prions.
Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies, or prion diseases, are a group of incurable disorders caused by the accumulation of an abnormally folded prion protein (PrP Sc ) in the brain. According to the "protein-only" hypothesis, PrP Sc is the infectious agent able to propagate the disease by acting as a template for the conversion of the correctly folded prion protein (PrP C ) into the pathological isoform. Recently, the mechanism of PrP C conversion has been mimicked in vitro using an innovative technique named protein misfolding cyclic amplification (PMCA). This technology represents a great tool for studying diverse aspects of prion biology in the field of basic research and diagnosis. Moreover, PMCA can be expanded for the study of the misfolding process associated to other neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and frontotemporal lobar degeneration. © 2017 Elsevier Inc. All rights reserved.
Prion infected meat-and-bone meal is still infectious after biodiesel production.
Directory of Open Access Journals (Sweden)
Cathrin E Bruederle
2008-08-01
Full Text Available The epidemic of bovine spongiform encephalopathy (BSE has led to a world-wide drop in the market for beef by-products, such as Meat-and-Bone Meal (MBM, a fat-containing but mainly proteinaceaous product traditionally used as an animal feed supplement. While normal rendering is insufficient, the production of biodiesel from MBM has been suggested to destroy infectivity from transmissible spongiform encephalopathies (TSEs. In addition to producing fuel, this method simultaneously generates a nutritious solid residue. In our study we produced biodiesel from MBM under defined conditions using a modified form of alkaline methanolysis. We evaluated the presence of prion in the three resulting phases of the biodiesel reaction (Biodiesel, Glycerol and Solid Residue in vitro and in vivo. Analysis of the reaction products from 263K scrapie infected MBM led to no detectable immunoreactivity by Western Blot. Importantly, and in contrast to the biochemical results the solid MBM residue from the reaction retained infectivity when tested in an animal bioassay. Histochemical analysis of hamster brains inoculated with the solid residue showed typical spongiform degeneration and vacuolation. Re-inoculation of these brains into a new cohort of hamsters led to onset of clinical scrapie symptoms within 75 days, suggesting that the specific infectivity of the prion protein was not changed during the biodiesel process. The biodiesel reaction cannot be considered a viable prion decontamination method for MBM, although we observed increased survival time of hamsters and reduced infectivity greater than 6 log orders in the solid MBM residue. Furthermore, results from our study compare for the first time prion detection by Western Blot versus an infectivity bioassay for analysis of biodiesel reaction products. We could show that biochemical analysis alone is insufficient for detection of prion infectivity after a biodiesel process.
A naturally occurring variant of the human prion protein completely prevents prion disease.
Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John
2015-06-25
Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.
Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.
Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F
2016-05-01
Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.
New insights into structural determinants of prion protein folding and stability.
Benetti, Federico; Legname, Giuseppe
2015-01-01
Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.
Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G
2018-05-01
Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.
Comparative analysis of the prion protein gene sequences in African lion.
Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming
2006-10-01
The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.
Resistance of soil-bound prions to rumen digestion.
Directory of Open Access Journals (Sweden)
Samuel E Saunders
Full Text Available Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrP(c from complete digestion, while both unbound and soil-bound infectious PrP(Sc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD and scrapie in the environment.
Resistance of Soil-Bound Prions to Rumen Digestion
Saunders, Samuel E.; Bartelt-Hunt, Shannon L.; Bartz, Jason C.
2012-01-01
Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrPc from complete digestion, while both unbound and soil-bound infectious PrPSc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD) and scrapie in the environment. PMID:22937149
Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki
2014-03-28
Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.
Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K
2014-07-01
Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have
Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2010-10-01
Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.
Yeast prions: structure, biology, and prion-handling systems.
Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E
2015-03-01
A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kraus, Allison; Raymond, Gregory J; Race, Brent; Campbell, Katrina J; Hughson, Andrew G; Anson, Kelsie J; Raymond, Lynne D; Caughey, Byron
2017-11-01
Accumulation of fibrillar protein aggregates is a hallmark of many diseases. While numerous proteins form fibrils by prion-like seeded polymerization in vitro , only some are transmissible and pathogenic in vivo To probe the structural features that confer transmissibility to prion protein (PrP) fibrils, we have analyzed synthetic PrP amyloids with or without the human prion disease-associated P102L mutation. The formation of infectious prions from PrP molecules in vitro has required cofactors and/or unphysiological denaturing conditions. Here, we demonstrate that, under physiologically compatible conditions without cofactors, the P102L mutation in recombinant hamster PrP promoted prion formation when seeded by minute amounts of scrapie prions in vitro Surprisingly, combination of the P102L mutation with charge-neutralizing substitutions of four nearby lysines promoted spontaneous prion formation. When inoculated into hamsters, both of these types of synthetic prions initiated substantial accumulation of prion seeding activity and protease-resistant PrP without transmissible spongiform encephalopathy (TSE) clinical signs or notable glial activation. Our evidence suggests that PrP's centrally located proline and lysine residues act as conformational switches in the in vitro formation of transmissible PrP amyloids. IMPORTANCE Many diseases involve the damaging accumulation of specific misfolded proteins in thread-like aggregates. These threads (fibrils) are capable of growing on the ends by seeding the refolding and incorporation of the normal form of the given protein. In many cases such aggregates can be infectious and propagate like prions when transmitted from one individual host to another. Some transmitted aggregates can cause fatal disease, as with human iatrogenic prion diseases, while other aggregates appear to be relatively innocuous. The factors that distinguish infectious and pathogenic protein aggregates from more innocuous ones are poorly understood
Immunology of Prion Protein and Prions.
Mabbott, Neil A
2017-01-01
Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure
Energy Technology Data Exchange (ETDEWEB)
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-09-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-01-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Genetic prion disease: no role for the immune system in disease pathogenesis?
Friedman-Levi, Yael; Binyamin, Orli; Frid, Kati; Ovadia, Haim; Gabizon, Ruth
2014-08-01
Prion diseases, which can manifest by transmissible, sporadic or genetic etiologies, share several common features, such as a fatal neurodegenerative outcome and the aberrant accumulation of proteinase K (PK)-resistant PrP forms in the CNS. In infectious prion diseases, such as scrapie in mice, prions first replicate in immune organs, then invade the CNS via ascending peripheral tracts, finally causing death. Accelerated neuroinvasion and death occurs when activated prion-infected immune cells infiltrate into the CNS, as is the case for scrapie-infected mice induced for experimental autoimmune encephalomyelitis (EAE), a CNS inflammatory insult. To establish whether the immune system plays such a central role also in genetic prion diseases, we induced EAE in TgMHu2ME199K mice, a line mimicking for late onset genetic Creutzfeldt Jacob disease (gCJD), a human prion disease. We show here that EAE induction of TgMHu2ME199K mice neither accelerated nor aggravated prion disease manifestation. Concomitantly, we present evidence that PK-resistant PrP forms were absent from CNS immune infiltrates, and most surprisingly also from lymph nodes and spleens of TgMHu2ME199K mice at all ages and stages of disease. These results imply that the mechanism of genetic prion disease differs widely from that of the infectious presentation, and that the conversion of mutant PrPs into PK resistant forms occurs mostly/only in the CNS. If the absence of pathogenic PrP forms form immune organs is also true for gCJD patients, it may suggest their blood is devoid of prion infectivity. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Daus, Martin L
2016-01-04
In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
Role of Prion Protein Aggregation in Neurotoxicity
Directory of Open Access Journals (Sweden)
Tullio Florio
2012-07-01
Full Text Available In several neurodegenerative diseases, such as Parkinson, Alzheimer’s, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP, the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126 and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death.
An assessment of the long-term persistence of prion infectivity in aquatic environments
International Nuclear Information System (INIS)
Marín-Moreno, Alba; Espinosa, Juan-Carlos; Fernández-Borges, Natalia; Píquer, Juan; Girones, Rosina; Andreoletti, Olivier; Torres, Juan-María
2016-01-01
The environment plays a key role in horizontal transmission of prion diseases, since prions are extremely resistant to classical inactivation procedures. In prior work, we observed the high stability of bovine spongiform encephalopathy (BSE) infectivity when these prions were incubated in aqueous media such as phosphate-buffered saline (PBS) or wastewater for nearly nine months. As a continuation of this experiment, the same samples were maintained in PBS or wastewater for five additional years and residual BSE infectivity was assessed in bovine PrP C transgenic mice. Over this long time period (more than six years), BSE infectivity was reduced by three and one orders of magnitude in wastewater and PBS respectively. To rule out a possible agent specific effect, sheep scrapie prions were subjected to the same experimental protocol, using eight years as the experimental end-point. No significant reduction in scrapie infectivity was observed over the first nine months of wastewater incubation while PBS incubation for eight years only produced a two logarithmic unit reduction in infectivity. By contrast, the dynamics of PrP Res persistence was different, disappearing progressively over the first year. The long persistence of prion infectivity observed in this study for two different agents provides supporting evidence of the assumed high stability of these agents in aquatic environments and that environmental processes or conventional wastewater treatments with low retention times would have little impact on prion infectivity. These results could have great repercussions in terms of risk assessment and safety for animals and human populations. - Highlights: • Prion infectivity resists long term incubations in aquatic environments. • Infectivity persistence in wastewater is reduced when compared to PBS. • In this study PrPRes fails as a marker for prion detection. • Mice bioassay is the most powerful tool for assessing prion presence. • Wastewater conventional
An assessment of the long-term persistence of prion infectivity in aquatic environments
Energy Technology Data Exchange (ETDEWEB)
Marín-Moreno, Alba; Espinosa, Juan-Carlos; Fernández-Borges, Natalia; Píquer, Juan [Centro de Investigación en Sanidad Animal, CISA-INIA, Carretera Algete-El Casar S/n, Valdeolmos, 28130 Madrid (Spain); Girones, Rosina [Department of Microbiology, University of Barcelona, Diagonal 643, 08028 Barcelona (Spain); Andreoletti, Olivier [UMR INRA-ENVT 1225, Interactions Hôte Agent Pathogène, Ecole Nationale Vétérinaire de Toulouse, Toulouse (France); Torres, Juan-María, E-mail: jmtorres@inia.es [Centro de Investigación en Sanidad Animal, CISA-INIA, Carretera Algete-El Casar S/n, Valdeolmos, 28130 Madrid (Spain)
2016-11-15
The environment plays a key role in horizontal transmission of prion diseases, since prions are extremely resistant to classical inactivation procedures. In prior work, we observed the high stability of bovine spongiform encephalopathy (BSE) infectivity when these prions were incubated in aqueous media such as phosphate-buffered saline (PBS) or wastewater for nearly nine months. As a continuation of this experiment, the same samples were maintained in PBS or wastewater for five additional years and residual BSE infectivity was assessed in bovine PrP{sup C} transgenic mice. Over this long time period (more than six years), BSE infectivity was reduced by three and one orders of magnitude in wastewater and PBS respectively. To rule out a possible agent specific effect, sheep scrapie prions were subjected to the same experimental protocol, using eight years as the experimental end-point. No significant reduction in scrapie infectivity was observed over the first nine months of wastewater incubation while PBS incubation for eight years only produced a two logarithmic unit reduction in infectivity. By contrast, the dynamics of PrP{sup Res} persistence was different, disappearing progressively over the first year. The long persistence of prion infectivity observed in this study for two different agents provides supporting evidence of the assumed high stability of these agents in aquatic environments and that environmental processes or conventional wastewater treatments with low retention times would have little impact on prion infectivity. These results could have great repercussions in terms of risk assessment and safety for animals and human populations. - Highlights: • Prion infectivity resists long term incubations in aquatic environments. • Infectivity persistence in wastewater is reduced when compared to PBS. • In this study PrPRes fails as a marker for prion detection. • Mice bioassay is the most powerful tool for assessing prion presence. • Wastewater
Scrapie-specific pathology of sheep lymphoid tissues.
Directory of Open Access Journals (Sweden)
Gillian McGovern
Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases often result in accumulation of disease-associated PrP (PrP(d in the lymphoreticular system (LRS, specifically in association with follicular dendritic cells (FDCs and tingible body macrophages (TBMs of secondary follicles. We studied the effects of sheep scrapie on lymphoid tissue in tonsils and lymph nodes by light and electron microscopy. FDCs of sheep were grouped according to morphology as immature, mature or regressing. Scrapie was associated with FDC dendrite hypertrophy and electron dense deposit or vesicles. PrP(d was located using immunogold labelling at the plasmalemma of FDC dendrites and, infrequently, mature B cells. Abnormal electron dense deposits surrounding FDC dendrites were identified as immunoglobulins suggesting that excess immune complexes are retained and are indicative of an FDC dysfunction. Within scrapie-affected lymph nodes, macrophages outside the follicle and a proportion of germinal centre TBMs accumulated PrP(d within endosomes and lysosomes. In addition, TBMs showed PrP(d in association with the cell membrane, non-coated pits and vesicles, and also with discrete, large and random endoplasmic reticulum networks, which co-localised with ubiquitin. These observations suggest that PrP(d is internalised via the caveolin-mediated pathway, and causes an abnormal disease-related alteration in endoplasmic reticulum structure. In contrast to current dogma, this study shows that sheep scrapie is associated with cytopathology of germinal centres, which we attribute to abnormal antigen complex trapping by FDCs and abnormal endocytic events in TBMs. The nature of the sub-cellular changes in FDCs and TBMs differs from those of scrapie infected neurones and glial cells suggesting that different PrP(d/cell membrane interactions occur in different cell types.
Sod1 deficiency reduces incubation time in mouse models of prion disease.
Directory of Open Access Journals (Sweden)
Shaheen Akhtar
Full Text Available Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02 and Sod1 (P<0.0001 suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.
Race, Brent; Meade-White, Kimberly; Race, Richard; Baumann, Frank; Aguzzi, Adriano; Chesebro, Bruce
2009-01-01
Prion protein (PrP) is a host-encoded membrane-anchored glycoprotein which is required for susceptibility to prion disease. PrP may also be important for normal brain functions such as hippocampal spatial memory. Previously transgenic mice expressing amino terminally truncated mouse PrP (Δ32–134) spontaneously developed a fatal disease associated with degeneration of cerebellar granular neurons as well as vacuolar degeneration of deep cerebellar and brain stem white matter. This disease could...
Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.
Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A
2016-12-01
Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD
Molecular modeling of the conformational dynamics of the cellular prion protein
Nguyen, Charles; Colling, Ian; Bartz, Jason; Soto, Patricia
2014-03-01
Prions are infectious agents responsible for transmissible spongiform encephalopathies (TSEs), a type of fatal neurodegenerative disease in mammals. Prions propagate biological information by conversion of the non-pathological version of the prion protein to the infectious conformation, PrPSc. A wealth of knowledge has shed light on the nature and mechanism of prion protein conversion. In spite of the significance of this problem, we are far from fully understanding the conformational dynamics of the cellular isoform. To remedy this situation we employ multiple biomolecular modeling techniques such as docking and molecular dynamics simulations to map the free energy landscape and determine what specific regions of the prion protein are most conductive to binding. The overall goal is to characterize the conformational dynamics of the cell form of the prion protein, PrPc, to gain insight into inhibition pathways against misfolding. NE EPSCoR FIRST Award to Patricia Soto.
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Directory of Open Access Journals (Sweden)
Djamel Harbi
Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M
2012-01-01
Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing
The roles of the conserved tyrosine in the β2-α2 loop of the prion protein.
Huang, Danzhi; Caflisch, Amedeo
2015-01-01
Prions cause neurodegenerative diseases for which no cure exists. Despite decades of research activities the function of the prion protein (PrP) in mammalians is not known. Moreover, little is known on the molecular mechanisms of the self-assembly of the PrP from its monomeric state (cellular PrP, PrP(C)) to the multimeric state. The latter state includes the toxic species (scrapie PrP, PrP(Sc)) knowledge of which would facilitate the development of drugs against prion diseases. Here we analyze the role of a tyrosine residue (Y169) which is strictly conserved in mammalian PrPs. Nuclear magnetic resonance (NMR) spectroscopy studies of many mammalian PrP(C) proteins have provided evidence of a conformational equilibrium between a 3(10)-helical turn and a type I β turn conformation in the β2-α2 loop (residues 165-175). In vitro cell-free experiments of the seeded conversion of PrP(C) indicate that non-aromatic residues at position 169 reduce the formation of proteinase K-resistant PrP. Recent molecular dynamics (MD) simulations of monomeric PrP and several single-point mutants show that Y169 stabilizes the 3(10)-helical turn conformation more than single-point mutants at position 169 or residues in contact with it. In the 3(10)-helical turn conformation the hydrophobic and aggregation-prone segment 169-YSNQNNF-175 is buried and thus not-available for self-assembly. From the combined analysis of simulation and experimental results it emerges that Y169 is an aggregation gatekeeper with a twofold role. Mutations related to 3 human prion diseases are interpreted on the basis of the gatekeeper role in the monomeric state. Another potential role of the Y169 side chain is the stabilization of the ordered aggregates, i.e., reduction of frangibility of filamentous protofibrils and fibrils, which is likely to reduce the generation of toxic species.
Aberrant ERK 1/2 complex activation and localization in scrapie-infected GT1-1 cells
Directory of Open Access Journals (Sweden)
Didonna Alessandro
2010-08-01
Full Text Available Abstract Background Fatal neurodegenerative disorders such as Creutzfeldt-Jakob and Gerstmann-Sträussler-Scheinker diseases in humans, scrapie and bovine spongiform encephalopathy in animals, are characterized by the accumulation in the brain of a pathological form of the prion protein (PrP denominated PrPSc. The latter derives from the host cellular form, PrPC, through a process whereby portions of its α-helical and coil structures are refolded into β-sheet structures. Results In this work, the widely known in vitro model of prion replication, hypothalamic GT1-1 cell line, was used to investigate cellular and molecular responses to prion infection. The MAP kinase cascade was dissected to assess the phosphorylation levels of src, MEK 1/2 and ERK 1/2 signaling molecules, both before and after prion infection. Our findings suggest that prion replication leads to a hyper-activation of this pathway. Biochemical analysis was complemented with immunofluorescence studies to map the localization of the ERK complex within the different cellular compartments. We showed how the ERK complex relocates in the cytosol upon prion infection. We correlated these findings with an impairment of cell growth in prion-infected GT1-1 cells as probed by MTT assay. Furthermore, given the persistent urgency in finding compounds able to cure prion infected cells, we tested the effects on the ERK cascade of two molecules known to block prion replication in vitro, quinacrine and Fab D18. We were able to show that while these two compounds possess similar effects in curing prion infection, they affect the MAP kinase cascade differently. Conclusions Taken together, our results help shed light on the molecular events involved in neurodegeneration and neuronal loss in prion infection and replication. In particular, the combination of chronic activation and aberrant localization of the ERK complex may lead to a lack of essential neuroprotective and survival factors
Directory of Open Access Journals (Sweden)
Martin L. Daus
2016-01-01
Full Text Available In 1982, the term “prions” (proteinaceous infectious particles was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
The Prion Protein Preference of Sporadic Creutzfeldt-Jakob Disease Subtypes*
Klemm, Helen M. J.; Welton, Jeremy M.; Masters, Colin L.; Klug, Genevieve M.; Boyd, Alison; Hill, Andrew F.; Collins, Steven J.; Lawson, Victoria A.
2012-01-01
Sporadic Creutzfeldt-Jakob disease (CJD) is the most prevalent manifestation of the transmissible spongiform encephalopathies or prion diseases affecting humans. The disease encompasses a spectrum of clinical phenotypes that have been correlated with molecular subtypes that are characterized by the molecular mass of the protease-resistant fragment of the disease-related conformation of the prion protein and a polymorphism at codon 129 of the gene encoding the prion protein. A cell-free assay of prion protein misfolding was used to investigate the ability of these sporadic CJD molecular subtypes to propagate using brain-derived sources of the cellular prion protein (PrPC). This study confirmed the presence of three distinct sporadic CJD molecular subtypes with PrPC substrate requirements that reflected their codon 129 associations in vivo. However, the ability of a sporadic CJD molecular subtype to use a specific PrPC substrate was not determined solely by codon 129 as the efficiency of prion propagation was also influenced by the composition of the brain tissue from which the PrPC substrate was sourced, thus indicating that nuances in PrPC or additional factors may determine sporadic CJD subtype. The results of this study will aid in the design of diagnostic assays that can detect prion disease across the diversity of sporadic CJD subtypes. PMID:22930754
Prion protein self-interaction in prion disease therapy approaches
Rigter, A.; Priem, J.; Langeveld, J.P.M.; Bossers, A.
2011-01-01
Transmissible spongiform encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seem to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders
Prion Protein Promotes Kidney Iron Uptake via Its Ferrireductase Activity*
Haldar, Swati; Tripathi, Ajai; Qian, Juan; Beserra, Amber; Suda, Srinivas; McElwee, Matthew; Turner, Jerrold; Hopfer, Ulrich; Singh, Neena
2015-01-01
Brain iron-dyshomeostasis is an important cause of neurotoxicity in prion disorders, a group of neurodegenerative conditions associated with the conversion of prion protein (PrPC) from its normal conformation to an aggregated, PrP-scrapie (PrPSc) isoform. Alteration of iron homeostasis is believed to result from impaired function of PrPC in neuronal iron uptake via its ferrireductase activity. However, unequivocal evidence supporting the ferrireductase activity of PrPC is lacking. Kidney provides a relevant model for this evaluation because PrPC is expressed in the kidney, and ∼370 μg of iron are reabsorbed daily from the glomerular filtrate by kidney proximal tubule cells (PT), requiring ferrireductase activity. Here, we report that PrPC promotes the uptake of transferrin (Tf) and non-Tf-bound iron (NTBI) by the kidney in vivo and mainly NTBI by PT cells in vitro. Thus, uptake of 59Fe administered by gastric gavage, intravenously, or intraperitoneally was significantly lower in PrP-knock-out (PrP−/−) mouse kidney relative to PrP+/+ controls. Selective in vivo radiolabeling of plasma NTBI with 59Fe revealed similar results. Expression of exogenous PrPC in immortalized PT cells showed localization on the plasma membrane and intracellular vesicles and increased transepithelial transport of 59Fe-NTBI and to a smaller extent 59Fe-Tf from the apical to the basolateral domain. Notably, the ferrireductase-deficient mutant of PrP (PrPΔ51–89) lacked this activity. Furthermore, excess NTBI and hemin caused aggregation of PrPC to a detergent-insoluble form, limiting iron uptake. Together, these observations suggest that PrPC promotes retrieval of iron from the glomerular filtrate via its ferrireductase activity and modulates kidney iron metabolism. PMID:25572394
Strain-dependent profile of misfolded prion protein aggregates.
Morales, Rodrigo; Hu, Ping Ping; Duran-Aniotz, Claudia; Moda, Fabio; Diaz-Espinoza, Rodrigo; Chen, Baian; Bravo-Alegria, Javiera; Makarava, Natallia; Baskakov, Ilia V; Soto, Claudio
2016-02-15
Prions are composed of the misfolded prion protein (PrP(Sc)) organized in a variety of aggregates. An important question in the prion field has been to determine the identity of functional PrP(Sc) aggregates. In this study, we used equilibrium sedimentation in sucrose density gradients to separate PrP(Sc) aggregates from three hamster prion strains (Hyper, Drowsy, SSLOW) subjected to minimal manipulations. We show that PrP(Sc) aggregates distribute in a wide range of arrangements and the relative proportion of each species depends on the prion strain. We observed a direct correlation between the density of the predominant PrP(Sc) aggregates and the incubation periods for the strains studied. The relative presence of PrP(Sc) in fractions of different sucrose densities was indicative of the protein deposits present in the brain as analyzed by histology. Interestingly, no association was found between sensitivity to proteolytic degradation and aggregation profiles. Therefore, the organization of PrP molecules in terms of the density of aggregates generated may determine some of the particular strain properties, whereas others are independent from it. Our findings may contribute to understand the mechanisms of strain variation and the role of PrP(Sc) aggregates in prion-induced neurodegeneration.
Paquet, Sophie; Daude, Nathalie; Courageot, Marie-Pierre; Chapuis, Jérôme; Laude, Hubert; Vilette, Didier
2007-01-01
We have studied the interactions of exogenous prions with an epithelial cell line inducibly expressing PrPc protein and permissive to infection by a sheep scrapie agent. We demonstrate that abnormal PrP (PrPSc) and prion infectivity are efficiently internalized in Rov cells, whether or not PrPc is expressed. At odds with earlier studies implicating cellular heparan sulfates in PrPSc internalization, we failed to find any involvement of such molecules in Rov cells, indicating that prions can enter target cells by several routes. We further show that PrPSc taken up in the absence of PrPc was unable to promote efficient prion multiplication once PrPc expression was restored in the cells. This observation argues that interaction of PrPSc with PrPc has to occur early, in a specific subcellular compartment(s), and is consistent with the view that the first prion multiplication events may occur at the cell surface. PMID:17626095
Torres, Juan-María; Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSErelated disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profi les of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molec...
Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano
2017-01-01
Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.
Nyström, Sofie; Hammarström, Per
2015-05-11
Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.
Quinacrine reactivity with prion proteins and prion-derived peptides
Czech Academy of Sciences Publication Activity Database
Zawada, Zbigniew; Šafařík, Martin; Dvořáková, E.; Janoušková, O.; Březinová, Anna; Stibor, Ivan; Holada, K.; Bouř, Petr; Hlaváček, Jan; Šebestík, Jaroslav
2013-01-01
Roč. 44, č. 5 (2013), s. 1279-1292 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional support: RVO:61388963 Keywords : quinacrine * prion protein and peptide model reactions * solid phase and recombinant synthesis Subject RIV: CE - Biochemistry Impact factor: 3.653, year: 2013
Yeast prion architecture explains how proteins can be genes
Wickner, Reed
2013-03-01
Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452
Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L
2001-06-01
Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.
Wyckoff, A. Christy; Lockwood, Krista L.; Meyerett-Reid, Crystal; Michel, Brady A.; Bender, Heather; VerCauteren, Kurt C.; Zabel, Mark D.
2013-01-01
Prions, the infectious agent of scrapie, chronic wasting disease and other transmissible spongiform encephalopathies, are misfolded proteins that are highly stable and resistant to degradation. Prions are known to associate with clay and other soil components, enhancing their persistence and surprisingly, transmissibility. Currently, few detection and quantification methods exist for prions in soil, hindering an understanding of prion persistence and infectivity in the environment. Variability in apparent infectious titers of prions when bound to soil has complicated attempts to quantify the binding capacity of soil for prion infectivity. Here, we quantify the prion adsorption capacity of whole, sandy loam soil (SLS) typically found in CWD endemic areas in Colorado; and purified montmorillonite clay (Mte), previously shown to bind prions, by BioAssay of Subtracted Infectivity in Complex Solutions (BASICS). We incubated prion positive 10% brain homogenate from terminally sick mice infected with the Rocky Mountain Lab strain of mouse-adapted prions (RML) with 10% SLS or Mte. After 24 hours samples were centrifuged five minutes at 200×g and soil-free supernatant was intracerebrally inoculated into prion susceptible indicator mice. We used the number of days post inoculation to clinical disease to calculate the infectious titer remaining in the supernatant, which we subtracted from the starting titer to determine the infectious prion binding capacity of SLS and Mte. BASICS indicated SLS bound and removed ≥ 95% of infectivity. Mte bound and removed lethal doses (99.98%) of prions from inocula, effectively preventing disease in the mice. Our data reveal significant prion-binding capacity of soil and the utility of BASICS to estimate prion loads and investigate persistence and decomposition in the environment. Additionally, since Mte successfully rescued the mice from prion disease, Mte might be used for remediation and decontamination protocols. PMID:23484043
Protein A磁珠检测朊病毒方法的建立%The foundation of Protein A magnetism to detect Prion assay
Institute of Scientific and Technical Information of China (English)
李奇; 杨阳; 吕鹏; 宋博翠; 白宗瑞; 陈志宝
2009-01-01
建立Protein A磁珠法检测朊病毒,将朊病毒抗体IH2包被后的Protein A磁珠与蛋白酶K消化过的攻毒小鼠脑组织匀浆液混合,经免疫沉淀缓冲液温和洗脱杂蛋白,再经0.2 M甘氨酸将目的蛋白洗脱并且利用聚丙酰胺凝胶电泳检测.通过聚丙酰胺凝胶电泳检测出25 KD的目的蛋白带,经与正常未消化的朊蛋白条带相比较,证实检测出朊病毒.Protein A磁珠具有高效特异的与抗体IgG结合的特点,与多克隆抗体混合后可有效结合IgG.该方法较免疫组织化学和Western-blot技术简便快速,且磁珠可以回收再使用,使成本低廉.%Objective The country need the fast and effective detection for Prion asthe high risk country where Scrapie and BSE may bresk out. The common assay of Western-Blot and Immunohistochemistry consume a long time and the associated experience is needed. Protein A magnetism has the feature of binding IgG differential.h could bind the IgG adequately,when mixing with polyclonal antibody.After intermixing with brain tissue protein digested by protein kinase, Prion could easily elute from Protein A magnetism.Interest protein band is 25KD through SDS-PAGE. When definiting the molecular weight of Priori,the result of detection is educed by SDS-PAGE electrophoresis. The assay is more handier and faster than common assay. The magnetism can reclaim and reuse,which reduce the cost.The assay of detection is a innovation and many branches could generally applicated it.
Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.
2010-01-01
Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)
Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B
2012-02-28
Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.
Lions and prions and deer demise.
Directory of Open Access Journals (Sweden)
Michael W Miller
Full Text Available BACKGROUND: Contagious prion diseases--scrapie of sheep and chronic wasting disease of several species in the deer family--give rise to epidemics that seem capable of compromising host population viability. Despite this prospect, the ecological consequences of prion disease epidemics in natural populations have received little consideration. METHODOLOGY/PRINCIPAL FINDINGS: Using a cohort study design, we found that prion infection dramatically lowered survival of free-ranging adult (>2-year-old mule deer (Odocoileus hemionus: estimated average life expectancy was 5.2 additional years for uninfected deer but only 1.6 additional years for infected deer. Prion infection also increased nearly fourfold the rate of mountain lions (Puma concolor preying on deer, suggesting that epidemics may alter predator-prey dynamics by facilitating hunting success. Despite selective predation, about one fourth of the adult deer we sampled were infected. High prevalence and low survival of infected deer provided a plausible explanation for the marked decline in this deer population since the 1980s. CONCLUSION: Remarkably high infection rates sustained in the face of intense predation show that even seemingly complete ecosystems may offer little resistance to the spread and persistence of contagious prion diseases. Moreover, the depression of infected populations may lead to local imbalances in food webs and nutrient cycling in ecosystems in which deer are important herbivores.
Do prion protein gene polymorphisms induce apoptosis in non ...
Indian Academy of Sciences (India)
2016-08-26
Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...
Classifying prion and prion-like phenomena.
Harbi, Djamel; Harrison, Paul M
2014-01-01
The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.
The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease
King, Oliver D.; Gitler, Aaron D.; Shorter, James
2012-01-01
Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the
Probing Early Misfolding Events in Prion Protein Mutants by NMR Spectroscopy
Directory of Open Access Journals (Sweden)
Gregor Ilc
2013-08-01
Full Text Available The post-translational conversion of the ubiquitously expressed cellular form of the prion protein, PrPC, into its misfolded and pathogenic isoform, known as prion or PrPSc, plays a key role in prion diseases. These maladies are denoted transmissible spongiform encephalopathies (TSEs and affect both humans and animals. A prerequisite for understanding TSEs is unraveling the molecular mechanism leading to the conversion process whereby most α-helical motifs are replaced by β-sheet secondary structures. Importantly, most point mutations linked to inherited prion diseases are clustered in the C-terminal domain region of PrPC and cause spontaneous conversion to PrPSc. Structural studies with PrP variants promise new clues regarding the proposed conversion mechanism and may help identify “hot spots” in PrPC involved in the pathogenic conversion. These investigations may also shed light on the early structural rearrangements occurring in some PrPC epitopes thought to be involved in modulating prion susceptibility. Here we present a detailed overview of our solution-state NMR studies on human prion protein carrying different pathological point mutations and the implications that such findings may have for the future of prion research.
Prion protein induced signaling cascades in monocytes
International Nuclear Information System (INIS)
Krebs, Bjarne; Dorner-Ciossek, Cornelia; Schmalzbauer, Ruediger; Vassallo, Neville; Herms, Jochen; Kretzschmar, Hans A.
2006-01-01
Prion proteins play a central role in transmission and pathogenesis of transmissible spongiform encephalopathies. The cellular prion protein (PrP C ), whose physiological function remains elusive, is anchored to the surface of a variety of cell types including neurons and cells of the lymphoreticular system. In this study, we investigated the response of a mouse monocyte/macrophage cell line to exposure with PrP C fusion proteins synthesized with a human Fc-tag. PrP C fusion proteins showed an attachment to the surface of monocyte/macrophages in nanomolar concentrations. This was accompanied by an increase of cellular tyrosine phosphorylation as a result of activated signaling pathways. Detailed investigations exhibited activation of downstream pathways through a stimulation with PrP fusion proteins, which include phosphorylation of ERK 1,2 and Akt kinase. Macrophages opsonize and present antigenic structures, contact lymphocytes, and deliver cytokines. The findings reported here may become the basis of understanding the molecular function of PrP C in monocytes and macrophages
Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg; Kretzschmar, Hans; Westaway, David
2017-01-01
Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1-4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain.
Prion search and cellular prion protein expression in stranded dolphins.
Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C
2012-01-01
The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.
Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F
2018-03-15
The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2013-01-01
Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Directory of Open Access Journals (Sweden)
Emmanuel A Asante
Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Directory of Open Access Journals (Sweden)
Di Bari Michele A
2011-08-01
Full Text Available Abstract Objective Cholesterol changes have been described in prion-cell models and in experimental rodent scrapie; yet, the pattern of this association is still controversial. Methods To shed light on the matter, we analysed and compared cholesterol variations in ScN2a cells and in brains of Scrapie-infected C57Bl/6 mice, using two different methods: a fluorimetric-enzymatic cholesterol assay, and high performance liquid chromatography-mass spectroscopy (HPLC-MS. Results Compared to uninfected controls, similar cholesterol metabolism anomalies were observed in infected cells and brains by both methods; however, only HPLC-MS revealed statistically significant cholesterol variations, particularly in the cholesteryl esters (CE fraction. HPLC-MS analyses also revealed different fatty acid composition of the CE fraction in cells and brains. In N2a cells, their profile reflected that of serum, while in normal brains cholesteryl-linoleate only was found at detectable levels. Following prion infection, most CE species were increased in the CE pool of ScN2a cells, whereas a conspicuous amount of cholesteryl-arachidonate only was found to contribute to the cerebral increase of CE. Of interest, oral pravastatin administration to Scrapie-infected mice, was associated with a significant reduction of cerebral free cholesterol (FC along with a concomitant further increase of the CE pool, which included increased amounts of both cholesteryl-linoleate and cholesteryl-arachidonate. Conclusion Although mechanistic studies are needed to establish the pathophysiological relevance of changes in cerebral CE concentrations, to the best of our knowledge this is the first report to provide evidence of increased cholesterol esterification in brains of prion-infected mice, untreated and treated with pravastatin.
Prions, prion-like prionoids, and neurodegenerative disordersVacancy
Directory of Open Access Journals (Sweden)
Ashok Verma
2016-01-01
Full Text Available Prion diseases or transmissible spongiform encephalopathies are fatal neurodegenerative diseases characterized by the aggregation and deposition of the misfolded prion protein in the brain. α-synuclein (α-syn-associated multiple system atrophy has been recently shown to be caused by a bona fide α-syn prion strain. Several other misfolded native proteins such as β-amyloid, tau and TDP-43 share some aspects of prions although none of them is shown to be transmissible in nature or in experimental animals. However, these prion-like “prionoids” are causal to a variety of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. The remarkable recent discovery of at least two new α-syn prion strains and their transmissibility in transgenic mice and in vitro cell models raises a distinct question as to whether some specific strain of other prionoids could have the capability of disease transmission in a manner similar to prions. In this overview, we briefly describe human and other mammalian prion diseases and comment on certain similarities between prion and prionoid and the possibility of prion-like transmissibility of some prionoid strains.
Prion Protein-specific antibodies that detect multiple TSE Agents with high sensitivity
McCutcheon, S.; Langeveld, J.P.M.; Tan, B.C.; Gill, A.C.; Wolf, de C.A.; Martin, S.; Gonzalez, L.; Alibhai, J.; Alejo Blanco, A.R.; Campbell, L.; Hunter, N.; Houston, E.F.
2014-01-01
This paper describes the generation, characterisation and potential applications of a panel of novel anti-prion protein monoclonal antibodies (mAbs). The mAbs were generated by immunising PRNP null mice, using a variety of regimes, with a truncated form of recombinant ovine prion protein spanning
PrP Knockout Cells Expressing Transmembrane PrP Resist Prion Infection.
Marshall, Karen E; Hughson, Andrew; Vascellari, Sarah; Priola, Suzette A; Sakudo, Akikazu; Onodera, Takashi; Baron, Gerald S
2017-01-15
Glycosylphosphatidylinositol (GPI) anchoring of the prion protein (PrP C ) influences PrP C misfolding into the disease-associated isoform, PrP res , as well as prion propagation and infectivity. GPI proteins are found in cholesterol- and sphingolipid-rich membrane regions called rafts. Exchanging the GPI anchor for a nonraft transmembrane sequence redirects PrP C away from rafts. Previous studies showed that nonraft transmembrane PrP C variants resist conversion to PrP res when transfected into scrapie-infected N2a neuroblastoma cells, likely due to segregation of transmembrane PrP C and GPI-anchored PrP res in distinct membrane environments. Thus, it remained unclear whether transmembrane PrP C might convert to PrP res if seeded by an exogenous source of PrP res not associated with host cell rafts and without the potential influence of endogenous expression of GPI-anchored PrP C To further explore these questions, constructs containing either a C-terminal wild-type GPI anchor signal sequence or a nonraft transmembrane sequence containing a flexible linker were expressed in a cell line derived from PrP knockout hippocampal neurons, NpL2. NpL2 cells have physiological similarities to primary neurons, representing a novel and advantageous model for studying transmissible spongiform encephalopathy (TSE) infection. Cells were infected with inocula from multiple prion strains and in different biochemical states (i.e., membrane bound as in brain microsomes from wild-type mice or purified GPI-anchorless amyloid fibrils). Only GPI-anchored PrP C supported persistent PrP res propagation. Our data provide strong evidence that in cell culture GPI anchor-directed membrane association of PrP C is required for persistent PrP res propagation, implicating raft microdomains as a location for conversion. Mechanisms of prion propagation, and what makes them transmissible, are poorly understood. Glycosylphosphatidylinositol (GPI) membrane anchoring of the prion protein (PrP C
The Prion Concept and Synthetic Prions.
Legname, Giuseppe; Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.
PrionScan: an online database of predicted prion domains in complete proteomes.
Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier
2014-02-05
Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists
Directory of Open Access Journals (Sweden)
Laura McCulloch
2011-12-01
Full Text Available Prion diseases are characterised by the accumulation of PrP(Sc, an abnormally folded isoform of the cellular prion protein (PrP(C, in affected tissues. Following peripheral exposure high levels of prion-specific PrP(Sc accumulate first upon follicular dendritic cells (FDC in lymphoid tissues before spreading to the CNS. Expression of PrP(C is mandatory for cells to sustain prion infection and FDC appear to express high levels. However, whether FDC actively replicate prions or simply acquire them from other infected cells is uncertain. In the attempts to-date to establish the role of FDC in prion pathogenesis it was not possible to dissociate the Prnp expression of FDC from that of the nervous system and all other non-haematopoietic lineages. This is important as FDC may simply acquire prions after synthesis by other infected cells. To establish the role of FDC in prion pathogenesis transgenic mice were created in which PrP(C expression was specifically "switched on" or "off" only on FDC. We show that PrP(C-expression only on FDC is sufficient to sustain prion replication in the spleen. Furthermore, prion replication is blocked in the spleen when PrP(C-expression is specifically ablated only on FDC. These data definitively demonstrate that FDC are the essential sites of prion replication in lymphoid tissues. The demonstration that Prnp-ablation only on FDC blocked splenic prion accumulation without apparent consequences for FDC status represents a novel opportunity to prevent neuroinvasion by modulation of PrP(C expression on FDC.
Humic substances interfere with detection of pathogenic prion protein
Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.
2014-01-01
Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.
Differentially expressed genes in iron-induced prion protein conversion
International Nuclear Information System (INIS)
Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong
2016-01-01
The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.
Prions: Protein Rebels with a Cause!
Marshall, Karen E.; Serpell, Louise C.
2017-01-01
Traditionally we consider infection to arise from viruses, bacteria and parasites. Prions are infectious proteins without any nucleic acids, and therefore do not represent living things. Despite this, they have the ability to replicate themselves and cause diseases such as mad cow disease (bovine spongiform encepthalopathy) and human…
Low copper and high manganese levels in prion protein plaques
Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie
2013-01-01
Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.
Prion-Like Domains in Phagobiota
Directory of Open Access Journals (Sweden)
George Tetz
2017-11-01
Full Text Available Prions are molecules characterized by self-propagation, which can undergo a conformational switch leading to the creation of new prions. Prion proteins have originally been associated with the development of mammalian pathologies; however, recently they have been shown to contribute to the environmental adaptation in a variety of prokaryotic and eukaryotic organisms. Bacteriophages are widespread and represent the important regulators of microbiota homeostasis and have been shown to be diverse across various bacterial families. Here, we examined whether bacteriophages contain prion-like proteins and whether these prion-like protein domains are involved in the regulation of homeostasis. We used a computational algorithm, prion-like amino acid composition, to detect prion-like domains in 370,617 publicly available bacteriophage protein sequences, which resulted in the identification of 5040 putative prions. We analyzed a set of these prion-like proteins, and observed regularities in their distribution across different phage families, associated with their interactions with the bacterial host cells. We found that prion-like domains could be found across all phages of various groups of bacteria and archaea. The results obtained in this study indicate that bacteriophage prion-like proteins are predominantly involved in the interactions between bacteriophages and bacterial cell, such as those associated with the attachment and penetration of bacteriophage in the cell, and the release of the phage progeny. These data allow the identification of phage prion-like proteins as novel regulators of the interactions between bacteriophages and bacterial cells.
Hwang, Soyoun; Greenlee, Justin J; Nicholson, Eric M
2017-01-01
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from the normal cellular prion protein to the pathogenic misfolded conformation (PrPSc). This conversion has been used for in vitro assays including serial protein misfolding amplification and real-time quaking induced conversion (RT-QuIC). RT-QuIC can be used for the detection of prions in a variety of biological tissues from humans and animals. Extensive work has been done to demonstrate that RT-QuIC is a rapid, specific, and highly sensitive prion detection assay. RT-QuIC uses recombinant prion protein to detect minute amounts of PrPSc. RT-QuIC has been successfully used to detect PrPSc from different prion diseases with a variety of substrates including hamster, human, sheep, bank vole, bovine and chimeric forms of prion protein. However, recombinant bovine prion protein has not been used to detect transmissible mink encephalopathy (TME) or to differentiate types of bovine spongiform encephalopathy (BSE) in samples from cattle. We evaluated whether PrPSc from TME and BSE infected cattle can be detected with RT-QuIC using recombinant bovine prion proteins, and optimized the reaction conditions to specifically detect cattle TME and to discriminate between classical and atypical BSE by conversion efficiency. We also found that substrate composed of the disease associated E211K mutant protein can be effective for the detection of TME in cattle and that wild type prion protein appears to be a practical substrate to discriminate between the different types of BSEs.
The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion
Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe
2015-10-01
The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.
Bezdíčka, Martin
2013-01-01
The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...
Glycosaminoglycan sulphation affects the seeded misfolding of a mutant prion protein.
Directory of Open Access Journals (Sweden)
Victoria A Lawson
Full Text Available BACKGROUND: The accumulation of protease resistant conformers of the prion protein (PrP(res is a key pathological feature of prion diseases. Polyanions, including RNA and glycosaminoglycans have been identified as factors that contribute to the propagation, transmission and pathogenesis of prion disease. Recent studies have suggested that the contribution of these cofactors to prion propagation may be species specific. METHODOLOGY/PRINCIPAL FINDING: In this study a cell-free assay was used to investigate the molecular basis of polyanion stimulated PrP(res formation using brain tissue or cell line derived murine PrP. Enzymatic depletion of endogenous nucleic acids or heparan sulphate (HS from the PrP(C substrate was found to specifically prevent PrP(res formation seeded by mouse derived PrP(Sc. Modification of the negative charge afforded by the sulphation of glycosaminoglycans increased the ability of a familial PrP mutant to act as a substrate for PrP(res formation, while having no effect on PrP(res formed by wildtype PrP. This difference may be due to the observed differences in the binding of wild type and mutant PrP for glycosaminoglycans. CONCLUSIONS/SIGNIFICANCE: Cofactor requirements for PrP(res formation are host species and prion strain specific and affected by disease associated mutations of the prion protein. This may explain both species and strain dependent propagation characteristics and provide insights into the underlying mechanisms of familial prion disease. It further highlights the challenge of designing effective therapeutics against a disease which effects a range of mammalian species, caused by range of aetiologies and prion strains.
Prions and animal transmissible spongiform encephalopathies
Directory of Open Access Journals (Sweden)
Juntes Polona
2017-01-01
Full Text Available Background. Transmissible spongiform encephalopathies (TSEs or prion diseases are a unique group of neurodegenerative diseases of animals and humans, which always have a fatal outcome and are transmissible among animals of the same or different species. Scope and Approach. The aim of this work is to review some recent data about animal TSEs, with the emphasis on their causative agents and zoonotic potential, and to discuss why the surveillance and control measures over animal TSEs should remain in force. Key Findings and Conclusions. We still have incomplete knowledge of prions and prion diseases. Scrapie has been present for a very long time and controlled with varied success. Bovine spongiform encephalopathy (BSE emerged unnoticed, and spread within a few years to epidemic proportions, entailing enormous economic consequences and public concerns. Currently, the classical BSE epidemic is under control, but atypical cases do, and probably will, persist in bovine populations. The Chronic Wasting Disease (CWD of the cervids has been spreading in North America and has recently been detected in Europe. Preventive measures for the control of classical BSE remain in force, including the feed ban and removal of specified risk materials. However, active BSE surveillance has considerably decreased. In the absence of such preventive and control measures, atypical BSE cases in healthy slaughtered bovines might persist in the human food chain, and BSE prions might resurface. Moreover, other prion strains might emerge and spread undetected if the appropriate preventive and surveillance measures were to cease, leaving behind inestimable consequences.
Yuan, Qi; Eckland, Thomas; Telling, Glenn; Bartz, Jason; Bartelt-Hunt, Shannon
2015-01-01
Prions enter the environment from infected hosts, bind to a wide range of soil and soil minerals, and remain highly infectious. Environmental sources of prions almost certainly contribute to the transmission of chronic wasting disease in cervids and scrapie in sheep and goats. While much is known about the introduction of prions into the environment and their interaction with soil, relatively little is known about prion degradation and inactivation by natural environmental processes. In this study, we examined the effect of repeated cycles of drying and wetting on prion fitness and determined that 10 cycles of repeated drying and wetting could reduce PrPSc abundance, PMCA amplification efficiency and extend the incubation period of disease. Importantly, prions bound to soil were more susceptible to inactivation by repeated cycles of drying and wetting compared to unbound prions, a result which may be due to conformational changes in soil-bound PrPSc or consolidation of the bonding between PrPSc and soil. This novel finding demonstrates that naturally-occurring environmental process can degrade prions. PMID:25665187
Meade-White, K.; Race, B.; Trifilo, M.; Bossers, A.; Favara, C.; Lacasse, R.; Miller, M.; Williams, E.; Oldstone, M.; Race, R.; Chesebro, B.
2007-01-01
Prion protein (PrP) is a required factor for susceptibility to transmissible spongiform encephalopathy or prion diseases. In transgenic mice, expression of prion protein (PrP) from another species often confers susceptibility to prion disease from that donor species. For example, expression of deer
Cali, Ignazio; Miller, Cathleen J; Parisi, Joseph E; Geschwind, Michael D; Gambetti, Pierluigi; Schonberger, Lawrence B
2015-06-25
The present study compares the clinical, pathological and molecular features of a United States (US) case of growth hormone (GH)-associated Creutzfeldt-Jakob disease (GH-CJD) (index case) to those of two earlier referred US cases of GH-CJD and one case of dura mater (d)-associated CJD (dCJD). All iatrogenic CJD (iCJD) subjects were methionine (M) homozygous at codon 129 (129MM) of the prion protein (PrP) gene and had scrapie prion protein (PrP(Sc)) type 1 (iCJDMM1). The index subject presented with ataxia, weight loss and changes in the sleep pattern about 38 years after the midpoint of GH treatment. Autopsy examination revealed a neuropathological phenotype reminiscent of both sCJDMV2-K (a sporadic CJD subtype in subjects methionine/valine heterozygous at codon 129 with PrP(Sc) type 2 and the presence of kuru plaques) and variant CJD (vCJD). The two earlier cases of GH-CJDMM1 and the one of dCJDMM1 were associated with neuropathological phenotypes that differed from that of the index case mainly because they lacked PrP plaques. The phenotype of the earlier GH-CJDMM1 cases shared several, but not all, characteristics with sCJDMM1, whereas dCJDMM1 was phenotypically indistinguishable from sCJDMM1. Two distinct groups of dCJDMM1 have also been described in Japan based on clinical features, the presence or absence of PrP plaques and distinct PK-resistant PrP(Sc) (resPrP(Sc)) electrophoretic mobilities. The resPrP(Sc) electrophoretic mobility was, however, identical in our GH-CJDMM1 and dCJDMM1 cases, and matched that of sCJDMM1. Our study shows that receipt of prion-contaminated GH can lead to a prion disease with molecular features (129MM and PrP(Sc) type 2) and phenotypic characteristics that differ from those of sporadic prion disease (sCJDMM1), a difference that may reflect adaptation of "heterologous" prion strains to the 129MM background.
Directory of Open Access Journals (Sweden)
Diego La Mendola
2014-05-01
Full Text Available Prion disorders are a group of fatal neurodegenerative conditions of mammals. The key molecular event in the pathogenesis of such diseases is the conformational conversion of prion protein, PrPC, into a misfolded form rich in β-sheet structure, PrPSc, but the detailed mechanistic aspects of prion protein conversion remain enigmatic. There is uncertainty on the precise physiological function of PrPC in healthy individuals. Several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ mainly through a domain composed by four to five repeats of eight amino acids. In addition to mammals, PrP homologues have also been identified in birds, reptiles, amphibians and fish. The globular domain of protein is retained in the different species, suggesting that the protein carries out an essential common function. However, the comparison of amino acid sequences indicates that prion protein has evolved differently in each vertebrate class. The primary sequences are strongly conserved in each group, but these exhibit a low similarity with those of mammals. The N-terminal domain of different prions shows tandem amino acid repeats with an increasing amount of histidine residues going from amphibians to mammals. The difference in the sequence affects the number of copper binding sites, the affinity and the coordination environment of metal ions, suggesting that the involvement of prion in metal homeostasis may be a specific characteristic of mammalian prion protein. In this review, we describe the similarities and the differences in the metal binding of different species’ prion protein, as revealed by studies carried out on the entire protein and related peptide fragments.
Accelerated high fidelity prion amplification within and across prion species barriers.
Directory of Open Access Journals (Sweden)
Kristi M Green
2008-08-01
Full Text Available Experimental obstacles have impeded our ability to study prion transmission within and, more particularly, between species. Here, we used cervid prion protein expressed in brain extracts of transgenic mice, referred to as Tg(CerPrP, as a substrate for in vitro generation of chronic wasting disease (CWD prions by protein misfolding cyclic amplification (PMCA. Characterization of this infectivity in Tg(CerPrP mice demonstrated that serial PMCA resulted in the high fidelity amplification of CWD prions with apparently unaltered properties. Using similar methods to amplify mouse RML prions and characterize the resulting novel cervid prions, we show that serial PMCA abrogated a transmission barrier that required several hundred days of adaptation and subsequent stabilization in Tg(CerPrP mice. While both approaches produced cervid prions with characteristics distinct from CWD, the subtly different properties of the resulting individual prion isolates indicated that adaptation of mouse RML prions generated multiple strains following inter-species transmission. Our studies demonstrate that combined transgenic mouse and PMCA approaches not only expedite intra- and inter-species prion transmission, but also provide a facile means of generating and characterizing novel prion strains.
Detection of type 1 prion protein in variant Creutzfeldt-Jakob disease
Yull, H.M.; Ritchie, D.L.; Langeveld, J.P.M.; Zijderveld, van F.G.; Bruce, M.E.; Ironside, J.W.; Head, M.W.
2006-01-01
Molecular typing of the abnormal form of the prion protein (PrPSc) has come to be regarded as a powerful tool in the investigation of the prion diseases. All evidence thus far presented indicates a single PrPSc molecular type in variant Creutzfeldt-Jakob disease (termed type 2B), presumably
Rapid and discriminatory diagnosis of scrapie and BSE in retro-pharyngeal lymph nodes of sheep
Directory of Open Access Journals (Sweden)
van Zijderveld Fred G
2006-06-01
Full Text Available Abstract Background Diagnosis based on prion detection in lymph nodes of sheep and goats can improve active surveillance for scrapie and, if it were circulating, for bovine spongiform encephalopathy (BSE. With sizes that allow repetitive testing and a location that is easily accessible at slaughter, retropharyngeal lymph nodes (RLN are considered suitable organs for testing. Western blotting (WB of brain homogenates is, in principle, a technique well suited to both detect and discriminate between scrapie and BSE. In this report, WB is developed for rapid diagnosis in RLN and to study biochemical characteristics of PrPres. Results Optimal PrPres detection in RLN by WB was achieved by proper tissue processing, antibody choice and inclusion of a step for PrPresconcentration. The analyses were performed on three different sheep sources. Firstly, in a study with preclinical scrapie cases, WB of RLN from infected sheep of VRQ/VRQ genotype – VRQ represents, respectively, polymorphic PrP amino acids 136, 154, and 171 – allowed a diagnosis 14 mo earlier compared to WB of brain stem. Secondly, samples collected from sheep with confirmed scrapie in the course of passive and active surveillance programmes in the period 2002–2003 yielded positive results depending on genotype: all sheep with genotypes ARH/VRQ, VRQ/VRQ, and ARQ/VRQ scored positive for PrPres, but ARQ/ARQ and ARR/VRQ were not all positive. Thirdly, in an experimental BSE study, detection of PrPres in all 11 ARQ/ARQ sheep, including 7 preclinical cases, was possible. In all instances, WB and IHC were almost as sensitive. Moreover, BSE infection could be discriminated from scrapie infection by faster electrophoretic migration of the PrPres bands. Using dual antibody staining with selected monoclonal antibodies like 12B2 and L42, these differences in migration could be employed for an unequivocal differentiation between BSE and scrapie. With respect to glycosylation of PrPres, BSE cases
Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.
Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E
2016-01-01
Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.
Fast, C; Goldmann, W; Berthon, P; Tauscher, K; Andréoletti, O; Lantier, I; Rossignol, C; Bossers, A; Jacobs, J G; Hunter, N; Groschup, M H; Lantier, F; Langeveld, J P M
2017-09-19
Breeding towards genetic resistance to prion disease is effective in eliminating scrapie. In sheep, classical forms of scrapie have been eradicated almost completely in several countries by breeding programs using a prion protein (PrP) gene (PRNP) amino acid polymorphism. For goats, field and experimental studies have provided evidence for several amino acid polymorphisms that are associated with resistance to scrapie, but only limited data are available concerning the susceptibility of caprine PRNP genotypes to BSE. In this study, goat kids representing five PRNP genotypes based on three polymorphisms (M142, Q211 and K222 and the wild type I142, R211 and Q222) were orally challenged with bovine or goat BSE. Wild type goats were killed with clinical signs between 24-28 months post inoculation (mpi) to both challenges, and goats with genotype R/Q211 succumbed between 29-36 mpi. I/M142 goats developed clinical signs at 44-45 mpi and M/M142 goats remained healthy until euthanasia at 48 mpi. None of the Q/K222 goats showed definite clinical signs. Taken together the highest attack ratios were seen in wild type and R/Q211 goats, and the lowest in I/M142, M/M142 and Q/K222. In all genotype groups, one or more goats remained healthy within the incubation period in both challenges and without detectable PrP deposition in the tissues. Our data show that both the K222 and M142 polymorphisms lengthen the incubation period significantly compared to wild type animals, but only K222 was associated with a significant increase in resistance to BSE infection after oral exposure to both BSE sources.
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2014-01-01
A model of protein folding kinetics is applied to study the combined effects of protein flexibility and macromolecular crowding on protein folding rate and stability. It is found that the increase in stability and folding rate promoted by macromolecular crowding is damped for proteins with highly flexible native structures. The model is applied to the folding dynamics of the murine prion protein (121-231). It is found that the high flexibility of the native isoform of the murine prion protein (121-231) reduces the effects of macromolecular crowding on its folding dynamics. The relevance of these findings for the pathogenic mechanism are discussed.
Directory of Open Access Journals (Sweden)
Zi Yang
Full Text Available Prions are self-propagating conformations of proteins that can cause heritable phenotypic traits. Most yeast prions contain glutamine (Q/asparagine (N-rich domains that facilitate the accumulation of the protein into amyloid-like aggregates. Efficient transmission of these infectious aggregates to daughter cells requires that chaperones, including Hsp104 and Sis1, continually sever the aggregates into smaller "seeds." We previously identified 11 proteins with Q/N-rich domains that, when overproduced, facilitate the de novo aggregation of the Sup35 protein into the [PSI(+] prion state. Here, we show that overexpression of many of the same 11 Q/N-rich proteins can also destabilize pre-existing [PSI(+] or [URE3] prions. We explore in detail the events leading to the loss (curing of [PSI(+] by the overexpression of one of these proteins, the Q/N-rich domain of Pin4, which causes Sup35 aggregates to increase in size and decrease in transmissibility to daughter cells. We show that the Pin4 Q/N-rich domain sequesters Hsp104 and Sis1 chaperones away from the diffuse cytoplasmic pool. Thus, a mechanism by which heterologous Q/N-rich proteins impair prion propagation appears to be the loss of cytoplasmic Hsp104 and Sis1 available to sever [PSI(+].
Persistence of pathogenic prion protein during simulated wastewater treatment processes
Hinckley, G.T.; Johnson, C.J.; Jacobson, K.H.; Bartholomay, C.; Mcmahon, K.D.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2008-01-01
Transmissible spongiform encephalopathies (TSEs, prion diseases) are a class of fatal neurodegenerative diseases affecting a variety of mammalian species including humans. A misfolded form of the prion protein (PrP TSE) is the major, if not sole, component of the infectious agent. Prions are highly resistant to degradation and to many disinfection procedures suggesting that, if prions enter wastewater treatment systems through sewers and/or septic systems (e.g., from slaughterhouses, necropsy laboratories, rural meat processors, private game dressing) or through leachate from landfills that have received TSE-contaminated material, prions could survive conventional wastewater treatment Here, we report the results of experiments examining the partitioning and persistence of PrPTSE during simulated wastewater treatment processes including activated and mesophilic anaerobic sludge digestion. Incubation with activated sludge did not result in significant PrPTSE degradation. PrPTSE and prion infectivity partitioned strongly to activated sludge solids and are expected to enter biosolids treatment processes. A large fraction of PrPTSE survived simulated mesophilic anaerobic sludge digestion. The small reduction in recoverable PrPTSE after 20-d anaerobic sludge digestion appeared attributable to a combination of declining extractability with time and microbial degradation. Our results suggest that if prions were to enter municipal wastewater treatment systems, most would partition to activated sludge solids, survive mesophilic anaerobic digestion, and be present in treated biosolids. ?? 2008 American Chemical Society.
LRP1 controls biosynthetic and endocytic trafficking of neuronal prion protein
DEFF Research Database (Denmark)
Parkyn, Celia J; Vermeulen, Esmeralda G M; Mootoosamy, Roy C
2008-01-01
The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly and consti......The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly...... required for this process. Moreover, sustained inhibition of LRP1 levels by siRNA leads to the accumulation of PrP(C) in biosynthetic compartments, with a concomitant lowering of surface PrP(C), suggesting that LRP1 expedites the trafficking of PrP(C) to the neuronal surface. PrP(C) and LRP1 can be co......-immunoprecipitated from the endoplasmic reticulum in normal neurons. The N-terminal domain of PrP(C) binds to purified human LRP1 with nanomolar affinity, even in the presence of 1 microM of the LRP-specific chaperone, receptor-associated protein (RAP). Taken together, these data argue that LRP1 controls both the surface...
Kabani, Mehdi; Melki, Ronald
2011-01-01
Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.
DEFF Research Database (Denmark)
Jen, Angela; Parkyn, Celia J; Mootoosamy, Roy C
2010-01-01
For infectious prion protein (designated PrP(Sc)) to act as a template to convert normal cellular protein (PrP(C)) to its distinctive pathogenic conformation, the two forms of prion protein (PrP) must interact closely. The neuronal receptor that rapidly endocytoses PrP(C) is the low......-density lipoprotein receptor-related protein 1 (LRP1). We show here that on sensory neurons LRP1 is also the receptor that binds and rapidly endocytoses smaller oligomeric forms of infectious prion fibrils, and recombinant PrP fibrils. Although LRP1 binds two molecules of most ligands independently to its receptor...... both prion and LRP1 biology....
The complexity and implications of yeast prion domains
2011-01-01
Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731
Amyloid cores in prion domains: Key regulators for prion conformational conversion.
Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador
2017-01-02
Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.
Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein
Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi
2011-01-01
Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009
Human prion diseases: surgical lessons learned from iatrogenic prion transmission.
Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio
2016-07-01
The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission
Bate, Clive; Nolan, William; Williams, Alun
2016-01-01
The prion diseases occur following the conversion of the cellular prion protein (PrP(C)) into disease-related isoforms (PrP(Sc)). In this study, the role of the glycosylphosphatidylinositol (GPI) anchor attached to PrP(C) in prion formation was examined using a cell painting technique. PrP(Sc) formation in two prion-infected neuronal cell lines (ScGT1 and ScN2a cells) and in scrapie-infected primary cortical neurons was increased following the introduction of PrP(C). In contrast, PrP(C) containing a GPI anchor from which the sialic acid had been removed (desialylated PrP(C)) was not converted to PrP(Sc). Furthermore, the presence of desialylated PrP(C) inhibited the production of PrP(Sc) within prion-infected cortical neurons and ScGT1 and ScN2a cells. The membrane rafts surrounding desialylated PrP(C) contained greater amounts of sialylated gangliosides and cholesterol than membrane rafts surrounding PrP(C). Desialylated PrP(C) was less sensitive to cholesterol depletion than PrP(C) and was not released from cells by treatment with glimepiride. The presence of desialylated PrP(C) in neurons caused the dissociation of cytoplasmic phospholipase A2 from PrP-containing membrane rafts and reduced the activation of cytoplasmic phospholipase A2. These findings show that the sialic acid moiety of the GPI attached to PrP(C) modifies local membrane microenvironments that are important in PrP-mediated cell signaling and PrP(Sc) formation. These results suggest that pharmacological modification of GPI glycosylation might constitute a novel therapeutic approach to prion diseases. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Pathogenic prion protein is degraded by a manganese oxide mineral found in soils
Russo, F.; Johnson, C.J.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2009-01-01
Prions, the aetiological agents of transmissible spongiform encephalopathies, exhibit extreme resistance to degradation. Soil can retain prion infectivity in the environment for years. Reactive soil components may, however, contribute to the inactivation of prions in soil. Members of the birnessite family of manganese oxides (MnO2) rank among the strongest natural oxidants in soils. Here, we report the abiotic degradation of pathogenic prion protein (PrPTSE) by a synthetic analogue of naturally occurring birnessite minerals. Aqueous MnO2 suspensions degraded the PrPTSE as evidenced by decreased immunoreactivity and diminished ability to seed protein misfolding cyclic amplification reactions. Birnessite-mediated PrPTSE degradation increased as a solution's pH decreased, consistent with the pH-dependence of the redox potential of MnO2. Exposure to 5.6 mg MnO2 ml-1 (PrPTSE:MnO2=1 : 110) decreased PrPTSE levels by ???4 orders of magnitude. Manganese oxides may contribute to prion degradation in soil environments rich in these minerals. ?? 2009 SGM.
Du, Zhiqiang; Valtierra, Stephanie; Li, Liming
2014-01-01
The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.
Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc
2002-04-19
All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from normal cellular prion protein to pathogenic misfolded conformation. This conversion has been used for in vitro assays including serial protein misfolding amplification...
Directory of Open Access Journals (Sweden)
Gourdain Pauline
2012-01-01
Full Text Available Abstract Background The cellular prion protein (PrPc is a host-encoded glycoprotein whose transconformation into PrP scrapie (PrPSc initiates prion diseases. The role of PrPc in health is still obscure, but many candidate functions have been attributed to the protein, both in the immune and the nervous systems. Recent data show that experimental autoimmune encephalomyelitis (EAE is worsened in mice lacking PrPc. Disease exacerbation has been attributed to T cells that would differentiate into more aggressive effectors when deprived of PrPc. However, alternative interpretations such as reduced resistance of neurons to autoimmune insult and exacerbated gliosis leading to neuronal deficits were not considered. Method To better discriminate the contribution of immune cells versus neural cells, reciprocal bone marrow chimeras with differential expression of PrPc in the lymphoid or in the central nervous system (CNS were generated. Mice were subsequently challenged with MOG35-55 peptide and clinical disease as well as histopathology were compared in both groups. Furthermore, to test directly the T cell hypothesis, we compared the encephalitogenicity of adoptively transferred PrPc-deficient versus PrPc-sufficient, anti-MOG T cells. Results First, EAE exacerbation in PrPc-deficient mice was confirmed. Irradiation exacerbated EAE in all the chimeras and controls, but disease was more severe in mice with a PrPc-deleted CNS and a normal immune system than in the reciprocal construction. Moreover, there was no indication that anti-MOG responses were different in PrPc-sufficient and PrPc-deficient mice. Paradoxically, PrPc-deficient anti-MOG 2D2 T cells were less pathogenic than PrPc-expressing 2D2 T cells. Conclusions In view of the present data, it can be concluded that the origin of EAE exacerbation in PrPc-ablated mice resides in the absence of the prion protein in the CNS. Furthermore, the absence of PrPc on both neural and immune cells does not
Real-time visualization of prion transport in single live cells using quantum dots
International Nuclear Information System (INIS)
Luo, Kan; Li, Shu; Xie, Min; Wu, Di; Wang, WenXi; Chen, Rui; Huang, Liqin; Huang, Tao; Pang, Daiwen; Xiao, Gengfu
2010-01-01
Prion diseases are fatal neurodegenerative disorders resulting from structural conversion of the cellular isoform of PrP C to the infectious scrapie isoform PrP Sc . It is believed that such structural alteration may occur within the internalization pathway. However, there is no direct evidence to support this hypothesis. Employing quantum dots (QDs) as a probe, we have recorded a real-time movie demonstrating the process of prion internalization in a living cell for the first time. The entire internalization process can be divided into four discrete but connected stages. In addition, using methyl-beta-cyclodextrin to disrupt cell membrane cholesterol, we show that lipid rafts play an important role in locating cellular PrP C to the cell membrane and in initiating PrP C endocytosis.
Yu, Peng; Zhang, Xiaohua; Zhou, Jiawan; Xiong, Erhu; Li, Xiaoyu; Chen, Jinhua
2015-11-01
A novel competitive host-guest strategy regulated by protein biogate was developed for sensitive and selective analysis of prion protein. The methylene blue (MB)-tagged prion aptamer (MB-Apt) was introduced to the multiwalled carbon nanotubes-β-cyclodextrins (MWCNTs-β-CD) composites-modified glassy carbon (GC) electrode through the host-guest interaction between β-CD and MB. In the absence of prion, MB-Apt could be displaced by ferrocenecarboxylic acid (FCA) due to its stronger binding affinity to β-CD, resulting in a large oxidation peak of FCA. However, in the presence of prion, the specific prion-aptamer interaction drove the formation of protein biogate to seal the cavity of β-CD, which hindered the guest displacement of MB by FCA and resulted in the oxidation peak current of MB (IMB) increased and that of FCA (IFCA) decreased. The developed aptasensor showed good response towards the target (prion protein) with a low detection limit of 160 fM. By changing the specific aptamers, this strategy could be easily extended to detect other proteins, showing promising potential for extensive applications in bioanalysis.
COMPOSITE PEPTIDE COMPOUNDS FOR DIAGNOSIS AND TREATMENT OF DISEASES CAUSED BY PRION PROTEINS
DEFF Research Database (Denmark)
2004-01-01
The present invention relates to diseases caused by prion proteins, Novel composite peptide compounds are disclosed which comprise two or more peptides or peptide fragments optionally linked to a backbone and the peptides or peptide fragments are spatially positioned relative to each other so tha....... Other uses of the composite peptide compounds are also disclosed, such as use in diagnostic assays, production of antibodies and uses as vaccine immunogens for the prophylactic protection and therapeutic treatment of subjects against transmissible prion disease.......The present invention relates to diseases caused by prion proteins, Novel composite peptide compounds are disclosed which comprise two or more peptides or peptide fragments optionally linked to a backbone and the peptides or peptide fragments are spatially positioned relative to each other so...
Spermidine cures yeast of prions
Directory of Open Access Journals (Sweden)
Shaun H. Speldewinde
2015-12-01
Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.
Lyu, Justin; Andrianarijaona, V. M.
2016-05-01
The causes of the misfolding of prion protein -i.e. the transformation of PrPC to PrPSc - have not been clearly elucidated. Many studies have focused on identifying possible chemical conditions, such as pH, temperature and chemical denaturation, that may trigger the pathological transformation of prion proteins (Weiwei Tao, Gwonchan Yoon, Penghui Cao, `` β-sheet-like formation during the mechanical unfolding of prion protein'', The Journal of Chemical Physics, 2015, 143, 125101). Here, we attempt to calculate the ionization energies of the prion protein, which will be able to shed light onto the possible causes of the misfolding. We plan on using the coarse-grain method which allows for a more feasible calculation time by means of approximation. We believe that by being able to approximate the ionization potential, particularly that of the regions known to form stable β-strands of the PrPSc form, the possible sources of denaturation, be it chemical or mechanical, may be narrowed down.
Directory of Open Access Journals (Sweden)
Rodríguez-Martínez Ana B
2012-10-01
Full Text Available Abstract Introduction The coexistence of different molecular types of classical protease-resistant prion protein in the same individual have been described, however, the simultaneous finding of these with the recently described protease-sensitive variant or variably protease-sensitive prionopathy has, to the best of our knowledge, not yet been reported. Case presentation A 74-year-old Caucasian woman showed a sporadic Creutzfeldt–Jakob disease clinical phenotype with reactive depression, followed by cognitive impairment, akinetic-rigid Parkinsonism with pseudobulbar syndrome and gait impairment with motor apraxia, visuospatial disorientation, and evident frontal dysfunction features such as grasping, palmomental reflex and brisk perioral reflexes. She died at age 77. Neuropathological findings showed: spongiform change in the patient’s cerebral cortex, striatum, thalamus and molecular layer of the cerebellum with proteinase K-sensitive synaptic-like, dot-like or target-like prion protein deposition in the cortex, thalamus and striatum; proteinase K-resistant prion protein in the same regions; and elongated plaque-like proteinase K-resistant prion protein in the molecular layer of the cerebellum. Molecular analysis of prion protein after proteinase K digestion revealed decreased signal intensity in immunoblot, a ladder-like protein pattern, and a 71% reduction of PrPSc signal relative to non-digested material. Her cerebellum showed a 2A prion protein type largely resistant to proteinase K. Genotype of polymorphism at codon 129 was valine homozygous. Conclusion Molecular typing of prion protein along with clinical and neuropathological data revealed, to the best of our knowledge, the first case of the coexistence of different protease-sensitive prion proteins in the same patient in a rare case that did not fulfill the current clinical diagnostic criteria for either probable or possible sporadic Creutzfeldt–Jakob disease. This highlights the
Mutation directional selection sheds light on prion pathogenesis
International Nuclear Information System (INIS)
Shen, Liang; Ji, Hong-Fang
2011-01-01
Highlights: → Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. → Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. → The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP C to PrP Sc . -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP C ) to abnormal scrapie isoform (PrP Sc ). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP C conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.
Mutation directional selection sheds light on prion pathogenesis
Energy Technology Data Exchange (ETDEWEB)
Shen, Liang [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China); Ji, Hong-Fang, E-mail: jhf@sdut.edu.cn [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China)
2011-07-01
Highlights: {yields} Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. {yields} Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. {yields} The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP{sup C} to PrP{sup Sc}. -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP{sup C}) to abnormal scrapie isoform (PrP{sup Sc}). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP{sup C} conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.
Victoria, Guiliana Soraya; Zurzolo, Chiara
2017-09-04
Progression of pathology in neurodegenerative diseases is hypothesized to be a non-cell-autonomous process that may be mediated by the productive spreading of prion-like protein aggregates from a "donor cell" that is the source of misfolded aggregates to an "acceptor cell" in which misfolding is propagated by conversion of the normal protein. Although the proteins involved in the various diseases are unrelated, common pathways appear to be used for their intercellular propagation and spreading. Here, we summarize recent evidence of the molecular mechanisms relevant for the intercellular trafficking of protein aggregates involved in prion, Alzheimer's, Huntington's, and Parkinson's diseases. We focus in particular on the common roles that lysosomes and tunneling nanotubes play in the formation and spreading of prion-like assemblies. © 2017 Victoria and Zurzolo.
Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D
2017-07-04
Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.
Wang, Hui; Tian, Chan; Fan, Xue-Yu; Chen, Li-Na; Lv, Yan; Sun, Jing; Zhao, Yang-Jing; Zhang, Lu-bin; Wang, Jing; Shi, Qi; Gao, Chen; Chen, Cao; Shao, Qi-Xiang; Dong, Xiao-Ping
2015-05-01
Polo-like kinases (PLKs) family has long been known to be critical for cell cycle and recent studies have pointed to new dimensions of PLKs function in the nervous system. Our previous study has verified that the levels of PLK3 in the brain are severely downregulated in prion-related diseases. However, the associations of PLKs with prion protein remain unclear. In the present study, we confirmed that PrP protein constitutively interacts with PLK3 as determined by both in vitro and in vivo assays. Both the kinase domain and polo-box domain of PLK3 were proved to bind PrP proteins expressed in mammalian cell lines. Overexpression of PLK3 did not affect the level of wild-type PrP, but significantly decreased the levels of the mutated PrPs in cultured cells. The kinase domain appeared to be responsible for the clearance of abnormally aggregated PrPs, but this function seemed to be independent of its kinase activity. RNA-mediated knockdown of PLK3 obviously aggravated the accumulation of cytosolic PrPs. Moreover, PLK3 overexpression in a scrapie infected cell line caused notable reduce of PrP(Sc) level in a dose-dependent manner, but had minimal effect on the expression of PrP(C) in its normal partner cell line. Our findings here confirmed the molecular interaction between PLK3 and PrP and outlined the regulatory activity of PLK3 on the degradation of abnormal PrPs, even its pathogenic isoform PrP(Sc). We, therefore, assume that the recovery of PLK3 in the early stage of prion infection may be helpful to prevent the toxic accumulation of PrP(Sc) in the brain tissues. Copyright © 2015 Elsevier Ltd. All rights reserved.
Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent
2016-07-07
Prions are formed of misfolded assemblies (PrP(Sc)) of the variably N-glycosylated cellular prion protein (PrP(C)). In infected species, prions replicate by seeding the conversion and polymerization of host PrP(C). Distinct prion strains can be recognized, exhibiting defined PrP(Sc) biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrP(Sc) assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrP(C) glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrP(C) species of interest as substrate. Applying the technique to PrP(C) glycosylation mutants expressing cells revealed that neither PrP(C) nor PrP(Sc) glycoform stoichiometry was instrumental to PrP(Sc) formation and strainness perpetuation. Our study supports the view that strain properties, including PrP(Sc) glycotype are enciphered within PrP(Sc) structural backbone, not in the attached glycans.
Energy Technology Data Exchange (ETDEWEB)
Manno, D; Filippo, E; Fiore, R; Serra, A [Dipartimento di Scienza dei Materiali, Universita del Salento, Lecce (Italy); Urso, E; Rizzello, A; Maffia, M [Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Universita del Salento, Lecce (Italy)
2010-04-23
Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP{sup C}. In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP{sup C} at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.
International Nuclear Information System (INIS)
Manno, D; Filippo, E; Fiore, R; Serra, A; Urso, E; Rizzello, A; Maffia, M
2010-01-01
Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP C . In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP C at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.
Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...
Prion Protein Gene Polymorphisms in Turkish Native Goat Breeds ...
Indian Academy of Sciences (India)
Navya
In these diseases, a neuronal glycoprotein known as prion protein PrPC ... sheep or goats in Turkey, but the OIE (World Organisation for Animal Health) does not .... Turkish goat breeds was approximately 6.3%, which is a low starting point for ...
Genetic, histochemical and biochemical studies on goat TSE cases from Cyprus.
Niedermeyer, Susanne; Eiden, Martin; Toumazos, Pavlos; Papasavva-Stylianou, Penelope; Ioannou, Ioannis; Sklaviadis, Theodoros; Panagiotidis, Cynthia; Langeveld, Jan; Bossers, Alex; Kuczius, Thorsten; Kaatz, Martin; Groschup, Martin H; Fast, Christine
2016-10-06
Scrapie and bovine spongiform encephalopathy (BSE) are transmissible spongiform encephalopathies (TSE's) affecting sheep and goats. Susceptibility of goats to scrapie is influenced by polymorphisms of the prion protein gene (PRNP) of the host. Five polymorphisms are associated with reduced susceptibility to TSE's. In the study presented here caprine samples from a scrapie eradication program on Cyprus were genotyped and further characterized using BioRad TeSeE rapid test, histological, immunohistochemical and biochemical methods. In total 42 goats from 20 flocks were necropsied from which 25 goats showed a positive result in the rapid test, a spongiform encephalopathy and an accumulation of pathological prion protein (PrP Sc ) in the obex. PrP Sc deposits were demonstrated in the placenta, peripheral nervous and lymphoreticular system. Two animals showed PrP Sc -accumulations in peripheral tissues only. By discriminatory immunoblots a scrapie infection could be confirmed for all cases. Nevertheless, slight deviations in the glycosylation pattern might indicate the presence of different scrapie strains. Furthermore scrapie samples from goats in the current study demonstrated less long term resistance to proteinase K than ovine or caprine BSE control samples. Reduced scrapie susceptibility according to the PRNP genotype was demonstrated (Fishers Exact test, p goats with at least one polymorphism (p = 0.023) at the six codons examined and in particular for those with polymorphisms at codon 146 (p = 0.016). This work characterizes scrapie in goats having implications for breeding and surveillance strategies.
Snord 3A: A Molecular Marker and Modulator of Prion Disease Progression
Cohen, Eran; Avrahami, Dana; Frid, Kati; Canello, Tamar; Levy Lahad, Ephrat; Zeligson, Sharon; Perlberg, Shira; Chapman, Joab; Cohen, Oren S.; Kahana, Esther; Lavon, Iris; Gabizon, Ruth
2013-01-01
Since preventive treatments for prion disease require early identification of subjects at risk, we searched for surrogate peripheral markers characterizing the asymptomatic phases of such conditions. To this effect, we subjected blood mRNA from E200K PrP CJD patients and corresponding family members to global arrays and found that the expression of Snord3A, a non-coding RNA transcript, was elevated several times in CJD patients as compared to controls, while asymptomatic carriers presented intermediate Snord3A levels. In the brains of TgMHu2ME199K mice, a mouse model mimicking for E200K CJD, Snord 3A levels were elevated in an age and disease severity dependent manner, as was the case for brains of these mice in which disease was exacerbated by copper administration. Snord3A expression was also elevated in scrapie infected mice, but not in PrP0/0 mice, indicating that while the expression levels of this transcript may reflect diverse prion etiologies, they are not related to the loss of PrPC’s function. Elevation of Snord3A was consistent with the activation of ATF6, representing one of the arms of the unfolded protein response system. Indeed, SnoRNAs were associated with reduced resistance to oxidative stress, and with ER stress in general, factors playing a significant role in this and other neurodegenerative conditions. We hypothesize that in addition to its function as a disease marker, Snord3A may play an important role in the mechanism of prion disease manifestation and progression. PMID:23349890
Snord 3A: a molecular marker and modulator of prion disease progression.
Directory of Open Access Journals (Sweden)
Eran Cohen
Full Text Available Since preventive treatments for prion disease require early identification of subjects at risk, we searched for surrogate peripheral markers characterizing the asymptomatic phases of such conditions. To this effect, we subjected blood mRNA from E200K PrP CJD patients and corresponding family members to global arrays and found that the expression of Snord3A, a non-coding RNA transcript, was elevated several times in CJD patients as compared to controls, while asymptomatic carriers presented intermediate Snord3A levels. In the brains of TgMHu2ME199K mice, a mouse model mimicking for E200K CJD, Snord 3A levels were elevated in an age and disease severity dependent manner, as was the case for brains of these mice in which disease was exacerbated by copper administration. Snord3A expression was also elevated in scrapie infected mice, but not in PrP(0/0 mice, indicating that while the expression levels of this transcript may reflect diverse prion etiologies, they are not related to the loss of PrP(C's function. Elevation of Snord3A was consistent with the activation of ATF6, representing one of the arms of the unfolded protein response system. Indeed, SnoRNAs were associated with reduced resistance to oxidative stress, and with ER stress in general, factors playing a significant role in this and other neurodegenerative conditions. We hypothesize that in addition to its function as a disease marker, Snord3A may play an important role in the mechanism of prion disease manifestation and progression.
Cellular Aspects of Prion Replication In Vitro
Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina
2013-01-01
Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381
Real-time visualization of prion transport in single live cells using quantum dots
Energy Technology Data Exchange (ETDEWEB)
Luo, Kan [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Li, Shu [AIDS Research Centre, Institute of Pathogen Biology, Chinese Academy of Medical Science, Beijing 100730 (China); Xie, Min [College of Chemistry and Molecular Science, Wuhan University, Wuhan 430072 (China); Wu, Di; Wang, WenXi; Chen, Rui; Huang, Liqin; Huang, Tao [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Pang, Daiwen, E-mail: dwpang@whu.edu.cn [College of Chemistry and Molecular Science, Wuhan University, Wuhan 430072 (China); Xiao, Gengfu, E-mail: xiaogf@wh.iov.cn [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071 (China)
2010-04-09
Prion diseases are fatal neurodegenerative disorders resulting from structural conversion of the cellular isoform of PrP{sup C} to the infectious scrapie isoform PrP{sup Sc}. It is believed that such structural alteration may occur within the internalization pathway. However, there is no direct evidence to support this hypothesis. Employing quantum dots (QDs) as a probe, we have recorded a real-time movie demonstrating the process of prion internalization in a living cell for the first time. The entire internalization process can be divided into four discrete but connected stages. In addition, using methyl-beta-cyclodextrin to disrupt cell membrane cholesterol, we show that lipid rafts play an important role in locating cellular PrP{sup C} to the cell membrane and in initiating PrP{sup C} endocytosis.
McBride, P. A.; Eikelenboom, P.; Kraal, G.; Fraser, H.; Bruce, M. E.
1992-01-01
Abnormal forms of a host protein, PrP, accumulate in the central nervous system in scrapie-affected animals. Here, PrP protein was detected immunocytochemically in tissue sections of spleen, lymph node, Peyer's patches, thymus, and pancreas from uninfected mice and from mice infected with a range of
Zhou, Minghai; Ottenberg, Gregory; Sferrazza, Gian Franco; Hubbs, Christopher; Fallahi, Mohammad; Rumbaugh, Gavin; Brantley, Alicia F.
2015-01-01
The mechanisms of neuronal death in protein misfolding neurodegenerative diseases such as Alzheimer’s, Parkinson’s and prion diseases are poorly understood. We used a highly toxic misfolded prion protein (TPrP) model to understand neurotoxicity induced by prion protein misfolding. We show that abnormal autophagy activation and neuronal demise is due to severe, neuron-specific, nicotinamide adenine dinucleotide (NAD+) depletion. Toxic prion protein-exposed neuronal cells exhibit dramatic reductions of intracellular NAD+ followed by decreased ATP production, and are completely rescued by treatment with NAD+ or its precursor nicotinamide because of restoration of physiological NAD+ levels. Toxic prion protein-induced NAD+ depletion results from PARP1-independent excessive protein ADP-ribosylations. In vivo, toxic prion protein-induced degeneration of hippocampal neurons is prevented dose-dependently by intracerebral injection of NAD+. Intranasal NAD+ treatment of prion-infected sick mice significantly improves activity and delays motor impairment. Our study reveals NAD+ starvation as a novel mechanism of autophagy activation and neurodegeneration induced by a misfolded amyloidogenic protein. We propose the development of NAD+ replenishment strategies for neuroprotection in prion diseases and possibly other protein misfolding neurodegenerative diseases. PMID:25678560
Kao, Yu-Chun; Bailey, Andy; Samminger, Bernhard; Tanimoto, Junji; Burnouf, Thierry
2016-07-01
Pooled human platelet lysate (HPL) is becoming the new gold standard as supplement for ex vivo cell culture for clinical protocols. However, the risk of pathogen contamination of HPL increases with the platelet pool size. We hypothesized that hollow fiber anion exchange membrane chromatography using QyuSpeed D (QSD) could remove resistant and untested bloodborne pathogens, such as parvoviruses and prions, from HPL-supplemented growth media without substantially affecting their capacity to support ex vivo cell expansion. Frozen or thawed platelet concentrates were serum-converted and centrifuged for obtaining HPL that was added to various growth media (ca. 100 mL), filtered through a 0.6-mL QSD membrane and characterized for proteins, growth factors and chemical composition. Capacity to expand Chinese hamster ovary, periodontal ligament, gingival fibroblast cells and Wharton's jelly mesenchymal stromal cells was studied. Removal of porcine parvovirus (PPV) and of the 263K prion strain of hamster-adapted scrapie was studied by spiking experiments following international guidelines. QSD had minimal impact on HPL-supplemented medium composition in proteins, growth factors and chemical content, nor capacity to expand and differentiate cells. In addition, QSD could remove ≥5.58 log10 [TCID50/mL] and ≥3.72 log10 of PPV and the 263K prion, respectively. QSD hollow fiber chromatography can be used to improve the virus and prion safety of HPL-supplemented media to safely expand cells for clinical protocols. These data bring new perspectives for increasingly safer use of pooled HPL in cell therapy and regenerative medicine applications. Copyright © 2016 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Treatment with a non-toxic, self-replicating anti-prion delays or prevents prion disease in vivo.
Diaz-Espinoza, R; Morales, R; Concha-Marambio, L; Moreno-Gonzalez, I; Moda, F; Soto, C
2018-03-01
Transmissible spongiform encephalopathies (TSEs) are fatal neurological disorders caused by prions, which are composed of a misfolded protein (PrP Sc ) that self-propagates in the brain of infected individuals by converting the normal prion protein (PrP C ) into the pathological isoform. Here, we report a novel experimental strategy for preventing prion disease based on producing a self-replicating, but innocuous PrP Sc -like form, termed anti-prion, which can compete with the replication of pathogenic prions. Our results show that a prophylactic inoculation of prion-infected animals with an anti-prion delays the onset of the disease and in some animals completely prevents the development of clinical symptoms and brain damage. The data indicate that a single injection of the anti-prion eliminated ~99% of the infectivity associated to pathogenic prions. Furthermore, this treatment caused significant changes in the profile of regional PrP Sc deposition in the brains of animals that were treated, but still succumbed to the disease. Our findings provide new insights for a mechanistic understanding of prion replication and support the concept that prion replication can be separated from toxicity, providing a novel target for therapeutic intervention.
Transmissible Spongiform Encephalopathies (Prion Diseases)
... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ...
Long-term memory consolidation: The role of RNA-binding proteins with prion-like domains.
Sudhakaran, Indulekha P; Ramaswami, Mani
2017-05-04
Long-term and short-term memories differ primarily in the duration of their retention. At a molecular level, long-term memory (LTM) is distinguished from short-term memory (STM) by its requirement for new gene expression. In addition to transcription (nuclear gene expression) the translation of stored mRNAs is necessary for LTM formation. The mechanisms and functions for temporal and spatial regulation of mRNAs required for LTM is a major contemporary problem, of interest from molecular, cell biological, neurobiological and clinical perspectives. This review discusses primary evidence in support for translational regulatory events involved in LTM and a model in which different phases of translation underlie distinct phases of consolidation of memories. However, it focuses largely on mechanisms of memory persistence and the role of prion-like domains in this defining aspect of long-term memory. We consider primary evidence for the concept that Cytoplasmic Polyadenylation Element Binding (CPEB) protein enables the persistence of formed memories by transforming in prion-like manner from a soluble monomeric state to a self-perpetuating and persistent polymeric translationally active state required for maintaining persistent synaptic plasticity. We further discuss prion-like domains prevalent on several other RNA-binding proteins involved in neuronal translational control underlying LTM. Growing evidence indicates that such RNA regulatory proteins are components of mRNP (RiboNucleoProtein) granules. In these proteins, prion-like domains, being intrinsically disordered, could mediate weak transient interactions that allow the assembly of RNP granules, a source of silenced mRNAs whose translation is necessary for LTM. We consider the structural bases for RNA granules formation as well as functions of disordered domains and discuss how these complicate the interpretation of existing experimental data relevant to general mechanisms by which prion-domain containing RBPs
E.A. Croes (Esther); B.Z. Alizadeh (Behrooz); A.M. Bertoli Avella (Aida); T.A.M. Rademaker (Tessa); J. Vergeer-Drop (Jeannette); B. Dermaut (Bart); J.J. Houwing-Duistermaat (Jeanine); D.P.W.M. Wientjens (Dorothee); A. Hofman (Albert); C. van Broeckhoven (Christine); C.M. van Duijn (Cornelia)
2004-01-01
textabstractThe prion protein gene (PRNP) plays a central role in the origin of Creutzfeldt-Jakob disease (CJD), but there is growing interest in other polymorphisms that may be involved in CJD. Polymorphisms upstream of PRNP that may modulate the prion protein production as well as polymorphisms in
Prion-based memory of heat stress in yeast.
Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D
2017-05-04
Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices. We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.
Development of techniques in magnetic resonance and structural studies of the prion protein
Energy Technology Data Exchange (ETDEWEB)
Bitter, Hans-Marcus L. [Univ. of California, Berkeley, CA (United States)
2000-07-01
Magnetic resonance is the most powerful analytical tool used by chemists today. Its applications range from determining structures of large biomolecules to imaging of human brains. Nevertheless, magnetic resonance remains a relatively young field, in which many techniques are currently being developed that have broad applications. In this dissertation, two new techniques are presented, one that enables the determination of torsion angles in solid-state peptides and proteins, and another that involves imaging of heterogenous materials at ultra-low magnetic fields. In addition, structural studies of the prion protein via solid-state NMR are described. More specifically, work is presented in which the dependence of chemical shifts on local molecular structure is used to predict chemical shift tensors in solid-state peptides with theoretical ab initio surfaces. These predictions are then used to determine the backbone dihedral angles in peptides. This method utilizes the theoretical chemicalshift tensors and experimentally determined chemical-shift anisotropies (CSAs) to predict the backbone and side chain torsion angles in alanine, leucine, and valine residues. Additionally, structural studies of prion protein fragments are described in which conformationally-dependent chemical-shift measurements were made to gain insight into the structural differences between the various conformational states of the prion protein. These studies are of biological and pathological interest since conformational changes in the prion protein are believed to cause prion diseases. Finally, an ultra-low field magnetic resonance imaging technique is described that enables imaging and characterization of heterogeneous and porous media. The notion of imaging gases at ultra-low fields would appear to be very difficult due to the prohibitively low polarization and spin densities as well as the low sensitivities of conventional Faraday coil detectors. However, Chapter 5 describes how gas imaging
Prions, From Structure to Epigenetics and Neuronal Functions
Lindquist, Susan
2012-02-01
Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting
Silva, Christopher J
2018-06-13
Food forensicists need a variety of tools to detect the many possible food contaminants. As a result of its analytical flexibility, mass spectrometry is one of those tools. Use of the multiple reaction monitoring (MRM) method expands its use to quantitation as well as detection of infectious proteins (prions) and protein toxins, such as Shiga toxins. The sample processing steps inactivate prions and Shiga toxins; the proteins are digested with proteases to yield peptides suitable for MRM-based analysis. Prions are detected by their distinct physicochemical properties and differential covalent modification. Shiga toxin analysis is based on detecting peptides derived from the five identical binding B subunits comprising the toxin. 15 N-labeled internal standards are prepared from cloned proteins. These examples illustrate the power of MRM, in that the same instrument can be used to safely detect and quantitate protein toxins, prions, and small molecules that might contaminate our food.
The comprehensive native interactome of a fully functional tagged prion protein.
Directory of Open Access Journals (Sweden)
Dorothea Rutishauser
Full Text Available The enumeration of the interaction partners of the cellular prion protein, PrP(C, may help clarifying its elusive molecular function. Here we added a carboxy proximal myc epitope tag to PrP(C. When expressed in transgenic mice, PrP(myc carried a GPI anchor, was targeted to lipid rafts, and was glycosylated similarly to PrP(C. PrP(myc antagonized the toxicity of truncated PrP, restored prion infectibility of PrP(C-deficient mice, and was physically incorporated into PrP(Sc aggregates, indicating that it possessed all functional characteristics of genuine PrP(C. We then immunopurified myc epitope-containing protein complexes from PrP(myc transgenic mouse brains. Gentle differential elution with epitope-mimetic decapeptides, or a scrambled version thereof, yielded 96 specifically released proteins. Quantitative mass spectrometry with isotope-coded tags identified seven proteins which co-eluted equimolarly with PrP(C and may represent component of a multiprotein complex. Selected PrP(C interactors were validated using independent methods. Several of these proteins appear to exert functions in axomyelinic maintenance.
Directory of Open Access Journals (Sweden)
Imperiale Valentina
2007-07-01
Full Text Available Abstract Background A hallmark of prion disease is the transformation of normal cellular prion protein (PrPc into an infectious disease-associated isoform, (PrPsc. Anti-prion protein monoclonal antibodies are invaluable for structure-function studies of PrP molecules. Furthermore recent in vitro and in vivo studies indicate that anti-PrP monoclonal antibodies can prevent the incorporation of PrPc into propagating prions. In the present article, we show two new human phage antibodies, isolated on recombinant hamster prion protein (rHaPrP. Results We adopted an antibody phage display strategy to isolate specific human antibodies directed towards rHaPrP which has been used as a bait for panning the synthetic ETH-2 antibody phage library. Two phage antibodies clones named MA3.B4 and MA3.G3 were isolated and characterized under genetic biochemical and immunocytochemical aspects. The clones were found to recognize the prion protein in ELISA studies. In flow-cytometry studies, these human single chain Fragment variable (scFv phage-antibodies show a well defined pattern of reactivity on human lymphoblastoid and myeloid cells. Conclusion Sequence analysis of the gene encoding for the antibody fragments and antigen recognition patterns determined by flow-cytometry analysis indicate that the isolated scFvs recognize novel epitopes in the PrPc molecule. These new anti PrPc human antibodies are unique reagents for prion protein detection and may represent a biologic platform to develop new reagents to treat PrPsc associated disease.
Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria
2017-11-15
This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected
Molecular Pathology of Human Prion Diseases
Directory of Open Access Journals (Sweden)
2009-03-01
Full Text Available Prion diseases are fatal neurodegenerative conditions in humans and animals. In this review, we summarize the molecular background of phenotypic variability, relation of prion protein (PrP to other proteins associated with neurodegenerative diseases, and pathogenesis of neuronal vulnerability. PrP exists in different forms that may be present in both diseased and non-diseased brain, however, abundant disease-associated PrP together with tissue pathology characterizes prion diseases and associates with transmissibility. Prion diseases have different etiological background with distinct pathogenesis and phenotype. Mutations of the prion protein gene are associated with genetic forms. The codon 129 polymorphism in combination with the Western blot pattern of PrP after proteinase K digestion serves as a basis for molecular subtyping of sporadic Creutzfeldt-Jakob disease. Tissue damage may result from several parallel, interacting or subsequent pathways that involve cellular systems associated with synapses, protein processing, oxidative stress, autophagy, and apoptosis.
A comparative molecular dynamics study on thermostability of human and chicken prion proteins
International Nuclear Information System (INIS)
Ji, Hong-Fang; Zhang, Hong-Yu
2007-01-01
To compare the thermostabilities of human and chicken normal cellular prion proteins (HuPrP C and CkPrP C ), molecular dynamics (MD) simulations were performed for both proteins at an ensemble level (10 parallel simulations at 400 K and 5 parallel simulations at 300 K as a control). It is found that the thermostability of HuPrP C is comparable with that of CkPrP C , which implicates that the non-occurrence of prion diseases in non-mammals cannot be completely attributed to the thermodynamic properties of non-mammalian PrP C
High prevalence of a fungal prion
Debets, A.J.M.; Dalstra, H.J.P.; Slakhorst, S.M.; Koopmanschap-Memelink, A.B.; Hoekstra, R.F.; Saupe, S.J.
2012-01-01
Prions are infectious proteins that cause fatal diseases in mammals. Prions have also been found in fungi, but studies on their role in nature are scarce. The proposed biological function of fungal prions is debated and varies from detrimental to benign or even beneficial. [Het-s] is a prion of the
Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M
2017-12-14
Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.
Veerhuis, Robert; Hoozemans, Jeroen J. M.; Janssen, Ingrid; Boshuizen, Ronald S.; Langeveld, Jan P. M.; Eikelenboom, Piet
2002-01-01
Prion diseases are characterized by accumulation of protease resistant isoforms of prion protein (termed PrP(SC)), glial activation and neurodegeneration. The time course of PrP deposition, appearance of activated microglia, and of neuronal apoptosis in experimentally-induced prion disease suggests
Prion Protein Self-Interactions: a gateway to novel therapeutic strategies?
Rigter, A.
2011-01-01
Transmissible Spongiform Encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seems to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-01-01
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-07-26
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.
Johnson, Christopher J.; Carlson, Christina M.; Morawski, Aaron R.; Manthei, Alyson; Cashman, Neil R.
2015-01-01
Studies to understanding interspecies transmission of transmissible spongiform encephalopathies (TSEs, prion diseases) are challenging in that they typically rely upon lengthy and costly in vivo animal challenge studies. A number of in vitro assays have been developed to aid in measuring prion species barriers, thereby reducing animal use and providing quicker results than animal bioassays. Here, we present the protocol for a rapid in vitroprion conversion assay called the conversion efficiency ratio (CER) assay. In this assay cellular prion protein (PrPC) from an uninfected host brain is denatured at both pH 7.4 and 3.5 to produce two substrates. When the pH 7.4 substrate is incubated with TSE agent, the amount of PrPC that converts to a proteinase K (PK)-resistant state is modulated by the original host’s species barrier to the TSE agent. In contrast, PrPC in the pH 3.5 substrate is misfolded by any TSE agent. By comparing the amount of PK-resistant prion protein in the two substrates, an assessment of the host’s species barrier can be made. We show that the CER assay correctly predicts known prion species barriers of laboratory mice and, as an example, show some preliminary results suggesting that bobcats (Lynx rufus) may be susceptible to white-tailed deer (Odocoileus virginianus) chronic wasting disease agent.
Statistical Mechanics of Prion Diseases
International Nuclear Information System (INIS)
Slepoy, A.; Singh, R. R. P.; Pazmandi, F.; Kulkarni, R. V.; Cox, D. L.
2001-01-01
We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ''species barriers'' to prion infection and assess a related treatment protocol
International Nuclear Information System (INIS)
Baral, Pravas Kumar; Wieland, Barbara; Swayampakula, Mridula; Polymenidou, Magdalini; Aguzzi, Adriano; Kav, Nat N. V.; James, Michael N. G.
2011-01-01
The complex of MoPrP(120–232) and Fab POM1 has been crystallized (space group C2, unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°). Diffraction data to 2.30 Å resolution have been collected using synchrotron radiation. Prion diseases are neurodegenerative diseases that are characterized by the conversion of the cellular prion protein PrP c to the pathogenic isoform PrP sc . Several antibodies are known to interact with the cellular prion protein and to inhibit this transition. An antibody Fab fragment, Fab POM1, was produced that recognizes a structural motif of the C-terminal domain of mouse prion protein. To study the mechanism by which Fab POM1 recognizes and binds the prion molecule, the complex between Fab POM1 and the C-terminal domain of mouse prion (residues 120–232) was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group C2, with unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°
Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich
2015-01-01
Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high Pr...
Molecular dynamics study of the dominant-negative E219K polymorphism in human prion protein
Jahandideh, Samad; Jamalan, Mostafa; Faridounnia, Maryam|info:eu-repo/dai/nl/338666923
2015-01-01
Human prion diseases are associated with misfolding or aggregation of the Human Prion Protein (HuPrP). Missense mutations in the HuPrP gene, contribute to conversion of HuPrP(C) to HuPrP(Sc) and amyloid formation. Based on our previous comprehensive study, three missense mutations, from two
Mabbott, Neil A
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp ?/?) mice. So far, six types of Prnp ?/? mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not ...
Matías-Guiu, Jordi A; Guerrero-Márquez, Carmen; Cabrera-Martín, María Nieves; Gómez-Pinedo, Ulises; Romeral, María; Mayo, Diego; Porta-Etessam, Jesús; Moreno-Ramos, Teresa; Carreras, José Luis; Matías-Guiu, Jorge
2017-05-04
The role of positron emission tomography (PET) in Creutzfeldt-Jakob disease is less defined than in other neurodegenerative diseases. We studied the correlation between the uptake of 18 F-florbetaben and 18 F-fluorodeoxyglucose with pathological prion protein deposition in histopathology in a case. A patient with 80 y old with a rapid neurological deterioration with a confirmed diagnosis of CJD was studied. PET and MRI studies were performed between 13-20 d before the death. A region of interest analysis was performed using Statistical Parametric Mapping. MRI showed atrophy with no other alterations. FDG-PET showed extensive areas of hypometabolism including left frontoparietal lobes as well as bilateral thalamus. Correlation between uptake of 18 F-florbetaben and pathological prion protein deposition was r = 0.786 (p < 0.05). Otherwise, correlation between uptake of 18 F-FDG and pathological prion protein was r = 0.357 (p = 0.385). Immunohistochemistry with β-amyloid did not show amyloid deposition or neuritic plaques. Our study supports the use of FDG-PET in the assessment of CJD. FDG-PET may be especially useful in cases of suspected CJD and negative MRI. Furthermore, this case report provides more evidence about the behavioral of amyloid tracers, and the possibility of a low-affinity binding to other non-amyloid proteins, such as the pathological prion protein, is discussed.
Relationship between magnetism and prion protein
Directory of Open Access Journals (Sweden)
F. Balzano
2010-01-01
Full Text Available The mechanism of conversion of the normal prion protein (PrPC into aggregates of its pathological conformer (PrPSc reamins unclear. The aim of this study was to evaluate the effects induced by exposure of biological samples containing PrPSC to a magnetic field induced prominent molecular changes of samples indicated by the IR spectra located in the region that contains contribution primarily from absorption of amides. This finding suggests the existence of a strong correlation between magnetism and PrPsc and supports a new hypothesis that explains the conversion of normal PrPc to abnormal isoform PrPsc.
Prion protein inhibits microtubule assembly by inducing tubulin oligomerization
International Nuclear Information System (INIS)
Nieznanski, Krzysztof; Podlubnaya, Zoya A.; Nieznanska, Hanna
2006-01-01
A growing body of evidence points to an association of prion protein (PrP) with microtubular cytoskeleton. Recently, direct binding of PrP to tubulin has also been found. In this work, using standard light scattering measurements, sedimentation experiments, and electron microscopy, we show for First time the effect of a direct interaction between these proteins on tubulin polymerization. We demonstrate that full-length recombinant PrP induces a rapid increase in the turbidity of tubulin diluted below the critical concentration for microtubule assembly. This effect requires magnesium ions and is weakened by NaCl. Moreover, the PrP-induced light scattering structures of tubulin are cold-stable. In preparations of diluted tubulin incubated with PrP, electron microscopy revealed the presence of ∼50 nm disc-shaped structures not reported so far. These unique tubulin oligomers may form large aggregates. The effect of PrP is more pronounced under the conditions promoting microtubule formation. In these tubulin samples, PrP induces formation of the above oligomers associated with short protofilaments and sheets of protofilaments into aggregates. Noticeably, this is accompanied by a significant reduction of the number and length of microtubules. Hence, we postulate that prion protein may act as an inhibitor of microtubule assembly by inducing formation of stable tubulin oligomers
Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...
Accelerating Yeast Prion Biology using Droplet Microfluidics
Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David
2012-02-01
Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.
Background: Transmissible spongiform encephalopathies (TSEs) or prion diseases are caused by the propagation of a misfolded form (PrP**d) of the normal cellular prion protein, PrP**c. Recently, we have reported the generation and characterization of PrP**C-deficient cattle (PrP-/-) produced by a seq...
Victoria, Guiliana Soraya; Zurzolo, Chiara
2015-09-02
Several neurodegenerative diseases such as transmissible spongiform encephalopathies, Alzheimer's and Parkinson's diseases are caused by the conversion of cellular proteins to a pathogenic conformer. Despite differences in the primary structure and subcellular localization of these proteins, which include the prion protein, α-synuclein and amyloid precursor protein (APP), striking similarity has been observed in their ability to seed and convert naïve protein molecules as well as transfer between cells. This review aims to cover what is known about the intracellular trafficking of these proteins as well as their degradation mechanisms and highlight similarities in their movement through the endocytic pathway that could contribute to the pathogenic conversion and seeding of these proteins which underlies the basis of these diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Intraperitoneal Infection of Wild-Type Mice with Synthetically Generated Mammalian Prion.
Directory of Open Access Journals (Sweden)
Xinhe Wang
2015-07-01
Full Text Available The prion hypothesis postulates that the infectious agent in transmissible spongiform encephalopathies (TSEs is an unorthodox protein conformation based agent. Recent successes in generating mammalian prions in vitro with bacterially expressed recombinant prion protein provide strong support for the hypothesis. However, whether the pathogenic properties of synthetically generated prion (rec-Prion recapitulate those of naturally occurring prions remains unresolved. Using end-point titration assay, we showed that the in vitro prepared rec-Prions have infectious titers of around 104 LD50/μg. In addition, intraperitoneal (i.p. inoculation of wild-type mice with rec-Prion caused prion disease with an average survival time of 210-220 days post inoculation. Detailed pathological analyses revealed that the nature of rec-Prion induced lesions, including spongiform change, disease specific prion protein accumulation (PrP-d and the PrP-d dissemination amongst lymphoid and peripheral nervous system tissues, the route and mechanisms of neuroinvasion were all typical of classical rodent prions. Our results revealed that, similar to naturally occurring prions, the rec-Prion has a titratable infectivity and is capable of causing prion disease via routes other than direct intra-cerebral challenge. More importantly, our results established that the rec-Prion caused disease is pathogenically and pathologically identical to naturally occurring contagious TSEs, supporting the concept that a conformationally altered protein agent is responsible for the infectivity in TSEs.
Proteomics analyses for the global proteins in the brain tissues of different human prion diseases.
Shi, Qi; Chen, Li-Na; Zhang, Bao-Yun; Xiao, Kang; Zhou, Wei; Chen, Cao; Zhang, Xiao-Mei; Tian, Chan; Gao, Chen; Wang, Jing; Han, Jun; Dong, Xiao-Ping
2015-04-01
Proteomics changes of brain tissues have been described in different neurodegenerative diseases including Alzheimer's disease and Parkinson's disease. However, the brain proteomics of human prion disease remains less understood. In the study, the proteomics patterns of cortex and cerebellum of brain tissues of sporadic Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD were analyzed with isobaric tags for relative and absolute quantitation combined with multidimensional liquid chromatography and MS analysis, with the brains from three normal individuals as controls. Global protein profiling, significant pathway, and functional categories were analyzed. In total, 2287 proteins were identified with quantitative information both in cortex and cerebellum regions. Cerebellum tissues appeared to contain more up- and down-regulated proteins (727 proteins) than cortex regions (312 proteins) of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD. Viral myocarditis, Parkinson's disease, Alzheimer's disease, lysosome, oxidative phosphorylation, protein export, and drug metabolism-cytochrome P450 were the most commonly affected pathways of the three kinds of diseases. Almost coincident biological functions were identified in the brain tissues of the three diseases. In all, data here demonstrate that the brain tissues of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD have obvious proteomics changes at their terminal stages, which show the similarities not only among human prion diseases but also with other neurodegeneration diseases. This is the first study to provide a reference proteome map for human prion diseases and will be helpful for future studies focused on potential biomarkers for the diagnosis and therapy of human prion diseases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Yuan, Zhen; Yang, Lifeng; Chen, Baian; Zhu, Ting; Hassan, Mohammad Farooque; Yin, Xiaomin; Zhou, Xiangmei; Zhao, Deming
2015-06-01
The formation of neurotoxic prion protein (PrP) oligomers is thought to be a key step in the development of prion diseases. Recently, it was determined that the sonication and shaking of recombinant PrP can convert PrP monomers into β-state oligomers. Herein, we demonstrate that β-state oligomeric PrP can be generated through protein misfolding cyclic amplification from recombinant full-length hamster, human, rabbit, and mutated rabbit PrP, and that these oligomers can be used for subsequent research into the mechanisms of PrP-induced neurotoxicity. We have characterized protein misfolding cyclic amplification-induced monomer-to-oligomer conversion of PrP from three species using western blotting, circular dichroism, size-exclusion chromatography, and resistance to proteinase K (PK) digestion. We have further shown that all of the resulting β-oligomers are toxic to primary mouse cortical neurons independent of the presence of PrP(C) in the neurons, whereas the corresponding monomeric PrP were not toxic. In addition, we found that this toxicity is the result of oligomer-induced apoptosis via regulation of Bcl-2, Bax, and caspase-3 in both wild-type and PrP(-/-) cortical neurons. It is our hope that these results may contribute to our understanding of prion transformation within the brain. We found that β-state oligomeric PrPs can be generated through protein misfolding cyclic amplification (PMCA) from recombinant full-length hamster, human, rabbit, and mutated rabbit PrP. β-oligomers are toxic to primary mouse cortical neurons independent of the presence of PrP(C) in the neurons, while the corresponding monomeric PrPs were not toxic. This toxicity is the result of oligomers-induced apoptosis via regulation of Bcl-2, Bax, and caspase-3. These results may contribute to our understanding of prion transformation within the brain. © 2015 International Society for Neurochemistry.
International Nuclear Information System (INIS)
Haigh, Cathryn L.; Drew, Simon C.
2015-01-01
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation
Energy Technology Data Exchange (ETDEWEB)
Haigh, Cathryn L., E-mail: chaigh@unimelb.edu.au [Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); Drew, Simon C., E-mail: sdrew@unimelb.edu.au [Florey Department of Neuroscience and Mental Health, The University of Melbourne, Victoria 3010 (Australia)
2015-06-05
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation.
Glycoform-selective prion formation in sporadic and familial forms of prion disease
Xiao, X.; Yuan, J.; Haïk, S.; Cali, I.; Zhan, Y.; Moudjou, M.; Li, B.; Laplanche, J.L.; Laude, H.; Langeveld, J.P.M.; Gambetti, P.
2013-01-01
The four glycoforms of the cellular prion protein (PrP(C)) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrP(Sc)) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrP(Sc) in the recently identified
Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions
Directory of Open Access Journals (Sweden)
Sandra Pritzkow
2015-05-01
Full Text Available Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves. These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.
Kim, Soochan; Han, Sinsuk; Lee, Ye Eun; Jung, Woong-Jae; Lee, Hyung Soo; Kim, Yong-Sun; Choi, Eun-Kyoung; Kim, Mi-Yeon
2016-01-01
The cellular prion protein is expressed in almost all tissues, including the central nervous system and lymphoid tissues. To investigate the effects of the prion protein in lymphoid cells and spleen structure formation, we used prion protein-deficient (Prnp(0/0)) Zürich I mice generated by inactivation of the Prnp gene. Prnp(0/0) mice had decreased lymphocytes, in particular, CD4 T cells and lymphoid tissue inducer (LTi) cells. Decreased CD4 T cells resulted from impaired expression of CCL19 and CCL21 in the spleen rather than altered chemokine receptor CCR7 expression. Importantly, some of the white pulp regions in spleens from Prnp(0/0) mice displayed impaired T zone structure as a result of decreased LTi cell numbers and altered expression of the lymphoid tissue-organizing genes lymphotoxin-α and CXCR5, although expression of the lymphatic marker podoplanin and CXCL13 by stromal cells was not affected. In addition, CD3(-)CD4(+)IL-7Rα(+) LTi cells were rarely detected in impaired white pulp in spleens of these mice. These data suggest that the prion protein is required to form the splenic white pulp structure and for development of normal levels of CD4 T and LTi cells. Copyright © 2015. Published by Elsevier GmbH.
Vilches, Silvia; Vergara, Cristina; Nicolás, Oriol; Mata, Ágata; Del Río, José A; Gavín, Rosalina
2016-09-01
The biological functions of the cellular prion protein remain poorly understood. In fact, numerous studies have aimed to determine specific functions for the different protein domains. Studies of cellular prion protein (PrP(C)) domains through in vivo expression of molecules carrying internal deletions in a mouse Prnp null background have provided helpful data on the implication of the protein in signalling cascades in affected neurons. Nevertheless, understanding of the mechanisms underlying the neurotoxicity induced by these PrP(C) deleted forms is far from complete. To better define the neurotoxic or neuroprotective potential of PrP(C) N-terminal domains, and to overcome the heterogeneity of results due to the lack of a standardized model, we used neuroblastoma cells to analyse the effects of overexpressing PrP(C) deleted forms. Results indicate that PrP(C) N-terminal deleted forms were properly processed through the secretory pathway. However, PrPΔF35 and PrPΔCD mutants led to death by different mechanisms sharing loss of alpha-cleavage and activation of caspase-3. Our data suggest that both gain-of-function and loss-of-function pathogenic mechanisms may be associated with N-terminal domains and may therefore contribute to neurotoxicity in prion disease. Dissecting the molecular response induced by PrPΔF35 may be the key to unravelling the physiological and pathological functions of the prion protein.
Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich
2015-01-01
ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451
The prion-ZIP connection: From cousins to partners in iron uptake
Singh, Neena; Asthana, Abhishek; Baksi, Shounak; Desai, Vilok; Haldar, Swati; Hari, Sahi; Tripathi, Ajai K
2015-01-01
ABSTRACT Converging observations from disparate lines of inquiry are beginning to clarify the cause of brain iron dyshomeostasis in sporadic Creutzfeldt-Jakob disease (sCJD), a neurodegenerative condition associated with the conversion of prion protein (PrPC), a plasma membrane glycoprotein, from α-helical to a β-sheet rich PrP-scrapie (PrPSc) isoform. Biochemical evidence indicates that PrPC facilitates cellular iron uptake by functioning as a membrane-bound ferrireductase (FR), an activity necessary for the transport of iron across biological membranes through metal transporters. An entirely different experimental approach reveals an evolutionary link between PrPC and the Zrt, Irt-like protein (ZIP) family, a group of proteins involved in the transport of zinc, iron, and manganese across the plasma membrane. Close physical proximity of PrPC with certain members of the ZIP family on the plasma membrane and increased uptake of extracellular iron by cells that co-express PrPC and ZIP14 suggest that PrPC functions as a FR partner for certain members of this family. The connection between PrPC and ZIP proteins therefore extends beyond common ancestry to that of functional cooperation. Here, we summarize evidence supporting the facilitative role of PrPC in cellular iron uptake, and implications of this activity on iron metabolism in sCJD brains. PMID:26689487
Prion replication without host adaptation during interspecies transmissions.
Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C
2017-01-31
Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.
Localization of A11-reactive oligomeric species in prion diseases
DEFF Research Database (Denmark)
Aidt, Frederik H; Hasholt, Lis F; Christiansen, Michael
2013-01-01
To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases.......To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases....
Protease-sensitive synthetic prions.
Directory of Open Access Journals (Sweden)
David W Colby
2010-01-01
Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.
Molecular pathogenesis of sporadic prion diseases in man
Safar, Jiri G.
2012-01-01
The yeast, fungal and mammalian prions determine heritable and infectious traits that are encoded in alternative conformations of proteins. They cause lethal sporadic, familial and infectious neurodegenerative conditions in man, including Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), kuru, sporadic fatal insomnia (SFI) and likely variable protease-sensitive prionopathy (VPSPr). The most prevalent of human prion diseases is sporadic (s)CJD. Recent advances in amplification and detection of prions led to considerable optimism that early and possibly preclinical diagnosis and therapy might become a reality. Although several drugs have already been tested in small numbers of sCJD patients, there is no clear evidence of any agent’s efficacy. Therefore, it remains crucial to determine the full spectrum of sCJD prion strains and the conformational features in the pathogenic human prion protein governing replication of sCJD prions. Research in this direction is essential for the rational development of diagnostic as well as therapeutic strategies. Moreover, there is growing recognition that fundamental processes involved in human prion propagation – intercellular induction of protein misfolding and seeded aggregation of misfolded host proteins – are of far wider significance. This insight leads to new avenues of research in the ever-widening spectrum of age-related human neurodegenerative diseases that are caused by protein misfolding and that pose a major challenge for healthcare. PMID:22421210
Prions and neuro degenerative diseases | Nair | African Journal of ...
African Journals Online (AJOL)
Prion is a disease-causing agent that is neither bacterial nor fungal nor viral and contains no genetic material. A prion is a protein that occurs normally in a harmless form. By folding into an aberrant shape, the normal prion turns into a rogue agent. It then co-opts other normal prions to become rogue prions. Prions have ...
Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio
2017-01-01
Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.
Genes contributing to prion pathogenesis
DEFF Research Database (Denmark)
Tamgüney, Gültekin; Giles, Kurt; Glidden, David V
2008-01-01
incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...
Thellung, Stefano; Gatta, Elena; Pellistri, Francesca; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Robello, Mauro; Florio, Tullio
2017-10-01
Glia over-stimulation associates with amyloid deposition contributing to the progression of central nervous system neurodegenerative disorders. Here we analyze the molecular mechanisms mediating microglia-dependent neurotoxicity induced by prion protein (PrP)90-231, an amyloidogenic polypeptide corresponding to the protease-resistant portion of the pathological prion protein scrapie (PrP Sc ). PrP90-231 neurotoxicity is enhanced by the presence of microglia within neuronal culture, and associated to a rapid neuronal [Ca ++ ] i increase. Indeed, while in "pure" cerebellar granule neuron cultures, PrP90-231 causes a delayed intracellular Ca ++ entry mediated by the activation of NMDA receptors; when neuron and glia are co-cultured, a transient increase of [Ca ++ ] i occurs within seconds after treatment in both granule neurons and glial cells, then followed by a delayed and sustained [Ca ++ ] i raise, associated with the induction of the expression of inducible nitric oxide synthase and phagocytic NADPH oxidase. [Ca ++ ] i fast increase in neurons is dependent on the activation of multiple pathways since it is not only inhibited by the blockade of voltage-gated channel activity and NMDA receptors but also prevented by the inhibition of nitric oxide and PGE 2 release from glial cells. Thus, Ca ++ homeostasis alteration, directly induced by PrP90-231 in cerebellar granule cells, requires the activation of NMDA receptors, but is greatly enhanced by soluble molecules released by activated glia. In glia-enriched cerebellar granule cultures, the activation of inducible nitric oxide (iNOS) and NADPH oxidase represents the main mechanism of toxicity since their pharmacological inhibition prevented PrP90-231 neurotoxicity, whereas NMDA blockade by D(-)-2-amino-5-phosphonopentanoic acid is ineffective; conversely, in pure cerebellar granule cultures, NMDA blockade but not iNOS inhibition strongly reduced PrP90-231 neurotoxicity. These data indicate that amyloidogenic peptides
Grass plants bind, retain, uptake, and transport infectious prions.
Pritzkow, Sandra; Morales, Rodrigo; Moda, Fabio; Khan, Uffaf; Telling, Glenn C; Hoover, Edward; Soto, Claudio
2015-05-26
Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrP(Sc)) to plants. Small quantities of PrP(Sc) contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrP(Sc) for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk
2010-03-01
Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
The prion protein and New World primate phylogeny
Directory of Open Access Journals (Sweden)
Igor Schneider
2004-01-01
Full Text Available The PrP C prion protein contains 250 amino acids with some variation among species and is expressed in several cell types. PrP C is converted to PrP Sc by a post-translational process in which it acquires amino acid sequences of three-dimensional conformation of beta-sheets. Variations in the prion protein gene were observed among 16 genera of New World primates (Platyrrhini, and resulted in amino acid substitutions when compared with the human sequence. Seven substitutions not yet described in the literature were found: W -> R at position 31 in Cebuella, T -> A at position 95 in Cacajao and Chiropotes, N-> S at position 100 in Brachyteles, L -> Q at position 130 in Leontopithecus (in the sequence responsible for generating the beta-sheet 1, D -> E at position 144 in Lagothrix (in the sequence responsible for the alpha-helix 1, D-> G at position 147 in Saguinus (also located in the alpha-helix 1 region, and M -> I at position 232 in Alouatta. The phylogenetic trees generated by parsimony, neighbor-joining and Bayesian analyses strongly support the monophyletic status of the platyrrhines, but did not resolve relationships among families. However, the results do corroborate previous findings, which indicate that the three platyrrhine families radiated rapidly from an ancient split.
Synthetic study on prion protein fragments using a SPPS and native chemical ligation
Czech Academy of Sciences Publication Activity Database
Zawada, Z.; Šebestík, Jaroslav; Bednárová, Lucie; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan
2009-01-01
Roč. 37, Suppl. 1 (2009), s. 44-44 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /11./. 03.08.2009-07.08.2009, Vienna] Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * SPPS * native chemical ligation * fragments Subject RIV: CC - Organic Chemistry
Windig, J.J.; Hoving, A.H.
2009-01-01
National legislation to breed for scrapie resistence was changed in 2007. The obligatory use of ARR/ARR rams was suspended in that year. Breeding for scrapie resistance is, however, still stimulated and not suspended. In this report a general advice on how to continue breeding for scrapie resistance
Eikelenboom, P.; Scott, J. R.; McBride, P. A.; Rozemuller, J. M.; Bruce, M. E.; Fraser, H.
1987-01-01
The present study was designed to investigate blood-brain permeability and the possible involvement of plasma proteins and blood-borne cells in amyloid plaque formation in scrapie-affected mice. No abnormal extravasation of intravenously injected horseradish peroxidase (HRP) was found and with
Aβ seeds and prions: How close the fit?
Rasmussen, Jay; Jucker, Mathias; Walker, Lary C
2017-07-04
The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.
Rozemuller, A.J.M.; Jansen, C.; Carrano, A.; van Haastert, E.S.; Hondius, D.; van der Vies, S.M.; Hoozemans, J.J.M.
2012-01-01
Background: In cases with a long (>1 year) clinical duration of prion disease, the prion protein can form amyloid deposits. These cases do not show accumulation of 4-kDa β-amyloid, which is observed in amyloid deposits in Alzheimer's disease (AD). In AD, amyloid is associated with inflammation and
Prion pathogenesis and secondary lymphoid organs (SLO)
Mabbott, Neil A.
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090
Soluble Aβ aggregates can inhibit prion propagation.
Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John
2017-11-01
Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.
Generating Bona Fide Mammalian Prions with Internal Deletions.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2016-08-01
Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative
The many shades of prion strain adaptation.
Baskakov, Ilia V
2014-01-01
In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.
Directory of Open Access Journals (Sweden)
Bencsik Anna A
2010-08-01
Full Text Available Abstract In a recent paper written by Hilbe et al (BMC vet res, 2009, the nature and specificity of the prion protein deposition in the kidney of feline species affected with feline spongiform encephalopathy (FSE were clearly considered doubtful. This article was brought to our attention because we published several years ago an immunodetection of abnormal prion protein in the kidney of a cheetah affected with FSE. At this time we were convinced of its specificity but without having all the possibilities to demonstrate it. As previously published by another group, the presence of abnormal prion protein in some renal glomeruli in domestic cats affected with FSE is indeed generally considered as doubtful mainly because of low intensity detected in this organ and because control kidneys from safe animals present also a weak prion immunolabelling. Here we come back on these studies and thought it would be helpful to relay our last data to the readers of BMC Vet res for future reference on this subject. Here we come back on our material as it is possible to study and demonstrate the specificity of prion immunodetection using the PET-Blot method (Paraffin Embedded Tissue - Blot. It is admitted that this method allows detecting the Proteinase K (PK resistant form of the abnormal prion protein (PrPres without any confusion with unspecific immunoreaction. We re-analysed the kidney tissue versus adrenal gland and brain samples from the same cheetah affected with TSE using this PET-Blot method. The PET-Blot analysis revealed specific PrPres detection within the brain, adrenal gland and some glomeruli of the kidney, with a complete identicalness compared to our previous detection using immunohistochemistry. In conclusion, these new data enable us to confirm with assurance the presence of specific abnormal prion protein in the adrenal gland and in the kidney of the cheetah affected with FSE. It also emphasizes the usefulness for the re-examination of any
Preclinical deposition of pathological prion protein in muscle of experimentally infected primates.
Directory of Open Access Journals (Sweden)
Susanne Krasemann
Full Text Available Prion diseases are transmissible fatal neurodegenerative disorders affecting humans and animals. A central step in disease progression is the accumulation of a misfolded form (PrP(Sc of the host encoded prion protein (PrP(C in neuronal and non-neuronal tissues. The involvement of peripheral tissues in preclinical states increases the risk of accidental transmission. On the other hand, detection of PrP(Sc in non-neuronal easy-accessible compartments such as muscle may offer a novel diagnostic tool. Primate models have proven invaluable to investigate prion diseases. We have studied the deposition of PrP(Sc in muscle and central nervous system of rhesus monkeys challenged with sporadic Creutzfeldt-Jakob disease (sCJD, variant CJD (vCJD and bovine spongiform encephalopathy (BSE in preclinical and clinical stage using biochemical and morphological methods. Here, we show the preclinical presence of PrP(Sc in muscle and central nervous system of rhesus monkeys experimentally infected with vCJD.
Currently, there is a lack of pathologic landmarks to objectively evaluate the progression of prion disease in vivo. The goal of this work was to determine the temporal relationship between transport of misfolded prion protein to the retina from the brain, accumulation of PrPSc in the retina, the re...
Directory of Open Access Journals (Sweden)
Randi Sørby
Full Text Available BACKGROUND: In prion disease, the peripheral expression of PrP(C is necessary for the transfer of infectivity to the central nervous system. The spleen is involved in neuroinvasion and neural dissemination in prion diseases but the nature of this involvement is not known. The present study undertook the investigation of the spatial relationship between sites of PrP(Sc accumulation, localisation of nerve fibres and PrP(C expression in the tissue compartments of the spleen of scrapie-inoculated and control sheep. METHODOLOGY/PRINCIPAL FINDINGS: Laser microdissection and quantitative PCR were used to determine PrP mRNA levels and results were compared with immunohistochemical protocols to distinguish PrP(C and PrP(Sc in tissue compartments of the spleen. In sheep experimentally infected with scrapie, the major sites of accumulation of PrP(Sc in the spleen, namely the lymphoid nodules and the marginal zone, expressed low levels of PrP mRNA. Double immunohistochemical labelling for PrP(Sc and the pan-nerve fibre marker, PGP, was used to evaluate the density of innervation of splenic tissue compartments and the intimacy of association between PrP(Sc and nerves. Some nerve fibres were observed to accompany blood vessels into the PrP(Sc-laden germinal centres. However, the close association between nerves and PrP(Sc was most apparent in the marginal zone. Other sites of close association were adjacent to the wall of the central artery of PALS and the outer rim of germinal centres. CONCLUSIONS/SIGNIFICANCE: The findings suggest that the degree of PrP(Sc accumulation does not depend on the expression level of PrP(C. Though several splenic compartments may contribute to neuroinvasion, the marginal zone may play a central role in being the compartment with most apparent association between nerves and PrP(Sc.
Directory of Open Access Journals (Sweden)
Maas Elke
2005-10-01
Full Text Available Abstract Background The definite diagnosis of prion diseases such as Creutzfeldt-Jakob disease (CJD in humans or bovine spongiform encephalopathy (BSE in cattle currently relies on the post mortem detection of the pathological form of the prion protein (PrPSc in brain tissue. Infectivity studies indicate that PrPSc may also be present in body fluids, even at presymptomatic stages of the disease, albeit at concentrations well below the detection limits of currently available analytical methods. Results We developed a highly sensitive method for detecting prion protein aggregates that takes advantage of kinetic differences between seeded and unseeded polymerization of prion protein monomers. Detection of the aggregates was carried out by flow cytometry. In the presence of prion seeds, the association of labelled recombinant PrP monomers in plasma and serum proceeds much more efficiently than in the absence of seeds. In a diagnostic model system, synthetic PrP aggregates were detected down to a concentration of approximately 10-8 nM [0.24 fg/ml]. A specific signal was detected in six out of six available serum samples from BSE-positive cattle. Conclusion We have developed a method based on seed-dependent PrP fibril formation that shows promising results in differentiating a small number of BSE-positive serum samples from healthy controls. This method may provide the basis for an ante mortem diagnostic test for prion diseases.
2008-07-01
polyphenols were selected as PrPSc inhibitors against both strains of mouse scrapie in the SCDB assay. Tannin (tannic acid), the most potent inhibitor...of human prion disease is contingent on post-mortem (or biopsy) analysis of brain, despite a number of clinical and paraclinical laboratory features... analysis of the scrapie-associated protein PrP 27-30 in water by infrared spectroscopy. Biochemistry 30, 7672–7680 (1991). The first study revealing
Key points concerning amyloid infectivity and prion-like neuronal invasion
Directory of Open Access Journals (Sweden)
Alba eEspargaró
2016-04-01
Full Text Available Amyloid aggregation has been related to an increasing number of human illnesses, from Alzheimer and Parkinson’s diseases to Creutzfeldt-Jakob disease. Traditionally only prions have been considered as infectious agents with a high capacity of propagation. Although recent publications have showed that many amyloid proteins, including amyloid β-peptide, α-synuclein and tau protein, also propagate in a prion-like manner, the link between propagation of pathological proteins and neurotoxicity has not been evidenced. The extremely low infectivity in natural conditions of the most of non-prion amyloids is far from the spreading capacity displayed by the prions. However, it is important to elucidate the key factors that cause non-prion amyloids become infectious agents. In recent years, important advances in the understanding of the amyloid processes of amyloid-like proteins and unrelated prions (i.e., yeast and fungal prions have yielded essential information that can be applied to shed light on the prion phenomenon in mammals and humans. As shown in this review, recent evidences suggest that there are key factors that could dramatically modulate the prion capacity of proteins in the amyloid conformation. The concentration of nuclei, the presence of oligomers, and the toxicity, resistance and localization of these aggregates could be key factors affecting their spreading. In short, those factors that favor the high concentration of extracellular nuclei or oligomers, characterized by a small size, with a low toxicity could dramatically increase prion propensity; whereas low concentrations of highly toxic intracellular amyloids, with a large size, would prevent infectivity.
Goldmann, W.; Ryan, K.; Stewart, P.; Parnham, D.; Xicohtencatl, R.; Fernandez, N.; Saunders, G.; Windl, O.; Gonzalez, L.; Bossers, A.
2011-01-01
The application of genetic breeding programmes to eradicate transmissible spongiform encephalopathies in goats is an important aim for reasons of animal welfare as well as human food safety and food security. Based on the positive impact of Prnp genetics on sheep scrapie in Europe in the past
Cockcroft, P D; Clark, A M
2006-02-01
There were 574 scrapie positive suspects (histopathological scrapie lesions present) and 198 scrapie negative suspects (histopathological scrapie lesions absent). The greatest number of scrapie cases were recorded in sheep of 2, 3 and 4 years of age which represented 17%, 36% and 23% of the scrapie positive suspects, respectively. The sign sensitivities and specificities for the ten recorded signs were, respectively: pruritus (62%, 42%), ataxia (23%, 74%), hyperaesthesia (32%, 74%), wool loss (25%, 73%), fleece discolouration (29%, 85%), bruxism (23%, 69%), nibbling reflex (17%, 58%), head rubbing (47%, 78%), poll rubbing (25%, 83%). These single signs had poor discriminatory values with likelihood ratios close to one (range 0.89-1.21); combinations of the four signs, pruritus, wool loss, ataxia, hyperaesthesia and emaciation were more discriminatory (range 0.30-4.3). This study covered a time period when bovine spongiform encephalopathy (BSE) might have been introduced into the sheep population on the Shetland Islands via contaminated feed. No temporal changes could be detected in the age structure of the affected animals.
Araman, Can; Thompson, Robert E; Wang, Siyao; Hackl, Stefanie; Payne, Richard J; Becker, Christian F W
2017-09-01
The prion protein (PrP) is an N -glycosylated protein attached to the outer leaflet of eukaryotic cell membranes via a glycosylphosphatidylinositol (GPI) anchor. Different prion strains have distinct glycosylation patterns and the extent of glycosylation of potentially pathogenic misfolded prion protein (PrP Sc ) has a major impact on several prion-related diseases (transmissible spongiform encephalopathies, TSEs). Based on these findings it is hypothesized that posttranslational modifications (PTMs) of PrP influence conversion of cellular prion protein (PrP C ) into PrP Sc and, as such, modified PrP variants are critical tools needed to investigate the impact of PTMs on the pathogenesis of TSEs. Here we report a semisynthetic approach to generate PrP variants modified with monodisperse polyethyleneglycol (PEG) units as mimics of N-glycans. Incorporating PEG at glycosylation sites 181 and 197 in PrP induced only small changes to the secondary structure when compared to unmodified, wildtype PrP. More importantly, in vitro aggregation was abrogated for all PEGylated PrP variants under conditions at which wildtype PrP aggregated. Furthermore, the addition of PEGylated PrP as low as 10 mol% to wildtype PrP completely blocked aggregation. A similar effect was observed for synthetic PEGylated PrP segments comprising amino acids 179-231 alone if these were added to wildtype PrP in aggregation assays. This behavior raises the question if large N-glycans interfere with aggregation in vivo and if PEGylated PrP peptides could serve as potential therapeutics.
Defining the conformational features of anchorless, poorly neuroinvasive prions.
Directory of Open Access Journals (Sweden)
Cyrus Bett
Full Text Available Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same infectious prion develop fibrillar or nonfibrillar aggregates, respectively, and show a striking divergence in the disease pathogenesis. To better understand how a prion's physical properties govern the pathogenesis, infectious anchorless prions were passaged in mice expressing anchorless prion protein and the resulting prions were biochemically characterized. Serial passage of anchorless prions led to a significant decrease in the incubation period to terminal disease and altered the biochemical properties, consistent with a transmission barrier effect. After an intraperitoneal exposure, anchorless prions were only weakly neuroinvasive, as prion plaques rarely occurred in the brain yet were abundant in extracerebral sites such as heart and adipose tissue. Anchorless prions consistently showed very high stability in chaotropes or when heated in SDS, and were highly resistant to enzyme digestion. Consistent with the results in mice, anchorless prions from a human patient were also highly stable in chaotropes. These findings reveal that anchorless prions consist of fibrillar and highly stable conformers. The additional finding from our group and others that both anchorless and anchored prion fibrils are poorly neuroinvasive strengthens the hypothesis that a fibrillar prion structure impedes efficient CNS invasion.
Detection of Prion Proteins and TSE Infectivity in the Rendering and Biodiesel Manufacture Processes
Energy Technology Data Exchange (ETDEWEB)
Brown, R.; Keller, B.; Oleschuk, R. [Queen' s University, Kingston, Ontario (Canada)
2007-03-15
This paper addresses emerging issues related to monitoring prion proteins and TSE infectivity in the products and waste streams of rendering and biodiesel manufacture processes. Monitoring is critical to addressing the knowledge gaps identified in 'Biodiesel from Specified Risk Material Tallow: An Appraisal of TSE Risks and their Reduction' (IEA's AMF Annex XXX, 2006) that prevent comprehensive risk assessment of TSE infectivity in products and waste. The most important challenge for monitoring TSE risk is the wide variety of sample types, which are generated at different points in the rendering/biodiesel production continuum. Conventional transmissible spongiform encephalopathy (TSE) assays were developed for specified risk material (SRM) and other biological tissues. These, however, are insufficient to address the diverse sample matrices produced in rendering and biodiesel manufacture. This paper examines the sample types expected in rendering and biodiesel manufacture and the implications of applying TSE assay methods to them. The authors then discuss a sample preparation filtration, which has not yet been applied to these sample types, but which has the potential to provide or significantly improve TSE monitoring. The main improvement will come from transfer of the prion proteins from the sample matrix to a matrix compatible with conventional and emerging bioassays. A second improvement will come from preconcentrating the prion proteins, which means transferring proteins from a larger sample volume into a smaller volume for analysis to provide greater detection sensitivity. This filtration method may also be useful for monitoring other samples, including wash waters and other waste streams, which may contain SRM, including those from abattoirs and on-farm operations. Finally, there is a discussion of emerging mass spectrometric methods, which Prusiner and others have shown to be suitable for detection and characterisation of prion proteins (Stahl
Van der Rest, Guillaume; Rezaei, Human; Halgand, Frédéric
2017-02-01
Prion protein is involved in deadly neurodegenerative diseases. Its pathogenicity is linked to its structural conversion (α-helix to β-strand transition). However, recent studies suggest that prion protein can follow a plurality of conversion pathways, which hints towards different conformers that might coexist in solution. To gain insights on the plasticity of the ovine prion protein (PrP) monomer, wild type (A136, R154, Q171), mutants and deletions of ARQ were studied by traveling wave ion mobility experiments coupled to mass spectrometry. In order to perform the analysis of a large body of data sets, we designed and evaluated the performance of a processing pipeline based on Driftscope peak detection and a homemade script for automated peak assignment, annotation, and quantification on specific multiply charged protein data. Using this approach, we showed that in the gas phase, PrPs are represented by at least three conformer families differing in both charge state distribution and collisional cross-section, in agreement with the work of Hilton et al. (2010). We also showed that this plasticity is borne both by the N- and C-terminal domains. Effect of protein concentration, pH and temperature were also assessed, showing that (1) pH does not affect conformer distributions, (2) protein concentration modifies the conformational landscape of one mutant (I208M) only, and (3) heating leads to other unfolded species and to a modification of the conformer intensity ratios.
Ito, Yoko; Sanjo, Nobuo; Hizume, Masaki; Kobayashi, Atsushi; Ohgami, Tetsuya; Satoh, Katsuya; Hamaguchi, Tsuyoshi; Yamada, Masahito; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro; Yokota, Takanori
2018-02-19
Valine-to-isoleucine substitution at codon 180 of the prion protein gene is only observed in patients with Creutzfeldt-Jakob disease and accounts for approximately half of all cases of genetic prion disease in Japan. In the present study, we investigated the biochemical characteristics of valine-to-isoleucine substitution at codon 180 in the prion protein gene, using samples obtained from the autopsied brains of seven patients with genetic Creutzfeldt-Jakob disease exhibiting this mutation (diagnoses confirmed via neuropathological examination). Among these patients, we observed an absence of diglycosylated and monoglycosylated forms of PrP res at codon 181. Our findings further indicated that the abnormal prion proteins were composed of at least three components, although smaller carboxyl-terminal fragments were predominant. Western blot analyses revealed large amounts of PrP res in the cerebral neocortices, where neuropathological examination revealed marked spongiosis. Relatively smaller amounts of PrP res were detected in the hippocampus, where milder spongiosis was observed, than in the cerebral neocortex. These findings indicate that abnormal prion proteins in the neocortex are associated with severe toxicity, resulting in severe spongiosis. Our findings further indicate that the valine-to-isoleucine substitution is not a polymorphism, but rather an authentic pathogenic mutation associated with specific biochemical characteristics that differ from those observed in sporadic Creutzfeldt-Jakob disease. Copyright © 2018 Elsevier Inc. All rights reserved.
Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP
Yang, Sujeong; Thackray, Alana M.; Hopkins, Lee; Monie, Tom P.; Burke, David F.; Bujdoso, Raymond
2014-01-01
Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie. PMID:25126555
Directory of Open Access Journals (Sweden)
Christine Pampeno
Full Text Available The laminin receptor (LamR is a cell surface receptor for extracellular matrix laminin, whereas the same protein within the cell interacts with ribosomes, nuclear proteins and cytoskeletal fibers. LamR has been shown to be a receptor for several bacteria and viruses. Furthermore, LamR interacts with both cellular and infectious forms of the prion protein, PrP(C and PrP(Sc. Indeed, LamR is a receptor for PrP(C. Whether LamR interacts with PrP(Sc exclusively in a capacity of the PrP receptor, or LamR specifically recognizes prion determinants of PrP(Sc, is unclear. In order to explore whether LamR has a propensity to interact with prions and amyloids, we examined LamR interaction with the yeast prion-forming protein, Sup35. Sup35 is a translation termination factor with no homology or functional relationship to PrP. Plasmids expressing LamR or LamR fused with the green fluorescent protein (GFP were transformed into yeast strain variants differing by the presence or absence of the prion conformation of Sup35, respectively [PSI⁺] and [psi⁻]. Analyses by immunoprecipitation, centrifugal fractionation and fluorescent microscopy reveal interaction between LamR and Sup35 in [PSI⁺] strains. The presence of [PSI⁺] promotes LamR co-precipitation with Sup35 as well as LamR aggregation. In [PSI⁺] cells, LamR tagged with GFP or mCherry forms bright fluorescent aggregates that co-localize with visible [PSI⁺] foci. The yeast prion model will facilitate studying the interaction of LamR with amyloidogenic prions in a safe and easily manipulated system that may lead to a better understanding and treatment of amyloid diseases.
Pathogenesis of bovine spongiform encephalopathy in sheep
Keulen, van L.J.M.; Vromans, M.E.W.; Dolstra, C.H.; Bossers, A.; Zijderveld, van F.G.
2008-01-01
The pathogenesis of bovine spongiform encephalopathy (BSE) in sheep was studied by immunohistochemical detection of scrapie-associated prion protein (PrPSc) in the gastrointestinal, lymphoid and neural tissues following oral inoculation with BSE brain homogenate. First accumulation of PrPSc was
Dissociation of recombinant prion autocatalysis from infectivity.
Noble, Geoffrey P; Supattapone, Surachai
2015-01-01
Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.
Silva, Jerson L; Vieira, Tuane C R G; Gomes, Mariana P B; Rangel, Luciana P; Scapin, Sandra M N; Cordeiro, Yraima
2011-03-01
The concept that transmissible spongiform encephalopathies (TSEs) are caused only by proteins has changed the traditional paradigm that disease transmission is due solely to an agent that carries genetic information. The central hypothesis for prion diseases proposes that the conversion of a cellular prion protein (PrP(C)) into a misfolded, β-sheet-rich isoform (PrP(Sc)) accounts for the development of (TSE). There is substantial evidence that the infectious material consists chiefly of a protein, PrP(Sc), with no genomic coding material, unlike a virus particle, which has both. However, prions seem to have other partners that chaperone their activities in converting the PrP(C) into the disease-causing isoform. Nucleic acids (NAs) and glycosaminoglycans (GAGs) are the most probable accomplices of prion conversion. Here, we review the recent experimental approaches that have been employed to characterize the interaction of prion proteins with nucleic acids and glycosaminoglycans. A PrP recognizes many nucleic acids and GAGs with high affinities, and this seems to be related to a pathophysiological role for this interaction. A PrP binds nucleic acids and GAGs with structural selectivity, and some PrP:NA complexes can become proteinase K-resistant, undergoing amyloid oligomerization and conversion to a β-sheet-rich structure. These results are consistent with the hypothesis that endogenous polyanions (such as NAs and GAGs) may accelerate the rate of prion disease progression by acting as scaffolds or lattices that mediate the interaction between PrP(C) and PrP(Sc) molecules. In addition to a still-possible hypothesis that nucleic acids and GAGs, especially those from the host, may modulate the conversion, the recent structural characterization of the complexes has raised the possibility of developing new diagnostic and therapeutic strategies. Copyright © 2010 Elsevier Inc. All rights reserved.
Prion-like domains in RNA binding proteins are essential for building subnuclear paraspeckles
Hennig, Sven; Kong, Geraldine; Mannen, Taro; Sadowska, Agata; Kobelke, Simon; Blythe, Amanda; Knott, Gavin J; Iyer, K Swaminathan; Ho, Diwei; Newcombe, Estella A; Hosoki, Kana; Goshima, Naoki; Kawaguchi, Tetsuya; Hatters, Danny; Trinkle-Mulcahy, Laura; Hirose, Tetsuro; Bond, Charles S; Fox, Archa H
2015-01-01
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule
The Role of the Mammalian Prion Protein in the Control of Sleep
Directory of Open Access Journals (Sweden)
Amber Roguski
2017-11-01
Full Text Available Sleep disruption is a prevalent clinical feature in many neurodegenerative disorders, including human prion diseases where it can be the defining dysfunction, as in the case of the “eponymous” fatal familial insomnia, or an early-stage symptom as in certain types of Creutzfeldt-Jakob disease. It is important to establish the role of the cellular prion protein (PrPC, the key molecule involved in prion pathogenesis, within the sleep-wake system in order to understand fully the mechanisms underlying its contribution to both healthy circadian rhythmicity and sleep dysfunction during disease. Although severe disruption to the circadian rhythm and melatonin release is evident during the pathogenic phases of some prion diseases, untangling whether PrPC plays a role in circadian rhythmicity, as suggested in mice deficient for PrPC expression, is challenging given the lack of basic experimental research. We provide a short review of the small amount of direct literature focused on the role of PrPC in melatonin and circadian rhythm regulation, as well as suggesting mechanisms by which PrPC might exert influence upon noradrenergic and dopaminergic signaling and melatonin synthesis. Future research in this area should focus upon isolating the points of dysfunction within the retino-pineal pathway and further investigate PrPC mediation of pinealocyte GPCR activity.
Prions in Variably Protease-Sensitive Prionopathy: An Update
Zou, W.Q.; Gambetti, P.; Xiao, X.; Yuan, J.; Langeveld, J.P.M.; Pirisinu, L.
2013-01-01
Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably
Abskharon, Romany; Dang, Johnny; Elfarash, Ameer; Wang, Zerui; Shen, Pingping; Zou, Lewis S; Hassan, Sedky; Wang, Fei; Fujioka, Hisashi; Steyaert, Jan; Mulaj, Mentor; Surewicz, Witold K; Castilla, Joaquín; Wohlkonig, Alexandre; Zou, Wen-Quan
2017-10-04
The infectious prion protein (PrP Sc or prion) is derived from its cellular form (PrP C ) through a conformational transition in animal and human prion diseases. Studies have shown that the interspecies conversion of PrP C to PrP Sc is largely swayed by species barriers, which is mainly deciphered by the sequence and conformation of the proteins among species. However, the bank vole PrP C (BVPrP) is highly susceptible to PrP Sc from different species. Transgenic mice expressing BVPrP with the polymorphic isoleucine (109I) but methionine (109M) at residue 109 spontaneously develop prion disease. To explore the mechanism underlying the unique susceptibility and convertibility, we generated soluble BVPrP by co-expression of BVPrP with Quiescin sulfhydryl oxidase (QSOX) in Escherichia coli. Interestingly, rBVPrP-109M and rBVPrP-109I exhibited distinct seeded aggregation pathways and aggregate morphologies upon seeding of mouse recombinant PrP fibrils, as monitored by thioflavin T fluorescence and electron microscopy. Moreover, they displayed different aggregation behaviors induced by seeding of hamster and mouse prion strains under real-time quaking-induced conversion. Our results suggest that QSOX facilitates the formation of soluble prion protein and provide further evidence that the polymorphism at residue 109 of QSOX-induced BVPrP may be a determinant in mediating its distinct convertibility and susceptibility.
Current and future molecular diagnostics for prion diseases.
Lehto, Marty T; Peery, Harry E; Cashman, Neil R
2006-07-01
It is now widely held that the infectious agents underlying the transmissible spongiform encephalopathies are prions, which are primarily composed of a misfolded, protease-resistant isoform of the host prion protein. Untreatable prion disorders include some human diseases, such as Creutzfeldt-Jakob disease, and diseases of economically important animals, such as bovine spongiform encephalopathy (cattle) and chronic wasting disease (deer and elk). Detection and diagnosis of prion disease (and presymptomatic incubation) is contingent upon developing novel assays, which exploit properties uniquely possessed by this misfolded protein complex, rather than targeting an agent-specific nucleic acid. This review highlights some of the conventional and disruptive technologies developed to respond to this challenge.
Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.
Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio
2017-06-01
In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of
A Neuronal Culture System to Detect Prion Synaptotoxicity.
Directory of Open Access Journals (Sweden)
Cheng Fang
2016-05-01
Full Text Available Synaptic pathology is an early feature of prion as well as other neurodegenerative diseases. Although the self-templating process by which prions propagate is well established, the mechanisms by which prions cause synaptotoxicity are poorly understood, due largely to the absence of experimentally tractable cell culture models. Here, we report that exposure of cultured hippocampal neurons to PrPSc, the infectious isoform of the prion protein, results in rapid retraction of dendritic spines. This effect is entirely dependent on expression of the cellular prion protein, PrPC, by target neurons, and on the presence of a nine-amino acid, polybasic region at the N-terminus of the PrPC molecule. Both protease-resistant and protease-sensitive forms of PrPSc cause dendritic loss. This system provides new insights into the mechanisms responsible for prion neurotoxicity, and it provides a platform for characterizing different pathogenic forms of PrPSc and testing potential therapeutic agents.
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
Rebels with a cause: molecular features and physiological consequences of yeast prions.
Garcia, David M; Jarosz, Daniel F
2014-02-01
Prions are proteins that convert between structurally and functionally distinct states, at least one of which is self-perpetuating. The prion fold templates the conversion of native protein, altering its structure and function, and thus serves as a protein-based element of inheritance. Molecular chaperones ensure that these prion aggregates are divided and faithfully passed from mother cells to their daughters. Prions were originally identified as the cause of several rare neurodegenerative diseases in mammals, but the last decade has brought great progress in understanding their broad importance in biology and evolution. Most prion proteins regulate information flow in signaling networks, or otherwise affect gene expression. Consequently, switching into and out of prion states creates diverse new traits – heritable changes based on protein structure rather than nucleic acid. Despite intense study of the molecular mechanisms of this paradigm-shifting, epigenetic mode of inheritance, many key questions remain. Recent studies in yeast that support the view that prions are common, often beneficial elements of inheritance that link environmental stress to the appearance of new traits.
Synthetic prions and other human neurodegenerative proteinopathies.
Le, Nhat Tran Thanh; Narkiewicz, Joanna; Aulić, Suzana; Salzano, Giulia; Tran, Hoa Thanh; Scaini, Denis; Moda, Fabio; Giachin, Gabriele; Legname, Giuseppe
2015-09-02
Transmissible spongiform encephalopathies (TSE) are a heterogeneous group of neurodegenerative disorders. The common feature of these diseases is the pathological conversion of the normal cellular prion protein (PrP(C)) into a β-structure-rich conformer-termed PrP(Sc). The latter can induce a self-perpetuating process leading to amplification and spreading of pathological protein assemblies. Much evidence suggests that PrP(Sc) itself is able to recruit and misfold PrP(C) into the pathological conformation. Recent data have shown that recombinant PrP(C) can be misfolded in vitro and the resulting synthetic conformers are able to induce the conversion of PrP(C) into PrP(Sc)in vivo. In this review we describe the state-of-the-art of the body of literature in this field. In addition, we describe a cell-based assay to test synthetic prions in cells, providing further evidence that synthetic amyloids are able to template conversion of PrP into prion inclusions. Studying prions might help to understand the pathological mechanisms governing other neurodegenerative diseases. Aggregation and deposition of misfolded proteins is a common feature of several neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and other disorders. Although the proteins implicated in each of these diseases differ, they share a common prion mechanism. Recombinant proteins are able to aggregate in vitro into β-rich amyloid fibrils, sharing some features of the aggregates found in the brain. Several studies have reported that intracerebral inoculation of synthetic aggregates lead to unique pathology, which spread progressively to distal brain regions and reduced survival time in animals. Here, we review the prion-like features of different proteins involved in neurodegenerative disorders, such as α-synuclein, superoxide dismutase-1, amyloid-β and tau. Copyright © 2014 Elsevier B.V. All rights reserved.
Harrington, Robert D; Herrmann-Hoesing, Lynn M; White, Stephen N; O'Rourke, Katherine I; Knowles, Donald P
2009-01-22
Selective breeding of sheep for arginine (R) at prion gene (PRNP) codon 171 confers resistance to classical scrapie. However, other effects of 171R selection are uncertain. Ovine progressive pneumonia/Maedi-Visna virus (OPPV) may infect up to 66% of a flock thus any affect of 171R selection on OPPV susceptibility or disease progression could have major impact on the sheep industry. Hypotheses that the PRNP 171R allele is 1) associated with the presence of OPPV provirus and 2) associated with higher provirus levels were tested in an Idaho ewe flock. OPPV provirus was found in 226 of 358 ewes by quantitative PCR. The frequency of ewes with detectable provirus did not differ significantly among the 171QQ, 171QR, and 171RR genotypes (p > 0.05). Also, OPPV provirus levels in infected ewes were not significantly different among codon 171 genotypes (p > 0.05). These results show that, in the flock examined, the presence of OPPV provirus and provirus levels are not related to the PRNP 171R allele. Therefore, a genetic approach to scrapie control is not expected to increase or decrease the number of OPPV infected sheep or the progression of disease. This study provides further support to the adoption of PRNP 171R selection as a scrapie control measure.
S. pombe placed on the prion map
Directory of Open Access Journals (Sweden)
Jacqueline Hayles
2017-02-01
Full Text Available Schizosaccharomyces pombe has been used extensively as a model organism, however it is only recently that the first prion in this organism, a copper transporter protein encoded by ctr4, has been conclusively demonstrated. Prions are found in a wide range of organisms and have been implicated in a number of human neurodegenerative diseases. Research into the biology of prions has been carried out mainly in the budding yeast Saccharomyces cerevisiae, however there are many questions still to be addressed. Now, with the identification of the Ctr4 prion in S. pombe, further work in the two yeasts and comparisons of prion biology in these organisms should lead to a greater understanding of prions and their role in disease.
Yeast prions form infectious amyloid inclusion bodies in bacteria
Directory of Open Access Journals (Sweden)
Espargaró Alba
2012-06-01
Full Text Available Abstract Background Prions were first identified as infectious proteins associated with fatal brain diseases in mammals. However, fungal prions behave as epigenetic regulators that can alter a range of cellular processes. These proteins propagate as self-perpetuating amyloid aggregates being an example of structural inheritance. The best-characterized examples are the Sup35 and Ure2 yeast proteins, corresponding to [PSI+] and [URE3] phenotypes, respectively. Results Here we show that both the prion domain of Sup35 (Sup35-NM and the Ure2 protein (Ure2p form inclusion bodies (IBs displaying amyloid-like properties when expressed in bacteria. These intracellular aggregates template the conformational change and promote the aggregation of homologous, but not heterologous, soluble prionogenic molecules. Moreover, in the case of Sup35-NM, purified IBs are able to induce different [PSI+] phenotypes in yeast, indicating that at least a fraction of the protein embedded in these deposits adopts an infectious prion fold. Conclusions An important feature of prion inheritance is the existence of strains, which are phenotypic variants encoded by different conformations of the same polypeptide. We show here that the proportion of infected yeast cells displaying strong and weak [PSI+] phenotypes depends on the conditions under which the prionogenic aggregates are formed in E. coli, suggesting that bacterial systems might become useful tools to generate prion strain diversity.
Molecular Modeling of Prion Transmission to Humans
Directory of Open Access Journals (Sweden)
Etienne Levavasseur
2014-10-01
Full Text Available Using different prion strains, such as the variant Creutzfeldt-Jakob disease agent and the atypical bovine spongiform encephalopathy agents, and using transgenic mice expressing human or bovine prion protein, we assessed the reliability of protein misfolding cyclic amplification (PMCA to model interspecies and genetic barriers to prion transmission. We compared our PMCA results with in vivo transmission data characterized by attack rates, i.e., the percentage of inoculated mice that developed the disease. Using 19 seed/substrate combinations, we observed that a significant PMCA amplification was only obtained when the mouse line used as substrate is susceptible to the corresponding strain. Our results suggest that PMCA provides a useful tool to study genetic barriers to transmission and to study the zoonotic potential of emerging prion strains.
Degradation of the disease-associated prion protein by a serine protease from lichens
Johnson, C.J.; Bennett, J.P.; Biro, S.M.; Duque-Velasquez, J.C.; Rodriguez, C.M.; Bessen, R.A.; Rocke, T.E.; Bartz, Jason C.
2011-01-01
The disease-associated prion protein (PrP(TSE)), the probable etiological agent of the transmissible spongiform encephalopathies (TSEs), is resistant to degradation and can persist in the environment. Lichens, mutualistic symbioses containing fungi, algae, bacteria and occasionally cyanobacteria, are ubiquitous in the environment and have evolved unique biological activities allowing their survival in challenging ecological niches. We investigated PrP(TSE) inactivation by lichens and found acetone extracts of three lichen species (Parmelia sulcata, Cladonia rangiferina and Lobaria pulmonaria) have the ability to degrade prion protein (PrP) from TSE-infected hamsters, mice and deer. Immunoblots measuring PrP levels and protein misfolding cyclic amplification indicated at least two logs of reductions in PrP(TSE). Degradative activity was not found in closely related lichen species or in algae or a cyanobacterium that inhabit lichens. Degradation was blocked by Pefabloc SC, a serine protease inhibitor, but not inhibitors of other proteases or enzymes. Additionally, we found that PrP levels in PrP(TSE)-enriched preps or infected brain homogenates are also reduced following exposure to freshly-collected P. sulcata or an aqueous extract of the lichen. Our findings indicate that these lichen extracts efficiently degrade PrP(TSE) and suggest that some lichens could have potential to inactivate TSE infectivity on the landscape or be a source for agents to degrade prions. Further work to clone and characterize the protease, assess its effect on TSE infectivity and determine which organism or organisms present in lichens produce or influence the protease activity is warranted.
Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred
2012-01-01
Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380
Directory of Open Access Journals (Sweden)
Paula Stewart
Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.
Gene expression profiling of mesenteric lymph nodes from sheep with natural scrapie
Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Hedman, C.; Mediano, D.R.; Monzón, M.; Bossers, A.; Badiola, J.J.
2014-01-01
Background - Prion diseases are characterized by the accumulation of the pathogenic PrPSc protein, mainly in the brain and the lymphoreticular system. Although prions multiply/accumulate in the lymph nodes without any detectable pathology, transcriptional changes in this tissue may reflect
Defining the Conformational Features of Anchorless, Poorly Neuroinvasive Prions
Bett, C.; Kurt, T.D.; Lucero, M.; Trejo, M.; Rozemuller, A.J.M.; Kong, Q.Z.; Nilsson, K.P.R.; Masliah, E.; Oldstone, M.B.; Sigurdson, C.J.
2013-01-01
Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same
β-sheet-like formation during the mechanical unfolding of prion protein
Tao, Weiwei; Yoon, Gwonchan; Cao, Penghui; Eom, Kilho; Park, Harold S.
2015-09-01
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrPC, whose misfolded form PrPSc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.
β-sheet-like formation during the mechanical unfolding of prion protein
Energy Technology Data Exchange (ETDEWEB)
Tao, Weiwei; Cao, Penghui; Park, Harold S., E-mail: parkhs@bu.edu [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Yoon, Gwonchan [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Department of Mechanical Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Eom, Kilho [Biomechanics Laboratory, College of Sport Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)
2015-09-28
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP{sup C}, whose misfolded form PrP{sup Sc} can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.
β-sheet-like formation during the mechanical unfolding of prion protein
International Nuclear Information System (INIS)
Tao, Weiwei; Cao, Penghui; Park, Harold S.; Yoon, Gwonchan; Eom, Kilho
2015-01-01
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP C , whose misfolded form PrP Sc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220
Uchiyama, Keiji; Miyata, Hironori; Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro
2014-01-01
Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp 0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp 0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp 0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice, compared with RML- and 22L-inoculated Prnp 0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc.
Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole
2014-01-01
Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.
Sheep Feed and Scrapie, France
Philippe, Sandrine; Ducrot, Christian; Roy, Pascal; Remontet, Laurent; Jarrige, Nathalie
2005-01-01
Scrapie is a small ruminant, transmissible spongiform encephalopathy (TSE). Although in the past scrapie has not been considered a zoonosis, the emergence of bovine spongiform encephalopathy, transmissible to humans and experimentally to sheep, indicates that risk exists for small ruminant TSEs in humans. To identify the risk factors for introducing scrapie into sheep flocks, a case-control study was conducted in France from 1999 to 2000. Ninety-four case and 350 control flocks were matched by location and main breed. Three main hypotheses were tested: direct contact between flocks, indirect environmental contact, and foodborne risk. Statistical analysis was performed by using adjusted generalized linear models with the complementary log-log link function, considering flock size as an offset. A notable effect of using proprietary concentrates and milk replacers was observed. The risk was heterogeneous among feed factories. Contacts between flocks were not shown to be a risk factor. PMID:16102318
Production, purification and oxidative folding of the mouse recombinant prion protein
Czech Academy of Sciences Publication Activity Database
Pavlíček, A.; Bednárová, Lucie; Holada, K.
2007-01-01
Roč. 52, č. 4 (2007), s. 391-397 ISSN 0015-5632 R&D Projects: GA ČR GD310/05/H533 Grant - others:GA ČR(CZ) GA310/04/0419 Institutional research plan: CEZ:AV0Z40550506 Keywords : recombinant prion protein * production * purification * folding Subject RIV: CE - Biochemistry Impact factor: 0.989, year: 2007 http://www.biomed.cas.cz/mbu/folia/
Structure-based view on [PSI(+)] prion properties.
Bondarev, Stanislav A; Zhouravleva, Galina A; Belousov, Mikhail V; Kajava, Andrey V
2015-01-01
Yeast [PSI(+)] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated β-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI(+)] stability and propagation.
Moore, Roger A; Head, Mark W; Ironside, James W; Ritchie, Diane L; Zanusso, Gianluigi; Choi, Young Pyo; Pyo Choi, Young; Priola, Suzette A
2016-02-01
Sporadic Creutzfeldt-Jakob disease (sCJD) is the most prevalent of the human prion diseases, which are fatal and transmissible neurodegenerative diseases caused by the infectious prion protein (PrP(Sc)). The origin of sCJD is unknown, although the initiating event is thought to be the stochastic misfolding of endogenous prion protein (PrP(C)) into infectious PrP(Sc). By contrast, human growth hormone-associated cases of iatrogenic CJD (iCJD) in the United Kingdom (UK) are associated with exposure to an exogenous source of PrP(Sc). In both forms of CJD, heterozygosity at residue 129 for methionine (M) or valine (V) in the prion protein gene may affect disease phenotype, onset and progression. However, the relative contribution of each PrP(C) allotype to PrP(Sc) in heterozygous cases of CJD is unknown. Using mass spectrometry, we determined that the relative abundance of PrP(Sc) with M or V at residue 129 in brain specimens from MV cases of sCJD was highly variable. This result is consistent with PrP(C) containing an M or V at residue 129 having a similar propensity to misfold into PrP(Sc) thus causing sCJD. By contrast, PrP(Sc) with V at residue 129 predominated in the majority of the UK human growth hormone associated iCJD cases, consistent with exposure to infectious PrP(Sc) containing V at residue 129. In both types of CJD, the PrP(Sc) allotype ratio had no correlation with CJD type, age at clinical onset, or disease duration. Therefore, factors other than PrP(Sc) allotype abundance must influence the clinical progression and phenotype of heterozygous cases of CJD.
Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.
Kabir, M Enamul; Safar, Jiri G
2014-01-01
There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and
Prion disease tempo determined by host-dependent substrate reduction
Mays, C.E.; Kim, C.; Haldiman, T.; Merwe, v.d. J.; Lau, A.; Yang, J.; Grams, J.; Bari, Di M.A.; Nonno, R.; Telling, G.C.; Kong, Q.; Langeveld, J.P.M.; McKenzie, D.; Westaway, D.; Safar, J.G.
2014-01-01
The symptoms of prion infection can take years or decades to manifest following the initial exposure. Molecular markers of prion disease include accumulation of the misfolded prion protein (PrPSc), which is derived from its cellular precursor (PrPC), as well as downregulation of the PrP-like Shadoo
Comparative syntheses of peptide thioesters derived from mouse and human prion proteins
Czech Academy of Sciences Publication Activity Database
Šebestík, Jaroslav; Zawada, Zbigniew; Šafařík, Martin; Hlaváček, Jan
2011-01-01
Roč. 41, Suppl. 1 (2011), S78-S79 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /12./. 01.08.2011-05.08.2011, Beijing] R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : peptide thioesters * ligation * prions * C-domain Subject RIV: CC - Organic Chemistry
International Nuclear Information System (INIS)
Gavora, J.S.; Kochhar, H.P.S.; Gifford, G.A.
2005-01-01
Transmissible spongiform encephalopathies (TSE) include bovine spongiform encephalopathy (BSE), scrapie in sheep and Creutzfeldt-Jakob disease (CJD) in humans. A new CJD variant (nvCJD) is believed to be related to consumption of meat from BSE cattle. In TSE individuals, prion proteins (PrP) with approximately 250 amino acids convert to the pathogenic prion PrP Sc , leading to a dysfunction of the central neural system. Research elsewhere with mice has indicated a possible genetic engineering approach to the introduction of BSE resistance: individuals with amino acid substitutions at positions 167 or 218, inoculated with a pathogenic prion protein, did not support PrP Sc replication. This raises the possibility of producing prion-resistant cattle with a single PrP amino acid substitution. Since prion-resistant animals might still harbour acquired prion infectivity, regulatory assessment of the engineered animals would need to ascertain that such possible 'carriers' do not result in a threat to animal and human health. (author)
Moreno, Julie A.; Telling, Glenn C.
2018-01-01
Prions represent a new paradigm of protein-mediated information transfer. In the case of mammals, prions are the cause of fatal, transmissible neurodegenerative diseases, sometimes referred to as transmissible spongiform encephalopathies (TSE’s), which frequently occur as epidemics. An increasing body of evidence indicates that the canonical mechanism of conformational corruption of cellular prion protein (PrPC) by the pathogenic isoform (PrPSc) that is the basis of prion formation in TSE’s, is common to a spectrum of proteins associated with various additional human neurodegenerative disorders, including the more common Alzheimer’s and Parkinson’s diseases. The peerless infectious properties of TSE prions, and the unparalleled tools for their study, therefore enable elucidation of mechanisms of template-mediated conformational propagation that are generally applicable to these related disease states. Many unresolved issues remain including the exact molecular nature of the prion, the detailed cellular and molecular mechanisms of prion propagation, and the means by which prion diseases can be both genetic and infectious. In addition, we know little about the mechanism by which neurons degenerate during prion diseases. Tied to this, the physiological role of the normal form of the prion protein remains unclear and it is uncertain whether or not loss of this function contributes to prion pathogenesis. The factors governing the transmission of prions between species remain unclear, in particular the means by which prion strains and PrP primary structure interact to affect inter-species prion transmission. Despite all these unknowns, advances in our understanding of prions have occurred because of their transmissibility to experimental animals and the development of transgenic (Tg) mouse models has done much to further our understanding about various aspects of prion biology. In this review we will focus on advances in our understanding of prion biology that
Pros and cons of a prion-like pathogenesis in Parkinson's disease
Directory of Open Access Journals (Sweden)
Brotchie Jonathan M
2011-06-01
Full Text Available Abstract Background Parkinson's disease (PD is a slowly progressive neurodegenerative disorder which affects widespread areas of the brainstem, basal ganglia and cerebral cortex. A number of proteins are known to accumulate in parkinsonian brains including ubiquitin and α-synuclein. Prion diseases are sporadic, genetic or infectious disorders with various clinical and histopathological features caused by prion proteins as infectious proteinaceous particles transmitting a misfolded protein configuration through brain tissue. The most important form is Creutzfeldt-Jakob disease which is associated with a self-propagating pathological precursor form of the prion protein that is physiologically widely distributed in the central nervous system. Discussion It has recently been found that α-synuclein may behave similarly to the prion precursor and propagate between cells. The post-mortem proof of α-synuclein containing Lewy bodies in embryonic dopamine cells transplants in PD patient suggests that the misfolded protein might be transmitted from the diseased host to donor neurons reminiscent of prion behavior. The involvement of the basal ganglia and brainstem in the degenerative process are other congruencies between Parkinson's and Creutzfeldt-Jakob disease. However, a number of issues advise caution before categorizing Parkinson's disease as a prion disorder, because clinical appearance, brain imaging, cerebrospinal fluid and neuropathological findings exhibit fundamental differences between both disease entities. Most of all, infectiousness, a crucial hallmark of prion diseases, has never been observed in PD so far. Moreover, the cellular propagation of the prion protein has not been clearly defined and it is, therefore, difficult to assess the molecular similarities between the two disease entities. Summary At the current state of knowledge, the molecular pathways of transmissible pathogenic proteins are not yet fully understood. Their exact
Destabilization and recovery of a yeast prion after mild heat shock.
Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O
2011-05-06
Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.
Pin1 and neurodegeneration: a new player for prion disorders?
Directory of Open Access Journals (Sweden)
Elisa Isopi
2015-07-01
Full Text Available Pin1 is a peptidyl-prolyl isomerase that catalyzes the cis/trans conversion of phosphorylated proteins at serine or threonine residues which precede a proline. The peptidyl-prolyl isomerization induces a conformational change of the proteins involved in cell signaling process. Pin1 dysregulation has been associated with some neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Huntington's disease. Proline-directed phosphorylation is a common regulator of these pathologies and a recent work showed that it is also involved in prion disorders. In fact, prion protein phosphorylation at the Ser-43-Pro motif induces prion protein conversion into a disease-associated form. Furthermore, phosphorylation at Ser-43-Pro has been observed to increase in the cerebral spinal fluid of sporadic Creutzfeldt-Jakob Disease patients. These findings provide new insights into the pathogenesis of prion disorders, suggesting Pin1 as a potential new player in the disease. In this paper, we review the mechanisms underlying Pin1 involvement in the aforementioned neurodegenerative pathologies focusing on the potential role of Pin1 in prion disorders.
Directory of Open Access Journals (Sweden)
Kourosh Bamdad
2016-12-01
Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion: Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.
Genetic human prion disease modelled in PrP transgenic Drosophila.
Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond
2017-09-20
Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).
Design and Implementation of Distributed Crawler System Based on Scrapy
Fan, Yuhao
2018-01-01
At present, some large-scale search engines at home and abroad only provide users with non-custom search services, and a single-machine web crawler cannot sovle the difficult task. In this paper, Through the study and research of the original Scrapy framework, the original Scrapy framework is improved by combining Scrapy and Redis, a distributed crawler system based on Web information Scrapy framework is designed and implemented, and Bloom Filter algorithm is applied to dupefilter modul to reduce memory consumption. The movie information captured from douban is stored in MongoDB, so that the data can be processed and analyzed. The results show that distributed crawler system based on Scrapy framework is more efficient and stable than the single-machine web crawler system.
Experimental Models of Inherited PrP Prion Diseases.
Watts, Joel C; Prusiner, Stanley B
2017-11-01
The inherited prion protein (PrP) prion disorders, which include familial Creutzfeldt-Jakob disease, Gerstmann-Sträussler-Scheinker disease, and fatal familial insomnia, constitute ∼10%-15% of all PrP prion disease cases in humans. Attempts to generate animal models of these disorders using transgenic mice expressing mutant PrP have produced variable results. Although many lines of mice develop spontaneous signs of neurological illness with accompanying prion disease-specific neuropathological changes, others do not. Furthermore, demonstrating the presence of protease-resistant PrP species and prion infectivity-two of the hallmarks of the PrP prion disorders-in the brains of spontaneously sick mice has proven particularly challenging. Here, we review the progress that has been made toward developing accurate mouse models of the inherited PrP prion disorders. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.
Prion disease. The characteristics and diagnostic points in Japan
International Nuclear Information System (INIS)
Sanjo, Nobuo; Mizusawa, Hidehiro
2010-01-01
Prion disease develops when normal prion proteins change into transmissible abnormal prion proteins and the converted proteins accumulate in the brain. The Japanese Creutzfeldt-Jakob Disease (CJD) Surveillance Committee has identified 1,320 patients with prion diseases in the 10 years since 1999 (classified into 3 types: sporadic, 77.2%; hereditary, 16.7%; and environmentally acquired, 6.1%). Compared with patients in other countries, a relatively larger number of Japanese patients characteristically have dura mater graft-associated CJD and hereditary prion diseases. All the environmentally acquired cases, except 1 case of variant CJD, were acquired from dura grafts. Although most patients were diagnosed with a classical subtype of sporadic CJD (sCJD), whose features include rapidly progressing dementia, myoclonus, hyperintensity in the cerebral cortex and basal ganglia in diffusion-weighted magnetic resonance imaging, and periodic synchronous discharge in electroencephalography, the number of cases with atypical symptoms, such as MM2 (0.8%), MV2 (0.2%), VV1 (0%), and VV2 (0.2%) subtypes of sCJD cases, was not negligible. Appropriate diagnosis should be made based on clinical features, neuroradiological findings, cerebrospinal fluid (CSF) findings (14-3-3 and total tau proteins), and genetic analysis of polymorphisms. Hereditary prion diseases are classified into 3 major phenotypes: familial CJD (fCJD); Gerstmann-Straeussler-Scheinker disease (GSS), which mainly presents as spinocerebellar ataxia; and fatal familial insomnia. Many mutations of the prion protein gene have been identified, but V1801 (fCJD), P102L (GSS), and E200K (fCJD) mutations were the most common among the fCJD cases in Japan. Without a family history, genetic testing is necessary to distinguish even seemingly ''sporadic'' CJD from fCJD. Accurate diagnosis is important for clarification of the pathological process, prevention of secondary infection, and also psychological support. (author)
Translational errors as an early event in prion conversion.
Hatin, I; Bidou, L; Cullin, C; Rousset, J P
2001-01-01
A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.
Directory of Open Access Journals (Sweden)
Herrmann-Hoesing Lynn M
2009-01-01
Full Text Available Abstract Selective breeding of sheep for arginine (R at prion gene (PRNP codon 171 confers resistance to classical scrapie. However, other effects of 171R selection are uncertain. Ovine progressive pneumonia/Maedi-Visna virus (OPPV may infect up to 66% of a flock thus any affect of 171R selection on OPPV susceptibility or disease progression could have major impact on the sheep industry. Hypotheses that the PRNP 171R allele is 1 associated with the presence of OPPV provirus and 2 associated with higher provirus levels were tested in an Idaho ewe flock. OPPV provirus was found in 226 of 358 ewes by quantitative PCR. The frequency of ewes with detectable provirus did not differ significantly among the 171QQ, 171QR, and 171RR genotypes (p > 0.05. Also, OPPV provirus levels in infected ewes were not significantly different among codon 171 genotypes (p > 0.05. These results show that, in the flock examined, the presence of OPPV provirus and provirus levels are not related to the PRNP 171R allele. Therefore, a genetic approach to scrapie control is not expected to increase or decrease the number of OPPV infected sheep or the progression of disease. This study provides further support to the adoption of PRNP 171R selection as a scrapie control measure.
Leliveld, S Rutger; Stitz, Lothar; Korth, Carsten
2008-06-10
A misfolded conformation of the prion protein (PrP), PrP (Sc), is the essential component of prions, the infectious agents that cause transmissible neurodegenerative diseases. Insertional mutations that lead to an increase in the number of octarepeats (ORs) in PrP are linked to familial human prion disease. In this study, we investigated how expansion of the OR domain causes PrP to favor a prion-like conformation. Therefore, we compared the conformational and aggregation modulating properties of wild-type versus expanded OR domains, either as a fusion construct with the protein G B1 domain (GB1-OR) or as an integral part of full-length mouse PrP (MoPrP). Using circular dichroism spectroscopy, we first demonstrated that ORs are not unfolded but exist as an ensemble of three distinct conformers: polyproline helix-like, beta-turn, and "Trp-related". Domain expansion had little effect on the conformation of GB1-OR fusion proteins. When part of MoPrP however, OR domain expansion changed PrP's folding landscape, not by hampering the production of native alpha-helical monomers but by greatly reducing the propensity to form amyloid and by altering the assembly of misfolded, beta-rich aggregates. These features may relate to subtle pH-dependent conformational differences between wild-type and mutant monomers. In conclusion, we propose that PrP insertional mutations are pathogenic because they enhance specific misfolding pathways of PrP rather than by undermining native folding. This idea was supported by a trial bioassay in transgenic mice overexpressing wild-type MoPrP, where intracerebral injection of recombinant MoPrP with an expanded OR domain but not wild-type MoPrP caused prion disease.
2007-06-01
is not known. Obtaining structural information on the misfolded isoform of prion may lead to preventative therapies and treatments of prion diseases...the misfolded prion isoform may allow for the development of drug therapies or early detection systems for prion diseases, or illuminate mechanistic...showing fluorescence intensity as a function of time and energy for 2,6-p-toluidinonapththalene adsorbed to egg L-α- lecithin vesicles. The steady
9 CFR 54.10 - Tests for scrapie.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Tests for scrapie. 54.10 Section 54.10... tests may be approved for the identification of suspect animals, for the identification of scrapie-positive animals, or for other purposes such as flock certification. For a test to be approved for the...
Prion infections and anti-PrP antibodies trigger converging neurotoxic pathways.
Directory of Open Access Journals (Sweden)
Uli S Herrmann
2015-02-01
Full Text Available Prions induce lethal neurodegeneration and consist of PrPSc, an aggregated conformer of the cellular prion protein PrPC. Antibody-derived ligands to the globular domain of PrPC (collectively termed GDL are also neurotoxic. Here we show that GDL and prion infections activate the same pathways. Firstly, both GDL and prion infection of cerebellar organotypic cultured slices (COCS induced the production of reactive oxygen species (ROS. Accordingly, ROS scavenging, which counteracts GDL toxicity in vitro and in vivo, prolonged the lifespan of prion-infected mice and protected prion-infected COCS from neurodegeneration. Instead, neither glutamate receptor antagonists nor inhibitors of endoplasmic reticulum calcium channels abolished neurotoxicity in either model. Secondly, antibodies against the flexible tail (FT of PrPC reduced neurotoxicity in both GDL-exposed and prion-infected COCS, suggesting that the FT executes toxicity in both paradigms. Thirdly, the PERK pathway of the unfolded protein response was activated in both models. Finally, 80% of transcriptionally downregulated genes overlapped between prion-infected and GDL-treated COCS. We conclude that GDL mimic the interaction of PrPSc with PrPC, thereby triggering the downstream events characteristic of prion infection.
CWDPRNP: A tool for cervid prion sequence analysis in program R
Miller, William L.; Walter, W. David
2017-01-01
Chronic wasting disease is a fatal, neurological disease caused by an infectious prion protein, which affects economically and ecologically important members of the family Cervidae. Single nucleotide polymorphisms within the prion protein gene have been linked to differential susceptibility to the disease in many species. Wildlife managers are seeking to determine the frequencies of disease-associated alleles and genotypes and delineate spatial genetic patterns. The CWDPRNP package, implemented in program R, provides a unified framework for analyzing prion protein gene variability and spatial structure.
The N-terminal, polybasic region is critical for prion protein neuroprotective activity.
Directory of Open Access Journals (Sweden)
Jessie A Turnbaugh
Full Text Available Several lines of evidence suggest that the normal form of the prion protein, PrP(C, exerts a neuroprotective activity against cellular stress or toxicity. One of the clearest examples of such activity is the ability of wild-type PrP(C to suppress the spontaneous neurodegenerative phenotype of transgenic mice expressing a deleted form of PrP (Δ32-134, called F35. To define domains of PrP involved in its neuroprotective activity, we have analyzed the ability of several deletion mutants of PrP (Δ23-31, Δ23-111, and Δ23-134 to rescue the phenotype of Tg(F35 mice. Surprisingly, all of these mutants displayed greatly diminished rescue activity, although Δ23-31 PrP partially suppressed neuronal loss when expressed at very high levels. Our results pinpoint the N-terminal, polybasic domain as a critical determinant of PrP(C neuroprotective activity, and suggest that identification of molecules interacting with this region will provide important clues regarding the normal function of the protein. Small molecule ligands targeting this region may also represent useful therapeutic agents for treatment of prion diseases.
Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.
Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D
2011-11-01
Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.
Amano, Yuko; Kimura, Noriyuki; Hanaoka, Takuya; Aso, Yasuhiro; Hirano, Teruyuki; Murai, Hiroyuki; Satoh, Katsuya; Matsubara, Etsuro
2015-01-01
Here we report a genetically confirmed case of Creutzfeldt-Jakob disease with a prion protein gene codon 180 mutation presenting atypical magnetic resonance imaging findings. The present case exhibited an acute onset and lateralized neurologic signs, and progressive cognitive impairment. No myoclonus or periodic synchronous discharges on electroencephalography were observed. Diffusion-weighted images revealed areas of high signal intensity in the right frontal and temporal cortices at onset that extended to the whole cortex and basal ganglia of the right cerebral hemisphere at 3 months. Although the cerebrospinal fluid (CSF) was initially negative for neuron specific enolase, tau protein, 14-3-3 protein, and abnormal prion protein, the CSF was positive for these brain-derived proteins at 3 months after onset.
Antimicrobial Activity of Human Prion Protein Is Mediated by Its N-Terminal Region
Pasupuleti, Mukesh; Roupe, Markus; Rydeng?rd, Victoria; Surewicz, Krystyna; Surewicz, Witold K.; Chalupka, Anna; Malmsten, Martin; S?rensen, Ole E.; Schmidtchen, Artur
2009-01-01
BACKGROUND: Cellular prion-related protein (PrP(c)) is a cell-surface protein that is ubiquitously expressed in the human body. The multifunctionality of PrP(c), and presence of an exposed cationic and heparin-binding N-terminus, a feature characterizing many antimicrobial peptides, made us hypothesize that PrP(c) could exert antimicrobial activity. METHODOLOGY AND PRINCIPAL FINDINGS: Intact recombinant PrP exerted antibacterial and antifungal effects at normal and low pH. Studies employing r...
Energy Technology Data Exchange (ETDEWEB)
Douma, M.D.; Kerr, G.M.; Brown, R.S.; Keller, B.O.; Oleschuk, R.D. [Queen' s Univ., Kingston, ON (Canada). Dept. of Chemistry
2008-08-15
This paper presented a filtration method for detecting protein traces in non-aqueous media. The extraction technique used a mixture of acetonitrile, non-ionic detergent and water along with filter disks with embedded C{sub 8}-modified silica particles to capture the proteins from non-aqueous samples. The extraction process was then followed by an elution of the protein from the filter disk and direct mass spectrometric detection and tryptic digestion with peptide mapping and MS/MS fragmentation of protein-specific peptides. The method was used to detect prion proteins in spiked biodiesel samples. A tryptic peptide with the sequence YGQGSPGGNR was used for unambiguous identification. Results of the study showed that the method is suitable for the large-scale testing of protein impurities in tallow-based biodiesel production processes. 33 refs., 6 figs.
The POM monoclonals: a comprehensive set of antibodies to non-overlapping prion protein epitopes.
Directory of Open Access Journals (Sweden)
Magdalini Polymenidou
Full Text Available PrP(Sc, a misfolded and aggregated form of the cellular prion protein PrP(C, is the only defined constituent of the transmissible agent causing prion diseases. Expression of PrP(C in the host organism is necessary for prion replication and for prion neurotoxicity. Understanding prion diseases necessitates detailed structural insights into PrP(C and PrP(Sc. Towards this goal, we have developed a comprehensive collection of monoclonal antibodies denoted POM1 to POM19 and directed against many different epitopes of mouse PrP(C. Three epitopes are located within the N-terminal octarepeat region, one is situated within the central unstructured region, and four epitopes are discontinuous within the globular C-proximal domain of PrP(C. Some of these antibodies recognize epitopes that are resilient to protease digestion in PrP(Sc. Other antibodies immunoprecipitate PrP(C, but not PrP(Sc. A third group was found to immunoprecipitate both PrP isoforms. Some of the latter antibodies could be blocked with epitope-mimicking peptides, and incubation with an excess of these peptides allowed for immunochromatography of PrP(C and PrP(Sc. Amino-proximal antibodies were found to react with repetitive PrP(C epitopes, thereby vastly increasing their avidity. We have also created functional single-chain miniantibodies from selected POMs, which retained the binding characteristics despite their low molecular mass. The POM collection, thus, represents a unique set of reagents allowing for studies with a variety of techniques, including western blotting, ELISA, immunoprecipitation, conformation-dependent immunoassays, and plasmon surface plasmon resonance-based assays.
Aguilar-Calvo, Patricia; Fast, C.; Tauscher, Kerstin; Espinosa, J.C.; Groschup, M.H.; Muhammad, Nadeem; Goldmann, W.; Langeveld, J.P.M.; Bossers, A.; Andreoletti, O.
2015-01-01
Background. The prion protein-encoding gene (PRNP) is one of the major determinants for scrapie occurrence in sheep and goats. However, its effect on bovine spongiform encephalopathy (BSE) transmission to goats is not clear.
Methods. Goats harboring wild-type, R/Q211 or Q/K222 PRNP
Combined copper/zinc attachment to prion protein
Hodak, Miroslav; Bernholc, Jerry
2013-03-01
Misfolding of prion protein (PrP) is responsible for diseases such as ``mad-cow disease'' in cattle and Creutzfeldt-Jacob in humans. Extensive experimental investigation has established that this protein strongly interacts with copper ions, and this ability has been linked to its still unknown function. Attachment of other metal ions (zinc, iron, manganese) have been demonstrated as well, but none of them could outcompete copper. Recent finding, however, indicates that at intermediate concentrations both copper and zinc ions can attach to the PrP at the octarepeat region, which contains high affinity metal binding sites. Based on this evidence, we have performed density functional theory simulations to investigate the combined Cu/Zn attachment. We consider all previously reported binding modes of copper at the octarepeat region and examine a possibility simultaneous Cu/Zn attachment. We find that this can indeed occur for only one of the known binding sites, when copper changes its coordination mode to allow for attachment of zinc ion. The implications of the simultaneous attachment on neural function remain to be explored.
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
Energy Technology Data Exchange (ETDEWEB)
Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)
2011-02-25
Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
International Nuclear Information System (INIS)
Tsuji, Toshikazu; Kawai-Noma, Shigeko; Pack, Chan-Gi; Terajima, Hideki; Yajima, Junichiro; Nishizaka, Takayuki; Kinjo, Masataka; Taguchi, Hideki
2011-01-01
Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Cell type-specific neuroprotective activity of untranslocated prion protein.
Directory of Open Access Journals (Sweden)
Elena Restelli
2010-10-01
Full Text Available A key pathogenic role in prion diseases was proposed for a cytosolic form of the prion protein (PrP. However, it is not clear how cytosolic PrP localization influences neuronal viability, with either cytotoxic or anti-apoptotic effects reported in different studies. The cellular mechanism by which PrP is delivered to the cytosol of neurons is also debated, and either retrograde transport from the endoplasmic reticulum or inefficient translocation during biosynthesis has been proposed. We investigated cytosolic PrP biogenesis and effect on cell viability in primary neuronal cultures from different mouse brain regions.Mild proteasome inhibition induced accumulation of an untranslocated form of cytosolic PrP in cortical and hippocampal cells, but not in cerebellar granules. A cyclopeptolide that interferes with the correct insertion of the PrP signal sequence into the translocon increased the amount of untranslocated PrP in cortical and hippocampal cells, and induced its synthesis in cerebellar neurons. Untranslocated PrP boosted the resistance of cortical and hippocampal neurons to apoptotic insults but had no effect on cerebellar cells.These results indicate cell type-dependent differences in the efficiency of PrP translocation, and argue that cytosolic PrP targeting might serve a physiological neuroprotective function.
Clinical findings in two cases of atypical scrapie in sheep: a case report
Directory of Open Access Journals (Sweden)
Chaplin Melanie
2007-02-01
Full Text Available Abstract Background Atypical scrapie is a recently recognised form of transmissible spongiform encephalopathy of sheep that differs from classical scrapie in its neuropathological and biochemical features. Most cases are detected in apparently healthy sheep and information on the clinical presentation is limited. Case presentation This report describes the clinical findings in two sheep notified as scrapie suspects and confirmed as atypical scrapie cases by immunohistochemistry and Western immunoblotting. Although both sheep displayed signs suggestive of a cerebellar dysfunction there was considerable variation in the individual clinical signs, which were similar to classical scrapie. Conclusion Any sheep presenting with neurological gait deficits should be assessed more closely for other behavioural, neurological and physical signs associated with scrapie and their presence should lead to the suspicion of scrapie.
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2013-06-01
A model of protein folding kinetics is applied to study the effects of macromolecular crowding on protein folding rate and stability. Macromolecular crowding is found to promote a decrease of the entropic cost of folding of proteins that produces an increase of both the stability and the folding rate. The acceleration of the folding rate due to macromolecular crowding is shown to be a topology-dependent effect. The model is applied to the folding dynamics of the murine prion protein (121-231). The differential effect of macromolecular crowding as a function of protein topology suffices to make non-native configurations relatively more accessible.
Secretin receptor involvement in prion-infected cells and animals.
Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi
2015-07-08
The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Anti-prion activity of Brilliant Blue G.
Directory of Open Access Journals (Sweden)
Yoshifumi Iwamaru
Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.
Chronic wasting disease prion infection of differentiated neurospheres.
Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A
2017-07-04
A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.
Using small molecule reagents to help distinguish among prion structural models
The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...
The prion protein constitutively controls neuronal store-operated Ca2+ entry through Fyn kinase
Directory of Open Access Journals (Sweden)
Agnese eDe Mario
2015-10-01
Full Text Available The prion protein (PrPC is a cell surface glycoprotein mainly expressed in neurons, whose misfolded isoforms generate the prion responsible for incurable neurodegenerative disorders. Whereas PrPC involvement in prion propagation is well established, PrPC physiological function is still enigmatic despite suggestions that it could act in cell signal transduction by modulating phosphorylation cascades and Ca2+ homeostasis. Because PrPC binds neurotoxic protein aggregates with high-affinity, it has also been proposed that PrPC acts as receptor for amyloid-β (Aβ oligomers associated with Alzheimer’s disease (AD, and that PrPC-Aβ binding mediates AD-related synaptic dysfunctions following activation of the tyrosine kinase Fyn.Here, use of gene-encoded Ca2+ probes targeting different cell domains in primary cerebellar granule neurons expressing, or not, PrPC allowed us to investigate whether PrPC regulates store-operated Ca2+ entry (SOCE and the implication of Fyn in this control. Our findings show that PrPC attenuates SOCE, and Ca2+ accumulation in the cytosol and mitochondria, by constitutively restraining Fyn activation and tyrosine phosphorylation of STIM1, a key molecular component of SOCE. This data establishes the existence of a PrPC-Fyn-SOCE triad in neurons.We also demonstrate that treating cerebellar granule and cortical neurons with soluble Aβ(1-42 oligomers abrogates the control of PrPC over Fyn and SOCE, suggesting a PrPC-dependent mechanism for Aβ-induced neuronal Ca2+ dyshomeostasis.
Experimental transmission of atypical scrapie to sheep
Directory of Open Access Journals (Sweden)
Spiropoulos John
2007-08-01
Full Text Available Abstract Background Active surveillance for transmissible spongiform encephalopathies in small ruminants has been an EU regulatory requirement since 2002. A number of European countries have subsequently reported cases of atypical scrapie, similar to previously published cases from Norway, which have pathological and molecular features distinct from classical scrapie. Most cases have occurred singly in flocks, associated with genotypes considered to be more resistant to classical disease. Experimental transmissibility of such isolates has been reported in certain ovinised transgenic mice, but has not previously been reported in the natural host. Information on the transmissibility of this agent is vital to ensuring that disease control measures are effective and proportionate. Results This report presents the successful experimental transmission, in 378 days, of atypical scrapie to a recipient sheep of homologous genotype with preservation of the pathological and molecular characteristics of the donor. This isolate also transmitted to ovinised transgenic mice (Tg338 with a murine phenotype indistinguishable from that of Nor 98. Conclusion This result strengthens the opinion that these cases result from a distinct strain of scrapie agent, which is potentially transmissible in the natural host under field conditions.
Synthetic prions with novel strain-specified properties.
Moda, Fabio; Le, Thanh-Nhat T; Aulić, Suzana; Bistaffa, Edoardo; Campagnani, Ilaria; Virgilio, Tommaso; Indaco, Antonio; Palamara, Luisa; Andréoletti, Olivier; Tagliavini, Fabrizio; Legname, Giuseppe
2015-12-01
Prions are infectious proteins that possess multiple self-propagating structures. The information for strains and structural specific barriers appears to be contained exclusively in the folding of the pathological isoform, PrP(Sc). Many recent studies determined that de novo prion strains could be generated in vitro from the structural conversion of recombinant (rec) prion protein (PrP) into amyloidal structures. Our aim was to elucidate the conformational diversity of pathological recPrP amyloids and their biological activities, as well as to gain novel insights in characterizing molecular events involved in mammalian prion conversion and propagation. To this end we generated infectious materials that possess different conformational structures. Our methodology for the prion conversion of recPrP required only purified rec full-length mouse (Mo) PrP and common chemicals. Neither infected brain extracts nor amplified PrP(Sc) were used. Following two different in vitro protocols recMoPrP converted to amyloid fibrils without any seeding factor. Mouse hypothalamic GT1 and neuroblastoma N2a cell lines were infected with these amyloid preparations as fast screening methodology to characterize the infectious materials. Remarkably, a large number of amyloid preparations were able to induce the conformational change of endogenous PrPC to harbor several distinctive proteinase-resistant PrP forms. One such preparation was characterized in vivo habouring a synthetic prion with novel strain specified neuropathological and biochemical properties.
A cross-sectional study of PRNP gene in two native Sicilian goat ...
Indian Academy of Sciences (India)
Sergio Migliore
Prion protein gene (PRNP) analysis revealed that none of the scrapie cases carried the p. ... low presence of wild-type goats and the lack of protective alleles. ... Recent association studies showed that allelic vari- .... healthy goats (94 males and 63 females) in more than 20 ..... Results from a retrospective cohort study. Vet.
Genesis of mammalian prions: from non-infectious amyloid fibrils to a transmissible prion disease.
Directory of Open Access Journals (Sweden)
Natallia Makarava
2011-12-01
Full Text Available The transmissible agent of prion disease consists of a prion protein in its abnormal, β-sheet rich state (PrP(Sc, which is capable of replicating itself according to the template-assisted mechanism. This mechanism postulates that the folding pattern of a newly recruited polypeptide chain accurately reproduces that of a PrP(Sc template. Here we report that authentic PrP(Sc and transmissible prion disease can be generated de novo in wild type animals by recombinant PrP (rPrP amyloid fibrils, which are structurally different from PrP(Sc and lack any detectable PrP(Sc particles. When induced by rPrP fibrils, a long silent stage that involved two serial passages preceded development of the clinical disease. Once emerged, the prion disease was characterized by unique clinical, neuropathological, and biochemical features. The long silent stage to the disease was accompanied by significant transformation in neuropathological properties and biochemical features of the proteinase K-resistant PrP material (PrPres before authentic PrP(Sc evolved. The current work illustrates that transmissible prion diseases can be induced by PrP structures different from that of authentic PrP(Sc and suggests that a new mechanism different from the classical templating exists. This new mechanism designated as "deformed templating" postulates that a change in the PrP folding pattern from the one present in rPrP fibrils to an alternative specific for PrP(Sc can occur. The current work provides important new insight into the mechanisms underlying genesis of the transmissible protein states and has numerous implications for understanding the etiology of neurodegenerative diseases.
Genetic evidence for susceptibility and resistance against scrapie in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... Scrapie is a fatal, neurodegenerative disease of sheep and goats (Prusiner ... and/or resistance of Indian sheep to scrapie via some other .... (model 583). ..... tory manual, 3rd edition, Cold spring Harbour Laboratory Press,.
Speldewinde, Shaun H.; Tuite, Mick F.
2017-01-01
Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054
Prions amplify through degradation of the VPS10P sorting receptor sortilin.
Uchiyama, Keiji; Tomita, Mitsuru; Yano, Masashi; Chida, Junji; Hara, Hideyuki; Das, Nandita Rani; Nykjaer, Anders; Sakaguchi, Suehiro
2017-06-01
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains through constitutive conformational conversion of the cellular prion protein, PrPC, into PrPSc. However, the cellular mechanism by which PrPSc is progressively accumulated in prion-infected neurons remains unknown. Here, we show that PrPSc is progressively accumulated in prion-infected cells through degradation of the VPS10P sorting receptor sortilin. We first show that sortilin interacts with PrPC and PrPSc and sorts them to lysosomes for degradation. Consistently, sortilin-knockdown increased PrPSc accumulation in prion-infected cells. In contrast, overexpression of sortilin reduced PrPSc accumulation in prion-infected cells. These results indicate that sortilin negatively regulates PrPSc accumulation in prion-infected cells. The negative role of sortilin in PrPSc accumulation was further confirmed in sortilin-knockout mice infected with prions. The infected mice had accelerated prion disease with early accumulation of PrPSc in their brains. Interestingly, sortilin was reduced in prion-infected cells and mouse brains. Treatment of prion-infected cells with lysosomal inhibitors, but not proteasomal inhibitors, increased the levels of sortilin. Moreover, sortilin was reduced following PrPSc becoming detectable in cells after infection with prions. These results indicate that PrPSc accumulation stimulates sortilin degradation in lysosomes. Taken together, these results show that PrPSc accumulation of itself could impair the sortilin-mediated sorting of PrPC and PrPSc to lysosomes for degradation by stimulating lysosomal degradation of sortilin, eventually leading to progressive accumulation of PrPSc in prion-infected cells.
International Nuclear Information System (INIS)
Abskharon, Romany N. N.; Soror, Sameh H.; Pardon, Els; El Hassan, Hassan; Legname, Giuseppe; Steyaert, Jan; Wohlkonig, Alexandre
2010-01-01
The crystallization of a specific nanobody against mouse PrP C and preliminary diffraction analysis of a crystal that diffracted to 1.23 Å resolution are presented. Prion disorders are infectious diseases that are characterized by the conversion of the cellular prion protein PrP C into the pathogenic isoform PrP Sc . Specific antibodies that interact with the cellular prion protein have been shown to inhibit this transition. Recombinant VHHs (variable domain of dromedary heavy-chain antibodies) or nanobodies are single-domain antibodies, making them the smallest antigen-binding fragments. A specific nanobody (Nb-PrP-01) was raised against mouse PrP C . A crystallization condition for this recombinant nanobody was identified using high-throughput screening. The crystals were optimized using streak-seeding and the hanging-drop method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 30.04, b = 37.15, c = 83.00 Å, and diffracted to 1.23 Å resolution using synchrotron radiation. The crystal structure of this specific nanobody against PrP C together with the known PrP C structure may help in understanding the PrP C /PrP Sc transition mechanism
Comparative syntheses of peptides and peptide thioesters derived from mouse and human prion proteins
Czech Academy of Sciences Publication Activity Database
Šebestík, Jaroslav; Zawada, Zbigniew; Šafařík, Martin; Hlaváček, Jan
2012-01-01
Roč. 43, č. 3 (2012), s. 1297-1309 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein segments * classical synthesis * chemical ligation synthesis * peptide thioesters Subject RIV: CC - Organic Chemistry Impact factor: 3.914, year: 2012
N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis
International Nuclear Information System (INIS)
Magzoub, Mazin; Sandgren, Staffan; Lundberg, Pontus; Oglecka, Kamila; Lilja, Johanna; Wittrup, Anders; Goeran Eriksson, L.E.; Langel, Ulo; Belting, Mattias; Graeslund, Astrid
2006-01-01
A peptide derived from the N-terminus of the unprocessed bovine prion protein (bPrPp), incorporating the hydrophobic signal sequence (residues 1-24) and a basic domain (KKRPKP, residues 25-30), internalizes into mammalian cells, even when coupled to a sizeable cargo, and therefore functions as a cell-penetrating peptide (CPP). Confocal microscopy and co-localization studies indicate that the internalization of bPrPp is mainly through macropinocytosis, a fluid-phase endocytosis process, initiated by binding to cell-surface proteoglycans. Electron microscopy studies show internalized bPrPp-DNA-gold complexes residing in endosomal vesicles. bPrPp induces expression of a complexed luciferase-encoding DNA plasmid, demonstrating the peptide's ability to transport the cargo across the endosomal membrane and into the cytosol and nucleus. The novel CPP activity of the unprocessed N-terminal domain of PrP could be important for the retrotranslocation of partly processed PrP and for PrP trafficking inside or between cells, with implications for the infectivity associated with prion diseases
The cellular prion protein (PrPC) is a highly conserved protein, which is anchored to the outer surface of the plasma membrane. Even though its physiological function has already been investigated in different cell or mouse models where PrPC expression is either up-regulated or depleted, its exact p...
Campeau, Jody L; Wu, Gengshu; Bell, John R; Rasmussen, Jay; Sim, Valerie L
2013-01-01
Prion diseases are infectious neurodegenerative diseases associated with the accumulation of protease-resistant prion protein, neuronal loss, spongiform change and astrogliosis. In the mouse model, the loss of dendritic spines is one of the earliest pathological changes observed in vivo, occurring 4-5 weeks after the first detection of protease-resistant prion protein in the brain. While there are cell culture models of prion infection, most do not recapitulate the neuropathology seen in vivo. Only the recently developed prion organotypic slice culture assay has been reported to undergo neuronal loss and the development of some aspects of prion pathology, namely small vacuolar degeneration and tubulovesicular bodies. Given the rapid replication of prions in this system, with protease-resistant prion protein detectable by 21 days, we investigated whether the dendritic spine loss and altered dendritic morphology seen in prion disease might also develop within the lifetime of this culture system. Indeed, six weeks after first detection of protease-resistant prion protein in tga20 mouse cerebellar slice cultures infected with RML prion strain, we found a statistically significant loss of Purkinje cell dendritic spines and altered dendritic morphology in infected cultures, analogous to that seen in vivo. In addition, we found a transient but statistically significant increase in Purkinje cell dendritic spine density during infection, at the time when protease-resistant prion protein was first detectable in culture. Our findings support the use of this slice culture system as one which recapitulates prion disease pathology and one which may facilitate study of the earliest stages of prion disease pathogenesis.
International Nuclear Information System (INIS)
Cui, P.X.; Lian, F.L.; Wang, Y.; Wen, Yi; Chu, W.S.; Zhao, H.F.; Zhang, S.; Li, J.; Lin, D.H.; Wu, Z.Y.
2014-01-01
Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrP C ) to the post-translationally modified form (PrP Sc ) is thought to be relevant to Cu 2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrP C ) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases. - Highlights: ► The first structure of the metal ion binding site in RaPrP fifth copper-binding site. ► Quantitative determination by XANES spectroscopy combined with ab initio calculations. ► Provide a proof of the roles of copper in prion conformation conversions. ► Provide a proof of the molecular mechanisms of prion-involved diseases
Small stress molecules inhibit aggregation and neurotoxicity of prion peptide 106-126
International Nuclear Information System (INIS)
Kanapathipillai, Mathumai; Ku, Sook Hee; Girigoswami, Koyeli; Park, Chan Beum
2008-01-01
In prion diseases, the posttranslational modification of host-encoded prion protein PrP c yields a high β-sheet content modified protein PrP sc , which further polymerizes into amyloid fibrils. PrP106-126 initiates the conformational changes leading to the conversion of PrP c to PrP sc . Molecules that can defunctionalize such peptides can serve as a potential tool in combating prion diseases. In microorganisms during stressed conditions, small stress molecules (SSMs) are formed to prevent protein denaturation and maintain protein stability and function. The effect of such SSMs on PrP106-126 amyloid formation is explored in the present study using turbidity, atomic force microscopy (AFM), and cellular toxicity assay. Turbidity and AFM studies clearly depict that the SSMs-ectoine and mannosylglyceramide (MGA) inhibit the PrP106-126 aggregation. Our study also connotes that ectoine and MGA offer strong resistance to prion peptide-induced toxicity in human neuroblastoma cells, concluding that such molecules can be potential inhibitors of prion aggregation and toxicity
Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.
2014-02-01
Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.
Unraveling the key to the resistance of canids to prion diseases.
Directory of Open Access Journals (Sweden)
Natalia Fernández-Borges
2017-11-01
Full Text Available One of the characteristics of prions is their ability to infect some species but not others and prion resistant species have been of special interest because of their potential in deciphering the determinants for susceptibility. Previously, we developed different in vitro and in vivo models to assess the susceptibility of species that were erroneously considered resistant to prion infection, such as members of the Leporidae and Equidae families. Here we undertake in vitro and in vivo approaches to understand the unresolved low prion susceptibility of canids. Studies based on the amino acid sequence of the canine prion protein (PrP, together with a structural analysis in silico, identified unique key amino acids whose characteristics could orchestrate its high resistance to prion disease. Cell- and brain-based PMCA studies were performed highlighting the relevance of the D163 amino acid in proneness to protein misfolding. This was also investigated by the generation of a novel transgenic mouse model carrying this substitution and these mice showed complete resistance to disease despite intracerebral challenge with three different mouse prion strains (RML, 22L and 301C known to cause disease in wild-type mice. These findings suggest that dog D163 amino acid is primarily, if not totally, responsible for the prion resistance of canids.
Structural determinants of phenotypic diversity and replication rate of human prions.
Directory of Open Access Journals (Sweden)
Jiri G Safar
2015-04-01
Full Text Available The infectious pathogen responsible for prion diseases is the misfolded, aggregated form of the prion protein, PrPSc. In contrast to recent progress in studies of laboratory rodent-adapted prions, current understanding of the molecular basis of human prion diseases and, especially, their vast phenotypic diversity is very limited. Here, we have purified proteinase resistant PrPSc aggregates from two major phenotypes of sporadic Creutzfeldt-Jakob disease (sCJD, determined their conformational stability and replication tempo in vitro, as well as characterized structural organization using recently emerged approaches based on hydrogen/deuterium (H/D exchange coupled with mass spectrometry. Our data clearly demonstrate that these phenotypically distant prions differ in a major way with regard to their structural organization, both at the level of the polypeptide backbone (as indicated by backbone amide H/D exchange data as well as the quaternary packing arrangements (as indicated by H/D exchange kinetics for histidine side chains. Furthermore, these data indicate that, in contrast to previous observations on yeast and some murine prion strains, the replication rate of sCJD prions is primarily determined not by conformational stability but by specific structural features that control the growth rate of prion protein aggregates.
RESEARCH ARTICLE A cross-sectional study of PRNP gene in two ...
Indian Academy of Sciences (India)
Navya
Prion protein gene (PRNP) analysis revealed that none of the scrapie cases carried the p.Gln222Lys ... genetic variation, with low presence of wild type goats and the lack of protective alleles. .... We analyzed 157 clinically healthy goats (94 males and 63 females) in more than 20 .... Results from a retrospective cohort study.
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Regulation of the Hsp104 middle domain activity is critical for yeast prion propagation.
Directory of Open Access Journals (Sweden)
Jennifer E Dulle
Full Text Available Molecular chaperones play a significant role in preventing protein misfolding and aggregation. Indeed, some protein conformational disorders have been linked to changes in the chaperone network. Curiously, in yeast, chaperones also play a role in promoting prion maintenance and propagation. While many amyloidogenic proteins are associated with disease in mammals, yeast prion proteins, and their ability to undergo conformational conversion into a prion state, are proposed to play a functional role in yeast biology. The chaperone Hsp104, a AAA+ ATPase, is essential for yeast prion propagation. Hsp104 fragments large prion aggregates to generate a population of smaller oligomers that can more readily convert soluble monomer and be transmitted to daughter cells. Here, we show that the middle (M domain of Hsp104, and its mobility, plays an integral part in prion propagation. We generated and characterized mutations in the M-domain of Hsp104 that are predicted to stabilize either a repressed or de-repressed conformation of the M-domain (by analogy to ClpB in bacteria. We show that the predicted stabilization of the repressed conformation inhibits general chaperone activity. Mutation to the de-repressed conformation, however, has differential effects on ATP hydrolysis and disaggregation, suggesting that the M-domain is involved in coupling these two activities. Interestingly, we show that changes in the M-domain differentially affect the propagation of different variants of the [PSI+] and [RNQ+] prions, which indicates that some prion variants are more sensitive to changes in the M-domain mobility than others. Thus, we provide evidence that regulation of the M-domain of Hsp104 is critical for efficient prion propagation. This shows the importance of elucidating the function of the M-domain in order to understand the role of Hsp104 in the propagation of different prions and prion variants.
Head, Mark W; Ironside, James W
2012-07-01
Creutzfeldt-Jakob disease is a fatal neurodegenerative disease that primarily affects the central nervous system. In this respect, it can be considered alongside the more frequently occurring neurodegenerative diseases, such as Alzheimer's disease. Creutzfeldt-Jakob disease is perhaps the paradigmatic protein misfolding disorder, so comparisons between the mechanisms involved in Creutzfeldt-Jakob disease and other neurodegenerative diseases associated with protein misfolding (such as the tauopathies and synucleinopathies) may also be informative. Like many of these diseases, Creutzfeldt-Jakob disease occurs sporadically or can, more rarely, be associated with mutations. However, Creutzfeldt-Jakob disease can also be acquired and is experimentally transmissible. These properties have had profound public health implications and made the disease of interest to virologists, in addition to those interested in protein misfolding disorders and neurodegeneration. The possible causes for the pronounced phenotypic variation among different forms of Creutzfeldt-Jakob disease are beginning to become understood, and these appear to depend in large measure on the genetics of the host (specifically the sequence of the prion protein gene, PRNP) and the epigenetic aspects of the agent (thought to be a misfolded and aggregated form of the PRNP gene product, termed a prion). This review will examine whether this model in its present form has sufficient complexity and subtlety to account for the clinicopathological variation evident in Creutzfeldt-Jakob disease and will outline the ways in which a more complete and informative molecular definition of human prions are currently being sought. Copyright © 2012 John Wiley & Sons, Ltd.
Epidemiological analysis of data for scrapie in Great Britain
Hagenaars, T.H.J.; Donnelly, C.; Ferguson, N.M.
2006-01-01
In recent years, the control or eradication of scrapie and any other transmissible spongiform encephalopathies (TSEs) possibly circulating in the sheep population has become a priority in Britain and elsewhere in Europe. A better understanding of the epidemiology of scrapie would greatly aid the
Prion diseases: immunotargets and therapy
Directory of Open Access Journals (Sweden)
Burchell JT
2016-06-01
Full Text Available Jennifer T Burchell, Peter K Panegyres Neurodegenerative Disorders Research Pty Ltd, West Perth, Western Australia, Australia Abstract: Transmissible spongiform encephathalopathies or prion diseases are a group of neurological disorders characterized by neuronal loss, spongiform degeneration, and activation of astrocytes or microglia. These diseases affect humans and animals with an extremely high prevalence in some species such as deer and elk in North America. Although rare in humans, they result in a devastatingly swift neurological progression with dementia and ataxia. Patients usually die within a year of diagnosis. Prion diseases are familial, sporadic, iatrogenic, or transmissible. Human prion diseases include Kuru, sporadic, iatrogenic, and familial forms of Creutzfeldt–Jakob disease, variant Creutzfeldt–Jakob disease, Gerstmann–Sträussler–Scheinker disease, and fatal familial insomnia. The causative agent is a misfolded version of the physiological prion protein called PrPSc in the brain. There are a number of therapeutic options currently under investigation. A number of small molecules have had some success in delaying disease progression in animal models and mixed results in clinical trials, including pentosan polysulfate, quinacrine, and amphotericin B. More promisingly, immunotherapy has reported success in vitro and in vivo in animal studies and clinical trials. The three main branches of immunotherapy research are focus on antibody vaccines, dendritic cell vaccines, and adoptive transfer of physiological prion protein-specific CD4+ T-lymphocytes. Vaccines utilizing antibodies generally target disease-specific epitopes that are only exposed in the misfolded PrPSc conformation. Vaccines utilizing antigen-loaded dendritic cell have the ability to bypass immune tolerance and prime CD4+ cells to initiate an immune response. Adoptive transfer of CD4+ T-cells is another promising target as this cell type can orchestrate the
RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. Y. Prosekov
2016-01-01
Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Directory of Open Access Journals (Sweden)
Kazunori Sano
Full Text Available INTRODUCTION: The definitive diagnosis of genetic prion diseases (gPrD requires pathological confirmation. To date, diagnosis has relied upon the finding of the biomarkers 14-3-3 protein and total tau (t-tau protein in the cerebrospinal fluid (CSF, but many researchers have reported that these markers are not sufficiently elevated in gPrD, especially in Gerstmann-Sträussler-Scheinker syndrome (GSS. We recently developed a new in vitro amplification technology, designated "real-time quaking-induced conversion (RT-QUIC", to detect the abnormal form of prion protein in CSF from sporadic Creutzfeldt-Jakob disease (sCJD patients. In the present study, we aimed to investigate the presence of biomarkers and evaluate RT-QUIC assay in patients with gPrD, as the utility of RT-QUIC as a diagnostic tool in gPrD has yet to be determined. METHOD/PRINCIPAL FINDINGS: 56 CSF samples were obtained from gPrD patients, including 20 cases of GSS with P102L mutation, 12 cases of fatal familial insomnia (FFI; D178N, and 24 cases of genetic CJD (gCJD, comprising 22 cases with E200K mutation and 2 with V203I mutation. We subjected all CSF samples to RT-QUIC assay, analyzed 14-3-3 protein by Western blotting, and measured t-tau protein using an ELISA kit. The detection sensitivities of RT-QUIC were as follows: GSS (78%, FFI (100%, gCJD E200K (87%, and gCJD V203I (100%. On the other hand the detection sensitivities of biomarkers were considerably lower: GSS (11%, FFI (0%, gCJD E200K (73%, and gCJD V203I (67%. Thus, RT-QUIC had a much higher detection sensitivity compared with testing for biomarkers, especially in patients with GSS and FFI. CONCLUSION/SIGNIFICANCE: RT-QUIC assay is more sensitive than testing for biomarkers in gPrD patients. RT-QUIC method would thus be useful as a diagnostic tool when the patient or the patient's family does not agree to genetic testing, or to confirm the diagnosis in the presence of a positive result for genetic testing.
Energy Technology Data Exchange (ETDEWEB)
Krasnoslobodtsev, Alexey V., E-mail: akrasnos@unomaha.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Department of Physics, University of Nebraska Omaha, Omaha, NE 68182 (United States); Deckert-Gaudig, Tanja [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Zhang, Yuliang [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Deckert, Volker [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Institute for Physical Chemistry and Abbe Center of Photonics, University of Jena, Helmholtzweg 4, D-07743 Jena (Germany); Lyubchenko, Yuri L., E-mail: ylyubchenko@unmc.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States)
2016-06-15
Aggregation of prion proteins is the cause of various prion related diseases. The infectious form of prions, amyloid aggregates, exist as multiple strains. The strains are thought to represent structurally different prion protein molecules packed into amyloid aggregates, but the knowledge on the structure of different types of aggregates is limited. Here we report on the use of AFM (Atomic Force Microscopy) and TERS (Tip-Enhanced Raman Scattering) to study morphological heterogeneity and access underlying conformational features of individual amyloid aggregates. Using AFM we identified the morphology of amyloid fibrils formed by the peptide (CGNNQQNY) from the yeast prion protein Sup35 that is critically involved in the aggregation of the full protein. TERS results demonstrate that morphologically different amyloid fibrils are composed of a distinct set of conformations. Fibrils formed at pH 5.6 are composed of a mixture of peptide conformations (β-sheets, random coil and α-helix) while fibrils formed in pH~2 solution primarily have β-sheets. Additionally, peak positions in the amide III region of the TERS spectra suggested that peptides have parallel arrangement of β-sheets for pH~2 fibrils and antiparallel arrangement for fibrils formed at pH 5.6. We also developed a methodology for detailed analysis of the peptide secondary structure by correlating intensity changes of Raman bands in different regions of TERS spectra. Such correlation established that structural composition of peptides is highly localized with large contribution of unordered secondary structures on a fibrillar surface. - Highlights: • Amyloid polymorphs were characterized by AFM and TERS. • A mixture of peptide secondary structures in fibrils were identified using TERS. • TERS recognizes packing arrangement (parallel versus antiparallel) of peptides. • TERS is a powerful tool for high resolution structural analysis of fibrils.
Directory of Open Access Journals (Sweden)
Victoria Lewis
Full Text Available There is increasing evidence of molecular and cellular links between Alzheimer's disease (AD and prion diseases. The cellular prion protein, PrP(C, modulates the post-translational processing of the AD amyloid precursor protein (APP, through its inhibition of the β-secretase BACE1, and oligomers of amyloid-β bind to PrP(C which may mediate amyloid-β neurotoxicity. In addition, the APP intracellular domain (AICD, which acts as a transcriptional regulator, has been reported to control the expression of PrP(C. Through the use of transgenic mice, cell culture models and manipulation of APP expression and processing, this study aimed to clarify the role of AICD in regulating PrP(C. Over-expression of the three major isoforms of human APP (APP(695, APP(751 and APP(770 in cultured neuronal and non-neuronal cells had no effect on the level of endogenous PrP(C. Furthermore, analysis of brain tissue from transgenic mice over-expressing either wild type or familial AD associated mutant human APP revealed unaltered PrP(C levels. Knockdown of endogenous APP expression in cells by siRNA or inhibition of γ-secretase activity also had no effect on PrP(C levels. Overall, we did not detect any significant difference in the expression of PrP(C in any of the cell or animal-based paradigms considered, indicating that the control of cellular PrP(C levels by AICD is not as straightforward as previously suggested.
Infectious prion diseases in humans: cannibalism, iatrogenicity and zoonoses.
Haïk, Stéphane; Brandel, Jean-Philippe
2014-08-01
In contrast with other neurodegenerative disorders associated to protein misfolding, human prion diseases include infectious forms (also called transmitted forms) such as kuru, iatrogenic Creutzfeldt-Jakob disease and variant Creutzfeldt-Jakob disease. The transmissible agent is thought to be solely composed of the abnormal isoform (PrP(Sc)) of the host-encoded prion protein that accumulated in the central nervous system of affected individuals. Compared to its normal counterpart, PrP(Sc) is β-sheet enriched and aggregated and its propagation is based on an autocatalytic conversion process. Increasing evidence supports the view that conformational variations of PrP(Sc) encoded the biological properties of the various prion strains that have been isolated by transmission studies in experimental models. Infectious forms of human prion diseases played a pivotal role in the emergence of the prion concept and in the characterization of the very unconventional properties of prions. They provide a unique model to understand how prion strains are selected and propagate in humans. Here, we review and discuss how genetic factors interplay with strain properties and route of transmission to influence disease susceptibility, incubation period and phenotypic expression in the light of the kuru epidemics due to ritual endocannibalism, the various series iatrogenic diseases secondary to extractive growth hormone treatment or dura mater graft and the epidemics of variant Creutzfeldt-Jakob disease linked to dietary exposure to the agent of bovine spongiform encephalopathy. Copyright © 2014 Elsevier B.V. All rights reserved.
Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates
Tyedmers, Jens
2012-01-01
The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721
Huang, Hongsheng; Soutyrine, Andrei; Rendulich, Jasmine; O'Rourke, Katherine; Balachandran, Aru
2011-01-01
Tissues unsuitable for standard immunohistochemical and histopathological examinations for chronic wasting disease (CWD) in cervids and for scrapie in sheep are frequently submitted for testing. This study investigated the effects of experimental autolysis on the detection of abnormal prion protein (PrPsc) in lymphoid and central nervous system (CNS) tissues from elk and sheep. The PrPsc was detected using a Western blotting (WB) test following PrPsc enrichment using sodium phosphotungstic acid (PTA) precipitation (PTA-WB). A commercial enzyme-linked immunosorbent assay (ELISA) was used as a reference test for quantitative measurement. This study showed that the amount of PrPsc in lymphoid and CNS tssues from elk and sheep decreased gradually as a result of autolysis, but PrPsc was still detectable after 5 and 15 d incubation at 37°C by PTA-WB for all lymphoid and CNS samples. The results of the ELISA supported those of PTA-WB, particularly for CNS tissues. In conclusion, autolysis at 37°C for 15 d would not significantly affect the detection of PrPsc in lymphoid and CNS tissues by WB and ELISA and, particularly, PTA-WB is a valuable and alternative confirmatory test to detect PrPsc in autolyzed lymphoid and CNS samples.
Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection
Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark
2015-02-01
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.
Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark
2015-02-10
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Background: The Rocky Mountain elk (Cervus elaphus nelsoni) prion protein gene exhibits amino acid polymorphism at codon 132, with 132L (leucine) and 132M (methionine) allelic variants present in the population. We have previously shown that following experimental oral challenge with chronic wasting...
A new mutation in the prion protein gene: A patient with dementia and white matter changes
Van Harten, B.; Van Gool, W.A.; Van Langen, I.M.; Deekman, J.M.; Meijerink, P.H.S.; Weinstein, H.C.
2000-01-01
The authors describe the clinical characteristics, MRI abnormalities, and molecular findings in a patient with a novel variant of a two-octarepeat insertion mutation in the prion protein gene. This patient presented with moderately progressive dementia of presenile onset and gait ataxia. MRI showed
Saccharomyces cerevisiae: a sexy yeast with a prion problem.
Kelly, Amy C; Wickner, Reed B
2013-01-01
Yeast prions are infectious proteins that spread exclusively by mating. The frequency of prions in the wild therefore largely reflects the rate of spread by mating counterbalanced by prion growth slowing effects in the host. We recently showed that the frequency of outcross mating is about 1% of mitotic doublings with 23-46% of total matings being outcrosses. These findings imply that even the mildest forms of the [PSI+], [URE3] and [PIN+] prions impart > 1% growth/survival detriment on their hosts. Our estimate of outcrossing suggests that Saccharomyces cerevisiae is far more sexual than previously thought and would therefore be more responsive to the adaptive effects of natural selection compared with a strictly asexual yeast. Further, given its large effective population size, a growth/survival detriment of > 1% for yeast prions should strongly select against prion-infected strains in wild populations of Saccharomyces cerevisiae.
... with facebook share with twitter share with linkedin Prion Diseases Prion diseases are a related group of ... deer and elk. Why Is the Study of Prion Diseases a Priority for NIAID? Much about TSE ...
Molecular architecture of human prion protein amyloid: a parallel, in-register beta-structure.
Cobb, Nathan J; Sönnichsen, Frank D; McHaourab, Hassane; Surewicz, Witold K
2007-11-27
Transmissible spongiform encephalopathies (TSEs) represent a group of fatal neurodegenerative diseases that are associated with conformational conversion of the normally monomeric and alpha-helical prion protein, PrP(C), to the beta-sheet-rich PrP(Sc). This latter conformer is believed to constitute the main component of the infectious TSE agent. In contrast to high-resolution data for the PrP(C) monomer, structures of the pathogenic PrP(Sc) or synthetic PrP(Sc)-like aggregates remain elusive. Here we have used site-directed spin labeling and EPR spectroscopy to probe the molecular architecture of the recombinant PrP amyloid, a misfolded form recently reported to induce transmissible disease in mice overexpressing an N-terminally truncated form of PrP(C). Our data show that, in contrast to earlier, largely theoretical models, the con formational conversion of PrP(C) involves major refolding of the C-terminal alpha-helical region. The core of the amyloid maps to C-terminal residues from approximately 160-220, and these residues form single-molecule layers that stack on top of one another with parallel, in-register alignment of beta-strands. This structural insight has important implications for understanding the molecular basis of prion propagation, as well as hereditary prion diseases, most of which are associated with point mutations in the region found to undergo a refolding to beta-structure.
The scrapie disease process is unaffected by ionizing radiation
International Nuclear Information System (INIS)
Fraser, H.; Farquhar, C.F.; McConnell, I.; Davies, D.
1989-01-01
The incubation period of scrapie, its degenerative neuropathology and the replication of its causal unconventional virus are all tightly controlled parameters of the experimental disease in mice. Each parameter can vary depending on the strain and dose of virus, on the route of infection, and on the host genotype. Exposure to whole-body gamma-irradiation from Cesium 137 has no effect on the progress or development of the disease, based on the three independent indices of incubation period, neuropathology, or infectibility by high or low doses of virus. These results are based on an extensive series of experiments in many mouse strains and are consistent using different strains (ME7, 22A, 79A, 87V) and doses of virus, routes of infection, timing and dose of radiation (3-15 Gy) administered as single or fractionated exposures with or without bone-marrow (b.m.) replacement therapy. Levels of infection in the spleen are unaltered after lethal whole-body irradiation of the scrapie-infected host, despite several-fold reductions in tissue mass due to the loss of proliferating myeloid and lymphoid precursor cells and their progeny. Contrary to our earlier suggestion, scrapie infection with the 22A virus does not reduce the effectiveness of post-exposure bone-marrow replacements to recolonize an infected host after repeated ionizing radiation totalling 15Gy. This work narrows the search for the candidate cells and biosynthetic systems which replicate the virus in the lymphoreticular and central nervous systems. Many programmed cellular events are radiation sensitive but protein synthesis is extremely radioresistant
In 2006, a case of H-type bovine spongiform encephalopathy (BSE-H) was diagnosed in a cow that was associated with a heritable polymorphism in the bovine prion protein gene (PRNP) resulting in a lysine for glutamine amino acid substitution at codon 211 (called E211K) of the prion protein. Although t...
Extended scrapie incubation time in goats singly heterozygous for PRNP S146 or K222
Scrapie is the transmissible spongiform encephalopathy (TSE) of sheep and goats, and scrapie eradication in sheep is based in part on strong genetic resistance to classical scrapie. Goats may serve as a scrapie reservoir, and to date there has been no experimental inoculation confirming strong genet...
Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent
2016-02-05
Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of
The Structural Architecture of an Infectious Mammalian Prion Using Electron Cryomicroscopy.
Directory of Open Access Journals (Sweden)
Ester Vázquez-Fernández
2016-09-01
Full Text Available The structure of the infectious prion protein (PrPSc, which is responsible for Creutzfeldt-Jakob disease in humans and bovine spongiform encephalopathy, has escaped all attempts at elucidation due to its insolubility and propensity to aggregate. PrPSc replicates by converting the non-infectious, cellular prion protein (PrPC into the misfolded, infectious conformer through an unknown mechanism. PrPSc and its N-terminally truncated variant, PrP 27-30, aggregate into amorphous aggregates, 2D crystals, and amyloid fibrils. The structure of these infectious conformers is essential to understanding prion replication and the development of structure-based therapeutic interventions. Here we used the repetitive organization inherent to GPI-anchorless PrP 27-30 amyloid fibrils to analyze their structure via electron cryomicroscopy. Fourier-transform analyses of averaged fibril segments indicate a repeating unit of 19.1 Å. 3D reconstructions of these fibrils revealed two distinct protofilaments, and, together with a molecular volume of 18,990 Å3, predicted the height of each PrP 27-30 molecule as ~17.7 Å. Together, the data indicate a four-rung β-solenoid structure as a key feature for the architecture of infectious mammalian prions. Furthermore, they allow to formulate a molecular mechanism for the replication of prions. Knowledge of the prion structure will provide important insights into the self-propagation mechanisms of protein misfolding.
Cross-seeding of prions by aggregated α-synuclein leads to transmissible spongiform encephalopathy.
Directory of Open Access Journals (Sweden)
Elizaveta Katorcha
2017-08-01
Full Text Available Aggregation of misfolded proteins or peptides is a common feature of neurodegenerative diseases including Alzheimer's, Parkinson's, Huntington's, prion and other diseases. Recent years have witnessed a growing number of reports of overlap in neuropathological features that were once thought to be unique to only one neurodegenerative disorder. However, the origin for the overlap remains unclear. One possibility is that diseases with mixed brain pathologies might arise from cross-seeding of one amyloidogenic protein by aggregated states of unrelated proteins. In the current study we examined whether prion replication can be induced by cross-seeding by α-synuclein or Aβ peptide. We found that α-synuclein aggregates formed in cultured cells or in vitro display cross-seeding activity and trigger misfolding of the prion protein (PrPC in serial Protein Misfolding Cyclic Amplification reactions, producing self-replicating PrP states characterized by a short C-terminal proteinase K (PK-resistant region referred to as PrPres. Non-fibrillar α-synuclein or fibrillar Aβ failed to cross-seed misfolding of PrPC. Remarkably, PrPres triggered by aggregated α-synuclein in vitro propagated in animals and, upon serial transmission, produced PrPSc and clinical prion disease characterized by spongiosis and astrocytic gliosis. The current study demonstrates that aggregated α-synuclein is potent in cross-seeding of prion protein misfolding and aggregation in vitro, producing self-replicating states that can lead to transmissible prion diseases upon serial passaging in wild type animals. In summary, the current work documents direct cross-seeding between unrelated amyloidogenic proteins associated with different neurodegenerative diseases. This study suggests that early interaction between unrelated amyloidogenic proteins might underlie the etiology of mixed neurodegenerative proteinopathies.
Effect of metal ions on de novo aggregation of full-length prion protein
International Nuclear Information System (INIS)
Giese, Armin; Levin, Johannes; Bertsch, Uwe; Kretzschmar, Hans
2004-01-01
It is well established that the prion protein (PrP) contains metal ion binding sites with specificity for copper. Changes in copper levels have been suggested to influence incubation time in experimental prion disease. Therefore, we studied the effect of heavy metal ions (Cu 2+ , Mn 2+ , Ni 2+ , Co 2+ , and Zn 2+ ) in vitro in a model system that utilizes changes in the concentration of SDS to induce structural conversion and aggregation of recombinant PrP. To quantify and characterize PrP aggregates, we used fluorescently labelled PrP and cross-correlation analysis as well as scanning for intensely fluorescent targets in a confocal single molecule detection system. We found a specific strong pro-aggregatory effect of Mn 2+ at low micromolar concentrations that could be blocked by nanomolar concentration of Cu 2+ . These findings suggest that metal ions such as copper and manganese may also affect PrP conversion in vivo
Directory of Open Access Journals (Sweden)
Dongseob Tark
Full Text Available Bovine spongiform encephalopathy (BSE is a zoonotic transmissible spongiform encephalopathy (TSE thought to be caused by the same prion strain as variant Creutzfeldt-Jakob disease (vCJD. Unlike scrapie and chronic wasting disease there is no cell culture model allowing the replication of proteinase K resistant BSE (PrPBSE and the further in vitro study of this disease. We have generated a cell line based on the Madin-Darby Bovine Kidney (MDBK cell line over-expressing the bovine prion protein. After exposure to naturally BSE-infected bovine brain homogenate this cell line has shown to replicate and accumulate PrPBSE and maintain infection up to passage 83 after initial challenge. Collectively, we demonstrate, for the first time, that the BSE agent can infect cell lines over-expressing the bovine prion protein similar to other prion diseases. These BSE infected cells will provide a useful tool to facilitate the study of potential therapeutic agents and the diagnosis of BSE.
Czech Academy of Sciences Publication Activity Database
Zawada, Zbigniew; Šebestík, Jaroslav; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan
2008-01-01
Roč. 14, č. 8 (2008), s. 76-77 ISSN 1075-2617. [European Peptide Symposium /30./. 31.08.2008-05.09.2008, Helsinki] R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * neurodegenerative diseases * chemical synthesis * ligation conditions Subject RIV: CC - Organic Chemistry
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.; Al-Talla, Zeyad; Guo, Xianrong; Al-Ghamdi, Suliman; Al-Masri, Harbi Tomah
2013-01-01
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.
2013-02-24
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Prions and neuro degenerative diseases
African Journals Online (AJOL)
user
2011-03-28
Mar 28, 2011 ... scrapie (a fatal disease of sheep and goats), mad cow disease, Creutzfeldt-Jacob disease, fatal familial insomnia, kuru .... The scrapie agent is extremely resistant to heat ... movement, or the stress of handling, the animal may.
Conformational detection of prion protein with biarsenical labeling and FlAsH fluorescence
International Nuclear Information System (INIS)
Coleman, Bradley M.; Nisbet, Rebecca M.; Han, Sen; Cappai, Roberto; Hatters, Danny M.; Hill, Andrew F.
2009-01-01
Prion diseases are associated with the misfolding of the host-encoded cellular prion protein (PrP C ) into a disease associated form (PrP Sc ). Recombinant PrP can be refolded into either an α-helical rich conformation (α-PrP) resembling PrP C or a β-sheet rich, protease resistant form similar to PrP Sc . Here, we generated tetracysteine tagged recombinant PrP, folded this into α- or β-PrP and determined the levels of FlAsH fluorescence. Insertion of the tetracysteine tag at three different sites within the 91-111 epitope readily distinguished β-PrP from α-PrP upon FlAsH labeling. Labelling of tetracysteine tagged PrP in the α-helical form showed minimal fluorescence, whereas labeling of tagged PrP in the β-sheet form showed high fluorescence indicating that this region is exposed upon conversion. This highlights a region of PrP that can be implicated in the development of diagnostics and is a novel, protease free mechanism for distinguishing PrP Sc from PrP C . This technique may also be applied to any protein that undergoes conformational change and/or misfolding such as those involved in other neurodegenerative disorders including Alzheimer's, Huntington's and Parkinson's diseases.
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp−/−) mice. So far, six types of Prnp−/− mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not fully reveal PrP functions. Recently, varieties of Prnp−/− cell lines established from Prnp−/− mice have contributed to the analysis of PrP functions. In this mini-review, we focus on Prnp−/− cell lines and summarize currently available Prnp−/− cell lines and their characterizations. In addition, we introduce the recent advances in the methodology of cell line generation with knockout or knockdown of the PrP gene. We also discuss how these cell lines have provided valuable insights into PrP functions and show future perspectives. PMID:25642423
Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice.
Giles, Kurt; Berry, David B; Condello, Carlo; Dugger, Brittany N; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B Michael; Olson, Steven H; Prusiner, Stanley B
2016-09-01
Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure-activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Fungal prion HET-s as a model for structural complexity and self-propagation in prions.
Wan, William; Stubbs, Gerald
2014-04-08
The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.
Mammalian prions: tolerance to sequence changes-how far?
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.
Inactivation of animal and human prions by hydrogen peroxide gas plasma sterilization.
Rogez-Kreuz, C; Yousfi, R; Soufflet, C; Quadrio, I; Yan, Z-X; Huyot, V; Aubenque, C; Destrez, P; Roth, K; Roberts, C; Favero, M; Clayette, P
2009-08-01
Prions cause various transmissible spongiform encephalopathies. They are highly resistant to the chemical and physical decontamination and sterilization procedures routinely used in healthcare facilities. The decontamination procedures recommended for the inactivation of prions are often incompatible with the materials used in medical devices. In this study, we evaluated the use of low-temperature hydrogen peroxide gas plasma sterilization systems and other instrument-processing procedures for inactivating human and animal prions. We provide new data concerning the efficacy of hydrogen peroxide against prions from in vitro or in vivo tests, focusing on the following: the efficiency of hydrogen peroxide sterilization and possible interactions with enzymatic or alkaline detergents, differences in the efficiency of this treatment against different prion strains, and the influence of contaminating lipids. We found that gaseous hydrogen peroxide decreased the infectivity of prions and/or the level of the protease-resistant form of the prion protein on different surface materials. However, the efficiency of this treatment depended strongly on the concentration of hydrogen peroxide and the delivery system used in medical devices, because these effects were more pronounced for the new generation of Sterrad technology. The Sterrad NX sterilizer is 100% efficient (0% transmission and no protease-resistant form of the prion protein signal detected on the surface of the material for the mouse-adapted bovine spongiform encephalopathy 6PB1 strain and a variant Creutzfeldt-Jakob disease strain). Thus, gaseous or vaporized hydrogen peroxide efficiently inactivates prions on the surfaces of medical devices.