Complexity of deciding detectability in discrete event systems
Czech Academy of Sciences Publication Activity Database
Masopust, Tomáš
2018-01-01
Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer science s, information science , bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www. science direct.com/ science /article/pii/S0005109818301730
Complexity of deciding detectability in discrete event systems
Czech Academy of Sciences Publication Activity Database
Masopust, Tomáš
2018-01-01
Roč. 93, July (2018), s. 257-261 ISSN 0005-1098 Institutional support: RVO:67985840 Keywords : discrete event systems * finite automata * detectability Subject RIV: BA - General Mathematics OBOR OECD: Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8) Impact factor: 5.451, year: 2016 https://www.sciencedirect.com/science/article/pii/S0005109818301730
Directory of Open Access Journals (Sweden)
Naing C
2012-08-01
Full Text Available Cho Naing,1,3 Kyan Aung,1 Syed Imran Ahmed,2 Joon Wah Mak31School of Medical Sciences, 2School of Pharmacy and Health Sciences, 3School of Postgraduate Studies and Research, International Medical University, Kuala Lumpur, MalaysiaBackground: For all medications, there is a trade-off between benefits and potential for harm. It is important for patient safety to detect drug-event combinations and analyze by appropriate statistical methods. Mefloquine is used as chemoprophylaxis for travelers going to regions with known chloroquine-resistant Plasmodium falciparum malaria. As such, there is a concern about serious adverse events associated with mefloquine chemoprophylaxis. The objective of the present study was to assess whether any signal would be detected for the serious adverse events of mefloquine, based on data in clinicoepidemiological studies.Materials and methods: We extracted data on adverse events related to mefloquine chemoprophylaxis from the two published datasets. Disproportionality reporting of adverse events such as neuropsychiatric events and other adverse events was presented in the 2 × 2 contingency table. Reporting odds ratio and corresponding 95% confidence interval [CI] data-mining algorithm was applied for the signal detection. The safety signals are considered significant when the ROR estimates and the lower limits of the corresponding 95% CI are ≥2.Results: Two datasets addressing adverse events of mefloquine chemoprophylaxis (one from a published article and one from a Cochrane systematic review were included for analyses. Reporting odds ratio 1.58, 95% CI: 1.49–1.68 based on published data in the selected article, and 1.195, 95% CI: 0.94–1.44 based on data in the selected Cochrane review. Overall, in both datasets, the reporting odds ratio values of lower 95% CI were less than 2.Conclusion: Based on available data, findings suggested that signals for serious adverse events pertinent to neuropsychiatric event were
Automated Feature and Event Detection with SDO AIA and HMI Data
Davey, Alisdair; Martens, P. C. H.; Attrill, G. D. R.; Engell, A.; Farid, S.; Grigis, P. C.; Kasper, J.; Korreck, K.; Saar, S. H.; Su, Y.; Testa, P.; Wills-Davey, M.; Savcheva, A.; Bernasconi, P. N.; Raouafi, N.-E.; Delouille, V. A.; Hochedez, J. F..; Cirtain, J. W.; Deforest, C. E.; Angryk, R. A.; de Moortel, I.; Wiegelmann, T.; Georgouli, M. K.; McAteer, R. T. J.; Hurlburt, N.; Timmons, R.
The Solar Dynamics Observatory (SDO) represents a new frontier in quantity and quality of solar data. At about 1.5 TB/day, the data will not be easily digestible by solar physicists using the same methods that have been employed for images from previous missions. In order for solar scientists to use the SDO data effectively they need meta-data that will allow them to identify and retrieve data sets that address their particular science questions. We are building a comprehensive computer vision pipeline for SDO, abstracting complete metadata on many of the features and events detectable on the Sun without human intervention. Our project unites more than a dozen individual, existing codes into a systematic tool that can be used by the entire solar community. The feature finding codes will run as part of the SDO Event Detection System (EDS) at the Joint Science Operations Center (JSOC; joint between Stanford and LMSAL). The metadata produced will be stored in the Heliophysics Event Knowledgebase (HEK), which will be accessible on-line for the rest of the world directly or via the Virtual Solar Observatory (VSO) . Solar scientists will be able to use the HEK to select event and feature data to download for science studies.
Towards Detecting the Crowd Involved in Social Events
Directory of Open Access Journals (Sweden)
Wei Huang
2017-10-01
Full Text Available Knowing how people interact with urban environments is fundamental for a variety of fields, ranging from transportation to social science. Despite the fact that human mobility patterns have been a major topic of study in recent years, a challenge to understand large-scale human behavior when a certain event occurs remains due to a lack of either relevant data or suitable approaches. Psychological crowd refers to a group of people who are usually located at different places and show different behaviors, but who are very sensitively driven to take the same act (gather together by a certain event, which has been theoretically studied by social psychologists since the 19th century. This study aims to propose a computational approach using a machine learning method to model psychological crowds, contributing to the better understanding of human activity patterns under events. Psychological features and mental unity of the crowd are computed to detect the involved individuals. A national event happening across the USA in April, 2015 is analyzed using geotagged tweets as a case study to test our approach. The result shows that 81% of individuals in the crowd can be successfully detected. Through investigating the geospatial pattern of the involved users, not only can the event related users be identified but also those unobserved users before the event can be uncovered. The proposed approach can effectively represent the psychological feature and measure the mental unity of the psychological crowd, which sheds light on the study of large-scale psychological crowd and provides an innovative way to understanding human behavior under events.
Using Family Science Day Events to Inspire Future Scientists
Brevik, Corinne
2015-04-01
Dickinson State University organizes four Family Science Day events each fall to increase student engagement in the sciences. Offered on Saturday afternoons, each event focuses on a different science-related theme. Families can attend these events free of charge, and the kids participate in a large-variety of hands-on activities which center around the event's theme. Previous themes include The Amazing Telescope, Night of the Titanic, Dinosaur Prophecy, and Space Exploration. These events are amazing opportunities to show young children how much fun science can be. Many of the kids come from schools where science is neither interactive nor engaging. The activities help the children learn that science is a process of discovery that helps us better understand the world around us. University students staff all of the activity booths at these events, and this has proven to be a very valuable experience for them as well. Some of the students who help are majoring in a science field, and for them, the experience teaches public communication. They learn to break complicated concepts down into simpler terms that young kids can understand. Other students who help with these events are not science majors but may be taking a science course as part of their college curriculum. For these students, the experience reinforces various concepts that they are learning in their science class. For many of them, it also opens their eyes to the idea that science can be engaging. Some of them even discover that they have a true gift for teaching.
A simple strategy for fall events detection
Harrou, Fouzi
2017-01-20
The paper concerns the detection of fall events based on human silhouette shape variations. The detection of fall events is addressed from the statistical point of view as an anomaly detection problem. Specifically, the paper investigates the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart. The MEWMA fall detection scheme has been successfully applied to two publicly available fall detection databases, the UR fall detection dataset (URFD) and the fall detection dataset (FDD). The monitoring strategy developed was able to provide early alert mechanisms in the event of fall situations.
Generalized Detectability for Discrete Event Systems
Shu, Shaolong; Lin, Feng
2011-01-01
In our previous work, we investigated detectability of discrete event systems, which is defined as the ability to determine the current and subsequent states of a system based on observation. For different applications, we defined four types of detectabilities: (weak) detectability, strong detectability, (weak) periodic detectability, and strong periodic detectability. In this paper, we extend our results in three aspects. (1) We extend detectability from deterministic systems to nondeterministic systems. Such a generalization is necessary because there are many systems that need to be modeled as nondeterministic discrete event systems. (2) We develop polynomial algorithms to check strong detectability. The previous algorithms are based on observer whose construction is of exponential complexity, while the new algorithms are based on a new automaton called detector. (3) We extend detectability to D-detectability. While detectability requires determining the exact state of a system, D-detectability relaxes this requirement by asking only to distinguish certain pairs of states. With these extensions, the theory on detectability of discrete event systems becomes more applicable in solving many practical problems. PMID:21691432
Network Science Research Laboratory (NSRL) Discrete Event Toolkit
2016-01-01
ARL-TR-7579 ● JAN 2016 US Army Research Laboratory Network Science Research Laboratory (NSRL) Discrete Event Toolkit by...Laboratory (NSRL) Discrete Event Toolkit by Theron Trout and Andrew J Toth Computational and Information Sciences Directorate, ARL...Research Laboratory (NSRL) Discrete Event Toolkit 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Theron Trout
Joint Attributes and Event Analysis for Multimedia Event Detection.
Ma, Zhigang; Chang, Xiaojun; Xu, Zhongwen; Sebe, Nicu; Hauptmann, Alexander G
2017-06-15
Semantic attributes have been increasingly used the past few years for multimedia event detection (MED) with promising results. The motivation is that multimedia events generally consist of lower level components such as objects, scenes, and actions. By characterizing multimedia event videos with semantic attributes, one could exploit more informative cues for improved detection results. Much existing work obtains semantic attributes from images, which may be suboptimal for video analysis since these image-inferred attributes do not carry dynamic information that is essential for videos. To address this issue, we propose to learn semantic attributes from external videos using their semantic labels. We name them video attributes in this paper. In contrast with multimedia event videos, these external videos depict lower level contents such as objects, scenes, and actions. To harness video attributes, we propose an algorithm established on a correlation vector that correlates them to a target event. Consequently, we could incorporate video attributes latently as extra information into the event detector learnt from multimedia event videos in a joint framework. To validate our method, we perform experiments on the real-world large-scale TRECVID MED 2013 and 2014 data sets and compare our method with several state-of-the-art algorithms. The experiments show that our method is advantageous for MED.
Public affairs events at Ocean Sciences Meeting
Uhlenbrock, Kristan
2012-02-01
AGU public affairs will be cohosting two special events at Ocean Sciences 2012 that offer scientists opportunities to expand their communication, policy, and media experience. Join the conversations that highlight two important topics to connect science to society.
Volcano!: An Event-Based Science Module. Teacher's Guide. Geology Module.
Wright, Russell G.
This book is designed for middle school earth science teachers to help their students learn scientific literacy through event-based science. Unlike traditional curricula, the event-based earth science module is a student-centered, interdisciplinary, inquiry-oriented program that emphasizes cooperative learning, teamwork, independent research,…
Lessons Learned from Real-Time, Event-Based Internet Science Communications
Phillips, T.; Myszka, E.; Gallagher, D. L.; Adams, M. L.; Koczor, R. J.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
For the last several years the Science Directorate at Marshall Space Flight Center has carried out a diverse program of Internet-based science communication. The Directorate's Science Roundtable includes active researchers, NASA public relations, educators, and administrators. The Science@NASA award-winning family of Web sites features science, mathematics, and space news. The program includes extended stories about NASA science, a curriculum resource for teachers tied to national education standards, on-line activities for students, and webcasts of real-time events. The focus of sharing science activities in real-time has been to involve and excite students and the public about science. Events have involved meteor showers, solar eclipses, natural very low frequency radio emissions, and amateur balloon flights. In some cases, broadcasts accommodate active feedback and questions from Internet participants. Through these projects a pattern has emerged in the level of interest or popularity with the public. The pattern differentiates projects that include science from those that do not, All real-time, event-based Internet activities have captured public interest at a level not achieved through science stories or educator resource material exclusively. The worst event-based activity attracted more interest than the best written science story. One truly rewarding lesson learned through these projects is that the public recognizes the importance and excitement of being part of scientific discovery. Flying a camera to 100,000 feet altitude isn't as interesting to the public as searching for viable life-forms at these oxygen-poor altitudes. The details of these real-time, event-based projects and lessons learned will be discussed.
Cartan invariants and event horizon detection
Brooks, D.; Chavy-Waddy, P. C.; Coley, A. A.; Forget, A.; Gregoris, D.; MacCallum, M. A. H.; McNutt, D. D.
2018-04-01
We show that it is possible to locate the event horizon of a black hole (in arbitrary dimensions) by the zeros of certain Cartan invariants. This approach accounts for the recent results on the detection of stationary horizons using scalar polynomial curvature invariants, and improves upon them since the proposed method is computationally less expensive. As an application, we produce Cartan invariants that locate the event horizons for various exact four-dimensional and five-dimensional stationary, asymptotically flat (or (anti) de Sitter), black hole solutions and compare the Cartan invariants with the corresponding scalar curvature invariants that detect the event horizon.
Event Coverage Detection and Event Source Determination in Underwater Wireless Sensor Networks
Directory of Open Access Journals (Sweden)
Zhangbing Zhou
2015-12-01
Full Text Available With the advent of the Internet of Underwater Things, smart things are deployed in the ocean space and establish underwater wireless sensor networks for the monitoring of vast and dynamic underwater environments. When events are found to have possibly occurred, accurate event coverage should be detected, and potential event sources should be determined for the enactment of prompt and proper responses. To address this challenge, a technique that detects event coverage and determines event sources is developed in this article. Specifically, the occurrence of possible events corresponds to a set of neighboring sensor nodes whose sensory data may deviate from a normal sensing range in a collective fashion. An appropriate sensor node is selected as the relay node for gathering and routing sensory data to sink node(s. When sensory data are collected at sink node(s, the event coverage is detected and represented as a weighted graph, where the vertices in this graph correspond to sensor nodes and the weight specified upon the edges reflects the extent of sensory data deviating from a normal sensing range. Event sources are determined, which correspond to the barycenters in this graph. The results of the experiments show that our technique is more energy efficient, especially when the network topology is relatively steady.
Subsurface event detection and classification using Wireless Signal Networks.
Yoon, Suk-Un; Ghazanfari, Ehsan; Cheng, Liang; Pamukcu, Sibel; Suleiman, Muhannad T
2012-11-05
Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs). The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.
Ferragut, Erik M.; Laska, Jason A.; Bridges, Robert A.
2016-06-07
A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The system can include a plurality of anomaly detectors that together implement an algorithm to identify low-probability events and detect atypical traffic patterns. The anomaly detector provides for comparability of disparate sources of data (e.g., network flow data and firewall logs.) Additionally, the anomaly detector allows for regulatability, meaning that the algorithm can be user configurable to adjust a number of false alerts. The anomaly detector can be used for a variety of probability density functions, including normal Gaussian distributions, irregular distributions, as well as functions associated with continuous or discrete variables.
Leisure and Pleasure: Science events in unusual locations
Bultitude, Karen; Margarida Sardo, Ana
2012-12-01
Building on concepts relating to informal science education, this work compares science-related activities which successfully engaged public audiences at three different 'generic' locations: a garden festival, a public park, and a music festival. The purpose was to identify what factors contribute to the perceived success of science communication activities occurring within leisure spaces. This article reports the results of 71 short (2-3 min) structured interviews with public participants at the events, and 18 structured observations sessions, demonstrating that the events were considered both novel and interesting by the participants. Audience members were found to perceive both educational and affective purposes from the events. Three key elements were identified as contributing to the success of the activities across the three 'generic venues': the informality of the surroundings, the involvement of 'real' scientists, and the opportunity to re-engage participants with scientific concepts outside formal education.
Subsurface Event Detection and Classification Using Wireless Signal Networks
Directory of Open Access Journals (Sweden)
Muhannad T. Suleiman
2012-11-01
Full Text Available Subsurface environment sensing and monitoring applications such as detection of water intrusion or a landslide, which could significantly change the physical properties of the host soil, can be accomplished using a novel concept, Wireless Signal Networks (WSiNs. The wireless signal networks take advantage of the variations of radio signal strength on the distributed underground sensor nodes of WSiNs to monitor and characterize the sensed area. To characterize subsurface environments for event detection and classification, this paper provides a detailed list and experimental data of soil properties on how radio propagation is affected by soil properties in subsurface communication environments. Experiments demonstrated that calibrated wireless signal strength variations can be used as indicators to sense changes in the subsurface environment. The concept of WSiNs for the subsurface event detection is evaluated with applications such as detection of water intrusion, relative density change, and relative motion using actual underground sensor nodes. To classify geo-events using the measured signal strength as a main indicator of geo-events, we propose a window-based minimum distance classifier based on Bayesian decision theory. The window-based classifier for wireless signal networks has two steps: event detection and event classification. With the event detection, the window-based classifier classifies geo-events on the event occurring regions that are called a classification window. The proposed window-based classification method is evaluated with a water leakage experiment in which the data has been measured in laboratory experiments. In these experiments, the proposed detection and classification method based on wireless signal network can detect and classify subsurface events.
Volcano!: An Event-Based Science Module. Student Edition. Geology Module.
Wright, Russell G.
This book is designed for middle school students to learn scientific literacy through event-based science. Unlike traditional curricula, the event-based earth science module is a student-centered, interdisciplinary, inquiry-oriented program that emphasizes cooperative learning, teamwork, independent research, hands-on investigations, and…
Public Outreach Guerilla Style: Just Add Science to Existing Events
Gelderman, Richard
2016-01-01
We report on a campaign to use the visual appeal of astronomy as a gateway drug to inject public outreach into settings where people aren't expecting an encounter with science. Our inspiration came from the team at guerillascience.org, who have earned a reputation for creating, at sites around the world, "experiences and events that are unexpected, thought-provoking, but, above all, that delight and entertain." Our goal is to insert astronomy into existing festivals of music, culture, and art; county and state fairs; sporting events; and local farmer's markets. With volunteers and near-zero budgets, we have been able to meaningfully engage with audience members who would never willingly attend an event advertised as science related. By purposefully relating astronomy to the non-science aspects of the event that caused the audience members to attend, new learning experiences are created that alter the often negative pre-conceived notions about science that many of them held before our encounter.
Event storm detection and identification in communication systems
International Nuclear Information System (INIS)
Albaghdadi, Mouayad; Briley, Bruce; Evens, Martha
2006-01-01
Event storms are the manifestation of an important class of abnormal behaviors in communication systems. They occur when a large number of nodes throughout the system generate a set of events within a small period of time. It is essential for network management systems to detect every event storm and identify its cause, in order to prevent and repair potential system faults. This paper presents a set of techniques for the effective detection and identification of event storms in communication systems. First, we introduce a new algorithm to synchronize events to a single node in the system. Second, the system's event log is modeled as a normally distributed random process. This is achieved by using data analysis techniques to explore and then model the statistical behavior of the event log. Third, event storm detection is proposed using a simple test statistic combined with an exponential smoothing technique to overcome the non-stationary behavior of event logs. Fourth, the system is divided into non-overlapping regions to locate the main contributing regions of a storm. We show that this technique provides us with a method for event storm identification. Finally, experimental results from a commercially deployed multimedia communication system that uses these techniques demonstrate their effectiveness
Metrics for Polyphonic Sound Event Detection
Directory of Open Access Journals (Sweden)
Annamaria Mesaros
2016-05-01
Full Text Available This paper presents and discusses various metrics proposed for evaluation of polyphonic sound event detection systems used in realistic situations where there are typically multiple sound sources active simultaneously. The system output in this case contains overlapping events, marked as multiple sounds detected as being active at the same time. The polyphonic system output requires a suitable procedure for evaluation against a reference. Metrics from neighboring fields such as speech recognition and speaker diarization can be used, but they need to be partially redefined to deal with the overlapping events. We present a review of the most common metrics in the field and the way they are adapted and interpreted in the polyphonic case. We discuss segment-based and event-based definitions of each metric and explain the consequences of instance-based and class-based averaging using a case study. In parallel, we provide a toolbox containing implementations of presented metrics.
Building a Global Catalog of Nonvolcanic Tremor Events Using an Automatic Detection Algorithm
Bagley, B. C.; Revenaugh, J.
2009-12-01
Nonvolcanic tremor is characterized by a long-period seismic event containing a series of low-frequency earthquakes (LFEs). Tremor has been detected in regions of subduction (e.g. Kao et. al. 2007, 2008; Shelly 2006) and beneath the San Andreas fault near Cholame, California (e.g. Nadeau and Dolenc, 2005). In some cases tremor events seem to have periodicity, and these are often referred to as episodic tremor and slip (ETS). The origin of nonvolcanic tremor has been ascribed to shear slip along plate boundaries and/or high pore-fluid pressure. The apparent periodicity and tectonic setting associated with ETS has led to the suggestion that there may be a link between ETS and megathrust earthquakes. Until recently tremor detection has been a manual process requiring visual inspection of seismic data. In areas that have dense seismic arrays (e.g. Japan) waveform cross correlation techniques have been successfully employed (e.g. Obara, 2002). Kao et al. (2007) developed an algorithm for automatic detection of seismic tremor that can be used in regions without dense arrays. This method has been used to create the Tremor Activity Monitoring System (TAMS), which is used by the Geologic Survey of Canada to monitor northern Cascadia. So far the study of nonvolcanic tremor has been limited to regions of subduction or along major transform faults. It is unknown if tremor events occur in other tectonic settings, or if the current detection schemes will be useful for finding them. We propose to look for tremor events in non-subduction regions. It is possible that if tremor exists in other regions it will have different characteristics and may not trigger the TAMS system or be amenable to other existing detection schemes. We are developing algorithms for searching sparse array data sets for quasi-harmonic energy bursts in hopes of recognizing and cataloging nonvolcanic tremor in an expanded tectonic setting. Statistical comparisons against the TAMS algorithm will be made if
Detection of goal events in soccer videos
Kim, Hyoung-Gook; Roeber, Steffen; Samour, Amjad; Sikora, Thomas
2005-01-01
In this paper, we present an automatic extraction of goal events in soccer videos by using audio track features alone without relying on expensive-to-compute video track features. The extracted goal events can be used for high-level indexing and selective browsing of soccer videos. The detection of soccer video highlights using audio contents comprises three steps: 1) extraction of audio features from a video sequence, 2) event candidate detection of highlight events based on the information provided by the feature extraction Methods and the Hidden Markov Model (HMM), 3) goal event selection to finally determine the video intervals to be included in the summary. For this purpose we compared the performance of the well known Mel-scale Frequency Cepstral Coefficients (MFCC) feature extraction method vs. MPEG-7 Audio Spectrum Projection feature (ASP) extraction method based on three different decomposition methods namely Principal Component Analysis( PCA), Independent Component Analysis (ICA) and Non-Negative Matrix Factorization (NMF). To evaluate our system we collected five soccer game videos from various sources. In total we have seven hours of soccer games consisting of eight gigabytes of data. One of five soccer games is used as the training data (e.g., announcers' excited speech, audience ambient speech noise, audience clapping, environmental sounds). Our goal event detection results are encouraging.
Science policy events at the 2012 AGU Fall Meeting
Hankin, Erik
2012-10-01
Are you interested in the intersection of science and policy, looking to make an impact on Capitol Hill, or concerned about the increasing number of attacks against scientists and their academic freedom? AGU Public Affairs offers many events at the 2012 Fall Meeting to assist member involvement in political processes and inform scientists of their rights and options should their research come under legal fire. Learn how you can share your science with policy makers to help inform policy at two luncheon events at the Fall Meeting. If you have ever considered working as a science expert for a member of Congress or reporting science in a mass media outlet, then you should attend the first luncheon, How to be a Congressional Science Fellow or Mass Media Fellow. The event will feature current AGU Congressional Science Fellows detailing their experiences working in Congress as well as past AGU Mass Media Fellows sharing their stories of reporting for a news organization. The luncheon will be held on Tuesday, 4 December, from 12:30 to 1:30 P.M. at the Marriott Hotel, in room Golden Gate B. In addition, current and former fellows will be available for one-on-one interactions at the AGU Marketplace from 3:30 to 4:30 P.M. on Tuesday, 4 December, through Thursday, 6 December.
Abnormal Event Detection in Wireless Sensor Networks Based on Multiattribute Correlation
Directory of Open Access Journals (Sweden)
Mengdi Wang
2017-01-01
Full Text Available Abnormal event detection is one of the vital tasks in wireless sensor networks. However, the faults of nodes and the poor deployment environment have brought great challenges to abnormal event detection. In a typical event detection technique, spatiotemporal correlations are collected to detect an event, which is susceptible to noises and errors. To improve the quality of detection results, we propose a novel approach for abnormal event detection in wireless sensor networks. This approach considers not only spatiotemporal correlations but also the correlations among observed attributes. A dependency model of observed attributes is constructed based on Bayesian network. In this model, the dependency structure of observed attributes is obtained by structure learning, and the conditional probability table of each node is calculated by parameter learning. We propose a new concept named attribute correlation confidence to evaluate the fitting degree between the sensor reading and the abnormal event pattern. On the basis of time correlation detection and space correlation detection, the abnormal events are identified. Experimental results show that the proposed algorithm can reduce the impact of interference factors and the rate of the false alarm effectively; it can also improve the accuracy of event detection.
2013-08-01
A scientific session of the Physical Sciences Division of the Russian Academy of Sciences (RAS), titled "Near-Earth space hazards and their detection", was held on 27 March 2013 at the conference hall of the Lebedev Physical Institute, RAS. The agenda posted on the website of the Physical Sciences Division, RAS, http://www.gpad.ac.ru, included the following reports: (1) Emel'yanenko V V, Shustov B M (Institute of Astronomy, RAS, Moscow) "The Chelyabinsk event and the asteroid-comet hazard"; (2) Chugai N N (Institute of Astronomy, RAS, Moscow) "A physical model of the Chelyabinsk event"; (3) Lipunov V M (Lomonosov Moscow State University, Sternberg Astronomical Institute, Moscow) "MASTER global network of optical monitoring"; (4) Beskin G M (Special Astrophysical Observatory, RAS, Arkhyz, Karachai-Cirkassian Republic) "Wide-field optical monitoring systems with subsecond time resolution for the detection and study of cosmic threats". The expanded papers written on the base of oral reports 1 and 4 are given below. • The Chelyabinsk event and the asteroid-comet hazard, V V Emel'yanenko, B M Shustov Physics-Uspekhi, 2013, Volume 56, Number 8, Pages 833-836 • Wide-field subsecond temporal resolution optical monitoring systems for the detection and study of cosmic hazards, G M Beskin, S V Karpov, V L Plokhotnichenko, S F Bondar, A V Perkov, E A Ivanov, E V Katkova, V V Sasyuk, A Shearer Physics-Uspekhi, 2013, Volume 56, Number 8, Pages 836-842
Using a Family Science Day Event to Engage Youth in Climate Change Issues
Brevik, C.; Brevik, E. C.
2015-12-01
Each fall, Dickinson State University organizes four Family Science Day events for elementary-aged children to increase their engagement in the sciences. Offered on Saturday afternoons, each event focuses on a different science-related theme. Families can attend these events free of charge, and the kids participate in a large variety of hands-on activities which center around the event's theme. This year, the November event focused on climate change and the roles soil plays in the climate system. The timing of this topic was carefully chosen. 2015 has been declared the International Year of Soil by the United Nations, and the Soil Science Society of America theme for the month of November was Soils and Climate. This public outreach event was an amazing opportunity to help the youth in our community learn about climate change and soil in a fun, interactive environment. The activities also helped the children learn how science is a process of discovery that allows them to better understand the world they live in. In addition to the hands-on activities, a planetarium show focusing on climate change was also offered during the event. The fully immersive, 360-degree show allowed the kids and their parents to personally observe phenomena that are otherwise difficult to visualize. All of the activities at the Family Science Day event were staffed by university students, and this proved to be a very valuable experience for them as well. Some of the students who helped are majoring in a science field, and for them, the experience taught public communication. They learned to break complicated concepts down into simpler terms that young kids can understand. Education majors who participated practiced communicating science concepts to children, and students in other majors who helped with this event gained experiences that reinforced various concepts they had learned in their general education science courses.
Learning Multimodal Deep Representations for Crowd Anomaly Event Detection
Directory of Open Access Journals (Sweden)
Shaonian Huang
2018-01-01
Full Text Available Anomaly event detection in crowd scenes is extremely important; however, the majority of existing studies merely use hand-crafted features to detect anomalies. In this study, a novel unsupervised deep learning framework is proposed to detect anomaly events in crowded scenes. Specifically, low-level visual features, energy features, and motion map features are simultaneously extracted based on spatiotemporal energy measurements. Three convolutional restricted Boltzmann machines are trained to model the mid-level feature representation of normal patterns. Then a multimodal fusion scheme is utilized to learn the deep representation of crowd patterns. Based on the learned deep representation, a one-class support vector machine model is used to detect anomaly events. The proposed method is evaluated using two available public datasets and compared with state-of-the-art methods. The experimental results show its competitive performance for anomaly event detection in video surveillance.
Fire!: An Event-Based Science Module. Teacher's Guide. Chemistry and Fire Ecology Module.
Wright, Russell G.
This book is designed for middle school earth science or physical science teachers to help their students learn scientific literacy through event-based science. Unlike traditional curricula, the event- based earth science module is a student-centered, interdisciplinary, inquiry-oriented program that emphasizes cooperative learning, teamwork,…
Non-Linguistic Vocal Event Detection Using Online Random
DEFF Research Database (Denmark)
Abou-Zleikha, Mohamed; Tan, Zheng-Hua; Christensen, Mads Græsbøll
2014-01-01
areas such as object detection, face recognition, and audio event detection. This paper proposes to use online random forest technique for detecting laughter and filler and for analyzing the importance of various features for non-linguistic vocal event classification through permutation. The results...... show that according to the Area Under Curve measure the online random forest achieved 88.1% compared to 82.9% obtained by the baseline support vector machines for laughter classification and 86.8% to 83.6% for filler classification....
Semantic Context Detection Using Audio Event Fusion
Directory of Open Access Journals (Sweden)
Cheng Wen-Huang
2006-01-01
Full Text Available Semantic-level content analysis is a crucial issue in achieving efficient content retrieval and management. We propose a hierarchical approach that models audio events over a time series in order to accomplish semantic context detection. Two levels of modeling, audio event and semantic context modeling, are devised to bridge the gap between physical audio features and semantic concepts. In this work, hidden Markov models (HMMs are used to model four representative audio events, that is, gunshot, explosion, engine, and car braking, in action movies. At the semantic context level, generative (ergodic hidden Markov model and discriminative (support vector machine (SVM approaches are investigated to fuse the characteristics and correlations among audio events, which provide cues for detecting gunplay and car-chasing scenes. The experimental results demonstrate the effectiveness of the proposed approaches and provide a preliminary framework for information mining by using audio characteristics.
Application of Data Cubes for Improving Detection of Water Cycle Extreme Events
Albayrak, Arif; Teng, William
2015-01-01
As part of an ongoing NASA-funded project to remove a longstanding barrier to accessing NASA data (i.e., accessing archived time-step array data as point-time series), for the hydrology and other point-time series-oriented communities, "data cubes" are created from which time series files (aka "data rods") are generated on-the-fly and made available as Web services from the Goddard Earth Sciences Data and Information Services Center (GES DISC). Data cubes are data as archived rearranged into spatio-temporal matrices, which allow for easy access to the data, both spatially and temporally. A data cube is a specific case of the general optimal strategy of reorganizing data to match the desired means of access. The gain from such reorganization is greater the larger the data set. As a use case of our project, we are leveraging existing software to explore the application of the data cubes concept to machine learning, for the purpose of detecting water cycle extreme events, a specific case of anomaly detection, requiring time series data. We investigate the use of support vector machines (SVM) for anomaly classification. We show an example of detection of water cycle extreme events, using data from the Tropical Rainfall Measuring Mission (TRMM).
An Examination of Three Spatial Event Cluster Detection Methods
Directory of Open Access Journals (Sweden)
Hensley H. Mariathas
2015-03-01
Full Text Available In spatial disease surveillance, geographic areas with large numbers of disease cases are to be identified, so that targeted investigations can be pursued. Geographic areas with high disease rates are called disease clusters and statistical cluster detection tests are used to identify geographic areas with higher disease rates than expected by chance alone. In some situations, disease-related events rather than individuals are of interest for geographical surveillance, and methods to detect clusters of disease-related events are called event cluster detection methods. In this paper, we examine three distributional assumptions for the events in cluster detection: compound Poisson, approximate normal and multiple hypergeometric (exact. The methods differ on the choice of distributional assumption for the potentially multiple correlated events per individual. The methods are illustrated on emergency department (ED presentations by children and youth (age < 18 years because of substance use in the province of Alberta, Canada, during 1 April 2007, to 31 March 2008. Simulation studies are conducted to investigate Type I error and the power of the clustering methods.
Unsupervised Event Characterization and Detection in Multichannel Signals: An EEG application
Directory of Open Access Journals (Sweden)
Angel Mur
2016-04-01
Full Text Available In this paper, we propose a new unsupervised method to automatically characterize and detect events in multichannel signals. This method is used to identify artifacts in electroencephalogram (EEG recordings of brain activity. The proposed algorithm has been evaluated and compared with a supervised method. To this end an example of the performance of the algorithm to detect artifacts is shown. The results show that although both methods obtain similar classification, the proposed method allows detecting events without training data and can also be applied in signals whose events are unknown a priori. Furthermore, the proposed method provides an optimal window whereby an optimal detection and characterization of events is found. The detection of events can be applied in real-time.
Spatial-Temporal Event Detection from Geo-Tagged Tweets
Directory of Open Access Journals (Sweden)
Yuqian Huang
2018-04-01
Full Text Available As one of the most popular social networking services in the world, Twitter allows users to post messages along with their current geographic locations. Such georeferenced or geo-tagged Twitter datasets can benefit location-based services, targeted advertising and geosocial studies. Our study focused on the detection of small-scale spatial-temporal events and their textual content. First, we used Spatial-Temporal Density-Based Spatial Clustering of Applications with Noise (ST-DBSCAN to spatially-temporally cluster the tweets. Then, the word frequencies were summarized for each cluster and the potential topics were modeled by the Latent Dirichlet Allocation (LDA algorithm. Using two years of Twitter data from four college cities in the U.S., we were able to determine the spatial-temporal patterns of two known events, two unknown events and one recurring event, which then were further explored and modeled to identify the semantic content about the events. This paper presents our process and recommendations for both finding event-related tweets as well as understanding the spatial-temporal behaviors and semantic natures of the detected events.
Abnormal global and local event detection in compressive sensing domain
Wang, Tian; Qiao, Meina; Chen, Jie; Wang, Chuanyun; Zhang, Wenjia; Snoussi, Hichem
2018-05-01
Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.
Reinventing Image Detective: An Evidence-Based Approach to Citizen Science Online
Romano, C.; Graff, P. V.; Runco, S.
2017-12-01
Usability studies demonstrate that web users are notoriously impatient, spending as little as 15 seconds on a home page. How do you get users to stay long enough to understand a citizen science project? How do you get users to complete complex citizen science tasks online?Image Detective, a citizen science project originally developed by scientists and science engagement specialists at the NASA Johnson Space center to engage the public in the analysis of images taken from space by astronauts to help enhance NASA's online database of astronaut imagery, partnered with the CosmoQuest citizen science platform to modernize, offering new and improved options for participation in Image Detective. The challenge: to create a web interface that builds users' skills and knowledge, creating engagement while learning complex concepts essential to the accurate completion of tasks. The project team turned to usability testing for an objective understanding of how users perceived Image Detective and the steps required to complete required tasks. A group of six users was recruited online for unmoderated and initial testing. The users followed a think-aloud protocol while attempting tasks, and were recorded on video and audio. The usability test examined users' perception of four broad areas: the purpose of and context for Image Detective; the steps required to successfully complete the analysis (differentiating images of Earth's surface from those showing outer space and identifying common surface features); locating the image center point on a map of Earth; and finally, naming geographic locations or natural events seen in the image.Usability test findings demonstrated that the following best practices can increase participation in Image Detective and can be applied to the successful implementation of any citizen science project:• Concise explanation of the project, its context, and its purpose;• Including a mention of the funding agency (in this case, NASA);• A preview of
Analysing recurrent events in exercise science and sports medicine ...
African Journals Online (AJOL)
Episodic or recurrent events are a class of data that is frequently reported in health sciences research. The purpose of this paper is to highlight the prevalence of published reports, especially within the South African context, that have used inappropriate statistical techniques when dealing with episodic events and to urge ...
Tokarchuk, Laurissa; Wang, Xinyue; Poslad, Stefan
2017-01-01
In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM) framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The novel combination of
Directory of Open Access Journals (Sweden)
Laurissa Tokarchuk
Full Text Available In an age when people are predisposed to report real-world events through their social media accounts, many researchers value the benefits of mining user generated content from social media. Compared with the traditional news media, social media services, such as Twitter, can provide more complete and timely information about the real-world events. However events are often like a puzzle and in order to solve the puzzle/understand the event, we must identify all the sub-events or pieces. Existing Twitter event monitoring systems for sub-event detection and summarization currently typically analyse events based on partial data as conventional data collection methodologies are unable to collect comprehensive event data. This results in existing systems often being unable to report sub-events in real-time and often in completely missing sub-events or pieces in the broader event puzzle. This paper proposes a Sub-event detection by real-TIme Microblog monitoring (STRIM framework that leverages the temporal feature of an expanded set of news-worthy event content. In order to more comprehensively and accurately identify sub-events this framework first proposes the use of adaptive microblog crawling. Our adaptive microblog crawler is capable of increasing the coverage of events while minimizing the amount of non-relevant content. We then propose a stream division methodology that can be accomplished in real time so that the temporal features of the expanded event streams can be analysed by a burst detection algorithm. In the final steps of the framework, the content features are extracted from each divided stream and recombined to provide a final summarization of the sub-events. The proposed framework is evaluated against traditional event detection using event recall and event precision metrics. Results show that improving the quality and coverage of event contents contribute to better event detection by identifying additional valid sub-events. The
Abnormal global and local event detection in compressive sensing domain
Directory of Open Access Journals (Sweden)
Tian Wang
2018-05-01
Full Text Available Abnormal event detection, also known as anomaly detection, is one challenging task in security video surveillance. It is important to develop effective and robust movement representation models for global and local abnormal event detection to fight against factors such as occlusion and illumination change. In this paper, a new algorithm is proposed. It can locate the abnormal events on one frame, and detect the global abnormal frame. The proposed algorithm employs a sparse measurement matrix designed to represent the movement feature based on optical flow efficiently. Then, the abnormal detection mission is constructed as a one-class classification task via merely learning from the training normal samples. Experiments demonstrate that our algorithm performs well on the benchmark abnormal detection datasets against state-of-the-art methods.
Analysing recurrent events in exercise science and sports medicine
African Journals Online (AJOL)
Episodic or recurrent events are a class of data that is frequently described in sports medicine literature. However, the correct statis- tical techniques to deal with data containing recurrent events are not widely known within sports medicine and the exercise sciences. This is evidenced by the few papers in these specialist ...
Event-Triggered Fault Detection of Nonlinear Networked Systems.
Li, Hongyi; Chen, Ziran; Wu, Ligang; Lam, Hak-Keung; Du, Haiping
2017-04-01
This paper investigates the problem of fault detection for nonlinear discrete-time networked systems under an event-triggered scheme. A polynomial fuzzy fault detection filter is designed to generate a residual signal and detect faults in the system. A novel polynomial event-triggered scheme is proposed to determine the transmission of the signal. A fault detection filter is designed to guarantee that the residual system is asymptotically stable and satisfies the desired performance. Polynomial approximated membership functions obtained by Taylor series are employed for filtering analysis. Furthermore, sufficient conditions are represented in terms of sum of squares (SOSs) and can be solved by SOS tools in MATLAB environment. A numerical example is provided to demonstrate the effectiveness of the proposed results.
Adams, Mitzi L.; Gallagher, D. L.; Whitt, A.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
For the last several years the Science Directorate at Marshall Space Flight Center has carried out a diverse program of Internet-based science communication. The program includes extended stories about NASA science, a curriculum resource for teachers tied to national education standards, on-line activities for students, and webcasts of real-time events. The focus of sharing real-time science related events has been to involve and excite students and the public about science. Events have involved meteor showers, solar eclipses, natural very low frequency radio emissions, and amateur balloon flights. In some cases broadcasts accommodate active feedback and questions from Internet participants. Panel participation will be used to communicate the problems and lessons learned from these activities over the last three years.
Multivariate algorithms for initiating event detection and identification in nuclear power plants
International Nuclear Information System (INIS)
Wu, Shun-Chi; Chen, Kuang-You; Lin, Ting-Han; Chou, Hwai-Pwu
2018-01-01
Highlights: •Multivariate algorithms for NPP initiating event detection and identification. •Recordings from multiple sensors are simultaneously considered for detection. •Both spatial and temporal information is used for event identification. •Untrained event isolation avoids falsely relating an untrained event. •Efficacy of the algorithms is verified with data from the Maanshan NPP simulator. -- Abstract: To prevent escalation of an initiating event into a severe accident, promptly detecting its occurrence and precisely identifying its type are essential. In this study, several multivariate algorithms for initiating event detection and identification are proposed to help maintain safe operations of nuclear power plants (NPPs). By monitoring changes in the NPP sensing variables, an event is detected when the preset thresholds are exceeded. Unlike existing approaches, recordings from sensors of the same type are simultaneously considered for detection, and no subjective reasoning is involved in setting these thresholds. To facilitate efficient event identification, a spatiotemporal feature extractor is proposed. The extracted features consist of the temporal traits used by existing techniques and the spatial signature of an event. Through an F-score-based feature ranking, only those that are most discriminant in classifying the events under consideration will be retained for identification. Moreover, an untrained event isolation scheme is introduced to avoid relating an untrained event to those in the event dataset so that improper recovery actions can be prevented. Results from experiments containing data of 12 event classes and a total of 125 events generated using a Taiwan’s Maanshan NPP simulator are provided to illustrate the efficacy of the proposed algorithms.
International Nuclear Information System (INIS)
2013-01-01
A scientific session of the Physical Sciences Division of the Russian Academy of Sciences (RAS), titled N ear-Earth space hazards and their detection , was held on 27 March 2013 at the conference hall of the Lebedev Physical Institute, RAS. The agenda posted on the website of the Physical Sciences Division, RAS, http://www.gpad.ac.ru, included the following reports: (1) Emel'yanenko V V, Shustov B M (Institute of Astronomy, RAS, Moscow) T he Chelyabinsk event and the asteroid-comet hazard ; (2) Chugai N N (Institute of Astronomy, RAS, Moscow) A physical model of the Chelyabinsk event ; (3) Lipunov V M (Lomonosov Moscow State University, Sternberg Astronomical Institute, Moscow) M ASTER global network of optical monitoring ; (4) Beskin G M (Special Astrophysical Observatory, RAS, Arkhyz, Karachai-Cirkassian Republic) W ide-field optical monitoring systems with subsecond time resolution for the detection and study of cosmic threats . The expanded papers written on the base of oral reports 1 and 4 are given below. • The Chelyabinsk event and the asteroid-comet hazard, V V Emel'yanenko, B M Shustov Physics-Uspekhi, 2013, Volume 56, Number 8, Pages 833–836 • Wide-field subsecond temporal resolution optical monitoring systems for the detection and study of cosmic hazards, G M Beskin, S V Karpov, V L Plokhotnichenko, S F Bondar, A V Perkov, E A Ivanov, E V Katkova, V V Sasyuk, A Shearer Physics-Uspekhi, 2013, Volume 56, Number 8, Pages 836–842 (conferences and symposia)
Detecting impacts of extreme events with ecological in situ monitoring networks
Directory of Open Access Journals (Sweden)
M. D. Mahecha
2017-09-01
Full Text Available Extreme hydrometeorological conditions typically impact ecophysiological processes on land. Satellite-based observations of the terrestrial biosphere provide an important reference for detecting and describing the spatiotemporal development of such events. However, in-depth investigations of ecological processes during extreme events require additional in situ observations. The question is whether the density of existing ecological in situ networks is sufficient for analysing the impact of extreme events, and what are expected event detection rates of ecological in situ networks of a given size. To assess these issues, we build a baseline of extreme reductions in the fraction of absorbed photosynthetically active radiation (FAPAR, identified by a new event detection method tailored to identify extremes of regional relevance. We then investigate the event detection success rates of hypothetical networks of varying sizes. Our results show that large extremes can be reliably detected with relatively small networks, but also reveal a linear decay of detection probabilities towards smaller extreme events in log–log space. For instance, networks with ≈ 100 randomly placed sites in Europe yield a ≥ 90 % chance of detecting the eight largest (typically very large extreme events; but only a ≥ 50 % chance of capturing the 39 largest events. These findings are consistent with probability-theoretic considerations, but the slopes of the decay rates deviate due to temporal autocorrelation and the exact implementation of the extreme event detection algorithm. Using the examples of AmeriFlux and NEON, we then investigate to what degree ecological in situ networks can capture extreme events of a given size. Consistent with our theoretical considerations, we find that today's systematically designed networks (i.e. NEON reliably detect the largest extremes, but that the extreme event detection rates are not higher than would
Online Detection of Abnormal Events in Video Streams
Directory of Open Access Journals (Sweden)
Tian Wang
2013-01-01
an image descriptor and online nonlinear classification method. We introduce the covariance matrix of the optical flow and image intensity as a descriptor encoding moving information. The nonlinear online support vector machine (SVM firstly learns a limited set of the training frames to provide a basic reference model then updates the model and detects abnormal events in the current frame. We finally apply the method to detect abnormal events on a benchmark video surveillance dataset to demonstrate the effectiveness of the proposed technique.
Bartlow, N. M.
2017-12-01
Slow Earthquake Hunters is a new citizen science project to detect, catalog, and monitor slow slip events. Slow slip events, also called "slow earthquakes", occur when faults slip too slowly to generate significant seismic radiation. They typically take between a few days and over a year to occur, and are most often found on subduction zone plate interfaces. While not dangerous in and of themselves, recent evidence suggests that monitoring slow slip events is important for earthquake hazards, as slow slip events have been known to trigger damaging "regular" earthquakes. Slow slip events, because they do not radiate seismically, are detected with a variety of methods, most commonly continuous geodetic Global Positioning System (GPS) stations. There is now a wealth of GPS data in some regions that experience slow slip events, but a reliable automated method to detect them in GPS data remains elusive. This project aims to recruit human users to view GPS time series data, with some post-processing to highlight slow slip signals, and flag slow slip events for further analysis by the scientific team. Slow Earthquake Hunters will begin with data from the Cascadia subduction zone, where geodetically detectable slow slip events with a duration of at least a few days recur at regular intervals. The project will then expand to other areas with slow slip events or other transient geodetic signals, including other subduction zones, and areas with strike-slip faults. This project has not yet rolled out to the public, and is in a beta testing phase. This presentation will show results from an initial pilot group of student participants at the University of Missouri, and solicit feedback for the future of Slow Earthquake Hunters.
Automatic Detection and Classification of Audio Events for Road Surveillance Applications
Directory of Open Access Journals (Sweden)
Noor Almaadeed
2018-06-01
Full Text Available This work investigates the problem of detecting hazardous events on roads by designing an audio surveillance system that automatically detects perilous situations such as car crashes and tire skidding. In recent years, research has shown several visual surveillance systems that have been proposed for road monitoring to detect accidents with an aim to improve safety procedures in emergency cases. However, the visual information alone cannot detect certain events such as car crashes and tire skidding, especially under adverse and visually cluttered weather conditions such as snowfall, rain, and fog. Consequently, the incorporation of microphones and audio event detectors based on audio processing can significantly enhance the detection accuracy of such surveillance systems. This paper proposes to combine time-domain, frequency-domain, and joint time-frequency features extracted from a class of quadratic time-frequency distributions (QTFDs to detect events on roads through audio analysis and processing. Experiments were carried out using a publicly available dataset. The experimental results conform the effectiveness of the proposed approach for detecting hazardous events on roads as demonstrated by 7% improvement of accuracy rate when compared against methods that use individual temporal and spectral features.
On Event Detection and Localization in Acyclic Flow Networks
Suresh, Mahima Agumbe
2013-05-01
Acyclic flow networks, present in many infrastructures of national importance (e.g., oil and gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures have been proven costly and imprecise, particularly when dealing with large-scale distribution systems. In this article, to the best of our knowledge, for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. We propose the idea of using sensors that move along the edges of the network and detect events (i.e., attacks). To localize the events, sensors detect proximity to beacons, which are devices with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensors and beacons deployed) in a predetermined zone of interest, while ensuring a degree of coverage by sensors and a required accuracy in locating events using beacons. We propose algorithms for solving the aforementioned problem and demonstrate their effectiveness with results obtained from a realistic flow network simulator.
Network hydraulics inclusion in water quality event detection using multiple sensor stations data.
Oliker, Nurit; Ostfeld, Avi
2015-09-01
Event detection is one of the current most challenging topics in water distribution systems analysis: how regular on-line hydraulic (e.g., pressure, flow) and water quality (e.g., pH, residual chlorine, turbidity) measurements at different network locations can be efficiently utilized to detect water quality contamination events. This study describes an integrated event detection model which combines multiple sensor stations data with network hydraulics. To date event detection modelling is likely limited to single sensor station location and dataset. Single sensor station models are detached from network hydraulics insights and as a result might be significantly exposed to false positive alarms. This work is aimed at decreasing this limitation through integrating local and spatial hydraulic data understanding into an event detection model. The spatial analysis complements the local event detection effort through discovering events with lower signatures by exploring the sensors mutual hydraulic influences. The unique contribution of this study is in incorporating hydraulic simulation information into the overall event detection process of spatially distributed sensors. The methodology is demonstrated on two example applications using base runs and sensitivity analyses. Results show a clear advantage of the suggested model over single-sensor event detection schemes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Adams, M.; Gallagher, D. L.; Whitt, A.; Six, N. Frank (Technical Monitor)
2002-01-01
For the past four years the Science Directorate at Marshall Space Flight Center has carried out a diverse program of science communication through the web resources on the Internet. The program includes extended stories about NAS.4 science, a curriculum resource for teachers tied to national education standards, on-line activities for students, and webcasts of real-time events. Events have involved meteor showers, solar eclipses, natural very low frequency radio emissions, and amateur balloon flights. In some cases broadcasts accommodate active feedback and questions from Internet participants. We give here, examples of events, problems, and lessons learned from these activities.
Earth Science Data Fusion with Event Building Approach
Lukashin, C.; Bartle, Ar.; Callaway, E.; Gyurjyan, V.; Mancilla, S.; Oyarzun, R.; Vakhnin, A.
2015-01-01
Objectives of the NASA Information And Data System (NAIADS) project are to develop a prototype of a conceptually new middleware framework to modernize and significantly improve efficiency of the Earth Science data fusion, big data processing and analytics. The key components of the NAIADS include: Service Oriented Architecture (SOA) multi-lingual framework, multi-sensor coincident data Predictor, fast into-memory data Staging, multi-sensor data-Event Builder, complete data-Event streaming (a work flow with minimized IO), on-line data processing control and analytics services. The NAIADS project is leveraging CLARA framework, developed in Jefferson Lab, and integrated with the ZeroMQ messaging library. The science services are prototyped and incorporated into the system. Merging the SCIAMACHY Level-1 observations and MODIS/Terra Level-2 (Clouds and Aerosols) data products, and ECMWF re- analysis will be used for NAIADS demonstration and performance tests in compute Cloud and Cluster environments.
Detection of Abnormal Events via Optical Flow Feature Analysis
Directory of Open Access Journals (Sweden)
Tian Wang
2015-03-01
Full Text Available In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm.
Detection of Abnormal Events via Optical Flow Feature Analysis
Wang, Tian; Snoussi, Hichem
2015-01-01
In this paper, a novel algorithm is proposed to detect abnormal events in video streams. The algorithm is based on the histogram of the optical flow orientation descriptor and the classification method. The details of the histogram of the optical flow orientation descriptor are illustrated for describing movement information of the global video frame or foreground frame. By combining one-class support vector machine and kernel principal component analysis methods, the abnormal events in the current frame can be detected after a learning period characterizing normal behaviors. The difference abnormal detection results are analyzed and explained. The proposed detection method is tested on benchmark datasets, then the experimental results show the effectiveness of the algorithm. PMID:25811227
Lawhern, Vernon; Hairston, W David; Robbins, Kay
2013-01-01
Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG) data as an additional illustration.
Directory of Open Access Journals (Sweden)
Vernon Lawhern
Full Text Available Recent advances in sensor and recording technology have allowed scientists to acquire very large time-series datasets. Researchers often analyze these datasets in the context of events, which are intervals of time where the properties of the signal change relative to a baseline signal. We have developed DETECT, a MATLAB toolbox for detecting event time intervals in long, multi-channel time series. Our primary goal is to produce a toolbox that is simple for researchers to use, allowing them to quickly train a model on multiple classes of events, assess the accuracy of the model, and determine how closely the results agree with their own manual identification of events without requiring extensive programming knowledge or machine learning experience. As an illustration, we discuss application of the DETECT toolbox for detecting signal artifacts found in continuous multi-channel EEG recordings and show the functionality of the tools found in the toolbox. We also discuss the application of DETECT for identifying irregular heartbeat waveforms found in electrocardiogram (ECG data as an additional illustration.
A robust neural network-based approach for microseismic event detection
Akram, Jubran
2017-08-17
We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset for event detection. The input features used include the average of absolute amplitudes, variance, energy-ratio and polarization rectilinearity. These features are calculated in a moving-window of same length for the entire waveform. The output is set as a user-specified relative probability curve, which provides a robust way of distinguishing between weak and strong events. An optimal network is selected by studying the weight-based saliency and effect of number of neurons on the predicted results. Using synthetic data examples, we demonstrate that this approach is effective in detecting weaker events and reduces the number of false positives.
Detecting Seismic Events Using a Supervised Hidden Markov Model
Burks, L.; Forrest, R.; Ray, J.; Young, C.
2017-12-01
We explore the use of supervised hidden Markov models (HMMs) to detect seismic events in streaming seismogram data. Current methods for seismic event detection include simple triggering algorithms, such as STA/LTA and the Z-statistic, which can lead to large numbers of false positives that must be investigated by an analyst. The hypothesis of this study is that more advanced detection methods, such as HMMs, may decreases false positives while maintaining accuracy similar to current methods. We train a binary HMM classifier using 2 weeks of 3-component waveform data from the International Monitoring System (IMS) that was carefully reviewed by an expert analyst to pick all seismic events. Using an ensemble of simple and discrete features, such as the triggering of STA/LTA, the HMM predicts the time at which transition occurs from noise to signal. Compared to the STA/LTA detection algorithm, the HMM detects more true events, but the false positive rate remains unacceptably high. Future work to potentially decrease the false positive rate may include using continuous features, a Gaussian HMM, and multi-class HMMs to distinguish between types of seismic waves (e.g., P-waves and S-waves). Acknowledgement: Sandia National Laboratories is a multi-mission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.SAND No: SAND2017-8154 A
Full-waveform detection of non-impulsive seismic events based on time-reversal methods
Solano, Ericka Alinne; Hjörleifsdóttir, Vala; Liu, Qinya
2017-12-01
We present a full-waveform detection method for non-impulsive seismic events, based on time-reversal principles. We use the strain Green's tensor as a matched filter, correlating it with continuous observed seismograms, to detect non-impulsive seismic events. We show that this is mathematically equivalent to an adjoint method for detecting earthquakes. We define the detection function, a scalar valued function, which depends on the stacked correlations for a group of stations. Event detections are given by the times at which the amplitude of the detection function exceeds a given value relative to the noise level. The method can make use of the whole seismic waveform or any combination of time-windows with different filters. It is expected to have an advantage compared to traditional detection methods for events that do not produce energetic and impulsive P waves, for example glacial events, landslides, volcanic events and transform-fault earthquakes for events which velocity structure along the path is relatively well known. Furthermore, the method has advantages over empirical Greens functions template matching methods, as it does not depend on records from previously detected events, and therefore is not limited to events occurring in similar regions and with similar focal mechanisms as these events. The method is not specific to any particular way of calculating the synthetic seismograms, and therefore complicated structural models can be used. This is particularly beneficial for intermediate size events that are registered on regional networks, for which the effect of lateral structure on the waveforms can be significant. To demonstrate the feasibility of the method, we apply it to two different areas located along the mid-oceanic ridge system west of Mexico where non-impulsive events have been reported. The first study area is between Clipperton and Siqueiros transform faults (9°N), during the time of two earthquake swarms, occurring in March 2012 and May
COMPARISON OF FOUR METHODS TO DETECT ADVERSE EVENTS IN HOSPITAL
Directory of Open Access Journals (Sweden)
Inge Dhamanti
2015-09-01
Full Text Available AbstrakDeteksi terjadinya kejadian yang tidak diharapkan (KTD telah menjadi salah satu tantangan dalam keselamatan pasien oleh karena itu metode untuk mendeteksi terjadinya KTD sangatlah penting untuk meningkatkan keselamatan pasien. Tujuan dari artikel ini adalah untuk membandingkan kelebihan dan kekurangan dari beberapa metode untuk mendeteksi terjadinya KTD di rumah sakit, meliputi review rekam medis, pelaporan insiden secara mandiri, teknologi informasi, dan pelaporan oleh pasien. Studi ini merupakan kajian literatur untuk membandingkan dan menganalisa metode terbaik untuk mendeteksi KTD yang dapat diimplementasikan oleh rumah sakit. Semua dari empat metode telah terbukti mampu untuk mendeteksi terjadinya KTD di rumah sakit, tetapi masing-masing metode mempunyai kelebihan dan kekurangan yang perlu diatasi. Tidak ada satu metode terbaik yang akan memberikan hasil terbaik untuk mendeteksi KTD di rumah sakit. Sehingga untuk mendeteksi lebih banyak KTD yang seharusnya dapat dicegah, atau KTD yang telah terjadi, rumah sakit seharusnya mengkombinasikan lebih dari satu metode untuk mendeteksi, karena masing-masing metode mempunyai sensitivitas berbeda-beda.AbstractDetecting adverse events has become one of the challenges in patient safety thus methods to detect adverse events become critical for improving patient safety. The purpose of this paper is to compare the strengths and weaknesses of several methods of identifying adverse events in hospital, including medical records reviews, self-reported incidents, information technology, and patient self-reports. This study is a literature review to compared and analyzed to determine the best method implemented by the hospital. All of four methods have been proved in their ability in detecting adverse events in hospitals, but each method had strengths and limitations to be overcome. There is no ‘best’ single method that will give the best results for adverse events detection in hospital. Thus to
O'Brien, Thomas
2011-01-01
How can water and a penny demonstrate the power of mathematics and molecular theory? Do spelling and punctuation really matter to the human brain? The third of Thomas O'Brien's books designed for 5-12 grade science teachers, "Even More Brain-Powered Science" uses the questions above and 11 other inquiry-oriented discrepant events--experiments or…
Object-Oriented Query Language For Events Detection From Images Sequences
Ganea, Ion Eugen
2015-09-01
In this paper is presented a method to represent the events extracted from images sequences and the query language used for events detection. Using an object oriented model the spatial and temporal relationships between salient objects and also between events are stored and queried. This works aims to unify the storing and querying phases for video events processing. The object oriented language syntax used for events processing allow the instantiation of the indexes classes in order to improve the accuracy of the query results. The experiments were performed on images sequences provided from sport domain and it shows the reliability and the robustness of the proposed language. To extend the language will be added a specific syntax for constructing the templates for abnormal events and for detection of the incidents as the final goal of the research.
R2R Eventlogger: Community-wide Recording of Oceanographic Cruise Science Events
Maffei, A. R.; Chandler, C. L.; Stolp, L.; Lerner, S.; Avery, J.; Thiel, T.
2012-12-01
Methods used by researchers to track science events during a science research cruise - and to note when and where these occur - varies widely. Handwritten notebooks, printed forms, watch-keeper logbooks, data-logging software, and customized software have all been employed. The quality of scientific results is affected by the consistency and care with which such events are recorded and integration of multi-cruise results is hampered because recording methods vary widely from cruise to cruise. The Rolling Deck to Repository (R2R) program has developed an Eventlogger system that will eventually be deployed on most vessels in the academic research fleet. It is based on the open software package called ELOG (http://midas.psi.ch/elog/) originally authored by Stefan Ritt and enhanced by our team. Lessons have been learned in its development and use on several research cruises. We have worked hard to find approaches that encourage cruise participants to use tools like the eventlogger. We examine these lessons and several eventlogger datasets from past cruises. We further describe how the R2R Science Eventlogger works in concert with the other R2R program elements to help coordinate research vessels into a coordinated mobile observing fleet. Making use of data collected on different research cruises is enabled by adopting common ways of describing science events, the science instruments employed, the data collected, etc. The use of controlled vocabularies and the practice of mapping these local vocabularies to accepted oceanographic community vocabularies helps to bind shipboard research events from different cruises into a more cohesive set of fleet-wide events that can be queried and examined in a cross-cruise manner. Examples of the use of the eventlogger during multi-cruise oceanographic research programs along with examples of resultant eventlogger data will be presented. Additionally we will highlight the importance of vocabulary use strategies to the success of the
TACKLING EVENT DETECTION IN THE CONTEXT OF VIDEO SURVEILLANCE
Directory of Open Access Journals (Sweden)
Raducu DUMITRESCU
2011-11-01
Full Text Available In this paper we address the problem of event detection in the context of video surveillance systems. First we deal with background extraction. Three methods are being tested, namely: frame differencing, running average and an estimate of median filtering technique. This provides information about changing contents. Further, we use this information to address human presence detection in the scene. This is carried out thought a contour-based approach. Contours are extracted from moving regions and parameterized. Human silhouettes show particular signatures of these parameters. Experimental results prove the potential of this approach to event detection. However, these are our first preliminary results to this application.
Analytic 3D image reconstruction using all detected events
International Nuclear Information System (INIS)
Kinahan, P.E.; Rogers, J.G.
1988-11-01
We present the results of testing a previously presented algorithm for three-dimensional image reconstruction that uses all gamma-ray coincidence events detected by a PET volume-imaging scanner. By using two iterations of an analytic filter-backprojection method, the algorithm is not constrained by the requirement of a spatially invariant detector point spread function, which limits normal analytic techniques. Removing this constraint allows the incorporation of all detected events, regardless of orientation, which improves the statistical quality of the final reconstructed image
Adaptive Sensor Tuning for Seismic Event Detection in Environment with Electromagnetic Noise
Ziegler, Abra E.
The goal of this research is to detect possible microseismic events at a carbon sequestration site. Data recorded on a continuous downhole microseismic array in the Farnsworth Field, an oil field in Northern Texas that hosts an ongoing carbon capture, utilization, and storage project, were evaluated using machine learning and reinforcement learning techniques to determine their effectiveness at seismic event detection on a dataset with electromagnetic noise. The data were recorded from a passive vertical monitoring array consisting of 16 levels of 3-component 15 Hz geophones installed in the field and continuously recording since January 2014. Electromagnetic and other noise recorded on the array has significantly impacted the utility of the data and it was necessary to characterize and filter the noise in order to attempt event detection. Traditional detection methods using short-term average/long-term average (STA/LTA) algorithms were evaluated and determined to be ineffective because of changing noise levels. To improve the performance of event detection and automatically and dynamically detect seismic events using effective data processing parameters, an adaptive sensor tuning (AST) algorithm developed by Sandia National Laboratories was utilized. AST exploits neuro-dynamic programming (reinforcement learning) trained with historic event data to automatically self-tune and determine optimal detection parameter settings. The key metric that guides the AST algorithm is consistency of each sensor with its nearest neighbors: parameters are automatically adjusted on a per station basis to be more or less sensitive to produce consistent agreement of detections in its neighborhood. The effects that changes in neighborhood configuration have on signal detection were explored, as it was determined that neighborhood-based detections significantly reduce the number of both missed and false detections in ground-truthed data. The performance of the AST algorithm was
Multilingual event extraction for epidemic detection.
Lejeune, Gaël; Brixtel, Romain; Doucet, Antoine; Lucas, Nadine
2015-10-01
This paper presents a multilingual news surveillance system applied to tele-epidemiology. It has been shown that multilingual approaches improve timeliness in detection of epidemic events across the globe, eliminating the wait for local news to be translated into major languages. We present here a system to extract epidemic events in potentially any language, provided a Wikipedia seed for common disease names exists. The Daniel system presented herein relies on properties that are common to news writing (the journalistic genre), the most useful being repetition and saliency. Wikipedia is used to screen common disease names to be matched with repeated characters strings. Language variations, such as declensions, are handled by processing text at the character-level, rather than at the word level. This additionally makes it possible to handle various writing systems in a similar fashion. As no multilingual ground truth existed to evaluate the Daniel system, we built a multilingual corpus from the Web, and collected annotations from native speakers of Chinese, English, Greek, Polish and Russian, with no connection or interest in the Daniel system. This data set is available online freely, and can be used for the evaluation of other event extraction systems. Experiments for 5 languages out of 17 tested are detailed in this paper: Chinese, English, Greek, Polish and Russian. The Daniel system achieves an average F-measure of 82% in these 5 languages. It reaches 87% on BEcorpus, the state-of-the-art corpus in English, slightly below top-performing systems, which are tailored with numerous language-specific resources. The consistent performance of Daniel on multiple languages is an important contribution to the reactivity and the coverage of epidemiological event detection systems. Most event extraction systems rely on extensive resources that are language-specific. While their sophistication induces excellent results (over 90% precision and recall), it restricts their
An integrated logit model for contamination event detection in water distribution systems.
Housh, Mashor; Ostfeld, Avi
2015-05-15
The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
A simple strategy for fall events detection
Harrou, Fouzi; Zerrouki, Nabil; Sun, Ying; Houacine, Amrane
2017-01-01
the multivariate exponentially weighted moving average (MEWMA) control chart to detect fall events. Towards this end, a set of ratios for five partial occupancy areas of the human body for each frame are collected and used as the input data to MEWMA chart
Linking events, science and media for flood and drought management
Ding, M.; Wei, Y.; Zheng, H.; Zhao, Y.
2017-12-01
Throughout history, floods and droughts have been closely related to the development of human riparian civilization. The socio-economic damage caused by floods/droughts appears to be on the rise and the frequency of floods/droughts increases due to global climate change. In this paper, we take a fresh perspective to examine the (dis)connection between events (floods and droughts), research papers and media reports in globally 42 river basins between 1990 and 2012 for better solutions in floods and droughts management. We collected hydrological data from NOAA/ESPL Physical Sciences Division (PSD) and CPC Merged Analysis of Precipitation (CMAP), all relevant scientific papers from Web of Science (WOS) and media records from Emergency Events Database (EM-DAT) during the study period, presented the temporal variability at annual level of these three groups of data, and analysed the (connection) among these three groups of data in typical river basins. We found that 1) the number of flood related reports on both media and research is much more than those on droughts; 2) the concerns of media reports just focused on partial topics (death, severity and damage) and partial catchments (Mediterranean Sea and Nile River); 3) the scientific contribution on floods and droughts were limited within some river basins such as Nile River Basin, Parana River Basin, Savannah River Basin and Murray-Darling River Basin; 4) the scientific contribution on floods and droughts were limited within only a few of disciplines such as Geology, Environmental Sciences & Ecology, Agriculture, Engineering and Forestry. It is recommended that multiple disciplinary contribution and collaboration should be promoted to achieve comprehensive flood/drought management, and science and media should interactively play their valuable roles and in flood/drought issues. Keywords: Floods, droughts, events, science, media, flood and drought management
EDICAM (Event Detection Intelligent Camera)
Energy Technology Data Exchange (ETDEWEB)
Zoletnik, S. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Szabolics, T., E-mail: szabolics.tamas@wigner.mta.hu [Wigner RCP RMI, EURATOM Association, Budapest (Hungary); Kocsis, G.; Szepesi, T.; Dunai, D. [Wigner RCP RMI, EURATOM Association, Budapest (Hungary)
2013-10-15
Highlights: ► We present EDICAM's hardware modules. ► We present EDICAM's main design concepts. ► This paper will describe EDICAM firmware architecture. ► Operation principles description. ► Further developments. -- Abstract: A new type of fast framing camera has been developed for fusion applications by the Wigner Research Centre for Physics during the last few years. A new concept was designed for intelligent event driven imaging which is capable of focusing image readout to Regions of Interests (ROIs) where and when predefined events occur. At present these events mean intensity changes and external triggers but in the future more sophisticated methods might also be defined. The camera provides 444 Hz frame rate at full resolution of 1280 × 1024 pixels, but monitoring of smaller ROIs can be done in the 1–116 kHz range even during exposure of the full image. Keeping space limitations and the harsh environment in mind the camera is divided into a small Sensor Module and a processing card interconnected by a fast 10 Gbit optical link. This camera hardware has been used for passive monitoring of the plasma in different devices for example at ASDEX Upgrade and COMPASS with the first version of its firmware. The new firmware and software package is now available and ready for testing the new event processing features. This paper will present the operation principle and features of the Event Detection Intelligent Camera (EDICAM). The device is intended to be the central element in the 10-camera monitoring system of the Wendelstein 7-X stellarator.
Contamination Event Detection with Multivariate Time-Series Data in Agricultural Water Monitoring
Directory of Open Access Journals (Sweden)
Yingchi Mao
2017-12-01
Full Text Available Time series data of multiple water quality parameters are obtained from the water sensor networks deployed in the agricultural water supply network. The accurate and efficient detection and warning of contamination events to prevent pollution from spreading is one of the most important issues when pollution occurs. In order to comprehensively reduce the event detection deviation, a spatial–temporal-based event detection approach with multivariate time-series data for water quality monitoring (M-STED was proposed. The M-STED approach includes three parts. The first part is that M-STED adopts a Rule K algorithm to select backbone nodes as the nodes in the CDS, and forward the sensed data of multiple water parameters. The second part is to determine the state of each backbone node with back propagation neural network models and the sequential Bayesian analysis in the current timestamp. The third part is to establish a spatial model with Bayesian networks to estimate the state of the backbones in the next timestamp and trace the “outlier” node to its neighborhoods to detect a contamination event. The experimental results indicate that the average detection rate is more than 80% with M-STED and the false detection rate is lower than 9%, respectively. The M-STED approach can improve the rate of detection by about 40% and reduce the false alarm rate by about 45%, compared with the event detection with a single water parameter algorithm, S-STED. Moreover, the proposed M-STED can exhibit better performance in terms of detection delay and scalability.
Energy-Efficient Fault-Tolerant Dynamic Event Region Detection in Wireless Sensor Networks
DEFF Research Database (Denmark)
Enemark, Hans-Jacob; Zhang, Yue; Dragoni, Nicola
2015-01-01
to a hybrid algorithm for dynamic event region detection, such as real-time tracking of chemical leakage regions. Considering the characteristics of the moving away dynamic events, we propose a return back condition for the hybrid algorithm from distributed neighborhood collaboration, in which a node makes......Fault-tolerant event detection is fundamental to wireless sensor network applications. Existing approaches usually adopt neighborhood collaboration for better detection accuracy, while need more energy consumption due to communication. Focusing on energy efficiency, this paper makes an improvement...... its detection decision based on decisions received from its spatial and temporal neighbors, to local non-communicative decision making. The simulation results demonstrate that the improved algorithm does not degrade the detection accuracy of the original algorithm, while it has better energy...
Detecting failure events in buildings: a numerical and experimental analysis
Heckman, V. M.; Kohler, M. D.; Heaton, T. H.
2010-01-01
A numerical method is used to investigate an approach for detecting the brittle fracture of welds associated with beam -column connections in instrumented buildings in real time through the use of time-reversed Green’s functions and wave propagation reciprocity. The approach makes use of a prerecorded catalog of Green’s functions for an instrumented building to detect failure events in the building during a later seismic event by screening continuous data for the presence of wavef...
Abnormal Event Detection Using Local Sparse Representation
DEFF Research Database (Denmark)
Ren, Huamin; Moeslund, Thomas B.
2014-01-01
We propose to detect abnormal events via a sparse subspace clustering algorithm. Unlike most existing approaches, which search for optimized normal bases and detect abnormality based on least square error or reconstruction error from the learned normal patterns, we propose an abnormality measurem...... is found that satisfies: the distance between its local space and the normal space is large. We evaluate our method on two public benchmark datasets: UCSD and Subway Entrance datasets. The comparison to the state-of-the-art methods validate our method's effectiveness....
Adaptive prediction applied to seismic event detection
International Nuclear Information System (INIS)
Clark, G.A.; Rodgers, P.W.
1981-01-01
Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data
Towards Optimal Event Detection and Localization in Acyclic Flow Networks
Agumbe Suresh, Mahima
2012-01-03
Acyclic flow networks, present in many infrastructures of national importance (e.g., oil & gas and water distribution systems), have been attracting immense research interest. Existing solutions for detecting and locating attacks against these infrastructures, have been proven costly and imprecise, especially when dealing with large scale distribution systems. In this paper, to the best of our knowledge for the first time, we investigate how mobile sensor networks can be used for optimal event detection and localization in acyclic flow networks. Sensor nodes move along the edges of the network and detect events (i.e., attacks) and proximity to beacon nodes with known placement in the network. We formulate the problem of minimizing the cost of monitoring infrastructure (i.e., minimizing the number of sensor and beacon nodes deployed), while ensuring a degree of sensing coverage in a zone of interest and a required accuracy in locating events. We propose algorithms for solving these problems and demonstrate their effectiveness with results obtained from a high fidelity simulator.
Event Detection Challenges, Methods, and Applications in Natural and Artificial Systems
2009-03-01
Sauvageon, Agogino, Mehr, and Tumer [2006], for instance, use a fourth degree polynomial within an event detection algorithm to sense high... cancer , and coronary artery disease. His study examines the age at which to begin screening exams, the intervals between the exams, and (possibly...AM, Mehr AF, and Tumer IY. 2006. “Comparison of Event Detection Methods for Centralized Sensor Networks.” IEEE Sensors Applications Symposium 2006
National Earthquake Information Center Seismic Event Detections on Multiple Scales
Patton, J.; Yeck, W. L.; Benz, H.; Earle, P. S.; Soto-Cordero, L.; Johnson, C. E.
2017-12-01
The U.S. Geological Survey National Earthquake Information Center (NEIC) monitors seismicity on local, regional, and global scales using automatic picks from more than 2,000 near-real time seismic stations. This presents unique challenges in automated event detection due to the high variability in data quality, network geometries and density, and distance-dependent variability in observed seismic signals. To lower the overall detection threshold while minimizing false detection rates, NEIC has begun to test the incorporation of new detection and picking algorithms, including multiband (Lomax et al., 2012) and kurtosis (Baillard et al., 2014) pickers, and a new bayesian associator (Glass 3.0). The Glass 3.0 associator allows for simultaneous processing of variably scaled detection grids, each with a unique set of nucleation criteria (e.g., nucleation threshold, minimum associated picks, nucleation phases) to meet specific monitoring goals. We test the efficacy of these new tools on event detection in networks of various scales and geometries, compare our results with previous catalogs, and discuss lessons learned. For example, we find that on local and regional scales, rapid nucleation of small events may require event nucleation with both P and higher-amplitude secondary phases (e.g., S or Lg). We provide examples of the implementation of a scale-independent associator for an induced seismicity sequence (local-scale), a large aftershock sequence (regional-scale), and for monitoring global seismicity. Baillard, C., Crawford, W. C., Ballu, V., Hibert, C., & Mangeney, A. (2014). An automatic kurtosis-based P-and S-phase picker designed for local seismic networks. Bulletin of the Seismological Society of America, 104(1), 394-409. Lomax, A., Satriano, C., & Vassallo, M. (2012). Automatic picker developments and optimization: FilterPicker - a robust, broadband picker for real-time seismic monitoring and earthquake early-warning, Seism. Res. Lett. , 83, 531-540, doi: 10
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
Adaptive prediction applied to seismic event detection
Energy Technology Data Exchange (ETDEWEB)
Clark, G.A.; Rodgers, P.W.
1981-09-01
Adaptive prediction was applied to the problem of detecting small seismic events in microseismic background noise. The Widrow-Hoff LMS adaptive filter used in a prediction configuration is compared with two standard seismic filters as an onset indicator. Examples demonstrate the technique's usefulness with both synthetic and actual seismic data.
First CNGS events detected by LVD
International Nuclear Information System (INIS)
Selvi, M.
2007-01-01
The Cern Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at Cern and send it towards the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Montecarlo simulations
Context-aware event detection smartphone application for first responders
Boddhu, Sanjay K.; Dave, Rakesh P.; McCartney, Matt; West, James A.; Williams, Robert L.
2013-05-01
The rise of social networking platforms like Twitter, Facebook, etc…, have provided seamless sharing of information (as chat, video and other media) among its user community on a global scale. Further, the proliferation of the smartphones and their connectivity networks has powered the ordinary individuals to share and acquire information regarding the events happening in his/her immediate vicinity in a real-time fashion. This human-centric sensed data being generated in "human-as-sensor" approach is tremendously valuable as it delivered mostly with apt annotations and ground truth that would be missing in traditional machine-centric sensors, besides high redundancy factor (same data thru multiple users). Further, when appropriately employed this real-time data can support in detecting localized events like fire, accidents, shooting, etc…, as they unfold and pin-point individuals being affected by those events. This spatiotemporal information, when made available for first responders in the event vicinity (or approaching it) can greatly assist them to make effective decisions to protect property and life in a timely fashion. In this vein, under SATE and YATE programs, the research team at AFRL Tec^Edge Discovery labs had demonstrated the feasibility of developing Smartphone applications, that can provide a augmented reality view of the appropriate detected events in a given geographical location (localized) and also provide an event search capability over a large geographic extent. In its current state, the application thru its backend connectivity utilizes a data (Text & Image) processing framework, which deals with data challenges like; identifying and aggregating important events, analyzing and correlating the events temporally and spatially and building a search enabled event database. Further, the smartphone application with its backend data processing workflow has been successfully field tested with live user generated feeds.
Impact of sensor detection limits on protecting water distribution systems from contamination events
International Nuclear Information System (INIS)
McKenna, Sean Andrew; Hart, David Blaine; Yarrington, Lane
2006-01-01
Real-time water quality sensors are becoming commonplace in water distribution systems. However, field deployable, contaminant-specific sensors are still in the development stage. As development proceeds, the necessary operating parameters of these sensors must be determined to protect consumers from accidental and malevolent contamination events. This objective can be quantified in several different ways including minimization of: the time necessary to detect a contamination event, the population exposed to contaminated water, the extent of the contamination within the network, and others. We examine the ability of a sensor set to meet these objectives as a function of both the detection limit of the sensors and the number of sensors in the network. A moderately sized distribution network is used as an example and different sized sets of randomly placed sensors are considered. For each combination of a certain number of sensors and a detection limit, the mean values of the different objectives across multiple random sensor placements are calculated. The tradeoff between the necessary detection limit in a sensor and the number of sensors is evaluated. Results show that for the example problem examined here, a sensor detection limit of 0.01 of the average source concentration is adequate for maximum protection. Detection of events is dependent on the detection limit of the sensors, but for those events that are detected, the values of the performance measures are not a function of the sensor detection limit. The results of replacing a single sensor in a network with a sensor having a much lower detection limit show that while this replacement can improve results, the majority of the additional events detected had performance measures of relatively low consequence.
Neutron detector for detecting rare events of spontaneous fission
International Nuclear Information System (INIS)
Ter-Akop'yan, G.M.; Popeko, A.G.; Sokol, E.A.; Chelnokov, L.P.; Smirnov, V.I.; Gorshkov, V.A.
1981-01-01
The neutron detector for registering rare events of spontaneous fission by detecting multiple neutron emission is described. The detector represents a block of plexiglas of 550 mm diameter and 700 mm height in the centre of which there is a through 160 mm diameter channel for the sample under investigation. The detector comprises 56 3 He filled counters (up to 7 atm pressure) with 1% CO 2 addition. The counters have a 500 mm length and a 32 mm diameter. The sampling of fission events is realized by an electron system which allows determining the number of detected neutrons, numbers of operated counters, signal amplitude and time for fission event detecting. A block diagram of a neutron detector electron system is presented and its operation principle is considered. For protection against cosmic radiation the detector is surronded by a system of plastic scintillators and placed behind the concrete shield of 6 m thickness. The results of measurements of background radiation are given. It has been found that the background radiation of single neutron constitutes about 150 counts per hour, the detecting efficiency of single neutron equals 0.483 +- 0.005, for a 10l detector sensitive volume. By means of the detector described the parameters of multiplicity distribution of prompt neutrons for 256 Fm spontaneous fission are measured. The average multiplicity equals 3.59+-0.06 the dispersion being 2.30+-0.65
Machine learning for the automatic detection of anomalous events
Fisher, Wendy D.
In this dissertation, we describe our research contributions for a novel approach to the application of machine learning for the automatic detection of anomalous events. We work in two different domains to ensure a robust data-driven workflow that could be generalized for monitoring other systems. Specifically, in our first domain, we begin with the identification of internal erosion events in earth dams and levees (EDLs) using geophysical data collected from sensors located on the surface of the levee. As EDLs across the globe reach the end of their design lives, effectively monitoring their structural integrity is of critical importance. The second domain of interest is related to mobile telecommunications, where we investigate a system for automatically detecting non-commercial base station routers (BSRs) operating in protected frequency space. The presence of non-commercial BSRs can disrupt the connectivity of end users, cause service issues for the commercial providers, and introduce significant security concerns. We provide our motivation, experimentation, and results from investigating a generalized novel data-driven workflow using several machine learning techniques. In Chapter 2, we present results from our performance study that uses popular unsupervised clustering algorithms to gain insights to our real-world problems, and evaluate our results using internal and external validation techniques. Using EDL passive seismic data from an experimental laboratory earth embankment, results consistently show a clear separation of events from non-events in four of the five clustering algorithms applied. Chapter 3 uses a multivariate Gaussian machine learning model to identify anomalies in our experimental data sets. For the EDL work, we used experimental data from two different laboratory earth embankments. Additionally, we explore five wavelet transform methods for signal denoising. The best performance is achieved with the Haar wavelets. We achieve up to 97
First CNGS events detected by LVD
International Nuclear Information System (INIS)
Agafonova, N.Yu.; Boyarkin, V.V.; Kuznetsov, V.V.; Kuznetsov, V.A.; Malguin, A.S.; Ryasny, V.G.; Ryazhskaya, O.G.; Yakushev, V.F.; Zatsepin, G.T.; Aglietta, M.; Bonardi, A.; Fulgione, W.; Galeotti, P.; Porta, A.; Saavedra, O.; Vigorito, C.; Antonioli, P.; Bari, G.; Giusti, P.; Menghetti, H.; Persiani, R.; Pesci, A.; Sartorelli, G.; Selvi, M.; Zichichi, A.; Bruno, G.; Ghia, P.L.; Garbini, M.; Kemp, E.; Pless, I.A.; Votano, L.
2007-01-01
The CERN Neutrino to Gran Sasso (CNGS) project aims to produce a high energy, wide band ν μ beam at CERN and send it toward the INFN Gran Sasso National Laboratory (LNGS), 732 km away. Its main goal is the observation of the ν τ appearance, through neutrino flavour oscillation. The beam started its operation in August 2006 for about 12 days: a total amount of 7.6 x 10 17 protons were delivered to the target. The LVD detector, installed in hall A of the LNGS and mainly dedicated to the study of supernova neutrinos, was fully operating during the whole CNGS running time. A total number of 569 events were detected in coincidence with the beam spill time. This is in good agreement with the expected number of events from Monte Carlo simulations. (orig.)
Meteorite Fall Detection and Analysis via Weather Radar: Worldwide Potential for Citizen Science
Fries, M.; Bresky, C.; Laird, C.; Reddy, V.; Hankey, M.
2017-12-01
Meteorite falls can be detected using weather radars, facilitating rapid recovery of meteorites to minimize terrestrial alteration. Imagery from the US NEXRAD radar network reveals over two dozen meteorite falls where meteorites have been recovered, and about another dozen that remain unrecovered. Discovery of new meteorite falls is well suited to "citizen science" and similar outreach activities, as well as automation of computational components into internet-based search tools. Also, there are many more weather radars employed worldwide than those in the US NEXRAD system. Utilization of weather radars worldwide for meteorite recovery can not only expand citizen science opportunities but can also lead to significant improvement in the number of freshly-fallen meteorites available for research. We will discuss the methodologies behind locating and analyzing meteorite falls using weather radar, and how to make them available for citizen science efforts. An important example is the Aquarius Project, a Chicago-area consortium recently formed with the goal of recovering meteorites from Lake Michigan. This project has extensive student involvement geared toward development of actual hardware for recovering meteorites from the lake floor. Those meteorites were identified in weather radar imagery as they fell into the lake from a large meteor on 06 Feb 2017. Another example of public interaction is the meteor detection systems operated by the American Meteor Society (AMS). The AMS website has been developed to allow public reporting of meteors, effectively enabling citizen science to locate and describe significant meteor events worldwide.
Detection and interpretation of seismoacoustic events at German infrasound stations
Pilger, Christoph; Koch, Karl; Ceranna, Lars
2016-04-01
Three infrasound arrays with collocated or nearby installed seismometers are operated by the Federal Institute for Geosciences and Natural Resources (BGR) as the German National Data Center (NDC) for the verification of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). Infrasound generated by seismoacoustic events is routinely detected at these infrasound arrays, but air-to-ground coupled acoustic waves occasionally show up in seismometer recordings as well. Different natural and artificial sources like meteoroids as well as industrial and mining activity generate infrasonic signatures that are simultaneously detected at microbarometers and seismometers. Furthermore, many near-surface sources like earthquakes and explosions generate both seismic and infrasonic waves that can be detected successively with both technologies. The combined interpretation of seismic and acoustic signatures provides additional information about the origin time and location of remote infrasound events or about the characterization of seismic events distinguishing man-made and natural origins. Furthermore, seismoacoustic studies help to improve the modelling of infrasound propagation and ducting in the atmosphere and allow quantifying the portion of energy coupled into ground and into air by seismoacoustic sources. An overview of different seismoacoustic sources and their detection by German infrasound stations as well as some conclusions on the benefit of a combined seismoacoustic analysis are presented within this study.
Oliker, Nurit; Ostfeld, Avi
2014-03-15
This study describes a decision support system, alerts for contamination events in water distribution systems. The developed model comprises a weighted support vector machine (SVM) for the detection of outliers, and a following sequence analysis for the classification of contamination events. The contribution of this study is an improvement of contamination events detection ability and a multi-dimensional analysis of the data, differing from the parallel one-dimensional analysis conducted so far. The multivariate analysis examines the relationships between water quality parameters and detects changes in their mutual patterns. The weights of the SVM model accomplish two goals: blurring the difference between sizes of the two classes' data sets (as there are much more normal/regular than event time measurements), and adhering the time factor attribute by a time decay coefficient, ascribing higher importance to recent observations when classifying a time step measurement. All model parameters were determined by data driven optimization so the calibration of the model was completely autonomic. The model was trained and tested on a real water distribution system (WDS) data set with randomly simulated events superimposed on the original measurements. The model is prominent in its ability to detect events that were only partly expressed in the data (i.e., affecting only some of the measured parameters). The model showed high accuracy and better detection ability as compared to previous modeling attempts of contamination event detection. Copyright © 2013 Elsevier Ltd. All rights reserved.
Method for detecting binding events using micro-X-ray fluorescence spectrometry
Warner, Benjamin P.; Havrilla, George J.; Mann, Grace
2010-12-28
Method for detecting binding events using micro-X-ray fluorescence spectrometry. Receptors are exposed to at least one potential binder and arrayed on a substrate support. Each member of the array is exposed to X-ray radiation. The magnitude of a detectable X-ray fluorescence signal for at least one element can be used to determine whether a binding event between a binder and a receptor has occurred, and can provide information related to the extent of binding between the binder and receptor.
SciNews: Incorporating Science Current Events in 21st Century Classrooms
DiMaggio, E.
2011-12-01
Middle school students are instructed with the aid of textbooks, lectures, and activities to teach topics that satisfy state standards. However, teaching materials created to convey standard-aligned science concepts often leave students asking how the content relates to their lives and why they should be learning it. Conveying relevance is important for student learning and retention, especially in science where abstract concepts can often be incorrectly perceived as irrelevant. One way to create an educational link between classroom content and everyday life is through the use of scientific current events. Students read, hear, and watch media coverage of natural events (such as the 2011 earthquake and tsunami in Japan), but do not necessarily relate the scientific information from media sources to classroom studies. Taking advantage of these brief 'teachable moments'--when student interest is high--provides a valuable opportunity to make classroom-to-everyday life associations and to incorporate inquiry based learning. To address this need, I create pre-packaged current event materials for middle to high school teachers that align to state standards, and which are short, effective, and easy to implement in the classroom. Each lesson takes approximately 15-30 minutes to implement, allowing teachers time to facilitate brief but meaningful discussions. I assemble materials within approximately one week of the regional or global science event, consisting of short slide shows, maps, videos, pictures, and real-time data. I use a listserv to send biweekly emails to subscribed instructors containing the current event topic and a link to download the materials. All materials are hosted on the Arizona State University Education Outreach SciNews website (http://sese.asu.edu/teacher-resources) and are archived. Currently, 285 educators subscribe to the SciNews listserv, representing 36 states and 19 countries. In order to assess the effectiveness and usefulness of Sci
Early snowmelt events: detection, distribution, and significance in a major sub-arctic watershed
International Nuclear Information System (INIS)
Semmens, Kathryn Alese; Ramage, Joan; Bartsch, Annett; Liston, Glen E
2013-01-01
High latitude drainage basins are experiencing higher average temperatures, earlier snowmelt onset in spring, and an increase in rain on snow (ROS) events in winter, trends that climate models project into the future. Snowmelt-dominated basins are most sensitive to winter temperature increases that influence the frequency of ROS events and the timing and duration of snowmelt, resulting in changes to spring runoff. Of specific interest in this study are early melt events that occur in late winter preceding melt onset in the spring. The study focuses on satellite determination and characterization of these early melt events using the Yukon River Basin (Canada/USA) as a test domain. The timing of these events was estimated using data from passive (Advanced Microwave Scanning Radiometer—EOS (AMSR-E)) and active (SeaWinds on Quick Scatterometer (QuikSCAT)) microwave remote sensors, employing detection algorithms for brightness temperature (AMSR-E) and radar backscatter (QuikSCAT). The satellite detected events were validated with ground station meteorological and hydrological data, and the spatial and temporal variability of the events across the entire river basin was characterized. Possible causative factors for the detected events, including ROS, fog, and positive air temperatures, were determined by comparing the timing of the events to parameters from SnowModel and National Centers for Environmental Prediction North American Regional Reanalysis (NARR) outputs, and weather station data. All melt events coincided with above freezing temperatures, while a limited number corresponded to ROS (determined from SnowModel and ground data) and a majority to fog occurrence (determined from NARR). The results underscore the significant influence that warm air intrusions have on melt in some areas and demonstrate the large temporal and spatial variability over years and regions. The study provides a method for melt detection and a baseline from which to assess future change
Event detection for car park entries by video-surveillance
Coquin, Didier; Tailland, Johan; Cintract, Michel
2007-10-01
Intelligent surveillance has become an important research issue due to the high cost and low efficiency of human supervisors, and machine intelligence is required to provide a solution for automated event detection. In this paper we describe a real-time system that has been used for detecting car park entries, using an adaptive background learning algorithm and two indicators representing activity and identity to overcome the difficulty of tracking objects.
A novel seizure detection algorithm informed by hidden Markov model event states
Baldassano, Steven; Wulsin, Drausin; Ung, Hoameng; Blevins, Tyler; Brown, Mesha-Gay; Fox, Emily; Litt, Brian
2016-06-01
Objective. Recently the FDA approved the first responsive, closed-loop intracranial device to treat epilepsy. Because these devices must respond within seconds of seizure onset and not miss events, they are tuned to have high sensitivity, leading to frequent false positive stimulations and decreased battery life. In this work, we propose a more robust seizure detection model. Approach. We use a Bayesian nonparametric Markov switching process to parse intracranial EEG (iEEG) data into distinct dynamic event states. Each event state is then modeled as a multidimensional Gaussian distribution to allow for predictive state assignment. By detecting event states highly specific for seizure onset zones, the method can identify precise regions of iEEG data associated with the transition to seizure activity, reducing false positive detections associated with interictal bursts. The seizure detection algorithm was translated to a real-time application and validated in a small pilot study using 391 days of continuous iEEG data from two dogs with naturally occurring, multifocal epilepsy. A feature-based seizure detector modeled after the NeuroPace RNS System was developed as a control. Main results. Our novel seizure detection method demonstrated an improvement in false negative rate (0/55 seizures missed versus 2/55 seizures missed) as well as a significantly reduced false positive rate (0.0012 h versus 0.058 h-1). All seizures were detected an average of 12.1 ± 6.9 s before the onset of unequivocal epileptic activity (unequivocal epileptic onset (UEO)). Significance. This algorithm represents a computationally inexpensive, individualized, real-time detection method suitable for implantable antiepileptic devices that may considerably reduce false positive rate relative to current industry standards.
The event notification and alarm system for the Open Science Grid operations center
Hayashi, S.; Teige and, S.; Quick, R.
2012-12-01
The Open Science Grid Operations (OSG) Team operates a distributed set of services and tools that enable the utilization of the OSG by several HEP projects. Without these services users of the OSG would not be able to run jobs, locate resources, obtain information about the status of systems or generally use the OSG. For this reason these services must be highly available. This paper describes the automated monitoring and notification systems used to diagnose and report problems. Described here are the means used by OSG Operations to monitor systems such as physical facilities, network operations, server health, service availability and software error events. Once detected, an error condition generates a message sent to, for example, Email, SMS, Twitter, an Instant Message Server, etc. The mechanism being developed to integrate these monitoring systems into a prioritized and configurable alarming system is emphasized.
The event notification and alarm system for the Open Science Grid operations center
Energy Technology Data Exchange (ETDEWEB)
Hayashi, S; Teige and, S; Quick, R [Indiana University, University Information Technology Services (United States)
2012-12-13
The Open Science Grid Operations (OSG) Team operates a distributed set of services and tools that enable the utilization of the OSG by several HEP projects. Without these services users of the OSG would not be able to run jobs, locate resources, obtain information about the status of systems or generally use the OSG. For this reason these services must be highly available. This paper describes the automated monitoring and notification systems used to diagnose and report problems. Described here are the means used by OSG Operations to monitor systems such as physical facilities, network operations, server health, service availability and software error events. Once detected, an error condition generates a message sent to, for example, Email, SMS, Twitter, an Instant Message Server, etc. The mechanism being developed to integrate these monitoring systems into a prioritized and configurable alarming system is emphasized.
The event notification and alarm system for the Open Science Grid operations center
International Nuclear Information System (INIS)
Hayashi, S; Teige and, S; Quick, R
2012-01-01
The Open Science Grid Operations (OSG) Team operates a distributed set of services and tools that enable the utilization of the OSG by several HEP projects. Without these services users of the OSG would not be able to run jobs, locate resources, obtain information about the status of systems or generally use the OSG. For this reason these services must be highly available. This paper describes the automated monitoring and notification systems used to diagnose and report problems. Described here are the means used by OSG Operations to monitor systems such as physical facilities, network operations, server health, service availability and software error events. Once detected, an error condition generates a message sent to, for example, Email, SMS, Twitter, an Instant Message Server, etc. The mechanism being developed to integrate these monitoring systems into a prioritized and configurable alarming system is emphasized.
LAN attack detection using Discrete Event Systems.
Hubballi, Neminath; Biswas, Santosh; Roopa, S; Ratti, Ritesh; Nandi, Sukumar
2011-01-01
Address Resolution Protocol (ARP) is used for determining the link layer or Medium Access Control (MAC) address of a network host, given its Internet Layer (IP) or Network Layer address. ARP is a stateless protocol and any IP-MAC pairing sent by a host is accepted without verification. This weakness in the ARP may be exploited by malicious hosts in a Local Area Network (LAN) by spoofing IP-MAC pairs. Several schemes have been proposed in the literature to circumvent these attacks; however, these techniques either make IP-MAC pairing static, modify the existing ARP, patch operating systems of all the hosts etc. In this paper we propose a Discrete Event System (DES) approach for Intrusion Detection System (IDS) for LAN specific attacks which do not require any extra constraint like static IP-MAC, changing the ARP etc. A DES model is built for the LAN under both a normal and compromised (i.e., spoofed request/response) situation based on the sequences of ARP related packets. Sequences of ARP events in normal and spoofed scenarios are similar thereby rendering the same DES models for both the cases. To create different ARP events under normal and spoofed conditions the proposed technique uses active ARP probing. However, this probing adds extra ARP traffic in the LAN. Following that a DES detector is built to determine from observed ARP related events, whether the LAN is operating under a normal or compromised situation. The scheme also minimizes extra ARP traffic by probing the source IP-MAC pair of only those ARP packets which are yet to be determined as genuine/spoofed by the detector. Also, spoofed IP-MAC pairs determined by the detector are stored in tables to detect other LAN attacks triggered by spoofing namely, man-in-the-middle (MiTM), denial of service etc. The scheme is successfully validated in a test bed. Copyright © 2010 ISA. Published by Elsevier Ltd. All rights reserved.
Microseismic Events Detection on Xishancun Landslide, Sichuan Province, China
Sheng, M.; Chu, R.; Wei, Z.
2016-12-01
On landslide, the slope movement and the fracturing of the rock mass often lead to microearthquakes, which are recorded as weak signals on seismographs. The distribution characteristics of temporal and spatial regional unstability as well as the impact of external factors on the unstable regions can be understand and analyzed by monitoring those microseismic events. Microseismic method can provide some information inside the landslide, which can be used as supplementary of geodetic methods for monitoring the movement of landslide surface. Compared to drilling on landslide, microseismic method is more economical and safe. Xishancun Landslide is located about 60km northwest of Wenchuan earthquake centroid, it keep deforming after the earthquake, which greatly increases the probability of disasters. In the autumn of 2015, 30 seismometers were deployed on the landslide for 3 months with intervals of 200 500 meters. First, we used regional earthquakes for time correction of seismometers to eliminate the influence of inaccuracy GPS clocks and the subsurface structure of stations. Due to low velocity of the loose medium, the travel time difference of microseismic events on the landslide up to 5s. According to travel time and waveform characteristics, we found many microseismic events and converted them into envelopes as templates, then we used a sliding-window cross-correlation technique based on waveform envelope to detect the other microseismic events. Consequently, 100 microseismic events were detected with the waveforms recorded on all seismometers. Based on the location, we found most of them located on the front of the landslide while the others located on the back end. The bottom and top of the landslide accumulated considerable energy and deformed largely, radiated waves could be recorded by all stations. What's more, the bottom with more events seemed very active. In addition, there were many smaller events happened in middle part of the landslide where released
Data Albums: An Event Driven Search, Aggregation and Curation Tool for Earth Science
Ramachandran, Rahul; Kulkarni, Ajinkya; Maskey, Manil; Bakare, Rohan; Basyal, Sabin; Li, Xiang; Flynn, Shannon
2014-01-01
Approaches used in Earth science research such as case study analysis and climatology studies involve discovering and gathering diverse data sets and information to support the research goals. To gather relevant data and information for case studies and climatology analysis is both tedious and time consuming. Current Earth science data systems are designed with the assumption that researchers access data primarily by instrument or geophysical parameter. In cases where researchers are interested in studying a significant event, they have to manually assemble a variety of datasets relevant to it by searching the different distributed data systems. This paper presents a specialized search, aggregation and curation tool for Earth science to address these challenges. The search rool automatically creates curated 'Data Albums', aggregated collections of information related to a specific event, containing links to relevant data files [granules] from different instruments, tools and services for visualization and analysis, and information about the event contained in news reports, images or videos to supplement research analysis. Curation in the tool is driven via an ontology based relevancy ranking algorithm to filter out non relevant information and data.
Vision-based Event Detection of the Sit-to-Stand Transition
Directory of Open Access Journals (Sweden)
Victor Shia
2015-12-01
Full Text Available Sit-to-stand (STS motions are one of the most important activities of daily living as they serve as a precursor to mobility and walking. However, there exist no standard method of segmenting STS motions. This is partially due to the variety of different sensors and modalities used to study the STS motion such as force plate, vision, and accelerometers, each providing different types of data, and the variability of the STS motion in video data. In this work, we present a method using motion capture to detect events in the STS motion by estimating ground reaction forces, thereby eliminating the variability in joint angles from visual data. We illustrate the accuracy of this method with 10 subjects with an average difference of 16.5ms in event times obtained via motion capture vs force plate. This method serves as a proof of concept for detecting events in the STS motion via video which are comparable to those obtained via force plate.
Nishii, Nobuhiro; Miyoshi, Akihito; Kubo, Motoki; Miyamoto, Masakazu; Morimoto, Yoshimasa; Kawada, Satoshi; Nakagawa, Koji; Watanabe, Atsuyuki; Nakamura, Kazufumi; Morita, Hiroshi; Ito, Hiroshi
2018-03-01
Remote monitoring (RM) has been advocated as the new standard of care for patients with cardiovascular implantable electronic devices (CIEDs). RM has allowed the early detection of adverse clinical events, such as arrhythmia, lead failure, and battery depletion. However, lead failure was often identified only by arrhythmic events, but not impedance abnormalities. To compare the usefulness of arrhythmic events with conventional impedance abnormalities for identifying lead failure in CIED patients followed by RM. CIED patients in 12 hospitals have been followed by the RM center in Okayama University Hospital. All transmitted data have been analyzed and summarized. From April 2009 to March 2016, 1,873 patients have been followed by the RM center. During the mean follow-up period of 775 days, 42 lead failure events (atrial lead 22, right ventricular pacemaker lead 5, implantable cardioverter defibrillator [ICD] lead 15) were detected. The proportion of lead failures detected only by arrhythmic events, which were not detected by conventional impedance abnormalities, was significantly higher than that detected by impedance abnormalities (arrhythmic event 76.2%, 95% CI: 60.5-87.9%; impedance abnormalities 23.8%, 95% CI: 12.1-39.5%). Twenty-seven events (64.7%) were detected without any alert. Of 15 patients with ICD lead failure, none has experienced inappropriate therapy. RM can detect lead failure earlier, before clinical adverse events. However, CIEDs often diagnose lead failure as just arrhythmic events without any warning. Thus, to detect lead failure earlier, careful human analysis of arrhythmic events is useful. © 2017 Wiley Periodicals, Inc.
CERN and the Festival of Science
2005-01-01
La Fête de la science (Festival of Science) in France has become an unmissable event, where researchers and the general public meet each other amid microscopes and computers. The 2005 event runs during the week 10 to 16 October and CERN, as every year, is part of it. In the programme of events at the Laboratory: The exhibition 'One hundred years after Einstein' opens on 11 October. Based on an exhibition from the Cité des Sciences et de l'Industrie in Paris, it shows Einstein's discoveries, their impact and applications a hundred years later. For the week of the Festival of Science, the opening hours are extended to 9am-5pm every day. Also in the Globe, a workshop entitled 'Poussière d'étoiles' (Stardust) will enable young and old alike to see a working cloud chamber and to detect some of the countless cosmic particles that pass through our atmosphere. In this workshop, budding physicists can learn the ABC of detecting and identifying particles. (Wednesday 12 October 2-5pm, Saturday 15 October 9a...
International Nuclear Information System (INIS)
Chung, Sun-Ju; Lee, Chung-Uk; Koo, Jae-Rim
2014-01-01
Even though the recently discovered high-magnification event MOA-2010-BLG-311 had complete coverage over its peak, confident planet detection did not happen due to extremely weak central perturbations (EWCPs, fractional deviations of ≲ 2%). For confident detection of planets in EWCP events, it is necessary to have both high cadence monitoring and high photometric accuracy better than those of current follow-up observation systems. The next-generation ground-based observation project, Korea Microlensing Telescope Network (KMTNet), satisfies these conditions. We estimate the probability of occurrence of EWCP events with fractional deviations of ≤2% in high-magnification events and the efficiency of detecting planets in the EWCP events using the KMTNet. From this study, we find that the EWCP events occur with a frequency of >50% in the case of ≲ 100 M E planets with separations of 0.2 AU ≲ d ≲ 20 AU. We find that for main-sequence and sub-giant source stars, ≳ 1 M E planets in EWCP events with deviations ≤2% can be detected with frequency >50% in a certain range that changes with the planet mass. However, it is difficult to detect planets in EWCP events of bright stars like giant stars because it is easy for KMTNet to be saturated around the peak of the events because of its constant exposure time. EWCP events are caused by close, intermediate, and wide planetary systems with low-mass planets and close and wide planetary systems with massive planets. Therefore, we expect that a much greater variety of planetary systems than those already detected, which are mostly intermediate planetary systems, regardless of the planet mass, will be significantly detected in the near future.
Directory of Open Access Journals (Sweden)
A. Yuki
2016-06-01
Full Text Available In this study, we developed a method to detect sudden population concentration on a certain day and area, that is, an “Event,” all over Japan in 2012 using mass GPS data provided from mobile phone users. First, stay locations of all phone users were detected using existing methods. Second, areas and days where Events occurred were detected by aggregation of mass stay locations into 1-km-square grid polygons. Finally, the proposed method could detect Events with an especially large number of visitors in the year by removing the influences of Events that occurred continuously throughout the year. In addition, we demonstrated reasonable reliability of the proposed Event detection method by comparing the results of Event detection with light intensities obtained from the night light images from the DMSP/OLS night light images. Our method can detect not only positive events such as festivals but also negative events such as natural disasters and road accidents. These results are expected to support policy development of urban planning, disaster prevention, and transportation management.
Detection and location of multiple events by MARS. Final report
International Nuclear Information System (INIS)
Wang, J.; Masso, J.F.; Archambeau, C.B.; Savino, J.M.
1980-09-01
Seismic data from two explosions was processed using the Systems Science and Software MARS (Multiple Arrival Recognition System) seismic event detector in an effort to determine their relative spatial and temporal separation on the basis of seismic data alone. The explosions were less than 1.0 kilometer apart and were separated by less than 0.5 sec in origin times. The seismic data consisted of nine local accelerograms (r < 1.0 km) and four regional (240 through 400 km) seismograms. The MARS processing clearly indicates the presence of multiple explosions, but the restricted frequency range of the data inhibits accurate time picks and hence limits the precision of the event location
Real-time detection and classification of anomalous events in streaming data
Ferragut, Erik M.; Goodall, John R.; Iannacone, Michael D.; Laska, Jason A.; Harrison, Lane T.
2016-04-19
A system is described for receiving a stream of events and scoring the events based on anomalousness and maliciousness (or other classification). The events can be displayed to a user in user-defined groupings in an animated fashion. The system can include a plurality of anomaly detectors that together implement an algorithm to identify low probability events and detect atypical traffic patterns. The atypical traffic patterns can then be classified as being of interest or not. In one particular example, in a network environment, the classification can be whether the network traffic is malicious or not.
Hutchison, A. A.; Ghosh, A.
2016-12-01
Very low frequency earthquakes (VLFEs) occur in transitional zones of faults, releasing seismic energy in the 0.02-0.05 Hz frequency band over a 90 s duration and typically have magntitudes within the range of Mw 3.0-4.0. VLFEs can occur down-dip of the seismogenic zone, where they can transfer stress up-dip potentially bringing the locked zone closer to a critical failure stress. VLFEs also occur up-dip of the seismogenic zone in a region along the plate interface that can rupture coseismically during large megathrust events, such as the 2011 Tohoku-Oki earthquake [Ide et al., 2011]. VLFEs were first detected in Cascadia during the 2011 episodic tremor and slip (ETS) event, occurring coincidentally with tremor [Ghosh et al., 2015]. However, during the 2014 ETS event, VLFEs were spatially and temporally asynchronous with tremor activity [Hutchison and Ghosh, 2016]. Such contrasting behaviors remind us that the mechanics behind such events remain elusive, yet they are responsible for the largest portion of the moment release during an ETS event. Here, we apply a match filter method using known VLFEs as template events to detect additional VLFEs. Using a grid-search centroid moment tensor inversion method, we invert stacks of the resulting match filter detections to ensure moment tensor solutions are similar to that of the respective template events. Our ability to successfully employ a match filter method to VLFE detection in Cascadia intrinsically indicates that these events can be repeating, implying that the same asperities are likely responsible for generating multiple VLFEs.
Description and detection of burst events in turbulent flows
Schmid, P. J.; García-Gutierrez, A.; Jiménez, J.
2018-04-01
A mathematical and computational framework is developed for the detection and identification of coherent structures in turbulent wall-bounded shear flows. In a first step, this data-based technique will use an embedding methodology to formulate the fluid motion as a phase-space trajectory, from which state-transition probabilities can be computed. Within this formalism, a second step then applies repeated clustering and graph-community techniques to determine a hierarchy of coherent structures ranked by their persistencies. This latter information will be used to detect highly transitory states that act as precursors to violent and intermittent events in turbulent fluid motion (e.g., bursts). Used as an analysis tool, this technique allows the objective identification of intermittent (but important) events in turbulent fluid motion; however, it also lays the foundation for advanced control strategies for their manipulation. The techniques are applied to low-dimensional model equations for turbulent transport, such as the self-sustaining process (SSP), for varying levels of complexity.
Why conventional detection methods fail in identifying the existence of contamination events.
Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han
2016-04-15
Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.
Developing Science Games for use at Public Events to Better Inform Students and Citizen Scientists
Lewis, P. M.; Chambers, L. H.; Bethea, K. L.; Crecelius, S.; Ruhlman, K.; Harte, T.
2013-12-01
At NASA's Langley Research Center, the Science Directorate participates in a wide range of public outreach events, from individual small-scale classroom visits, to the large-scale NASA events like Exploration Day at Busch Gardens Williamsburg. Despite the diversity of venues, one thing is certain: the public is hungry for science and ravenous for the materials and activities that NASA produces. However, designing and producing materials and activities to capture the attention of everyone from children to grandparents can be a challenging task. The NASA Langley Science Directorate Outreach and Communications Team has taken on the task to ensure that event participants have a worthwhile science experience through a series of educational tabletop games. This diverse group of educators, scientists, writers and graphic artists has been able to produce many games and activities perfect for public exposure and understanding. These games not only capture the imagination of the citizen scientists that visit the display, but they also allow them to learn the science behind many of the things that happen around them on a daily basis, many of which they take for granted. Teaching the public through games and short activities has proven to be a winning combination of efforts. In the development of any game or activity a great deal of consideration is given to "boiling down" the science concept or educational "take away." This step is where the diverse development group has proven to be invaluable. A final product developed by this team includes a review for science validity by a scientist, words written by a science writer, educational alignment by a science educator and design by a graphic designer. This process ensures that the game will attract the right group of people and have them leave understanding new science content. Games and activities generated in this fashion have been successful in the traditional classroom and informal education venues that this team routinely
Ontology-based knowledge management for personalized adverse drug events detection.
Cao, Feng; Sun, Xingzhi; Wang, Xiaoyuan; Li, Bo; Li, Jing; Pan, Yue
2011-01-01
Since Adverse Drug Event (ADE) has become a leading cause of death around the world, there arises high demand for helping clinicians or patients to identify possible hazards from drug effects. Motivated by this, we present a personalized ADE detection system, with the focus on applying ontology-based knowledge management techniques to enhance ADE detection services. The development of electronic health records makes it possible to automate the personalized ADE detection, i.e., to take patient clinical conditions into account during ADE detection. Specifically, we define the ADE ontology to uniformly manage the ADE knowledge from multiple sources. We take advantage of the rich semantics from the terminology SNOMED-CT and apply it to ADE detection via the semantic query and reasoning.
Detection of red tide events in the Ariake Sound, Japan
Ishizaka, Joji
2003-05-01
High resolution SeaWiFS data was used to detect a red tide event occurred in the Ariake Sound, Japan, in winter of 2000 to 2001. The area is small embayment surrounding by tidal flat, and it is known as one of the most productive areas in coast of Japan. The red tide event damaged to seaweed (Nori) culture, and the relation to the reclamation at the Isahaya Bay in the Sound has been discussed. SeaWiFS chlorophyll data showed the red tide started early December 2000, from the Isahaya Bay, although direct relationship to the reclamation was not clear. The red tide persisted to the end of February. Monthly average of SeaWiFS data from May 1998 to December 2001 indicated that the chlorophyll increased twice a year, early summer and fall after the rain. The red tide event was part of the fall bloom which started later and continued longer than other years. Ocean color is useful to detect the red tide; however, it is required to improve the algorithms to accurately estimate chlorophyll in high turbid water and to discriminate toxic flagellates.
Event detection intelligent camera development
International Nuclear Information System (INIS)
Szappanos, A.; Kocsis, G.; Molnar, A.; Sarkozi, J.; Zoletnik, S.
2008-01-01
A new camera system 'event detection intelligent camera' (EDICAM) is being developed for the video diagnostics of W-7X stellarator, which consists of 10 distinct and standalone measurement channels each holding a camera. Different operation modes will be implemented for continuous and for triggered readout as well. Hardware level trigger signals will be generated from real time image processing algorithms optimized for digital signal processor (DSP) and field programmable gate array (FPGA) architectures. At full resolution a camera sends 12 bit sampled 1280 x 1024 pixels with 444 fps which means 1.43 Terabyte over half an hour. To analyse such a huge amount of data is time consuming and has a high computational complexity. We plan to overcome this problem by EDICAM's preprocessing concepts. EDICAM camera system integrates all the advantages of CMOS sensor chip technology and fast network connections. EDICAM is built up from three different modules with two interfaces. A sensor module (SM) with reduced hardware and functional elements to reach a small and compact size and robust action in harmful environment as well. An image processing and control unit (IPCU) module handles the entire user predefined events and runs image processing algorithms to generate trigger signals. Finally a 10 Gigabit Ethernet compatible image readout card functions as the network interface for the PC. In this contribution all the concepts of EDICAM and the functions of the distinct modules are described
Evaluation of Music And Astronomy Under The Stars: Bringing Science To New Audiences At Music Events
Lubowich, D.; Torff, B.
2014-07-01
Evaluations were conducted of the 2009-2012 NASA-funded Music and Astronomy Under the Stars (MAUS) program at outdoor concerts (see the separate MAUS poster at this meeting). MAUS promoted lifelong learning by providing opportunities for the public to look through telescopes, participate in hands-on activities, and view posters, banners, and videos at events where large numbers of people are gathered. Surveys were given to 1.6% of the concertgoers at MAUS events with the participants expressing their level of agreement on a four-point scale with the following statements: “The astronomy at this event has been an enjoyable experience;” “It has been easy to comprehend the astronomy at this event;” “This event has helped me learn new things about astronomy;” “This event has made me want to learn more about astronomy;” and “This event has increased my interest in science.” On a scale where 1 = strongly disagree, 2 = disagree, 3 = agree, and 4 = strongly agree, MAUS received high ratings (>3.34/4) on all outcomes. MAUS successfully reached people at different concerts who had little interest in science. MAUS appealed to concert attendees of both genders, all ages, multiple levels of education, and all musical tastes. MAUS positively influenced the public's knowledge of and interest in astronomy. The high ratings from virtually all respondents indicate that the gains were not restricted to science enthusiasts. The data strongly supports the conclusion that MAUS—bringing astronomy to people at musical events—is effective!
Dimaggio, E.
2010-12-01
Middle school students are instructed with the aid of textbooks, lectures, and activities to teach topics that satisfy state standards. However, teaching materials created to convey standard-aligned science concepts often leave students asking how the content relates to their lives and why they should be learning it. Conveying relevance, especially in science when abstract concepts can often be incorrectly perceived as irrelevant, is important for student learning and retention. One way to create an educational link between classroom content and everyday life is through the use of scientific current events. Students read, hear, and watch media coverage of natural events (such as the Haiti or Chile earthquakes in 2010), but do not necessarily relate the scientific information from media sources to classroom studies. Taking advantage of these brief ‘teachable moments’-when student interest is high- provides a valuable opportunity to make classroom-to-everyday life associations and to incorporate inquiry based learning. To address this need, we are creating pre-packaged current event materials for middle school teachers in Arizona that align to state standards and which are short, effective, and easy to implement in the classroom. Each lesson takes approximately 15 minutes to implement, allowing teachers time to facilitate brief but meaningful discussions. Materials are assembled within approximately one week of the regional or global science event (e.g., volcanic eruptions, earthquakes) and may include a short slide show, maps, videos, pictures, and real-time data. A listserv is used to send biweekly emails to subscribed instructors. The email contains the current event topic, specific Arizona science standards addressed, and a link to download the materials. All materials are hosted on the Arizona State University Education Outreach website and are archived. Early implementation efforts have been received positively by participating teachers. In one case
Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong
2017-07-01
One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.
FOREWORD: 3rd Symposium on Large TPCs for Low Energy Event Detection
Irastorza, Igor G.; Colas, Paul; Gorodetzky, Phillippe
2007-05-01
The Third International Symposium on large TPCs for low-energy rare-event detection was held at Carré des sciences, Poincaré auditorium, 25 rue de la Montagne Ste Geneviève in Paris on 11 12 December 2006. This prestigious location belonging to the Ministry of Research is hosted in the former Ecole Polytechnique. The meeting, held in Paris every two years, gathers a significant community of physicists involved in rare event detection. Its purpose is an extensive discussion of present and future projects using large TPCs for low energy, low background detection of rare events (low-energy neutrinos, dark matter, solar axions). The use of a new generation of Micro-Pattern Gaseous Detectors (MPGD) appears to be a promising way to reach this goal. The program this year was enriched by a new session devoted to the detection challenge of polarized gamma rays, relevant novel experimental techniques and the impact on particle physics, astrophysics and astronomy. A very particular feature of this conference is the large variety of talks ranging from purely theoretical to purely experimental subjects including novel technological aspects. This allows discussion and exchange of useful information and new ideas that are emerging to address particle physics experimental challenges. The scientific highlights at the Symposium came on many fronts: Status of low-energy neutrino physics and double-beta decay New ideas on double-beta decay experiments Gamma ray polarization measurement combining high-precision TPCs with MPGD read-out Dark Matter challenges in both axion and WIMP search with new emerging ideas for detection improvements Progress in gaseous and liquid TPCs for rare event detection Georges Charpak opened the meeting with a talk on gaseous detectors for applications in the bio-medical field. He also underlined the importance of new MPGD detectors for both physics and applications. There were about 100 registered participants at the symposium. The successful
A robust neural network-based approach for microseismic event detection
Akram, Jubran; Ovcharenko, Oleg; Peter, Daniel
2017-01-01
We present an artificial neural network based approach for robust event detection from low S/N waveforms. We use a feed-forward network with a single hidden layer that is tuned on a training dataset and later applied on the entire example dataset
Complex Event Detection via Multi Source Video Attributes (Open Access)
2013-10-03
Complex Event Detection via Multi-Source Video Attributes Zhigang Ma† Yi Yang‡ Zhongwen Xu‡§ Shuicheng Yan Nicu Sebe† Alexander G. Hauptmann...under its International Research Centre @ Singapore Fund- ing Initiative and administered by the IDM Programme Of- fice, and the Intelligence Advanced
Energy Reconstruction for Events Detected in TES X-ray Detectors
Ceballos, M. T.; Cardiel, N.; Cobo, B.
2015-09-01
The processing of the X-ray events detected by a TES (Transition Edge Sensor) device (such as the one that will be proposed in the ESA AO call for instruments for the Athena mission (Nandra et al. 2013) as a high spectral resolution instrument, X-IFU (Barret et al. 2013)), is a several step procedure that starts with the detection of the current pulses in a noisy signal and ends up with their energy reconstruction. For this last stage, an energy calibration process is required to convert the pseudo energies measured in the detector to the real energies of the incoming photons, accounting for possible nonlinearity effects in the detector. We present the details of the energy calibration algorithm we implemented as the last part of the Event Processing software that we are developing for the X-IFU instrument, that permits the calculation of the calibration constants in an analytical way.
Etgen, Thorleif; Hochreiter, Manfred; Mundel, Markus; Freudenberger, Thomas
2013-07-01
Atrial fibrillation (AF) is the most frequent risk factor in ischemic stroke but often remains undetected. We analyzed the value of insertable cardiac event recorder in detection of AF in a 1-year cohort of patients with cryptogenic ischemic stroke. All patients with cryptogenic stroke and eligibility for oral anticoagulation were offered the insertion of a cardiac event recorder. Regular follow-up for 1 year recorded the incidence of AF. Of the 393 patients with ischemic stroke, 65 (16.5%) had a cryptogenic stroke, and in 22 eligible patients, an event recorder was inserted. After 1 year, in 6 of 22 patients (27.3%), AF was detected. These preliminary data show that insertion of cardiac event recorder was eligible in approximately one third of patients with cryptogenic stroke and detected in approximately one quarter of these patients new AF.
Distributed Event Detection in Wireless Sensor Networks for Disaster Management
Bahrepour, M.; Meratnia, Nirvana; Poel, Mannes; Taghikhaki, Zahra; Havinga, Paul J.M.
2010-01-01
Recently, wireless sensor networks (WSNs) have become mature enough to go beyond being simple fine-grained continuous monitoring platforms and become one of the enabling technologies for disaster early-warning systems. Event detection functionality of WSNs can be of great help and importance for
LIU, Q.; Lv, Q.; Klucik, R.; Chen, C.; Gallaher, D. W.; Grant, G.; Shang, L.
2016-12-01
Due to the high volume and complexity of satellite data, computer-aided tools for fast quality assessments and scientific discovery are indispensable for scientists in the era of Big Data. In this work, we have developed a framework for automated anomalous event detection in massive satellite data. The framework consists of a clustering-based anomaly detection algorithm and a cloud-based tool for interactive analysis of detected anomalies. The algorithm is unsupervised and requires no prior knowledge of the data (e.g., expected normal pattern or known anomalies). As such, it works for diverse data sets, and performs well even in the presence of missing and noisy data. The cloud-based tool provides an intuitive mapping interface that allows users to interactively analyze anomalies using multiple features. As a whole, our framework can (1) identify outliers in a spatio-temporal context, (2) recognize and distinguish meaningful anomalous events from individual outliers, (3) rank those events based on "interestingness" (e.g., rareness or total number of outliers) defined by users, and (4) enable interactively query, exploration, and analysis of those anomalous events. In this presentation, we will demonstrate the effectiveness and efficiency of our framework in the application of detecting data quality issues and unusual natural events using two satellite datasets. The techniques and tools developed in this project are applicable for a diverse set of satellite data and will be made publicly available for scientists in early 2017.
Li, C.; Li, Z.; Peng, Z.; Zhang, C.; Nakata, N.
2017-12-01
Oklahoma has experienced abrupt increase of induced seismicity in the last decade. An important way to fully understand seismic activities in Oklahoma is to obtain more complete earthquake catalogs and detect different types of seismic events. The IRIS Community Wavefield Demonstration Experiment was deployed near Enid, Oklahoma in Summer of 2016. The dataset from this ultra-dense array provides an excellent opportunity for detecting microseismicity in that region with wavefield approaches. Here we examine continuous waveforms recorded by 3 seismic lines using local coherence for ultra-dense arrays (Li et al., 2017), which is a measure of cross-correlation of waveform at each station with its nearby stations. So far we have detected more than 5,000 events from 06/22/2016 to 07/20/2016, and majority of them are not listed on the regional catalog of Oklahoma or global catalogs, indicating that they are local events. We also identify 15-20 long-period long-duration events, some of them lasting for more than 500 s. Such events have been found at major plate-boundary faults (also known as deep tectonic tremor), as well as during hydraulic fracturing, slow-moving landslides and glaciers. Our next step is to locate these possible tremor-like events with their relative arrival times across the array and compare their occurrence times with solid-earth tides and injection histories to better understand their driving mechanisms.
Zhou, Hui; Ji, Ning; Samuel, Oluwarotimi Williams; Cao, Yafei; Zhao, Zheyi; Chen, Shixiong; Li, Guanglin
2016-10-01
Real-time detection of gait events can be applied as a reliable input to control drop foot correction devices and lower-limb prostheses. Among the different sensors used to acquire the signals associated with walking for gait event detection, the accelerometer is considered as a preferable sensor due to its convenience of use, small size, low cost, reliability, and low power consumption. Based on the acceleration signals, different algorithms have been proposed to detect toe off (TO) and heel strike (HS) gait events in previous studies. While these algorithms could achieve a relatively reasonable performance in gait event detection, they suffer from limitations such as poor real-time performance and are less reliable in the cases of up stair and down stair terrains. In this study, a new algorithm is proposed to detect the gait events on three walking terrains in real-time based on the analysis of acceleration jerk signals with a time-frequency method to obtain gait parameters, and then the determination of the peaks of jerk signals using peak heuristics. The performance of the newly proposed algorithm was evaluated with eight healthy subjects when they were walking on level ground, up stairs, and down stairs. Our experimental results showed that the mean F1 scores of the proposed algorithm were above 0.98 for HS event detection and 0.95 for TO event detection on the three terrains. This indicates that the current algorithm would be robust and accurate for gait event detection on different terrains. Findings from the current study suggest that the proposed method may be a preferable option in some applications such as drop foot correction devices and leg prostheses.
Kwon, Yong-Seok; Naeem, Khurram; Jeon, Min Yong; Kwon, Il-bum
2017-04-01
We analyze the relations of parameters in moving average method to enhance the event detectability of phase sensitive optical time domain reflectometer (OTDR). If the external events have unique frequency of vibration, then the control parameters of moving average method should be optimized in order to detect these events efficiently. A phase sensitive OTDR was implemented by a pulsed light source, which is composed of a laser diode, a semiconductor optical amplifier, an erbium-doped fiber amplifier, a fiber Bragg grating filter, and a light receiving part, which has a photo-detector and high speed data acquisition system. The moving average method is operated with the control parameters: total number of raw traces, M, number of averaged traces, N, and step size of moving, n. The raw traces are obtained by the phase sensitive OTDR with sound signals generated by a speaker. Using these trace data, the relation of the control parameters is analyzed. In the result, if the event signal has one frequency, then the optimal values of N, n are existed to detect the event efficiently.
Integrating physically based simulators with Event Detection Systems: Multi-site detection approach.
Housh, Mashor; Ohar, Ziv
2017-03-01
The Fault Detection (FD) Problem in control theory concerns of monitoring a system to identify when a fault has occurred. Two approaches can be distinguished for the FD: Signal processing based FD and Model-based FD. The former concerns of developing algorithms to directly infer faults from sensors' readings, while the latter uses a simulation model of the real-system to analyze the discrepancy between sensors' readings and expected values from the simulation model. Most contamination Event Detection Systems (EDSs) for water distribution systems have followed the signal processing based FD, which relies on analyzing the signals from monitoring stations independently of each other, rather than evaluating all stations simultaneously within an integrated network. In this study, we show that a model-based EDS which utilizes a physically based water quality and hydraulics simulation models, can outperform the signal processing based EDS. We also show that the model-based EDS can facilitate the development of a Multi-Site EDS (MSEDS), which analyzes the data from all the monitoring stations simultaneously within an integrated network. The advantage of the joint analysis in the MSEDS is expressed by increased detection accuracy (higher true positive alarms and fewer false alarms) and shorter detection time. Copyright © 2016 Elsevier Ltd. All rights reserved.
Extreme Events and Energy Providers: Science and Innovation
Yiou, P.; Vautard, R.
2012-04-01
Most socio-economic regulations related to the resilience to climate extremes, from infrastructure or network design to insurance premiums, are based on a present-day climate with an assumption of stationarity. Climate extremes (heat waves, cold spells, droughts, storms and wind stilling) affect in particular energy production, supply, demand and security in several ways. While national, European or international projects have generated vast amounts of climate projections for the 21st century, their practical use in long-term planning remains limited. Estimating probabilistic diagnostics of energy user relevant variables from those multi-model projections will help the energy sector to elaborate medium to long-term plans, and will allow the assessment of climate risks associated to those plans. The project "Extreme Events for Energy Providers" (E3P) aims at filling a gap between climate science and its practical use in the energy sector and creating in turn favourable conditions for new business opportunities. The value chain ranges from addressing research questions directly related to energy-significant climate extremes to providing innovative tools of information and decision making (including methodologies, best practices and software) and climate science training for the energy sector, with a focus on extreme events. Those tools will integrate the scientific knowledge that is developed by scientific communities, and translate it into a usable probabilistic framework. The project will deliver projection tools assessing the probabilities of future energy-relevant climate extremes at a range of spatial scales varying from pan-European to local scales. The E3P project is funded by the Knowledge and Innovation Community (KIC Climate). We will present the mechanisms of interactions between academic partners, SMEs and industrial partners for this project. Those mechanisms are elementary bricks of a climate service.
Buxner, S.; Jones, A. P.; Bleacher, L.; Wasser, M. L.; Day, B. H.; Shaner, A. J.; Bakerman, M. N.; Joseph, E.
2017-12-01
International Observe the Moon Night (InOMN) is an annual worldwide event, held in the fall, that celebrates lunar and planetary science and exploration. InOMN is sponsored by NASA's Lunar Reconnaissance Orbiter (LRO) in collaboration with NASA's Solar System Exploration Research Virtual Institute (SSERVI), the NASA's Heliophysics Education Consortium, CosmoQuest, Night Sky Network, and Science Festival Alliance. Other key partners include the NASA Museum Alliance, Night Sky Network, and NASA Solar System Ambassadors. In 2017, InOMN will bring together thousands of people across the globe to observe and learn about the Moon and its connection to planetary science. We are partnering with the NASA Science Mission Directorate total solar eclipse team to highlight InOMN as an opportunity to harness and sustain the interest and momentum in space science and observation following the August 21st eclipse. This is part of a new partnership with the Sun-Earth Day team, through the Heliophysics Education Consortium, to better connect the two largest NASA-sponsored public engagement events, increase participation in both events, and share best practices in implementation and evaluation between the teams. Over 3,800 InOMN events have been registered between 2010 and 2016, engaging over 550,000 visitors worldwide. Most InOMN events are held in the United States, with strong representation from many other countries. InOMN events are evaluated to determine the value of the events and to allow us to improve the experience for event hosts and visitors. Our results show that InOMN events are hosted by scientists, educators, and citizen enthusiasts around the world who leverage InOMN to bring communities together, get visitors excited and learn about the Moon - and beyond, and share resources to extend engagement in lunar and planetary science and observation. Through InOMN, we annually provide resources such as event-specific Moon maps, presentations, advertising materials, and
Science Hack Day: an opportunity for public engagement, art/science mash-ups, and inspiration
Bellis, Matthew
2013-04-01
The idea of a Science Hack Day (http://sciencehackday.com/) is to put non-scientists (designers, web developers, artists, interested enthusiasts) in a room with scientists and some good ideas, and see what science-themed project they can create in a weekend (about 24 hours of real hacking). The motto of the organizers is ``Get Excited and Make Things with Science!'' I have participated in several of these events including the first one held in the United State in Palo Alto in 2010 and as a remote advisor to participants in Nairobi, Kenya. To these events I have brought particle physics data from both the BaBar and the CMS (Compact Muon Solenoid) experiments, data from the CoGeNT dark matter direct-detection experiment, and my expertise and enthusiasm. The experience has been transformative for me as both a scientist and a science advocate. This talk will recount my experiences with Science Hack Day events in general and detail some projects that have come out of these days, including the Particle Physics Wind Chime (http://www.mattbellis.com/windchime/) and the Standard Model of Cocktail Physics (http://www.physicsdavid.net/2012/11/standard-model-of-cocktail-physics/). Opportunities for other scientists to take part in similar events will be discussed.
Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza
2017-01-01
A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.
The Climate Science Special Report: Detection and Attribution
Wehner, M. F.
2017-12-01
The Climate Science Special Report reiterates previous findings about the human influence on global mean surface air temperature with the statement "…it is extremely likely that human activities, especially emissions of greenhouse gases, are the dominant cause of the observed warming since the mid 20th century. For the warming over the last century, there is no convincing alternative explanation supported by the extent of the observational evidence." This is a statement made with high confidence and supported by multiple lines of evidence. The report also assesses the latest developments in the field of probabilistic extreme event attribution—the quantification of the influence of anthropogenic climate change on individual extreme weather events—with a focus on those recent events within the United States that have been analyzed. Thirty different events within the US are reported on including heat waves, cold snaps, wet seasons, individual storms and droughts. Most but not all of the individual US events studied revealed an influence from human induced changes to the climate system.
On the event detected by the Mont Blanc underground neutrino detector on February 23, 1987
Energy Technology Data Exchange (ETDEWEB)
Dadykin, V L; Zatsepin, G T; Korchagin, V B
1988-02-01
The event detected by the Mont Balnc Soviet -Italian scintillation detector on February 23, 1987 at 2:52:37 are discussed. The corrected energies of the pulases of the event and the probability of the event imitation by the background are presented.
Secure access control and large scale robust representation for online multimedia event detection.
Liu, Changyu; Lu, Bin; Li, Huiling
2014-01-01
We developed an online multimedia event detection (MED) system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC) model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK) event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.
Secure Access Control and Large Scale Robust Representation for Online Multimedia Event Detection
Directory of Open Access Journals (Sweden)
Changyu Liu
2014-01-01
Full Text Available We developed an online multimedia event detection (MED system. However, there are a secure access control issue and a large scale robust representation issue when we want to integrate traditional event detection algorithms into the online environment. For the first issue, we proposed a tree proxy-based and service-oriented access control (TPSAC model based on the traditional role based access control model. Verification experiments were conducted on the CloudSim simulation platform, and the results showed that the TPSAC model is suitable for the access control of dynamic online environments. For the second issue, inspired by the object-bank scene descriptor, we proposed a 1000-object-bank (1000OBK event descriptor. Feature vectors of the 1000OBK were extracted from response pyramids of 1000 generic object detectors which were trained on standard annotated image datasets, such as the ImageNet dataset. A spatial bag of words tiling approach was then adopted to encode these feature vectors for bridging the gap between the objects and events. Furthermore, we performed experiments in the context of event classification on the challenging TRECVID MED 2012 dataset, and the results showed that the robust 1000OBK event descriptor outperforms the state-of-the-art approaches.
TNO at TRECVID 2013: Multimedia Event Detection and Instance Search
Bouma, H.; Azzopardi, G.; Spitters, M.M.; Wit, J.J. de; Versloot, C.A.; Zon, R.W.L. van der; Eendebak, P.T.; Baan, J.; Hove, R.J.M. ten; Eekeren, A.W.M. van; Haar, F.B. ter; Hollander, R.J.M. den; Huis, R.J. van; Boer, M.H.T. de; Antwerpen, G. van; Broekhuijsen, B.J.; Daniele, L.M.; Brandt, P.; Schavemaker, J.G.M.; Kraaij, W.; Schutte, K.
2013-01-01
We describe the TNO system and the evaluation results for TRECVID 2013 Multimedia Event Detection (MED) and instance search (INS) tasks. The MED system consists of a bag-of-word (BOW) approach with spatial tiling that uses low-level static and dynamic visual features, an audio feature and high-level
A novel CUSUM-based approach for event detection in smart metering
Zhu, Zhicheng; Zhang, Shuai; Wei, Zhiqiang; Yin, Bo; Huang, Xianqing
2018-03-01
Non-intrusive load monitoring (NILM) plays such a significant role in raising consumer awareness on household electricity use to reduce overall energy consumption in the society. With regard to monitoring low power load, many researchers have introduced CUSUM into the NILM system, since the traditional event detection method is not as effective as expected. Due to the fact that the original CUSUM faces limitations given the small shift is below threshold, we therefore improve the test statistic which allows permissible deviation to gradually rise as the data size increases. This paper proposes a novel event detection and corresponding criterion that could be used in NILM systems to recognize transient states and to help the labelling task. Its performance has been tested in a real scenario where eight different appliances are connected to main line of electric power.
Predictive modeling of structured electronic health records for adverse drug event detection.
Zhao, Jing; Henriksson, Aron; Asker, Lars; Boström, Henrik
2015-01-01
The digitization of healthcare data, resulting from the increasingly widespread adoption of electronic health records, has greatly facilitated its analysis by computational methods and thereby enabled large-scale secondary use thereof. This can be exploited to support public health activities such as pharmacovigilance, wherein the safety of drugs is monitored to inform regulatory decisions about sustained use. To that end, electronic health records have emerged as a potentially valuable data source, providing access to longitudinal observations of patient treatment and drug use. A nascent line of research concerns predictive modeling of healthcare data for the automatic detection of adverse drug events, which presents its own set of challenges: it is not yet clear how to represent the heterogeneous data types in a manner conducive to learning high-performing machine learning models. Datasets from an electronic health record database are used for learning predictive models with the purpose of detecting adverse drug events. The use and representation of two data types, as well as their combination, are studied: clinical codes, describing prescribed drugs and assigned diagnoses, and measurements. Feature selection is conducted on the various types of data to reduce dimensionality and sparsity, while allowing for an in-depth feature analysis of the usefulness of each data type and representation. Within each data type, combining multiple representations yields better predictive performance compared to using any single representation. The use of clinical codes for adverse drug event detection significantly outperforms the use of measurements; however, there is no significant difference over datasets between using only clinical codes and their combination with measurements. For certain adverse drug events, the combination does, however, outperform using only clinical codes. Feature selection leads to increased predictive performance for both data types, in isolation and
Detection of visual events along the apparent motion trace in patients with paranoid schizophrenia.
Sanders, Lia Lira Olivier; Muckli, Lars; de Millas, Walter; Lautenschlager, Marion; Heinz, Andreas; Kathmann, Norbert; Sterzer, Philipp
2012-07-30
Dysfunctional prediction in sensory processing has been suggested as a possible causal mechanism in the development of delusions in patients with schizophrenia. Previous studies in healthy subjects have shown that while the perception of apparent motion can mask visual events along the illusory motion trace, such motion masking is reduced when events are spatio-temporally compatible with the illusion, and, therefore, predictable. Here we tested the hypothesis that this specific detection advantage for predictable target stimuli on the apparent motion trace is reduced in patients with paranoid schizophrenia. Our data show that, although target detection along the illusory motion trace is generally impaired, both patients and healthy control participants detect predictable targets more often than unpredictable targets. Patients had a stronger motion masking effect when compared to controls. However, patients showed the same advantage in the detection of predictable targets as healthy control subjects. Our findings reveal stronger motion masking but intact prediction of visual events along the apparent motion trace in patients with paranoid schizophrenia and suggest that the sensory prediction mechanism underlying apparent motion is not impaired in paranoid schizophrenia. Copyright © 2012. Published by Elsevier Ireland Ltd.
Detection of unusual events and trends in complex non-stationary data streams
International Nuclear Information System (INIS)
Charlton-Perez, C.; Perez, R.B.; Protopopescu, V.; Worley, B.A.
2011-01-01
The search for unusual events and trends hidden in multi-component, nonlinear, non-stationary, noisy signals is extremely important for diverse applications, ranging from power plant operation to homeland security. In the context of this work, we define an unusual event as a local signal disturbance and a trend as a continuous carrier of information added to and different from the underlying baseline dynamics. The goal of this paper is to investigate the feasibility of detecting hidden events inside intermittent signal data sets corrupted by high levels of noise, by using the Hilbert-Huang empirical mode decomposition method.
Directory of Open Access Journals (Sweden)
Hyoung‐Gook Kim
2017-12-01
Full Text Available Recently, deep recurrent neural networks have achieved great success in various machine learning tasks, and have also been applied for sound event detection. The detection of temporally overlapping sound events in realistic environments is much more challenging than in monophonic detection problems. In this paper, we present an approach to improve the accuracy of polyphonic sound event detection in multichannel audio based on gated recurrent neural networks in combination with auditory spectral features. In the proposed method, human hearing perception‐based spatial and spectral‐domain noise‐reduced harmonic features are extracted from multichannel audio and used as high‐resolution spectral inputs to train gated recurrent neural networks. This provides a fast and stable convergence rate compared to long short‐term memory recurrent neural networks. Our evaluation reveals that the proposed method outperforms the conventional approaches.
Energy Technology Data Exchange (ETDEWEB)
Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.
2007-01-30
In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are
International Nuclear Information System (INIS)
Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.
2007-01-01
In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are
Latency and mode of error detection as reflected in Swedish licensee event reports
Energy Technology Data Exchange (ETDEWEB)
Svenson, Ola; Salo, Ilkka [Stockholm Univ., (Sweden). Dept. of Psychology
2002-03-01
Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety.
Latency and mode of error detection as reflected in Swedish licensee event reports
International Nuclear Information System (INIS)
Svenson, Ola; Salo, Ilkka
2002-03-01
Licensee event reports (LERs) from an industry provide important information feedback about safety to the industry itself, the regulators and to the public. LERs from four nuclear power reactors were analyzed to find out about detection times, mode of detection and qualitative differences in reports from different reactors. The reliability of the coding was satisfactory and measured as the covariance between the ratings from two independent judges. The results showed differences in detection time across the reactors. On the average about ten percent of the errors remained undetected for 100 weeks or more, but the great majority of errors were detected soon after their first appearance in the plant. On the average 40 percent of the errors were detected in regular tests and 40 per cent through alarms. Operators found about 10 per cent of the errors through noticing something abnormal in the plant. The remaining errors were detected in various other ways. There were qualitative differences between the LERs from the different reactors reflecting the different conditions in the plants. The number of reports differed by a magnitude 1:2 between the different plants. However, a greater number of LERs can indicate both higher safety standards (e.g., a greater willingness to report all possible events to be able to learn from them) and lower safety standards (e.g., reporting as few events as possible to make a good impression). It was pointed out that LERs are indispensable in order to maintain safety of an industry and that the differences between plants found in the analyses of this study indicate how error reports can be used to initiate further investigations for improved safety
Spacecraft-to-Earth Communications for Juno and Mars Science Laboratory Critical Events
Soriano, Melissa; Finley, Susan; Jongeling, Andre; Fort, David; Goodhart, Charles; Rogstad, David; Navarro, Robert
2012-01-01
Deep Space communications typically utilize closed loop receivers and Binary Phase Shift Keying (BPSK) or Quadrature Phase Shift Keying (QPSK). Critical spacecraft events include orbit insertion and entry, descent, and landing.---Low gain antennas--> low signal -to-noise-ratio.---High dynamics such as parachute deployment or spin --> Doppler shift. During critical events, open loop receivers and Multiple Frequency Shift Keying (MFSK) used. Entry, Descent, Landing (EDL) Data Analysis (EDA) system detects tones in real-time.
Event detection and exception handling strategies in the ASDEX Upgrade discharge control system
International Nuclear Information System (INIS)
Treutterer, W.; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.
2013-01-01
Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control
Event detection and exception handling strategies in the ASDEX Upgrade discharge control system
Energy Technology Data Exchange (ETDEWEB)
Treutterer, W., E-mail: Wolfgang.Treutterer@ipp.mpg.de; Neu, G.; Rapson, C.; Raupp, G.; Zasche, D.; Zehetbauer, T.
2013-10-15
Highlights: •Event detection and exception handling is integrated in control system architecture. •Pulse control with local exception handling and pulse supervision with central exception handling are strictly separated. •Local exception handling limits the effect of an exception to a minimal part of the controlled system. •Central Exception Handling solves problems requiring coordinated action of multiple control components. -- Abstract: Thermonuclear plasmas are governed by nonlinear characteristics: plasma operation can be classified into scenarios with pronounced features like L and H-mode, ELMs or MHD activity. Transitions between them may be treated as events. Similarly, technical systems are also subject to events such as failure of measurement sensors, actuator saturation or violation of machine and plant operation limits. Such situations often are handled with a mixture of pulse abortion and iteratively improved pulse schedule reference programming. In case of protection-relevant events, however, the complexity of even a medium-sized device as ASDEX Upgrade requires a sophisticated and coordinated shutdown procedure rather than a simple stop of the pulse. The detection of events and their intelligent handling by the control system has been shown to be valuable also in terms of saving experiment time and cost. This paper outlines how ASDEX Upgrade's discharge control system (DCS) detects events and handles exceptions in two stages: locally and centrally. The goal of local exception handling is to limit the effect of an unexpected or asynchronous event to a minimal part of the controlled system. Thus, local exception handling facilitates robustness to failures but keeps the decision structures lean. A central state machine deals with exceptions requiring coordinated action of multiple control components. DCS implements the state machine by means of pulse schedule segments containing pre-programmed waveforms to define discharge goal and control
The necessity of recognizing all events in x-ray detection
International Nuclear Information System (INIS)
Papp, T.; Maxwell, J.A.; Papp, A.T.
2008-01-01
-ray detection. Examples will be given in detection of x-rays in nuclear backgrounds, and in industrial measurements for ROHS and WEEE compliance with input rates of up to several hundred thousands counts per seconds. The availability of all the events allows one to see the other part of the spectrum, and thus offer explanations why the basic parameters are in such a bad shape
Mancuso, Vincent J.
Students' scientific investigations have been identified in national standards and related reform documents as a critical component of students' learning experiences in school, yet it is not easy to implement them in science classrooms. Could science demonstrations help science teachers put this recommendation into practice? While demonstrations are a common practice in the science classroom and research has documented some positive effects in terms of student motivation and engagement from their use, the literature also shows that, as traditionally presented, science demonstrations do not always achieve their intended outcomes. This, in turn, suggested the value of investigating what design elements of demonstrations could be used to promote specific instructional goals. Employing action research as a methodology, the proposed study was developed to explore how science demonstrations can be designed so as to most effectively promote student engagement in scientific investigations. More specifically, I was interested in examining the effects of using a discrepant event as part of the demonstration, as a way to create cognitive conflict and, thus, increase interest and engagement. I also investigated the relative merit of the well-researched POE (Predict, Observe, Explain) design versus employing demonstrations that appear to the student to be unplanned (what I will refer to as NOE, or a Naturally Occurring Experience). This study was informed by Constructivism, Situated Cognition and Conceptual Change as theoretical frameworks. The project included the design, implementation and study of an intervention consisting of three instructional units designed to support students' learning of the concepts of density, molecular arrangement of gas particles, and cohesion, respectively. In each of these units, lasting a total of two 80-minute class periods, students were asked to design and conduct an investigation to gain a better understanding of the concept under study. In
Fundamental aspects of seismic event detection, magnitude estimation and their interrelation
International Nuclear Information System (INIS)
Ringdal, F.
1977-01-01
The main common subject of the papers forming this thesis is statistical model development within the seismological disciplines of seismic event detection and event magnitude estimation. As more high quality seismic data become available as a result of recent seismic network developments, the opportunity will exist for large scale application and further refinement of these models. It is hoped that the work presented here will facilitate improved understanding of the basic issues, both within earthquake-explosion discrimination, in the framework of which most of this work originated, and in seismology in general. (Auth.)
Brewer, Gene A; Knight, Justin B; Marsh, Richard L; Unsworth, Nash
2010-04-01
The multiprocess view proposes that different processes can be used to detect event-based prospective memory cues, depending in part on the specificity of the cue. According to this theory, attentional processes are not necessary to detect focal cues, whereas detection of nonfocal cues requires some form of controlled attention. This notion was tested using a design in which we compared performance on a focal and on a nonfocal prospective memory task by participants with high or low working memory capacity. An interaction was found, such that participants with high and low working memory performed equally well on the focal task, whereas the participants with high working memory performed significantly better on the nonfocal task than did their counterparts with low working memory. Thus, controlled attention was only necessary for detecting event-based prospective memory cues in the nonfocal task. These results have implications for theories of prospective memory, the processes necessary for cue detection, and the successful fulfillment of intentions.
Directory of Open Access Journals (Sweden)
Junji eOhyama
2016-02-01
Full Text Available We examined how the temporal and spatial predictability of a task-irrelevant visual event affects the detection and memory of a visual item embedded in a continuously changing sequence. Participants observed 11 sequentially presented letters, during which a task-irrelevant visual event was either present or absent. Predictabilities of spatial location and temporal position of the event were controlled in 2 × 2 conditions. In the spatially predictable conditions, the event occurred at the same location within the stimulus sequence or at another location, while, in the spatially unpredictable conditions, it occurred at random locations. In the temporally predictable conditions, the event timing was fixed relative to the order of the letters, while in the temporally unpredictable condition, it could not be predicted from the letter order. Participants performed a working memory task and a target detection reaction time task. Memory accuracy was higher for a letter simultaneously presented at the same location as the event in the temporally unpredictable conditions, irrespective of the spatial predictability of the event. On the other hand, the detection reaction times were only faster for a letter simultaneously presented at the same location as the event when the event was both temporally and spatially predictable. Thus, to facilitate ongoing detection processes, an event must be predictable both in space and time, while memory processes are enhanced by temporally unpredictable (i.e., surprising events. Evidently, temporal predictability has differential effects on detection and memory of a visual item embedded in a sequence of images.
Flow detection via sparse frame analysis for suspicious event recognition in infrared imagery
Fernandes, Henrique C.; Batista, Marcos A.; Barcelos, Celia A. Z.; Maldague, Xavier P. V.
2013-05-01
It is becoming increasingly evident that intelligent systems are very bene¯cial for society and that the further development of such systems is necessary to continue to improve society's quality of life. One area that has drawn the attention of recent research is the development of automatic surveillance systems. In our work we outline a system capable of monitoring an uncontrolled area (an outside parking lot) using infrared imagery and recognizing suspicious events in this area. The ¯rst step is to identify moving objects and segment them from the scene's background. Our approach is based on a dynamic background-subtraction technique which robustly adapts detection to illumination changes. It is analyzed only regions where movement is occurring, ignoring in°uence of pixels from regions where there is no movement, to segment moving objects. Regions where movement is occurring are identi¯ed using °ow detection via sparse frame analysis. During the tracking process the objects are classi¯ed into two categories: Persons and Vehicles, based on features such as size and velocity. The last step is to recognize suspicious events that may occur in the scene. Since the objects are correctly segmented and classi¯ed it is possible to identify those events using features such as velocity and time spent motionless in one spot. In this paper we recognize the suspicious event suspicion of object(s) theft from inside a parked vehicle at spot X by a person" and results show that the use of °ow detection increases the recognition of this suspicious event from 78:57% to 92:85%.
A study in the use of the position of discrepant events in the teaching of science
Frassinelli, John James
The purpose of this study was to determine whether alternative placement of discrepant events would impact affective and cognitive outcomes of ninth-grade physical science students grouped into intact classes and classified as either "high" or "low" in prior academic achievement. Although researchers have found discrepant events to be effective in terms of cognition and recall, their chronological placement within science lessons had not been empirically researched. In this study, discrepant events were presented before, during, and after specific science lessons involving thermodynamics and heat. Discrepant events were withheld from the control group. To measure affective outcomes, the "enjoyment" and "motivation" scales taken from Sandman's (1973) Attitudes Towards Science Inventory (ATSI) were used to index subjects' global feelings about studying science, while a 20-item set of Semantic Differential (SD) scales was employed to determine their attitudes regarding the specific subject matter taught. To measure cognitive outcomes, a 20-item, selected response test was constructed by the researcher, with 6 items intended to assess subjects' knowledge of unit materials, and 14 items designed to query their understanding of unit concepts. Each subject (N = 131) was administered identical forms of each test in both pre-and post-test formats, both before and after the four-week study. Analyzed using a 4 x 2 mixed Analysis of Variance (ANOVA) model, data pertinent to the ATSI suggested neither between- nor within-group differences in subjects' global attitudes about studying science, although data pertinent to the SD scales indicated generally improved attitudes about studying thermodynamics and heat (F (1,122) = 2.759, p < .10). On the cognitive pretests and posttests, significant two-way interactions were observed for the overall test and experimental condition (F (3,121) = 4.068, p < .01), as well as for the overall test and higher prior achievement in physical
Kreilinger, Alex; Hiebel, Hannah; Müller-Putz, Gernot R
2016-03-01
This work aimed to find and evaluate a new method for detecting errors in continuous brain-computer interface (BCI) applications. Instead of classifying errors on a single-trial basis, the new method was based on multiple events (MEs) analysis to increase the accuracy of error detection. In a BCI-driven car game, based on motor imagery (MI), discrete events were triggered whenever subjects collided with coins and/or barriers. Coins counted as correct events, whereas barriers were errors. This new method, termed ME method, combined and averaged the classification results of single events (SEs) and determined the correctness of MI trials, which consisted of event sequences instead of SEs. The benefit of this method was evaluated in an offline simulation. In an online experiment, the new method was used to detect erroneous MI trials. Such MI trials were discarded and could be repeated by the users. We found that, even with low SE error potential (ErrP) detection rates, feasible accuracies can be achieved when combining MEs to distinguish erroneous from correct MI trials. Online, all subjects reached higher scores with error detection than without, at the cost of longer times needed for completing the game. Findings suggest that ErrP detection may become a reliable tool for monitoring continuous states in BCI applications when combining MEs. This paper demonstrates a novel technique for detecting errors in online continuous BCI applications, which yields promising results even with low single-trial detection rates.
Peidou, Athina C.; Fotopoulos, Georgia; Pagiatakis, Spiros
2017-10-01
The main focus of this paper is to assess the feasibility of utilizing dedicated satellite gravity missions in order to detect large-scale solid mass transfer events (e.g. landslides). Specifically, a sensitivity analysis of Gravity Recovery and Climate Experiment (GRACE) gravity field solutions in conjunction with simulated case studies is employed to predict gravity changes due to past subaerial and submarine mass transfer events, namely the Agulhas slump in southeastern Africa and the Heart Mountain Landslide in northwestern Wyoming. The detectability of these events is evaluated by taking into account the expected noise level in the GRACE gravity field solutions and simulating their impact on the gravity field through forward modelling of the mass transfer. The spectral content of the estimated gravity changes induced by a simulated large-scale landslide event is estimated for the known spatial resolution of the GRACE observations using wavelet multiresolution analysis. The results indicate that both the Agulhas slump and the Heart Mountain Landslide could have been detected by GRACE, resulting in {\\vert }0.4{\\vert } and {\\vert }0.18{\\vert } mGal change on GRACE solutions, respectively. The suggested methodology is further extended to the case studies of the submarine landslide in Tohoku, Japan, and the Grand Banks landslide in Newfoundland, Canada. The detectability of these events using GRACE solutions is assessed through their impact on the gravity field.
A Macro-Observation Scheme for Abnormal Event Detection in Daily-Life Video Sequences
Directory of Open Access Journals (Sweden)
Chiu Wei-Yao
2010-01-01
Full Text Available Abstract We propose a macro-observation scheme for abnormal event detection in daily life. The proposed macro-observation representation records the time-space energy of motions of all moving objects in a scene without segmenting individual object parts. The energy history of each pixel in the scene is instantly updated with exponential weights without explicitly specifying the duration of each activity. Since possible activities in daily life are numerous and distinct from each other and not all abnormal events can be foreseen, images from a video sequence that spans sufficient repetition of normal day-to-day activities are first randomly sampled. A constrained clustering model is proposed to partition the sampled images into groups. The new observed event that has distinct distance from any of the cluster centroids is then classified as an anomaly. The proposed method has been evaluated in daily work of a laboratory and BEHAVE benchmark dataset. The experimental results reveal that it can well detect abnormal events such as burglary and fighting as long as they last for a sufficient duration of time. The proposed method can be used as a support system for the scene that requires full time monitoring personnel.
Polygraph lie detection on real events in a laboratory setting.
Bradley, M T; Cullen, M C
1993-06-01
This laboratory study dealt with real-life intense emotional events. Subjects generated embarrassing stories from their experience, then submitted to polygraph testing and, by lying, denied their stories and, by telling the truth, denied a randomly assigned story. Money was given as an incentive to be judged innocent on each story. An interrogator, blind to the stories, used Control Question Tests and found subjects more deceptive when lying than when truthful. Stories interacted with order such that lying on the second story was more easily detected than lying on the first. Embarrassing stories provide an alternative to the use of mock crimes to study lie detection in the laboratory.
The GLAST LAT Instrument Science Operations Center
International Nuclear Information System (INIS)
Cameron, Robert A.; SLAC
2007-01-01
The Gamma-ray Large Area Space Telescope (GLAST) is scheduled for launch in late 2007. Operations support and science data processing for the Large Area Telescope (LAT) instrument on GLAST will be provided by the LAT Instrument Science Operations Center (ISOC) at the Stanford Linear Accelerator Center (SLAC). The ISOC supports GLAST mission operations in conjunction with other GLAST mission ground system elements and supports the research activities of the LAT scientific collaboration. The ISOC will be responsible for monitoring the health and safety of the LAT, preparing command loads for the LAT, maintaining embedded flight software which controls the LAT detector and data acquisition flight hardware, maintaining the operating configuration of the LAT and its calibration, and applying event reconstruction processing to down-linked LAT data to recover information about detected gamma-ray photons. The SLAC computer farm will be used to process LAT event data and generate science products, to be made available to the LAT collaboration through the ISOC and to the broader scientific community through the GLAST Science Support Center at NASA/GSFC. ISOC science operations will optimize the performance of the LAT and oversee automated science processing of LAT data to detect and monitor transient gamma-ray sources
Predictions for microlensing planetary events from core accretion theory
International Nuclear Information System (INIS)
Zhu, Wei; Mao, Shude; Penny, Matthew; Gould, Andrew; Gendron, Rieul
2014-01-01
We conduct the first microlensing simulation in the context of a planet formation model. The planet population is taken from the Ida and Lin core accretion model for 0.3 M ☉ stars. With 6690 microlensing events, we find that for a simplified Korea Microlensing Telescopes Network (KMTNet), the fraction of planetary events is 2.9%, out of which 5.5% show multiple-planet signatures. The numbers of super-Earths, super-Neptunes, and super-Jupiters detected are expected to be almost equal. Our simulation shows that high-magnification events and massive planets are favored by planet detections, which is consistent with previous expectation. However, we notice that extremely high-magnification events are less sensitive to planets, which is possibly because the 10 minute sampling of KMTNet is not intensive enough to capture the subtle anomalies that occur near the peak. This suggests that while KMTNet observations can be systematically analyzed without reference to any follow-up data, follow-up observations will be essential in extracting the full science potential of very high magnification events. The uniformly high-cadence observations expected for KMTNet also result in ∼55% of all detected planets not being caustic crossing, and more low-mass planets even down to Mars mass being detected via planetary caustics. We also find that the distributions of orbital inclinations and planet mass ratios in multiple-planet events agree with the intrinsic distributions.
Predictions for microlensing planetary events from core accretion theory
Energy Technology Data Exchange (ETDEWEB)
Zhu, Wei; Mao, Shude [National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Penny, Matthew; Gould, Andrew [Department of Astronomy, The Ohio State University, 140 W. 18th Avenue, Columbus, OH 43210 (United States); Gendron, Rieul, E-mail: weizhu@astronomy.ohio-state.edu [Jodrell Bank Centre for Astrophysics, University of Manchester, Alan Turing Building, Manchester M13 9PL (United Kingdom)
2014-06-10
We conduct the first microlensing simulation in the context of a planet formation model. The planet population is taken from the Ida and Lin core accretion model for 0.3 M {sub ☉} stars. With 6690 microlensing events, we find that for a simplified Korea Microlensing Telescopes Network (KMTNet), the fraction of planetary events is 2.9%, out of which 5.5% show multiple-planet signatures. The numbers of super-Earths, super-Neptunes, and super-Jupiters detected are expected to be almost equal. Our simulation shows that high-magnification events and massive planets are favored by planet detections, which is consistent with previous expectation. However, we notice that extremely high-magnification events are less sensitive to planets, which is possibly because the 10 minute sampling of KMTNet is not intensive enough to capture the subtle anomalies that occur near the peak. This suggests that while KMTNet observations can be systematically analyzed without reference to any follow-up data, follow-up observations will be essential in extracting the full science potential of very high magnification events. The uniformly high-cadence observations expected for KMTNet also result in ∼55% of all detected planets not being caustic crossing, and more low-mass planets even down to Mars mass being detected via planetary caustics. We also find that the distributions of orbital inclinations and planet mass ratios in multiple-planet events agree with the intrinsic distributions.
Detection of Unusual Events and Trends in Complex Non-Stationary Data Streams
International Nuclear Information System (INIS)
Perez, Rafael B.; Protopopescu, Vladimir A.; Worley, Brian Addison; Perez, Cristina
2006-01-01
The search for unusual events and trends hidden in multi-component, nonlinear, non-stationary, noisy signals is extremely important for a host of different applications, ranging from nuclear power plant and electric grid operation to internet traffic and implementation of non-proliferation protocols. In the context of this work, we define an unusual event as a local signal disturbance and a trend as a continuous carrier of information added to and different from the underlying baseline dynamics. The goal of this paper is to investigate the feasibility of detecting hidden intermittent events inside non-stationary signal data sets corrupted by high levels of noise, by using the Hilbert-Huang empirical mode decomposition method
Li, Yunji; Wu, QingE; Peng, Li
2018-01-23
In this paper, a synthesized design of fault-detection filter and fault estimator is considered for a class of discrete-time stochastic systems in the framework of event-triggered transmission scheme subject to unknown disturbances and deception attacks. A random variable obeying the Bernoulli distribution is employed to characterize the phenomena of the randomly occurring deception attacks. To achieve a fault-detection residual is only sensitive to faults while robust to disturbances, a coordinate transformation approach is exploited. This approach can transform the considered system into two subsystems and the unknown disturbances are removed from one of the subsystems. The gain of fault-detection filter is derived by minimizing an upper bound of filter error covariance. Meanwhile, system faults can be reconstructed by the remote fault estimator. An recursive approach is developed to obtain fault estimator gains as well as guarantee the fault estimator performance. Furthermore, the corresponding event-triggered sensor data transmission scheme is also presented for improving working-life of the wireless sensor node when measurement information are aperiodically transmitted. Finally, a scaled version of an industrial system consisting of local PC, remote estimator and wireless sensor node is used to experimentally evaluate the proposed theoretical results. In particular, a novel fault-alarming strategy is proposed so that the real-time capacity of fault-detection is guaranteed when the event condition is triggered.
Automatic detection of lexical change: an auditory event-related potential study.
Muller-Gass, Alexandra; Roye, Anja; Kirmse, Ursula; Saupe, Katja; Jacobsen, Thomas; Schröger, Erich
2007-10-29
We investigated the detection of rare task-irrelevant changes in the lexical status of speech stimuli. Participants performed a nonlinguistic task on word and pseudoword stimuli that occurred, in separate conditions, rarely or frequently. Task performance for pseudowords was deteriorated relative to words, suggesting unintentional lexical analysis. Furthermore, rare word and pseudoword changes had a similar effect on the event-related potentials, starting as early as 165 ms. This is the first demonstration of the automatic detection of change in lexical status that is not based on a co-occurring acoustic change. We propose that, following lexical analysis of the incoming stimuli, a mental representation of the lexical regularity is formed and used as a template against which lexical change can be detected.
DEFF Research Database (Denmark)
Olsen, Emil; Andersen, Pia Haubro; Pfau, Thilo
2012-01-01
The increased variations of temporal gait events when pathology is present are good candidate features for objective diagnostic tests. We hypothesised that the gait events hoof-on/off and stance can be detected accurately and precisely using features from trunk and distal limb-mounted Inertial....... Accuracy (bias) and precision (SD of bias) was calculated to compare force plate and IMU timings for gait events. Data were collected from seven horses. One hundred and twenty three (123) front limb steps were analysed; hoof-on was detected with a bias (SD) of -7 (23) ms, hoof-off with 0.7 (37) ms...... and front limb stance with -0.02 (37) ms. A total of 119 hind limb steps were analysed; hoof-on was found with a bias (SD) of -4 (25) ms, hoof-off with 6 (21) ms and hind limb stance with 0.2 (28) ms. IMUs mounted on the distal limbs and sacrum can detect gait events accurately and precisely....
Discrete Event Simulation Model of the Polaris 2.1 Gamma Ray Imaging Radiation Detection Device
2016-06-01
release; distribution is unlimited DISCRETE EVENT SIMULATION MODEL OF THE POLARIS 2.1 GAMMA RAY IMAGING RADIATION DETECTION DEVICE by Andres T...ONLY (Leave blank) 2. REPORT DATE June 2016 3. REPORT TYPE AND DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE DISCRETE EVENT SIMULATION MODEL...modeled. The platform, Simkit, was utilized to create a discrete event simulation (DES) model of the Polaris. After carefully constructing the DES
Detections of Planets in Binaries Through the Channel of Chang–Refsdal Gravitational Lensing Events
Energy Technology Data Exchange (ETDEWEB)
Han, Cheongho [Department of Physics, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Shin, In-Gu; Jung, Youn Kil [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)
2017-02-01
Chang–Refsdal (C–R) lensing, which refers to the gravitational lensing of a point mass perturbed by a constant external shear, provides a good approximation in describing lensing behaviors of either a very wide or a very close binary lens. C–R lensing events, which are identified by short-term anomalies near the peak of high-magnification lensing light curves, are routinely detected from lensing surveys, but not much attention is paid to them. In this paper, we point out that C–R lensing events provide an important channel to detect planets in binaries, both in close and wide binary systems. Detecting planets through the C–R lensing event channel is possible because the planet-induced perturbation occurs in the same region of the C–R lensing-induced anomaly and thus the existence of the planet can be identified by the additional deviation in the central perturbation. By presenting the analysis of the actually observed C–R lensing event OGLE-2015-BLG-1319, we demonstrate that dense and high-precision coverage of a C–R lensing-induced perturbation can provide a strong constraint on the existence of a planet in a wide range of planet parameters. The sample of an increased number of microlensing planets in binary systems will provide important observational constraints in giving shape to the details of planet formation, which have been restricted to the case of single stars to date.
Unsupervised behaviour-specific dictionary learning for abnormal event detection
DEFF Research Database (Denmark)
Ren, Huamin; Liu, Weifeng; Olsen, Søren Ingvor
2015-01-01
the training data is only a small proportion of the surveillance data. Therefore, we propose behavior-specific dictionaries (BSD) through unsupervised learning, pursuing atoms from the same type of behavior to represent one behavior dictionary. To further improve the dictionary by introducing information from...... potential infrequent normal patterns, we refine the dictionary by searching ‘missed atoms’ that have compact coefficients. Experimental results show that our BSD algorithm outperforms state-of-the-art dictionaries in abnormal event detection on the public UCSD dataset. Moreover, BSD has less false alarms...
International Nuclear Information System (INIS)
Hou, Dibo; He, Huimei; Huang, Pingjie; Zhang, Guangxin; Loaiciga, Hugo
2013-01-01
This study presents a method for detecting contamination events of sources of drinking water based on the Dempster–Shafer (D-S) evidence theory. The detection method has the purpose of protecting water supply systems against accidental and intentional contamination events. This purpose is achieved by first predicting future water-quality parameters using an autoregressive (AR) model. The AR model predicts future water-quality parameters using recent measurements of these parameters made with automated (on-line) water-quality sensors. Next, a probabilistic method assigns probabilities to the time series of residuals formed by comparing predicted water-quality parameters with threshold values. Finally, the D-S fusion method searches for anomalous probabilities of the residuals and uses the result of that search to determine whether the current water quality is normal (that is, free of pollution) or contaminated. The D-S fusion method is extended and improved in this paper by weighted averaging of water-contamination evidence and by the analysis of the persistence of anomalous probabilities of water-quality parameters. The extended D-S fusion method makes determinations that have a high probability of being correct concerning whether or not a source of drinking water has been contaminated. This paper's method for detecting water-contamination events was tested with water-quality time series from automated (on-line) water quality sensors. In addition, a small-scale, experimental, water-pipe network was tested to detect water-contamination events. The two tests demonstrated that the extended D-S fusion method achieves a low false alarm rate and high probabilities of detecting water contamination events. (paper)
Quench detection of fast plasma events for the JT-60SA central solenoid
International Nuclear Information System (INIS)
Murakami, Haruyuki; Kizu, Kaname; Tsuchiya, Katsuhiko; Kamiya, Koji; Takahashi, Yoshikazu; Yoshida, Kiyoshi
2012-01-01
Highlights: ► Pick-up coil method is used for the quench detection of JT-60SA magnet system. ► Disk-shaped pick-up coils are inserted in CS module to compensate inductive voltage. ► Applicability of pick-up coil is evaluated by two dimensional analysis. ► Pick-up coil is applicable whenever disruption, mini collapse and other plasma event. - Abstract: The JT-60 is planned to be modified to a full-superconducting tokamak referred to as the JT-60 Super Advanced (JT-60SA). The maximum temperature of the magnet during its quench might reach the temperature of higher than several hundreds Kelvin that will damage the superconducting magnet itself. The high precision quench detection system, therefore, is one of the key technologies in the superconducting magnet protection system. The pick-up coil method, which is using voltage taps to detect the normal voltage, is used for the quench detection of the JT-60SA superconducting magnet system. The disk-shaped pick-up coils are inserted in the central solenoid (CS) module to compensate the inductive voltage. In the previous study, the quench detection system requires a large number of pick-up coils. The reliability of quench detection system would be higher by simplifying the detection system such as reducing the number of pick-up coils. Simplifying the quench detection system is also important to reduce the total cost of the protection system. Hence the design method is improved by increasing optimizing parameters. The improved design method can reduce the number of pick-up coils without reducing the sensitivity of detection; consequently the protection system can be designed with higher reliability and lower cost. The applicability of the disk-shaped pick-up coil for quench detection system is evaluated by the two dimensional analysis. In the previous study, however, the analysis model only took into account the CS, EF (equilibrium field) coils and plasma. Therefore, applicability of the disk-shaped pick-up coil for
Automatic Multi-sensor Data Quality Checking and Event Detection for Environmental Sensing
LIU, Q.; Zhang, Y.; Zhao, Y.; Gao, D.; Gallaher, D. W.; Lv, Q.; Shang, L.
2017-12-01
With the advances in sensing technologies, large-scale environmental sensing infrastructures are pervasively deployed to continuously collect data for various research and application fields, such as air quality study and weather condition monitoring. In such infrastructures, many sensor nodes are distributed in a specific area and each individual sensor node is capable of measuring several parameters (e.g., humidity, temperature, and pressure), providing massive data for natural event detection and analysis. However, due to the dynamics of the ambient environment, sensor data can be contaminated by errors or noise. Thus, data quality is still a primary concern for scientists before drawing any reliable scientific conclusions. To help researchers identify potential data quality issues and detect meaningful natural events, this work proposes a novel algorithm to automatically identify and rank anomalous time windows from multiple sensor data streams. More specifically, (1) the algorithm adaptively learns the characteristics of normal evolving time series and (2) models the spatial-temporal relationship among multiple sensor nodes to infer the anomaly likelihood of a time series window for a particular parameter in a sensor node. Case studies using different data sets are presented and the experimental results demonstrate that the proposed algorithm can effectively identify anomalous time windows, which may resulted from data quality issues and natural events.
Detection of nitrification events in chloraminated drinking water distribution systems remains an ongoing challenge for many drinking water utilities, including Dallas Water Utilities (DWU) and the City of Houston (CoH). Each year, these utilities experience nitrification events ...
Directory of Open Access Journals (Sweden)
Sofia Maria Dima
2016-01-01
Full Text Available Event detection in realistic WSN environments is a critical research domain, while the environmental monitoring comprises one of its most pronounced applications. Although efforts related to the environmental applications have been presented in the current literature, there is a significant lack of investigation on the performance of such systems, when applied in wireless environments. Aiming at addressing this shortage, in this paper an advanced multimodal approach is followed based on fuzzy logic. The proposed fuzzy inference system (FIS is implemented on TelosB motes and evaluates the probability of fire detection while aiming towards power conservation. Additionally to a straightforward centralized approach, a distributed implementation of the above FIS is also proposed, aiming towards network congestion reduction while optimally distributing the energy consumption among network nodes so as to maximize network lifetime. Moreover this work proposes an event based execution of the aforementioned FIS aiming to further reduce the computational as well as the communication cost, compared to a periodical time triggered FIS execution. As a final contribution, performance metrics acquired from all the proposed FIS implementation techniques are thoroughly compared and analyzed with respect to critical network conditions aiming to offer realistic evaluation and thus objective conclusions’ extraction.
Vilar, Santiago; Harpaz, Rave; Chase, Herbert S; Costanzi, Stefano; Rabadan, Raul
2011-01-01
Background Adverse drug events (ADE) cause considerable harm to patients, and consequently their detection is critical for patient safety. The US Food and Drug Administration maintains an adverse event reporting system (AERS) to facilitate the detection of ADE in drugs. Various data mining approaches have been developed that use AERS to detect signals identifying associations between drugs and ADE. The signals must then be monitored further by domain experts, which is a time-consuming task. Objective To develop a new methodology that combines existing data mining algorithms with chemical information by analysis of molecular fingerprints to enhance initial ADE signals generated from AERS, and to provide a decision support mechanism to facilitate the identification of novel adverse events. Results The method achieved a significant improvement in precision in identifying known ADE, and a more than twofold signal enhancement when applied to the ADE rhabdomyolysis. The simplicity of the method assists in highlighting the etiology of the ADE by identifying structurally similar drugs. A set of drugs with strong evidence from both AERS and molecular fingerprint-based modeling is constructed for further analysis. Conclusion The results demonstrate that the proposed methodology could be used as a pharmacovigilance decision support tool to facilitate ADE detection. PMID:21946238
Wang, L.; Toshioka, T.; Nakajima, T.; Narita, A.; Xue, Z.
2017-12-01
In recent years, more and more Carbon Capture and Storage (CCS) studies focus on seismicity monitoring. For the safety management of geological CO2 storage at Tomakomai, Hokkaido, Japan, an Advanced Traffic Light System (ATLS) combined different seismic messages (magnitudes, phases, distributions et al.) is proposed for injection controlling. The primary task for ATLS is the seismic events detection in a long-term sustained time series record. Considering the time-varying characteristics of Signal to Noise Ratio (SNR) of a long-term record and the uneven energy distributions of seismic event waveforms will increase the difficulty in automatic seismic detecting, in this work, an improved probability autoregressive (AR) method for automatic seismic event detecting is applied. This algorithm, called sequentially discounting AR learning (SDAR), can identify the effective seismic event in the time series through the Change Point detection (CPD) of the seismic record. In this method, an anomaly signal (seismic event) can be designed as a change point on the time series (seismic record). The statistical model of the signal in the neighborhood of event point will change, because of the seismic event occurrence. This means the SDAR aims to find the statistical irregularities of the record thought CPD. There are 3 advantages of SDAR. 1. Anti-noise ability. The SDAR does not use waveform messages (such as amplitude, energy, polarization) for signal detecting. Therefore, it is an appropriate technique for low SNR data. 2. Real-time estimation. When new data appears in the record, the probability distribution models can be automatic updated by SDAR for on-line processing. 3. Discounting property. the SDAR introduces a discounting parameter to decrease the influence of present statistic value on future data. It makes SDAR as a robust algorithm for non-stationary signal processing. Within these 3 advantages, the SDAR method can handle the non-stationary time-varying long
A Novel Event-Based Incipient Slip Detection Using Dynamic Active-Pixel Vision Sensor (DAVIS).
Rigi, Amin; Baghaei Naeini, Fariborz; Makris, Dimitrios; Zweiri, Yahya
2018-01-24
In this paper, a novel approach to detect incipient slip based on the contact area between a transparent silicone medium and different objects using a neuromorphic event-based vision sensor (DAVIS) is proposed. Event-based algorithms are developed to detect incipient slip, slip, stress distribution and object vibration. Thirty-seven experiments were performed on five objects with different sizes, shapes, materials and weights to compare precision and response time of the proposed approach. The proposed approach is validated by using a high speed constitutional camera (1000 FPS). The results indicate that the sensor can detect incipient slippage with an average of 44.1 ms latency in unstructured environment for various objects. It is worth mentioning that the experiments were conducted in an uncontrolled experimental environment, therefore adding high noise levels that affected results significantly. However, eleven of the experiments had a detection latency below 10 ms which shows the capability of this method. The results are very promising and show a high potential of the sensor being used for manipulation applications especially in dynamic environments.
How does structured sparsity work in abnormal event detection?
DEFF Research Database (Denmark)
Ren, Huamin; Pan, Hong; Olsen, Søren Ingvor
the training, which is the due to the fact that abnormal videos are limited or even unavailable in advance in most video surveillance applications. As a result, there could be only one label in the training data which hampers supervised learning; 2) Even though there are multiple types of normal behaviors, how...... many normal patterns lie in the whole surveillance data is still unknown. This is because there is huge amount of video surveillance data and only a small proportion is used in algorithm learning, consequently, the normal patterns in the training data could be incomplete. As a result, any sparse...... structure learned from the training data could have a high bias and ruin the precision of abnormal event detection. Therefore, we in the paper propose an algorithm to solve the abnormality detection problem by sparse representation, in which local structured sparsity is preserved in coefficients. To better...
Directory of Open Access Journals (Sweden)
Elmer P. Dadios
2009-01-01
Full Text Available This paper presents a new algorithm for real time event detection using Finite State Machines with multiple Fuzzy Logic Probability Evaluators (FLPEs. A machine referee for a robot soccer game is developed and is used as the platform to test the proposed algorithm. A novel technique to detect collisions and other events in microrobot soccer game under inaccurate and insufficient information is presented. The robots' collision is used to determine goalkeeper charging and goal score events which are crucial for the machine referee's decisions. The Main State Machine (MSM handles the schedule of event activation. The FLPE calculates the probabilities of the true occurrence of the events. Final decisions about the occurrences of events are evaluated and compared through threshold crisp probability values. The outputs of FLPEs can be combined to calculate the probability of an event composed of subevents. Using multiple fuzzy logic system, the FLPE utilizes minimal number of rules and can be tuned individually. Experimental results show the accuracy and robustness of the proposed algorithm.
Directory of Open Access Journals (Sweden)
Lei Jiang
2012-01-01
Full Text Available Energy signature analysis of power appliance is the core of nonintrusive load monitoring (NILM where the detailed data of the appliances used in houses are obtained by analyzing changes in the voltage and current. This paper focuses on developing an automatic power load event detection and appliance classification based on machine learning. In power load event detection, the paper presents a new transient detection algorithm. By turn-on and turn-off transient waveforms analysis, it can accurately detect the edge point when a device is switched on or switched off. The proposed load classification technique can identify different power appliances with improved recognition accuracy and computational speed. The load classification method is composed of two processes including frequency feature analysis and support vector machine. The experimental results indicated that the incorporation of the new edge detection and turn-on and turn-off transient signature analysis into NILM revealed more information than traditional NILM methods. The load classification method has achieved more than ninety percent recognition rate.
Event Detection Intelligent Camera: Demonstration of flexible, real-time data taking and processing
Energy Technology Data Exchange (ETDEWEB)
Szabolics, Tamás, E-mail: szabolics.tamas@wigner.mta.hu; Cseh, Gábor; Kocsis, Gábor; Szepesi, Tamás; Zoletnik, Sándor
2015-10-15
Highlights: • We present EDICAM's operation principles description. • Firmware tests results. • Software test results. • Further developments. - Abstract: An innovative fast camera (EDICAM – Event Detection Intelligent CAMera) was developed by MTA Wigner RCP in the last few years. This new concept was designed for intelligent event driven processing to be able to detect predefined events and track objects in the plasma. The camera provides a moderate frame rate of 400 Hz at full frame resolution (1280 × 1024), and readout of smaller region of interests can be done in the 1–140 kHz range even during exposure of the full image. One of the most important advantages of this hardware is a 10 Gbit/s optical link which ensures very fast communication and data transfer between the PC and the camera, enabling two level of processing: primitive algorithms in the camera hardware and high-level processing in the PC. This camera hardware has successfully proven to be able to monitoring the plasma in several fusion devices for example at ASDEX Upgrade, KSTAR and COMPASS with the first version of firmware. A new firmware and software package is under development. It allows to detect predefined events in real time and therefore the camera is capable to change its own operation or to give warnings e.g. to the safety system of the experiment. The EDICAM system can handle a huge amount of data (up to TBs) with high data rate (950 MB/s) and will be used as the central element of the 10 camera overview video diagnostic system of Wendenstein 7-X (W7-X) stellarator. This paper presents key elements of the newly developed built-in intelligence stressing the revolutionary new features and the results of the test of the different software elements.
Attribution of extreme weather and climate-related events.
Stott, Peter A; Christidis, Nikolaos; Otto, Friederike E L; Sun, Ying; Vanderlinden, Jean-Paul; van Oldenborgh, Geert Jan; Vautard, Robert; von Storch, Hans; Walton, Peter; Yiou, Pascal; Zwiers, Francis W
2016-01-01
Extreme weather and climate-related events occur in a particular place, by definition, infrequently. It is therefore challenging to detect systematic changes in their occurrence given the relative shortness of observational records. However, there is a clear interest from outside the climate science community in the extent to which recent damaging extreme events can be linked to human-induced climate change or natural climate variability. Event attribution studies seek to determine to what extent anthropogenic climate change has altered the probability or magnitude of particular events. They have shown clear evidence for human influence having increased the probability of many extremely warm seasonal temperatures and reduced the probability of extremely cold seasonal temperatures in many parts of the world. The evidence for human influence on the probability of extreme precipitation events, droughts, and storms is more mixed. Although the science of event attribution has developed rapidly in recent years, geographical coverage of events remains patchy and based on the interests and capabilities of individual research groups. The development of operational event attribution would allow a more timely and methodical production of attribution assessments than currently obtained on an ad hoc basis. For event attribution assessments to be most useful, remaining scientific uncertainties need to be robustly assessed and the results clearly communicated. This requires the continuing development of methodologies to assess the reliability of event attribution results and further work to understand the potential utility of event attribution for stakeholder groups and decision makers. WIREs Clim Change 2016, 7:23-41. doi: 10.1002/wcc.380 For further resources related to this article, please visit the WIREs website.
Detection of genetically modified maize events in Brazilian maize-derived food products
Directory of Open Access Journals (Sweden)
Maria Regina Branquinho
2013-09-01
Full Text Available The Brazilian government has approved many transgenic maize lines for commercialization and has established a threshold of 1% for food labeling, which underscores need for monitoring programs. Thirty four samples including flours and different types of nacho chips were analyzed by conventional and real-time PCR in 2011 and 2012. The events MON810, Bt11, and TC1507 were detected in most of the samples, and NK603 was present only in the samples analyzed in 2012. The authorized lines GA21, T25, and the unauthorized Bt176 were not detected. All positive samples in the qualitative tests collected in 2011 showed a transgenic content higher than 1%, and none of them was correctly labeled. Regarding the samples collected in 2012, all positive samples were quantified higher than the threshold, and 47.0% were not correctly labeled. The overall results indicated that the major genetically modified organisms detected were MON810, TC1507, Bt11, and NK603 events. Some industries that had failed to label their products in 2011 started labeling them in 2012, demonstrating compliance with the current legislation observing the consumer rights. Although these results are encouraging, it has been clearly demonstrated the need for continuous monitoring programs to ensure consumers that food products are labeled properly.
International Nuclear Information System (INIS)
Puccetti, S.; Giommi, P.; Fiore, F.
2009-01-01
The ASI Science Data Center (ASDC) has developed an X-ray event simulator to support users (and team members) in simulation of data taken with the two cameras on board the Simbol-X X-Ray Telescope. The Simbol-X simulator is very fast and flexible, compared to ray-tracing simulator. These properties make our simulator advantageous to support the user in planning proposals and comparing real data with the theoretical expectations and for a quick detection of unexpected features. We present here the simulator outline and a few examples of simulated data.
Puccetti, S.; Fiore, F.; Giommi, P.
2009-05-01
The ASI Science Data Center (ASDC) has developed an X-ray event simulator to support users (and team members) in simulation of data taken with the two cameras on board the Simbol-X X-Ray Telescope. The Simbol-X simulator is very fast and flexible, compared to ray-tracing simulator. These properties make our simulator advantageous to support the user in planning proposals and comparing real data with the theoretical expectations and for a quick detection of unexpected features. We present here the simulator outline and a few examples of simulated data.
Indigenous people's detection of rapid ecological change.
Aswani, Shankar; Lauer, Matthew
2014-06-01
When sudden catastrophic events occur, it becomes critical for coastal communities to detect and respond to environmental transformations because failure to do so may undermine overall ecosystem resilience and threaten people's livelihoods. We therefore asked how capable of detecting rapid ecological change following massive environmental disruptions local, indigenous people are. We assessed the direction and periodicity of experimental learning of people in the Western Solomon Islands after a tsunami in 2007. We compared the results of marine science surveys with local ecological knowledge of the benthos across 3 affected villages and 3 periods before and after the tsunami. We sought to determine how people recognize biophysical changes in the environment before and after catastrophic events such as earthquakes and tsunamis and whether people have the ability to detect ecological changes over short time scales or need longer time scales to recognize changes. Indigenous people were able to detect changes in the benthos over time. Detection levels differed between marine science surveys and local ecological knowledge sources over time, but overall patterns of statistically significant detection of change were evident for various habitats. Our findings have implications for marine conservation, coastal management policies, and disaster-relief efforts because when people are able to detect ecological changes, this, in turn, affects how they exploit and manage their marine resources. © 2014 Society for Conservation Biology.
Detection of Visual Events in Underwater Video Using a Neuromorphic Saliency-based Attention System
Edgington, D. R.; Walther, D.; Cline, D. E.; Sherlock, R.; Salamy, K. A.; Wilson, A.; Koch, C.
2003-12-01
The Monterey Bay Aquarium Research Institute (MBARI) uses high-resolution video equipment on remotely operated vehicles (ROV) to obtain quantitative data on the distribution and abundance of oceanic animals. High-quality video data supplants the traditional approach of assessing the kinds and numbers of animals in the oceanic water column through towing collection nets behind ships. Tow nets are limited in spatial resolution, and often destroy abundant gelatinous animals resulting in species undersampling. Video camera-based quantitative video transects (QVT) are taken through the ocean midwater, from 50m to 4000m, and provide high-resolution data at the scale of the individual animals and their natural aggregation patterns. However, the current manual method of analyzing QVT video by trained scientists is labor intensive and poses a serious limitation to the amount of information that can be analyzed from ROV dives. Presented here is an automated system for detecting marine animals (events) visible in the videos. Automated detection is difficult due to the low contrast of many translucent animals and due to debris ("marine snow") cluttering the scene. Video frames are processed with an artificial intelligence attention selection algorithm that has proven a robust means of target detection in a variety of natural terrestrial scenes. The candidate locations identified by the attention selection module are tracked across video frames using linear Kalman filters. Typically, the occurrence of visible animals in the video footage is sparse in space and time. A notion of "boring" video frames is developed by detecting whether or not there is an interesting candidate object for an animal present in a particular sequence of underwater video -- video frames that do not contain any "interesting" events. If objects can be tracked successfully over several frames, they are stored as potentially "interesting" events. Based on low-level properties, interesting events are
Automatic detection of whole night snoring events using non-contact microphone.
Directory of Open Access Journals (Sweden)
Eliran Dafna
Full Text Available OBJECTIVE: Although awareness of sleep disorders is increasing, limited information is available on whole night detection of snoring. Our study aimed to develop and validate a robust, high performance, and sensitive whole-night snore detector based on non-contact technology. DESIGN: Sounds during polysomnography (PSG were recorded using a directional condenser microphone placed 1 m above the bed. An AdaBoost classifier was trained and validated on manually labeled snoring and non-snoring acoustic events. PATIENTS: Sixty-seven subjects (age 52.5 ± 13.5 years, BMI 30.8 ± 4.7 kg/m(2, m/f 40/27 referred for PSG for obstructive sleep apnea diagnoses were prospectively and consecutively recruited. Twenty-five subjects were used for the design study; the validation study was blindly performed on the remaining forty-two subjects. MEASUREMENTS AND RESULTS: To train the proposed sound detector, >76,600 acoustic episodes collected in the design study were manually classified by three scorers into snore and non-snore episodes (e.g., bedding noise, coughing, environmental. A feature selection process was applied to select the most discriminative features extracted from time and spectral domains. The average snore/non-snore detection rate (accuracy for the design group was 98.4% based on a ten-fold cross-validation technique. When tested on the validation group, the average detection rate was 98.2% with sensitivity of 98.0% (snore as a snore and specificity of 98.3% (noise as noise. CONCLUSIONS: Audio-based features extracted from time and spectral domains can accurately discriminate between snore and non-snore acoustic events. This audio analysis approach enables detection and analysis of snoring sounds from a full night in order to produce quantified measures for objective follow-up of patients.
An Ensemble Approach for Emotion Cause Detection with Event Extraction and Multi-Kernel SVMs
Institute of Scientific and Technical Information of China (English)
Ruifeng Xu; Jiannan Hu; Qin Lu; Dongyin Wu; Lin Gui
2017-01-01
In this paper,we present a new challenging task for emotion analysis,namely emotion cause extraction.In this task,we focus on the detection of emotion cause a.k.a the reason or the stimulant of an emotion,rather than the regular emotion classification or emotion component extraction.Since there is no open dataset for this task available,we first designed and annotated an emotion cause dataset which follows the scheme of W3C Emotion Markup Language.We then present an emotion cause detection method by using event extraction framework,where a tree structure-based representation method is used to represent the events.Since the distribution of events is imbalanced in the training data,we propose an under-sampling-based bagging algorithm to solve this problem.Even with a limited training set,the proposed approach may still extract sufficient features for analysis by a bagging of multi-kernel based SVMs method.Evaluations show that our approach achieves an F-measure 7.04% higher than the state-of-the-art methods.
Mull, Hillary J; Borzecki, Ann M; Loveland, Susan; Hickson, Kathleen; Chen, Qi; MacDonald, Sally; Shin, Marlena H; Cevasco, Marisa; Itani, Kamal M F; Rosen, Amy K
2014-04-01
The Patient Safety Indicators (PSIs) use administrative data to screen for select adverse events (AEs). In this study, VA Surgical Quality Improvement Program (VASQIP) chart review data were used as the gold standard to measure the criterion validity of 5 surgical PSIs. Independent chart review was also used to determine reasons for PSI errors. The sensitivity, specificity, and positive predictive value of PSI software version 4.1a were calculated among Veterans Health Administration hospitalizations (2003-2007) reviewed by VASQIP (n = 268,771). Nurses re-reviewed a sample of hospitalizations for which PSI and VASQIP AE detection disagreed. Sensitivities ranged from 31% to 68%, specificities from 99.1% to 99.8%, and positive predictive values from 31% to 72%. Reviewers found that coding errors accounted for some PSI-VASQIP disagreement; some disagreement was also the result of differences in AE definitions. These results suggest that the PSIs have moderate criterion validity; however, some surgical PSIs detect different AEs than VASQIP. Future research should explore using both methods to evaluate surgical quality. Published by Elsevier Inc.
Use of wireless sensor networks for distributed event detection in disaster management applications
Bahrepour, M.; Meratnia, Nirvana; Poel, Mannes; Taghikhaki, Zahra; Havinga, Paul J.M.
Recently, wireless sensor networks (WSNs) have become mature enough to go beyond being simple fine-grained continuous monitoring platforms and have become one of the enabling technologies for early-warning disaster systems. Event detection functionality of WSNs can be of great help and importance
Schwartz, Rafi; Lahav, Ori; Ostfeld, Avi
2014-10-15
As a complementary step towards solving the general event detection problem of water distribution systems, injection of the organophosphate pesticides, chlorpyrifos (CP) and parathion (PA), were simulated at various locations within example networks and hydraulic parameters were calculated over 24-h duration. The uniqueness of this study is that the chemical reactions and byproducts of the contaminants' oxidation were also simulated, as well as other indicative water quality parameters such as alkalinity, acidity, pH and the total concentration of free chlorine species. The information on the change in water quality parameters induced by the contaminant injection may facilitate on-line detection of an actual event involving this specific substance and pave the way to development of a generic methodology for detecting events involving introduction of pesticides into water distribution systems. Simulation of the contaminant injection was performed at several nodes within two different networks. For each injection, concentrations of the relevant contaminants' mother and daughter species, free chlorine species and water quality parameters, were simulated at nodes downstream of the injection location. The results indicate that injection of these substances can be detected at certain conditions by a very rapid drop in Cl2, functioning as the indicative parameter, as well as a drop in alkalinity concentration and a small decrease in pH, both functioning as supporting parameters, whose usage may reduce false positive alarms. Copyright © 2014 Elsevier Ltd. All rights reserved.
123I-MIBG imaging detects cardiac involvement and predicts cardiac events in Churg-Strauss syndrome
International Nuclear Information System (INIS)
Horiguchi, Yoriko; Morita, Yukiko; Tsurikisawa, Naomi; Akiyama, Kazuo
2011-01-01
In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether 123 I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. 123 I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using 123 I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M ≤ 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP ≤ 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. 123 I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)
Data quality studies for burst analysis of Virgo data acquired during Weekly Science Runs
International Nuclear Information System (INIS)
Acernese, F; Amico, P; Alshourbagy, M
2007-01-01
Virgo started collecting science data during weekends in order to not interfere with commissioning activities. The goal of Weekly Science Runs is to ease the transition between commissioning periods and data taking periods, in addition to providing data sets exploiting the stationary behavior of the detector. The detection of gravitational wave (GW) bursts emitted by core collapse of supernovae is one of the most difficult tasks for the GW community due to the fact that there are uncertainties in the exact shape of the waveforms, as we do not have complete models. A major task for this kind of detection effort is the cleaning of the event triggers found by the detection pipelines, namely the removal of accidental transient signals due to noise source events. In order to clean our data from false GW events, we need to define a strategy for data quality cut and veto of auxiliary and environmental monitoring channels. In this paper we report on the analysis we performed on data acquired during Weekly Science Runs to explore and define the data quality cut and veto studies for burst analysis
Chu, Catherine J; Chan, Arthur; Song, Dan; Staley, Kevin J; Stufflebeam, Steven M; Kramer, Mark A
2017-02-01
High frequency oscillations are emerging as a clinically important indicator of epileptic networks. However, manual detection of these high frequency oscillations is difficult, time consuming, and subjective, especially in the scalp EEG, thus hindering further clinical exploration and application. Semi-automated detection methods augment manual detection by reducing inspection to a subset of time intervals. We propose a new method to detect high frequency oscillations that co-occur with interictal epileptiform discharges. The new method proceeds in two steps. The first step identifies candidate time intervals during which high frequency activity is increased. The second step computes a set of seven features for each candidate interval. These features require that the candidate event contain a high frequency oscillation approximately sinusoidal in shape, with at least three cycles, that co-occurs with a large amplitude discharge. Candidate events that satisfy these features are stored for validation through visual analysis. We evaluate the detector performance in simulation and on ten examples of scalp EEG data, and show that the proposed method successfully detects spike-ripple events, with high positive predictive value, low false positive rate, and high intra-rater reliability. The proposed method is less sensitive than the existing method of visual inspection, but much faster and much more reliable. Accurate and rapid detection of high frequency activity increases the clinical viability of this rhythmic biomarker of epilepsy. The proposed spike-ripple detector rapidly identifies candidate spike-ripple events, thus making clinical analysis of prolonged, multielectrode scalp EEG recordings tractable. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Тетяна Андріївна Непокупна
2015-03-01
Full Text Available This article analyzes the global transformations and their impact on the main society life; the specifics of modern interpretations of events and phenomena, their destabilizing effects on behavior, health and life of humans; the role of economic sciences in the formation of critical thinking as a means of combating ignorance and propaganda, formation of an objective world view that grounded on knowledge
Balloon-Borne Infrasound Detection of Energetic Bolide Events
Young, Eliot F.; Ballard, Courtney; Klein, Viliam; Bowman, Daniel; Boslough, Mark
2016-10-01
Infrasound is usually defined as sound waves below 20 Hz, the nominal limit of human hearing. Infrasound waves propagate over vast distances through the Earth's atmosphere: the CTBTO (Comprehensive Nuclear-Test-Ban Treaty Organization) has 48 installed infrasound-sensing stations around the world to detect nuclear detonations and other disturbances. In February 2013, several CTBTO infrasound stations detected infrasound signals from a large bolide that exploded over Chelyabinsk, Russia. Some stations recorded signals that had circumnavigated the Earth, over a day after the original event. The goal of this project is to improve upon the sensitivity of the CTBTO network by putting microphones on small, long-duration super-pressure balloons, with the overarching goal of studying the small end of the NEO population by using the Earth's atmosphere as a witness plate.A balloon-borne infrasound sensor is expected to have two advantages over ground-based stations: a lack of wind noise and a concentration of infrasound energy in the "stratospheric duct" between roughly 5 - 50 km altitude. To test these advantages, we have built a small balloon payload with five calibrated microphones. We plan to fly this payload on a NASA high-altitude balloon from Ft Sumner, NM in August 2016. We have arranged for three large explosions to take place in Socorro, NM while the balloon is aloft to assess the sensitivity of balloon-borne vs. ground-based infrasound sensors. We will report on the results from this test flight and the prospects for detecting/characterizing small bolides in the stratosphere.
Kambhampati, Satya Samyukta; Singh, Vishal; Manikandan, M Sabarimalai; Ramkumar, Barathram
2015-08-01
In this Letter, the authors present a unified framework for fall event detection and classification using the cumulants extracted from the acceleration (ACC) signals acquired using a single waist-mounted triaxial accelerometer. The main objective of this Letter is to find suitable representative cumulants and classifiers in effectively detecting and classifying different types of fall and non-fall events. It was discovered that the first level of the proposed hierarchical decision tree algorithm implements fall detection using fifth-order cumulants and support vector machine (SVM) classifier. In the second level, the fall event classification algorithm uses the fifth-order cumulants and SVM. Finally, human activity classification is performed using the second-order cumulants and SVM. The detection and classification results are compared with those of the decision tree, naive Bayes, multilayer perceptron and SVM classifiers with different types of time-domain features including the second-, third-, fourth- and fifth-order cumulants and the signal magnitude vector and signal magnitude area. The experimental results demonstrate that the second- and fifth-order cumulant features and SVM classifier can achieve optimal detection and classification rates of above 95%, as well as the lowest false alarm rate of 1.03%.
Directory of Open Access Journals (Sweden)
Anne F Voor In 't Holt
Full Text Available Since the year 2000 there has been a sharp increase in the prevalence of healthcare-related infections caused by extended-spectrum beta-lactamase (ESBL-producing Escherichia coli. However, the high community prevalence of ESBL-producing E. coli isolates means that many E. coli typing techniques may not be suitable for detecting E. coli transmission events. Therefore, we investigated if High-throughput MultiLocus Sequence Typing (HiMLST and/or Raman spectroscopy were suitable techniques for detecting recent E. coli transmission events.This study was conducted from January until December 2010 at Erasmus University Medical Center, Rotterdam, the Netherlands. Isolates were typed using HiMLST and Raman spectroscopy. A genetic cluster was defined as two or more patients carrying identical isolates. We used predefined definitions for epidemiological relatedness to assess healthcare-related transmission.We included 194 patients; strains of 112 patients were typed using HiMLST and strains of 194 patients were typed using Raman spectroscopy. Raman spectroscopy identified 16 clusters while HiMLST identified 10 clusters. However, no healthcare-related transmission events were detected. When combining data from both typing techniques, we identified eight clusters (n = 34 patients, as well as 78 patients with a non-cluster isolate. However, we could not detect any healthcare-related transmission in these 8 clusters.Although clusters were genetically detected using HiMLST and Raman spectroscopy, no definite epidemiological relationships could be demonstrated which makes the possibility of healthcare-related transmission events highly unlikely. Our results suggest that typing of ESBL-producing E. coli using HiMLST and/or Raman spectroscopy is not helpful in detecting E. coli healthcare-related transmission events.
Prescription-event monitoring: developments in signal detection.
Ferreira, Germano
2007-01-01
Prescription-event monitoring (PEM) is a non-interventional intensive method for post-marketing drug safety monitoring of newly licensed medicines. PEM studies are cohort studies where exposure is obtained from a centralised service and outcomes from simple questionnaires completed by general practitioners. Follow-up forms are sent for selected events. Because PEM captures all events and not only the suspected adverse drug reactions, PEM cohorts potentially differ in respect to the distribution of number of events per person depending on the nature of the drug under study. This variance can be related either with the condition for which the drug is prescribed (e.g. a condition causing high morbidity will have, in average, a higher number of events per person compared with a condition with lower morbidity) or with the drug effect itself. This paper describes an exploratory investigation of the distortion caused by product-related variations of the number of events to the interpretation of the proportional reporting ratio (PRR) values ("the higher the PRR, the greater the strength of the signal") computed using drug-cohort data. We studied this effect by assessing the agreement between the PRR based on events (event of interest vs all other events) and PRR based on cases (cases with the event of interest vs cases with any other events). PRR were calculated for all combinations reported to ten selected drugs against a comparator of 81 other drugs. Three of the ten drugs had a cohort with an apparent higher proportion of patients with lower number of events. The PRRs based on events were systematically higher than the PRR based on cases for the combinations reported to these three drugs. Additionally, when applying the threshold criteria for signal screening (n > or =3, PRR > or =1.5 and Chi-squared > or =4), the binary agreement was generally high but apparently lower for these three drugs. In conclusion, the distribution of events per patient in drug cohorts shall be
Optimized Swinging Door Algorithm for Wind Power Ramp Event Detection: Preprint
Energy Technology Data Exchange (ETDEWEB)
Cui, Mingjian; Zhang, Jie; Florita, Anthony R.; Hodge, Bri-Mathias; Ke, Deping; Sun, Yuanzhang
2015-08-06
Significant wind power ramp events (WPREs) are those that influence the integration of wind power, and they are a concern to the continued reliable operation of the power grid. As wind power penetration has increased in recent years, so has the importance of wind power ramps. In this paper, an optimized swinging door algorithm (SDA) is developed to improve ramp detection performance. Wind power time series data are segmented by the original SDA, and then all significant ramps are detected and merged through a dynamic programming algorithm. An application of the optimized SDA is provided to ascertain the optimal parameter of the original SDA. Measured wind power data from the Electric Reliability Council of Texas (ERCOT) are used to evaluate the proposed optimized SDA.
Pérez Zapata, A I; Gutiérrez Samaniego, M; Rodríguez Cuéllar, E; Gómez de la Cámara, A; Ruiz López, P
Surgery is a high risk for the occurrence of adverse events (AE). The main objective of this study is to compare the effectiveness of the Trigger tool with the Hospital National Health System registration of Discharges, the minimum basic data set (MBDS), in detecting adverse events in patients admitted to General Surgery and undergoing surgery. Observational and descriptive retrospective study of patients admitted to general surgery of a tertiary hospital, and undergoing surgery in 2012. The identification of adverse events was made by reviewing the medical records, using an adaptation of "Global Trigger Tool" methodology, as well as the (MBDS) registered on the same patients. Once the AE were identified, they were classified according to damage and to the extent to which these could have been avoided. The area under the curve (ROC) were used to determine the discriminatory power of the tools. The Hanley and Mcneil test was used to compare both tools. AE prevalence was 36.8%. The TT detected 89.9% of all AE, while the MBDS detected 28.48%. The TT provides more information on the nature and characteristics of the AE. The area under the curve was 0.89 for the TT and 0.66 for the MBDS. These differences were statistically significant (P<.001). The Trigger tool detects three times more adverse events than the MBDS registry. The prevalence of adverse events in General Surgery is higher than that estimated in other studies. Copyright © 2017 SECA. Publicado por Elsevier España, S.L.U. All rights reserved.
Automatic detection of esophageal pressure events. Is there an alternative to rule-based criteria?
DEFF Research Database (Denmark)
Kruse-Andersen, S; Rütz, K; Kolberg, Jens Godsk
1995-01-01
of relevant pressure peaks at the various recording levels. Until now, this selection has been performed entirely by rule-based systems, requiring each pressure deflection to fit within predefined rigid numerical limits in order to be detected. However, due to great variations in the shapes of the pressure...... curves generated by muscular contractions, rule-based criteria do not always select the pressure events most relevant for further analysis. We have therefore been searching for a new concept for automatic event recognition. The present study describes a new system, based on the method of neurocomputing.......79-0.99 and accuracies of 0.89-0.98, depending on the recording level within the esophageal lumen. The neural networks often recognized peaks that clearly represented true contractions but that had been rejected by a rule-based system. We conclude that neural networks have potentials for automatic detections...
Khandelwal, Siddhartha; Wickstrom, Nicholas
2016-12-01
Detecting gait events is the key to many gait analysis applications that would benefit from continuous monitoring or long-term analysis. Most gait event detection algorithms using wearable sensors that offer a potential for use in daily living have been developed from data collected in controlled indoor experiments. However, for real-word applications, it is essential that the analysis is carried out in humans' natural environment; that involves different gait speeds, changing walking terrains, varying surface inclinations and regular turns among other factors. Existing domain knowledge in the form of principles or underlying fundamental gait relationships can be utilized to drive and support the data analysis in order to develop robust algorithms that can tackle real-world challenges in gait analysis. This paper presents a novel approach that exhibits how domain knowledge about human gait can be incorporated into time-frequency analysis to detect gait events from long-term accelerometer signals. The accuracy and robustness of the proposed algorithm are validated by experiments done in indoor and outdoor environments with approximately 93 600 gait events in total. The proposed algorithm exhibits consistently high performance scores across all datasets in both, indoor and outdoor environments.
GRAVITATIONAL MICROLENSING EVENTS AS A TARGET FOR THE SETI PROJECT
Energy Technology Data Exchange (ETDEWEB)
Rahvar, Sohrab, E-mail: rahvar@sharif.edu [Department of Physics, Sharif University of Technology, P.O. Box 11365–9161, Tehran (Iran, Islamic Republic of)
2016-09-01
The detection of signals from a possible extrasolar technological civilization is one of the most challenging efforts of science. In this work, we propose using natural telescopes made of single or binary gravitational lensing systems to magnify leakage of electromagnetic signals from a remote planet that harbors Extraterrestrial Intelligent (ETI) technology. Currently, gravitational microlensing surveys are monitoring a large area of the Galactic bulge to search for microlensing events, finding more than 2000 events per year. These lenses are capable of playing the role of natural telescopes, and, in some instances, they can magnify radio band signals from planets orbiting around the source stars in gravitational microlensing systems. Assuming that the frequency of electromagnetic waves used for telecommunication in ETIs is similar to ours, we propose follow-up observation of microlensing events with radio telescopes such as the Square Kilometre Array (SKA), the Low Frequency Demonstrators, and the Mileura Wide-Field Array. Amplifying signals from the leakage of broadcasting by an Earth-like civilization will allow us to detect them as far as the center of the Milky Way galaxy. Our analysis shows that in binary microlensing systems, the probability of amplification of signals from ETIs is more than that in single microlensing events. Finally, we propose the use of the target of opportunity mode for follow-up observations of binary microlensing events with SKA as a new observational program for searching ETIs. Using optimistic values for the factors of the Drake equation provides detection of about one event per year.
Online Least Squares One-Class Support Vector Machines-Based Abnormal Visual Event Detection
Directory of Open Access Journals (Sweden)
Tian Wang
2013-12-01
Full Text Available The abnormal event detection problem is an important subject in real-time video surveillance. In this paper, we propose a novel online one-class classification algorithm, online least squares one-class support vector machine (online LS-OC-SVM, combined with its sparsified version (sparse online LS-OC-SVM. LS-OC-SVM extracts a hyperplane as an optimal description of training objects in a regularized least squares sense. The online LS-OC-SVM learns a training set with a limited number of samples to provide a basic normal model, then updates the model through remaining data. In the sparse online scheme, the model complexity is controlled by the coherence criterion. The online LS-OC-SVM is adopted to handle the abnormal event detection problem. Each frame of the video is characterized by the covariance matrix descriptor encoding the moving information, then is classified into a normal or an abnormal frame. Experiments are conducted, on a two-dimensional synthetic distribution dataset and a benchmark video surveillance dataset, to demonstrate the promising results of the proposed online LS-OC-SVM method.
Process variant comparison: using event logs to detect differences in behavior and business rules
Bolt, A.; de Leoni, M.; van der Aalst, W.M.P.
2018-01-01
This paper addresses the problem of comparing different variants of the same process. We aim to detect relevant differences between processes based on what was recorded in event logs. We use transition systems to model behavior and to highlight differences. Transition systems are annotated with
Using Brain Imaging for Lie Detection: Where Science, Law and Research Policy Collide
Langleben, Daniel D.; Moriarty, Jane Campbell
2012-01-01
Progress in the use of functional magnetic resonance imaging (fMRI) of the brain to evaluate deception and differentiate lying from truth-telling has created anticipation of a breakthrough in the search for technology-based methods of lie detection. In the last few years, litigants have attempted to introduce fMRI lie detection evidence in courts. This article weighs in on the interdisciplinary debate about the admissibility of such evidence, identifying the missing pieces of the scientific puzzle that need to be completed if fMRI-based lie detection is to meet the standards of either legal reliability or general acceptance. We believe that the Daubert’s “known error rate” is the key concept linking the legal and scientific standards. We posit that properly-controlled clinical trials are the most convincing means to determine the error rates of fMRI-based lie detection and confirm or disprove the relevance of the promising laboratory research on this topic. This article explains the current state of the science and provides an analysis of the case law in which litigants have sought to introduce fMRI lie detection. Analyzing the myriad issues related to fMRI lie detection, the article identifies the key limitations of the current neuroimaging of deception science as expert evidence and explores the problems that arise from using scientific evidence before it is proven scientifically valid and reliable. We suggest that courts continue excluding fMRI lie detection evidence until this potentially useful form of forensic science meets the scientific standards currently required for adoption of a medical test or device. Given a multitude of stakeholders and, the charged and controversial nature and the potential societal impact of this technology, goodwill and collaboration of several government agencies may be required to sponsor impartial and comprehensive clinical trials that will guide the development of forensic fMRI technology. PMID:23772173
What's science? Where's science? Science journalism in German print media.
Summ, Annika; Volpers, Anna-Maria
2016-10-01
This article examines the current state of science coverage in German print media. It deals with the following questions: (1) how the main characteristics of science journalism can be described, (2) whether there is a difference between various scientific fields, and (3) how different definitions of science journalism lead to differing findings. Two forms of science coverage were analyzed in a standardized, two-part content analysis of German newspapers (N = 1730 and N = 1640). The results show a significant difference between a narrow and a broad definition of science journalism. In the classic understanding, science journalism is prompted by scientific events and is rather noncritical. Science coverage in a broad sense is defined by a wider range of journalistic styles, driven by non-scientific events, and with a focus on the statements of scientific experts. Furthermore, the study describes the specific role of the humanities and social sciences in German science coverage. © The Author(s) 2015.
Olsen, Sisse; Neale, Graham; Schwab, Kat; Psaila, Beth; Patel, Tejal; Chapman, E Jane; Vincent, Charles
2007-01-01
Background Over the past five years, in most hospitals in England and Wales, incident reporting has become well established but it remains unclear how well reports match clinical adverse events. International epidemiological studies of adverse events are based on retrospective, multi‐hospital case record review. In this paper the authors describe the use of incident reporting, pharmacist surveillance and local real‐time record review for the recognition of clinical risks associated with hospital inpatient care. Methodology Data on adverse events were collected prospectively on 288 patients discharged from adult acute medical and surgical units in an NHS district general hospital using incident reports, active surveillance of prescription charts by pharmacists and record review at time of discharge. Results Record review detected 26 adverse events (AEs) and 40 potential adverse events (PAEs) occurring during the index admission. In contrast, in the same patient group, incident reporting detected 11 PAEs and no AEs. Pharmacy surveillance found 10 medication errors all of which were PAEs. There was little overlap in the nature of events detected by the three methods. Conclusion The findings suggest that incident reporting does not provide an adequate assessment of clinical adverse events and that this method needs to be supplemented with other more systematic forms of data collection. Structured record review, carried out by clinicians, provides an important component of an integrated approach to identifying risk in the context of developing a safety and quality improvement programme. PMID:17301203
Ma, Xingyi; Sim, Sang Jun
2013-03-21
Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.
Directory of Open Access Journals (Sweden)
Giuseppe De Marco
2007-01-01
Full Text Available In this paper, we study a particular application of wireless sensor networks for event-detection and tracking. In this kind of application, the transport of data is simplified, and guaranteeing a minimum number of packets at the monitoring node is the only constraint on the performance of the sensor network. This minimum number of packets is called event-reliability. Contrary to other studies on the subject, here we consider the behavior of such a network in presence of a realistic radio model, such as the shadowing of the radio signal. With this setting, we extend our previous analysis of the event-reliability approach for the transport of data. In particular, both regular and random networks are considered. The contribute of this work is to show via simulations that, in the presence of randomness or irregularities in the radio channel, the event-reliability can be jeopardized, that is the constraint on the minimum number of packets at the sink node could not be satisfied.
Surface Management System Departure Event Data Analysis
Monroe, Gilena A.
2010-01-01
This paper presents a data analysis of the Surface Management System (SMS) performance of departure events, including push-back and runway departure events.The paper focuses on the detection performance, or the ability to detect departure events, as well as the prediction performance of SMS. The results detail a modest overall detection performance of push-back events and a significantly high overall detection performance of runway departure events. The overall detection performance of SMS for push-back events is approximately 55%.The overall detection performance of SMS for runway departure events nears 100%. This paper also presents the overall SMS prediction performance for runway departure events as well as the timeliness of the Aircraft Situation Display for Industry data source for SMS predictions.
Gurulingappa, Harsha; Toldo, Luca; Rajput, Abdul Mateen; Kors, Jan A; Taweel, Adel; Tayrouz, Yorki
2013-11-01
The aim of this study was to assess the impact of automatically detected adverse event signals from text and open-source data on the prediction of drug label changes. Open-source adverse effect data were collected from FAERS, Yellow Cards and SIDER databases. A shallow linguistic relation extraction system (JSRE) was applied for extraction of adverse effects from MEDLINE case reports. Statistical approach was applied on the extracted datasets for signal detection and subsequent prediction of label changes issued for 29 drugs by the UK Regulatory Authority in 2009. 76% of drug label changes were automatically predicted. Out of these, 6% of drug label changes were detected only by text mining. JSRE enabled precise identification of four adverse drug events from MEDLINE that were undetectable otherwise. Changes in drug labels can be predicted automatically using data and text mining techniques. Text mining technology is mature and well-placed to support the pharmacovigilance tasks. Copyright © 2013 John Wiley & Sons, Ltd.
Best Practices in Pulic Outreach Events
Cobb, Whitney; Buxner, Sanlyn; Shipp, Stephanie
2015-11-01
IntroductionEach year the National Aeronautics and Space Administration (NASA) sponsors public outreach events designed to increase student, educator, and general public engagement in its missions and goals. NASA SMD Education’s review of large-scale events, “Best Practices in Outreach Events,” highlighted planning and implementation best practices, which were used by the Dawn mission to strategize and implement its Ceres arrival celebration event, i C Ceres.BackgroundThe literature review focused on best identifying practices rising from evaluations of large-scale public outreach events. The following criteria guided the study:* Public, science-related events open to adults and children* Events that occurred during the last 5 years* Evaluations that included information on data collected from visitors and/or volunteers* Evaluations that specified the type of data collected, methodology, and associated resultsBest Practices: Planning and ImplementationThe literature review revealed key considerations for planning implement large-scale events. Best practices included can be pertinent for all event organizers and evaluators regardless of event size. A summary of related best practices is presented below.1) Advertise the event2) Use and advertise access to scientists* Attendees who reported an interaction with a science professional were 15% to 19% more likely to report positive learning impacts, (SFA, 2012, p. 24).3) Recruit scientists using findings such as:* High percentages of scientists (85% to 96%) from most events were interested in participating again (SFA, 2012).4) Ensure that the event is group and, particularly, child friendly5) Target specific event outcomesBest Practices Informing Real-world Planning, Implementation and EvaluationDawn mission’s collaborative design of a series of events, i C Ceres, including in-person, interactive events geared to families and live presentations, will be shared, with focus on the family event, and the evidence
Rare events: a state of the art
International Nuclear Information System (INIS)
Uppuluri, V.R.R.
1980-12-01
The study of rare events has become increasingly important in the context of nuclear safety. Some philosophical considerations, such as the framework for the definition of a rare event, rare events and science, rare events and trans-science, and rare events and public perception, are discussed. The technical work of the Task Force on problems of Rare Events in the Reliability Analysis of Nuclear Plants (1976-1978), sponsored by OECD, is reviewed. Some recent technical considerations are discussed, and conclusions are drawn. The appendix contains an essay written by Anne E. Beachey, under the title: A Study of Rare Events - Problems and Promises
An analog cell to detect single event transients in voltage references
Energy Technology Data Exchange (ETDEWEB)
Franco, F.J., E-mail: fjfranco@fis.ucm.es [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Palomar, C. [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Izquierdo, J.G. [Centro de Láseres Ultrarrápidos, Facultad de Químicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain); Agapito, J.A. [Departamento de Física Aplicada III, Facultad de Físicas, Universidad Complutense de Madrid (UCM), 28040 Madrid (Spain)
2015-01-11
A reliable voltage reference is mandatory in mixed-signal systems. However, this family of components can undergo very long single event transients when operating in radiation environments such as space and nuclear facilities due to the impact of heavy ions. The purpose of the present paper is to demonstrate how a simple cell can be used to detect these transients. The cell was implemented with typical COTS components and its behavior was verified by SPICE simulations and in a laser facility. Different applications of the cell are explored as well.
High-Performance Signal Detection for Adverse Drug Events using MapReduce Paradigm.
Fan, Kai; Sun, Xingzhi; Tao, Ying; Xu, Linhao; Wang, Chen; Mao, Xianling; Peng, Bo; Pan, Yue
2010-11-13
Post-marketing pharmacovigilance is important for public health, as many Adverse Drug Events (ADEs) are unknown when those drugs were approved for marketing. However, due to the large number of reported drugs and drug combinations, detecting ADE signals by mining these reports is becoming a challenging task in terms of computational complexity. Recently, a parallel programming model, MapReduce has been introduced by Google to support large-scale data intensive applications. In this study, we proposed a MapReduce-based algorithm, for common ADE detection approach, Proportional Reporting Ratio (PRR), and tested it in mining spontaneous ADE reports from FDA. The purpose is to investigate the possibility of using MapReduce principle to speed up biomedical data mining tasks using this pharmacovigilance case as one specific example. The results demonstrated that MapReduce programming model could improve the performance of common signal detection algorithm for pharmacovigilance in a distributed computation environment at approximately liner speedup rates.
Extreme Weather Events and Climate Change Attribution
Energy Technology Data Exchange (ETDEWEB)
Thomas, Katherine [National Academy of Sciences, Washington, DC (United States)
2016-03-31
A report from the National Academies of Sciences, Engineering, and Medicine concludes it is now possible to estimate the influence of climate change on some types of extreme events. The science of extreme event attribution has advanced rapidly in recent years, giving new insight to the ways that human-caused climate change can influence the magnitude or frequency of some extreme weather events. This report examines the current state of science of extreme weather attribution, and identifies ways to move the science forward to improve attribution capabilities. Confidence is strongest in attributing types of extreme events that are influenced by climate change through a well-understood physical mechanism, such as, the more frequent heat waves that are closely connected to human-caused global temperature increases, the report finds. Confidence is lower for other types of events, such as hurricanes, whose relationship to climate change is more complex and less understood at present. For any extreme event, the results of attribution studies hinge on how questions about the event's causes are posed, and on the data, modeling approaches, and statistical tools chosen for the analysis.
Hazardous Traffic Event Detection Using Markov Blanket and Sequential Minimal Optimization (MB-SMO
Directory of Open Access Journals (Sweden)
Lixin Yan
2016-07-01
Full Text Available The ability to identify hazardous traffic events is already considered as one of the most effective solutions for reducing the occurrence of crashes. Only certain particular hazardous traffic events have been studied in previous studies, which were mainly based on dedicated video stream data and GPS data. The objective of this study is twofold: (1 the Markov blanket (MB algorithm is employed to extract the main factors associated with hazardous traffic events; (2 a model is developed to identify hazardous traffic event using driving characteristics, vehicle trajectory, and vehicle position data. Twenty-two licensed drivers were recruited to carry out a natural driving experiment in Wuhan, China, and multi-sensor information data were collected for different types of traffic events. The results indicated that a vehicle’s speed, the standard deviation of speed, the standard deviation of skin conductance, the standard deviation of brake pressure, turn signal, the acceleration of steering, the standard deviation of acceleration, and the acceleration in Z (G have significant influences on hazardous traffic events. The sequential minimal optimization (SMO algorithm was adopted to build the identification model, and the accuracy of prediction was higher than 86%. Moreover, compared with other detection algorithms, the MB-SMO algorithm was ranked best in terms of the prediction accuracy. The conclusions can provide reference evidence for the development of dangerous situation warning products and the design of intelligent vehicles.
Energy Technology Data Exchange (ETDEWEB)
Horiguchi, Yoriko; Morita, Yukiko [National Hospital Organization Sagamihara National Hospital, Department of Cardiology, Sagamihara City, Kanagawa (Japan); Tsurikisawa, Naomi; Akiyama, Kazuo [National Hospital Organization Sagamihara National Hospital, Clinical Research Centre for Allergy and Rheumatology, Sagamihara City, Kanagawa (Japan)
2011-02-15
In Churg-Strauss syndrome (CSS) it is important to detect cardiac involvement, which predicts poor prognosis. This study evaluated whether {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy could detect cardiac damage and predict cardiac events in CSS. {sup 123}I-MIBG scintigraphy was performed in 28 patients with CSS, 12 of whom had cardiac involvement. The early and delayed heart to mediastinum ratio (early H/M and delayed H/M) and washout rate were calculated by using {sup 123}I-MIBG scintigraphy and compared with those in control subjects. Early H/M and delayed H/M were significantly lower and the washout rate was significantly higher in patients with cardiac involvement than in those without and in controls (early H/M, p = 0.0024, p = 0.0001; delayed H/M, p = 0.0002, p = 0.0001; washout rate, p = 0.0012, p = 0.0052 vs those without and vs controls, respectively). Accuracy for detecting cardiac involvement was 86% for delayed H/M and washout rate and 79% for early H/M and B-type natriuretic peptide (BNP). Kaplan-Meier analysis showed significantly lower cardiac event-free rates in patients with early H/M {<=} 2.18 and BNP > 21.8 pg/ml than those with early H/M > 2.18 and BNP {<=} 21.8 pg/ml (log-rank test p = 0.006). Cardiac sympathetic nerve function was damaged in CSS patients with cardiac involvement. {sup 123}I-MIBG scintigraphy was useful in detecting cardiac involvement and in predicting cardiac events. (orig.)
Detecting regular sound changes in linguistics as events of concerted evolution.
Hruschka, Daniel J; Branford, Simon; Smith, Eric D; Wilkins, Jon; Meade, Andrew; Pagel, Mark; Bhattacharya, Tanmoy
2015-01-05
Concerted evolution is normally used to describe parallel changes at different sites in a genome, but it is also observed in languages where a specific phoneme changes to the same other phoneme in many words in the lexicon—a phenomenon known as regular sound change. We develop a general statistical model that can detect concerted changes in aligned sequence data and apply it to study regular sound changes in the Turkic language family. Linguistic evolution, unlike the genetic substitutional process, is dominated by events of concerted evolutionary change. Our model identified more than 70 historical events of regular sound change that occurred throughout the evolution of the Turkic language family, while simultaneously inferring a dated phylogenetic tree. Including regular sound changes yielded an approximately 4-fold improvement in the characterization of linguistic change over a simpler model of sporadic change, improved phylogenetic inference, and returned more reliable and plausible dates for events on the phylogenies. The historical timings of the concerted changes closely follow a Poisson process model, and the sound transition networks derived from our model mirror linguistic expectations. We demonstrate that a model with no prior knowledge of complex concerted or regular changes can nevertheless infer the historical timings and genealogical placements of events of concerted change from the signals left in contemporary data. Our model can be applied wherever discrete elements—such as genes, words, cultural trends, technologies, or morphological traits—can change in parallel within an organism or other evolving group. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Guzmán-Ruiz, O; Ruiz-López, P; Gómez-Cámara, A; Ramírez-Martín, M
2015-01-01
To identify and characterize adverse events (AE) in an Internal Medicine Department of a district hospital using an extension of the Global Trigger Tool (GTT), analyzing the diagnostic validity of the tool. An observational, analytical, descriptive and retrospective study was conducted on 2013 clinical charts from an Internal Medicine Department in order to detect EA through the identification of 'triggers' (an event often related to an AE). The 'triggers' and AE were located by systematic review of clinical documentation. The AE were characterized after they were identified. A total of 149 AE were detected in 291 clinical charts during 2013, of which 75.3% were detected directly by the tool, while the rest were not associated with a trigger. The percentage of charts that had at least one AE was 35.4%. The most frequent AE found was pressure ulcer (12%), followed by delirium, constipation, nosocomial respiratory infection and altered level of consciousness by drugs. Almost half (47.6%) of the AE were related to drug use, and 32.2% of all AE were considered preventable. The tool demonstrated a sensitivity of 91.3% (95%CI: 88.9-93.2) and a specificity of 32.5% (95%CI: 29.9-35.1). It had a positive predictive value of 42.5% (95%CI: 40.1-45.1) and a negative predictive value of 87.1% (95%CI: 83.8-89.9). The tool used in this study is valid, useful and reproducible for the detection of AE. It also serves to determine rates of injury and to observe their progression over time. A high frequency of both AE and preventable events were observed in this study. Copyright © 2014 SECA. Published by Elsevier Espana. All rights reserved.
Motion Pattern Extraction and Event Detection for Automatic Visual Surveillance
Directory of Open Access Journals (Sweden)
Benabbas Yassine
2011-01-01
Full Text Available Efficient analysis of human behavior in video surveillance scenes is a very challenging problem. Most traditional approaches fail when applied in real conditions and contexts like amounts of persons, appearance ambiguity, and occlusion. In this work, we propose to deal with this problem by modeling the global motion information obtained from optical flow vectors. The obtained direction and magnitude models learn the dominant motion orientations and magnitudes at each spatial location of the scene and are used to detect the major motion patterns. The applied region-based segmentation algorithm groups local blocks that share the same motion direction and speed and allows a subregion of the scene to appear in different patterns. The second part of the approach consists in the detection of events related to groups of people which are merge, split, walk, run, local dispersion, and evacuation by analyzing the instantaneous optical flow vectors and comparing the learned models. The approach is validated and experimented on standard datasets of the computer vision community. The qualitative and quantitative results are discussed.
Validating administrative data for the detection of adverse events in older hospitalized patients
Directory of Open Access Journals (Sweden)
Ackroyd-Stolarz S
2014-08-01
Full Text Available Stacy Ackroyd-Stolarz,1,2 Susan K Bowles,3–5 Lorri Giffin6 1Performance Excellence Portfolio, Capital District Health Authority, Halifax, Nova Scotia, Canada; 2Department of Emergency Medicine, Dalhousie University, Halifax, Nova Scotia, Canada; 3Geriatric Medicine, Capital District Health Authority, Halifax, Nova Scotia, Canada; 4College of Pharmacy and Division of Geriatric Medicine, Dalhousie University, Halifax, Nova Scotia, Canada; 5Department of Pharmacy at Capital District Health Authority, Halifax, Nova Scotia, Canada; 6South Shore Family Health, Bridgewater, Nova Scotia, Canada Abstract: Older hospitalized patients are at risk of experiencing adverse events including, but not limited to, hospital-acquired pressure ulcers, fall-related injuries, and adverse drug events. A significant challenge in monitoring and managing adverse events is lack of readily accessible information on their occurrence. Purpose: The objective of this retrospective cross-sectional study was to validate diagnostic codes for pressure ulcers, fall-related injuries, and adverse drug events found in routinely collected administrative hospitalization data. Methods: All patients 65 years of age or older discharged between April 1, 2009 and March 31, 2011 from a provincial academic health sciences center in Canada were eligible for inclusion in the validation study. For each of the three types of adverse events, a random sample of 50 patients whose records were positive and 50 patients whose records were not positive for an adverse event was sought for review in the validation study (n=300 records in total. A structured health record review was performed independently by two health care providers with experience in geriatrics, both of whom were unaware of the patient's status with respect to adverse event coding. A physician reviewed 40 records (20 reviewed by each health care provider to establish interrater agreement. Results: A total of 39 pressure ulcers, 56 fall
Energy Technology Data Exchange (ETDEWEB)
Savchenko, V.; Ferrigno, C.; Bozzo, E.; Courvoisier, T. J.-L. [ISDC, Department of Astronomy, University of Geneva, Chemin d’Écogia, 16 CH-1290 Versoix (Switzerland); Kuulkers, E. [European Space Research and Technology Centre (ESA/ESTEC), Keplerlaan 1, 2201 AZ Noordwijk (Netherlands); Bazzano, A.; Natalucci, L.; Rodi, J. [INAF-Institute for Space Astrophysics and Planetology, Via Fosso del Cavaliere 100, I-00133-Rome (Italy); Brandt, S.; Chenevez, J. [DTU Space, National Space Institute Elektrovej, Building 327 DK-2800 Kongens Lyngby (Denmark); Diehl, R.; Von Kienlin, A. [Max-Planck-Institut für Extraterrestrische Physik, Garching (Germany); Domingo, A. [Centro de Astrobiología (CAB-CSIC/INTA, ESAC Campus), Camino bajo del Castillo S/N, E-28692 Villanueva de la Cañada, Madrid (Spain); Hanlon, L.; Martin-Carrillo, A. [Space Science Group, School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Jourdain, E. [IRAP, Université de Toulouse, CNRS, UPS, CNES, 9 Av. Roche, F-31028 Toulouse (France); Laurent, P.; Lebrun, F. [APC, AstroParticule et Cosmologie, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire de Paris Sorbonne Paris Cité, 10 rue Alice Domont et Léonie Duquet, F-75205 Paris Cedex 13 (France); Lutovinov, A. [Space Research Institute of Russian Academy of Sciences, Profsoyuznaya 84/32, 117997 Moscow (Russian Federation); Mereghetti, S. [INAF, IASF-Milano, via E.Bassini 15, I-20133 Milano (Italy); and others
2017-10-20
We report the INTernational Gamma-ray Astrophysics Laboratory ( INTEGRAL ) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi -GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi -GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about 2 s after the end of the GW event. We measure a fluence of (1.4 ± 0.4 ± 0.6) × 10{sup −7} erg cm{sup −2} (75–2000 keV), where, respectively, the statistical error is given at the 1σ confidence level, and the systematic error corresponds to the uncertainty in the spectral model and instrument response. We also report on the pointed follow-up observations carried out by INTEGRAL , starting 19.5 hr after the event, and lasting for 5.4 days. We provide a stringent upper limit on any electromagnetic signal in a very broad energy range, from 3 keV to 8 MeV, constraining the soft gamma-ray afterglow flux to <7.1 × 10{sup −11} erg cm{sup −2} s{sup −1} (80–300 keV). Exploiting the unique capabilities of INTEGRAL , we constrained the gamma-ray line emission from radioactive decays that are expected to be the principal source of the energy behind a kilonova event following a BNS coalescence. Finally, we put a stringent upper limit on any delayed bursting activity, for example, from a newly formed magnetar.
An Event-Triggered Machine Learning Approach for Accelerometer-Based Fall Detection.
Putra, I Putu Edy Suardiyana; Brusey, James; Gaura, Elena; Vesilo, Rein
2017-12-22
The fixed-size non-overlapping sliding window (FNSW) and fixed-size overlapping sliding window (FOSW) approaches are the most commonly used data-segmentation techniques in machine learning-based fall detection using accelerometer sensors. However, these techniques do not segment by fall stages (pre-impact, impact, and post-impact) and thus useful information is lost, which may reduce the detection rate of the classifier. Aligning the segment with the fall stage is difficult, as the segment size varies. We propose an event-triggered machine learning (EvenT-ML) approach that aligns each fall stage so that the characteristic features of the fall stages are more easily recognized. To evaluate our approach, two publicly accessible datasets were used. Classification and regression tree (CART), k -nearest neighbor ( k -NN), logistic regression (LR), and the support vector machine (SVM) were used to train the classifiers. EvenT-ML gives classifier F-scores of 98% for a chest-worn sensor and 92% for a waist-worn sensor, and significantly reduces the computational cost compared with the FNSW- and FOSW-based approaches, with reductions of up to 8-fold and 78-fold, respectively. EvenT-ML achieves a significantly better F-score than existing fall detection approaches. These results indicate that aligning feature segments with fall stages significantly increases the detection rate and reduces the computational cost.
Park, Kyounghoon; Soukavong, Mick; Kim, Jungmee; Kwon, Kyoung Eun; Jin, Xue Mei; Lee, Joongyub; Yang, Bo Ram; Park, Byung Joo
2017-05-01
To detect signals of adverse drug events after imipenem treatment using the Korea Institute of Drug Safety & Risk Management-Korea adverse event reporting system database (KIDS-KD). We performed data mining using KIDS-KD, which was constructed using spontaneously reported adverse event (AE) reports between December 1988 and June 2014. We detected signals calculated the proportional reporting ratio, reporting odds ratio, and information component of imipenem. We defined a signal as any AE that satisfied all three indices. The signals were compared with drug labels of nine countries. There were 807582 spontaneous AEs reports in the KIDS-KD. Among those, the number of antibiotics related AEs was 192510; 3382 reports were associated with imipenem. The most common imipenem-associated AE was the drug eruption; 353 times. We calculated the signal by comparing with all other antibiotics and drugs; 58 and 53 signals satisfied the three methods. We compared the drug labelling information of nine countries, including the USA, the UK, Japan, Italy, Switzerland, Germany, France, Canada, and South Korea, and discovered that the following signals were currently not included in drug labels: hypokalemia, cardiac arrest, cardiac failure, Parkinson's syndrome, myocardial infarction, and prostate enlargement. Hypokalemia was an additional signal compared with all other antibiotics, and the other signals were not different compared with all other antibiotics and all other drugs. We detected new signals that were not listed on the drug labels of nine countries. However, further pharmacoepidemiologic research is needed to evaluate the causality of these signals. © Copyright: Yonsei University College of Medicine 2017
Event-by-event simulation of quantum phenomena
De Raedt, Hans; Michielsen, Kristel
A discrete-event simulation approach is reviewed that does not require the knowledge of the solution of the wave equation of the whole system, yet reproduces the statistical distributions of wave theory by generating detection events one-by-one. The simulation approach is illustrated by applications
Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo
2005-05-18
To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.
Detection and Characterisation of Meteors as a Big Data Citizen Science project
Gritsevich, M.
2017-12-01
Out of a total around 50,000 meteorites currently known to science, the atmospheric passage was recorded instrumentally in only 30 cases with the potential to derive their atmospheric trajectories and pre-impact heliocentric orbits. Similarly, while the observations of meteors, add thousands of new entries per month to existing databases, it is extremely rare they lead to meteorite recovery. Meteor studies thus represent an excellent example of the Big Data citizen science project, where progress in the field largely depends on the prompt identification and characterisation of meteor events as well as on extensive and valuable contributions by amateur observers. Over the last couple of decades technological advancements in observational techniques have yielded drastic improvements in the quality, quantity and diversity of meteor data, while even more ambitious instruments are about to become operational. This empowers meteor science to boost its experimental and theoretical horizons and seek more advanced scientific goals. We review some of the developments that push meteor science into the Big Data era that requires more complex methodological approaches through interdisciplinary collaborations with other branches of physics and computer science. We argue that meteor science should become an integral part of large surveys in astronomy, aeronomy and space physics, and tackle the complexity of micro-physics of meteor plasma and its interaction with the atmosphere. The recent increased interest in meteor science triggered by the Chelyabinsk fireball helps in building the case for technologically and logistically more ambitious meteor projects. This requires developing new methodological approaches in meteor research, with Big Data science and close collaboration between citizen science, geoscience and astronomy as critical elements. We discuss possibilities for improvements and promote an opportunity for collaboration in meteor science within the currently
Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan
2017-05-01
We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10 CFU/mL) and the detection limit (10 2 CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tasting the Tree of Life: Development of a Collaborative, Cross-Campus, Science Outreach Meal Event.
Clement, Wendy L; Elliott, Kathryn T; Cordova-Hoyos, Okxana; Distefano, Isabel; Kearns, Kate; Kumar, Raagni; Leto, Ashley; Tumaliuan, Janis; Franchetti, Lauren; Kulesza, Evelyn; Tineo, Nicole; Mendes, Patrice; Roth, Karen; Osborn, Jeffrey M
2018-01-01
Communicating about science with the public can present a number of challenges, from participation to engagement to impact. In an effort to broadly communicate messages regarding biodiversity, evolution, and tree-thinking with the campus community at The College of New Jersey (TCNJ), a public, primarily undergraduate institution, we created a campus-wide, science-themed meal, "Tasting the Tree of Life: Exploring Biodiversity through Cuisine." We created nine meals that incorporated 149 species/ingredients across the Tree of Life. Each meal illustrated a scientific message communicated through interactions with undergraduate biology students, informational signs, and an interactive website. To promote tree-thinking, we reconstructed a phylogeny of all 149 ingredients. In total, 3,262 people attended the meal, and evaluations indicated that participants left with greater appreciation for the biodiversity and evolutionary relatedness of their food. A keynote lecture and a coordinated social media campaign enhanced the scientific messages, and media coverage extended the reach of this event. "Tasting the Tree of Life" highlights the potential of cuisine as a valuable science communication tool.
Semblance for microseismic event detection
Czech Academy of Sciences Publication Activity Database
Staněk, František; Anikiev, D.; Valenta, Jan; Eisner, Leo
2015-01-01
Roč. 201, č. 3 (2015), s. 1362-1369 ISSN 0956-540X R&D Projects: GA ČR GAP210/12/2451 Institutional support: RVO:67985891 Keywords : microseismic event * microseismic monitoring * source mechanisms Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.484, year: 2015
Guzmán Ruiz, Óscar; Pérez Lázaro, Juan José; Ruiz López, Pedro
To characterise the performance of the triggers used in the detection of adverse events (AE) of hospitalised adult patients and to define a simplified panel of triggers to facilitate the detection of AE. Cross-sectional study of charts of patients from a service of internal medicine to detect EA through systematic review of the charts and identification of triggers (clinical event often related to AE), determining if there was AE as the context in which it appeared the trigger. Once the EA was detected, we proceeded to the characterization of the triggers that detected it. Logistic regression was applied to select the triggers with greater AE detection capability. A total of 291 charts were reviewed, with a total of 562 triggers in 103 patients, of which 163 were involved in detecting an AE. The triggers that detected the most AE were "A.1. Pressure ulcer" (9.82%), "B.5. Laxative or enema" (8.59%), "A.8. Agitation" (8.59%), "A.9. Over-sedation" (7.98%), "A.7. Haemorrhage" (6.75%) and "B.4. Antipsychotic" (6.75%). A simplified model was obtained using logistic regression, and included the variable "Number of drugs" and the triggers "Over-sedation", "Urinary catheterisation", "Readmission in 30 days", "Laxative or enema" and "Abrupt medication stop". This model showed a probability of 81% to correctly classify charts with EA or without EA (p <0.001; 95% confidence interval: 0.763-0.871). A high number of triggers were associated with AE. The summary model is capable of detecting a large amount of AE, with a minimum of elements. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.
Live Streaming | Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
Live Streaming. Watch Academy events live here! There are no live events currently happening. Watch out this space for updates or suscribe to our YouTube channel by clicking here. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018. The 29th Mid-year ...
Energy Technology Data Exchange (ETDEWEB)
Sakaba, Nariaki; Nakazawa, Toshio; Kawasaki, Kozo [Japan Atomic Energy Research Inst., Oarai, Ibaraki (Japan). Oarai Research Establishment; Urakami, Masao; Saisyu, Sadanori [Japan Atomic Power Co., Tokyo (Japan)
2003-03-01
In High Temperature Gas-cooled Reactors (HTGR), the detection of leakage of helium at an early stage is very important for the safety and stability of operations. Since helium is a colourless gas, it is generally difficult to identify the location and the amount of leakage when very little leakage has occurred. The purpose of this R and D is to develop a helium leak detection system for the high temperature environment appropriate to the HTGR. As the first step in the development, this paper describes the result of surveying leakage events at nuclear facilities inside and outside Japan and current gas leakage detection technology to adapt optical-fibre detection technology to HTGRs. (author)
Method for the depth corrected detection of ionizing events from a co-planar grids sensor
De Geronimo, Gianluigi [Syosset, NY; Bolotnikov, Aleksey E [South Setauket, NY; Carini, Gabriella [Port Jefferson, NY
2009-05-12
A method for the detection of ionizing events utilizing a co-planar grids sensor comprising a semiconductor substrate, cathode electrode, collecting grid and non-collecting grid. The semiconductor substrate is sensitive to ionizing radiation. A voltage less than 0 Volts is applied to the cathode electrode. A voltage greater than the voltage applied to the cathode is applied to the non-collecting grid. A voltage greater than the voltage applied to the non-collecting grid is applied to the collecting grid. The collecting grid and the non-collecting grid are summed and subtracted creating a sum and difference respectively. The difference and sum are divided creating a ratio. A gain coefficient factor for each depth (distance between the ionizing event and the collecting grid) is determined, whereby the difference between the collecting electrode and the non-collecting electrode multiplied by the corresponding gain coefficient is the depth corrected energy of an ionizing event. Therefore, the energy of each ionizing event is the difference between the collecting grid and the non-collecting grid multiplied by the corresponding gain coefficient. The depth of the ionizing event can also be determined from the ratio.
Muszynski, G.; Kashinath, K.; Wehner, M. F.; Prabhat, M.; Kurlin, V.
2017-12-01
We investigate novel approaches to detecting, classifying and characterizing extreme weather events, such as atmospheric rivers (ARs), in large high-dimensional climate datasets. ARs are narrow filaments of concentrated water vapour in the atmosphere that bring much of the precipitation in many mid-latitude regions. The precipitation associated with ARs is also responsible for major flooding events in many coastal regions of the world, including the west coast of the United States and western Europe. In this study we combine ideas from Topological Data Analysis (TDA) with Machine Learning (ML) for detecting, classifying and characterizing extreme weather events, like ARs. TDA is a new field that sits at the interface between topology and computer science, that studies "shape" - hidden topological structure - in raw data. It has been applied successfully in many areas of applied sciences, including complex networks, signal processing and image recognition. Using TDA we provide ARs with a shape characteristic as a new feature descriptor for the task of AR classification. In particular, we track the change in topology in precipitable water (integrated water vapour) fields using the Union-Find algorithm. We use the generated feature descriptors with ML classifiers to establish reliability and classification performance of our approach. We utilize the parallel toolkit for extreme climate events analysis (TECA: Petascale Pattern Recognition for Climate Science, Prabhat et al., Computer Analysis of Images and Patterns, 2015) for comparison (it is assumed that events identified by TECA is ground truth). Preliminary results indicate that our approach brings new insight into the study of ARs and provides quantitative information about the relevance of topological feature descriptors in analyses of a large climate datasets. We illustrate this method on climate model output and NCEP reanalysis datasets. Further, our method outperforms existing methods on detection and
Koley, Bijoy Laxmi; Dey, Debangshu
2014-01-01
This paper presents an online method for automatic detection of apnea/hypopnea events, with the help of oxygen saturation (SpO2) signal, measured at fingertip by Bluetooth nocturnal pulse oximeter. Event detection is performed by identifying abnormal data segments from the recorded SpO2 signal, employing a binary classifier model based on a support vector machine (SVM). Thereafter the abnormal segment is further analyzed to detect different states within the segment, i.e., steady, desaturation, and resaturation, with the help of another SVM-based binary ensemble classifier model. Finally, a heuristically obtained rule-based system is used to identify the apnea/hypopnea events from the time-sequenced decisions of these classifier models. In the developmental phase, a set of 34 time domain-based features was extracted from the segmented SpO2 signal using an overlapped windowing technique. Later, an optimal set of features was selected on the basis of recursive feature elimination technique. A total of 34 subjects were included in the study. The results show average event detection accuracies of 96.7% and 93.8% for the offline and the online tests, respectively. The proposed system provides direct estimation of the apnea/hypopnea index with the help of a relatively inexpensive and widely available pulse oximeter. Moreover, the system can be monitored and accessed by physicians through LAN/WAN/Internet and can be extended to deploy in Bluetooth-enabled mobile phones.
Characterization of a subset of large amplitude noise events in VIRGO science run 1 (VSR1)
International Nuclear Information System (INIS)
Del Prete, M
2009-01-01
We report about a characterization study of a subset of large amplitude noise events present in the main data channel of the VIRGO detector. The main motivation of this study is the identification of auxiliary channels which can be used to define veto procedures. We characterized large amplitude events both in the time and in the frequency domain. We found evidence of coincidences among these and disturbances detected by magnetometer's sensors or inside the main power supply. In some cases the disturbances were produced by events in the VIRGO environment such as lightnings, main power supply glitches and airplane traffic. We have found two auxiliary channels that can be used to veto events generated by main power supply glitches or lightnings. A procedure to clean the main channel based on them has been successfully tested. We have also identified two auxiliary channels which are useful for the identification of events generated by airplane traffic. These can be used to implement a vetoing procedure both in the time and in the frequency domain.
Characterization of a subset of large amplitude noise events in VIRGO science run 1 (VSR1)
Energy Technology Data Exchange (ETDEWEB)
Del Prete, M [Universita di Pisa, Lungarno Pacinotti, 43, 56126 Pisa Instituto Nazionale di Fisica Nucleare sez. di Pisa, ED C polo Fibonacci, Via F Buonarroti 2, 56127, Pisa (Italy)
2009-10-21
We report about a characterization study of a subset of large amplitude noise events present in the main data channel of the VIRGO detector. The main motivation of this study is the identification of auxiliary channels which can be used to define veto procedures. We characterized large amplitude events both in the time and in the frequency domain. We found evidence of coincidences among these and disturbances detected by magnetometer's sensors or inside the main power supply. In some cases the disturbances were produced by events in the VIRGO environment such as lightnings, main power supply glitches and airplane traffic. We have found two auxiliary channels that can be used to veto events generated by main power supply glitches or lightnings. A procedure to clean the main channel based on them has been successfully tested. We have also identified two auxiliary channels which are useful for the identification of events generated by airplane traffic. These can be used to implement a vetoing procedure both in the time and in the frequency domain.
Directory of Open Access Journals (Sweden)
Andrew Cron
Full Text Available Flow cytometry is the prototypical assay for multi-parameter single cell analysis, and is essential in vaccine and biomarker research for the enumeration of antigen-specific lymphocytes that are often found in extremely low frequencies (0.1% or less. Standard analysis of flow cytometry data relies on visual identification of cell subsets by experts, a process that is subjective and often difficult to reproduce. An alternative and more objective approach is the use of statistical models to identify cell subsets of interest in an automated fashion. Two specific challenges for automated analysis are to detect extremely low frequency event subsets without biasing the estimate by pre-processing enrichment, and the ability to align cell subsets across multiple data samples for comparative analysis. In this manuscript, we develop hierarchical modeling extensions to the Dirichlet Process Gaussian Mixture Model (DPGMM approach we have previously described for cell subset identification, and show that the hierarchical DPGMM (HDPGMM naturally generates an aligned data model that captures both commonalities and variations across multiple samples. HDPGMM also increases the sensitivity to extremely low frequency events by sharing information across multiple samples analyzed simultaneously. We validate the accuracy and reproducibility of HDPGMM estimates of antigen-specific T cells on clinically relevant reference peripheral blood mononuclear cell (PBMC samples with known frequencies of antigen-specific T cells. These cell samples take advantage of retrovirally TCR-transduced T cells spiked into autologous PBMC samples to give a defined number of antigen-specific T cells detectable by HLA-peptide multimer binding. We provide open source software that can take advantage of both multiple processors and GPU-acceleration to perform the numerically-demanding computations. We show that hierarchical modeling is a useful probabilistic approach that can provide a
DEFF Research Database (Denmark)
Savchenko, V.; Ferrigno, C.; Kuulkers, E.
2017-01-01
We report the INTernational Gamma-ray Astrophysics Laboratory (INTEGRAL) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi-GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS......) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi-GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about...
Directory of Open Access Journals (Sweden)
Parivash Ranjbar
2008-09-01
Full Text Available Objectives: Conducting field tests of a vibrotactile aid for deaf/deafblind persons for detection, identification and directional perception of environmental sounds. Methods: Five deaf (3F/2M, 22–36 years individuals tested the aid separately in a home environment (kitchen and in a traffic environment. Their eyes were blindfolded and they wore a headband and holding a vibrator for sound identification. In the headband, three microphones were mounted and two vibrators for signalling direction of the sound source. The sounds originated from events typical for the home environment and traffic. The subjects were inexperienced (events unknown and experienced (events known. They identified the events in a home and traffic environment, but perceived sound source direction only in traffic. Results: The detection scores were higher than 98% both in the home and in the traffic environment. In the home environment, identification scores varied between 25%-58% when the subjects were inexperienced and between 33%-83% when they were experienced. In traffic, identification scores varied between 20%-40% when the subjects were inexperienced and between 22%-56% when they were experienced. The directional perception scores varied between 30%-60% when inexperienced and between 61%-83% when experienced. Discussion: The vibratory aid consistently improved all participants’ detection, identification and directional perception ability.
Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Events. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018. The 29th Mid-year meeting of the Academy will be held from 29–30 June ...
Events Diary | Women in Science | Initiatives | Indian Academy of ...
Indian Academy of Sciences (India)
... Proceedings – Mathematical Sciences · Resonance – Journal of Science ... 4th IUPAP International Conference on Women in Physics ... Sciences in Asia) meeting on "Women in Science Education and Research" was held on 24 September 2014. ... The Department of Biotechnology and Medical Engineering of National ...
Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T
2017-06-01
As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.
Detection of invisible and crucial events: from seismic fluctuations to the war against terrorism
Energy Technology Data Exchange (ETDEWEB)
Allegrini, Paolo; Fronzoni, Leone; Grigolini, Paolo; Latora, Vito; Mega, Mirko S.; Palatella, Luigi E-mail: luigi.palatella@df.unipi.it; Rapisarda, Andrea; Vinciguerra, Sergio
2004-04-01
We argue that the recent discovery of the non-Poissonian statistics of the seismic main-shocks is a special case of a more general approach to the detection of the distribution of the time increments between one crucial but invisible event and the next. We make the conjecture that the proposed approach can be applied to the analysis of terrorist network with significant benefits for the Intelligence Community.
A Cluster-Based Fuzzy Fusion Algorithm for Event Detection in Heterogeneous Wireless Sensor Networks
Directory of Open Access Journals (Sweden)
ZiQi Hao
2015-01-01
Full Text Available As limited energy is one of the tough challenges in wireless sensor networks (WSN, energy saving becomes important in increasing the lifecycle of the network. Data fusion enables combining information from several sources thus to provide a unified scenario, which can significantly save sensor energy and enhance sensing data accuracy. In this paper, we propose a cluster-based data fusion algorithm for event detection. We use k-means algorithm to form the nodes into clusters, which can significantly reduce the energy consumption of intracluster communication. Distances between cluster heads and event and energy of clusters are fuzzified, thus to use a fuzzy logic to select the clusters that will participate in data uploading and fusion. Fuzzy logic method is also used by cluster heads for local decision, and then the local decision results are sent to the base station. Decision-level fusion for final decision of event is performed by base station according to the uploaded local decisions and fusion support degree of clusters calculated by fuzzy logic method. The effectiveness of this algorithm is demonstrated by simulation results.
Energy Technology Data Exchange (ETDEWEB)
Silva, Rodrigo Tavares; Martinelli Filho, Martino, E-mail: martino@cardiol.br; Peixoto, Giselle de Lima; Lima, José Jayme Galvão de; Siqueira, Sérgio Freitas de; Costa, Roberto; Gowdak, Luís Henrique Wolff [Instituto do Coração do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Paula, Flávio Jota de [Unidade de Transplante Renal - Divisão de Urologia do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Kalil Filho, Roberto; Ramires, José Antônio Franchini [Instituto do Coração do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil)
2015-11-15
The recording of arrhythmic events (AE) in renal transplant candidates (RTCs) undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used. We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR). A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE. During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT) occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002), and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001) were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD) was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041). In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT.
Directory of Open Access Journals (Sweden)
Rodrigo Tavares Silva
2015-11-01
Full Text Available AbstractBackground:The recording of arrhythmic events (AE in renal transplant candidates (RTCs undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used.Objective:We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR.Methods:A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE.Results:During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002, and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001 were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041.Conclusions:In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT.
Silva, Rodrigo Tavares; Martinelli Filho, Martino; Peixoto, Giselle de Lima; de Lima, José Jayme Galvão; de Siqueira, Sérgio Freitas; Costa, Roberto; Gowdak, Luís Henrique Wolff; de Paula, Flávio Jota; Kalil Filho, Roberto; Ramires, José Antônio Franchini
2015-01-01
Background The recording of arrhythmic events (AE) in renal transplant candidates (RTCs) undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used. Objective We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR). Methods A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE. Results During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT) occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002), and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001) were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD) was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041). Conclusions In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT. PMID:26351983
Ultra-Low Power Sensor System for Disaster Event Detection in Metro Tunnel Systems
Directory of Open Access Journals (Sweden)
Jonah VINCKE
2017-05-01
Full Text Available In this extended paper, the concept for an ultra-low power wireless sensor network (WSN for underground tunnel systems is presented highlighting the chosen sensors. Its objectives are the detection of emergency events either from natural disasters, such as flooding or fire, or from terrorist attacks using explosives. Earlier works have demonstrated that the power consumption for the communication can be reduced such that the data acquisition (i.e. sensor sub-system becomes the most significant energy consumer. By using ultra-low power components for the smoke detector, a hydrostatic pressure sensor for water ingress detection and a passive acoustic emission sensor for explosion detection, all considered threats are covered while the energy consumption can be kept very low in relation to the data acquisition. In addition to 1 the sensor system is integrated into a sensor board. The total average power consumption for operating the sensor sub-system is measured to be 35.9 µW for lower and 7.8 µW for upper nodes.
Space Science at Los Alamos National Laboratory
Smith, Karl
2017-09-01
The Space Science and Applications group (ISR-1) in the Intelligence and Space Research (ISR) division at the Los Alamos National Laboratory lead a number of space science missions for civilian and defense-related programs. In support of these missions the group develops sensors capable of detecting nuclear emissions and measuring radiations in space including γ-ray, X-ray, charged-particle, and neutron detection. The group is involved in a number of stages of the lifetime of these sensors including mission concept and design, simulation and modeling, calibration, and data analysis. These missions support monitoring of the atmosphere and near-Earth space environment for nuclear detonations as well as monitoring of the local space environment including space-weather type events. Expertise in this area has been established over a long history of involvement with cutting-edge projects continuing back to the first space based monitoring mission Project Vela. The group's interests cut across a large range of topics including non-proliferation, space situational awareness, nuclear physics, material science, space physics, astrophysics, and planetary physics.
Creating a Successful Citizen Science Model to Detect and Report Invasive Species
Gallo, Travis; Waitt, Damon
2011-01-01
The Invaders of Texas program is a successful citizen science program in which volunteers survey and monitor invasive plants throughout Texas. Invasive plants are being introduced at alarming rates, and our limited knowledge about their distribution is a major cause for concern. The Invaders of Texas program trains citizen scientists to detect the…
Ramirez, Olga; McCollough, Cherie A.; Diaz, Zulmaris
2016-01-01
The following describes a culturally relevant mathematics and science content program implemented by preservice teachers (PSTs) at Family Math/Science Learning Events (FM/SLEs) conducted through two different university programs in south Texas. These experiences are required course activities designed to inform PSTs of the importance of…
Zhang, Jian; Hou, Dibo; Wang, Ke; Huang, Pingjie; Zhang, Guangxin; Loáiciga, Hugo
2017-05-01
The detection of organic contaminants in water distribution systems is essential to protect public health from potential harmful compounds resulting from accidental spills or intentional releases. Existing methods for detecting organic contaminants are based on quantitative analyses such as chemical testing and gas/liquid chromatography, which are time- and reagent-consuming and involve costly maintenance. This study proposes a novel procedure based on discrete wavelet transform and principal component analysis for detecting organic contamination events from ultraviolet spectral data. Firstly, the spectrum of each observation is transformed using discrete wavelet with a coiflet mother wavelet to capture the abrupt change along the wavelength. Principal component analysis is then employed to approximate the spectra based on capture and fusion features. The significant value of Hotelling's T 2 statistics is calculated and used to detect outliers. An alarm of contamination event is triggered by sequential Bayesian analysis when the outliers appear continuously in several observations. The effectiveness of the proposed procedure is tested on-line using a pilot-scale setup and experimental data.
Building Collections: Science Fiction
Krapp, JoAnn Vergona
2005-01-01
Fantasy and science fiction are two genres that are products of imagination. Both present alternate worlds governed by their own laws and values, but it is the plausibility of events in each world that sets the two apart. In fantasy, events happen by magic or inexplicable means. In science fiction, events could happen based on advanced…
Directory of Open Access Journals (Sweden)
Jie Yu
2017-01-01
Full Text Available The method based on conventional index and UV-vision has been widely applied in the field of water quality abnormality detection. This paper presents a qualitative analysis approach to detect the water contamination events with unknown pollutants. Fluorescence spectra were used as water quality monitoring tools, and the detection method of unknown contaminants in water based on alternating trilinear decomposition (ATLD is proposed to analyze the excitation and emission spectra of the samples. The Delaunay triangulation interpolation method was used to make the pretreatment of three-dimensional fluorescence spectra data, in order to estimate the effect of Rayleigh and Raman scattering; ATLD model was applied to establish the model of normal water sample, and the residual matrix was obtained by subtracting the measured matrix from the model matrix; the residual sum of squares obtained from the residual matrix and threshold was used to make qualitative discrimination of test samples and distinguish drinking water samples and organic pollutant samples. The results of the study indicate that ATLD modeling with three-dimensional fluorescence spectra can provide a tool for detecting unknown organic pollutants in water qualitatively. The method based on fluorescence spectra can be complementary to the method based on conventional index and UV-vision.
Directory of Open Access Journals (Sweden)
M. Flach
2017-08-01
Full Text Available Today, many processes at the Earth's surface are constantly monitored by multiple data streams. These observations have become central to advancing our understanding of vegetation dynamics in response to climate or land use change. Another set of important applications is monitoring effects of extreme climatic events, other disturbances such as fires, or abrupt land transitions. One important methodological question is how to reliably detect anomalies in an automated and generic way within multivariate data streams, which typically vary seasonally and are interconnected across variables. Although many algorithms have been proposed for detecting anomalies in multivariate data, only a few have been investigated in the context of Earth system science applications. In this study, we systematically combine and compare feature extraction and anomaly detection algorithms for detecting anomalous events. Our aim is to identify suitable workflows for automatically detecting anomalous patterns in multivariate Earth system data streams. We rely on artificial data that mimic typical properties and anomalies in multivariate spatiotemporal Earth observations like sudden changes in basic characteristics of time series such as the sample mean, the variance, changes in the cycle amplitude, and trends. This artificial experiment is needed as there is no gold standard for the identification of anomalies in real Earth observations. Our results show that a well-chosen feature extraction step (e.g., subtracting seasonal cycles, or dimensionality reduction is more important than the choice of a particular anomaly detection algorithm. Nevertheless, we identify three detection algorithms (k-nearest neighbors mean distance, kernel density estimation, a recurrence approach and their combinations (ensembles that outperform other multivariate approaches as well as univariate extreme-event detection methods. Our results therefore provide an effective workflow to
Solar Power Ramp Events Detection Using an Optimized Swinging Door Algorithm: Preprint
Energy Technology Data Exchange (ETDEWEB)
Cui, Mingjian; Zhang, Jie; Florita, Anthony; Hodge, Bri-Mathias; Ke, Deping; Sun, Yuanzhang
2015-08-07
Solar power ramp events (SPREs) are those that significantly influence the integration of solar power on non-clear days and threaten the reliable and economic operation of power systems. Accurately extracting solar power ramps becomes more important with increasing levels of solar power penetrations in power systems. In this paper, we develop an optimized swinging door algorithm (OpSDA) to detection. First, the swinging door algorithm (SDA) is utilized to segregate measured solar power generation into consecutive segments in a piecewise linear fashion. Then we use a dynamic programming approach to combine adjacent segments into significant ramps when the decision thresholds are met. In addition, the expected SPREs occurring in clear-sky solar power conditions are removed. Measured solar power data from Tucson Electric Power is used to assess the performance of the proposed methodology. OpSDA is compared to two other ramp detection methods: the SDA and the L1-Ramp Detect with Sliding Window (L1-SW) method. The statistical results show the validity and effectiveness of the proposed method. OpSDA can significantly improve the performance of the SDA, and it can perform as well as or better than L1-SW with substantially less computation time.
Mid Year Meetings | Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
: Faculty Hall, Indian Institute of Science, Bengaluru. 26 Mid-Year Meeting, 2015. Dates: 3 and 4 July 2015. Venue: Faculty Hall, Indian Institute of Science, Bengaluru. 25 Mid-Year Meeting, 2014. Dates: 4 and 5 July 2014. Venue: Faculty Hall ...
Symposia | Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
Annual meetings of Academy include one or two symposia, one of which is usually on a topic of interest to or pursued in .... Impact of science and technology on medicine - a cardiac illustration ... Planetary studies ... Elementary particle physics
Automated Detection of Financial Events in News Text
F.P. Hogenboom (Frederik)
2014-01-01
markdownabstractToday’s financial markets are inextricably linked with financial events like acquisitions, profit announcements, or product launches. Information extracted from news messages that report on such events could hence be beneficial for financial decision making. The ubiquity of news,
DiskDetective.org: Finding Homes for Exoplanets Through Citizen Science
Kuchner, Marc J.
2016-01-01
The Disk Detective project is scouring the data archive from the WISE all-sky survey to find new debris disks and protoplanetary disks-the dusty dens where exoplanets form and dwell. Volunteers on this citizen science website have already performed 1.6 million classifications, searching a catalog 8x the size of any published WISE survey. We follow up candidates using ground based telescopes in California, Arizona, Chile, Hawaii, and Argentina. We ultimately expect to increase the pool of known debris disks by approx. 400 and triple the solid angle in clusters of young stars examined with WISE, providing a unique new catalog of isolated disk stars, key planet-search targets, and candidate advanced extraterrestrial civilizations. Come to this talk to hear the news about our latest dusty discoveries and the trials and the ecstasy of launching a new citizen science project. Please bring your laptop or smartphone if you like!
Environmental conditions synchronize waterbird mortality events in the Great Lakes
Prince, Karine; Chipault, Jennifer G.; White, C. LeAnn; Zuckerberg, Benjamin
2018-01-01
Since the 1960s, periodic outbreaks of avian botulism type E have contributed to large-scale die-offs of thousands of waterbirds throughout the Great Lakes of the United States. In recent years, these events have become more common and widespread. Occurring during the summer and autumn months, the prevalence of these die-offs varies across years and is often associated with years of warmer lake temperatures and lower water levels. Little information exists on how environmental conditions mediate the spatial and temporal characteristics of mortality events.In 2010, a citizen science programme, Avian Monitoring for Botulism Lakeshore Events (AMBLE), was launched to enhance surveillance efforts and detect the appearance of beached waterbird carcasses associated with avian botulism type E outbreaks in northern Lake Michigan. Using these data, our goal was to quantify the within-year characteristics of mortality events for multiple species, and to test whether the synchrony of these events corresponded to fluctuations in two environmental factors suspected to be important in the spread of avian botulism: water temperature and the prevalence of green macroalgae.During two separate events of mass waterbird mortality, we found that the detection of bird carcasses was spatially synchronized at scales of c. 40 km. Notably, the extent of this spatial synchrony in avian mortality matched that of fluctuations in lake surface water temperatures and the prevalence of green macroalgae.Synthesis and applications. Our findings are suggestive of a synchronizing effect where warmer lake temperatures and the appearance of macroalgae mediate the characteristics of avian mortality. In future years, rising lake temperatures and a higher propensity of algal masses could lead to increases in the magnitude and synchronization of avian mortality due to botulism. We advocate that citizen-based monitoring efforts are critical for identifying the potential environmental conditions associated
ISOMER: Informative Segment Observations for Multimedia Event Recounting
Sun, C.; Burns, B.; Nevatia, R.; Snoek, C.; Bolles, B.; Myers, G.; Wang, W.; Yeh, E.
2014-01-01
This paper describes a system for multimedia event detection and recounting. The goal is to detect a high level event class in unconstrained web videos and generate event oriented summarization for display to users. For this purpose, we detect informative segments and collect observations for them,
Contribution of Infrasound to IDC Reviewed Event Bulletin
Bittner, Paulina; Polich, Paul; Gore, Jane; Ali, Sherif Mohamed; Medinskaya, Tatiana; Mialle, Pierrick
2016-04-01
Until 2003 two waveform technologies, i.e. seismic and hydroacoustic were used to detect and locate events included in the International Data Centre (IDC) Reviewed Event Bulletin (REB). The first atmospheric event was published in the REB in 2003 but infrasound detections could not be used by the Global Association (GA) Software due to the unmanageable high number of spurious associations. Offline improvements of the automatic processing took place to reduce the number of false detections to a reasonable level. In February 2010 the infrasound technology was reintroduced to the IDC operations and has contributed to both automatic and reviewed IDC bulletins. The primary contribution of infrasound technology is to detect atmospheric events. These events may also be observed at seismic stations, which will significantly improve event location. Examples of REB events, which were detected by the International Monitoring System (IMS) infrasound network were fireballs (e.g. Bangkok fireball, 2015), volcanic eruptions (e.g. Calbuco, Chile 2015) and large surface explosions (e.g. Tjanjin, China 2015). Query blasts and large earthquakes belong to events primarily recorded at seismic stations of the IMS network but often detected at the infrasound stations. Presence of infrasound detection associated to an event from a mining area indicates a surface explosion. Satellite imaging and a database of active mines can be used to confirm the origin of such events. This presentation will summarize the contribution of 6 years of infrasound data to IDC bulletins and provide examples of events recorded at the IMS infrasound network. Results of this study may help to improve location of small events with observations on infrasound stations.
Cole, Casey A; Anshari, Dien; Lambert, Victoria; Thrasher, James F; Valafar, Homayoun
2017-12-13
Smoking is the leading cause of preventable death in the world today. Ecological research on smoking in context currently relies on self-reported smoking behavior. Emerging smartwatch technology may more objectively measure smoking behavior by automatically detecting smoking sessions using robust machine learning models. This study aimed to examine the feasibility of detecting smoking behavior using smartwatches. The second aim of this study was to compare the success of observing smoking behavior with smartwatches to that of conventional self-reporting. A convenience sample of smokers was recruited for this study. Participants (N=10) recorded 12 hours of accelerometer data using a mobile phone and smartwatch. During these 12 hours, they engaged in various daily activities, including smoking, for which they logged the beginning and end of each smoking session. Raw data were classified as either smoking or nonsmoking using a machine learning model for pattern recognition. The accuracy of the model was evaluated by comparing the output with a detailed description of a modeled smoking session. In total, 120 hours of data were collected from participants and analyzed. The accuracy of self-reported smoking was approximately 78% (96/123). Our model was successful in detecting 100 of 123 (81%) smoking sessions recorded by participants. After eliminating sessions from the participants that did not adhere to study protocols, the true positive detection rate of the smartwatch based-detection increased to more than 90%. During the 120 hours of combined observation time, only 22 false positive smoking sessions were detected resulting in a 2.8% false positive rate. Smartwatch technology can provide an accurate, nonintrusive means of monitoring smoking behavior in natural contexts. The use of machine learning algorithms for passively detecting smoking sessions may enrich ecological momentary assessment protocols and cessation intervention studies that often rely on self
Semantics-based information extraction for detecting economic events
A.C. Hogenboom (Alexander); F. Frasincar (Flavius); K. Schouten (Kim); O. van der Meer
2013-01-01
textabstractAs today's financial markets are sensitive to breaking news on economic events, accurate and timely automatic identification of events in news items is crucial. Unstructured news items originating from many heterogeneous sources have to be mined in order to extract knowledge useful for
An Entropy-Based Network Anomaly Detection Method
Directory of Open Access Journals (Sweden)
Przemysław Bereziński
2015-04-01
Full Text Available Data mining is an interdisciplinary subfield of computer science involving methods at the intersection of artificial intelligence, machine learning and statistics. One of the data mining tasks is anomaly detection which is the analysis of large quantities of data to identify items, events or observations which do not conform to an expected pattern. Anomaly detection is applicable in a variety of domains, e.g., fraud detection, fault detection, system health monitoring but this article focuses on application of anomaly detection in the field of network intrusion detection.The main goal of the article is to prove that an entropy-based approach is suitable to detect modern botnet-like malware based on anomalous patterns in network. This aim is achieved by realization of the following points: (i preparation of a concept of original entropy-based network anomaly detection method, (ii implementation of the method, (iii preparation of original dataset, (iv evaluation of the method.
Guerilla Science: Outreach at music and art festival
Rosin, Mark
2012-10-01
Guerilla Science a non-profit science education organization that, since 2007, has brought live events to unconventional venues for science, such as music festivals, art galleries, banquets, department stores and theaters. Guerilla Science sets science free by taking it out of the lab and into the traditional domains of the arts. By producing events that mix science with art, music and play, they create unique opportunities for adult audiences to experience science in unorthodox ways, such as interactive events, games, live experiments, demonstrations and performances by academics, artists, musicians, actors, and professional science communicators. Much of Guerilla Science's work has focused on astrophysical and terrestrial plasmas, and this presentation will provide an overview of Guerilla Science's work in this area. Guerilla Science has produced over twenty events, receiving international media coverage, and directly reached over fifteen thousand members of the public.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Pies, Ross E.
2016-03-29
A method and device for the detection of impact events on a security barrier. A hollow rebar is farmed within a security barrier, whereby the hollow rebar is completely surrounded by the security barrier. An optical fiber passes through the interior of the hollow rebar. An optical transmitter and an optical receiver are both optically connected to the optical fiber and connected to optical electronics. The optical electronics are configured to provide notification upon the detection of an impact event at the security barrier based on the detection of disturbances within the optical fiber.
Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao
2017-09-27
Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.
Dehghani, Navid; Tankenson, Michael
2006-01-01
This paper details an architectural description of the Mission Data Processing and Control System (MPCS), an event-driven, multi-mission ground data processing components providing uplink, downlink, and data management capabilities which will support the Mars Science Laboratory (MSL) project as its first target mission. MPCS is developed based on a set of small reusable components, implemented in Java, each designed with a specific function and well-defined interfaces. An industry standard messaging bus is used to transfer information among system components. Components generate standard messages which are used to capture system information, as well as triggers to support the event-driven architecture of the system. Event-driven systems are highly desirable for processing high-rate telemetry (science and engineering) data, and for supporting automation for many mission operations processes.
Detecting surface events at the COBRA experiment
Energy Technology Data Exchange (ETDEWEB)
Tebruegge, Jan [Exp. Physik IV, TU Dortmund (Germany); Collaboration: COBRA-Collaboration
2015-07-01
The aim of the COBRA experiment is to prove the existence of neutrinoless double-beta-decay and to measure its half-life. For this purpose the COBRA demonstrator, a prototype for a large-scale experiment, is operated at the Gran Sasso Underground Laboratory (LNGS) in Italy. The demonstrator is a detector array made of 64 Cadmium-Zinc-Telluride (CdZnTe) semiconductor detectors in the coplanar grid anode configuration. Each detector is 1**1 ccm in size. This setup is used to investigate the experimental issues of operating CdZnTe detectors in low background mode and identify potential background components. As the ''detector=source'' principle is used, the neutrinoless double beta decay COBRA searches for happens within the whole detector volume. Consequently, events on the surface of the detectors are considered as background. These surface events are a main background component, stemming mainly from the natural radioactivity, especially radon. This talk explains to what extent surface events occur and shows how these are recognized and vetoed in the analysis using pulse shape discrimination algorithms.
Synchronization Techniques in Parallel Discrete Event Simulation
Lindén, Jonatan
2018-01-01
Discrete event simulation is an important tool for evaluating system models in many fields of science and engineering. To improve the performance of large-scale discrete event simulations, several techniques to parallelize discrete event simulation have been developed. In parallel discrete event simulation, the work of a single discrete event simulation is distributed over multiple processing elements. A key challenge in parallel discrete event simulation is to ensure that causally dependent ...
Event detection and localization for small mobile robots using reservoir computing.
Antonelo, E A; Schrauwen, B; Stroobandt, D
2008-08-01
Reservoir Computing (RC) techniques use a fixed (usually randomly created) recurrent neural network, or more generally any dynamic system, which operates at the edge of stability, where only a linear static readout output layer is trained by standard linear regression methods. In this work, RC is used for detecting complex events in autonomous robot navigation. This can be extended to robot localization tasks which are solely based on a few low-range, high-noise sensory data. The robot thus builds an implicit map of the environment (after learning) that is used for efficient localization by simply processing the input stream of distance sensors. These techniques are demonstrated in both a simple simulation environment and in the physically realistic Webots simulation of the commercially available e-puck robot, using several complex and even dynamic environments.
Mid Year Meetings | Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
Mid Year Meetings. 28 Mid-Year Meeting, 2017. Dates: 30th June and 1st July 2017. Venue: Faculty Hall, Indian Institute of Science, Bengaluru. 27 Mid-Year Meeting, 2016. Dates: 1 and 2 July 2016. Venue: Faculty Hall, Indian Institute of Science, Bengaluru. 26 Mid-Year Meeting, 2015. Dates: 3 and 4 July 2015. Venue: ...
Fermilab | Science | Particle Accelerators
perhaps most widely felt in the development of the World Wide Web and in the superconducting wire and Fermilab Search Toggle Fermilab Navbar Toggle Search Search Home About Science Jobs Contact Phone public events Fermilab Public Events Lederman Science Center Fermilab Natural Areas Folk and Barn Dancing
Detecting and characterising ramp events in wind power time series
International Nuclear Information System (INIS)
Gallego, Cristóbal; Cuerva, Álvaro; Costa, Alexandre
2014-01-01
In order to implement accurate models for wind power ramp forecasting, ramps need to be previously characterised. This issue has been typically addressed by performing binary ramp/non-ramp classifications based on ad-hoc assessed thresholds. However, recent works question this approach. This paper presents the ramp function, an innovative wavelet- based tool which detects and characterises ramp events in wind power time series. The underlying idea is to assess a continuous index related to the ramp intensity at each time step, which is obtained by considering large power output gradients evaluated under different time scales (up to typical ramp durations). The ramp function overcomes some of the drawbacks shown by the aforementioned binary classification and permits forecasters to easily reveal specific features of the ramp behaviour observed at a wind farm. As an example, the daily profile of the ramp-up and ramp-down intensities are obtained for the case of a wind farm located in Spain
Efficient hemodynamic event detection utilizing relational databases and wavelet analysis
Saeed, M.; Mark, R. G.
2001-01-01
Development of a temporal query framework for time-oriented medical databases has hitherto been a challenging problem. We describe a novel method for the detection of hemodynamic events in multiparameter trends utilizing wavelet coefficients in a MySQL relational database. Storage of the wavelet coefficients allowed for a compact representation of the trends, and provided robust descriptors for the dynamics of the parameter time series. A data model was developed to allow for simplified queries along several dimensions and time scales. Of particular importance, the data model and wavelet framework allowed for queries to be processed with minimal table-join operations. A web-based search engine was developed to allow for user-defined queries. Typical queries required between 0.01 and 0.02 seconds, with at least two orders of magnitude improvement in speed over conventional queries. This powerful and innovative structure will facilitate research on large-scale time-oriented medical databases.
The Event Detection and the Apparent Velocity Estimation Based on Computer Vision
Shimojo, M.
2012-08-01
The high spatial and time resolution data obtained by the telescopes aboard Hinode revealed the new interesting dynamics in solar atmosphere. In order to detect such events and estimate the velocity of dynamics automatically, we examined the estimation methods of the optical flow based on the OpenCV that is the computer vision library. We applied the methods to the prominence eruption observed by NoRH, and the polar X-ray jet observed by XRT. As a result, it is clear that the methods work well for solar images if the images are optimized for the methods. It indicates that the optical flow estimation methods in the OpenCV library are very useful to analyze the solar phenomena.
Sudden Event Recognition: A Survey
Directory of Open Access Journals (Sweden)
Mohd Asyraf Zulkifley
2013-08-01
Full Text Available Event recognition is one of the most active research areas in video surveillance fields. Advancement in event recognition systems mainly aims to provide convenience, safety and an efficient lifestyle for humanity. A precise, accurate and robust approach is necessary to enable event recognition systems to respond to sudden changes in various uncontrolled environments, such as the case of an emergency, physical threat and a fire or bomb alert. The performance of sudden event recognition systems depends heavily on the accuracy of low level processing, like detection, recognition, tracking and machine learning algorithms. This survey aims to detect and characterize a sudden event, which is a subset of an abnormal event in several video surveillance applications. This paper discusses the following in detail: (1 the importance of a sudden event over a general anomalous event; (2 frameworks used in sudden event recognition; (3 the requirements and comparative studies of a sudden event recognition system and (4 various decision-making approaches for sudden event recognition. The advantages and drawbacks of using 3D images from multiple cameras for real-time application are also discussed. The paper concludes with suggestions for future research directions in sudden event recognition.
THE RELATIONSHIP BETWEEN THE SEPTEMBER 2017 MARS GLOBAL AURORA EVENT AND CRUSTAL MAGNETIC FIELDS
Nasr, Camella-Rosa; Schneider, Nick; Connour, Kyle; Jain, Sonal; Deighan, Justin; Jakosky, Bruce; MAVEN/IUVS Team
2018-01-01
In September 2017, the Imaging UltraViolet Spectrograph (IUVS) on the MAVEN spacecraft observed global aurora on Mars caused by a surprisingly strong solar energetic particle event. Widespread “diffuse aurora” have previously been detected on Mars through more limited observations (Schneider et al., Science 350, (2015); DOI: 10.1126/science.aad0313), but recent observations established complete coverage of the observable portion of Mars’ nightside. The aurora was global due to Mars’s lack of a global magnetic field, which allowed energetic electrons from the Sun to directly precipitate into the atmosphere. On September 11th, IUVS detected aurora more than 25 times brighter than any prior IUVS observation, with high SNR detections of aurora at the limb and against the disk of the planet. Fainter auroral emission was seen around the nightside limb over 13 orbits spanning nearly 3 days.On September 14th, during the declining phase of the event, faint linear features and patches were detected by the spacecraft, which were higher than the noise floor, with a similar spatial distribution to “discrete aurora” patches observed on Mars by the SPICAM instrument on the Mars Express spacecraft (Bertaux et al., Nature 435, doi :10.1038/nature03603). Discrete aurora occur near areas of the crust affected by the magnetism left over from Mars’ once-strong dipole field. Emission is limited to regions of the crustal magnetic field where the field lines are likely to be open to solar wind interactions. Those regions are concentrated in Mars’ southern hemisphere centered on 180 degrees east longitude.We studied the localized emissions on 14 September to determine whether there might be a connection between the observed diffuse aurora event and discrete auroral processes. First, we investigated the localized emissions to confirm that the observed signal was consistent with expected auroral spectra. Second, their locations were projected on a map of the crustal magnetic
Desjardin, Marie; Roman, Sabine; des Varannes, Stanislas Bruley; Gourcerol, Guillaume; Coffin, Benoit; Ropert, Alain; Mion, François
2013-01-01
Background Pharyngeal pH probes and pH-impedance catheters have been developed for the diagnosis of laryngo-pharyngeal reflux. Objective To determine the reliability of pharyngeal pH alone for the detection of pharyngeal reflux events. Methods 24-h pH-impedance recordings performed in 45 healthy subjects with a bifurcated probe for detection of pharyngeal and oesophageal reflux events were reviewed. Pharyngeal pH drops to below 4 and 5 were analysed for the simultaneous occurrence of pharyngeal reflux, gastro-oesophageal reflux, and swallows, according to impedance patterns. Results Only 7.0% of pharyngeal pH drops to below 5 identified with impedance corresponded to pharyngeal reflux, while 92.6% were related to swallows and 10.2 and 13.3% were associated with proximal and distal gastro-oesophageal reflux events, respectively. Of pharyngeal pH drops to below 4, 13.2% were related to pharyngeal reflux, 87.5% were related to swallows, and 18.1 and 21.5% were associated with proximal and distal gastro-oesophageal reflux events, respectively. Conclusions This study demonstrates that pharyngeal pH alone is not reliable for the detection of pharyngeal reflux and that adding distal oesophageal pH analysis is not helpful. The only reliable analysis should take into account impedance patterns demonstrating the presence of pharyngeal reflux event preceded by a distal and proximal reflux event within the oesophagus. PMID:24917995
Disk Detective: Discovery of New Circumstellar Disk Candidates through Citizen Science
Kuchner, Marc J.; Silverberg, Steven M.; Bans, Alissa S.; Bhattacharjee, Shambo; Kenyon, Scott J.; Debes, John H.; Currie, Thayne; Garcia, Luciano; Jung, Dawoon; Lintott, Chris; McElwain, Michael; Padgett, Deborah L.; Rebull, Luisa M.; Wisniewski, John P.; Nesvold, Erika
2016-01-01
The Disk Detective citizen science project aims to find new stars with 22 μm excess emission from circumstellar dust using data from NASA's Wide-field Infrared Survey Explorer (WISE) mission. Initial cuts on the AllWISE catalog provide an input catalog of 277,686 sources. Volunteers then view images of each source online in 10 different bands to identify false positives (galaxies, interstellar matter, image artifacts, etc.). Sources that survive this online vetting are followed up with spectr...
Schwind, Jessica S; Norman, Stephanie A; Karmacharya, Dibesh; Wolking, David J; Dixit, Sameer M; Rajbhandari, Rajesh M; Mekaru, Sumiko R; Brownstein, John S
2017-09-21
Traditional media and the internet are crucial sources of health information. Media can significantly shape public opinion, knowledge and understanding of emerging and endemic health threats. As digital communication rapidly progresses, local access and dissemination of health information contribute significantly to global disease detection and reporting. Health event reports in Nepal (October 2013-December 2014) were used to characterize Nepal's media environment from a One Health perspective using HealthMap - a global online disease surveillance and mapping tool. Event variables (location, media source type, disease or risk factor of interest, and affected species) were extracted from HealthMap. A total of 179 health reports were captured from various sources including newspapers, inter-government agency bulletins, individual reports, and trade websites, yielding 108 (60%) unique articles. Human health events were reported most often (n = 85; 79%), followed by animal health events (n = 23; 21%), with no reports focused solely on environmental health. By expanding event coverage across all of the health sectors, media in developing countries could play a crucial role in national risk communication efforts and could enhance early warning systems for disasters and disease outbreaks.
Directory of Open Access Journals (Sweden)
Sangeet eKhemlani
2015-10-01
Full Text Available We describe a novel computational theory of how individuals segment perceptual information into representations of events. The theory is inspired by recent findings in the cognitive science and cognitive neuroscience of event segmentation. In line with recent theories, it holds that online event segmentation is automatic, and that event segmentation yields mental simulations of events. But it posits two novel principles as well: first, discrete episodic markers track perceptual and conceptual changes, and can be retrieved to construct event models. Second, the process of retrieving and reconstructing those episodic markers is constrained and prioritized. We describe a computational implementation of the theory, as well as a robotic extension of the theory that demonstrates the processes of online event segmentation and event model construction. The theory is the first unified computational account of event segmentation and temporal inference. We conclude by demonstrating now neuroimaging data can constrain and inspire the construction of process-level theories of human reasoning.
Maximum Redshift of Gravitational Wave Merger Events
Koushiappas, Savvas M.; Loeb, Abraham
2017-12-01
Future generations of gravitational wave detectors will have the sensitivity to detect gravitational wave events at redshifts far beyond any detectable electromagnetic sources. We show that if the observed event rate is greater than one event per year at redshifts z ≥40 , then the probability distribution of primordial density fluctuations must be significantly non-Gaussian or the events originate from primordial black holes. The nature of the excess events can be determined from the redshift distribution of the merger rate.
Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L
2015-08-10
The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.
Chen, Xiaoyun; Wang, Xiaofu; Jin, Nuo; Zhou, Yu; Huang, Sainan; Miao, Qingmei; Zhu, Qing; Xu, Junfeng
2012-11-07
Genetically modified (GM) rice KMD1, TT51-1, and KF6 are three of the most well known transgenic Bt rice lines in China. A rapid and sensitive molecular assay for risk assessment of GM rice is needed. Polymerase chain reaction (PCR), currently the most common method for detecting genetically modified organisms, requires temperature cycling and relatively complex procedures. Here we developed a visual and rapid loop-mediated isothermal amplification (LAMP) method to amplify three GM rice event-specific junction sequences. Target DNA was amplified and visualized by two indicators (SYBR green or hydroxy naphthol blue [HNB]) within 60 min at an isothermal temperature of 63 °C. Different kinds of plants were selected to ensure the specificity of detection and the results of the non-target samples were negative, indicating that the primer sets for the three GM rice varieties had good levels of specificity. The sensitivity of LAMP, with detection limits at low concentration levels (0.01%−0.005% GM), was 10- to 100-fold greater than that of conventional PCR. Additionally, the LAMP assay coupled with an indicator (SYBR green or HNB) facilitated analysis. These findings revealed that the rapid detection method was suitable as a simple field-based test to determine the status of GM crops.
Directory of Open Access Journals (Sweden)
Qing Zhu
2012-11-01
Full Text Available Genetically modified (GM rice KMD1, TT51-1, and KF6 are three of the most well known transgenic Bt rice lines in China. A rapid and sensitive molecular assay for risk assessment of GM rice is needed. Polymerase chain reaction (PCR, currently the most common method for detecting genetically modified organisms, requires temperature cycling and relatively complex procedures. Here we developed a visual and rapid loop-mediated isothermal amplification (LAMP method to amplify three GM rice event-specific junction sequences. Target DNA was amplified and visualized by two indicators (SYBR green or hydroxy naphthol blue [HNB] within 60 min at an isothermal temperature of 63 °C. Different kinds of plants were selected to ensure the specificity of detection and the results of the non-target samples were negative, indicating that the primer sets for the three GM rice varieties had good levels of specificity. The sensitivity of LAMP, with detection limits at low concentration levels (0.01%–0.005% GM, was 10- to 100-fold greater than that of conventional PCR. Additionally, the LAMP assay coupled with an indicator (SYBR green or HNB facilitated analysis. These findings revealed that the rapid detection method was suitable as a simple field-based test to determine the status of GM crops.
PROSPECTS FOR THE DETECTION OF FAST RADIO BURSTS WITH THE MURCHISON WIDEFIELD ARRAY
Energy Technology Data Exchange (ETDEWEB)
Trott, Cathryn M.; Tingay, Steven J.; Wayth, Randall B., E-mail: cathryn.trott@curtin.edu.au [International Centre for Radio Astronomy Research, Curtin University, Bentley WA 6845 (Australia)
2013-10-10
Fast radio bursts (FRBs) are short timescale (<<1 s) astrophysical radio signals, presumed to be a signature of cataclysmic events of extragalactic origin. The discovery of six high-redshift events at ∼1400 MHz from the Parkes radio telescope suggests that FRBs may occur at a high rate across the sky. The Murchison Widefield Array (MWA) operates at low radio frequencies (80-300 MHz) and is expected to detect FRBs due to its large collecting area (∼2500 m{sup 2}) and wide field-of-view (FOV, ∼ 1000 deg{sup 2} at ν = 200 MHz). We compute the expected number of FRB detections for the MWA assuming a source population consistent with the reported detections. Our formalism properly accounts for the frequency-dependence of the antenna primary beam, the MWA system temperature, and unknown spectral index of the source population, for three modes of FRB detection: coherent; incoherent; and fast imaging. We find that the MWA's sensitivity and large FOV combine to provide the expectation of multiple detectable events per week in all modes, potentially making it an excellent high time resolution science instrument. Deviations of the expected number of detections from actual results will provide a strong constraint on the assumptions made for the underlying source population and intervening plasma distribution.
Prospects for the Detection of Fast Radio Bursts with the Murchison Widefield Array
Trott, Cathryn M.; Tingay, Steven J.; Wayth, Randall B.
2013-10-01
Fast radio bursts (FRBs) are short timescale (Lt1 s) astrophysical radio signals, presumed to be a signature of cataclysmic events of extragalactic origin. The discovery of six high-redshift events at ~1400 MHz from the Parkes radio telescope suggests that FRBs may occur at a high rate across the sky. The Murchison Widefield Array (MWA) operates at low radio frequencies (80-300 MHz) and is expected to detect FRBs due to its large collecting area (~2500 m2) and wide field-of-view (FOV, ~ 1000 deg2 at ν = 200 MHz). We compute the expected number of FRB detections for the MWA assuming a source population consistent with the reported detections. Our formalism properly accounts for the frequency-dependence of the antenna primary beam, the MWA system temperature, and unknown spectral index of the source population, for three modes of FRB detection: coherent; incoherent; and fast imaging. We find that the MWA's sensitivity and large FOV combine to provide the expectation of multiple detectable events per week in all modes, potentially making it an excellent high time resolution science instrument. Deviations of the expected number of detections from actual results will provide a strong constraint on the assumptions made for the underlying source population and intervening plasma distribution.
Event generators for address event representation transmitters
Serrano-Gotarredona, Rafael; Serrano-Gotarredona, Teresa; Linares Barranco, Bernabe
2005-06-01
Address Event Representation (AER) is an emergent neuromorphic interchip communication protocol that allows for real-time virtual massive connectivity between huge number neurons located on different chips. By exploiting high speed digital communication circuits (with nano-seconds timings), synaptic neural connections can be time multiplexed, while neural activity signals (with mili-seconds timings) are sampled at low frequencies. Also, neurons generate 'events' according to their activity levels. More active neurons generate more events per unit time, and access the interchip communication channel more frequently, while neurons with low activity consume less communication bandwidth. In a typical AER transmitter chip, there is an array of neurons that generate events. They send events to a peripheral circuitry (let's call it "AER Generator") that transforms those events to neurons coordinates (addresses) which are put sequentially on an interchip high speed digital bus. This bus includes a parallel multi-bit address word plus a Rqst (request) and Ack (acknowledge) handshaking signals for asynchronous data exchange. There have been two main approaches published in the literature for implementing such "AER Generator" circuits. They differ on the way of handling event collisions coming from the array of neurons. One approach is based on detecting and discarding collisions, while the other incorporates arbitration for sequencing colliding events . The first approach is supposed to be simpler and faster, while the second is able to handle much higher event traffic. In this article we will concentrate on the second arbiter-based approach. Boahen has been publishing several techniques for implementing and improving the arbiter based approach. Originally, he proposed an arbitration squeme by rows, followed by a column arbitration. In this scheme, while one neuron was selected by the arbiters to transmit his event out of the chip, the rest of neurons in the array were
Expanding the Universe of "Astronomy on Tap" Public Outreach Events
Rice, Emily L.; Levine, Brian; Livermore, Rachael C.; Silverman, Jeffrey M.; LaMassa, Stephanie M.; Tyndall, Amy; Muna, Demitri; Garofali, Kristen; Morris, Brett; Byler, Nell; Fyhrie, Adalyn; Rehnberg, Morgan; Hart, Quyen N.; Connelly, Jennifer L.; Silvia, Devin W.; Morrison, Sarah J.; Agarwal, Bhaskar; Tremblay, Grant; Schwamb, Megan E.
2016-01-01
Astronomy on Tap (AoT, astronomyontap.org) is free public outreach event featuring engaging science presentations in bars, often combined with music, games, and prizes, to encourage a fun, interactive atmosphere. AoT events feature several short astronomy-related presentations primarily by local professional scientists, but also by visiting scientists, students, educators, amatuer astronomers, writers, and artists. Events are held in social venues (bars, coffee shops, art galleries, etc.) in order to bring science directly to the public in a relaxed, informal atmosphere. With this we hope to engage a more diverse audience than typical lectures at academic and cultural institutions and to develop enthusiasm for science among voting, tax-paying adults. The flexible format and content of an AoT event is easy to adapt and expand based on the priorities, resources, and interests of local organizers. The social nature of AoT events provides important professional development and networking opportunities in science communication. Since the first New York City event in April 2013, Astronomy on Tap has expanded to more than ten cities globally, including monthly events in NYC, Austin, Seattle, and Tucson; semi-regular events in Columbus, New Haven, Santiago, Toronto, and Denver; occasional (so far) events in Rochester (NY), Baltimore, Lansing, and Washington, DC; and one-off events in Chicago and Taipei. Several venues regularly attract audiences of over 200 people. We have received media coverage online, in print, and occasionally even on radio and television. In this poster we describe the overarching goals and characteristics of AoT events, distinct adaptations of various locations, resources we have developed, and the methods we use to coordinate among the worldwide local organizers.
2001-01-01
Last year, the first Science Night attracted nearly 1500 people. Dipping into history for the space of one night? This is the idea of Geneva's Museum of the History of Science, which is organizing its second Science Night, on 7 and 8 July, on the history of science. The first such event, held last year, was a considerable success with almost 15 000 visitors. The second Science Night, to be held in the magnificent setting of the Perle du Lac Park in Geneva, promises to be a winner too. By making science retell its own history, this major event is intended to show how every scientific and technical breakthrough is the culmination of a long period of growth that began hundreds of years in the past. Dozens of activities and events are included in this programme of time travel: visitors can study the night sky through telescopes and see what Galileo first observed, and then go to see a play on the life of the Italian scientist. Another play, commissioned specially for the occasion, will honour Geneva botanist De ...
Banerjee, Torsha
Detection (PERD) for WSNs. When a single event occurs, a child of the tree sends a Flagged Polynomial (FP) to its parent, if the readings approximated by it falls outside the data range defining the existing phenomenon. After the aggregation process is over, the root having the two polynomials, P and FP can be queried for FP (approximating the new event region) instead of flooding the whole network. For multiple such events, instead of computing a polynomial corresponding to each new event, areas with same data range are combined by the corresponding tree nodes and the aggregated coefficients are passed on. Results reveal that a new event can be detected by PERD while error in detection remains constant and is less than a threshold of 10%. As the node density increases, accuracy and delay for event detection are found to remain almost constant, making PERD highly scalable. Whenever an event occurs in a WSN, data is generated by closeby sensors and relaying the data to the base station (BS) make sensors closer to the BS run out of energy at a much faster rate than sensors in other parts of the network. This gives rise to an unequal distribution of residual energy in the network and makes those sensors with lower remaining energy level die at much faster rate than others. We propose a scheme for enhancing network Lifetime using mobile cluster heads (CH) in a WSN. To maintain remaining energy more evenly, some energy-rich nodes are designated as CHs which move in a controlled manner towards sensors rich in energy and data. This eliminates multihop transmission required by the static sensors and thus increases the overall lifetime of the WSN. We combine the idea of clustering and mobile CH to first form clusters of static sensor nodes. A collaborative strategy among the CHs further increases the lifetime of the network. Time taken for transmitting data to the BS is reduced further by making the CHs follow a connectivity strategy that always maintain a connected path to the BS
DETECTION OF FAST TRANSIENTS WITH RADIO INTERFEROMETRIC ARRAYS
International Nuclear Information System (INIS)
Bhat, N. D. R.; Chengalur, J. N.; Gupta, Y.; Prasad, J.; Roy, J.; Kudale, S. S.; Cox, P. J.; Bailes, M.; Burke-Spolaor, S.; Van Straten, W.
2013-01-01
Next-generation radio arrays, including the Square Kilometre Array (SKA) and its pathfinders, will open up new avenues for exciting transient science at radio wavelengths. Their innovative designs, comprising a large number of small elements, pose several challenges in digital processing and optimal observing strategies. The Giant Metre-wave Radio Telescope (GMRT) presents an excellent test-bed for developing and validating suitable observing modes and strategies for transient experiments with future arrays. Here we describe the first phase of the ongoing development of a transient detection system for GMRT that is planned to eventually function in a commensal mode with other observing programs. It capitalizes on the GMRT's interferometric and sub-array capabilities, and the versatility of a new software backend. We outline considerations in the plan and design of transient exploration programs with interferometric arrays, and describe a pilot survey that was undertaken to aid in the development of algorithms and associated analysis software. This survey was conducted at 325 and 610 MHz, and covered 360 deg 2 of the sky with short dwell times. It provides large volumes of real data that can be used to test the efficacies of various algorithms and observing strategies applicable for transient detection. We present examples that illustrate the methodologies of detecting short-duration transients, including the use of sub-arrays for higher resilience to spurious events of terrestrial origin, localization of candidate events via imaging, and the use of a phased array for improved signal detection and confirmation. In addition to demonstrating applications of interferometric arrays for fast transient exploration, our efforts mark important steps in the roadmap toward SKA-era science.
Detection of Fast Transients with Radio Interferometric Arrays
Bhat, N. D. R.; Chengalur, J. N.; Cox, P. J.; Gupta, Y.; Prasad, J.; Roy, J.; Bailes, M.; Burke-Spolaor, S.; Kudale, S. S.; van Straten, W.
2013-05-01
Next-generation radio arrays, including the Square Kilometre Array (SKA) and its pathfinders, will open up new avenues for exciting transient science at radio wavelengths. Their innovative designs, comprising a large number of small elements, pose several challenges in digital processing and optimal observing strategies. The Giant Metre-wave Radio Telescope (GMRT) presents an excellent test-bed for developing and validating suitable observing modes and strategies for transient experiments with future arrays. Here we describe the first phase of the ongoing development of a transient detection system for GMRT that is planned to eventually function in a commensal mode with other observing programs. It capitalizes on the GMRT's interferometric and sub-array capabilities, and the versatility of a new software backend. We outline considerations in the plan and design of transient exploration programs with interferometric arrays, and describe a pilot survey that was undertaken to aid in the development of algorithms and associated analysis software. This survey was conducted at 325 and 610 MHz, and covered 360 deg2 of the sky with short dwell times. It provides large volumes of real data that can be used to test the efficacies of various algorithms and observing strategies applicable for transient detection. We present examples that illustrate the methodologies of detecting short-duration transients, including the use of sub-arrays for higher resilience to spurious events of terrestrial origin, localization of candidate events via imaging, and the use of a phased array for improved signal detection and confirmation. In addition to demonstrating applications of interferometric arrays for fast transient exploration, our efforts mark important steps in the roadmap toward SKA-era science.
Ibrahim, Ichsan; Malasan, Hakim L.; Kunjaya, Chatief; Timur Jaelani, Anton; Puannandra Putri, Gerhana; Djamal, Mitra
2018-04-01
In astronomy, the brightness of a source is typically expressed in terms of magnitude. Conventionally, the magnitude is defined by the logarithm of received flux. This relationship is known as the Pogson formula. For received flux with a small signal to noise ratio (S/N), however, the formula gives a large magnitude error. We investigate whether the use of Inverse Hyperbolic Sine function (hereafter referred to as the Asinh magnitude) in the modified formulae could allow for an alternative calculation of magnitudes for small S/N flux, and whether the new approach is better for representing the brightness of that region. We study the possibility of increasing the detection level of gravitational microlensing using 40 selected microlensing light curves from the 2013 and 2014 seasons and by using the Asinh magnitude. Photometric data of the selected events are obtained from the Optical Gravitational Lensing Experiment (OGLE). We found that utilization of the Asinh magnitude makes the events brighter compared to using the logarithmic magnitude, with an average of about 3.42 × 10‑2 magnitude and an average in the difference of error between the logarithmic and the Asinh magnitude of about 2.21 × 10‑2 magnitude. The microlensing events OB140847 and OB140885 are found to have the largest difference values among the selected events. Using a Gaussian fit to find the peak for OB140847 and OB140885, we conclude statistically that the Asinh magnitude gives better mean squared values of the regression and narrower residual histograms than the Pogson magnitude. Based on these results, we also attempt to propose a limit in magnitude value for which use of the Asinh magnitude is optimal with small S/N data.
Science Hack Day uses CMS data
Katerina Sandoval
2012-01-01
Science Hack events: a new way for scientists, designers and other techno-savvy people to interact. The most recent Science Hack Day was held in San Francisco and with it the CMS collaboration found an original and simple way to present its data. Science Hack events: a new way for scientists, designers and other techno-savvy people to interact. The most recent Science Hack Day was held in San Francisco and with it the CMS collaboration found an original and simple way to present its data. Participants in the CMS hack event. (Photo credit: Morris Mwanga.) First of all, you need to know what “hack” means. A hack is a quick solution to a problem, often the cleverest one if not the most elegant. So, a Science Hack Day is a 48-hour all-night event that brings together “hackers” to create innovative solutions to scientific problems. This year’s event was held in San Francisco from 12 to 13 November and was a huge success! It hosted around 150 s...
First events from the CNGS neutrino beam detected in the OPERA experiment
Acquafredda, R.; Ambrosio, M.; Anokhina, A.; Aoki, S.; Ariga, A.; Arrabito, L.; Autiero, D.; Badertscher, A.; Bergnoli, A.; Bersani Greggio, F.; Besnier, M.; Beyer, M.; Bondil-Blin, S.; Borer, K.; Boucrot, J.; Boyarkin, V.; Bozza, C.; Brugnera, R.; Buontempo, S.; Caffari, Y.; Campagne, Jean-Eric; Carlus, B.; Carrara, E.; Cazes, A.; Chaussard, L.; Chernyavsky, M.; Chiarella, V.; Chon-Sen, N.; Chukanov, A.; Ciesielski, R.; Consiglio, L.; Cozzi, M.; Dal Corso, F.; D'Ambrosio, N.; Damet, J.; De Lellis, G.; Declais, Y.; Descombes, T.; De Serio, M.; Di Capua, F.; Di Ferdinando, D.; Di Giovanni, A.; Di Marco, N.; Di Troia, C.; Dmitrievski, S.; Dracos, M.; Duchesneau, D.; Dulach, B.; Dusini, S.; Ebert, J.; Enikeev, R.; Ereditato, A.; Esposito, L.S.; Fanin, C.; Favier, J.; Felici, G.; Ferber, T.; Fournier, L.; Franceschi, A.; Frekers, D.; Fukuda, T.; Fukushima, C.; Galkin, V.I.; Galkin, V.A.; Gallet, R.; Garfagnini, A.; Gaudiot, G.; Giacomelli, G.; Giarmana, O.; Giorgini, M.; Girard, L.; Girerd, C.; Goellnitz, C.; Goldberg, J.; Gornoushkin, Y.; Grella, G.; Grianti, F.; Guerin, C.; Guler, M.; Gustavino, C.; Hagner, C.; Hamane, T.; Hara, T.; Hauger, M.; Hess, M.; Hoshino, K.; Ieva, M.; Incurvati, M.; Jakovcic, K.; Janicsko Csathy, J.; Janutta, B.; Jollet, C.; Juget, F.; Kazuyama, M.; Kim, S.H.; Kimura, M.; Knuesel, J.; Kodama, K.; Kolev, D.; Komatsu, M.; Kose, U.; Krasnoperov, A.; Kreslo, I.; Krumstein, Z.; Laktineh, I.; de La Taille, C.; Le Flour, T.; Lieunard, S.; Ljubicic, A.; Longhin, A.; Malgin, A.; Manai, K.; Mandrioli, G.; Mantello, U.; Marotta, A.; Marteau, J.; Martin-Chassard, G.; Matveev, V.; Messina, M.; Meyer, L.; Micanovic, S.; Migliozzi, P.; Miyamoto, S.; Monacelli, Piero; Monteiro, I.; Morishima, K.; Moser, U.; Muciaccia, M.T.; Mugnier, P.; Naganawa, N.; Nakamura, M.; Nakano, T.; Napolitano, T.; Natsume, M.; Niwa, K.; Nonoyama, Y.; Nozdrin, A.; Ogawa, S.; Olchevski, A.; Orlandi, D.; Ossetski, D.; Paoloni, A.; Park, B.D.; Park, I.G.; Pastore, A.; Patrizii, L.; Pellegrino, L.; Pessard, H.; Pilipenko, V.; Pistillo, C.; Polukhina, N.; Pozzato, M.; Pretzl, K.; Publichenko, P.; Raux, L.; Repellin, J.P.; Roganova, T.; Romano, G.; Rosa, G.; Rubbia, A.; Ryasny, V.; Ryazhskaya, O.; Ryzhikov, D.; Sadovski, A.; Sanelli, C.; Sato, O.; Sato, Y.; Saveliev, V.; Savvinov, N.; Sazhina, G.; Schembri, A.; Schmidt Parzefall, W.; Schroeder, H.; Schutz, H.U.; Scotto Lavina, L.; Sewing, J.; Shibuya, H.; Simone, S.; Sioli, M.; Sirignano, C.; Sirri, G.; Song, J.S.; Spaeti, R.; Spinetti, M.; Stanco, L.; Starkov, N.; Stipcevic, M.; Strolin, Paolo Emilio; Sugonyaev, V.; Takahashi, S.; Tereschenko, V.; Terranova, F.; Tezuka, I.; Tioukov, V.; Tikhomirov, I.; Tolun, P.; Toshito, T.; Tsarev, V.; Tsenov, R.; Ugolino, U.; Ushida, N.; Van Beek, G.; Verguilov, V.; Vilain, P.; Votano, L.; Vuilleumier, J.L.; Waelchli, T.; Waldi, R.; Weber, M.; Wilquet, G.; Wonsak, B.; Wurth, R.; Wurtz, J.; Yakushev, V.; Yoon, C.S.; Zaitsev, Y.; Zamboni, I.; Zimmerman, R.
2006-01-01
The OPERA neutrino detector at the underground Gran Sasso Laboratory (LNGS) was designed to perform the first detection of neutrino oscillations in appearance mode, through the study of nu_mu to nu_tau oscillations. The apparatus consists of a lead/emulsion-film target complemented by electronic detectors. It is placed in the high-energy, long-baseline CERN to LNGS beam (CNGS) 730 km away from the neutrino source. In August 2006 a first run with CNGS neutrinos was successfully conducted. A first sample of neutrino events was collected, statistically consistent with the integrated beam intensity. After a brief description of the beam and of the various sub-detectors, we report on the achievement of this milestone, presenting the first data and some analysis results.
Multi-sensor radiation detection, imaging, and fusion
Energy Technology Data Exchange (ETDEWEB)
Vetter, Kai [Department of Nuclear Engineering, University of California, Berkeley, CA 94720 (United States); Nuclear Science Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)
2016-01-01
Glenn Knoll was one of the leaders in the field of radiation detection and measurements and shaped this field through his outstanding scientific and technical contributions, as a teacher, his personality, and his textbook. His Radiation Detection and Measurement book guided me in my studies and is now the textbook in my classes in the Department of Nuclear Engineering at UC Berkeley. In the spirit of Glenn, I will provide an overview of our activities at the Berkeley Applied Nuclear Physics program reflecting some of the breadth of radiation detection technologies and their applications ranging from fundamental studies in physics to biomedical imaging and to nuclear security. I will conclude with a discussion of our Berkeley Radwatch and Resilient Communities activities as a result of the events at the Dai-ichi nuclear power plant in Fukushima, Japan more than 4 years ago. - Highlights: • .Electron-tracking based gamma-ray momentum reconstruction. • .3D volumetric and 3D scene fusion gamma-ray imaging. • .Nuclear Street View integrates and associates nuclear radiation features with specific objects in the environment. • Institute for Resilient Communities combines science, education, and communities to minimize impact of disastrous events.
Public Lectures | Events | Indian Academy of Sciences
Indian Academy of Sciences (India)
Sustainable materials based on aliphatic polyesters: Teaching old chemistry some new tricks. S. Sivaram ..... Planning for science and technology and its relevance to national security ... The world of elementary particles - Past and future
The necessity of recognizing all events in X-ray detection.
Papp, T; Maxwell, J A; Papp, A T
2010-01-01
In our work in studying properties of inner shell ionization, we are troubled that the experimental data used to determine the basic parameters of X-ray physics have a large and unexplainable scatter. As we looked into the problems we found that many of them contradict simple logic, elemental arithmetic, even parity and angular momentum conservation laws. We have identified that the main source of the problems, other than the human factor, is rooted in the signal processing electronics. To overcome these problems we have developed a fully digital signal processor, which not only has excellent resolution and line shape, but also allows proper accounting of all events. This is achieved by processing all events and separating them into two or more spectra (maximum 16), where the first spectrum is the accepted or good spectrum and the second spectrum is the spectrum of all rejected events. The availability of all the events allows one to see the other part of the spectrum. To our surprise the total information explains many of the shortcomings and contradictions of the X-ray database. The data processing methodology cannot be established on the partial and fractional information offered by other approaches. Comparing Monte Carlo detector modeling results with the partial spectra is ambiguous. It suggests that the metrology of calibration by radioactive sources as well as other X-ray measurements could be improved by the availability of the proper accounting of all events. It is not enough to know that an event was rejected and increment the input counter, it is necessary to know, what was rejected and why it happened, whether it was a noise or a disturbed event, a retarded event or a true event, or any pile up combination of these events. Such information is supplied by our processor reporting the events rejected by each discriminator in separate spectra. Several industrial applications of this quality assurance capable signal processor are presented. Copyright 2009
A power filter for the detection of burst events based on time-frequency spectrum estimation
International Nuclear Information System (INIS)
Guidi, G M; Cuoco, E; Vicere, A
2004-01-01
We propose as a statistic for the detection of bursts in a gravitational wave interferometer the 'energy' of the events estimated with a time-dependent calculation of the spectrum. This statistic has an asymptotic Gaussian distribution with known statistical moments, which makes it possible to perform a uniformly most powerful test (McDonough R N and Whalen A D 1995 Detection of Signals in Noise (New York: Academic)) on the energy mean. We estimate the receiver operating characteristic (ROC, from the same book) of this statistic for different levels of the signal-to-noise ratio in the specific case of a simulated noise having the spectral density expected for Virgo, using test signals taken from a library of possible waveforms emitted during the collapse of the core of type II supernovae
Science Outreach for the Thousands: Coe College's Playground of Science
Watson, D. E.; Franke, M.; Affatigato, M.; Feller, S.
2011-12-01
Coe College is a private liberal arts college nestled in the northeast quadrant of Cedar Rapids, IA. Coe takes pride in the outreach it does in the local community. The sciences at Coe find enjoyment in educating the children and families of this community through a diverse set of venues; from performing science demonstrations for children at Cedar Rapids' Fourth of July Freedom Festival to hosting summer forums and talks to invigorate the minds of its more mature audiences. Among these events, the signature event of the year is the Coe Playground of Science. On the last Thursday of October, before Halloween, the science departments at Coe invite nearly two thousand children from pre elementary to high school ages, along with their parents to participate in a night filled with science demos, haunted halls, and trick-or-treating for more than just candy. The demonstrations are performed by professors and students alike from a raft of cooperative departments including physics, chemistry, biology, math, computer science, nursing, ROTC, and psychology. This event greatly strengthens the relationships between institution members and community members. The sciences at Coe understand the importance of imparting the thrill and hunger for exploration and discovery into the future generations. More importantly they recognize that this cannot start and end at the collegiate level, but the American public must be reached at younger ages and continue to be encouraged beyond the college experience. The Playground of Science unites these two groups under the common goal of elevating scientific interest in the American people.
Unbeck, Maria; Schildmeijer, Kristina; Henriksson, Peter; Jürgensen, Urban; Muren, Olav; Nilsson, Lena; Pukk Härenstam, Karin
2013-04-15
There has been a theoretical debate as to which retrospective record review method is the most valid, reliable, cost efficient and feasible for detecting adverse events. The aim of the present study was to evaluate the feasibility and capability of two common retrospective record review methods, the "Harvard Medical Practice Study" method and the "Global Trigger Tool" in detecting adverse events in adult orthopaedic inpatients. We performed a three-stage structured retrospective record review process in a random sample of 350 orthopaedic admissions during 2009 at a Swedish university hospital. Two teams comprised each of a registered nurse and two physicians were assigned, one to each method. All records were primarily reviewed by registered nurses. Records containing a potential adverse event were forwarded to physicians for review in stage 2. Physicians made an independent review regarding, for example, healthcare causation, preventability and severity. In the third review stage all adverse events that were found with the two methods together were compared and all discrepancies after review stage 2 were analysed. Events that had not been identified by one of the methods in the first two review stages were reviewed by the respective physicians. Altogether, 160 different adverse events were identified in 105 (30.0%) of the 350 records with both methods combined. The "Harvard Medical Practice Study" method identified 155 of the 160 (96.9%, 95% CI: 92.9-99.0) adverse events in 104 (29.7%) records compared with 137 (85.6%, 95% CI: 79.2-90.7) adverse events in 98 (28.0%) records using the "Global Trigger Tool". Adverse events "causing harm without permanent disability" accounted for most of the observed difference. The overall positive predictive value for criteria and triggers using the "Harvard Medical Practice Study" method and the "Global Trigger Tool" was 40.3% and 30.4%, respectively. More adverse events were identified using the "Harvard Medical Practice Study
Sanger, Denise; Hernandez, Debra; Libes, Susan; Voulgaris, George; Davis, Braxton; Smith, Erik; Shuford, Rebecca; Porter, Dwayne; Koepfler, Eric; Bennett, Joseph
2010-09-01
Communication of knowledge between the scientific and management communities is a difficult process complicated by the distinctive nature of professional career goals of scientists and decision-makers. This article provides a case history highlighting a collaboration between the science and management communities that resulted from a response to a 2004 hypoxia, or low dissolved oxygen, event in Long Bay, off Myrtle Beach, South Carolina. A working group of scientists and decision-makers was established at the time of the event and has continued to interact to develop a firm understanding of the drivers responsible for hypoxia formation in Long Bay. Several factors were found to be important to ensure that these collaborative efforts were productive: (1) genuine interest in collaboratively working across disciplines to examine a problem; (2) commitment by agency leadership, decision-makers, and researchers to create successful communication mechanisms; (3) respect for each others’ perspectives and an understanding how science and management are performed and that they are not mutually exclusive; (4) networking among researchers and decision-makers to ensure appropriate team members are involved in the process; (5) use of decision-maker input in the formulation of research and monitoring projects; and (6) commitment of resources for facilitation to ensure that researchers and decision-makers are communicating effectively.
Garde, Ainara; Dehkordi, Parastoo; Wensley, David; Ansermino, J Mark; Dumont, Guy A
2015-01-01
Obstructive sleep apnea (OSA) disrupts normal ventilation during sleep and can lead to serious health problems in children if left untreated. Polysomnography, the gold standard for OSA diagnosis, is resource intensive and requires a specialized laboratory. Thus, we proposed to use the Phone Oximeter™, a portable device integrating pulse oximetry with a smartphone, to detect OSA events. As a proportion of OSA events occur without oxygen desaturation (defined as SpO2 decreases ≥ 3%), we suggest combining SpO2 and pulse rate variability (PRV) analysis to identify all OSA events and provide a more detailed sleep analysis. We recruited 160 children and recorded pulse oximetry consisting of SpO2 and plethysmography (PPG) using the Phone Oximeter™, alongside standard polysomnography. A sleep technician visually scored all OSA events with and without oxygen desaturation from polysomnography. We divided pulse oximetry signals into 1-min signal segments and extracted several features from SpO2 and PPG analysis in the time and frequency domain. Segments with OSA, especially the ones with oxygen desaturation, presented greater SpO2 variability and modulation reflected in the spectral domain than segments without OSA. Segments with OSA also showed higher heart rate and sympathetic activity through the PRV analysis relative to segments without OSA. PRV analysis was more sensitive than SpO2 analysis for identification of OSA events without oxygen desaturation. Combining SpO2 and PRV analysis enhanced OSA event detection through a multiple logistic regression model. The area under the ROC curve increased from 81% to 87%. Thus, the Phone Oximeter™ might be useful to monitor sleep and identify OSA events with and without oxygen desaturation at home.
Kushida, N.; Kebede, F.; Feitio, P.; Le Bras, R.
2016-12-01
The Preparatory Commission for the Comprehensive Nuclear-Test-Ban Treaty Organization (CTBTO) has been developing and testing NET-VISA (Arora et al., 2013), a Bayesian automatic event detection and localization program, and evaluating its performance in a realistic operational mode. In our preliminary testing at the CTBTO, NET-VISA shows better performance than its currently operating automatic localization program. However, given CTBTO's role and its international context, a new technology should be introduced cautiously when it replaces a key piece of the automatic processing. We integrated the results of NET-VISA into the Analyst Review Station, extensively used by the analysts so that they can check the accuracy and robustness of the Bayesian approach. We expect the workload of the analysts to be reduced because of the better performance of NET-VISA in finding missed events and getting a more complete set of stations than the current system which has been operating for nearly twenty years. The results of a series of tests indicate that the expectations born from the automatic tests, which show an overall overlap improvement of 11%, meaning that the missed events rate is cut by 42%, hold for the integrated interactive module as well. New events are found by analysts, which qualify for the CTBTO Reviewed Event Bulletin, beyond the ones analyzed through the standard procedures. Arora, N., Russell, S., and Sudderth, E., NET-VISA: Network Processing Vertically Integrated Seismic Analysis, 2013, Bull. Seismol. Soc. Am., 103, 709-729.
Moving People from Science Adjacent to Science Doers with Twitch.tv
Gay, Pamela L.; CosmoQuest
2017-10-01
The CosmoQuest community is testing the ability to attract people from playing online videogames to doing fully online citizen science by engaging people through the Twitch.tv streaming platform. Twitch.tv launched in 2011 as an online platform for video gamers to stream their gameplay while providing narrative. In its six years of regular growth, the platform has added support for people playing non-video games, and for those participating in non-game activities. As part of their expansion, in April 2017, Twitch.tv hosted a science week during which they streamed the Cosmos series and allowed different feeds provide real-time commentary. They also hosted panel discussions on a variety of science topics. CosmoQuest participated in this event and used it as a jumping off point for beginning to interact with Twitch.tv community members online. With CosmoQuest’s beta launch of Image Detectives, they expanded their use of this streaming platform to include regular “office hours”, during which team members did science with CosmoQuest’s online projects, took questions from community members, and otherwise promoted the CosmoQuest community. This presentation examines this case study, and looks at how well different kinds of Twitter engagements attracted audiences, the conversion rate from viewer to subscriber, and at how effectively CosmoQuest was able to migrate users from viewing citizen science on Twitch.tv to participating in citizen science on CosmoQuest.org.This project was supported through NASA cooperative agreement NNX17AD20A.
2000-01-01
as Imperial College, the Royal Albert Hall, the Royal College of Art, the Natural History and Science Museums and the Royal Geographical Society. Under the heading `Shaping the future together' BA2000 will explore science, engineering and technology in their wider cultural context. Further information about this event on 6 - 12 September may be obtained from Sandra Koura, BA2000 Festival Manager, British Association for the Advancement of Science, 23 Savile Row, London W1X 2NB (tel: 0171 973 3075, e-mail: sandra.koura@britassoc.org.uk ). Details of the creating SPARKS events may be obtained from creating.sparks@britassoc.org.uk or from the website www.britassoc.org.uk . Other events 3 - 7 July, Porto Alegre, Brazil VII Interamerican conference on physics education: The preparation of physicists and physics teachers in contemporary society. Info: IACPE7@if.ufrgs.br or cabbat1.cnea.gov.ar/iacpe/iacpei.htm 27 August - 1 September, Barcelona, Spain GIREP conference: Physics teacher education beyond 2000. Info: www.blues.uab.es/phyteb/index.html
Directory of Open Access Journals (Sweden)
Begoña Pérez-Gómez
2016-11-01
Full Text Available The upgrade and enhancement of sea level networks worldwide for integration in sea level hazard warning systems have significantly increased the possibilities for measuring and analyzing high frequency sea level oscillations, with typical periods ranging from a few minutes to a few hours. Many tide gauges now afford 1 min or more frequent sampling and have shown such events to be a common occurrence. Their origins and spatial distribution are diverse and must be well understood in order to correctly design and interpret, for example, the automatic detection algorithms used by tsunami warning centers. Two events recorded recently in European Atlantic waters are analyzed here: possible wave-induced seiches that occurred along the North coast of Spain during the storms of January and February of 2014, and oscillations detected after an earthquake in the mid-Atlantic the 13th of February of 2015. The former caused significant flooding in towns and villages and a huge increase in wave-induced coastal damage that was reported in the media for weeks. The second was a smaller signal present in several tide gauges along the Atlantic coast that, that coincided with the occurrence of this earthquake, leading to a debate on the potential detection of a very small tsunami and how it might yield significant information for tsunami wave modelers and for the development of tsunami detection software. These kinds of events inform us about the limitations of automatic algorithms for tsunami warning and help to improve the information provided to tsunami warning centers, whilst also emphasizing the importance of other forcings in generating extreme sea levels and their associated potential for causing damage to infrastructure.
2008-06-01
Report of event of 11 May 2008 held at the African Institute of Mathematical Sciences (Muizenberg, Cape), with speakers Michael Griffin (Administrator of NASA), Stephen Hawking (Cambridge), David Gross (Kavli Institute, Santa Barbara) and George Smoot (Berkeley).
The power to detect recent fragmentation events using genetic differentiation methods.
Directory of Open Access Journals (Sweden)
Michael W Lloyd
Full Text Available Habitat loss and fragmentation are imminent threats to biological diversity worldwide and thus are fundamental issues in conservation biology. Increased isolation alone has been implicated as a driver of negative impacts in populations associated with fragmented landscapes. Genetic monitoring and the use of measures of genetic divergence have been proposed as means to detect changes in landscape connectivity. Our goal was to evaluate the sensitivity of Wright's F st, Hedrick' G'st , Sherwin's MI, and Jost's D to recent fragmentation events across a range of population sizes and sampling regimes. We constructed an individual-based model, which used a factorial design to compare effects of varying population size, presence or absence of overlapping generations, and presence or absence of population sub-structuring. Increases in population size, overlapping generations, and population sub-structuring each reduced F st, G'st , MI, and D. The signal of fragmentation was detected within two generations for all metrics. However, the magnitude of the change in each was small in all cases, and when N e was >100 individuals it was extremely small. Multi-generational sampling and population estimates are required to differentiate the signal of background divergence from changes in Fst , G'st , MI, and D associated with fragmentation. Finally, the window during which rapid change in Fst , G'st , MI, and D between generations occurs can be small, and if missed would lead to inconclusive results. For these reasons, use of F st, G'st , MI, or D for detecting and monitoring changes in connectivity is likely to prove difficult in real-world scenarios. We advocate use of genetic monitoring only in conjunction with estimates of actual movement among patches such that one could compare current movement with the genetic signature of past movement to determine there has been a change.
DEFF Research Database (Denmark)
Olsen, Mads; Schneider, Logan Douglas; Cheung, Joseph
2018-01-01
The current definition of sleep arousals neglects to address the diversity of arousals and their systemic cohesion. Autonomic arousals (AA) are autonomic activations often associated with cortical arousals (CA), but they may also occur in isolation in relation to a respiratory event, a leg movement...... event or spontaneously, without any other physiological associations. AA should be acknowledged as essential events to understand and explore the systemic implications of arousals. We developed an automatic AA detection algorithm based on intelligent feature selection and advanced machine learning using...... or respiratory events. This indicates that most FP constitute autonomic activations that are indistinguishable from those with cortical cohesion. The proposed algorithm provides an automatic system trained in a clinical environment, which can be utilized to analyse the systemic and clinical impacts of arousals....
Review of nuclear power reactor coolant system leakage events and leak detection requirements
International Nuclear Information System (INIS)
Chokshi, N.C.; Srinivasan, M.; Kupperman, D.S.; Krishnaswamy, P.
2005-01-01
In response to the vessel head event at the Davis-Besse reactor, the U.S. Nuclear Regulatory Commission (NRC) formed a Lessons Learned Task Force (LLTF). Four action plans were formulated to respond to the recommendations of the LLTF. The action plans involved efforts on barrier integrity, stress corrosion cracking (SCC), operating experience, and inspection and program management. One part of the action plan on barrier integrity was an assessment to identify potential safety benefits from changes in requirements pertaining to leakage in the reactor coolant system (RCS). In this effort, experiments and models were reviewed to identify correlations between crack size, crack-tip-opening displacement (CTOD), and leak rate in the RCS. Sensitivity studies using the Seepage Quantification of Upsets In Reactor Tubes (SQUIRT) code were carried out to correlate crack parameters, such as crack size, with leak rate for various types of crack configurations in RCS components. A database that identifies the leakage source, leakage rate, and resulting actions from RCS leaks discovered in U.S. light water reactors was developed. Humidity monitoring systems for detecting leakage and acoustic emission crack monitoring systems for the detection of crack initiation and growth before a leak occurs were also considered. New approaches to the detection of a leak in the reactor head region by monitoring boric-acid aerosols were also considered. (authors)
Private events: from methodological behaviorism to interbehaviorism
Bueno, Roberto; Universidad de San Martín de Porres / Universidad Nacional Federico Villarreal
2010-01-01
As supposed events being accessible to a unique observer, private events posit an interesting challenge to a behavioristic psychology. Three historical variants of behaviorism dealt with the problem of private events: methodological behaviorism, radical behaviorism and interbehaviorism. The basic argument of the two last views, and that distinguishes them from the former, is that private events are comprised into the scope of an objective science of behavior. The analysis of these accounts pe...
Detection of adverse events in general surgery using the " Trigger Tool" methodology.
Pérez Zapata, Ana Isabel; Gutiérrez Samaniego, María; Rodríguez Cuéllar, Elías; Andrés Esteban, Eva María; Gómez de la Cámara, Agustín; Ruiz López, Pedro
2015-02-01
Surgery is one of the high-risk areas for the occurrence of adverse events (AE). The purpose of this study is to know the percentage of hospitalisation-related AE that are detected by the «Global Trigger Tool» methodology in surgical patients, their characteristics and the tool validity. Retrospective, observational study on patients admitted to a general surgery department, who underwent a surgical operation in a third level hospital during the year 2012. The identification of AE was carried out by patient record review using an adaptation of «Global Trigger Tool» methodology. Once an AE was identified, a harm category was assigned, including the grade in which the AE could have been avoided and its relation with the surgical procedure. The prevalence of AE was 36,8%. There were 0,5 AE per patient. 56,2% were deemed preventable. 69,3% were directly related to the surgical procedure. The tool had a sensitivity of 86% and a specificity of 93,6%. The positive predictive value was 89% and the negative predictive value 92%. Prevalence of AE is greater than the estimate of other studies. In most cases the AE detected were related to the surgical procedure and more than half were also preventable. The adapted «Global Trigger Tool» methodology has demonstrated to be highly effective and efficient for detecting AE in surgical patients, identifying all the serious AE with few false negative results. Copyright © 2014 AEC. Publicado por Elsevier España, S.L.U. All rights reserved.
Climate Change Extreme Events: Meeting the Information Needs of Water Resource Managers
Quay, R.; Garfin, G. M.; Dominguez, F.; Hirschboeck, K. K.; Woodhouse, C. A.; Guido, Z.; White, D. D.
2013-12-01
Information about climate has long been used by water managers to develop short term and long term plans and strategies for regional and local water resources. Inherent within longer term forecasts is an element of uncertainty, which is particularly evident in Global Climate model results for precipitation. For example in the southwest estimates in the flow of the Colorado River based on GCM results indicate changes from 120% or current flow to 60%. Many water resource managers are now using global climate model down scaled estimates results as indications of potential climate change as part of that planning. They are addressing the uncertainty within these estimates by using an anticipatory planning approach looking at a range of possible futures. One aspect of climate that is important for such planning are estimates of future extreme storm (short term) and drought (long term) events. However, the climate science of future possible changes in extreme events is less mature than general climate change science. At a recent workshop among climate scientists and water managers in the southwest, it was concluded the science of climate change extreme events is at least a decade away from being robust enough to be useful for water managers in their water resource management activities. However, it was proposed that there are existing estimates and records of past flooding and drought events that could be combined with general climate change science to create possible future events. These derived events could be of sufficient detail to be used by water resource managers until such time that the science of extreme events is able to provide more detailed estimates. Based on the results of this workshop and other work being done by the Decision Center for a Desert City at Arizona State University and the Climate Assessment for the Southwest center at University of Arizona., this article will 1) review what are the extreme event data needs of Water Resource Managers in the
Henriques, C. A. O.; Freitas, E. D. C.; Azevedo, C. D. R.; González-Díaz, D.; Mano, R. D. P.; Jorge, M. R.; Fernandes, L. M. P.; Monteiro, C. M. B.; Gómez-Cadenas, J. J.; Álvarez, V.; Benlloch-Rodríguez, J. M.; Borges, F. I. G. M.; Botas, A.; Cárcel, S.; Carríon, J. V.; Cebrían, S.; Conde, C. A. N.; Díaz, J.; Diesburg, M.; Esteve, R.; Felkai, R.; Ferrario, P.; Ferreira, A. L.; Goldschmidt, A.; Gutiérrez, R. M.; Hauptman, J.; Hernandez, A. I.; Hernando Morata, J. A.; Herrero, V.; Jones, B. J. P.; Labarga, L.; Laing, A.; Lebrun, P.; Liubarsky, I.; López-March, N.; Losada, M.; Martín-Albo, J.; Martínez-Lema, G.; Martínez, A.; McDonald, A. D.; Monrabal, F.; Mora, F. J.; Moutinho, L. M.; Muñoz Vidal, J.; Musti, M.; Nebot-Guinot, M.; Novella, P.; Nygren, D. R.; Palmeiro, B.; Para, A.; Pérez, J.; Querol, M.; Renner, J.; Ripoll, L.; Rodríguez, J.; Rogers, L.; Santos, F. P.; dos Santos, J. M. F.; Simón, A.; Sofka, C.; Sorel, M.; Stiegler, T.; Toledo, J. F.; Torrent, J.; Tsamalaidze, Z.; Veloso, J. F. C. A.; Webb, R.; White, J. T.; Yahlali, N.; NEXT Collaboration
2017-10-01
Xe-CO2 mixtures are important alternatives to pure xenon in Time Projection Chambers (TPC) based on secondary scintillation (electroluminescence) signal amplification with applications in the important field of rare event detection such as directional dark matter, double electron capture and double beta decay detection. The addition of CO2 to pure xenon at the level of 0.05-0.1% can reduce significantly the scale of electron diffusion from 10 mm /√{m} to 2.5 mm /√{m}, with high impact on the discrimination efficiency of the events through pattern recognition of the topology of primary ionization trails. We have measured the electroluminescence (EL) yield of Xe-CO2 mixtures, with sub-percent CO2 concentrations. We demonstrate that the EL production is still high in these mixtures, 70% and 35% relative to that produced in pure xenon, for CO2 concentrations around 0.05% and 0.1%, respectively. The contribution of the statistical fluctuations in EL production to the energy resolution increases with increasing CO2 concentration, being smaller than the contribution of the Fano factor for concentrations below 0.1% CO2.
Urtnasan, Erdenebayar; Park, Jong-Uk; Joo, Eun-Yeon; Lee, Kyoung-Joung
2018-04-23
In this study, we propose a method for the automated detection of obstructive sleep apnea (OSA) from a single-lead electrocardiogram (ECG) using a convolutional neural network (CNN). A CNN model was designed with six optimized convolution layers including activation, pooling, and dropout layers. One-dimensional (1D) convolution, rectified linear units (ReLU), and max pooling were applied to the convolution, activation, and pooling layers, respectively. For training and evaluation of the CNN model, a single-lead ECG dataset was collected from 82 subjects with OSA and was divided into training (including data from 63 patients with 34,281 events) and testing (including data from 19 patients with 8571 events) datasets. Using this CNN model, a precision of 0.99%, a recall of 0.99%, and an F 1 -score of 0.99% were attained with the training dataset; these values were all 0.96% when the CNN was applied to the testing dataset. These results show that the proposed CNN model can be used to detect OSA accurately on the basis of a single-lead ECG. Ultimately, this CNN model may be used as a screening tool for those suspected to suffer from OSA.
SPEED : a semantics-based pipeline for economic event detection
Hogenboom, F.P.; Hogenboom, A.C.; Frasincar, F.; Kaymak, U.; Meer, van der O.; Schouten, K.; Vandic, D.; Parsons, J.; Motoshi, S.; Shoval, P.; Woo, C.; Wand, Y.
2010-01-01
Nowadays, emerging news on economic events such as acquisitions has a substantial impact on the financial markets. Therefore, it is important to be able to automatically and accurately identify events in news items in a timely manner. For this, one has to be able to process a large amount of
Convolutional neural networks for event-related potential detection: impact of the architecture.
Cecotti, H
2017-07-01
The detection of brain responses at the single-trial level in the electroencephalogram (EEG) such as event-related potentials (ERPs) is a difficult problem that requires different processing steps to extract relevant discriminant features. While most of the signal and classification techniques for the detection of brain responses are based on linear algebra, different pattern recognition techniques such as convolutional neural network (CNN), as a type of deep learning technique, have shown some interests as they are able to process the signal after limited pre-processing. In this study, we propose to investigate the performance of CNNs in relation of their architecture and in relation to how they are evaluated: a single system for each subject, or a system for all the subjects. More particularly, we want to address the change of performance that can be observed between specifying a neural network to a subject, or by considering a neural network for a group of subjects, taking advantage of a larger number of trials from different subjects. The results support the conclusion that a convolutional neural network trained on different subjects can lead to an AUC above 0.9 by using an appropriate architecture using spatial filtering and shift invariant layers.
2005-11-01
EIROforum presents the very best of European science teaching How can you weigh the Earth with a straw, a paperclip and a piece of thread? Why don't we really know what we see? How can a juggling act explain mathematics? These are but a few of the on-stage activities that will be shown at the EIROforum [1] Science on Stage Festival, to be held from 21 to 25 November at CERN in Geneva (Switzerland). With support from the European Commission, this international festival brings together around 500 science educators from 29 European countries to show how fascinating and entertaining science can be. "Science is fun! This is what this week-long event will show by presenting innovative methods of teaching science and demonstrations", says Helen Wilson from the European Space Agency and co-ordinator of the event. "At the festival, teachers have the chance to view things from a new perspective, to be entertained and enchanted by science", says Rolf Landua, Head of Education at CERN and Chairman of the event. "As well as taking to the stage, they set up stalls in fair-like surroundings to share their most successful teaching tricks." Workshops on themes as varied as "flying on stage", "the theatre of science", or "stem cell research" and "gamma-ray bursts", will give the attendees - teachers and other science educators - the chance to discuss and come up with solutions to the problem of growing disinterest for science in Europe. "A key element of the Science on Stage concept is to give teachers an up-to-date 'insider's view' of what is happening in big science, to tell them about new, highly diverse and interesting career opportunities for their pupils, and to create a European atmosphere where bright young people can meet and interact", says Colin Carlile, Director General of the Institut Laue-Langevin and current chairman of the EIROforum. At the end of the festival, the European Science Teaching Awards will be presented. The names of the winners will be made public on the
Coticone, Sulekha Rao; Van Houten, Lora Bailey
2015-01-01
A special topics course combining two relevant and contemporary themes (forensic DNA analysis and illicit drug detection) was developed to stimulate student enthusiasm and enhance understanding of forensic science. Building on the interest of popular television shows such as "CSI" and "Breaking Bad," this course connects…
Negated bio-events: analysis and identification
2013-01-01
Background Negation occurs frequently in scientific literature, especially in biomedical literature. It has previously been reported that around 13% of sentences found in biomedical research articles contain negation. Historically, the main motivation for identifying negated events has been to ensure their exclusion from lists of extracted interactions. However, recently, there has been a growing interest in negative results, which has resulted in negation detection being identified as a key challenge in biomedical relation extraction. In this article, we focus on the problem of identifying negated bio-events, given gold standard event annotations. Results We have conducted a detailed analysis of three open access bio-event corpora containing negation information (i.e., GENIA Event, BioInfer and BioNLP’09 ST), and have identified the main types of negated bio-events. We have analysed the key aspects of a machine learning solution to the problem of detecting negated events, including selection of negation cues, feature engineering and the choice of learning algorithm. Combining the best solutions for each aspect of the problem, we propose a novel framework for the identification of negated bio-events. We have evaluated our system on each of the three open access corpora mentioned above. The performance of the system significantly surpasses the best results previously reported on the BioNLP’09 ST corpus, and achieves even better results on the GENIA Event and BioInfer corpora, both of which contain more varied and complex events. Conclusions Recently, in the field of biomedical text mining, the development and enhancement of event-based systems has received significant interest. The ability to identify negated events is a key performance element for these systems. We have conducted the first detailed study on the analysis and identification of negated bio-events. Our proposed framework can be integrated with state-of-the-art event extraction systems. The
Event monitoring of parallel computations
Directory of Open Access Journals (Sweden)
Gruzlikov Alexander M.
2015-06-01
Full Text Available The paper considers the monitoring of parallel computations for detection of abnormal events. It is assumed that computations are organized according to an event model, and monitoring is based on specific test sequences
International Nuclear Information System (INIS)
Fleming, S.
1975-01-01
The range of laboratory authentication techniques now available for the detection of art fakes is reviewed. In particular the use of neutron activation analysis, x-ray fluorescence analysis and lead isotope analysis, are considered. The underlying principles of these three methods are explained and examples of their use in detecting forgeries of paintings, coins, bronzes etc. are given. (U.K.)
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. Bhawanisingh G Desai. Articles written in Journal of Earth System Science. Volume 120 Issue 4 August 2011 pp 723-734. Discontinuity surfaces and event stratigraphy of Okha Shell Limestone Member: Implications for Holocene sea level changes, western India.
Leveraging KVM Events to Detect Cache-Based Side Channel Attacks in a Virtualization Environment
Directory of Open Access Journals (Sweden)
Ady Wahyudi Paundu
2018-01-01
Full Text Available Cache-based side channel attack (CSCa techniques in virtualization systems are becoming more advanced, while defense methods against them are still perceived as nonpractical. The most recent CSCa variant called Flush + Flush has showed that the current detection methods can be easily bypassed. Within this work, we introduce a novel monitoring approach to detect CSCa operations inside a virtualization environment. We utilize the Kernel Virtual Machine (KVM event data in the kernel and process this data using a machine learning technique to identify any CSCa operation in the guest Virtual Machine (VM. We evaluate our approach using Receiver Operating Characteristic (ROC diagram of multiple attack and benign operation scenarios. Our method successfully separate the CSCa datasets from the non-CSCa datasets, on both trained and nontrained data scenarios. The successful classification also include the Flush + Flush attack scenario. We are also able to explain the classification results by extracting the set of most important features that separate both classes using their Fisher scores and show that our monitoring approach can work to detect CSCa in general. Finally, we evaluate the overhead impact of our CSCa monitoring method and show that it has a negligible computation overhead on the host and the guest VM.
Health Detectives: Uncovering the Mysteries of Disease (LBNL Science at the Theater)
Energy Technology Data Exchange (ETDEWEB)
Bissell, Mina; Canaria, Christie; Celnicker, Susan; Karpen, Gary
2012-04-23
In this April 23, 2012 Science at the Theater event, Berkeley Lab scientists discuss how they uncover the mysteries of disease in unlikely places. Speakers and topics include: World-renowned cancer researcher Mina Bissell's pioneering research on the role of the cellular microenvironment in breast cancer has changed the conversation about the disease. How does DNA instability cause disease? To find out, Christie Canaria images neural networks to study disorders such as Huntington's disease. Fruit flies can tell us a lot about ourselves. Susan Celniker explores the fruit fly genome to learn how our genome works. DNA is not destiny. Gary Karpen explores how environmental factors shape genome function and disease through epigenetics.
Ramsey, Michael
2015-04-01
The ASTER-based observational success of active volcanic processes early in the Terra mission later gave rise to a funded NASA program designed to both increase the number of ASTER scenes following an eruption and perform the ground-based science needed to validate that data. The urgent request protocol (URP) system for ASTER grew out of this initial study and has now operated in conjunction with and the support of the Alaska Volcano Observatory, the University of Alaska Fairbanks, the University of Hawaii, the USGS Land Processes DAAC, and the ASTER science team. The University of Pittsburgh oversees this rapid response/sensor-web system, which until 2011 had focused solely on the active volcanoes in the North Pacific region. Since that time, it has been expanded to operate globally with AVHRR and MODIS and now ASTER visible and thermal infrared (TIR) data are being acquired at numerous active volcanoes around the world. This program relies on the increased temporal resolution of AVHRR/MODIS midwave infrared data to trigger the next available ASTER observation, which results in ASTER data as frequently as every 2-5 days. For many new targets such as Mt. Etna, the URP has increased the observational frequency by as much 50%. Examples of these datasets will be presented, which have been used for operational response to new eruptions as well as longer-term scientific studies. These studies include emplacement of new lava flows, detection of endogenous dome growth, and interpretation of hazardous dome collapse events. As a means to validate the ASTER TIR data and capture higher-resolution images, a new ground-based sensor has recently been developed that consists of standard FLIR camera modified with wavelength filters similar to the ASTER bands. Data from this instrument have been acquired of the lava lake at Kilauea and reveal differences in emissivity between molten and cooled surfaces confirming prior laboratory results and providing important constraints on lava
Molaro, Jamie; Keane, Jamies; Peacock, Sarah; Schaefer, Ethan; Tanquary, Hannah
2014-11-01
The University of Arizona’s Lunar and Planetary Laboratory (LPL) presents the 2nd Annual The Art of Planetary Science: An Exhibition (TAPS) on 17-19 October 2014. This art exhibition and competition features artwork inspired by planetary science, alongside works created from scientific data. It is designed to connect the local art and science communities of Tucson, and engage the public together in celebration of the beauty and elegance of the universe. The exhibition is organized by a team of volunteer graduate students, with the help of LPL’s Space Imaging Center, and support from the LPL administration. Last year’s inaugural event featured over 150 works of art from 70 artists and scientists. A variety of mediums were represented, including paintings, photography, digital prints, sculpture, glasswork, textiles, film, and written word. Over 300 guests attended the opening. Art submission and event attendance are free, and open to anyone.The primary goal of the event is to present a different side of science to the public. Too often, the public sees science as dull or beyond their grasp. This event provides scientists the opportunity to demonstrate the beauty that they find in their science, by creating art out of their scientific data. These works utilized, for example, equations, simulations, visual representations of spacecraft data, and images of extra-terrestrial material samples. Viewing these works alongside more traditional artwork inspired by those same scientific ideas provided the audience a more complex, multifaceted view of the content that would not be possible viewing either alone. The event also provides a way to reach out specifically to the adult community. Most science outreach is targeted towards engaging children in STEM fields. While this is vital for the long term, adults have more immediate control over the perception of science and public policy that provides funding and research opportunities to scientists. We hope this event raises
2007-03-01
The Science on Stage festival as an alarm clock for science teaching How is Europe to tackle its shortage of scientists? The EIROforum Science on Stage festival aims to give European teachers some of the answers they need to take up this urgent challenge. This unique event, showcasing the very best of today's science education, will feature science demonstrations, a science teaching fair with some 66 stands, and a Round Table discussion with the participation of the European Commissioner for Science and Research, Janez Potočnik. ESO PR Photo 14/07 ESO PR Photo 14/07 Science on Stage will have the city of Grenoble (France) buzzing from 2 to 6 April 2007. A rugby team and a hockey team will take on the power of the vacuum, a cook will demonstrate how science can inspire new culinary ideas, visitors will discover the real colour of the sun, an inflatable model of Borromini's gallery will help to explain the science of optical illusions, and Merlin himself will reveal all about how to make a cake float. These are just some of the exciting things that will be happening at the EIROforum Science on Stage festival. By showing how fascinating and entertaining science can be, the event aims to attract young people to science and ultimately help to reduce the shortage of scientists in Europe. With support from the European Commission, this international festival will bring together some 500 science educators from 27 European countries. The highlight of the festival will be a Round Table discussion on 'Science Education in the Age of the Knowledge Society - Strengthening Science Education in Europe', which will take place on 5 April 2007 with the participation of the European Commissioner for Science and Research, Janez Potočnik. The panellists - all high-ranking decision-makers - will include the Danish Minister for Education, Bertel Haarder, the MEP Vittorio Prodi, and the Chair of the UK's Engineering and Physical Sciences Research Council, Julia Higgins. "Curiosity is in
Slattery, W.; Brown, D.
2008-12-01
Most science courses, including courses that provide preparation for pre-service K-12 teachers are only taught from a deductive big picture perspective. This method is fine for most abstract learners, but pre- service classroom educators that are being prepared to teach in middle school classrooms will be faced with the challenge of building science content knowledge in students that are concrete learners. For these K-12 students a better pedagogical practice is to use local real-world familiar places, issues and personal experience to connect student learning with more abstract concepts. To make it more likely that teachers have the requisite skills and pedagogical content knowledge to build K- 12 student science concept knowledge and science process skills we have integrated ESSEA modules that connect worldwide issues such as global climate change with local event studies chosen by learners. Some recent examples include how such local events such as landfill fires and suburban sprawl impact the local area's air, land, water and life. Course participants are able to choose a more personal route to understanding how their habits impact the global environment by participating in a three week learning experience called the Lifestyle Project. This experience asks students to incrementally reduce their use of heating or air-conditioning, the amount of waste going to landfills, to conserve electricity, drive less and eat less energy intensively. Pre-post content assessments indicate that students in this course scored significantly higher on post course content assessments and reported that by engaging in personal experience to global scale learning experiences they have a new appreciation for how personal choices impact the global environment and how to use local artifacts and issues to enhance K-12 student learning.
Decision support methods for the detection of adverse events in post-marketing data.
Hauben, M; Bate, A
2009-04-01
Spontaneous reporting is a crucial component of post-marketing drug safety surveillance despite its significant limitations. The size and complexity of some spontaneous reporting system databases represent a challenge for drug safety professionals who traditionally have relied heavily on the scientific and clinical acumen of the prepared mind. Computer algorithms that calculate statistical measures of reporting frequency for huge numbers of drug-event combinations are increasingly used to support pharamcovigilance analysts screening large spontaneous reporting system databases. After an overview of pharmacovigilance and spontaneous reporting systems, we discuss the theory and application of contemporary computer algorithms in regular use, those under development, and the practical considerations involved in the implementation of computer algorithms within a comprehensive and holistic drug safety signal detection program.
Citizen Science and Event-Based Science Education with the Quake-Catcher Network
DeGroot, R. M.; Sumy, D. F.; Benthien, M. L.
2017-12-01
The Quake-Catcher Network (QCN, quakecatcher.net) is a collaborative, citizen-science initiative to develop the world's largest, low-cost strong-motion seismic network through the utilization of sensors in laptops and smartphones or small microelectromechanical systems (MEMS) accelerometers attached to internet-connected computers. The volunteer computers monitor seismic motion and other vibrations and send the "triggers" in real-time to the QCN server hosted at the University of Southern California. The QCN servers sift through these signals and determine which ones represent earthquakes and which ones represent cultural noise. Data collected by the Quake-Catcher Network can contribute to better understanding earthquakes, provide teachable moments for students, and engage the public with authentic science experiences. QCN partners coordinate sensor installations, develop QCN's scientific tools and engagement activities, and create next generation online resources. In recent years, the QCN team has installed sensors in over 225 K-12 schools and free-choice learning institutions (e.g. museums) across the United States and Canada. One of the current goals of the program in the United States is to establish several QCN stations in K-12 schools around a local museum hub as a means to provide coordinated and sustained educational opportunities leading up to the yearly Great ShakeOut Earthquake Drill, to encourage citizen science, and enrich STEM curriculum. Several school districts and museums throughout Southern California have been instrumental in the development of QCN. For educators QCN fulfills a key component of the Next Generation Science Standards where students are provided an opportunity to utilize technology and interface with authentic scientific data and learn about emerging programs such as the ShakeAlert earthquake early warning system. For example, Sunnylands Center in Rancho Mirage, CA leads Coachella Valley Hub, which serves 31 K-12 schools, many of
Schmidt, F.; Liu, S.
2016-12-01
Source water quality plays an important role for the safety of drinking water and early detection of its contamination is vital to taking appropriate countermeasures. However, compared to drinking water, it is more difficult to detect contamination events because its environment is less controlled and numerous natural causes contribute to a high variability of the background values. In this project, Artificial Neural Networks (ANNs) and a Contamination Event Detection Process (CED Process) were used to identify events in river water. The ANN models the response of basic water quality sensors obtained in laboratory experiments in an off-line learning stage and continuously forecasts future values of the time line in an on-line forecasting step. During this second stage, the CED Process compares the forecast to the measured value and classifies it as regular background or event value, which modifies the ANN's continuous learning and influences its forecasts. In addition to this basic setup, external information is fed to the CED Process: A so-called Operator Input (OI) is provided to inform about unusual water quality levels that are unrelated to the presence of contamination, for example due to cooling water discharge from a nearby power plant. This study's primary goal is to evaluate how well the OI fits into the design of the combined forecasting ANN and CED Process and to understand its effects on the online forecasting stage. To test this, data from laboratory experiments conducted previously at the School of Environment, Tsinghua University, have been used to perform simulations highlighting features and drawbacks of this method. Applying the OI has been shown to have a positive influence on the ANN's ability to handle a sudden change in background values, which is unrelated to contamination. However, it might also mask the presence of an event, an issue that underlines the necessity to have several instances of the algorithm run in parallel. Other difficulties
Behaviorism, private events, and the molar view of behavior.
Baum, William M
2011-01-01
Viewing the science of behavior (behavior analysis) to be a natural science, radical behaviorism rejects any form of dualism, including subjective-objective or inner-outer dualism. Yet radical behaviorists often claim that treating private events as covert behavior and internal stimuli is necessary and important to behavior analysis. To the contrary, this paper argues that, compared with the rejection of dualism, private events constitute a trivial idea and are irrelevant to accounts of behavior. Viewed in the framework of evolutionary theory or for any practical purpose, behavior is commerce with the environment. By its very nature, behavior is extended in time. The temptation to posit private events arises when an activity is viewed in too small a time frame, obscuring what the activity does. When activities are viewed in an appropriately extended time frame, private events become irrelevant to the account. This insight provides the answer to many philosophical questions about thinking, sensing, and feeling. Confusion about private events arises in large part from failure to appreciate fully the radical implications of replacing mentalistic ideas about language with the concept of verbal behavior. Like other operant behavior, verbal behavior involves no agent and no hidden causes; like all natural events, it is caused by other natural events. In a science of behavior grounded in evolutionary theory, the same set of principles applies to verbal and nonverbal behavior and to human and nonhuman organisms.
Behaviorism, Private Events, and the Molar View of Behavior
Baum, William M
2011-01-01
Viewing the science of behavior (behavior analysis) to be a natural science, radical behaviorism rejects any form of dualism, including subjective–objective or inner–outer dualism. Yet radical behaviorists often claim that treating private events as covert behavior and internal stimuli is necessary and important to behavior analysis. To the contrary, this paper argues that, compared with the rejection of dualism, private events constitute a trivial idea and are irrelevant to accounts of behavior. Viewed in the framework of evolutionary theory or for any practical purpose, behavior is commerce with the environment. By its very nature, behavior is extended in time. The temptation to posit private events arises when an activity is viewed in too small a time frame, obscuring what the activity does. When activities are viewed in an appropriately extended time frame, private events become irrelevant to the account. This insight provides the answer to many philosophical questions about thinking, sensing, and feeling. Confusion about private events arises in large part from failure to appreciate fully the radical implications of replacing mentalistic ideas about language with the concept of verbal behavior. Like other operant behavior, verbal behavior involves no agent and no hidden causes; like all natural events, it is caused by other natural events. In a science of behavior grounded in evolutionary theory, the same set of principles applies to verbal and nonverbal behavior and to human and nonhuman organisms. PMID:22532740
Detectability Factors for Earth-based Imaging of the LCROSS Ejecta Plume
Strycker, Paul D.; Schotte, Jonathan M.; Temme, Ruth L.; Chanover, Nancy J.
2017-10-01
NASA’s Lunar Crater Observation and Sensing Satellite (LCROSS) mission delivered a kinetic impactor into Cabeus Crater on 9 October 2009 [1, 2]. Observing campaigns from Earth-based telescopes at multiple facilities attempted to obtain temporally-resolved imaging of the ejecta plume [3], but no Earth-based imaging detections were reported until 2013 after processing images with Principal Component Analysis (PCA) filtering [4]. Subsequently, PCA filtering has revealed plume detections in two additional cameras and also confirmed a non-detection from one telescope [5, 6]. This combination of detection and non-detection data is useful in determining the criteria for detectability in future observations of transient events. The goal of this work is to identify factors contributing to detectability and to establish thresholds applicable to the LCROSS event. We take the data containing detections and then degrade a specific factor in them until the plume is no longer detectable. These derived thresholds for factors (e.g., scattered light, temporal resolution, spatial resolution, field of view, and signal-to-noise of the illuminated foreground of Cabeus) can be compared to the properties of the actual non-detection data to identify problems specific to its observing conditions or observational setup. The percent differences between the thresholds and both the detection data and non-detection data may also reveal the relative importance of these detectability factors. This work was supported by NASA’s Lunar Data Analysis Program through grant number NNX15AP92G. Observations reported here were obtained at the MMT Observatory, a joint facility of the Smithsonian Institution and the University of Arizona.References: [1] Colaprete, A. et al. (2010) Science, 330, 463-468. [2] Schultz, P. H. et al. (2010) Science, 330, 468-472. [3] Heldmann, J. L. et al. (2012) Space Sci. Rev., 167:93-140, doi:10.1007/s11214-011-9759-y. [4] Strycker, P. D. et al. (2013) Nat. Commun., 4
Hilsden, Robert J; Dube, Catherine; Heitman, Steven J; Bridges, Ronald; McGregor, S Elizabeth; Rostom, Alaa
2015-11-01
Although several quality indicators of colonoscopy have been defined, quality assurance activities should be directed at the measurement of quality indicators that are predictive of key screening colonoscopy outcomes. The goal of this study was to examine the association among established quality indicators and the detection of screen-relevant lesions (SRLs), adverse events, and postcolonoscopy cancers. Historical cohort study. Canadian colorectal cancer screening center. A total of 18,456 asymptomatic men and women ages 40 to 74, at either average risk or increased risk for colorectal cancer because of a family history, who underwent a screening colonoscopy from 2008 to 2010. Using univariate and multivariate analyses, we explored the association among procedural quality indicators and 3 colonoscopy outcomes: detection of SRLs, adverse events, and postcolonoscopy cancers. The crude rates of SRLs, adverse events, and postcolonoscopy cancers were 240, 6.44, and .54 per 1000 colonoscopies, respectively. Several indicators, including endoscopist withdrawal time (OR, 1.3; 95% CI, 1.2-1.4) and cecal intubation rate (OR, 13.9; 95% CI, 1.9-96.9), were associated with the detection of SRLs. No quality indicator was associated with the risk of adverse events. Endoscopist average withdrawal time over 6 minutes (OR, .12; 95% CI, .002-.85) and SRL detection rate over 20% (OR, .17; 95% CI, .03-.74) were associated with a reduced risk of postcolonoscopy cancers. Single-center study. Quality assurance programs should prioritize the measurement of endoscopist average withdrawal time and adenoma (SRL) detection rate. Copyright © 2015 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.
Member State Event: Telling CERN's Story
2004-01-01
As part of the events to mark the Laboratory's fiftieth anniversary, members of the CERN personnel are telling the story of CERN. Robert Cailliau (on the right of the photograph), co-inventor of the Web and currently responsible for CERN's external communications, and Chiara Mariotti (in the center), a physicist working at CMS, were invited to talk about the history of CERN and the Web at a conference in the 'Science Thursdays' series entitled 'From the Quark to the Web' in Turin on 26 February. This was not their first appearance before a non-specialist audience (almost 1000 people that day!) eager to find out what goes on in a unique research centre like CERN as talking about the Laboratory's activities and its history are part and parcel of their work for the Organization. Anniversary Events in the Member States: This 'Science Thursday' event devoted to CERN was one of Italy's contributions to CERN's fiftieth anniversary celebrations. Coming up soon in the Member States: Italy International Centre...
NASA/MSFC/NSSTC Science Communication Roundtable
Adams, Mitzi L.; Gallagher, D. L.; Koczor, R. J.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
For the last several years the Science Directorate at Marshall Space Flight Center has carried out a diverse program of Internet-based science communication. The Directorate's Science Roundtable includes active researchers, NASA public relations, educators, and administrators. The Science@NASA award-winning family of Web sites features science, mathematics, and space news. The program includes extended stories about NASA science, a curriculum resource for teachers tied to national education standards, on-line activities for students, and webcasts of real-time events. Science stories cover a variety of space-related subjects and are expressed in simple terms everyone can understand. The sites address such questions as: what is space weather, what's in the heart of a hurricane, can humans live on Mars, and what is it like to live aboard the International Space Station? Along with a new look, the new format now offers articles organized by subject matter, such as astronomy, living in space, earth science or biology. The focus of sharing real-time science related events has been to involve and excite students and the public about science. Events have involved meteor showers, solar eclipses, natural very low frequency radio emissions, and amateur balloon flights. In some cases broadcasts accommodate active feedback and questions from Internet participants. Information will be provided about each member of the Science@NASA web sites.
Haustein, Karsten; Otto, Friederike; Uhe, Peter; Allen, Myles; Cullen, Heidi
2015-04-01
Extreme weather detection and attribution analysis has emerged as a core theme in climate science over the last decade or so. By using a combination of observational data and climate models it is possible to identify the role of climate change in certain types of extreme weather events such as sea level rise and its contribution to storm surges, extreme heat events and droughts or heavy rainfall and flood events. These analyses are usually carried out after an extreme event has occurred when reanalysis and observational data become available. The Climate Central WWA project will exploit the increasing forecast skill of seasonal forecast prediction systems such as the UK MetOffice GloSea5 (Global seasonal forecasting system) ensemble forecasting method. This way, the current weather can be fed into climate models to simulate large ensembles of possible weather scenarios before an event has fully emerged yet. This effort runs along parallel and intersecting tracks of science and communications that involve research, message development and testing, staged socialization of attribution science with key audiences, and dissemination. The method we employ uses a very large ensemble of simulations of regional climate models to run two different analyses: one to represent the current climate as it was observed, and one to represent the same events in the world that might have been without human-induced climate change. For the weather "as observed" experiment, the atmospheric model uses observed sea surface temperature (SST) data from GloSea5 (currently) and present-day atmospheric gas concentrations to simulate weather events that are possible given the observed climate conditions. The weather in the "world that might have been" experiments is obtained by removing the anthropogenic forcing from the observed SSTs, thereby simulating a counterfactual world without human activity. The anthropogenic forcing is obtained by comparing the CMIP5 historical and natural simulations
2013-03-01
Event: UK to host Science on Stage Travel: Gaining a more global perspective on physics Event: LIYSF asks students to 'cross scientific boundaries' Competition: Young Physicists' tournament is international affair Conference: Learning in a changing world of new technologies Event: Nordic physical societies meet in Lund Conference: Tenth ESERA conference to publish ebook Meeting: Rugby meeting brings teachers together Note: Remembering John L Lewis OBE
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. Raghavendra Ashrit. Articles written in Journal of Earth System Science. Volume 115 Issue 3 June 2006 pp 299-313. Simulation of a Himalayan cloudburst event · Someshwar Das Raghavendra Ashrit M W Moncrieff · More Details Abstract Fulltext PDF. Intense rainfall often ...
Delivering effective science communication: advice from a professional science communicator.
Illingworth, Sam
2017-10-01
Science communication is becoming ever more prevalent, with more and more scientists expected to not only communicate their research to a wider public, but to do so in an innovative and engaging manner. Given the other commitments that researchers and academics are required to fulfil as part of their workload models, it is unfair to be expect them to also instantly produce effective science communication events and activities. However, by thinking carefully about what it is that needs to be communicated, and why this is being done, it is possible to develop high-quality activities that are of benefit to both the audience and the communicator(s). In this paper, I present some practical advice for developing, delivering and evaluating effective science communication initiatives, based on over a decade of experience as being a professional science communicator. I provide advice regarding event logistics, suggestions on how to successfully market and advertise your science communication initiatives, and recommendations for establishing effective branding and legacy. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
Detection of Cardiopulmonary Activity and Related Abnormal Events Using Microsoft Kinect Sensor.
Al-Naji, Ali; Chahl, Javaan
2018-03-20
Monitoring of cardiopulmonary activity is a challenge when attempted under adverse conditions, including different sleeping postures, environmental settings, and an unclear region of interest (ROI). This study proposes an efficient remote imaging system based on a Microsoft Kinect v2 sensor for the observation of cardiopulmonary-signal-and-detection-related abnormal cardiopulmonary events (e.g., tachycardia, bradycardia, tachypnea, bradypnea, and central apnoea) in many possible sleeping postures within varying environmental settings including in total darkness and whether the subject is covered by a blanket or not. The proposed system extracts the signal from the abdominal-thoracic region where cardiopulmonary activity is most pronounced, using a real-time image sequence captured by Kinect v2 sensor. The proposed system shows promising results in any sleep posture, regardless of illumination conditions and unclear ROI even in the presence of a blanket, whilst being reliable, safe, and cost-effective.
Detection of Cardiopulmonary Activity and Related Abnormal Events Using Microsoft Kinect Sensor
Directory of Open Access Journals (Sweden)
Ali Al-Naji
2018-03-01
Full Text Available Monitoring of cardiopulmonary activity is a challenge when attempted under adverse conditions, including different sleeping postures, environmental settings, and an unclear region of interest (ROI. This study proposes an efficient remote imaging system based on a Microsoft Kinect v2 sensor for the observation of cardiopulmonary-signal-and-detection-related abnormal cardiopulmonary events (e.g., tachycardia, bradycardia, tachypnea, bradypnea, and central apnoea in many possible sleeping postures within varying environmental settings including in total darkness and whether the subject is covered by a blanket or not. The proposed system extracts the signal from the abdominal-thoracic region where cardiopulmonary activity is most pronounced, using a real-time image sequence captured by Kinect v2 sensor. The proposed system shows promising results in any sleep posture, regardless of illumination conditions and unclear ROI even in the presence of a blanket, whilst being reliable, safe, and cost-effective.
Zhang, G.; Ganguly, S.; Saatchi, S. S.; Hagen, S. C.; Harris, N.; Yu, Y.; Nemani, R. R.
2013-12-01
Spatial and temporal patterns of forest disturbance and regrowth processes are key for understanding aboveground terrestrial vegetation biomass and carbon stocks at regional-to-continental scales. The NASA Carbon Monitoring System (CMS) program seeks key input datasets, especially information related to impacts due to natural/man-made disturbances in forested landscapes of Conterminous U.S. (CONUS), that would reduce uncertainties in current carbon stock estimation and emission models. This study provides a end-to-end forest disturbance detection framework based on pixel time series analysis from MODIS (Moderate Resolution Imaging Spectroradiometer) and Landsat surface spectral reflectance data. We applied the BFAST (Breaks for Additive Seasonal and Trend) algorithm to the Normalized Difference Vegetation Index (NDVI) data for the time period from 2000 to 2011. A harmonic seasonal model was implemented in BFAST to decompose the time series to seasonal and interannual trend components in order to detect abrupt changes in magnitude and direction of these components. To apply the BFAST for whole CONUS, we built a parallel computing setup for processing massive time-series data using the high performance computing facility of the NASA Earth Exchange (NEX). In the implementation process, we extracted the dominant deforestation events from the magnitude of abrupt changes in both seasonal and interannual components, and estimated dates for corresponding deforestation events. We estimated the recovery rate for deforested regions through regression models developed between NDVI values and time since disturbance for all pixels. A similar implementation of the BFAST algorithm was performed over selected Landsat scenes (all Landsat cloud free data was used to generate NDVI from atmospherically corrected spectral reflectances) to demonstrate the spatial coherence in retrieval layers between MODIS and Landsat. In future, the application of this largely parallel disturbance
State of the Universe of Astronomy on Tap Public Outreach Events
Rice, Emily; Constellation of Astronomy on Tap Host Stars
2018-01-01
Astronomy on Tap (AoT, http://astronomyontap.org) is a series of free public outreach events featuring engaging science presentations combined with music, games, and prizes in a fun, interactive atmosphere. AoT events feature one or more presentations given primarily by local professional scientists and graduate students, but also by visiting scientists, undergraduate students, educators, amateur astronomers, writers, artists, and other astronomy enthusiasts. Events are held at social venues like bars, coffee shops, and art galleries in order to bring science, the stories behind the research, and updates on the latest astronomy news directly to the public in a relaxed, informal atmosphere. Since the first New York City event in April 2013, nearly 400 AoT-affiliated events have been held in over 30 locations worldwide and the expansion is accelerating. The casual, social nature of AoT events provides important professional development opportunities in networking and in science communication, which we describe in a separate poster. The flexible format and content of a typical AoT event is easy to adapt and expand based on the priorities, resources, and interests of local organizers. We present the 2017 launches, including the first events in Europe and the first events conducted in French and Spanish, summarize the Universe of ongoing AoT events, and share recommendations for launching new satellite locations, also described in detail in our “Launch Manifesto” available upon request.
Detection and attribution of extreme weather disasters
Huggel, Christian; Stone, Dáithí; Hansen, Gerrit
2014-05-01
Single disasters related to extreme weather events have caused loss and damage on the order of up to tens of billions US dollars over the past years. Recent disasters fueled the debate about whether and to what extent these events are related to climate change. In international climate negotiations disaster loss and damage is now high on the agenda, and related policy mechanisms have been discussed or are being implemented. In view of funding allocation and effective risk reduction strategies detection and attribution to climate change of extreme weather events and disasters is a key issue. Different avenues have so far been taken to address detection and attribution in this context. Physical climate sciences have developed approaches, among others, where variables that are reasonably sampled over climatically relevant time periods and related to the meteorological characteristics of the extreme event are examined. Trends in these variables (e.g. air or sea surface temperatures) are compared between observations and climate simulations with and without anthropogenic forcing. Generally, progress has been made in recent years in attribution of changes in the chance of some single extreme weather events to anthropogenic climate change but there remain important challenges. A different line of research is primarily concerned with losses related to the extreme weather events over time, using disaster databases. A growing consensus is that the increase in asset values and in exposure are main drivers of the strong increase of economic losses over the past several decades, and only a limited number of studies have found trends consistent with expectations from climate change. Here we propose a better integration of existing lines of research in detection and attribution of extreme weather events and disasters by applying a risk framework. Risk is thereby defined as a function of the probability of occurrence of an extreme weather event, and the associated consequences
Private events: from methodological behaviorism to interbehaviorism
Directory of Open Access Journals (Sweden)
Roberto Bueno
2011-09-01
Full Text Available As supposed events being accessible to a unique observer, private events posit an interesting challenge to a behavioristic psychology. Three historical variants of behaviorism dealt with the problem of private events: methodological behaviorism, radical behaviorism and interbehaviorism. The basic argument of the two last views, and that distinguishes them from the former, is that private events are comprised into the scope of an objective science of behavior. The analysis of these accounts permits us to confirm a gradual advance in behavior theory, in dealing with this issue, toward a totally monistic view.
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. Suresh Chandra Kandpal. Articles written in Journal of Earth System Science. Volume 120 Issue 5 October 2011 pp 873-883. Subsurface signatures and timing of extreme wave events along the southeast Indian coast · Rajesh R Nair Madhav K Murari C S Vijaya Lakshmi ...
A Survey on Distributed Filtering and Fault Detection for Sensor Networks
Directory of Open Access Journals (Sweden)
Hongli Dong
2014-01-01
Full Text Available In recent years, theoretical and practical research on large-scale networked systems has gained an increasing attention from multiple disciplines including engineering, computer science, and mathematics. Lying in the core part of the area are the distributed estimation and fault detection problems that have recently been attracting growing research interests. In particular, an urgent need has arisen to understand the effects of distributed information structures on filtering and fault detection in sensor networks. In this paper, a bibliographical review is provided on distributed filtering and fault detection problems over sensor networks. The algorithms employed to study the distributed filtering and detection problems are categorised and then discussed. In addition, some recent advances on distributed detection problems for faulty sensors and fault events are also summarized in great detail. Finally, we conclude the paper by outlining future research challenges for distributed filtering and fault detection for sensor networks.
Meijer, E.H.; Ben-Shakhar, G.; Verschuere, B.; Donchin, E.
2013-01-01
In a recent issue of Cognitive Neurodynamics Farwell (Cogn Neurodyn 6:115-154, 2012) published a comprehensive tutorial review of the use of Event Related Brain Potentials (ERP) in the detection of concealed information. Farwell’s review covered much of his own work employing his ‘‘brain
Detection of neutral current events
International Nuclear Information System (INIS)
Innocenti, P.G.
1979-01-01
The topics investigated in the course of the study can be broadly divided into three classes: (i) Inclusive measurements of the scattered electron for the determination of structure functions, scaling violations, deltaL/deltaT and weak interaction effects. (ii) Exclusive measurements of the current jet (momentum, energy, particle composition) for the study of fragmentation functions, for search of new particles, new quarks and QCD effects in the jet. (iii) Search for heavy leptons by detection and identification of their decay products. (orig.)
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. K Mohankumar. Articles written in Journal of Earth System Science. Volume 127 Issue 2 March 2018 pp 30. On the dynamics of an extreme rainfall event in northern India in 2013 · Anu Xavier M G Manoj K Mohankumar · More Details Abstract Fulltext PDF. India experienced ...
Analyzing time-ordered event data with missed observations.
Dokter, Adriaan M; van Loon, E Emiel; Fokkema, Wimke; Lameris, Thomas K; Nolet, Bart A; van der Jeugd, Henk P
2017-09-01
A common problem with observational datasets is that not all events of interest may be detected. For example, observing animals in the wild can difficult when animals move, hide, or cannot be closely approached. We consider time series of events recorded in conditions where events are occasionally missed by observers or observational devices. These time series are not restricted to behavioral protocols, but can be any cyclic or recurring process where discrete outcomes are observed. Undetected events cause biased inferences on the process of interest, and statistical analyses are needed that can identify and correct the compromised detection processes. Missed observations in time series lead to observed time intervals between events at multiples of the true inter-event time, which conveys information on their detection probability. We derive the theoretical probability density function for observed intervals between events that includes a probability of missed detection. Methodology and software tools are provided for analysis of event data with potential observation bias and its removal. The methodology was applied to simulation data and a case study of defecation rate estimation in geese, which is commonly used to estimate their digestive throughput and energetic uptake, or to calculate goose usage of a feeding site from dropping density. Simulations indicate that at a moderate chance to miss arrival events ( p = 0.3), uncorrected arrival intervals were biased upward by up to a factor 3, while parameter values corrected for missed observations were within 1% of their true simulated value. A field case study shows that not accounting for missed observations leads to substantial underestimates of the true defecation rate in geese, and spurious rate differences between sites, which are introduced by differences in observational conditions. These results show that the derived methodology can be used to effectively remove observational biases in time-ordered event
Cheng, Li-Fang; Chen, Tung-Chien; Chen, Liang-Gee
2012-01-01
Most of the abnormal cardiac events such as myocardial ischemia, acute myocardial infarction (AMI) and fatal arrhythmia can be diagnosed through continuous electrocardiogram (ECG) analysis. According to recent clinical research, early detection and alarming of such cardiac events can reduce the time delay to the hospital, and the clinical outcomes of these individuals can be greatly improved. Therefore, it would be helpful if there is a long-term ECG monitoring system with the ability to identify abnormal cardiac events and provide realtime warning for the users. The combination of the wireless body area sensor network (BASN) and the on-sensor ECG processor is a possible solution for this application. In this paper, we aim to design and implement a digital signal processor that is suitable for continuous ECG monitoring and alarming based on the continuous wavelet transform (CWT) through the proposed architectures--using both programmable RISC processor and application specific integrated circuits (ASIC) for performance optimization. According to the implementation results, the power consumption of the proposed processor integrated with an ASIC for CWT computation is only 79.4 mW. Compared with the single-RISC processor, about 91.6% of the power reduction is achieved.
Fischer, M.; Caprio, M.; Cua, G. B.; Heaton, T. H.; Clinton, J. F.; Wiemer, S.
2009-12-01
The Virtual Seismologist (VS) algorithm is a Bayesian approach to earthquake early warning (EEW) being implemented by the Swiss Seismological Service at ETH Zurich. The application of Bayes’ theorem in earthquake early warning states that the most probable source estimate at any given time is a combination of contributions from a likelihood function that evolves in response to incoming data from the on-going earthquake, and selected prior information, which can include factors such as network topology, the Gutenberg-Richter relationship or previously observed seismicity. The VS algorithm was one of three EEW algorithms involved in the California Integrated Seismic Network (CISN) real-time EEW testing and performance evaluation effort. Its compelling real-time performance in California over the last three years has led to its inclusion in the new USGS-funded effort to develop key components of CISN ShakeAlert, a prototype EEW system that could potentially be implemented in California. A significant portion of VS code development was supported by the SAFER EEW project in Europe. We discuss recent enhancements to the VS EEW algorithm. We developed and continue to test a multiple-threshold event detection scheme, which uses different association / location approaches depending on the peak amplitudes associated with an incoming P pick. With this scheme, an event with sufficiently high initial amplitudes can be declared on the basis of a single station, maximizing warning times for damaging events for which EEW is most relevant. Smaller, non-damaging events, which will have lower initial amplitudes, will require more picks to be declared an event to reduce false alarms. This transforms the VS codes from a regional EEW approach reliant on traditional location estimation (and it requirement of at least 4 picks as implemented by the Binder Earthworm phase associator) to a hybrid on-site/regional approach capable of providing a continuously evolving stream of EEW
Station Set Residual: Event Classification Using Historical Distribution of Observing Stations
Procopio, Mike; Lewis, Jennifer; Young, Chris
2010-05-01
Analysts working at the International Data Centre in support of treaty monitoring through the Comprehensive Nuclear-Test-Ban Treaty Organization spend a significant amount of time reviewing hypothesized seismic events produced by an automatic processing system. When reviewing these events to determine their legitimacy, analysts take a variety of approaches that rely heavily on training and past experience. One method used by analysts to gauge the validity of an event involves examining the set of stations involved in the detection of an event. In particular, leveraging past experience, an analyst can say that an event located in a certain part of the world is expected to be detected by Stations A, B, and C. Implicit in this statement is that such an event would usually not be detected by Stations X, Y, or Z. For some well understood parts of the world, the absence of one or more "expected" stations—or the presence of one or more "unexpected" stations—is correlated with a hypothesized event's legitimacy and to its survival to the event bulletin. The primary objective of this research is to formalize and quantify the difference between the observed set of stations detecting some hypothesized event, versus the expected set of stations historically associated with detecting similar nearby events close in magnitude. This Station Set Residual can be quantified in many ways, some of which are correlated with the analysts' determination of whether or not the event is valid. We propose that this Station Set Residual score can be used to screen out certain classes of "false" events produced by automatic processing with a high degree of confidence, reducing the analyst burden. Moreover, we propose that the visualization of the historically expected distribution of detecting stations can be immediately useful as an analyst aid during their review process.
Directory of Open Access Journals (Sweden)
Toshiyuki Sakaeda
Full Text Available OBJECTIVE: Adverse event reports (AERs submitted to the US Food and Drug Administration (FDA were reviewed to assess the muscular and renal adverse events induced by the administration of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA reductase inhibitors (statins and to attempt to determine the rank-order of the association. METHODS: After a revision of arbitrary drug names and the deletion of duplicated submissions, AERs involving pravastatin, simvastatin, atorvastatin, or rosuvastatin were analyzed. Authorized pharmacovigilance tools were used for quantitative detection of signals, i.e., drug-associated adverse events, including the proportional reporting ratio, the reporting odds ratio, the information component given by a Bayesian confidence propagation neural network, and the empirical Bayes geometric mean. Myalgia, rhabdomyolysis and an increase in creatine phosphokinase level were focused on as the muscular adverse events, and acute renal failure, non-acute renal failure, and an increase in blood creatinine level as the renal adverse events. RESULTS: Based on 1,644,220 AERs from 2004 to 2009, signals were detected for 4 statins with respect to myalgia, rhabdomyolysis, and an increase in creatine phosphokinase level, but these signals were stronger for rosuvastatin than pravastatin and atorvastatin. Signals were also detected for acute renal failure, though in the case of atorvastatin, the association was marginal, and furthermore, a signal was not detected for non-acute renal failure or for an increase in blood creatinine level. CONCLUSIONS: Data mining of the FDA's adverse event reporting system, AERS, is useful for examining statin-associated muscular and renal adverse events. The data strongly suggest the necessity of well-organized clinical studies with respect to statin-associated adverse events.
Sakaeda, Toshiyuki; Kadoyama, Kaori; Okuno, Yasushi
2011-01-01
Adverse event reports (AERs) submitted to the US Food and Drug Administration (FDA) were reviewed to assess the muscular and renal adverse events induced by the administration of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) and to attempt to determine the rank-order of the association. After a revision of arbitrary drug names and the deletion of duplicated submissions, AERs involving pravastatin, simvastatin, atorvastatin, or rosuvastatin were analyzed. Authorized pharmacovigilance tools were used for quantitative detection of signals, i.e., drug-associated adverse events, including the proportional reporting ratio, the reporting odds ratio, the information component given by a Bayesian confidence propagation neural network, and the empirical Bayes geometric mean. Myalgia, rhabdomyolysis and an increase in creatine phosphokinase level were focused on as the muscular adverse events, and acute renal failure, non-acute renal failure, and an increase in blood creatinine level as the renal adverse events. Based on 1,644,220 AERs from 2004 to 2009, signals were detected for 4 statins with respect to myalgia, rhabdomyolysis, and an increase in creatine phosphokinase level, but these signals were stronger for rosuvastatin than pravastatin and atorvastatin. Signals were also detected for acute renal failure, though in the case of atorvastatin, the association was marginal, and furthermore, a signal was not detected for non-acute renal failure or for an increase in blood creatinine level. Data mining of the FDA's adverse event reporting system, AERS, is useful for examining statin-associated muscular and renal adverse events. The data strongly suggest the necessity of well-organized clinical studies with respect to statin-associated adverse events.
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. K K Osuri. Articles written in Journal of Earth System Science. Volume 125 Issue 3 April 2016 pp 475-498. Role of land state in a high resolution mesoscale model for simulating the Uttarakhand heavy rainfall event over India · P V Rajesh S Pattnaik D Rai K K Osuri U C ...
The Giant Radio Array for Neutrino Detection
Directory of Open Access Journals (Sweden)
Martineau-Huynh Olivier
2017-01-01
Full Text Available The Giant Radio Array for Neutrino Detection (GRAND is a planned array of ~ 2·105 radio antennas deployed over ~ 200 000 km2 in a mountainous site. It aims primarly at detecting high-energy neutrinos via the observation of extensive air showers induced by the decay in the atmosphere of taus produced by the interaction of cosmic neutrinos under the Earth surface. GRAND aims at reaching a neutrino sensitivity of 5 · 10−11 E−2 GeV−1 cm−2 s−1 sr−1 above 3 · 1016 eV. This ensures the detection of cosmogenic neutrinos in the most pessimistic source models, and ~50 events per year are expected for the standard models. The instrument will also detect UHECRs and possibly FRBs. Here we show how our preliminary design should enable us to reach our sensitivity goals, and discuss the steps to be taken to achieve GRAND, while the compelling science case for GRAND is discussed in more details in [1].
Non-stationary condition monitoring through event alignment
DEFF Research Database (Denmark)
Pontoppidan, Niels Henrik; Larsen, Jan
2004-01-01
We present an event alignment framework which enables change detection in non-stationary signals. change detection. Classical condition monitoring frameworks have been restrained to laboratory settings with stationary operating conditions, which are not resembling real world operation....... In this paper we apply the technique for non-stationary condition monitoring of large diesel engines based on acoustical emission sensor signals. The performance of the event alignment is analyzed in an unsupervised probabilistic detection framework based on outlier detection with either Principal Component...... Analysis or Gaussian Processes modeling. We are especially interested in the true performance of the condition monitoring performance with mixed aligned and unaligned data, e.g. detection of fault condition of unaligned examples versus false alarms of aligned normal condition data. Further, we expect...
International Nuclear Information System (INIS)
Lépine, Sébastien; DiStefano, Rosanne
2012-01-01
Extrapolation of the astrometric motion of the nearby low-mass star VB 10 indicates that sometime in late 2011 December or during the first 2-3 months of 2012, the star will make a close approach to a background point source. Based on astrometric uncertainties, we estimate a 1 in 2 chance that the distance of closest approach ρ min will be less than 100 mas, a 1 in 5 chance that ρ min min J planet on a moderately wide (≈0.18 AU–0.84 AU) orbit, there is a chance (1% to more than 10%, depending on the distance of closest approach and orbital period and inclination) that a passage of the planet closer to the background source will result in a secondary event of higher magnification. The detection of secondary events could be made possible with a several-times-per-night multi-site monitoring campaign.
A Probabilistic Approach to Network Event Formation from Pre-Processed Waveform Data
Kohl, B. C.; Given, J.
2017-12-01
The current state of the art for seismic event detection still largely depends on signal detection at individual sensor stations, including picking accurate arrivals times and correctly identifying phases, and relying on fusion algorithms to associate individual signal detections to form event hypotheses. But increasing computational capability has enabled progress toward the objective of fully utilizing body-wave recordings in an integrated manner to detect events without the necessity of previously recorded ground truth events. In 2011-2012 Leidos (then SAIC) operated a seismic network to monitor activity associated with geothermal field operations in western Nevada. We developed a new association approach for detecting and quantifying events by probabilistically combining pre-processed waveform data to deal with noisy data and clutter at local distance ranges. The ProbDet algorithm maps continuous waveform data into continuous conditional probability traces using a source model (e.g. Brune earthquake or Mueller-Murphy explosion) to map frequency content and an attenuation model to map amplitudes. Event detection and classification is accomplished by combining the conditional probabilities from the entire network using a Bayesian formulation. This approach was successful in producing a high-Pd, low-Pfa automated bulletin for a local network and preliminary tests with regional and teleseismic data show that it has promise for global seismic and nuclear monitoring applications. The approach highlights several features that we believe are essential to achieving low-threshold automated event detection: Minimizes the utilization of individual seismic phase detections - in traditional techniques, errors in signal detection, timing, feature measurement and initial phase ID compound and propagate into errors in event formation, Has a formalized framework that utilizes information from non-detecting stations, Has a formalized framework that utilizes source information, in
Chaari, Lotfi; Vincent, Thomas; Forbes, Florence; Dojat, Michel; Ciuciu, Philippe
2013-01-01
In standard within-subject analyses of event-related fMRI data, two steps are usually performed separately: detection of brain activity and estimation of the hemodynamic response. Because these two steps are inherently linked, we adopt the so-called region-based Joint Detection-Estimation (JDE) framework that addresses this joint issue using a multivariate inference for detection and estimation. JDE is built by making use of a regional bilinear generative model of the BOLD response and constraining the parameter estimation by physiological priors using temporal and spatial information in a Markovian model. In contrast to previous works that use Markov Chain Monte Carlo (MCMC) techniques to sample the resulting intractable posterior distribution, we recast the JDE into a missing data framework and derive a Variational Expectation-Maximization (VEM) algorithm for its inference. A variational approximation is used to approximate the Markovian model in the unsupervised spatially adaptive JDE inference, which allows automatic fine-tuning of spatial regularization parameters. It provides a new algorithm that exhibits interesting properties in terms of estimation error and computational cost compared to the previously used MCMC-based approach. Experiments on artificial and real data show that VEM-JDE is robust to model mis-specification and provides computational gain while maintaining good performance in terms of activation detection and hemodynamic shape recovery. PMID:23096056
Difference Image Analysis of Galactic Microlensing. II. Microlensing Events
Energy Technology Data Exchange (ETDEWEB)
Alcock, C.; Allsman, R. A.; Alves, D.; Axelrod, T. S.; Becker, A. C.; Bennett, D. P.; Cook, K. H.; Drake, A. J.; Freeman, K. C.; Griest, K. (and others)
1999-09-01
The MACHO collaboration has been carrying out difference image analysis (DIA) since 1996 with the aim of increasing the sensitivity to the detection of gravitational microlensing. This is a preliminary report on the application of DIA to galactic bulge images in one field. We show how the DIA technique significantly increases the number of detected lensing events, by removing the positional dependence of traditional photometry schemes and lowering the microlensing event detection threshold. This technique, unlike PSF photometry, gives the unblended colors and positions of the microlensing source stars. We present a set of criteria for selecting microlensing events from objects discovered with this technique. The 16 pixel and classical microlensing events discovered with the DIA technique are presented. (c) (c) 1999. The American Astronomical Society.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Identifying Prominent Life Events on Twitter
Dickinson, Thomas; Fernández, Miriam; Thomas, Lisa A.; Mulholland, Paul; Briggs, Pam; Alani, Harith
2015-01-01
Social media is a common place for people to post and share digital reflections of their life events, including major events such as getting married, having children, graduating, etc. Although the creation of such posts is straightforward, the identification of events on online media remains a challenge. Much research in recent years focused on extracting major events from Twitter, such as earthquakes, storms, and floods. This paper however, targets the automatic detection of personal life ev...
Detection and discrimination of maintenance and de novo CpG methylation events using MethylBreak.
Hsu, William; Mercado, Augustus T; Hsiao, George; Yeh, Jui-Ming; Chen, Chung-Yung
2017-05-15
Understanding the principles governing the establishment and maintenance activities of DNA methyltransferases (DNMTs) can help in the development of predictive biomarkers associated with genetic disorders and diseases. A detection system was developed that distinguishes and quantifies methylation events using methylation-sensitive endonucleases and molecular beacon technology. MethylBreak (MB) is a 22-mer oligonucleotide with one hemimethylated and two unmethylated CpG sites, which are also recognition sites for Sau96I and SacII, and is attached to a fluorophore and a quencher. Maintenance methylation was quantified by fluorescence emission due to the digestion of SacII when the hemimethylated CpG site is methylated, which inhibits Sau96I cleavage. The signal difference between SacII digestion of both MB substrate and maintenance methylated MB corresponds to de novo methylation event. Our technology successfully discriminated and measured both methylation activities at different concentrations of MB and achieved a high correlation coefficient of R 2 =0.997. Additionally, MB was effectively applied to normal and cancer cell lines and in the analysis of enzymatic kinetics and RNA inhibition of recombinant human DNMT1. Copyright © 2017 Elsevier B.V. All rights reserved.
Cua, G. B.; Fischer, M.; Caprio, M.; Heaton, T. H.; Cisn Earthquake Early Warning Project Team
2010-12-01
The Virtual Seismologist (VS) earthquake early warning (EEW) algorithm is one of 3 EEW approaches being incorporated into the California Integrated Seismic Network (CISN) ShakeAlert system, a prototype EEW system that could potentially be implemented in California. The VS algorithm, implemented by the Swiss Seismological Service at ETH Zurich, is a Bayesian approach to EEW, wherein the most probable source estimate at any given time is a combination of contributions from a likehihood function that evolves in response to incoming data from the on-going earthquake, and selected prior information, which can include factors such as network topology, the Gutenberg-Richter relationship or previously observed seismicity. The VS codes have been running in real-time at the Southern California Seismic Network since July 2008, and at the Northern California Seismic Network since February 2009. We discuss recent enhancements to the VS EEW algorithm that are being integrated into CISN ShakeAlert. We developed and continue to test a multiple-threshold event detection scheme, which uses different association / location approaches depending on the peak amplitudes associated with an incoming P pick. With this scheme, an event with sufficiently high initial amplitudes can be declared on the basis of a single station, maximizing warning times for damaging events for which EEW is most relevant. Smaller, non-damaging events, which will have lower initial amplitudes, will require more picks to initiate an event declaration, with the goal of reducing false alarms. This transforms the VS codes from a regional EEW approach reliant on traditional location estimation (and the requirement of at least 4 picks as implemented by the Binder Earthworm phase associator) into an on-site/regional approach capable of providing a continuously evolving stream of EEW information starting from the first P-detection. Real-time and offline analysis on Swiss and California waveform datasets indicate that the
Directory of Open Access Journals (Sweden)
Núñez-Pérez Ricardo Francisco
2014-04-01
Full Text Available Within the signal analysis techniques in the time domain, the crest factor (CF is undoubtedly one of the most simple and fast to implement using electronic circuits and/or software. That's why it has been used reliably to care for machinery and to evaluate the quality of supply. One of the major manufacturers of instruments for these purposes is Bruel and Kjaer and defines the crest factor of voltage or repetitive current signal as the ratio of the peak level and its rms value during a certain period of time. In this paper, we try to find out experimentally the potential of CF and their tendency to detect the nascent and evolution of events in various fields of knowledge, either by generating it with a developed electronic circuit, or with calculations, through routines that are performed with the programs DADISP and LabVIEW. The results are validated and checked for all the above factors and trends through a comparison between them and the proposed features and specifications. The results were acceptable so that the tools were applied to detect early faults in electrical machines, to identify chaosity differences between the circuits with these dynamics, to detect abnormal respiratory distress or rales in patients and to detect harmful distortions in the electrical current, all this based on simulations and measurements for each of the 4 cases studied. Other CF original applications proposed are: a control of chaos in electronic circuits that stir/ mix industrial processes and b correct the power factor of non-linear and inductive loads. A medium-term study and use a CF that considers the maximum signal peak to peak is contemplated, and it is thought that it can improve event detection
International Nuclear Information System (INIS)
Garcia, Humberto E.; Simpson, Michael F.; Lin, Wen-Chiao; Carlson, Reed B.; Yoo, Tae-Sic
2017-01-01
Highlights: • Process monitoring can strengthen nuclear safeguards and material accountancy. • Assessment is conducted at a system-centric level to improve safeguards effectiveness. • Anomaly detection is improved by integrating process and operation relationships. • Decision making is benefited from using sensor and event sequence information. • Formal framework enables optimization of sensor and data processing resources. - Abstract: In this paper, we apply an advanced safeguards approach and associated methods for process monitoring to a hypothetical nuclear material processing system. The assessment regarding the state of the processing facility is conducted at a system-centric level formulated in a hybrid framework. This utilizes architecture for integrating both time- and event-driven data and analysis for decision making. While the time-driven layers of the proposed architecture encompass more traditional process monitoring methods based on time series data and analysis, the event-driven layers encompass operation monitoring methods based on discrete event data and analysis. By integrating process- and operation-related information and methodologies within a unified framework, the task of anomaly detection is greatly improved. This is because decision-making can benefit from not only known time-series relationships among measured signals but also from known event sequence relationships among generated events. This available knowledge at both time series and discrete event layers can then be effectively used to synthesize observation solutions that optimally balance sensor and data processing requirements. The application of the proposed approach is then implemented on an illustrative monitored system based on pyroprocessing and results are discussed.
Determination of the number of ψ(3686) events at BESIII
Ablikim, M.; Achasov, M. N.; Ai, X. C.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Baldini Ferroli, R.; Ban, Y.; Bennett, J. V.; Bertani, M.; Bian, J. M.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Chu, Y. P.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, Y.; Fava, L.; Feldbauer, F.; Feng, C. Q.; Fu, C. D.; Gao, Q.; Gao, Y.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, Y. P.; Han, Y. L.; Harris, F. A.; He, K. L.; He, M.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, H. M.; Hu, T.; Huang, G. S.; Huang, J. S.; Huang, L.; Huang, X. T.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Kloss, B.; Kopf, B.; Kornicer, M.; Kupsc, A.; Kühn, W.; Lai, W.; Lange, J. S.; Lara, M.; Larin, P.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, Kang; Li, Ke; Li, Lei; Li, P. R.; Li, Q. J.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, X. R.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. X.; Liu, F. H.; Liu, Fang.; Liu, Feng.; Liu, H. B.; Liu, H. M.; Liu, Huihui.; Liu, J.; Liu, J. P.; Liu, K.; Liu, K. Y.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang.; Liu, Zhiqing.; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, H. L.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Mao, Y. J.; Mao, Z. P.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ripka, M.; Rong, G.; Sarantsev, A.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Toth, D.; Uman, I.; Varner, G. S.; Wang, B.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q. J.; Wang, W.; Wang, X. F.; Wang(Yadi, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wei, D. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, W. B.; Yan, Y. H.; Yang, H. X.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Zafar, A. A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, L.; Zhang, R.; Zhang, S. H.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Yao.; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling.; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; BESIII Collaboration
2018-02-01
The numbers of ψ(3686) events accumulated by the BESIII detector for the data taken during 2009 and 2012 are determined to be (107.0+/- 0.8)× {10}6 and (341.1+/- 2.1)× {10}6, respectively, by counting inclusive hadronic events, where the uncertainties are systematic and the statistical uncertainties are negligible. The number of events for the sample taken in 2009 is consistent with that of the previous measurement. The total number of ψ(3686) events for the two data taking periods is (448.1+/- 2.9)× {10}6. Supported by the Ministry of Science and Technology of China (2009CB825200), National Natural Science Foundation of China (NSFC) (11235011, 11322544, 11335008, 11425524, 11475207), the Chinese Academy of Sciences (CAS) Large-Scale Scientific Facility Program, the Collaborative Innovation Center for Particles and Interactions (CICPI), Joint Large-Scale Scientific Facility Funds of the NSFC and CAS (11179014), Joint Large-Scale Scientific Facility Funds of the NSFC and CAS (11179007, U1232201, U1532257, U1532258), Joint Funds of the National Natural Science Foundation of China (11079008), CAS (KJCX2-YW-N29, KJCX2-YW-N45), 100 Talents Program of CAS, National 1000 Talents Program of China, German Research Foundation DFG (Collaborative Research Center CRC 1044), Istituto Nazionale di Fisica Nucleare, Italy, Koninklijke Nederlandse Akademie van Wetenschappen (KNAW) (530-4CDP03), Ministry of Development of Turkey (DPT2006K-120470), National Natural Science Foundation of China (11205082), The Swedish Research Council, U. S. Department of Energy (DE-FG02-05ER41374, DE-SC-0010118, DE-SC-0010504), U.S. National Science Foundation, University of Groningen (RuG) and the Helmholtzzentrum fuer Schwerionenforschung GmbH (GSI), Darmstadt, WCU Program of National Research Foundation of Korea (R32-2008-000-10155-0).
PROSPECTS FOR THE DETECTION OF FAST RADIO BURSTS WITH THE MURCHISON WIDEFIELD ARRAY
International Nuclear Information System (INIS)
Trott, Cathryn M.; Tingay, Steven J.; Wayth, Randall B.
2013-01-01
Fast radio bursts (FRBs) are short timescale ( 2 ) and wide field-of-view (FOV, ∼ 1000 deg 2 at ν = 200 MHz). We compute the expected number of FRB detections for the MWA assuming a source population consistent with the reported detections. Our formalism properly accounts for the frequency-dependence of the antenna primary beam, the MWA system temperature, and unknown spectral index of the source population, for three modes of FRB detection: coherent; incoherent; and fast imaging. We find that the MWA's sensitivity and large FOV combine to provide the expectation of multiple detectable events per week in all modes, potentially making it an excellent high time resolution science instrument. Deviations of the expected number of detections from actual results will provide a strong constraint on the assumptions made for the underlying source population and intervening plasma distribution
DEFF Research Database (Denmark)
Svendsen, Michael; Lauersen, Christian Ulrich
2015-01-01
At the Faculty Library of Social Sciences (part of Copenhagen University Library) we are currently working intensely towards the establishment of a Digital Social Science Lab (DSSL). The purpose of the lab is to connect research, education and learning processes with the use of digital tools...... at the Faculty of Social Sciences. DSSL will host and facilitate an 80 m2 large mobile and intelligent study- and learning environment with a focus on academic events, teaching and collaboration. Besides the physical settings DSSL has two primary functions: 1. To implement relevant social scientific software...... and hardware at the disposal for students and staff at The Faculty of Social Sciences along with instruction and teaching in the different types of software, e.g. Stata, Nvivo, Atlas.ti, R Studio, Zotero and GIS-software. 2. To facilitate academic events focusing on use of digital tools and analytic software...
Fenner-Crisp, Penelope A
2012-12-01
Contaminants are undesirable constituents in food. They may be formed during production of a processed food, present as a component in a source material, deliberately added to substitute for the proper substance, or the consequence of poor food-handling practices. Contaminants may be chemicals or pathogens. Chemicals generally degrade over time and become of less concern as a health threat. Pathogens have the ability to multiply, potentially resulting in an increased threat level. Formal structures have been lacking for systematically generating and evaluating hazard and exposure data for bioactive agents when problem situations arise. We need to know what the potential risk may be to determine whether intervention to reduce or eliminate contact with the contaminant is warranted. We need tools to aid us in assembling and assessing all available relevant information in an expeditious and scientifically sound manner. One such tool is the International Life Sciences Institute (ILSI) Key Events Dose-Response Framework (KEDRF). Developed as an extension of the WHO's International Program on Chemical Safety/ILSI mode of action/human relevance framework, it allows risk assessors to understand not only how a contaminant exerts its toxicity but also the dose response(s) for each key event and the ultimate outcome, including whether a threshold exists. This presentation will illustrate use of the KEDRF with case studies included in its development (chloroform and Listeriaonocytogenes) after its publication in the peer-reviewed scientific literature (chromium VI) and in a work in progress (3-monochloro-1, 2-propanediol).
Motivation of volunteers at disability sports events: A comparative ...
African Journals Online (AJOL)
Motivation of volunteers at disability sports events: A comparative study of volunteers in Malaysia, South Africa and the United States. ... African Journal for Physical Activity and Health Sciences. Journal Home ... Very few cross-cultural comparisons have been done to assess the motivations of volunteers at similar events.
Murray, Marissa
This past summer I interned at the American Institute of Physics and helped research and write articles for the FYI Science Policy Bulletin. FYI is an objective digest of science policy developments in Washington, D.C. that impact the greater physical sciences community. Over the course of the summer, I independently attended, analyzed, and reported on a variety of science, technology, and funding related events including congressional hearings, government agency advisory committee meetings, and scientific society events. I wrote and co-wrote three articles on basic energy research legislation, the National Institute of Standards and Technology improvement act, and the National Science Foundation's big ideas for future investment. I had the opportunity to examine some challenging questions such as what is the role of government in funding applied research? How should science priorities be set? What is the right balance of funding across different agencies and programs? I learned about how science policy is a two-way street: science is used to inform policy decisions and policy is made to fund and regulate the conduct of science. I will conclude with how my summer working with FYI showed me the importance of science advocacy, being informed, and voting. Society of Physics Students.
DISK DETECTIVE: DISCOVERY OF NEW CIRCUMSTELLAR DISK CANDIDATES THROUGH CITIZEN SCIENCE
Energy Technology Data Exchange (ETDEWEB)
Kuchner, Marc J.; McElwain, Michael; Padgett, Deborah L. [NASA Goddard Space Flight Center Exoplanets and Stellar Astrophysics Laboratory, Code 667 Greenbelt, MD 21230 (United States); Silverberg, Steven M.; Wisniewski, John P. [Homer L. Dodge Department of Physics and Astronomy The University of Oklahoma 440 W. Brooks St. Norman, OK 73019 (United States); Bans, Alissa S. [Valparaiso University, Department of Physics and Astronomy, Neils Science Center, 1610 Campus Drive East, Valparaiso, IN 46383 (United States); Bhattacharjee, Shambo [International Space University 1 Rue Jean-Dominique Cassini F-67400 Illkirch-Graffenstaden (France); Kenyon, Scott J. [Smithsonian Astrophysical Observatory 60 Garden Street Cambridge, MA 02138 (United States); Debes, John H. [Space Telescope Science Institute 3700 San Martin Dr. Baltimore, MD 21218 (United States); Currie, Thayne [National Astronomical Observatory of Japan 650 N A’ohokhu Place Hilo, HI 96720 (United States); García, Luciano [Observatorio Astronómico de Córdoba Universidad Nacional de Córdoba Laprida 854, X5000BGR, Córdoba (Argentina); Jung, Dawoon [Korea Aerospace Research Institute Lunar Exploration Program Office 169-84 Gwahak-ro, Yuseong-gu, Daejeon 34133 (Korea, Republic of); Lintott, Chris [Denys Wilkinson Building Keble Road Oxford, OX1 3RH (United Kingdom); Rebull, Luisa M. [Infrared Processing and Analaysis Center Caltech M/S 314-6 1200 E. California Blvd. Pasadena, CA 91125 (United States); Nesvold, Erika, E-mail: Marc.Kuchner@nasa.gov, E-mail: michael.w.mcelwain@nasa.gov, E-mail: deborah.l.padgett@nasa.gov, E-mail: carol.a.grady@nasa.gov, E-mail: silverberg@ou.edu, E-mail: wisniewski@ou.edu [Department of Terrestrial Magnetism, Carnegie Institution of Washington, 5241 Broad Branch Road, NW, Washington, DC 20015-1305 (United States); Collaboration: Disk Detective Collaboration; and others
2016-10-20
The Disk Detective citizen science project aims to find new stars with 22 μ m excess emission from circumstellar dust using data from NASA’s Wide-field Infrared Survey Explorer ( WISE ) mission. Initial cuts on the AllWISE catalog provide an input catalog of 277,686 sources. Volunteers then view images of each source online in 10 different bands to identify false positives (galaxies, interstellar matter, image artifacts, etc.). Sources that survive this online vetting are followed up with spectroscopy on the FLWO Tillinghast telescope. This approach should allow us to unleash the full potential of WISE for finding new debris disks and protoplanetary disks. We announce a first list of 37 new disk candidates discovered by the project, and we describe our vetting and follow-up process. One of these systems appears to contain the first debris disk discovered around a star with a white dwarf companion: HD 74389. We also report four newly discovered classical Be stars (HD 6612, HD 7406, HD 164137, and HD 218546) and a new detection of 22 μ m excess around the previously known debris disk host star HD 22128.
DISK DETECTIVE: DISCOVERY OF NEW CIRCUMSTELLAR DISK CANDIDATES THROUGH CITIZEN SCIENCE
International Nuclear Information System (INIS)
Kuchner, Marc J.; McElwain, Michael; Padgett, Deborah L.; Silverberg, Steven M.; Wisniewski, John P.; Bans, Alissa S.; Bhattacharjee, Shambo; Kenyon, Scott J.; Debes, John H.; Currie, Thayne; García, Luciano; Jung, Dawoon; Lintott, Chris; Rebull, Luisa M.; Nesvold, Erika
2016-01-01
The Disk Detective citizen science project aims to find new stars with 22 μ m excess emission from circumstellar dust using data from NASA’s Wide-field Infrared Survey Explorer ( WISE ) mission. Initial cuts on the AllWISE catalog provide an input catalog of 277,686 sources. Volunteers then view images of each source online in 10 different bands to identify false positives (galaxies, interstellar matter, image artifacts, etc.). Sources that survive this online vetting are followed up with spectroscopy on the FLWO Tillinghast telescope. This approach should allow us to unleash the full potential of WISE for finding new debris disks and protoplanetary disks. We announce a first list of 37 new disk candidates discovered by the project, and we describe our vetting and follow-up process. One of these systems appears to contain the first debris disk discovered around a star with a white dwarf companion: HD 74389. We also report four newly discovered classical Be stars (HD 6612, HD 7406, HD 164137, and HD 218546) and a new detection of 22 μ m excess around the previously known debris disk host star HD 22128.
Disk Detective: Discovery of New Circumstellar Disk Candidates Through Citizen Science
Kuchner, Marc J.; Silverberg, Steven M.; Bans, Alissa S.; Bhattacharjee, Shambo; Kenyon, Scott J.; Debes, John H.; Currie, Thayne; Garcia, Luciano; Jung, Dawoon; Lintott, Chris;
2016-01-01
The Disk Detective citizen science project aims to find new stars with 22 micron excess emission from circumstellar dust using data from NASAs Wide-field Infrared Survey Explorer (WISE) mission. Initial cuts on the AllWISE catalog provide an input catalog of 277,686 sources. Volunteers then view images of each source online in 10different bands to identify false positives (galaxies, interstellar matter, image artifacts, etc.). Sources that survive this online vetting are followed up with spectroscopy on the FLWO Tillinghast telescope. This approach should allow us to unleash the full potential of WISE for finding new debris disks and proto planetary disks. We announce a first list of 37 new disk candidates discovered by the project, and we describe our vetting and follow-up process. One of these systems appears to contain the first debris disk discovered around a star with a white dwarf companion: HD 74389. We also report four newly discovered classical Be stars (HD 6612, HD 7406, HD 164137,and HD 218546) and a new detection of 22 micron excess around the previously known debris disk host star HD 22128.
On causality of extreme events
Directory of Open Access Journals (Sweden)
Massimiliano Zanin
2016-06-01
Full Text Available Multiple metrics have been developed to detect causality relations between data describing the elements constituting complex systems, all of them considering their evolution through time. Here we propose a metric able to detect causality within static data sets, by analysing how extreme events in one element correspond to the appearance of extreme events in a second one. The metric is able to detect non-linear causalities; to analyse both cross-sectional and longitudinal data sets; and to discriminate between real causalities and correlations caused by confounding factors. We validate the metric through synthetic data, dynamical and chaotic systems, and data representing the human brain activity in a cognitive task. We further show how the proposed metric is able to outperform classical causality metrics, provided non-linear relationships are present and large enough data sets are available.
Directory of Open Access Journals (Sweden)
Michael D. Besmer
2017-11-01
Full Text Available Monitoring of microbial drinking water quality is a key component for ensuring safety and understanding risk, but conventional monitoring strategies are typically based on low sampling frequencies (e.g., quarterly or monthly. This is of concern because many drinking water sources, such as karstic springs are often subject to changes in bacterial concentrations on much shorter time scales (e.g., hours to days, for example after precipitation events. Microbial contamination events are crucial from a risk assessment perspective and should therefore be targeted by monitoring strategies to establish both the frequency of their occurrence and the magnitude of bacterial peak concentrations. In this study we used monitoring data from two specific karstic springs. We assessed the performance of conventional monitoring based on historical records and tested a number of alternative strategies based on a high-resolution data set of bacterial concentrations in spring water collected with online flow cytometry (FCM. We quantified the effect of increasing sampling frequency and found that for the specific case studied, at least bi-weekly sampling would be needed to detect precipitation events with a probability of >90%. We then proposed an optimized monitoring strategy with three targeted samples per event, triggered by precipitation measurements. This approach is more effective and efficient than simply increasing overall sampling frequency. It would enable the water utility to (1 analyze any relevant event and (2 limit median underestimation of peak concentrations to approximately 10%. We conclude with a generalized perspective on sampling optimization and argue that the assessment of short-term dynamics causing microbial peak loads initially requires increased sampling/analysis efforts, but can be optimized subsequently to account for limited resources. This offers water utilities and public health authorities systematic ways to evaluate and optimize their
Radionuclide data analysis in connection of DPRK event in May 2009
Nikkinen, Mika; Becker, Andreas; Zähringer, Matthias; Polphong, Pornsri; Pires, Carla; Assef, Thierry; Han, Dongmei
2010-05-01
The seismic event detected in DPRK on 25.5.2009 was triggering a series of actions within CTBTO/PTS to ensure its preparedness to detect any radionuclide emissions possibly linked with the event. Despite meticulous work to detect and verify, traces linked to the DPRK event were not found. After three weeks of high alert the PTS resumed back to normal operational routine. This case illuminates the importance of objectivity and procedural approach in the data evaluation. All the data coming from particulate and noble gas stations were evaluated daily, some of the samples even outside of office hours and during the weekends. Standard procedures were used to determine the network detection thresholds of the key (CTBT relevant) radionuclides achieved across the DPRK event area and for the assessment of radionuclides typically occurring at IMS stations (background history). Noble gas system has sometimes detections that are typical for the sites due to legitimate non-nuclear test related activities. Therefore, set of hypothesis were used to see if the detection is consistent with event time and location through atmospheric transport modelling. Also the consistency of event timing and isotopic ratios was used in the evaluation work. As a result it was concluded that if even 1/1000 of noble gasses from a nuclear detonation would had leaked, the IMS system would not had problems to detect it. This case also showed the importance of on-site inspections to verify the nuclear traces of possible tests.
Energy Technology Data Exchange (ETDEWEB)
Blackburn, L.; Camp, J. [NASA/Goddard Space Flight Center, Greenbelt, MD (United States); Briggs, M. S.; Connaughton, V.; Jenke, P. [University of Alabama in Huntsville, Huntsville, AL (United States); Christensen, N. [Carleton College, Northfield, MN (United States); Remillard, R. A. [Massachussetts Institute of Technology, Cambridge, MA (United States); Veitch, J. [University of Birmingham, Birmingham (United Kingdom)
2015-03-15
We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15–20%.
Blackburn, L.; Briggs, M. S.; Camp, J.; Christensen, N.; Connaughton, V.; Jenke, P.; Remillard, R. A.; Veitch, J.
2015-01-01
We present two different search methods for electromagnetic counterparts to gravitational-wave (GW) events from ground-based detectors using archival NASA high-energy data from the Fermi Gamma-ray Burst Monitor (GBM) and RXTE All-sky Monitor (ASM) instruments. To demonstrate the methods, we use a limited number of representative GW background noise events produced by a search for binary neutron star coalescence over the last two months of the LIGO-Virgo S6/VSR3 joint science run. Time and sky location provided by the GW data trigger a targeted search in the high-energy photon data. We use two custom pipelines: one to search for prompt gamma-ray counterparts in GBM, and the other to search for a variety of X-ray afterglow model signals in ASM. We measure the efficiency of the joint pipelines to weak gamma-ray burst counterparts, and a family of model X-ray afterglows. By requiring a detectable signal in either electromagnetic instrument coincident with a GW event, we are able to reject a large majority of GW candidates. This reduces the signal-to-noise ratio of the loudest surviving GW background event by around 15-20 percent.
Computing, Environment and Life Sciences | Argonne National Laboratory
Computing, Environment and Life Sciences Research Divisions BIOBiosciences CPSComputational Science DSLData Argonne Leadership Computing Facility Biosciences Division Environmental Science Division Mathematics and Computer Science Division Facilities and Institutes Argonne Leadership Computing Facility News Events About
Directory of Open Access Journals (Sweden)
Bogdan Ołdakowski
2008-03-01
Full Text Available The Baltic Sea Science Congress was held at Rostock University, Germany, from 19 to 22 March 2007. In the session entitled"Upwelling events, coastal offshore exchange, links to biogeochemical processes" 20 presentations were given,including 7 talks and 13 posters related to the theme of the session.This paper summarises new findings of the upwelling-related studies reported in the session. It deals with investigationsbased on the use of in situ and remote sensing measurements as well as numerical modelling tools. The biogeochemicalimplications of upwelling are also discussed.Our knowledge of the fine structure and dynamic considerations of upwelling has increased in recent decades with the advent ofhigh-resolution modern measurement techniques and modelling studies. The forcing and the overall structure, duration and intensity ofupwelling events are understood quite well. However, the quantification of related transports and the contribution to the overall mixingof upwelling requires further research. Furthermore, our knowledge of the links between upwelling and biogeochemical processes is stillincomplete. Numerical modelling has advanced to the extent that horizontal resolutions of c. 0.5 nautical miles can now be applied,which allows the complete spectrum of meso-scale features to be described. Even the development of filaments can be describedrealistically in comparison with high-resolution satellite data.But the effect of upwelling at a basin scale and possible changes under changing climatic conditions remain open questions.
De Raedt, Hans; Delina, M; Jin, Fengping; Michielsen, Kristel
2012-01-01
A corpuscular simulation model of optical phenomena that does not require knowledge of the solution of a wave equation of the whole system and reproduces the results of Maxwell's theory by generating detection events one by one is discussed. The event-based corpuscular model gives a unified
The CAULDRON game: Helping decision makers understand extreme weather event attribution
Walton, P.; Otto, F. E. L.
2014-12-01
There is a recognition from academics and stakeholders that climate science has a fundamental role to play in the decision making process, but too frequently there is still uncertainty about what, when, how and why to use it. Stakeholders suggest that it is because the science is presented in an inaccessible manner, while academics suggest it is because the stakeholders do not have the scientific knowledge to understand and apply the science appropriately. What is apparent is that stakeholders need support, and that there is an onus on academia to provide it. This support is even more important with recent developments in climate science, such as extreme weather event attribution. We are already seeing the impacts of extreme weather events around the world causing lost of life and damage to property and infrastructure with current research suggesting that these events could become more frequent and more intense. If this is to be the case then a better understanding of the science will be vital in developing robust adaptation and business planning. The use of games, role playing and simulations to aid learning has long been understood in education but less so as a tool to support stakeholder understanding of climate science. Providing a 'safe' space where participants can actively engage with concepts, ideas and often emotions, can lead to deep understanding that is not possible through more passive mechanisms such as papers and web sites. This paper reports on a game that was developed through a collaboration led by the Red Cross/Red Crescent, University of Oxford and University of Reading to help stakeholders understand the role of weather event attribution in the decision making process. The game has already been played successfully at a number of high profile events including COP 19 and the African Climate Conference. It has also been used with students as part of a postgraduate environmental management course. As well as describing the design principles of the
Events at the Globe of Science and Innovation
2006-01-01
CERN is organising a series of lectures based on the exhibition 'A des années-lumière' Thursday, 2 November, 8.00 p.m. (in French): Does time exist? Etienne Klein, Director of the CEA's Materials Science Research Laboratory Time is hard to define. Even though it seems quite a simple notion on the surface, its complexity soon becomes apparent. It is not always easy for us to visualise this inherently ambivalent concept. First of all, does time really exist or is it simply an illusion? Over time, philosophers have put forward just as many arguments in favour of its existence as against it. Does physics have a role to play in the debate and, if so, what kind of role? This lecture is part of the 'Fête de la Science' programme. Lectures for the general public. By reservation only: + 41 (0)22 767 76 76 Information on future meetings: Thursday, 16 November, 8.00 p.m. (in French): Antimatter in the Milky Way Jacques Paul, scientific advisor to the European Space Agency's INTEGRAL mission Tuesday, 21 November, ...
Events at the Globe of Science and Innovation
2006-01-01
CERN is organising a series of lectures based on the exhibition 'A des années-lumière' Thursday 12 October, 8.00 p.m. (in French) - From physics to medical imaging Paul Lecoq, a CERN physicist, and Professor Olivier Mundler from the Timone Hospital (Marseille) The technologies developed at CERN are widely used in fields other than particle physics. Medicine, and medical imaging in particular, has directly benefited from the work done on particle detectors. Come and meet a doctor and a physicist and learn about one of the practical applications of fundamental research. This lecture is part of the 'Fête de la Science' programme Lectures for the general public By reservation only: +41 (0)22 767 76 76 Information on future meetings : Thursday 2 November, 8.00 p.m. (in French) - Does time exist? Etienne Klein, Director of the CEA's materials science research laboratory Thursday 16 November, 8.00 p.m. (in French) - Antimatter in the Milky Way Jacques Paul, scientific advisor to the European Space...
Changing the face of science: Lessons from the 2017 Science-A-Thon
Barnes, R. T.; Licker, R.; Burt, M. A.; Holloway, T.
2017-12-01
Studies have shown that over two-thirds of Americans cannot name a living scientist. This disconnect is a concern for science and scientists, considering the large role of public funding for science, and the importance of science in many policy issues. As a large-scale public outreach initiative and fundraiser, the Earth Science Women's Network (ESWN) launched "Science-A-Thon" on July 13, 2017. This "day of science" invited participants to share 12 photos over 12 hours of a day, including both personal routines and professional endeavors. Over 200 scientists participated, with the #DayofScience hashtag trending on Twitter for the day. Earth scientists represented the largest portion of participants, but the event engaged cancer biologists, computer scientists, and more, including scientists from more than 10 countries. Science-A-Thon builds on the success and visibility of other social media campaigns, such as #actuallivingscientist and #DresslikeaWoman. Importantly these efforts share a common goal, by providing diverse images of scientists we can shift the public perception of who a scientist is and what science looks like in the real world. This type of public engagement offers a wide range of potential role models for students, and individual stories to increase public engagement with science. Social media campaigns such as this shift the public perception of who scientists are, why they do what they do, and what they do each day. The actions and conversations emerging from Science-A-Thon included scientists talking about (1) their science and motivation, (2) the purpose and need for ESWN, and (3) why they chose to participate in this event increased the reach of a social media campaign and fundraiser.
2010-06-01
Figures Figure Page 2.1. Verizon Data Breach Report: Detective Controls by percent of breach victims. [11...immature, operationally speaking. Figure 2.1: Verizon Data Breach Report: Detective Controls by percent of breach victims. [11] 7 The 2008 CSI Computer...Christopher Novak, Christopher Porter, Bryan Sartin, Peter Tippett, and J. Andrew Valentine. Data Breach Investigations Report. Technical report
2017-11-01
6201 Fort Belvoir, VA 22060-6201 T E C H N IC A L R E P O R T DTRA-TR-15-82 Radiological and Nuclear Detection Material Science : Novel...P.A. Dowben, “Surface Charging at the (100) Surface of Cu doped and undoped Li2B4O7”, Applied Surface Science 257 (2011) 3399-3403 27. S.R...V.T. Adamiv, Ya.V. Burak, P.A. Dowben, “The local structure of Mn doped Li2B4O7(001)”, in preparation for Materials Science and Engineering B 40. C
Interferences and events on epistemic shifts in physics through computer simulations
Warnke, Martin
2017-01-01
Computer simulations are omnipresent media in today's knowledge production. For scientific endeavors such as the detection of gravitational waves and the exploration of subatomic worlds, simulations are essential; however, the epistemic status of computer simulations is rather controversial as they are neither just theory nor just experiment. Therefore, computer simulations have challenged well-established insights and common scientific practices as well as our very understanding of knowledge. This volume contributes to the ongoing discussion on the epistemic position of computer simulations in a variety of physical disciplines, such as quantum optics, quantum mechanics, and computational physics. Originating from an interdisciplinary event, it shows that accounts of contemporary physics can constructively interfere with media theory, philosophy, and the history of science.
Materials science for nuclear detection
Peurrung, Anthony
2008-01-01
The increasing importance of nuclear detection technology has led to a variety of research efforts that seek to accelerate the discovery and development of useful new radiation detection materials. These efforts aim to improve our understanding of how these materials perform, develop formalized discovery tools, and enable rapid and effective performance characterization. We provide an overview of these efforts along with an introduction to the history, physics, and taxonomy of radiation detec...
Analyzing time-ordered event data with missed observations
Dokter, Adriaan M.; van Loon, E. Emiel; Fokkema, Wimke; Lameris, Thomas K.; Nolet, Bart A.; van der Jeugd, Henk P.
2017-01-01
A common problem with observational datasets is that not all events of interest may be detected. For example, observing animals in the wild can difficult when animals move, hide, or cannot be closely approached. We consider time series of events recorded in conditions where events are occasionally
ATLAS EventIndex General Dataflow and Monitoring Infrastructure
Fernandez Casani, Alvaro; The ATLAS collaboration
2016-01-01
The ATLAS EventIndex has been running in production since mid-2015, reliably collecting information worldwide about all produced events and storing them in a central Hadoop infrastructure at CERN. A subset of this information is copied to an Oracle relational database for fast access. The system design and its optimization is serving event picking from requests of a few events up to scales of tens of thousand of events, and in addition, data consistency checks are performed for large production campaigns. Detecting duplicate events with a scope of physics collections has recently arisen as an important use case. This paper describes the general architecture of the project and the data flow and operation issues, which are addressed by recent developments to improve the throughput of the overall system. In this direction, the data collection system is reducing the usage of the messaging infrastructure to overcome the performance shortcomings detected during production peaks; an object storage approach is instea...
Madden, Lauren; Seifried, Joyce; Farnum, Kerry; D'Armiento, Angela
2016-01-01
Discrepant events are often used by science educators to incite interest and excitement in learners, yet sometimes their results are farther-reaching. The following article describes how one such event--dissolving packing peanuts in acetone--led to a change in the course of a college-level elementary science teaching methods class and to the…
Directory of Open Access Journals (Sweden)
D. K. Papoulias
2015-01-01
Full Text Available In this work, we explore ν-nucleus processes from a nuclear theory point of view and obtain results with high confidence level based on accurate nuclear structure cross sections calculations. Besides cross sections, the present study includes simulated signals expected to be recorded by nuclear detectors and differential event rates as well as total number of events predicted to be measured. Our original cross sections calculations are focused on measurable rates for the standard model process, but we also perform calculations for various channels of the nonstandard neutrino-nucleus reactions and come out with promising results within the current upper limits of the corresponding exotic parameters. We concentrate on the possibility of detecting (i supernova neutrinos by using massive detectors like those of the GERDA and SuperCDMS dark matter experiments and (ii laboratory neutrinos produced near the spallation neutron source facilities (at Oak Ridge National Lab by the COHERENT experiment. Our nuclear calculations take advantage of the relevant experimental sensitivity and employ the severe bounds extracted for the exotic parameters entering the Lagrangians of various particle physics models and specifically those resulting from the charged lepton flavour violating μ-→e- experiments (Mu2e and COMET experiments.
Engaging Youth in Climate Change Issues with Family Science Day Activities
Brevik, Corinne E.; Brevik, Eric C.; Steffan, Joshua J.
2016-04-01
Dickinson State University organizes four Family Science Day events each fall during the months of September, October, November, and December. Activities are geared toward elementary-aged children to increase student engagement in the sciences. Offered on Saturday afternoons, each event focuses on a different science-related theme. Families can attend these events free of charge, and the kids participate in a large variety of hands-on activities that center around the event's theme. This year, the November event focused on climate change, including an emphasis on the roles soil plays in the climate system. The timing of this topic was carefully chosen. 2015 has been declared the International Year of Soil by the United Nations, and the Soil Science Society of America theme for the month of November was Soils and Climate. This public outreach event was an amazing opportunity to help the youth in our community learn about climate change in a fun, interactive environment. Climate changes in the past, present, and future were emphasized. Activities including the Farming Game, painting with soils, taking Jello "cores", creating a cloud in a jar, and making a glacier in a bag helped children learn how science is a process of discovery that allows them to better understand the world they live in. In addition to the hands-on activities, a planetarium show focused on climate change was also offered during the event, surrounding the kids and their parents in a fully immersive, 360-degree show that allowed them to personally observe phenomena that are otherwise difficult to visualize. All of the activities at the Family Science Day event were staffed by university students, and this proved to be a very valuable experience for them as well. Some of the students who helped are majoring in a science field, and for them, the experience taught public communication. They learned to break complicated concepts down into simpler terms that young kids could understand. Education
MeerLICHT and BlackGEM: custom-built telescopes to detect faint optical transients
Bloemen, Steven; Groot, Paul; Woudt, Patrick; Klein Wolt, Marc; McBride, Vanessa; Nelemans, Gijs; Körding, Elmar; Pretorius, Margaretha L.; Roelfsema, Ronald; Bettonvil, Felix; Balster, Harry; Bakker, Roy; Dolron, Peter; van Elteren, Arjen; Elswijk, Eddy; Engels, Arno; Fender, Rob; Fokker, Marc; de Haan, Menno; Hagoort, Klaas; de Hoog, Jasper; ter Horst, Rik; van der Kevie, Giel; Kozłowski, Stanisław; Kragt, Jan; Lech, Grzegorz; Le Poole, Rudolf; Lesman, Dirk; Morren, Johan; Navarro, Ramon; Paalberends, Willem-Jelle; Paterson, Kerry; Pawłaszek, Rafal; Pessemier, Wim; Raskin, Gert; Rutten, Harrie; Scheers, Bart; Schuil, Menno; Sybilski, Piotr W.
2016-07-01
We present the MeerLICHT and BlackGEM telescopes, which are wide-field optical telescopes that are currently being built to study transient phenomena, gravitational wave counterparts and variable stars. The telescopes have 65 cm primary mirrors and a 2.7 square degree field-of-view. The MeerLICHT and BlackGEM projects have different science goals, but will use identical telescopes. The first telescope, MeerLICHT, will be commissioned at Sutherland (South Africa) in the first quarter of 2017. It will co-point with MeerKAT to collect optical data commensurate with the radio observations. After careful analysis of MeerLICHT's performance, three telescopes of the same type will be commissioned in La Silla (Chile) in 2018 to form phase I of the BlackGEM array. BlackGEM aims at detecting and characterizing optical counterparts of gravitational wave events detected by Advanced LIGO and Virgo. In this contribution we present an overview of the science goals, the design and the status of the two projects.
Rule-Based Event Processing and Reaction Rules
Paschke, Adrian; Kozlenkov, Alexander
Reaction rules and event processing technologies play a key role in making business and IT / Internet infrastructures more agile and active. While event processing is concerned with detecting events from large event clouds or streams in almost real-time, reaction rules are concerned with the invocation of actions in response to events and actionable situations. They state the conditions under which actions must be taken. In the last decades various reaction rule and event processing approaches have been developed, which for the most part have been advanced separately. In this paper we survey reaction rule approaches and rule-based event processing systems and languages.
Microbeam mapping of single event latchups and single event upsets in CMOS SRAMs
International Nuclear Information System (INIS)
Barak, J.; Adler, E.; Fischer, B.E.; Schloegl, M.; Metzger, S.
1998-01-01
The first simultaneous microbeam mapping of single event upset (SEU) and latchup (SEL) in the CMOS RAM HM65162 is presented. The authors found that the shapes of the sensitive areas depend on V DD , on the ions being used and on the site on the chip being hit by the ion. In particular, they found SEL sensitive sites close to the main power supply lines between the memory-bit-arrays by detecting the accompanying current surge. All these SELs were also accompanied by bit-flips elsewhere in the memory (which they call indirect SEUs in contrast to the well known SEUs induced in the hit memory cell only). When identical SEL sensitive sites were hit farther away from the supply lines only indirect SEL sensitive sites could be detected. They interpret these events as latent latchups in contrast to the classical ones detected by their induced current surge. These latent SELs were probably decoupled from the main supply lines by the high resistivity of the local supply lines
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
2018-03-14
Mar 14, 2018 ... Cloud security; network security; anomaly detection; network traffic analysis; DDoS attack detection. ... Department of Computer Science and Engineering, Indian Institute of Technology Roorkee, Roorkee 247667, India; Department of Applied Science and Engineering, Indian Institute of Technology ...
African Journals Online (AJOL)
Aims and scope: The Western Indian Ocean Journal of Marine Science provides an avenue for the wide dissem- ... consist of special issues on major events or important thematic issues. ... of sources, including plant and animal by- products.
Science-based risk assessments for rare events in a changing climate
Sobel, A. H.; Tippett, M. K.; Camargo, S. J.; Lee, C. Y.; Allen, J. T.
2014-12-01
History shows that substantial investments in protection against any specific type of natural disaster usually occur only after (usually shortly after) that specific type of disaster has happened in a given place. This is true even when it was well known before the event that there was a significant risk that it could occur. Presumably what psychologists Kahneman and Tversky have called "availability bias" is responsible, at least in part, for these failures to act on known but out-of-sample risks. While understandable, this human tendency prepares us poorly for events which are very rare (on the time scales of human lives) and even more poorly for a changing climate, as historical records become a poorer guide. A more forward-thinking and rational approach would require scientific risk assessments that can place meaningful probabilities on events that are rare enough to be absent from the historical record, and that can account for the influences of both anthropogenic climate change and low-frequency natural climate variability. The set of tools available for doing such risk assessments is still quite limited, particularly for some of the most extreme events such as tropical cyclones and tornadoes. We will briefly assess the state of the art for these events in particular, and describe some of our ongoing research to develop new tools for quantitative risk assessment using hybrids of statistical methods and physical understanding of the hazards.
American Academy of Forensic Sciences
... Programs Courses in Forensic Odontology Choosing a Career What is Forensic Science? What Do Forensic Scientists Do? What’s a Forensic Scientist? ... ve Decided You Want a Career in Forensic Science … Now What? Young Forensic Scientists Forum (YFSF) Annual Meeting Events ...
Pazmino, J.
2012-06-01
(Abstract only) New York City in the late 20th century rose to be a planetary capital for the sciences, not just astronomy. This growth was mainly in the academic sector but a parallel growth occurred in the public and home field. With the millennium crossing, scientists in New York agitated for a celebration of the City as a place for a thriving science culture. In 2008 they began World Science Festival. 2011 is the fourth running, on June 1-5, following the AAVSO/AAS meetings. World Science Festival was founded by Dr. Brian Greene, Columbia University, and is operated through the World Science Foundation. The Festival is "saturation science" all over Manhattan in a series of lectures, shows, exhibits, performances. It is staged in "science" venues like colleges and musea, but also in off-science spaces like theaters and galleries. It is a blend from hard science, with lectures like those by us astronomers, to science-themed works of art, dance, music. Events are fitted for the public, either for free or a modest fee. While almost all events are on Manhattan, effort has been made to geographically disperse them, even to the outer boroughs. The grand finale of World Science Festival is a street fair in Washington Square. Science centers in booths, tents, and pavilions highlight their work. In past years this fair drew 100,000 to 150,000 visitors. The entire Festival attracts about a quarter-million attendees. NYSkies is a proud participant at the Washington Square fair. It interprets the "Earth to the Universe" display, debuting during IYA-2009. Attendance at "Earth..." on just the day of the fair plausibly is half of all visitors in America. The presentation shows the scale and scope of World Science Festival, its relation to the City, and how our astronomers work with it.
Carnegie Science Academy Web Site
Kotwicki, John; Atzinger, Joe; Turso, Denise
1997-11-01
The Carnegie Science Academy is a professional society "For Teens...By Teens" at the Carnegie Science Center in Pittsburgh. The CSA Web Site [ http://csa.clpgh.org ] is designed for teens who have an interest in science and technology. This online or virtual science academy provides resources for teens in high school science classes. The Web site also allows students around the world to participate and communicate with other students, discuss current events in science, share opinions, find answers to questions, or make online friends. Visitors can enjoy the main components of the site or sign up for a free membership which allows access to our chat room for monthly meeting, online newsletter, members forum, and much more. Main components to the site include a spot for cool links and downloads, available for any visitor to download or view. Online exhibits are created by students to examine and publish an area of study and also allow teachers to easily post classroom activities as exhibits by submitting pictures and text. Random Access, the interactive part of the academy, allows users to share ideas and opinions. Planet CSA focuses on current events in science and the academy. In the future the CSA Web site will become a major resource for teens and science teachers providing materials that will allow students to further enhance their interest and experiences in science.
Lightweight Advertising and Scalable Discovery of Services, Datasets, and Events Using Feedcasts
Wilson, B. D.; Ramachandran, R.; Movva, S.
2010-12-01
Broadcast feeds (Atom or RSS) are a mechanism for advertising the existence of new data objects on the web, with metadata and links to further information. Users then subscribe to the feed to receive updates. This concept has already been used to advertise the new granules of science data as they are produced (datacasting), with browse images and metadata, and to advertise bundles of web services (service casting). Structured metadata is introduced into the XML feed format by embedding new XML tags (in defined namespaces), using typed links, and reusing built-in Atom feed elements. This “infocasting” concept can be extended to include many other science artifacts, including data collections, workflow documents, topical geophysical events (hurricanes, forest fires, etc.), natural hazard warnings, and short articles describing a new science result. The common theme is that each infocast contains machine-readable, structured metadata describing the object and enabling further manipulation. For example, service casts contain type links pointing to the service interface description (e.g., WSDL for SOAP services), service endpoint, and human-readable documentation. Our Infocasting project has three main goals: (1) define and evangelize micro-formats (metadata standards) so that providers can easily advertise their web services, datasets, and topical geophysical events by adding structured information to broadcast feeds; (2) develop authoring tools so that anyone can easily author such service advertisements, data casts, and event descriptions; and (3) provide a one-stop, Google-like search box in the browser that allows discovery of service, data and event casts visible on the web, and services & data registered in the GEOSS repository and other NASA repositories (GCMD & ECHO). To demonstrate the event casting idea, a series of micro-articles—with accompanying event casts containing links to relevant datasets, web services, and science analysis workflows--will be
ON THE FERMI -GBM EVENT 0.4 s AFTER GW150914
Energy Technology Data Exchange (ETDEWEB)
Greiner, J.; Yu, H.-F. [Max Planck Institute for Extraterrestrial Physics, Giessenbachstrasse, D-85748 Garching (Germany); Burgess, J. M. [Oskar Klein Centre for Cosmoparticle Physics, SE-106 91 Stockholm (Sweden); Savchenko, V., E-mail: jcg@mpe.mpg.de, E-mail: sptfung@mpe.mpg.de, E-mail: jamesb@kth.se, E-mail: savchenk@apc.in2p3.fr [Francois Arago Centre, APC, Université Paris Diderot, CNRS/IN2P3, CEA/Irfu, Observatoire Paris, Sorbonne Paris Cité, 10 rue Alice Domon et Léonie Duquet, F-75205 Paris Cedex 13 (France)
2016-08-20
In view of the recent report by Connaughton et al., we analyze continuous time-tagged event (TTE) data of Fermi -gamma-ray burst monitor (GBM) around the time of the gravitational-wave event GW 150914. We find that after proper accounting for low-count statistics, the GBM transient event at 0.4 s after GW 150914 is likely not due to an astrophysical source, but consistent with a background fluctuation, removing the tension between the INTEGRAL /ACS non-detection and GBM. Additionally, reanalysis of other short GRBs shows that without proper statistical modeling the fluence of faint events is over-predicted, as verified for some joint GBM–ACS detections of short GRBs. We detail the statistical procedure to correct these biases. As a result, faint short GRBs, verified by ACS detections, with significances in the broadband light curve even smaller than that of the GBM–GW150914 event are recovered as proper non-zero source, while the GBM–GW150914 event is consistent with zero fluence.
Characterization of GM events by insert knowledge adapted re-sequencing approaches
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-01-01
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-ad...
Event displays from Beam 2 in ATLAS, November 20th, 2009
ATLAS collaboration
2009-01-01
ATLAS event displays and related information from the LHC restart in 2009. We recorded today, Friday November 20th, the first so-called "Beam Splash" events. For these events the beam in one arm of the LHC was dumped onto closed collimators located 140 meters upstream and downstream of ATLAS. The collision leads to a large number of detectable secondary particles longitudinally traversing the detect
Event displays from Beam Halo in ATLAS, November 20th, 2009
ATLAS collaboration
2009-01-01
ATLAS event displays and related information from the LHC restart in 2009. We recorded today, Friday November 20th, the first so-called "Beam Splash" events. For these events the beam in one arm of the LHC was dumped onto closed collimators located 140 meters upstream and downstream of ATLAS. The collision leads to a large number of detectable secondary particles longitudinally traversing the detect
Automated Testing with Targeted Event Sequence Generation
DEFF Research Database (Denmark)
Jensen, Casper Svenning; Prasad, Mukul R.; Møller, Anders
2013-01-01
Automated software testing aims to detect errors by producing test inputs that cover as much of the application source code as possible. Applications for mobile devices are typically event-driven, which raises the challenge of automatically producing event sequences that result in high coverage...
Polepalli Ramesh, Balaji; Belknap, Steven M; Li, Zuofeng; Frid, Nadya; West, Dennis P; Yu, Hong
2014-06-27
The Food and Drug Administration's (FDA) Adverse Event Reporting System (FAERS) is a repository of spontaneously-reported adverse drug events (ADEs) for FDA-approved prescription drugs. FAERS reports include both structured reports and unstructured narratives. The narratives often include essential information for evaluation of the severity, causality, and description of ADEs that are not present in the structured data. The timely identification of unknown toxicities of prescription drugs is an important, unsolved problem. The objective of this study was to develop an annotated corpus of FAERS narratives and biomedical named entity tagger to automatically identify ADE related information in the FAERS narratives. We developed an annotation guideline and annotate medication information and adverse event related entities on 122 FAERS narratives comprising approximately 23,000 word tokens. A named entity tagger using supervised machine learning approaches was built for detecting medication information and adverse event entities using various categories of features. The annotated corpus had an agreement of over .9 Cohen's kappa for medication and adverse event entities. The best performing tagger achieves an overall performance of 0.73 F1 score for detection of medication, adverse event and other named entities. In this study, we developed an annotated corpus of FAERS narratives and machine learning based models for automatically extracting medication and adverse event information from the FAERS narratives. Our study is an important step towards enriching the FAERS data for postmarketing pharmacovigilance.
La science à la portée de tous
Mazur, Laure Hélène
2004-01-01
Science festival: for its 13th edition, this manifestation is the meeting point for science and public The Festival of Science: for its thirteenth edition, this event is the meeting point of Science and general Public
A Data-Driven Monitoring Technique for Enhanced Fall Events Detection
Zerrouki, Nabil
2016-07-26
Fall detection is a crucial issue in the health care of seniors. In this work, we propose an innovative method for detecting falls via a simple human body descriptors. The extracted features are discriminative enough to describe human postures and not too computationally complex to allow a fast processing. The fall detection is addressed as a statistical anomaly detection problem. The proposed approach combines modeling using principal component analysis modeling with the exponentially weighted moving average (EWMA) monitoring chart. The EWMA scheme is applied on the ignored principal components to detect the presence of falls. Using two different fall detection datasets, URFD and FDD, we have demonstrated the greater sensitivity and effectiveness of the developed method over the conventional PCA-based methods.
International Nuclear Information System (INIS)
Egberts, P; Bennewitz, R
2011-01-01
Indentation experiments on the nanometre scale have been performed by means of atomic force microscopy in ultra-high vacuum on KBr(100) surfaces. The surfaces yield in the form of discrete surface displacements with a typical length scale of 1 A. These surface displacements are detected in both normal and lateral directions. Measurement of the lateral tip displacement requires a load-dependent calibration due to the load dependence of the effective lateral compliance. Correlation of the lateral and normal displacements for each glide event allow identification of the activated slip system. The results are discussed in terms of the resolved shear stress in indentation experiments and of typical results in atomistic simulations of nanometre-scale indentation.
Fellowship | Indian Academy of Sciences
Indian Academy of Sciences (India)
Ph.D. (Wisconsin). Date of birth: 21 September 1936. Date of death: 10 September 1996. Specialization: Digital Control Systems, Analysis and Simulation of Discrete Event Systems and Flight Vehicle Guidance Last known address: Department of Computer Science, and Automation, Indian Institute of Science, Bengaluru ...
Energy Technology Data Exchange (ETDEWEB)
Sahu, Kailash C.; Bond, Howard E.; Anderson, Jay [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dominik, Martin, E-mail: ksahu@stsci.edu, E-mail: jayander@stsci.edu, E-mail: heb11@psu.edu, E-mail: md35@st-andrews.ac.uk [SUPA, School of Physics and Astronomy, University of St. Andrews, North Haugh, St. Andrews KY16 9SS (United Kingdom)
2014-02-20
We have found that Proxima Centauri, the star closest to our Sun, will pass close to a pair of faint background stars in the next few years. Using Hubble Space Telescope (HST) images obtained in 2012 October, we determine that the passage close to a mag 20 star will occur in 2014 October (impact parameter 1.''6), and to a mag 19.5 star in 2016 February (impact parameter 0.''5). As Proxima passes in front of these stars, the relativistic deflection of light will cause shifts in the positions of the background stars of ∼0.5 and 1.5 mas, respectively, readily detectable by HST imaging, and possibly by Gaia and ground-based facilities such as the Very Large Telescope. Measurement of these astrometric shifts offers a unique and direct method to measure the mass of Proxima. Moreover, if Proxima has a planetary system, the planets may be detectable through their additional microlensing signals, although the probability of such detections is small. With astrometric accuracies of 0.03 mas (achievable with HST spatial scanning), centroid shifts caused by Jovian planets are detectable at separations of up to 2.''0 (corresponding to 2.6 AU at the distance of Proxima), and centroid shifts by Earth-mass planets are detectable within a small band of 8 mas (corresponding to 0.01 AU) around the source trajectories. Jovian planets within a band of about 28 mas (corresponding to 0.036 AU) around the source trajectories would produce a brightening of the source by >0.01 mag and could hence be detectable. Estimated timescales of the astrometric and photometric microlensing events due to a planet range from a few hours to a few days, and both methods would provide direct measurements of the planetary mass.
Swift pointing and gravitational-wave bursts from gamma-ray burst events
International Nuclear Information System (INIS)
Sutton, Patrick J; Finn, Lee Samuel; Krishnan, Badri
2003-01-01
The currently accepted model for gamma-ray burst phenomena involves the violent formation of a rapidly rotating solar-mass black hole. Gravitational waves should be associated with the black-hole formation, and their detection would permit this model to be tested. Even upper limits on the gravitational-wave strength associated with gamma-ray bursts could constrain the gamma-ray burst model. This requires joint observations of gamma-ray burst events with gravitational and gamma-ray detectors. Here we examine how the quality of an upper limit on the gravitational-wave strength associated with gamma-ray bursts depends on the relative orientation of the gamma-ray-burst and gravitational-wave detectors, and apply our results to the particular case of the Swift Burst-Alert Telescope (BAT) and the LIGO gravitational-wave detectors. A result of this investigation is a science-based 'figure of merit' that can be used, together with other mission constraints, to optimize the pointing of the Swift telescope for the detection of gravitational waves associated with gamma-ray bursts
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. KADARKARAI MURUGAN. Articles written in Bulletin of Materials Science. Volume 40 Issue 7 December 2017 pp 1455-1462. A sensitive optical sensor based on DNA-labelled Si@SiO 2 core–shell nanoparticle for the detection of Hg 2 + ions in environmental water samples.
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. KANNAIYAN DINAKARAN. Articles written in Bulletin of Materials Science. Volume 40 Issue 7 December 2017 pp 1455-1462. A sensitive optical sensor based on DNA-labelled Si@SiO 2 core–shell nanoparticle for the detection of Hg 2 + ions in environmental water samples.
Gateau, Jérôme; Aubry, Jean-François; Pernot, Mathieu; Fink, Mathias; Tanter, Mickaël
2011-03-01
The activation of natural gas nuclei to induce larger bubbles is possible using short ultrasonic excitations of high amplitude, and is required for ultrasound cavitation therapies. However, little is known about the distribution of nuclei in tissues. Therefore, the acoustic pressure level necessary to generate bubbles in a targeted zone and their exact location are currently difficult to predict. To monitor the initiation of cavitation activity, a novel all-ultrasound technique sensitive to single nucleation events is presented here. It is based on combined passive detection and ultrafast active imaging over a large volume using the same multi-element probe. Bubble nucleation was induced using a focused transducer (660 kHz, f-number = 1) driven by a high-power electric burst (up to 300 W) of one to two cycles. Detection was performed with a linear array (4 to 7 MHz) aligned with the single-element focal point. In vitro experiments in gelatin gel and muscular tissue are presented. The synchronized passive detection enabled radio-frequency data to be recorded, comprising high-frequency coherent wave fronts as signatures of the acoustic emissions linked to the activation of the nuclei. Active change detection images were obtained by subtracting echoes collected in the unnucleated medium. These indicated the appearance of stable cavitating regions. Because of the ultrafast frame rate, active detection occurred as quickly as 330 μs after the high-amplitude excitation and the dynamics of the induced regions were studied individually.
Detection of microsleep events in a car driving simulation study using electrocardiographic features
Directory of Open Access Journals (Sweden)
Lenis Gustavo
2016-09-01
Full Text Available Microsleep events (MSE are short intrusions of sleep under the demand of sustained attention. They can impose a major threat to safety while driving a car and are considered one of the most significant causes of traffic accidents. Driver’s fatigue and MSE account for up to 20% of all car crashes in Europe and at least 100,000 accidents in the US every year. Unfortunately, there is not a standardized test developed to quantify the degree of vigilance of a driver. To account for this problem, different approaches based on biosignal analysis have been studied in the past. In this paper, we investigate an electrocardiographic-based detection of MSE using morphological and rhythmical features. 14 records from a car driving simulation study with a high incidence of MSE were analyzed and the behavior of the ECG features before and after an MSE in relation to reference baseline values (without drowsiness were investigated. The results show that MSE cannot be detected (or predicted using only the ECG. However, in the presence of MSE, the rhythmical and morphological features were observed to be significantly different than the ones calculated for the reference signal without sleepiness. In particular, when MSE were present, the heart rate diminished while the heart rate variability increased. Time distances between P wave and R peak, and R peak and T wave and their dispersion increased also. This demonstrates a noticeable change of the autonomous regulation of the heart. In future, the ECG parameter could be used as a surrogate measure of fatigue.
Rare event simulation using Monte Carlo methods
Rubino, Gerardo
2009-01-01
In a probabilistic model, a rare event is an event with a very small probability of occurrence. The forecasting of rare events is a formidable task but is important in many areas. For instance a catastrophic failure in a transport system or in a nuclear power plant, the failure of an information processing system in a bank, or in the communication network of a group of banks, leading to financial losses. Being able to evaluate the probability of rare events is therefore a critical issue. Monte Carlo Methods, the simulation of corresponding models, are used to analyze rare events. This book sets out to present the mathematical tools available for the efficient simulation of rare events. Importance sampling and splitting are presented along with an exposition of how to apply these tools to a variety of fields ranging from performance and dependability evaluation of complex systems, typically in computer science or in telecommunications, to chemical reaction analysis in biology or particle transport in physics. ...
Kim, Seonji; Park, Kyounghoon; Kim, Mi-Sook; Yang, Bo Ram; Choi, Hyun Jin; Park, Byung-Joo
2017-10-01
Selective serotonin reuptake inhibitors (SSRIs) have become one of the most broadly used medications in psychiatry. Fluoxetine is the first representative antidepressant SSRI drug approved by the Food and Drug Administration (FDA) in 1987. Safety information on fluoxetine use alone was less reported than its combined use with other drugs. There were no published papers on adverse drug reactions (ADRs) of fluoxetine analyzing spontaneous adverse events reports. We detected signals of the adverse drug reactions of fluoxetine by data mining using the Korea Adverse Events Reporting System (KAERS) database. We defined signals in this study by the reporting odds ratios (ROR), proportional reporting ratios (PRR), and information components (IC) indices. The KAERS database included 860,224 AE reports, among which 866 reports contained fluoxetine. We compared the labels of fluoxetine among the United States, UK, Germany, France, China, and Korea. Some of the signals, including emotional lability, myositis, spinal stenosis, paradoxical drug reaction, drug dependence, extrapyramidal disorder, adrenal insufficiency, and intracranial hemorrhage, were not labeled in the six countries. In conclusion, we identified new signals that were not known at the time of market approval. However, certain factors should be required for signal evaluation, such as clinical significance, preventability, and causality of the detected signals. Copyright © 2017 Elsevier B.V. All rights reserved.
How FOSTER supports training Open Science in the GeoSciences
Orth, Astrid
2016-04-01
FOSTER (1) is about promoting and facilitating the adoption of Open Science by the European research community, and fostering compliance with the open access policies set out in Horizon 2020 (H2020). FOSTER aims to reach out and provide training to the wide range of disciplines and countries involved in the European Research Area (ERA) by offering and supporting face-to-face as well as distance training. Different stakeholders, mainly young researchers, are trained to integrate Open Science in their daily workflow, supporting researchers to optimise their research visibility and impact. Strengthening the institutional training capacity is achieved through a train-the-trainers approach. The two-and-half-year project started in February 2014 with identifying, enriching and providing training content on all relevant topics in the area of Open Science. One of the main elements was to support two rounds of trainings, which were conducted during 2014 and 2015, organizing more than 100 training events with around 3000 participants. The presentation will explain the project objectives and results and will look into best practice training examples, among them successful training series in the GeoSciences. The FOSTER portal that now holds a collection of training resources (e.g. slides and PDFs, schedules and design of training events dedicated to different audiences, video captures of complete events) is presented. It provides easy ways to identify learning materials and to create own e-learning courses based on the materials and examples. (1) FOSTER is funded through the European Union's Seventh Framework Programme for research, technological development and demonstration under grant agreement no 612425. http://fosteropenscience.eu
Physical Sciences 2007 Science & Technology Highlights
Energy Technology Data Exchange (ETDEWEB)
Hazi, A U
2008-04-07
The Physical Sciences Directorate applies frontier physics and technology to grand challenges in national security. Our highly integrated and multidisciplinary research program involves collaborations throughout Lawrence Livermore National Laboratory, the National Nuclear Security Administration, the Department of Energy, and with academic and industrial partners. The Directorate has a budget of approximately $150 million, and a staff of approximately 350 employees. Our scientists provide expertise in condensed matter and high-pressure physics, plasma physics, high-energy-density science, fusion energy science and technology, nuclear and particle physics, accelerator physics, radiation detection, optical science, biotechnology, and astrophysics. This document highlights the outstanding research and development activities in the Physical Sciences Directorate that made news in 2007. It also summarizes the awards and recognition received by members of the Directorate in 2007.
Gravity's kiss the detection of gravitational waves
Collins, Harry
2017-01-01
Scientists have been trying to confirm the existence of gravitational waves for fifty years. Then, in September 2015, came a "very interesting event" (as the cautious subject line in a physicist's email read) that proved to be the first detection of gravitational waves. In Gravity's Kiss, Harry Collins -- who has been watching the science of gravitational wave detection for forty-three of those fifty years and has written three previous books about it -- offers a final, fascinating account, written in real time, of the unfolding of one of the most remarkable scientific discoveries ever made. Predicted by Einstein in his theory of general relativity, gravitational waves carry energy from the collision or explosion of stars. Dying binary stars, for example, rotate faster and faster around each other until they merge, emitting a burst of gravitational waves. It is only with the development of extraordinarily sensitive, highly sophisticated detectors that physicists can now confirm Einstein's prediction. This is...
The ISC Seismic Event Bibliography
Di Giacomo, Domenico; Storchak, Dmitry
2015-04-01
The International Seismological Centre (ISC) is a not-for-profit organization operating in the UK for the last 50 years and producing the ISC Bulletin - the definitive worldwide summary of seismic events, both natural and anthropogenic - starting from the beginning of 20th century. Often researchers need to gather information related to specific seismic events for various reasons. To facilitate such task, in 2012 we set up a new database linking earthquakes and other seismic events in the ISC Bulletin to bibliographic records of scientific articles (mostly peer-reviewed journals) that describe those events. Such association allows users of the ISC Event Bibliography (www.isc.ac.uk/event_bibliography/index.php) to run searches for publications via a map-based web interface and, optionally, selecting scientific publications related to either specific events or events in the area of interest. Some of the greatest earthquakes were described in several hundreds of articles published over a period of few years. The journals included in our database are not limited to seismology but bring together a variety of fields in geosciences (e.g., engineering seismology, geodesy and remote sensing, tectonophysics, monitoring research, tsunami, geology, geochemistry, hydrogeology, atmospheric sciences, etc.) making this service useful in multidisciplinary studies. Usually papers dealing with large data set are not included (e.g., papers describing a seismic catalogue). Currently the ISC Event Bibliography includes over 17,000 individual publications from about 500 titles related to over 14,000 events that occurred in last 100+ years. The bibliographic records in the Event Bibliography start in the 1950s, and it is updated as new publications become available.
Riebeek Kohl, H.; Chambers, L. H.; Murphy, T.
2016-12-01
For more that 20 years, the Global Learning and Observations to Benefit the Environment (GLOBE) Program has sought to increase environment literacy in students by involving them in the process of data collection and scientific research. In 2016, the program expanded to accept observations from citizen scientists of all ages through a relatively simple app. Called GLOBE Observer, the new program aims to help participants feel connected to a global community focused on advancing the scientific understanding of Earth system science while building climate literacy among participants and increasing valuable environmental data points to expand both student and scientific research. In October 2016, GLOBE Observer partnered with the Association of Science & Technology Centers (ASTC) in an international science experiment in which museums and patrons around the world collected cloud observations through GLOBE Observer to create a global cloud map in support of NASA satellite science. The experiment was an element of the International Science Center and Science Museum Day, an event planned in partnership with UNESCO and ASTC. Museums and science centers provided the climate context for the observations, while GLOBE Observer offered a uniform experience and a digital platform to build a connected global community. This talk will introduce GLOBE Observer and will present the results of the experiment, including evaluation feedback on gains in climate literacy through the event.
Directory of Open Access Journals (Sweden)
O. Chavez
2010-12-01
Full Text Available The geomagnetic observatory of Juriquilla Mexico, located at longitude –100.45° and latitude 20.70°, and 1946 m a.s.l., has been operational since June 2004 compiling geomagnetic field measurements with a three component fluxgate magnetometer. In this paper, the results of the analysis of these measurements in relation to important seismic activity in the period of 2007 to 2009 are presented. For this purpose, we used superposed epochs of Discrete Wavelet Transform of filtered signals for the three components of the geomagnetic field during relative seismic calm, and it was compared with seismic events of magnitudes greater than Ms > 5.5, which have occurred in Mexico. The analysed epochs consisted of 18 h of observations for a dataset corresponding to 18 different earthquakes (EQs. The time series were processed for a period of 9 h prior to and 9 h after each seismic event. This data processing was compared with the same number of observations during a seismic calm. The proposed methodology proved to be an efficient tool to detect signals associated with seismic activity, especially when the seismic events occur in a distance (D from the observatory to the EQ, such that the ratio D/ρ < 1.8 where ρ is the earthquake radius preparation zone. The methodology presented herein shows important anomalies in the Ultra Low Frequency Range (ULF; 0.005–1 Hz, primarily for 0.25 to 0.5 Hz. Furthermore, the time variance (σ2 increases prior to, during and after the seismic event in relation to the coefficient D1 obtained, principally in the Bx (N-S and By (E-W geomagnetic components. Therefore, this paper proposes and develops a new methodology to extract the abnormal signals of the geomagnetic anomalies related to different stages of the EQs.
International Nuclear Information System (INIS)
Tregidgo, Daniel J.; West, Sarah E.; Ashmore, Mike R.
2013-01-01
Citizen science is having increasing influence on environmental monitoring as its advantages are becoming recognised. However methodologies are often simplified to make them accessible to citizen scientists. We tested whether a recent citizen science survey (the OPAL Air Survey) could detect trends in lichen community composition over transects away from roads. We hypothesised that the abundance of nitrophilic lichens would decrease with distance from the road, while that of nitrophobic lichens would increase. The hypothesised changes were detected along strong pollution gradients, but not where the road source was relatively weak, or background pollution relatively high. We conclude that the simplified OPAL methodology can detect large contrasts in nitrogenous pollution, but it may not be able to detect more subtle changes in pollution exposure. Similar studies are needed in conjunction with the ever-growing body of citizen science work to ensure that the limitations of these methods are fully understood. -- Highlights: •We investigated the validity of a simplified citizen science methodology. •Lichen abundance data were used to indicate nitrogenous air pollution. •Significant changes were detected beside busy roads with low background pollution. •The methodology detected major, but not subtle, contrasts in pollution. •Sensitivity of citizen science methods to environmental change must be evaluated. -- A simplified lichen biomonitoring method used for citizen science can detect the impact of nitrogenous air pollution from local roads
2012-05-01
Education: Physics Education Networks meeting has global scale Competition: Competition seeks the next Brian Cox Experiment: New measurement of neutrino time-of-flight consistent with the speed of light Event: A day for all those who teach physics Conference: Students attend first Anglo-Japanese international science conference Celebration: Will 2015 be the 'Year of Light'? Teachers: Challenging our intuition in spectacular fashion: the fascinating world of quantum physics awaits Research: Science sharpens up sport Learning: Kittinger and Baumgartner: on a mission to the edge of space International: London International Youth Science Forum calls for leading young scientists Competition: Physics paralympian challenge needs inquisitive, analytical, artistic and eloquent pupils Forthcoming events
The Role and Value of Dialogue Events as Sites of Informal Science Learning
DEFF Research Database (Denmark)
Lehr, Jane L.; McCallie, Ellen; Davies, Sarah Rachael
2007-01-01
and staging of adult-focused, face-to-face forums that bring scien- tific and technical experts, social scientists, and policy-makers into discussion with members of the public about contemporary scientific and socioscientific issues related to the development and application of science and technology......In the past five years, informal science institutions (ISIs), science communication, advocacy and citizen action groups, funding organizations, and policy-makers in the UK and the USA have become increasingly involved in efforts to promote increased public engagement with science and technology...
Open-science projects get kickstarted at CERN
Achintya Rao
2015-01-01
CERN is one of the host sites for the Mozilla Science Lab Global Sprint to be held on 4 and 5 June, which will see participants around the world work on projects to further open science and educational tools. IdeaSquare will be hosting the event at CERN. The Mozilla Science Lab Global Sprint was first held in 2014 to bring together open-science practitioners and enthusiasts to collaborate on projects designed to advance science on the open web. The sprint is a loosely federated event, and CERN is participating in the 2015 edition, hosting sprinters in the hacker-friendly IdeaSquare. Five projects have been formally proposed and CERN users and staff are invited to participate in a variety of ways. A special training session will also be held to introduce the CERN community to existing open-science and collaborative tools, including ones that have been deployed at CERN. 1. GitHub Science Badges: Sprinters will work on developing a badge-style visual representation of how open a software pro...
Risk factors for hazardous events in olfactory-impaired patients.
Pence, Taylor S; Reiter, Evan R; DiNardo, Laurence J; Costanzo, Richard M
2014-10-01
Normal olfaction provides essential cues to allow early detection and avoidance of potentially hazardous situations. Thus, patients with impaired olfaction may be at increased risk of experiencing certain hazardous events such as cooking or house fires, delayed detection of gas leaks, and exposure to or ingestion of toxic substances. To identify risk factors and potential trends over time in olfactory-related hazardous events in patients with impaired olfactory function. Retrospective cohort study of 1047 patients presenting to a university smell and taste clinic between 1983 and 2013. A total of 704 patients had both clinical olfactory testing and a hazard interview and were studied. On the basis of olfactory function testing results, patients were categorized as normosmic (n = 161), mildly hyposmic (n = 99), moderately hyposmic (n = 93), severely hyposmic (n = 142), and anosmic (n = 209). Patient evaluation including interview, examination, and olfactory testing. Incidence of specific olfaction-related hazardous events (ie, burning pots and/or pans, starting a fire while cooking, inability to detect gas leaks, inability to detect smoke, and ingestion of toxic substances or spoiled foods) by degree of olfactory impairment. The incidence of having experienced any hazardous event progressively increased with degree of impairment: normosmic (18.0%), mildly hyposmic (22.2%), moderately hyposmic (31.2%), severely hyposmic (32.4%), and anosmic (39.2%). Over 3 decades there was no significant change in the overall incidence of hazardous events. Analysis of demographic data (age, sex, race, smoking status, and etiology) revealed significant differences in the incidence of hazardous events based on age (among 397 patients hazardous event, vs 31 of 146 patients ≥65 years [21.3%]; P hazardous event, vs 73 of 265 men [27.6%]; P = .009), and race (among 98 African Americans, 41 [41.8%] with hazardous event, vs 134 of 434 whites [30.9%]; P = .04
Data Science Solution to Event Prediction in Outsourced Clinical Trial Models.
Dalevi, Daniel; Lovick, Susan; Mann, Helen; Metcalfe, Paul D; Spencer, Stuart; Hollis, Sally; Ruau, David
2015-01-01
Late phase clinical trials are regularly outsourced to a Contract Research Organisation (CRO) while the risk and accountability remain within the sponsor company. Many statistical tasks are delivered by the CRO and later revalidated by the sponsor. Here, we report a technological approach to standardised event prediction. We have built a dynamic web application around an R-package with the aim of delivering reliable event predictions, simplifying communication and increasing trust between the CRO and the in-house statisticians via transparency. Short learning curve, interactivity, reproducibility and data diagnostics are key here. The current implementation is motivated by time-to-event prediction in oncology. We demonstrate a clear benefit of standardisation for both parties. The tool can be used for exploration, communication, sensitivity analysis and generating standard reports. At this point we wish to present this tool and share some of the insights we have gained during the development.
Mote, A. S.; Lockwood, J.; Ellins, K. K.; Haddad, N.; Ledley, T. S.; Lynds, S. E.; McNeal, K.; Libarkin, J. C.
2014-12-01
EarthLabs, an exemplary series of lab-based climate science learning modules, is a model for high school Earth Science lab courses. Each module includes a variety of learning activities that allow students to explore the Earth's complex and dynamic climate history. The most recent module, Climate Detectives, uses data from IODP Expedition 341, which traveled to the Gulf of Alaska during the summer of 2013 to study past climate, sedimentation, and tectonics along the continental margin. At the onset of Climate Detectives, students are presented with a challenge engaging them to investigate how the Earth's climate has changed since the Miocene in southern Alaska. To complete this challenge, students join Exp. 341 to collect and examine sediments collected from beneath the seafloor. The two-week module consists of six labs that provide students with the content and skills needed to solve this climate mystery. Students discover how an international team collaborates to examine a scientific problem with the IODP, compete in an engineering design challenge to learn about scientific ocean drilling, and learn about how different types of proxy data are used to detect changes in Earth's climate. The NGSS Science and Engineering Practices are woven into the culminating activity, giving students the opportunity to think and act like scientists as they investigate the following questions: 1) How have environmental conditions in in the Gulf of Alaska changed during the time when the sediments in core U1417 were deposited? (2) What does the occurrence of different types of diatoms and their abundance reveal about the timing of the cycles of glacial advance and retreat? (3) What timeline is represented by the section of core? (4) How do results from the Gulf of Alaska compare with the global record of glaciations during this period based on oxygen isotopes proxies? Developed by educators in collaboration with Expedition 341 scientists, Climate Detectives is a strong example of
What can Citizen Science do for Ocean Science and Ocean Scientists?
Best, M.; Hoeberechts, M.; Mangin, A.; Oggioni, A.; Orcutt, J. A.; Parrish, J.; Pearlman, J.; Piera, J.; Tagliolato, P.
2016-12-01
The ocean represents over 70% of our planet's surface area, over 90% of the living space. Humans are not marine creatures, we therefore have fundamentally not built up knowledge of the ocean in the same way we have on land. The more we learn about the ocean, the more we understand it is the regulatory engine of our planet…How do we catch up? Answers to this question will need to come from many quarters; A powerful and strategic option to complement existing observation programs and infrastructure is Citizen Science. There has been significant and relevant discussion of the importance of Citizen Science to citizens and stakeholders. The missing effective question is sometimes what is the potential of citizen science for scientists? The answers for both scientists and society are: spatial coverage, remote locations, temporal coverage, event response, early detection of harmful processes, sufficient data volume for statistical analysis and identification of outliers, integrating local knowledge, data access in exchange for analysis (e.g. with industry) and cost-effective monitoring systems. Citizens can be involved in: instrument manufacture and maintenance, instrument deployment/sample collection, data collection and transmission, data analysis, data validation/verification, and proposals of new topics of research. Such opportunities are balanced by concern on the part of scientists about the quality, the consistency and the reliability of citizen observations and analyses. Experience working with citizen science groups continues to suggest that with proper training and mentoring, these issues can be addressed, understanding both benefits and limitations. How to do it- implementation and maintenance of citizen science: How to recruit, engage, train, and maintain Citizen Scientists. Data systems for acquisition, assessment, access, analysis, and visualisation of distributed data sources. Tools/methods for acquiring observations: Simple instruments, Smartphone Apps
International Nuclear Information System (INIS)
Chung, Sun-Ju; Park, Byeong-Gon; Humphrey, Andrew; Ryu, Yoon-Hyun
2009-01-01
When a source star is microlensed by one stellar component of widely separated binary stellar components, after finishing the lensing event, the event induced by the other binary star can be additionally detected. In this paper, we investigate whether the close/wide degeneracies in binary lensing events can be resolved by detecting the additional centroid shift of the source images induced by the secondary binary star in wide binary lensing events. From this investigation, we find that if the source star passes close to the Einstein ring of the secondary companion, the degeneracy can be easily resolved by using future astrometric follow-up observations with high astrometric precision. We determine the probability of detecting the additional centroid shift in binary lensing events with high magnification. From this, we find that the degeneracy of binary lensing events with a separation of ∼<20.0 AU can be resolved with a significant efficiency. We also estimate the waiting time for the detection of the additional centroid shift in wide binary lensing events. We find that for typical Galactic lensing events with a separation of ∼<20.0 AU, the additional centroid shift can be detected within 100 days, and thus the degeneracy of those events can be sufficiently broken within a year.
Label and Label-Free Detection Techniques for Protein Microarrays
Directory of Open Access Journals (Sweden)
Amir Syahir
2015-04-01
Full Text Available Protein microarray technology has gone through numerous innovative developments in recent decades. In this review, we focus on the development of protein detection methods embedded in the technology. Early microarrays utilized useful chromophores and versatile biochemical techniques dominated by high-throughput illumination. Recently, the realization of label-free techniques has been greatly advanced by the combination of knowledge in material sciences, computational design and nanofabrication. These rapidly advancing techniques aim to provide data without the intervention of label molecules. Here, we present a brief overview of this remarkable innovation from the perspectives of label and label-free techniques in transducing nano‑biological events.
Feng, Tai-Chen; Zhang, Ke-Quan; Su, Hai-Jing; Wang, Xiao-Juan; Gong, Zhi-Qiang; Zhang, Wen-Yu
2015-10-01
Based on an objective identification technique for regional low temperature event (OITRLTE), the daily minimum temperature in China has been detected from 1960 to 2013. During this period, there were 60 regional extreme low temperature events (ERLTEs), which are included in the 690 regional low temperature events (RLTEs). The 60 ERLTEs are analyzed in this paper. The results show that in the last 50 years, the intensity of the ERLTEs has become weak; the number of lasted days has decreased; and, the affected area has become small. However, that situation has changed in this century. In terms of spatial distribution, the high intensity regions are mainly in Northern China while the high frequency regions concentrate in Central and Eastern China. According to the affected area of each event, the 60 ERLTEs are classified into six types. The atmospheric circulation background fields which correspond to these types are also analyzed. The results show that, influenced by stronger blocking highs of Ural and Lake Baikal, as well as stronger southward polar vortex and East Asia major trough at 500-hPa geopotential height, cold air from high latitudes is guided to move southward and abnormal northerly winds at 850 hPa makes the cold air blow into China along diverse paths, thereby forming different types of regional extreme low temperatures in winter. Project supported by the National Natural Science Foundation of China (Grant No. 41305075), the National Basic Research Program of China (Grant Nos. 2012CB955203 and 2012CB955902), and the Special Scientific Research on Public Welfare Industry, China (Grant No. GYHY201306049).
Bringing computational science to the public.
McDonagh, James L; Barker, Daniel; Alderson, Rosanna G
2016-01-01
The increasing use of computers in science allows for the scientific analyses of large datasets at an increasing pace. We provided examples and interactive demonstrations at Dundee Science Centre as part of the 2015 Women in Science festival, to present aspects of computational science to the general public. We used low-cost Raspberry Pi computers to provide hands on experience in computer programming and demonstrated the application of computers to biology. Computer games were used as a means to introduce computers to younger visitors. The success of the event was evaluated by voluntary feedback forms completed by visitors, in conjunction with our own self-evaluation. This work builds on the original work of the 4273π bioinformatics education program of Barker et al. (2013, BMC Bioinform. 14:243). 4273π provides open source education materials in bioinformatics. This work looks at the potential to adapt similar materials for public engagement events. It appears, at least in our small sample of visitors (n = 13), that basic computational science can be conveyed to people of all ages by means of interactive demonstrations. Children as young as five were able to successfully edit simple computer programs with supervision. This was, in many cases, their first experience of computer programming. The feedback is predominantly positive, showing strong support for improving computational science education, but also included suggestions for improvement. Our conclusions are necessarily preliminary. However, feedback forms suggest methods were generally well received among the participants; "Easy to follow. Clear explanation" and "Very easy. Demonstrators were very informative." Our event, held at a local Science Centre in Dundee, demonstrates that computer games and programming activities suitable for young children can be performed alongside a more specialised and applied introduction to computational science for older visitors.
An Updated Perspective of Single Event Gate Rupture and Single Event Burnout in Power MOSFETs
Titus, Jeffrey L.
2013-06-01
Studies over the past 25 years have shown that heavy ions can trigger catastrophic failure modes in power MOSFETs [e.g., single-event gate rupture (SEGR) and single-event burnout (SEB)]. In 1996, two papers were published in a special issue of the IEEE Transaction on Nuclear Science [Johnson, Palau, Dachs, Galloway and Schrimpf, “A Review of the Techniques Used for Modeling Single-Event Effects in Power MOSFETs,” IEEE Trans. Nucl. Sci., vol. 43, no. 2, pp. 546-560, April. 1996], [Titus and Wheatley, “Experimental Studies of Single-Event Gate Rupture and Burnout in Vertical Power MOSFETs,” IEEE Trans. Nucl. Sci., vol. 43, no. 2, pp. 533-545, Apr. 1996]. Those two papers continue to provide excellent information and references with regard to SEB and SEGR in vertical planar MOSFETs. This paper provides updated references/information and provides an updated perspective of SEB and SEGR in vertical planar MOSFETs as well as provides references/information to other device types that exhibit SEB and SEGR effects.
Deep learning based beat event detection in action movie franchises
Ejaz, N.; Khan, U. A.; Martínez-del-Amor, M. A.; Sparenberg, H.
2018-04-01
Automatic understanding and interpretation of movies can be used in a variety of ways to semantically manage the massive volumes of movies data. "Action Movie Franchises" dataset is a collection of twenty Hollywood action movies from five famous franchises with ground truth annotations at shot and beat level of each movie. In this dataset, the annotations are provided for eleven semantic beat categories. In this work, we propose a deep learning based method to classify shots and beat-events on this dataset. The training dataset for each of the eleven beat categories is developed and then a Convolution Neural Network is trained. After finding the shot boundaries, key frames are extracted for each shot and then three classification labels are assigned to each key frame. The classification labels for each of the key frames in a particular shot are then used to assign a unique label to each shot. A simple sliding window based method is then used to group adjacent shots having the same label in order to find a particular beat event. The results of beat event classification are presented based on criteria of precision, recall, and F-measure. The results are compared with the existing technique and significant improvements are recorded.
To touch the science through the experiment!
Słowik, Grzegorz
2016-04-01
To touch the science through the experiment! Grzegorz P. Slowik, Gymnasium No. 2 in Zielona Gora, Poland Our School - Gymnasium No. 2 in Zielona Gora - where pupils' age is 13 -16, has for many years organized a lot of exciting events popularizing science among Zielona Gora children and young people, in particular experimental physics and astronomy. The best known in our town is the regular event on physics, - called the physical Festival of Zielona Gora, of which I am the main initiator and organizer. The Festival is directed to students of the last classes of Zielona Góra primary schools. During the Festivities their shows have also physicists and astronomers, from cooperating with us in popularization of science Zielona Gora University. At the festival the students from our Experimental School Group "Archimedes". Presented their own prepared themselves physical experience. With considerable help of students of Gymnasium No. 2 interested in astronomy, we organize the cyclical event, named "Cosmic Santa Claus," where I share with the students the knowledge gained through my active annual participation in the Space Workshop organized by the Science Centre in Warsaw. We all have fun and learn in a great way and with a smile, we touch real science that reveals its secrets!
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. K Krishnamoorthy. Articles written in Journal of Earth System Science. Volume 111 Issue 4 December 2002 pp 425-435. Detection of marine aerosols with IRS P4-Ocean Colour Monitor · Indrani Das M Mohan K Krishnamoorthy · More Details Abstract Fulltext PDF.
The Frasnian-Famennian mass killing event(s), methods of identification and evaluation
Geldsetzer, H. H. J.
1988-01-01
The absence of an abnormally high number of earlier Devonian taxa from Famennian sediments was repeatedly documented and can hardly be questioned. Primary recognition of the event(s) was based on paleontological data, especially common macrofossils. Most paleontologists place the disappearance of these common forms at the gigas/triangularis contact and this boundary was recently proposed as the Frasnian-Famennian (F-F) boundary. Not unexpectedly, alternate F-F positions were suggested caused by temporary Frasnian survivors or sudden post-event radiations of new forms. Secondary supporting evidence for mass killing event(s) is supplied by trace element and stable isotope geochemistry but not with the same success as for the K/T boundary, probably due to additional 300 ma of tectonic and diagenetic overprinting. Another tool is microfacies analysis which is surprisingly rarely used even though it can explain geochemical anomalies or paleontological overlap not detectable by conventional macrofacies analysis. The combination of microfacies analysis and geochemistry was applied at two F-F sections in western Canada and showed how interdependent the two methods are. Additional F-F sections from western Canada, western United States, France, Germany and Australia were sampled or re-sampled and await geochemical/microfacies evaluation.
Big Data and historical social science
Directory of Open Access Journals (Sweden)
Peter Bearman
2015-11-01
Full Text Available “Big Data” can revolutionize historical social science if it arises from substantively important contexts and is oriented towards answering substantively important questions. Such data may be especially important for answering previously largely intractable questions about the timing and sequencing of events, and of event boundaries. That said, “Big Data” makes no difference for social scientists and historians whose accounts rest on narrative sentences. Since such accounts are the norm, the effects of Big Data on the practice of historical social science may be more limited than one might wish.
Achard, P.; Aguilar-Benitez, M.; Alcaraz, J.; Alemanni, G.; Allaby, J.; Aloisio, A.; Alviggi, M.G.; Anderhub, H.; Andreev, V.P.; Anselmo, F.; Arefiev, A.; Azemoon, T.; Aziz, T.; Bagnaia, P.; Bajo, A.; Baksay, G.; Baksay, L.; Baldew, S.V.; Banerjee, S.; Banerjee, Sw.; Barczyk, A.; Barillere, R.; Bartalini, P.; Basile, M.; Batalova, N.; Battiston, R.; Bay, A.; Becker, U.; Behner, F.; Bellucci, L.; Berbeco, R.; Berdugo, J.; Berges, P.; Bertucci, B.; Betev, B.L.; Biasini, M.; Biglietti, M.; Biland, A.; Blaising, J.J.; Blyth, S.C.; Bobbink, G.J.; Bohm, A.; Boldizsar, L.; Borgia, B.; Bottai, S.; Bourilkov, D.; Bourquin, M.; Braccini, S.; Branson, J.G.; Brochu, F.; Burger, J.D.; Burger, W.J.; Cai, X.D.; Capell, M.; Cara Romeo, G.; Carlino, G.; Cartacci, A.; Casaus, J.; Cavallari, F.; Cavallo, N.; Cecchi, C.; Cerrada, M.; Chamizo, M.; Chang, Y.H.; Chemarin, M.; Chen, A.; Chen, G.; Chen, G.M.; Chen, H.F.; Chen, H.S.; Chiefari, G.; Cifarelli, L.; Cindolo, F.; Clare, I.; Clare, R.; Coignet, G.; Colino, N.; Costantini, S.; de la Cruz, B.; Cucciarelli, S.; de Asmundis, R.; Deglon, P.; Debreczeni, J.; Degre, A.; Dehmelt, K.; Deiters, K.; della Volpe, D.; Delmeire, E.; Denes, P.; DeNotaristefani, F.; De Salvo, A.; Diemoz, M.; Dierckxsens, M.; Dionisi, C.; Dittmar, M.; Doria, A.; Dova, M.T.; Duchesneau, D.; Duda, M.; Echenard, B.; Eline, A.; El Hage, A.; El Mamouni, H.; Engler, A.; Eppling, F.J.; Extermann, P.; Falagan, M.A.; Falciano, S.; Favara, A.; Fay, J.; Fedin, O.; Felcini, M.; Ferguson, T.; Fesefeldt, H.; Fiandrini, E.; Field, J.H.; Filthaut, F.; Fisher, P.H.; Fisher, W.; Forconi, G.; Freudenreich, K.; Furetta, C.; Galaktionov, Yu.; Ganguli, S.N.; Garcia-Abia, P.; Gataullin, M.; Gentile, S.; Giagu, S.; Gong, Z.F.; Grenier, G.; Grimm, O.; Gruenewald, M.W.; Gupta, V.K.; Gurtu, A.; Gutay, L.J.; Haas, D.; Hatzifotiadou, D.; Hebbeker, T.; Herve, A.; Hirschfelder, J.; Hofer, H.; Hohlmann, M.; Holzner, G.; Hou, S.R.; Jin, B.N.; Jindal, P.; Jones, L.W.; de Jong, P.; Josa-Mutuberria, I.; Kaur, M.; Kienzle-Focacci, M.N.; Kim, J.K.; Kirkby, J.; Kittel, W.; Klimentov, A.; Konig, A.C.; Kopal, M.; Koutsenko, V.; Kraber, M.; Kraemer, R.W.; Kruger, A.; Kunin, A.; Ladron de Guevara, P.; Laktineh, I.; Landi, G.; Lebeau, M.; Lebedev, A.; Lebrun, P.; Lecomte, P.; Lecoq, P.; Le Coultre, P.; Le Goff, J.M.; Leiste, R.; Levtchenko, M.; Levtchenko, P.; Li, C.; Likhoded, S.; Lin, C.H.; Lin, W.T.; Linde, F.L.; Lista, L.; Liu, Z.A.; Lohmann, W.; Longo, E.; Lu, Y.S.; Luci, C.; Luminari, L.; Lustermann, W.; Ma, W.G.; Malgeri, L.; Malinin, A.; Mana, C.; Mans, J.; Martin, J.P.; Marzano, F.; Mazumdar, K.; McNeil, R.R.; Mele, S.; Merola, L.; Meschini, M.; Metzger, W.J.; Mihul, A.; Milcent, H.; Mirabelli, G.; Mnich, J.; Mohanty, G.B.; Muanza, G.S.; Muijs, A.J.M.; Musy, M.; Nagy, S.; Natale, S.; Napolitano, M.; Nessi-Tedaldi, F.; Newman, H.; Nisati, A.; Novak, T.; Nowak, H.; Ofierzynski, R.; Organtini, G.; Pal, I.; Palomares, C.; Paolucci, P.; Paramatti, R.; Passaleva, G.; Patricelli, S.; Paul, T.; Pauluzzi, M.; Paus, C.; Pauss, F.; Pedace, M.; Pensotti, S.; Perret-Gallix, D.; Piccolo, D.; Pierella, F.; Pieri, M.; Pioppi, M.; Piroue, P.A.; Pistolesi, E.; Plyaskin, V.; Pohl, M.; Pojidaev, V.; Pothier, J.; Prokofiev, D.; Rahal-Callot, G.; Rahaman, M.A.; Raics, P.; Raja, N.; Ramelli, R.; Rancoita, P.G.; Ranieri, R.; Raspereza, A.; Razis, P.; Rembeczki, S.; Ren, D.; Rescigno, M.; Reucroft, S.; Riemann, S.; Riles, K.; Roe, B.P.; Romero, L.; Rosca, A.; Rosemann, C.; Rosenbleck, C.; Rosier-Lees, S.; Roth, S.; Rubio, J.A.; Ruggiero, G.; Rykaczewski, H.; Sakharov, A.; Saremi, S.; Sarkar, S.; Salicio, J.; Sanchez, E.; Schafer, C.; Schegelsky, V.; Schopper, H.; Schotanus, D.J.; Sciacca, C.; Servoli, L.; Shevchenko, S.; Shivarov, N.; Shoutko, V.; Shumilov, E.; Shvorob, A.; Son, D.; Souga, C.; Spillantini, P.; Steuer, M.; Stickland, D.P.; Stoyanov, B.; Straessner, A.; Sudhakar, K.; Sultanov, G.; Sun, L.Z.; Sushkov, S.; Suter, H.; Swain, J.D.; Szillasi, Z.; Tang, X.W.; Tarjan, P.; Tauscher, L.; Taylor, L.; Tellili, B.; Teyssier, D.; Timmermans, C.; Ting, Samuel C.C.; Ting, S.M.; Tonwar, S.C.; Toth, J.; Tully, C.; Tung, K.L.; Ulbricht, J.; Valente, E.; Van de Walle, R.T.; Vasquez, R.; Vesztergombi, G.; Vetlitsky, I.; Viertel, G.; Vivargent, M.; Vlachos, S.; Vodopianov, I.; Vogel, H.; Vogt, H.; Vorobiev, I.; Vorobyov, A.A.; Wadhwa, M.; Wang, Q.; Wang, X.L.; Wang, Z.M.; Weber, M.; Wynhoff, S.; Xia, L.; Xu, Z.Z.; Yamamoto, J.; Yang, B.Z.; Yang, C.G.; Yang, H.J.; Yang, M.; Yeh, S.C.; Zalite, An.; Zalite, Yu.; Zhang, Z.P.; Zhao, J.; Zhu, G.Y.; Zhu, R.Y.; Zhuang, H.L.; Zichichi, A.; Zimmermann, B.; Zoller, M.
2008-01-01
Results are presented from a study of the structure of hadronic events in highenergy (e^+)(e^-) interactions detected by the L3 detector at LEP. Various event shape distributions and their moments are measured at several energy points at and above the Z-boson mass. The event avour is tagged by using the decay characteristics of b-hadrons. Measurements of distributions of event shape variables for all hadronic events, for light (u, d, s, c) and heavy (b) quark avours are compared to several QCD models with improved leading log approximation: Jetset, Herwig and Ariadne. A good description of the data is provided by the models.
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
South-west Asia including the Middle East is one of the most prone regions to dust storm events. In recent years, there was an increase in the occurrence of these environmental and meteorological phenomena. Remote sensing could serve as an applicable method to detect and also characterise these events. In this study ...
A Comparative Evaluation of Unsupervised Anomaly Detection Algorithms for Multivariate Data
Goldstein, Markus; Uchida, Seiichi
2016-01-01
Anomaly detection is the process of identifying unexpected items or events in datasets, which differ from the norm. In contrast to standard classification tasks, anomaly detection is often applied on unlabeled data, taking only the internal structure of the dataset into account. This challenge is known as unsupervised anomaly detection and is addressed in many practical applications, for example in network intrusion detection, fraud detection as well as in the life science and medical domain. Dozens of algorithms have been proposed in this area, but unfortunately the research community still lacks a comparative universal evaluation as well as common publicly available datasets. These shortcomings are addressed in this study, where 19 different unsupervised anomaly detection algorithms are evaluated on 10 different datasets from multiple application domains. By publishing the source code and the datasets, this paper aims to be a new well-funded basis for unsupervised anomaly detection research. Additionally, this evaluation reveals the strengths and weaknesses of the different approaches for the first time. Besides the anomaly detection performance, computational effort, the impact of parameter settings as well as the global/local anomaly detection behavior is outlined. As a conclusion, we give an advise on algorithm selection for typical real-world tasks. PMID:27093601
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science; Volume 115; Issue 3 ... Modeling of groundwater flow for Mujib aquifer, Jordan ... a cloudburst event with attention to horizontal resolution and the cloud microphysics parameterization. ... Global surface temperature in relation to northeast monsoon rainfall over Tamil Nadu.
Could chiropractors screen for adverse drug events in the community? Survey of US chiropractors
Directory of Open Access Journals (Sweden)
Bero Lisa
2010-11-01
Full Text Available Abstract Background The "Put Prevention into Practice" campaign of the US Public Health Service (USPHS was launched with the dissemination of the Clinician's Handbook of Preventive Services that recommended standards of clinical care for various prevention activities, including preventive clinical strategies to reduce the risk of adverse drug events. We explored whether nonprescribing clinicians such as chiropractors may contribute to advancing drug safety initiatives by identifying potential adverse drug events in their chiropractic patients, and by bringing suspected adverse drug events to the attention of the prescribing clinicians. Methods Mail survey of US chiropractors about their detection of potential adverse drug events in their chiropractic patients. Results Over half of responding chiropractors (62% reported having identified a suspected adverse drug event occurring in one of their chiropractic patients. The severity of suspected drug-related events detected ranged from mild to severe. Conclusions Chiropractors or other nonprescribing clinicians may be in a position to detect potential adverse drug events in the community. These detection and reporting mechanisms should be standardized and policies related to clinical case management of suspected adverse drug events occurring in their patients should be developed.
Science for Alaska: A place for curious people
Campbell, D.
2017-12-01
For over 25 years, Alaskans have been attending Science for Alaska Lecture Series, held during the coldest part of an Alaskan winter. The hour-long evening lectures would see from around 100 to almost 300 people attend each event. The scientific literature is quiet as to why people attend an public science event, and focuses more on the delivery of science communication. This qualitative study looked at the audience of a science lecture series: who are they, why do they come and what do they do with the information. In taped audio interviews, the research participants described themselves as smart, curious lifelong learners who felt a sense of place to the Arctic for its practical and esoteric values. Attending the events constructed their social identity that they felt important to share with children. The findings suggest that addressing the audience's sense of place and mirroring their view as smart, curious people would be an effective avenue to communicate science. Furthermore, I will have more to say about the Arctic as a sense of place, after a fall trip on a research ship with a group studying the tropics in the Beaufort Sea.
Event Discrimination Using Seismoacoustic Catalog Probabilities
Albert, S.; Arrowsmith, S.; Bowman, D.; Downey, N.; Koch, C.
2017-12-01
Presented here are three seismoacoustic catalogs from various years and locations throughout Utah and New Mexico. To create these catalogs, we combine seismic and acoustic events detected and located using different algorithms. Seismoacoustic events are formed based on similarity of origin time and location. Following seismoacoustic fusion, the data is compared against ground truth events. Each catalog contains events originating from both natural and anthropogenic sources. By creating these seismoacoustic catalogs, we show that the fusion of seismic and acoustic data leads to a better understanding of the nature of individual events. The probability of an event being a surface blast given its presence in each seismoacoustic catalog is quantified. We use these probabilities to discriminate between events from natural and anthropogenic sources. Sandia National Laboratories is a multimission laboratory managed and operated by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-NA-0003525.
Single event effect hardness for the front-end ASICs in the DAMPE satellite BGO calorimeter
Gao, Shan-Shan; Jiang, Di; Feng, Chang-Qing; Xi, Kai; Liu, Shu-Bin; An, Qi
2016-01-01
The Dark Matter Particle Explorer (DAMPE) is a Chinese scientific satellite designed for cosmic ray studies with a primary scientific goal of indirect detection of dark matter particles. As a crucial sub-detector, the BGO calorimeter measures the energy spectrum of cosmic rays in the energy range from 5 GeV to 10 TeV. In order to implement high-density front-end electronics (FEE) with the ability to measure 1848 signals from 616 photomultiplier tubes on the strictly constrained satellite platform, two kinds of 32-channel front-end ASICs, VA160 and VATA160, are customized. However, a space mission period of more than 3 years makes single event effects (SEEs) become threats to reliability. In order to evaluate SEE sensitivities of these chips and verify the effectiveness of mitigation methods, a series of laser-induced and heavy ion-induced SEE tests were performed. Benefiting from the single event latch-up (SEL) protection circuit for power supply, the triple module redundancy (TMR) technology for the configuration registers and the optimized sequential design for the data acquisition process, 52 VA160 chips and 32 VATA160 chips have been applied in the flight model of the BGO calorimeter with radiation hardness assurance. Supported by Strategic Priority Research Program on Space Science of the Chinese Academy of Sciences (XDA04040202-4) and Fundamental Research Funds for the Central Universities (WK2030040048)
Power System Extreme Event Detection: The VulnerabilityFrontier
Energy Technology Data Exchange (ETDEWEB)
Lesieutre, Bernard C.; Pinar, Ali; Roy, Sandip
2007-10-17
In this work we apply graph theoretic tools to provide aclose bound on a frontier relating the number of line outages in a gridto the power disrupted by the outages. This frontier describes theboundary of a space relating the possible severity of a disturbance interms of power disruption, from zero to some maximum on the boundary, tothe number line outages involved in the event. We present the usefulnessof this analysis with a complete analysis of a 30 bus system, and presentresults for larger systems.
Physical Sciences 2007 Science and Technology Highlights
International Nuclear Information System (INIS)
Hazi, A.U.
2008-01-01
The Physical Sciences Directorate applies frontier physics and technology to grand challenges in national security. Our highly integrated and multidisciplinary research program involves collaborations throughout Lawrence Livermore National Laboratory, the National Nuclear Security Administration, the Department of Energy, and with academic and industrial partners. The Directorate has a budget of approximately $150 million, and a staff of approximately 350 employees. Our scientists provide expertise in condensed matter and high-pressure physics, plasma physics, high-energy-density science, fusion energy science and technology, nuclear and particle physics, accelerator physics, radiation detection, optical science, biotechnology, and astrophysics. This document highlights the outstanding research and development activities in the Physical Sciences Directorate that made news in 2007. It also summarizes the awards and recognition received by members of the Directorate in 2007
Event detection in athletics for personalized sports content delivery
DEFF Research Database (Denmark)
Katsarakis, N.; Pnevmatikakis, A.
2009-01-01
Broadcasting of athletics is nowadays biased towards running (sprint and longer distances) sports. Personalized content delivery can change that for users that wish to focus on different content. Using a combination of video signal processing algorithms and live information that accompanies the v...... algorithms needed for the extraction of the events that trigger both between and within sport camera selection, and describes a system that handles user preferences, live information andvideo-generated events to offer personalized content to the users.......Broadcasting of athletics is nowadays biased towards running (sprint and longer distances) sports. Personalized content delivery can change that for users that wish to focus on different content. Using a combination of video signal processing algorithms and live information that accompanies...... the video of large-scale sports like the Olympics, a system can attend to the preferences of users by selecting the most suitable camera view for them.There are two types of camera selection for personalized content delivery. According to the between sport camera selection, the view is changed between two...
Tool for Constructing Data Albums for Significant Weather Events
Kulkarni, A.; Ramachandran, R.; Conover, H.; McEniry, M.; Goodman, H.; Zavodsky, B. T.; Braun, S. A.; Wilson, B. D.
2012-12-01
Case study analysis and climatology studies are common approaches used in Atmospheric Science research. Research based on case studies involves a detailed description of specific weather events using data from different sources, to characterize physical processes in play for a given event. Climatology-based research tends to focus on the representativeness of a given event, by studying the characteristics and distribution of a large number of events. To gather relevant data and information for case studies and climatology analysis is tedious and time consuming; current Earth Science data systems are not suited to assemble multi-instrument, multi mission datasets around specific events. For example, in hurricane science, finding airborne or satellite data relevant to a given storm requires searching through web pages and data archives. Background information related to damages, deaths, and injuries requires extensive online searches for news reports and official storm summaries. We will present a knowledge synthesis engine to create curated "Data Albums" to support case study analysis and climatology studies. The technological challenges in building such a reusable and scalable knowledge synthesis engine are several. First, how to encode domain knowledge in a machine usable form? This knowledge must capture what information and data resources are relevant and the semantic relationships between the various fragments of information and data. Second, how to extract semantic information from various heterogeneous sources including unstructured texts using the encoded knowledge? Finally, how to design a structured database from the encoded knowledge to store all information and to support querying? The structured database must allow both knowledge overviews of an event as well as drill down capability needed for detailed analysis. An application ontology driven framework is being used to design the knowledge synthesis engine. The knowledge synthesis engine is being
Forecasting Turbine Icing Events
DEFF Research Database (Denmark)
Davis, Neil; Hahmann, Andrea N.; Clausen, Niels-Erik
2012-01-01
In this study, we present a method for forecasting icing events. The method is validated at two European wind farms in with known icing events. The icing model used was developed using current ice accretion methods, and newly developed ablation algorithms. The model is driven by inputs from the WRF...... mesoscale model, allowing for both climatological estimates of icing and short term icing forecasts. The current model was able to detect periods of icing reasonably well at the warmer site. However at the cold climate site, the model was not able to remove ice quickly enough leading to large ice...
LAT Perspectives in Detection of High Energy Cosmic Ray Electrons
International Nuclear Information System (INIS)
Moiseev, Alexander; Ormes, J.F.; Funk, Stefan
2007-01-01
The LAT science objectives and capabilities in the detection of high energy electrons in the energy range from 20 GeV to ∼1.5 TeV are presented. LAT simulations are used to establish the event selections. It is found that maintaining the efficiency of electron detection at the level of 30%, the residual hadron contamination does not exceed 2-3% of the electron flux. It is expected to collect ∼ ten million of electrons with the energy above 20 GeV for one year of observation. Precise spectrum reconstruction with collected electron statistics opens the unique opportunity to investigate several important problems such as models of IC radiation, revealing the signatures of nearby sources such as high energy cutoff in the electron spectrum, testing the propagation model, and search for KKDM particles decay through their contribution to the electron spectrum
Semantic Complex Event Processing over End-to-End Data Flows
Energy Technology Data Exchange (ETDEWEB)
Zhou, Qunzhi [University of Southern California; Simmhan, Yogesh; Prasanna, Viktor K.
2012-04-01
Emerging Complex Event Processing (CEP) applications in cyber physical systems like SmartPower Grids present novel challenges for end-to-end analysis over events, flowing from heterogeneous information sources to persistent knowledge repositories. CEP for these applications must support two distinctive features - easy specification patterns over diverse information streams, and integrated pattern detection over realtime and historical events. Existing work on CEP has been limited to relational query patterns, and engines that match events arriving after the query has been registered. We propose SCEPter, a semantic complex event processing framework which uniformly processes queries over continuous and archived events. SCEPteris built around an existing CEP engine with innovative support for semantic event pattern specification and allows their seamless detection over past, present and future events. Specifically, we describe a unified semantic query model that can operate over data flowing through event streams to event repositories. Compile-time and runtime semantic patterns are distinguished and addressed separately for efficiency. Query rewriting is examined and analyzed in the context of temporal boundaries that exist between event streams and their repository to avoid duplicate or missing results. The design and prototype implementation of SCEPterare analyzed using latency and throughput metrics for scenarios from the Smart Grid domain.
2001-01-01
The 6th Public Communication of Science and Technology network conference will end on Saturday 3 February with special performances. At 14:30 in the coffee area of restaurant no. 1 (Main Building) all participants and interested CERN members are invited to two events that will address science in an unorthodox and amusing way. Australian scientists will start with Science in the Pub, a fun discussion of topical science in an Australian pub ambiance (free Foster's beer served). Cabaret Pasteur, a French sample of entertainment with a scientific touch will follow.
Extreme sea-level events in coastal regions
Digital Repository Service at National Institute of Oceanography (India)
Unnikrishnan, A.S.
that the outcome of the project has been a code that is capable of predicting correct trends more often (15 out of 20) than the other ‘black box’ codes in operation at various agencies. U. N. SINHA CSIR-Centre for Mathematical Modelling and Computer... of the extreme climate events. Their past trends, future projections and vulnerabi- lity and adaptation to such events are discussed in the report. The report was based on the efforts of both the working groups of the IPCC, WG I, which deals with the science...
Modeling and simulation of discrete event systems
Choi, Byoung Kyu
2013-01-01
Computer modeling and simulation (M&S) allows engineers to study and analyze complex systems. Discrete-event system (DES)-M&S is used in modern management, industrial engineering, computer science, and the military. As computer speeds and memory capacity increase, so DES-M&S tools become more powerful and more widely used in solving real-life problems. Based on over 20 years of evolution within a classroom environment, as well as on decades-long experience in developing simulation-based solutions for high-tech industries, Modeling and Simulation of Discrete-Event Systems is the only book on
Creative Change: Art, Music, and Climate Science
Dahlberg, R. A.; Hoffman, J. S.; Maurakis, E. G.
2017-12-01
As part of ongoing climate science education initiatives, the Science Museum of Virginia hosted Creative Change in March 2017. The event featured multidisciplinary programming created by scientists, artists, and students reacting to and interpreting climate change and resiliency through a variety of artistic mediums and informal science education. Creative Change was developed in consideration of studies conducted at Columbia University that indicate traditional educational approaches, which rely heavily on scientific information and data literacy, fail to engage and inspire action in a majority of people. Our informal science education programming developed for Creative Change, by contrast, is inclusive to all ages and backgrounds, integrating scientific data and an artistic human touch. Our goal was to increase public awareness of climate change and resiliency through the humanities in support of the Museum's mission to inspire Virginians to enrich their lives through science. Visitors were invited to attend Coral Reef Fever, a dance performance of coral bleaching; high school and university art exhibitions; climate data performed by a string quartet; poetry, rap, and theater performances; and a panel discussion by artists and scientists on communicating science through the arts and humanities. Based on 26 post- event survey results, we found as a result that visitors enjoyed the event (mean of 9.58 out of 10), learned new information (9.07), and strongly agreed that the arts and humanities should be used more in communicating science concepts (9.77). Funded in part by Bond Bradley Endowment and NOAA ELG Award #NA15SEC0080009.
International Nuclear Information System (INIS)
Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.
1998-01-01
The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon
Pint of Science | 20-21 May | Geneva
2014-01-01
Pint of Science, established in 2012 in the UK, is an event that aims to make science accessible and fun by bringing current scientific research to the welcoming atmosphere of a pub. Pint of Science is run by groups of enthusiastic postgraduate students and postdoctoral researchers in various countries around the world. This year Switzerland joins the global event (run in parallel in France, UK, Ireland, USA and Australia), and events will be held in Geneva on 20 -21 May from 20:00 in Le Scandale and Lady Godiva. Join us for a drink to hear about: Data Parallelism and Big Data (EN) Big Data and Disaster Relief (EN) Medical software, graphics and imaging (EN) Memory mapping and the perception of reality (EN) Interactive Lab Experiments (FR) Cosmology (FR) Particle Physics (EN) Talks at Le Scandale will be mostly in French; talks at Lady Godiva will be in English. For more info: http://www.pintofscience.ch/
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Earth System Science. P Senthil Kumar. Articles written in Journal of Earth System Science. Volume 119 Issue 5 October 2010 pp 745-751. Soil-gas helium and surface-waves detection of fault zones in granitic bedrock · G K Reddy T Seshunarayana Rajeev Menon P Senthil Kumar · More Details ...
Episodic inflation events at Akutan Volcano, Alaska, during 2005-2017
Ji, Kang Hyeun; Yun, Sang-Ho; Rim, Hyoungrea
2017-08-01
Detection of weak volcano deformation helps constrain characteristics of eruption cycles. We have developed a signal detection technique, called the Targeted Projection Operator (TPO), to monitor surface deformation with Global Positioning System (GPS) data. We have applied the TPO to GPS data collected at Akutan Volcano from June 2005 to March 2017 and detected four inflation events that occurred in 2008, 2011, 2014, and 2016 with inflation rates of about 8-22 mm/yr above the background trend at a near-source site AV13. Numerical modeling suggests that the events should be driven by closely located sources or a single source in a shallow magma chamber at a depth of about 4 km. The inflation events suggest that magma has episodically accumulated in a shallow magma chamber.
Science and technology. A radio chemist's view
International Nuclear Information System (INIS)
Kuroda, P.K.
1995-01-01
In this document the author has described the political scenario and the progress in the field of radiochemistry during late eighties and first half of this century. The natural and political events and the discovery of certain natural elements during this period are discussed. The author is a Japanese radiochemist. At present he is teaching at the J. William Fulbright College of Arts and Science of the University of Arkansas. In a fascinating style he has narrated the role of nuclear chemistry and nuclear chemists in second world war and how it effected the nuclear science in Japan in those days. It gives some important events in the history of nuclear science and the people involved in it
Astronomy on Tap: A New Event Series for Outreach and Professional Development
Rice, Emily L.; Schwamb, M. E.; Muna, D.
2014-01-01
We have established an innovative public outreach event series called Astronomy on Tap. The venues, format, timing, and content of the events aim to bring science to the public in an informal, engaging, creative way and to reach a larger, more diverse audience than typical public science lectures at academic and cultural institutions. Each event is held on a weekday evening at a bar and features several short astronomy-related presentations, usually electronic slides with other media formats encouraged. The presenters are typically early-career scientists (grad students, postdocs and new faculty) and occasionally educators, writers, and artists with experience relevant to astronomy. The informal and interactive environment is encouraged by allowing ample time for questions and conversations between presenters and the audience before, during, and after presentations. We also have a designated host who provides introductions, interludes, games, prizes, and give aways. The events serve as professional development by providing opportunities for early-career scientists to practice communication and presentation skills in a decidedly non-academic environment. We have successfully held over ten events in three cities in 2012-2013 and received extremely positive feedback from presenters, attendees, and venue staff. We present key practical considerations for hosting a similar event and share initial evaluation results collected at events in October 2013.
Science, news, and the public tackling the 'red shift' in science communication
Nguyen, An; Thompson, Shelley
2019-01-01
As the rate of scientific discoveries and developments accelerates, it becomes increasingly difficult to understand and relate these events to our everyday lives. The day-to-day activities of science now lie obscured behind an ever-thickening screen of corporate, civil and military secrecy, whilst the news media the only major space left for public engagement in science development represent it in a way that tends to drive people away from science rather than attract them to its issues and debates. This book explores this shift in science news communication. It demonstrates that journalism needs to change the way it deals with science altering its traditional mindsets and abandoning its much discredited techniques if it is to maintain or regain its role as a principal force that encourages discussion and understanding of science in the public sphere."
The National Extreme Events Data and Research Center (NEED)
Gulledge, J.; Kaiser, D. P.; Wilbanks, T. J.; Boden, T.; Devarakonda, R.
2014-12-01
The Climate Change Science Institute at Oak Ridge National Laboratory (ORNL) is establishing the National Extreme Events Data and Research Center (NEED), with the goal of transforming how the United States studies and prepares for extreme weather events in the context of a changing climate. NEED will encourage the myriad, distributed extreme events research communities to move toward the adoption of common practices and will develop a new database compiling global historical data on weather- and climate-related extreme events (e.g., heat waves, droughts, hurricanes, etc.) and related information about impacts, costs, recovery, and available research. Currently, extreme event information is not easy to access and is largely incompatible and inconsistent across web sites. NEED's database development will take into account differences in time frames, spatial scales, treatments of uncertainty, and other parameters and variables, and leverage informatics tools developed at ORNL (i.e., the Metadata Editor [1] and Mercury [2]) to generate standardized, robust documentation for each database along with a web-searchable catalog. In addition, NEED will facilitate convergence on commonly accepted definitions and standards for extreme events data and will enable integrated analyses of coupled threats, such as hurricanes/sea-level rise/flooding and droughts/wildfires. Our goal and vision is that NEED will become the premiere integrated resource for the general study of extreme events. References: [1] Devarakonda, Ranjeet, et al. "OME: Tool for generating and managing metadata to handle BigData." Big Data (Big Data), 2014 IEEE International Conference on. IEEE, 2014. [2] Devarakonda, Ranjeet, et al. "Mercury: reusable metadata management, data discovery and access system." Earth Science Informatics 3.1-2 (2010): 87-94.
Murty, Vishnu P.; Adcock, R. Alison
2013-01-01
Learning how to obtain rewards requires learning about their contexts and likely causes. How do long-term memory mechanisms balance the need to represent potential determinants of reward outcomes with the computational burden of an over-inclusive memory? One solution would be to enhance memory for salient events that occur during reward anticipation, because all such events are potential determinants of reward. We tested whether reward motivation enhances encoding of salient events like expec...