ORNL Neutron Sciences Annual Report for 2007

Energy Technology Data Exchange (ETDEWEB)

Anderson, Ian S [ORNL; Horak, Charlie M [ORNL; Counce, Deborah Melinda [ORNL; Ekkebus, Allen E [ORNL

2008-07-01

This is the first annual report of the Oak Ridge National Laboratory Neutron Sciences Directorate for calendar year 2007. It describes the neutron science facilities, current developments, and future plans; highlights of the year's activities and scientific research; and information on the user program. It also contains information about education and outreach activities and about the organization and staff. The Neutron Sciences Directorate is responsible for operation of the High Flux Isotope Reactor and the Spallation Neutron Source. The main highlights of 2007 were highly successful operation and instrument commissioning at both facilities. At HFIR, the year began with the reactor in shutdown mode and work on the new cold source progressing as planned. The restart on May 16, with the cold source operating, was a significant achievement. Furthermore, measurements of the cold source showed that the performance exceeded expectations, making it one of the world's most brilliant sources of cold neutrons. HFIR finished the year having completed five run cycles and 5,880 MWd of operation. At SNS, the year began with 20 kW of beam power on target; and thanks to a highly motivated staff, we reached a record-breaking power level of 183 kW by the end of the year. Integrated beam power delivered to the target was 160 MWh. Although this is a substantial accomplishment, the next year will bring the challenge of increasing the integrated beam power delivered to 887 MWh as we chart our path toward 5,350 MWh by 2011.

Dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the North Pacific Ocean from 2007-09-04 to 2007-10-02 (NODC Accession 0112270)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112270 includes chemical, discrete sample, physical and profile data collected from MIRAI in the North Pacific Ocean from 2007-09-04 to 2007-10-02...

Forecast products from the Gulf of Mexico created by the NOAA Harmful Algal Bloom Operational Forecast System (HAB-OFS) from 2007-09-10 to the present

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — This collection contains outputs from the NOAA Harmful Algal Bloom Operational Forecast System (HAB-OFS) in the form of bulletin documents beginning on 2007-09-10....

Antarctic Surface Reflectivity Measurements from the ANITA-3 and HiCal-1 Experiments

Science.gov (United States)

Gorham, P. W.; Allison, P.; Banerjee, O.; Beatty, J. J.; Belov, K.; Besson, D. Z.; Binns, W. R.; Bugaev, V.; Cao, P.; Chen, C.; Chen, P.; Clem, J. M.; Connolly, A.; Dailey, B.; Dasgupta, P.; Deaconu, C.; Cremonesi, L.; Dowkontt, P. F.; Fox, B. D.; Gordon, J.; Hill, B.; Hupe, R.; Israel, M. H.; Jain, P.; Kowalski, J.; Lam, J.; Learned, J. G.; Liewer, K. M.; Liu, T. C.; Matsuno, S.; Miki, C.; Mottram, M.; Mulrey, K.; Nam, J.; Nichol, R. J.; Novikov, A.; Oberla, E.; Prohira, S.; Rauch, B. F.; Romero-Wolf, A.; Rotter, B.; Ratzlaff, K.; Russell, J.; Saltzberg, D.; Seckel, D.; Schoorlemmer, H.; Stafford, S.; Stockham, J.; Stockham, M.; Strutt, B.; Tatem, K.; Varner, G. S.; Vieregg, A. G.; Wissel, S. A.; Wu, F.; Young, R.

The primary science goal of the NASA-sponsored ANITA project is measurement of ultra-high energy neutrinos and cosmic rays, observed via radio-frequency signals resulting from a neutrino or cosmic ray interaction with terrestrial matter (e.g. atmospheric or ice molecules). Accurate inference of the energies of these cosmic rays requires understanding the transmission/reflection of radio wave signals across the ice-air boundary. Satellite-based measurements of Antarctic surface reflectivity, using a co-located transmitter and receiver, have been performed more-or-less continuously for the last few decades. Our comparison of four different reflectivity surveys, at frequencies ranging from 2 to 45GHz and at near-normal incidence, yield generally consistent maps of high versus low reflectivity, as a function of location, across Antarctica. Using the Sun as an RF source, and the ANITA-3 balloon borne radio-frequency antenna array as the RF receiver, we have also measured the surface reflectivity over the interval 200-1000MHz, at elevation angles of 12-30∘. Consistent with our previous measurement using ANITA-2, we find good agreement, within systematic errors (dominated by antenna beam width uncertainties) and across Antarctica, with the expected reflectivity as prescribed by the Fresnel equations. To probe low incidence angles, inaccessible to the Antarctic Solar technique and not probed by previous satellite surveys, a novel experimental approach (“HiCal-1”) was devised. Unlike previous measurements, HiCal-ANITA constitute a bi-static transmitter-receiver pair separated by hundreds of kilometers. Data taken with HiCal, between 200 and 600MHz shows a significant departure from the Fresnel equations, constant with frequency over that band, with the deficit increasing with obliquity of incidence, which we attribute to the combined effects of possible surface roughness, surface grain effects, radar clutter and/or shadowing of the reflection zone due to Earth

Diferencias y similitudes entre morteros de cal hidráulica y morteros mixtos de cal área y cemento portland

OpenAIRE

Peñaranda García, Pilar

2012-01-01

En el presente trabajo se estudian el mortero de cal hidráulica y el mortero mixto de cal aérea y cemento Portland, siendo este último el más utilizado en la actualidad, ya que la cal ha pasado a un segundo plano en la construcción debido a los grandes avances en la producción de cemento a lo largo del siglo XX. Estos avances han desplazado a la cal, un material utilizado desde hace milenios, olvidando su alta resistencia al paso del tiempo, cuya prueba es el gran volumen de ...

Globe : Fête de la science 2007

CERN Multimedia

2007-01-01

FROM 8 TO 13 OCTOBER 2007 Globe of Science and Innovation - Route de Meyrin, 1211 Geneva >>> "Expo NANO. Technology takes on a new dimension". Open on the Monday, Tuesday, Thursday and Friday from 2.00 p.m. to 5.30 p.m. and on the Wednesday and Saturday from 10.00 a.m. to 5.30 p.m. >>> Conference/Debate on the LHC "The LHC: an accelerator of science". Thursday 11 October from 8.00 p.m. to 10 p.m. CERN will soon commission the world’s most powerful accelerator, the LHC. This machine, the latest and greatest in a long line of CERN accelerators, is designed to provide answers to the remaining unsolved mysteries surrounding the building blocks of matter. Speakers : Jean-Philippe Tock, Jean-Pierre Revol, Daniel Denegri, Richard Jacobsson and Laurent Chevalier Free entrance. Please book by calling + 41 (0)22 767 76 76 >>> "Poussière d’étoiles" workshop: Saturday 13 October from 10 a.m. to 5.30 p.m. The "Poussière d’étoiles...

U.S. Army Deployment Injury Surveillance Summary, CY 2007 1 January 2007 - 31 December 2007

Science.gov (United States)

2007-12-31

percent), football (15 percent), PT (15 percent), and weightlifting (14 percent). 8 Injury Prevention Report No. 12-HF-OAN7A-09, 1 Jan -31 Dec 07...Washington, DC 20310 SUBJECT: Injury Prevention Report No. 12-HF-OAN7A-09, US Army Deployment Injury Surveillance Summary, CY 2007. 1. We are enclosing a...copy of the subject report with an Executive Summary. The ASA(I&E) provided initial funding in 2004 for the USACHPPM to conduct deployment injury

CALS - What are the Potentials for SMEs ?

DEFF Research Database (Denmark)

Bilberg, Arne; Larsen, Michael holm; Langer, Gilad

1996-01-01

The Danish CALS Center initiative, aims at making CALS operational in Danish industry. The center consists of three Danish companies, Bang & Olufsen, Odense Steel Shipyard, Nilfisk besides from the Technical University of Denmark and the Danish Technological Institute. The objective is to demonst...

The Efficiency of Delone Coverings of the Canonical Tilings MATH {cal T}(*(A_4)) -> T^*(A4) and MATH {cal T}(*(D_6)) -> T^*(D6)

Science.gov (United States)

Papadopolos, Zorka; Kasner, Gerald

This chapter is devoted to the coverings of the two quasiperiodic canonical tilings MATH {cal T}(*(A_4)) -> T^*(A4) and MATH {cal T}(*(D_6)) equiv {cal T}(*(2F)) -> T^*(D6) T^*(2F), obtained by projection from the root lattices A4 and D6, respectively. In the first major part of this chapter, in Sect. 5.2, we shall introduce a Delone covering MATH {cal C}(s_{{cal) T}(*(A_4)}) -> C^sT^*(A4) of the 2-dimensional decagonal tiling MATH {cal T}(*(A_4)) -> T^*(A4). In the second major part of this chapter, Sect. 5.3, we summarize the results related to the Delone covering of the icosahedral tiling MATH {cal T}(*(D_6)) -> T^*(D6), MATH {cal C}_{{cal T}(*(D_6)}) -> CT^*(D6) and determine the zero-, single-, and double- deckings and the resulting thickness of the covering. In the conclusions section, we give some suggestions as to how the definition of the Delone covering might be changed in order to reach some real (full) covering of the icosahedral tiling MATH {cal T}(*(D_6)) -> T^*(D6). In Section 5.2 the definition of the Delone covering is also changed in order to avoid an unnecessary large thickness of the covering.

Progress report on neutron science. April 1, 2006 - March 31, 2007

International Nuclear Information System (INIS)

Takeda, Masayasu; Ohhara, Takashi; Moriai, Atsushi

2008-03-01

There are 13 research groups in neutron science and technology in the Quantum Beam Science Directorate (QuBS) and Advanced Science Research Center (ASRC) of Japan Atomic Research Agency (JAEA). A wide variety of research is performed by these group: neutron scattering (condensed matter physics, polymer science, biology, and residual stress analysis), prompt gamma-ray analysis, neutron radiography, neutron optics, and development of a neutron spectrometer, neutron beam handling device and neutron detector. This issue summarizes research progress in neutron science and technology including activities of the Nuclear Science and Engineering Directorate of JAEA, and of the COMMON USE PROGRAM of JAEA utilizing the research reactor JRR-3 during the period between April 1, 2006 and March 31, 2007. This report contains highlights of research by these 13 neutron research groups of QuBS and ASRC, introducing 68 experimental reports. (author)

884 Cal.BP and all that

International Nuclear Information System (INIS)

Switsur, Roy

1986-01-01

A history of the development of the technique of radiocarbon dating highlights the two problems with this method. The first is calibration; the radiocarbon calendar is not linear. However two independent experiments to provide high precision measurements in tree rings have resulted in a high precision calibration curve. The second is how to denote radiocarbon ages and calibrated dates, as this depends on how the dendrochronology time scale used in the calibration is transferred to the actual calendar. If the zero of the dendroscale is transferred from the origin of the Christian calendar to AD 1950, radiocarbon ages are designated CAL BP (BP = before present). There is an alternative method which results in CAL AD and CAL BC. A suggestion for a standard notation is made to avoid the confusion of two systems. (U.K.)

Examining the Effects of Turkish Education Reform on Students' TIMSS 2007 Science Achievements

Science.gov (United States)

Atar, Hakan Yavuz; Atar, Burcu

2012-01-01

The purpose of this study is to examine the effects of some of the changes such as student centered learning (i.e. inquiry science instruction), outfitting classrooms with latest technology and computers that the reform movement has brought about on students' TIMSS 2007 science achievements. Two-staged stratified sampling was used in the selection…

CalNex Observational Data

Data.gov (United States)

U.S. Environmental Protection Agency — Observations made during the 2010 CalNex measurement campaign. This dataset is associated with the following publication: Woody , M., K. Baker , P. Hayes, J....

Marine04 marine radiocarbon age calibration, 0-26 cal kyr BP

NARCIS (Netherlands)

Hughen, Konrad A.; Baillie, Mike G.L.; Bard, Edouard; Beck, J. Warren; Bertrand, Chanda J.H.; Blackwell, Paul G.; Buck, Caitlin E.; Burr, George S.; Cutler, Kirsten B.; Damon, Paul E.; Edwards, Richard L.; Fairbanks, Richard G.; Friedrich, Michael; Guilderson, Thomas P.; Kromer, Bernd; McCormac, Gerry; Manning, Sturt; Bronk Ramsey, Christopher; Reimer, Paula J.; Reimer, Ron W.; Remmele, Sabine; Southon, John R.; Stuiver, Minze; Talamo, Sahra; Taylor, F.W.; Plicht, Johannes van der; Weyhenmeyer, Constanze E.

2004-01-01

New radiocarbon calibration curves, IntCal04 and Marine04, have been constructed and internationally ratified to replace the terrestrial and marine components of IntCal98. The new calibration data sets extend an additional 2000 yr, from 0–26 cal kyr BP (Before Present, 0 cal BP = AD 1950), and

CalWater 2 - Precipitation, Aerosols, and Pacific Atmospheric Rivers Experiment

Science.gov (United States)

Spackman, Ryan; Ralph, Marty; Prather, Kim; Cayan, Dan; DeMott, Paul; Dettinger, Mike; Fairall, Chris; Leung, Ruby; Rosenfeld, Daniel; Rutledge, Steven; Waliser, Duane; White, Allen

2014-05-01

Emerging research has identified two phenomena that play key roles in the variability of the water supply and the incidence of extreme precipitation events along the West Coast of the United States. These phenomena include the role of (1) atmospheric rivers (ARs) in delivering much of the precipitation associated with major storms along the U.S. West Coast, and (2) aerosols—from local sources as well as those transported from remote continents—and their modulating effects on western U.S. precipitation. A better understanding of these processes is needed to reduce uncertainties in weather predictions and climate projections of extreme precipitation and its effects, including the provision of beneficial water supply. This presentation summarizes science gaps associated with (1) the evolution and structure of ARs including cloud and precipitation processes and air-sea interaction, and (2) aerosol interaction with ARs and the impact on precipitation, including locally-generated aerosol effects on orographic precipitation along the U.S. West Coast. Observations are proposed for multiple winter seasons as part of a 5-year broad interagency vision referred to as CalWater 2 to address these science gaps (http://esrl.noaa.gov/psd/calwater). In the near term, a science investigation is being planned including a targeted set of aircraft and ship-based measurements and associated evaluation of data in near-shore regions of California and in the eastern Pacific for an intensive observing period between January 2015 and March 2015. DOE's Atmospheric Radiation Measurement (ARM) program and NOAA are coordinating on deployment of airborne and ship-borne facilities for this period in a DOE-sponsored study called ACAPEX (ARM Cloud Aerosol and Precipitation Experiment) to complement CalWater 2. The motivation for this major study is based on findings that have emerged in the last few years from airborne and ground-based studies including CalWater and NOAA's HydroMeterology Testbed

CalCOFI Egg Counts

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish egg counts and standardized counts for eggs captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets], and...

Beam Tests of a Multilayer LumiCal Prototype

CERN Document Server

Borysov, O

2018-01-01

LumiCal is a sampling electromagnetic calorimeter designed for the precise measurement of in- tegrated luminosity in electron positron linear collider experiments. The present report contains a description and results of the first beam test of a multilayer LumiCal prototype with four sili- con detector planes. A 5 GeV electron beam from the CERN PS T9 facility was used to study the performance of the LumiCal prototype. Presented results are mainly focused on the trans- verse structure of the observed electromagnetic shower and the Molière radius measurement. A comparison with MC simulation is also discussed.

Windows Calorimeter Control (WinCal) program computer software design description

International Nuclear Information System (INIS)

Pertzborn, N.F.

1997-01-01

The Windows Calorimeter Control (WinCal) Program System Design Description contains a discussion of the design details for the WinCal product. Information in this document will assist a developer in maintaining the WinCal system. The content of this document follows the guidance in WHC-CM-3-10, Software Engineering Standards, Standard for Software User Documentation

Finished Genome Sequence of Collimonas arenae Cal35

NARCIS (Netherlands)

Wu, Je-Jia; de Jager, Victor; Deng, Wen-ling; Leveau, Johan

2015-01-01

We announce the finished genome sequence of soil forest isolate Collimonas arenae Cal35, which comprises a 5.6-Mbp chromosome and 41-kb plasmid. The Cal35 genome is the second one published for the bacterial genus Collimonas and represents the first opportunity for high-resolution comparison of

APS Science 2007.

Energy Technology Data Exchange (ETDEWEB)

2008-05-30

This report provides research highlights from the Advanced Photon Source (APS). Although these highlights represent less than 10% of the published work from the APS in 2007, they give a flavor of the diversity and impact of user research at the facility. In the strategic planning the aim is to foster the growth of existing user communities and foresee new areas of research. This coming year finds the APS engaged in putting together, along with the users, a blueprint for the next five years, and making the case for a set of prioritized investments in beamlines, the accelerator, and infrastructure, each of which will be transformational in terms of scientific impact. As this is written plans are being formulated for an important user workshop on October 20-21, 2008, to prioritize strategic plans. The fruit from past investments can be seen in this report. Examples include the creation of a dedicated beamline for x-ray photon correlation spectroscopy at Sector 8, the evolution of dedicated high-energy x-ray scattering beamlines at sectors 1 and 11, a dedicated imaging beamline at Sector 32, and new beamlines for inelastic scattering and powder diffraction. A single-pulse facility has been built in collaboration with Sector 14 (BioCARS) and Phil Anfinrud at the National Institutes of Health, which will offer exceptionally high flux for single-pulse diffraction. The nanoprobe at Sector 26, built and operated jointly by the Argonne Center for Nanoscale Materials and the X-ray Operations and Research (XOR) section of the APS X-ray Science Division, has come on line to define the state of the art in nanoscience.

APS Science 2007

International Nuclear Information System (INIS)

2008-01-01

This report provides research highlights from the Advanced Photon Source (APS). Although these highlights represent less than 10% of the published work from the APS in 2007, they give a flavor of the diversity and impact of user research at the facility. In the strategic planning the aim is to foster the growth of existing user communities and foresee new areas of research. This coming year finds the APS engaged in putting together, along with the users, a blueprint for the next five years, and making the case for a set of prioritized investments in beamlines, the accelerator, and infrastructure, each of which will be transformational in terms of scientific impact. As this is written plans are being formulated for an important user workshop on October 20-21, 2008, to prioritize strategic plans. The fruit from past investments can be seen in this report. Examples include the creation of a dedicated beamline for x-ray photon correlation spectroscopy at Sector 8, the evolution of dedicated high-energy x-ray scattering beamlines at sectors 1 and 11, a dedicated imaging beamline at Sector 32, and new beamlines for inelastic scattering and powder diffraction. A single-pulse facility has been built in collaboration with Sector 14 (BioCARS) and Phil Anfinrud at the National Institutes of Health, which will offer exceptionally high flux for single-pulse diffraction. The nanoprobe at Sector 26, built and operated jointly by the Argonne Center for Nanoscale Materials and the X-ray Operations and Research (XOR) section of the APS X-ray Science Division, has come on line to define the state of the art in nanoscience

Implementació d'una Intranet pel Restaurant "Cal Fesu"

OpenAIRE

Maldonado Rubio, Lluís Manel

2007-01-01

Aquest projecte consisteix en el disseny i implementació d'una intranet amb zona privada pel restaurant "Cal Fesu", utilitzant una tecnologia puntera com és J2EE (struts). Este proyecto consiste en el diseño e implementación de una intranet con zona privada para el restaurante "Cal Fesu", utilizando una tecnología puntera como es J2EE (struts). This project consists of design and implementation of an intranet with a private area for the restaurant "Cal Fesu", using a leading technology ...

Applied CAL on Problem Based Learning Using Gagne’s Instructional Design

Directory of Open Access Journals (Sweden)

Sri Sundari Purbohadi

2014-10-01

Full Text Available Abstract— In the Problem-Based Learning (PBL model, students are expected to study independently. One of the methods that can improve the ability or skill of learners is using Computer Assisted Learning (CAL. Implementation of CAL in PBL should be able to create Self-Directed Learning (SDL culture through appropriate instructional design and interesting modules. In this paper, the CAL software is developed using multimedia learning principles, convenient appearance, and user-friendly navigation. The CAL’s learning content is designed using Gagne's instructional design. The experiment proved the CAL was able to give effect size 0.89 and developed self-directed learning culture. From the interviews, students were very glad and interested to use the CAL modules because they can learn anytime and can reach the course objectives without a lecturer.

Annual report 2008-09

International Nuclear Information System (INIS)

2009-01-01

The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).

Education Funding Crisis in the Suburbs: The Impact of the 2007-09 Recession Recovery Policies and the New York State Tax Levy Cap on School District Financial Planning Practices

Science.gov (United States)

Galligan, John J.; Annunziato, Anthony

2017-01-01

This article examines the impact of the fiscal recovery policies stemming from the 2007-09 economic recession and the implementation of the 2011 New York State Property Tax Levy Cap on the budgets of school districts located within a Long Island, New York suburban township. The research basis of this paper is based on two studies conducted by the…

On the correspondence between CAL and lagged cohort life expectancy

Directory of Open Access Journals (Sweden)

Michel Guillot

2011-04-01

Full Text Available It has been established that under certain mortality assumptions, the current value of the Cross-sectional Average length of Life (CAL is equal to the life expectancy for the cohort currently reaching its life expectancy. This correspondence is important, because the life expectancy for the cohort currently reaching its life expectancy, or lagged cohort life expectancy (LCLE, has been discussed in the tempo literature as a summary mortality measure of substantive interest. In this paper, we build on previous work by evaluating the extent to which the correspondence holds in actual populations. We also discuss the implications of the CAL-LCLE correspondence (or lack thereof for using CAL as a measure of cohort life expectancy, and for understanding the connection between CAL, LCLE, and underlying period mortality conditions.

L’Observatoire numérique Nouvelle-Calédonie

Directory of Open Access Journals (Sweden)

Charlotte Ullmann

2013-06-01

Full Text Available Ses missions consistent à observer le développement numérique et favoriser l’animation territoriale des acteurs en Nouvelle-Calédonie. Parrainée par l’association calédonienne pour les technologies de l’information et de la communication (ACTIC et le ministère en charge de l’économie numérique du Gouvernement de Nouvelle-Calédonie nommé depuis mai 2009, une mission d’étude a été menée depuis juin 2010 pour définir les contours d’un Observatoire numérique. A travers cette étude, il s’agissai...

Solar CalPoly

Energy Technology Data Exchange (ETDEWEB)

Stannard, Sandra [California Polytechnic State Univ., San Luis Obispo, CA (United States)

2016-06-15

The target budget of INhouse was about $650,000 for all materials and student expenses of the Solar Decathlon competition. In order to reach our goal, Cal Poly students and faculty worked with the College of Architecture and Environmental Design’s External Relations office to actively fundraise for INhouse. Students connected with Cal Poly alumni through phone calls, postal mail, email, and live presentations to reach as many alumni in the state of California as possible. Before construction begun, students and faculty met on a weekly basis to determine what brands of materials for the home to use and who would be responsible for reaching out to the company to seek a donation. Our College of Architecture and Environmental Design’s administration was essential in helping us fundraise. For some time, the college was hoping to depend on about half of our fundraising expenses to be covered through the sale of INhouse. However, plans to sell the home fell through during the design development phase; the college turned to the sale of a different asset in to help us meet our goal. If we were to do this project again, completing the design concept and securing a future location of our home sooner would have enhanced our fundraising activities.

Relationship between teacher preparedness and inquiry-based instructional practices to students' science achievement: Evidence from TIMSS 2007

Science.gov (United States)

Martin, Lynn A.

The purpose of this study was to examine the relationship between teachers' self-reported preparedness for teaching science content and their instructional practices to the science achievement of eighth grade science students in the United States as demonstrated by TIMSS 2007. Six hundred eighty-seven eighth grade science teachers in the United States representing 7,377 students responded to the TIMSS 2007 questionnaire about their instructional preparedness and their instructional practices. Quantitative data were reported. Through correlation analysis, the researcher found statistically significant positive relationships emerge between eighth grade science teachers' main area of study and their self-reported beliefs about their preparedness to teach that same content area. Another correlation analysis found a statistically significant negative relationship existed between teachers' self-reported use of inquiry-based instruction and preparedness to teach chemistry, physics and earth science. Another correlation analysis discovered a statistically significant positive relationship existed between physics preparedness and student science achievement. Finally, a correlation analysis found a statistically significant positive relationship existed between science teachers' self-reported implementation of inquiry-based instructional practices and student achievement. The data findings support the conclusion that teachers who have feelings of preparedness to teach science content and implement more inquiry-based instruction and less didactic instruction produce high achieving science students. As science teachers obtain the appropriate knowledge in science content and pedagogy, science teachers will feel prepared and will implement inquiry-based instruction in science classrooms.

The Pace of CalWORKs Implementation

National Research Council Canada - National Science Library

Klerman, Jacob

2000-01-01

...) and Greater Avenues to Independence (GAIN) with the California Work Responsibility to Kids (CalWORKs) program. Following an open and competitive bidding process, the California Department of Social Services...

The Pace of CalWORKS Implementation

National Research Council Canada - National Science Library

Klerman, Jacob

1999-01-01

...) and Greater Avenues to Independence (GAIN) with the California Work Responsibility to Kids (CalWORKs) program. Following an open and competitive bidding process, the California Department of Social Services...

Estrategias de desarrollo para la empresa Cal del Centro S.A.C.

OpenAIRE

Bautista Antón, Yovanni Patricia; Mendoza Rojas, Miguel Ángel

2015-01-01

Cal del Centro S.A.C. es una sociedad anónima cerrada cuyo negocio gira en torno a la actividad económica de la fabricación de cemento, cal y yeso. El objetivo del presente trabajo es evaluar la posibilidad de éxito de un proyecto de inversión en una planta de cal, a través de Cal del Centro S.A.C. –como empresa autosuficiente–, para asegurar el cien por ciento del suministro de óxido de calcio en cantidad y calidad para el procesamiento de concentrados de cobre y el tratamiento de aguas indu...

CalWater 2 - Precipitation, Aerosols, and Pacific Atmospheric Rivers Experiment

Science.gov (United States)

Spackman, J. R.; Ralph, F. M.; Prather, K. A.; Cayan, D. R.; DeMott, P. J.; Dettinger, M. D.; Fairall, C. W.; Leung, L. R.; Rosenfeld, D.; Rutledge, S. A.; Waliser, D. E.; White, A. B.

2014-12-01

Emerging research has identified two phenomena that play key roles in the variability of the water supply and the incidence of extreme precipitation events along the West Coast of the United States. These phenomena include the role of (1) atmospheric rivers (ARs) in delivering much of the precipitation associated with major storms along the U.S. West Coast, and (2) aerosols—from local sources as well as those transported from remote continents—and their modulating effects on western U.S. precipitation. A better understanding of these processes is needed to reduce uncertainties in weather predictions and climate projections of extreme precipitation and its effects, including the provision of beneficial water supply. This presentation summarizes the science objectives and strategies to address gaps associated with (1) the evolution and structure of ARs including cloud and precipitation processes and air-sea interaction, and (2) aerosol interaction with ARs and the impact on precipitation, including locally-generated aerosol effects on orographic precipitation along the U.S. West Coast. Observations are proposed for multiple winter seasons as part of a 5-year broad interagency vision referred to as CalWater 2 to address these science gaps (http://esrl.noaa.gov/psd/calwater). In January-February 2015, a field campaign has been planned consisting of a targeted set of aircraft and ship-based measurements and associated evaluation of data in near-shore regions of California and in the eastern Pacific. In close coordination with NOAA, DOE's Atmospheric Radiation Measurement (ARM) program is also contributing air and shipborne facilities for ACAPEX (ARM Cloud Aerosol and Precipitation Experiment), a DOE-sponsored study complementing CalWater 2. Ground-based measurements from NOAA's HydroMeteorological Testbed (HMT) network in California and aerosol chemical instrumentation at Bodega Bay, California have been designed to add important near surface-level context for the

The Megha-Tropiques Mission: overview of the French Science and Cal/Val plans

Science.gov (United States)

Roca, R.

2009-04-01

The Megha-Tropiques mission is an Indo-French mission built by the Centre National d'Études Spatiales et l'Indian Space Research Organisation due to launch in 2010. Megha means cloud in Sanskrit and Tropiques is the French for tropics. The major innovation of MT is to bring together a suite of complementary instruments on a dedicated orbit that strongly improves the sampling of the water cycle elements. Indeed the low inclination on the equator (20°) combined to the elevated height of the orbit (865km) provides unique observing capabilities with up to 6 over-passes per day for the best case (Figure 8). The scientific objective of the mission concerns i) Atmospheric energy budget in the inter-tropical zone and at system scale (radiation, latent heat, …) ii) Life cycle of Meso-scale Convective Complexes in the Tropics (over Oceans and Continents) and iii) Monitoring and assimilation for Cyclones, Monsoons, Meso-scale Convective Systems forecasting. These scientific objectives are achieved thanks to the following payload: SCARAB : wide band instrument for inferring longwave and shortwave outgoing fluxes at the top of the atmosphere (cross track scanning, 40 km resolution at nadir); SAPHIR: microwave sounder for water vapour sounding: 6 channels in the WV absorption band at 183.31 GHz. (cross track, 10 km) and MADRAS: microwave imager for precipitation: channels at 18, 23, 37, 89 and 157 GHz, H and V polarisations. (conical swath, <10 km to 40 km). In this presentation, a rapid overview of the anticipated Science and Cal/Val activities will be offered after a quick introduction to the Mission. The emphasis will be set on the instrumental combination and the associated scientific and technical challenges. Finally, the combination of this spacecraft and the other missions expected simultaneously, in particular in the framework of GPM, will be discussed.

Design de calçado do processo criativo à produção

OpenAIRE

Rolo, Margarida Filipa Gonçalves Araújo

2016-01-01

O seguinte projeto tem como tema principal o Design de calçado, pois foi com base nesse tema que foi feito todo o enquadramento teórico de modo a fundamentar a criação da coleção final de calçado a que este projeto se pretende. Logo, foi realizada uma pesquisa sobre a história do calçado, os seus materiais e componentes, tipos de sapatos e saltos, a indústria do calçado em Portugal e seus principais designers, entre outros. Este projeto consiste na criação de uma coleção cápsula de calçado...

Is Formative Measurement Really Measurement? Reply to Bollen (2007) and Bagozzi (2007)

Science.gov (United States)

Howell, Roy D.; Breivik, Einar; Wilcox, James B.

2007-01-01

R. D. Howell, E. Breivik, and J. B. Wilcox (2007) examined the use of formative measurement models in theory testing in the social sciences. K. A. Bollen (2007) and R. P. Bagozzi (2007) have provided comments on this work. In this article, the authors reply to the commentators and suggest that the conclusions reached in the original article and…

CalCOFI Larvae Counts Positive Tows

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for eggs captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

THE FLIP SIDE OF THE U.S. ECONOMIC RECESSION 2007-09

Directory of Open Access Journals (Sweden)

Behrouz Tabrizi

2011-01-01

Full Text Available This paper is an attempt to translate economic figures and indices into the living conditions of people who are behind the statistics of the U.S. economic recession, which officially began in December 2007 and ended in June 2009. The pathology of the Great Recession began with the financial shock, which resulted from the buildup of financial mischief since the 1980s, and the burst of its real estate bubble by 2007. A recession is a man-made tragedy with a large human cost. This paper addresses this flip side of the current economic crisis by examining its human consequences on different social classes and groups. A breakdown of various data proves that the working class, the majority in U.S. society, suffers most from the recession, and yet, some amongst them even more than others, depending upon their social status with regard to education, race, and age.

A modern documented Italian identified skeletal collection of 2127 skeletons: The CAL Milano Cemetery Skeletal Collection.

Science.gov (United States)

Cattaneo, Cristina; Mazzarelli, Debora; Cappella, Annalisa; Castoldi, Elisa; Mattia, Mirko; Poppa, Pasquale; De Angelis, Danilo; Vitello, Antonio; Biehler-Gomez, Lucie

2018-04-24

The CAL Milano Cemetery Skeletal Collection is a modern and continuously growing identified osteological collection of 2127 skeletons under study in the Laboratorio di Antropologia e Odontologia Forense (LABANOF) in the Department of Biomedical Sciences for Health of the University of Milan (Italy), and part of the Collezione Antropologica LABANOF (CAL). The collection presents individuals of both sexes and of all age groups with a high representation of elderly and an interesting sample of infants. Each individual is associated with a documentation that includes sex, age-at-death, dates of birth and death, and a death certificate that specifies the exact cause of death and the chain of events that led to it (related pathological conditions or traumatic events). It was also possible to recover for several individuals the autopsy reports and antemortem photographs. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

CalCOFI Egg Counts Positive Tows

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish egg counts and standardized counts for eggs captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets], and...

An Interaction of Screen Colour and Lesson Task in CAL

Science.gov (United States)

Clariana, Roy B.

2004-01-01

Colour is a common feature in computer-aided learning (CAL), though the instructional effects of screen colour are not well understood. This investigation considers the effects of different CAL study tasks with feedback on posttest performance and on posttest memory of the lesson colour scheme. Graduate students (n=68) completed a computer-based…

Views of a Cal/OSHA Inspector.

Science.gov (United States)

Oudiz, Jack

2009-01-01

Retiring CAL/OSHA Industrial Hygienist and Senior Safety Engineer Jack Oudiz offers his thoughts in the nature of a voluntary "exit interview" on his years working for the agency and its performance in its mission.

CERN to start Large Hadron Collider november 2007

CERN Multimedia

2006-01-01

"The Large Hadron Collider (LHC) is expected to provide its first collisions in November 2007, CERN has announced. A two-month run at 0.9 TeV is planned for 2007 to test the accelerating and detecting equipment, and a full power run at 14 TeV is expected in the spring of 2008."

Science Me! | 09-10 July | Geneva

CERN Multimedia

2016-01-01

The 11th Nuit de la Science (see here) will happen on July 9 and 10 on the theme "The Rules of the Game" in the gorgeous park of the Perle-du-Lac showcasing the Museum of Science History, organizer of this event that attracts 30-35,000 visitors on each edition.   On this occasion, the Chimiscope and the Museum of Science History invite the public to take part to Science Me!, the first European science show competition. Under a large circus tent, teams of young scientists from all origins and practicing all sciences will compete under the form of 10-minute shows, in French or in English. At the end of each show, the audience will also be able to interact and converse with the participating teams. The success of the demonstrations will be measured by applausemeter, while a jury of neutral and independent scientists will evaluate the qualit...

The impact of BeamCal performance at different international linear ...

Indian Academy of Sciences (India)

The ILC accelerator parameters and detector concepts are still under discussion in the world-wide community. As will be shown, the performance of the BeamCal, the calorimeter in the very forward area of the ILC detector, is very sensitive to the beam parameter and crossing angle choices. We propose here BeamCal ...

CERN Technical Training: Open Courses (July 2007)

CERN Multimedia

2007-01-01

The following course sessions are currently scheduled in the framework of the CERN Technical Training Programme 2007: Automate de Sécurité (French): -> POSTPONED > from 9 to 11 October 2007 ! 10.7.-12.7.2007 (3 days, full) JCOP - Joint PVSS - JCOP Framework 09.07-12.07.2007 (5 days, full) CERN - EDMS - Introduction 10.07.2007 (1 day, 5 places available) Oracle - HTML DB 2.0: Develop Web Applications (English): 11.7.-13.7.2007 (3 days, 5 places available) Technique du vide (French): 11.7.-12.7.2007 (2 days, full) ANSYS - Classical (French) 16.7.-20.7.2007 (5 days, 2 places available) CERN - EDMS - MTF en pratique 17.07.2007 (1 day, 7 places available) Oracle - Programming with PL/SQL (English): 17.7.-19.7.2007 (3 days, 1 place available) WORD 2007 - Niveau 1 ECDL 24.7.-25.7.2007 (2 days, 8 places available) Introduction to Databases and Database Design (English) 24.7.-25.7.2007 (2 days, 3 places available) Technique du vide (French): 24.7.-25.7.2007 (2 days, 6 place...

Progress Report on an Ultra-compact LumiCal

CERN Document Server

Borysov, O

2018-01-01

A new design of a detector module of submillimeter thickness for an electromagnetic calorimeter is presented. It is aimed to be used in the luminometers LumiCal and BeamCal in future linear e+e− collider experiments. The module prototypes were produced utilizing novel connectivity schemes technologies. They are installed in a compact prototype of the calorimeter and tested at DESY with an electron beam of 1 GeV – 6 GeV. The performance of eight detector modules and the possibility of electron and photon identification is studied.

Cal-Bridge and CAMPARE: Engaging Underrepresented Students in Physics and Astronomy

Science.gov (United States)

Rudolph, Alexander L.; Cal-Bridge and CAMPARE Teams

2018-01-01

We describe two programs, Cal-Bridge and CAMPARE, with the common mission of increasing participation of groups traditionally underrepresented in astronomy, through summer research opportunities, in the case of CAMPARE, scholarships in the case of Cal-Bridge, and significant mentoring in both programs, creating a national impact on their numbers successfully pursuing a PhD in the field.In 8 years, the CAMPARE program has sent 112 students, >80% from underrepresented groups, to conduct summer research at one of 14 major research institutions throughout the country. Of the CAMPARE scholars who have graduated with a Bachelor’s degree, almost two-thirds (65%) have completed or are pursuing graduate education in physics, astronomy, or a related field, at institutions including UCLA, UC Riverside, UC Irvine, UC Santa Barbara, USC, Stanford, Univ. of Arizona, Univ. of Washington, Univ. of Rochester, Michigan State Univ., Georgia Tech, Georgia State Univ., Kent State, Indiana Univ., Univ. of Oregon, Syracuse Univ., Montana State Univ., and the Fisk-Vanderbilt Master’s-to-PhD program.Now entering its fourth year, the Cal-Bridge program is a CSU-UC Bridge program comprised of >140 physics and astronomy faculty from 9 University of California (UC), 15 California State University (CSU), and 30 California Community College (CCC) campuses throughout California. In the first four years, 34 Cal-Bridge Scholars have been selected, including 22 Hispanic, 3 African-American and 13 women students, 10 of whom are from URM groups. Thirty (30) of the 34 Cal-Bridge Scholars are first generation college students. In the last two years, 11 of 13 Cal-Bridge Scholars have begun PhD programs in physics or astronomy at top PhD programs nationally. Three (3) of these 11 scholars have won NSF Graduate Research Fellowships; one more received an Honorable Mention. The next cohort applies this fall.Cal-Bridge provides much deeper mentoring and professional development experiences over the last

BER Science Network Requirements Workshop -- July 26-27,2007

Energy Technology Data Exchange (ETDEWEB)

Tierney, Brian L.; Dart, Eli

2008-02-01

The Energy Sciences Network (ESnet) is the primary provider of network connectivity for the US Department of Energy Office of Science, the single largest supporter of basic research in the physical sciences in the United States of America. In support of the Office of Science programs, ESnet regularly updates and refreshes its understanding of the networking requirements of the instruments, facilities, scientists, and science programs that it serves. This focus has helped ESnet to be a highly successful enabler of scientific discovery for over 20 years. In July 2007, ESnet and the Biological and Environmental Research (BER) Program Office of the DOE Office of Science organized a workshop to characterize the networking requirements of the science programs funded by the BER Program Office. These included several large programs and facilities, including Atmospheric Radiation Measurement (ARM) Program and the ARM Climate Research Facility (ACRF), Bioinformatics and Life Sciences Programs, Climate Sciences Programs, the Environmental Molecular Sciences Laboratory at PNNL, the Joint Genome Institute (JGI). National Center for Atmospheric Research (NCAR) also participated in the workshop and contributed a section to this report due to the fact that a large distributed data repository for climate data will be established at NERSC, ORNL and NCAR, and this will have an effect on ESnet. Workshop participants were asked to codify their requirements in a 'case study' format, which summarizes the instruments and facilities necessary for the science and the process by which the science is done, with emphasis on the network services needed and the way in which the network is used. Participants were asked to consider three time scales in their case studies--the near term (immediately and up to 12 months in the future), the medium term (3-5 years in the future), and the long term (greater than 5 years in the future). In addition to achieving its goal of collecting and

Didier Chanat 1959-2007

CERN Multimedia

2007-01-01

We deeply regret to announce the death of Mr Didier CHANAT on 05.09.2007. Mr Didier CHANAT, born on 27.05.1959, worked in the AT Department and had been employed at CERN since 01.06.1992. The Director-General has sent his family a message of condolence on behalf of the CERN staff. Social affairs

A modern documented Italian identified skeletal collection of 2127 skeletons: the CAL Milano Cemetery Skeletal Collection.

Science.gov (United States)

Cattaneo, Cristina; Mazzarelli, Debora; Cappella, Annalisa; Castoldi, Elisa; Mattia, Mirko; Poppa, Pasquale; De Angelis, Danilo; Vitello, Antonio; Biehler-Gomez, Lucie

2018-06-01

The CAL Milano Cemetery Skeletal Collection is a modern and continuously growing identified osteological collection of 2127 skeletons under study in the Laboratorio di Antropologia e Odontologia Forense (LABANOF) in the Department of Biomedical Sciences for Health of the University of Milan (Italy), and part of the Collezione Antropologica LABANOF (CAL). The collection presents individuals of both sexes and of all age groups with a high representation of the elderly and an interesting sample of infants. Each individual is associated with a documentation that includes sex, age-at-death, dates of birth and death, and a death certificate that specifies the exact cause of death and the chain of events that led to it (related pathological conditions or traumatic events). It was also possible to recover for several individuals the autopsy reports and antemortem photographs. This documented osteological collection is of crucial interest in physical and forensic anthropology: it provides unique teaching opportunities and more importantly considerable research possibilities to test and develop sex and age estimation methods, investigate key subjects of forensic relevance and discuss pathological markers, among others. The aim of this paper is to introduce the CAL Milano Cemetery Skeletal Collection as a new identified skeletal collection and present its research and teaching potential. Copyright © 2018 Elsevier B.V. All rights reserved.

Windows Calorimeter Control (WinCal) program computer software test plan

International Nuclear Information System (INIS)

Pertzborn, N.F.

1997-01-01

This document provides the information and guidelines necessary to conduct all the required testing of the Windows Calorimeter Control (WinCal) system. The strategy and essential components for testing the WinCal System Project are described in this test plan. The purpose of this test plan is to provide the customer and performing organizations with specific procedures for testing the specified system's functions

Cal-Bridge and CAMPARE: Engaging Underrepresented Students in Physics and Astronomy

Science.gov (United States)

Rudolph, Alexander L.; Smecker-Hane, Tammy A.; Cal-Bridge Team; CAMPARE Team

2018-06-01

We describe two programs, Cal-Bridge and CAMPARE, with the common mission of increasing participation of groups traditionally underrepresented in astronomy, through summer research opportunities, in the case of CAMPARE, scholarships in the case of Cal-Bridge, and significant mentoring in both programs, creating a national impact on their numbers successfully pursuing a PhD in the field. In 9 years, the CAMPARE program has sent 150 students, >80% from underrepresented groups, to conduct summer research at one of 14 major research institutions throughout the country. Of the CAMPARE scholars who have graduated with a Bachelor’s degree, almost two-thirds (65%) have completed or are pursuing graduate education in physics, astronomy, or a related field, at institutions including UCLA, UC Riverside, UC Irvine, UC Santa Barbara, USC, Stanford, Univ. of Arizona, Univ. of Washington, Univ. of Rochester, Michigan State Univ., Georgia Tech, Georgia State Univ., Kent State, Indiana Univ., Univ. of Oregon, Syracuse Univ., Montana State Univ., and the Fisk- Vanderbilt Master’s-to-PhD program. Now in its fourth year, the Cal-Bridge program is a CSU-UC Bridge program comprised of physics and astronomy faculty from 9 University of California (UC), 15 California State University (CSU), and more than 30 California Community College (CCC) campuses throughout California. In the first four years, 34 Cal-Bridge Scholars have been selected, including 22 Hispanic, 3 African-American and 13 women students, 10 of whom are from URM groups. Thirty (30) of the 34 Cal-Bridge Scholars are first generation college students. In the last three years, 17 of 21 Cal-Bridge Scholars have begun or been accepted PhD programs in physics or astronomy at top PhD programs nationally. Three (3) of these scholars have won NSF Graduate Research Fellowships; one more received an Honorable Mention. Once selected, Cal-Bridge Scholars benefit from substantial financial support, intensive, joint mentoring by CSU

CALS and the Product State Model - Methodology and Supporting Schools and Paradigms

DEFF Research Database (Denmark)

Larsen, Michael Holm

1998-01-01

incorporates relevant information about each stage of the production process.The paper will describe the research object, the model object and discuss a part of the methodology in developing a Product State Model. The project is primarily technological, however, organisational and human aspects......This paper address the preliminary considerations in a research project, initiated February 1997, regarding Continuous Acquisition and Life-cycle Support (CALS) which is a part of the activities in CALS Center Denmark. The CALS concept is presented focusing on the Product State Model (PSM). The PSM...... will be developed upon, will be discussed. Also, the parameters for evaluating the PSM will be considered. In establishing the theoretical body of knowledge with respect to CALS, an identification of schools and paradigms within the research area of applying information technology in a manufacturing environment...

Spatial and temporal dynamics of cyanotoxins and their relation to other water quality variables in Upper Klamath Lake, Oregon, 2007-09

Science.gov (United States)

Eldridge, Sara L. Caldwell; Wood, Tamara M.; Echols, Kathy R.

2012-01-01

Phytoplankton blooms dominated by cyanobacteria that occur annually in hypereutrophic Upper Klamath Lake, Oregon, produce microcystins at concentrations that may contribute to the decline in populations of endangered Lost River (Deltistes luxatus) and shortnose (Chasmistes brevirostris) suckers. During 2007–09, water samples were collected from Upper Klamath Lake to determine the presence and concentrations of microcystins and cylindrospermopsins and to relate the spatial and temporal occurrences of microcystins to water quality and other environmental variables. Samples were analyzed for intracellular (particulate) and extracellular (dissolved) microcystins and cylindrospermopsins using enzyme-linked immunosorbent assays (ELISA). Samples contained the highest and most variable concentrations of microcystins in 2009, the year in which an earlier and heavier Aphanizomenon flos-aquae-dominated phytoplankton bloom occurred. Concentrations were lowest in 2008 when the bloom was lighter, overall, and delayed by nearly 1 month. Microcystins occurred primarily in dissolved and large (> 63 μm) particulate forms in all years of the study, and overall, concentrations were highest at MDT (the deepest site in the study) and HDB, although HDB was sampled only in 2007 and MDT was not sampled in 2008. Comparisons among daily median total microcystin concentrations; chlorophyll a concentrations; total, dissolved, and particulate nutrient concentrations; and nutrient ratios measured in 2009 and between 2007 and 2009 indicate that microcystin concentrations generally increase following the decline of the first A. flos-aquae-dominated bloom of each season in response to an increase in bioavailable nitrogen and phosphorus. Nitrogen fixation by A. flos-aquae early in the sample season appears to provide new nitrogen for growth of toxigenic Microcystis aeruginosa, whereas, later in the season, these species appear to co-exist. Understanding the ecological interactions between these

LumiCal alignment system - Status report

CERN Document Server

Daniluk, W.; Lesiak, T.; Moszczyński, A.; Pawlik, B.; Wojtoń, T.; Zawiejski, L.

2015-01-01

The paper describes the status of the laser-based alignment-system for the luminosity detector, LumiCal, taking into considerations the conditions of the International Large Detector in the International Linear Collider project. The design of the system comprises two parts: the first one containing semi-transparent silicon sensors used to deliver simultaneous position measurements in the X,Y directions of the monitored object, and the second one in which the interferometric technique, i.e. the Frequency Scanning Interferometry (FSI), is proposed. Two laboratory prototypes for both components of the system were built and the preliminary measurements of the DUT displacements demonstrated their utility in the design of the final alignment system. The alignment of the LumiCal detector will allow us to monitor the detector displacements and possible deformations in its internal structure. Lack of information of the displacements will introduce a systematic effect which will have an impact on the accuracy of the fi...

A Novel TetR Family Transcriptional Regulator, CalR3, Negatively Controls Calcimycin Biosynthesis in Streptomyces chartreusis NRRL 3882

Directory of Open Access Journals (Sweden)

Lixia Gou

2017-11-01

Full Text Available Calcimycin is a unique ionophoric antibiotic that is widely used in biochemical and pharmaceutical applications, but the genetic basis underlying the regulatory mechanisms of calcimycin biosynthesis are unclear. Here, we identified the calR3 gene, which encodes a novel TetR family transcriptional regulator and exerts a negative effect on calcimycin biosynthesis. Disruption of calR3 in Streptomyces chartreusis NRRL 3882 led to significantly increased calcimycin and its intermediate cezomycin. Gene expression analysis showed that the transcription of calR3 and its adjacent calT gene were dramatically enhanced (30- and 171-fold, respectively in GLX26 (ΔcalR3 mutants compared with the wild-type strains. Two CalR3-binding sites within the bidirectional calR3-calT promoter region were identified using a DNase I footprinting assay, indicating that CalR3 directly repressed the transcription of its own gene and the calT gene. In vitro electrophoretic mobility shift assays suggested that both calcimycin and cezomycin can act as CalR3 ligands to induce CalR3 to dissociate from its binding sites. These findings indicate negative feedback for the regulation of CalR3 in calcimycin biosynthesis and suggest that calcimycin production can be improved by manipulating its biosynthetic machinery.

Data Management Standards in Computer-aided Acquisition and Logistic Support (CALS)

Science.gov (United States)

Jefferson, David K.

1990-01-01

Viewgraphs and discussion on data management standards in computer-aided acquisition and logistic support (CALS) are presented. CALS is intended to reduce cost, increase quality, and improve timeliness of weapon system acquisition and support by greatly improving the flow of technical information. The phase 2 standards, industrial environment, are discussed. The information resource dictionary system (IRDS) is described.

EDITORIAL: Announcing the 2007 Measurement Science and Technology Outstanding Paper Awards

Science.gov (United States)

Foss, John; Dewhurst, Richard; Fujii, Kenichi; Regtien, Paul

2008-05-01

Since 1991, Measurement Science and Technology has awarded a Best Paper prize. The Editorial Board of this journal believes that such a prize is an opportunity to thank authors for submitting their work, and serves as an integral part of the on-going quality review of the journal. The current breadth of topical areas that are covered by MST has made it advisable to expand the recognition of excellent publications. Hence, since 2005 the Editorial Board have presented 'Outstanding Paper Awards' in four subject categories: Fluid Mechanics; Measurement Science; Precision Measurements; and Sensors and Sensing Systems. 2007 Award Winners—Fluid Mechanics An adaptive sampling and windowing interrogation method in PIV R Theunissen, F Scarano and M L Riethmuller von Karman Institute for Fluid Dynamics, Chaussée de Waterloo 72, 1640 Sint-Genesius Rode, Belgium and Department of Aerospace Engineering, Delft University of Technology, Delft, PO Box 5058, 2600 GB Delft, The Netherlands The co-authored paper [1] has been selected as the Outstanding Paper in Fluid Mechanics for 2007. This paper provides a strategy whereby the placement and the size of the interrogation regions are adapted to the image signal strength (seeding density) and the spatial variations of the velocity magnitudes. Two, quite distinct, test cases demonstrate the efficacy of their method: a shockwave- boundary layer interaction and an aircraft vortex wake. The Selection Committee—Drs T Fansler, J Foss, I Marusic, S Morris, K Okamoto and M Wernet—selected this paper from a strongly competitive shortlist of four candidates. Their selection process was influenced by the perceived utility of the contribution to the numerous investigators who utilize PIV methods. 2007 Award Winners—Measurement Science Broadband single cell impedance spectroscopy using maximum length sequences: theoretical analysis and practical considerations Tao Sun, Shady Gawad, Catia Bernabini, Nicolas G Green and Hywel Morgan

Tests with beam setup of the TileCal Phase-II upgrade electronics

CERN Document Server

Hlaluku, Dingane Reward; The ATLAS collaboration

2017-01-01

The LHC has planned a series of upgrades culminating in the High Luminosity LHC (HL-LHC) which will have an average luminosity 5-7 times larger than the nominal Run-2 value. The ATLAS Tile Calorimeter (TileCal) will undergo an upgrade to accommodate to the HL-LHC parameters. The TileCal electronics both on- and off-detector will be completely redesigned and a new readout architecture will be adopted. The photomultiplier signals will be digitised and transferred to the TileCal PreProcessors (PPr) located off-detector for every bunch crossing. Then, the PPr will provide preprocessed digital data to the first level trigger with improved spatial granularity and energy resolution with respect to the current analog trigger signals. We plan to insert one TileCal module instrumented with the new electronics in the real detector to evaluate and qualify the new readout and trigger concepts in the overall ATLAS data acquisition system. This new drawer, so-called Hybrid Demonstrator, must provide analog trigger signal fo...

Como enfrentar o \\'Fenômeno China\\' na produção de calçados: proposta de estratégia competitiva para a indústria calçadista brasileira.

OpenAIRE

Mario Luiz Bimbatti

2007-01-01

A competição no mercado internacional com os produtores mundiais, pode ser uma fonte de excelentes oportunidades ou de perigosas armadilhas, como o desafio de difícil solução, representado pelos produtores mundiais de calçados com baixos custos de mão-de-obra, por exemplo, os chineses. A grande maioria dos produtores brasileiros de calçados está estabelecida em clusters, como na Europa os produtores italianos de calçados estão estabelecidos nos \\"distretti\\". Essas concentrações geográficas d...

' "~w.ith ~a'~nd"Atypz'cal Features

African Journals Online (AJOL)

2006-09-11

}? While there have been reports of ' this syndrome from ' Ibadan,' the exact incidence 1\\_Iigeria is It probably rare but it is alsoylikely that 'some. cases are missed in chm', 'cal due to poor awareness -and constraints' '.

Computer-aided acquisition and logistics support (CALS): Concept of Operations for Depot Maintenance

Energy Technology Data Exchange (ETDEWEB)

Bourgeois, N.C.; Greer, D.K.

1993-04-01

This CALS Concept of Operations for Depot Maintenance provides the foundation strategy and the near term tactical plan for CALS implementation in the depot maintenance environment. The user requirements enumerated and the overarching architecture outlined serve as the primary framework for implementation planning. The seamless integration of depot maintenance business processes and supporting information systems with the emerging global CALS environment will be critical to the efficient realization of depot user's information requirements, and as, such will be a fundamental theme in depot implementations.

Windows Calorimeter Control (WinCal) system configuration control board (SCCB) operating procedure

International Nuclear Information System (INIS)

Westsik, G.A.

1997-01-01

This document describes the operating procedure for the System Configuration Control Board (SCCB) performed in support of the Windows Calorimeter Control (WinCal) system. This board will consist of representatives from Babcock and Wilcox Hanford Company Babcock and Wilcox Protec, Inc.; and Lockheed Martin Services, Inc. In accordance with agreements for the joint use of the Babcock and Wilcox Hanford Company calorimeters located in the Hanford Site Plutonium Finishing Plant (PFP) Nondestructive Assay Laboratory, concurrence regarding changes to the WinCal system will be obtained from the International Atomic Energy Agency (IAEA). Further, changes to the WinCal software will be communicated to Los Alamos National Laboratory

Recuperación de morteros romanos de cal y chamota en aplicaciones actuales

OpenAIRE

González Cortina, Mariano

2000-01-01

La tesis se fundamenta en la utilización de residuos de fábricas cerámicas para su aprovechamiento y reutilización mediante una trituración, para posteriormente mezclarlos con cal aérea y obtener así un conglomerante capaz de fraguar, endurecer y adquirir resistencias tanto al aire como sumergido en agua. La cal, como conglomerante hidráulico, no se fabrica actualmente en España debido al uso de los cementos Pórtland. Sin embargo, las propiedades que tienen los morteros realizados con cal, co...

CALS Baseline Architecture Analysis of Weapons System. Technical Information: Army, Draft. Volume 8

Science.gov (United States)

1989-09-01

This effort was performed to provide a common framework for analysis and planning of CALS initiatives across the military services, leading eventually to the development of a common DoD-wide architecture for CALS. This study addresses Army technical ...

California Cooperative Oceanic Fisheries Investigations (CalCOFI)Database

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — This database contains icthyoplankton data collected as part of the California Cooperative Oceanic Fisheries Investigations (CalCOFI) program and other cruises...

CryoSat/SIRAL Cal1 Calibration Orbits

Science.gov (United States)

Scagliola, Michele; Fornari, Marco; Bouffard, Jerome; Parrinello, Tommaso

2017-04-01

The main payload of CryoSat is a Ku band pulsewidth limited radar altimeter, called SIRAL (Synthetic interferometric radar altimeter), that transmits pulses at a high pulse repetition frequency thus making the received echoes phase coherent and suitable for SAR processing. This allows to reach an along track resolution that is significantly improved with respect to traditional pulse-width limited altimeters. Due to the fact that SIRAL is a phase coherent pulse-width limited radar altimeter, a proper calibration approach has been developed. In fact, not only corrections for transfer function, gain and instrument path delay have to be computed (as in previous altimeters), but also corrections for phase (SAR/SARIn) and phase difference between the two receiving chains (SARIN only). Recalling that the CryoSat's orbit has a high inclination of 92° and it is non-sun-synchronous, the temperature of the SIRAL changes continuously along the orbit with a period of about 480 days and it is also function of the ascending/descending passes. By analysis of the CAL1 calibration corrections, it has been verified that the internal path delay and the instrument gain variation measured on the SIRAL are affected by the thermal status of the instrument and as a consequence they are expected to vary along the orbit. In order to gain knowledge on the calibration corrections (i.e. the instrument behavior) as function of latitude and temperature, it has been planned to command a few number of orbits where only CAL1 calibration acquisitions are continuously performed. The analysis of the CAL1 calibration corrections produced along the Calibration orbits can be also useful to verify whether the current calibration plan is able to provide sufficiently accurate corrections for the instrument acquisitions at any latitude. In 2016, the CryoSat/SIRAL Cal1 Calibration Orbits have been commanded two times, a first time the 20th of July 2016 and a second time the 24th of November 2016, and they

Laser measurement of the LumiCal detector displacement

International Nuclear Information System (INIS)

Blocki, J.; Daniluk, W.; Gil, M.; Karbowiak, M.; Moszczynski, A.; Oliwa, K.; Pawlik, B.; Wierba, W.; Zawiejski, L.; Slominski, W.; Suszycki, L.

2006-12-01

The silicon-tungsten calorimeter LumiCal, located in very forward region of the future detector at the International Linear Collider, is proposed for precisely luminosity measurement. One of the requirements to fulfil this task is available information on the actual position of the calorimeter relative to the beam interaction area which should be known with accuracy of a few micrometers. In this paper we discuss the possible solutions for the positioning of the LumiCal electron detector by optical method. The results of the displacement measurement using a laser beam and a CCD camera are described. The measurements were performed on a proof-of-principle basis and achieved the accuracy of about ± 1 μm in x, y and ± μm in z direction. (author)

[Analysis on acupuncture literature in Science Citation Index (SCI) periodicals in 2007].

Science.gov (United States)

Gao, Liang; Tian, Li-xin; Guo, Yi

2009-06-01

To grasp the international developing tendency of acupuncture research and provide some references for promoting acupuncture and moxibustion internationalization process, the articles about acupuncture in Science Citation Index (SCI) periodicals in 2007 were retrieved by adopting the retrieval tactics on line in combination with database searching. Results indicate that 257 articles about acupuncture had been retrived from the SCI Web databases. These articles were published in 125 journals respectively, most of which were Euramerican journals. Among these journals, the impact factor of the Journal of the American Medical Association (JAMA), 25. 547, is the highest one. It is shown that the impact factors of the SCI periodicals, in which acupuncture articles embodied are increased, the quality of these articles are improved obviously and the types of the articles are various in 2007, but there is obvious difference in the results of these studies due to the difference of experimental methods, the subjects of these experiments and acupuncture manipulations. Therefore, standardization of many problems arising from the researches on acupuncture is extremely imminent.

Apoptosis of human tongue squamous cell carcinoma cell (CAL-27 induced by Lactobacillus sp. A-2 metabolites

Directory of Open Access Journals (Sweden)

Guoliang ZHANG

2014-07-01

Full Text Available Objective: To study the effect of Lactobacillus sp. A-2 metabolites on viability of CAL-27 cells and apoptosis in CAL-27 cells. Methods: Lactobacillus sp. A-2 metabolites 1 and 2 (LM1 and LM2 were obtained by culturing Lactobacillus sp. A-2 in reconstituted whey medium and whey-inulin medium; the cultured CAL-27 cells were treated with different concentrations of LM1 and LM2 (0, 3, 6, 12, 24, 48 mg/mL and assayed by methyl thiazolyltetrazolium (MTT method; morphological changes of apoptotic cell were observed under fluorescence microscopy by acridine orange (Ao fluorescent staining; flow cytometry method (FCM and agarose gel electrophoresis were used to detect the apoptosis of CAL-27 cells treated LM1 and LM2. Results: The different concentrations of LM1 and LM2 could restrain the growth of CAL-27 cells, and in a dose-dependent manner; the apoptosis of CAL-27 cells was obviously induced and was time-dependent. Conclusions: Viability of CAL-27 cells was inhibited by Lactobacillus sp. A-2 metabolites; Lactobacillus sp. A-2 metabolites could induce CAL-27 cells apoptosis; study on the bioactive compounds in the Lactobacillus sp. A-2 metabolites and their molecular mechanism is in progress.

Defense AT&L (Volume 36, Number 3, May-June 2007)

Science.gov (United States)

2007-06-01

recruit from the heritage community; their recruits are known by their MOS [Military Occupational Specialty] “09 Limas ”—es- sentially interpreters...Defense AT&L: May-June 2007 Acquisition & Logistics Excellence Defense AT&L: May-June 2007 86 Acquisition & Logistics Excellence at Huntington Beach , Calif...programs in endangered species protection, historic preservation, waste reduction, environmental cleanup, and pollution prevention. Installation

Professor Tony F. Chan Assistant Director for Mathematics and Physical Sciences National Science Foundation United States of America on 23rd May 2007. Here visiting ATLAS experiment with P. Jenni and M. Tuts.

CERN Multimedia

Maximilien Brice

2007-01-01

Professor Tony F. Chan Assistant Director for Mathematics and Physical Sciences National Science Foundation United States of America on 23rd May 2007. Here visiting ATLAS experiment with P. Jenni and M. Tuts.

CubiCal - Fast radio interferometric calibration suite exploiting complex optimisation

Science.gov (United States)

Kenyon, J. S.; Smirnov, O. M.; Grobler, T. L.; Perkins, S. J.

2018-05-01

It has recently been shown that radio interferometric gain calibration can be expressed succinctly in the language of complex optimisation. In addition to providing an elegant framework for further development, it exposes properties of the calibration problem which can be exploited to accelerate traditional non-linear least squares solvers such as Gauss-Newton and Levenberg-Marquardt. We extend existing derivations to chains of Jones terms: products of several gains which model different aberrant effects. In doing so, we find that the useful properties found in the single term case still hold. We also develop several specialised solvers which deal with complex gains parameterised by real values. The newly developed solvers have been implemented in a Python package called CubiCal, which uses a combination of Cython, multiprocessing and shared memory to leverage the power of modern hardware. We apply CubiCal to both simulated and real data, and perform both direction-independent and direction-dependent self-calibration. Finally, we present the results of some rudimentary profiling to show that CubiCal is competitive with respect to existing calibration tools such as MeqTrees.

Earth Sciences Division Research Summaries 2006-2007

International Nuclear Information System (INIS)

DePaolo, Donald; DePaolo, Donald

2008-01-01

Research in earth and atmospheric sciences has become increasingly important in light of the energy, climate change, and other environmental issues facing the United States and the world. The development of new energy resources other than fossil hydrocarbons, the safe disposal of nuclear waste and greenhouse gases, and a detailed understanding of the climatic consequences of our energy choices are all critical to meeting energy needs while ensuring environmental safety. The cleanup of underground contamination and the preservation and management of water supplies continue to provide challenges, as they will for generations into the future. To address the critical energy and environmental issues requires continuing advances in our knowledge of Earth systems and our ability to translate that knowledge into new technologies. The fundamental Earth science research common to energy and environmental issues largely involves the physics, chemistry, and biology of fluids in and on the Earth. To manage Earth fluids requires the ability to understand their properties and behavior at the most fundamental molecular level, as well as prediction, characterization, imaging, and manipulation of those fluids and their behavior in real Earth reservoirs. The broad range of disciplinary expertise, the huge range of spatial and time scales, and the need to integrate theoretical, computational, laboratory and field research, represent both the challenge and the excitement of Earth science research. The Earth Sciences Division (ESD) of the Ernest Orlando Lawrence Berkeley National Laboratory (Berkeley Lab) is committed to addressing the key scientific and technical challenges that are needed to secure our energy future in an environmentally responsibly way. Our staff of over 200 scientists, UC Berkeley faculty, support staff and guests perform world-acclaimed fundamental research in hydrogeology and reservoir engineering, geophysics and geomechanics, geochemistry, microbial ecology

Earth Sciences Division Research Summaries 2006-2007

Energy Technology Data Exchange (ETDEWEB)

DePaolo, Donald; DePaolo, Donald

2008-07-21

Research in earth and atmospheric sciences has become increasingly important in light of the energy, climate change, and other environmental issues facing the United States and the world. The development of new energy resources other than fossil hydrocarbons, the safe disposal of nuclear waste and greenhouse gases, and a detailed understanding of the climatic consequences of our energy choices are all critical to meeting energy needs while ensuring environmental safety. The cleanup of underground contamination and the preservation and management of water supplies continue to provide challenges, as they will for generations into the future. To address the critical energy and environmental issues requires continuing advances in our knowledge of Earth systems and our ability to translate that knowledge into new technologies. The fundamental Earth science research common to energy and environmental issues largely involves the physics, chemistry, and biology of fluids in and on the Earth. To manage Earth fluids requires the ability to understand their properties and behavior at the most fundamental molecular level, as well as prediction, characterization, imaging, and manipulation of those fluids and their behavior in real Earth reservoirs. The broad range of disciplinary expertise, the huge range of spatial and time scales, and the need to integrate theoretical, computational, laboratory and field research, represent both the challenge and the excitement of Earth science research. The Earth Sciences Division (ESD) of the Ernest Orlando Lawrence Berkeley National Laboratory (Berkeley Lab) is committed to addressing the key scientific and technical challenges that are needed to secure our energy future in an environmentally responsibly way. Our staff of over 200 scientists, UC Berkeley faculty, support staff and guests perform world-acclaimed fundamental research in hydrogeology and reservoir engineering, geophysics and geomechanics, geochemistry, microbial ecology

CEA Annual report 2007; CEA rapport annuel 2007

Energy Technology Data Exchange (ETDEWEB)

NONE

2007-07-01

The CEA, a prominent player in research development and innovation, is active in three main domains: energy, health care and information technology, defense and security. This annual report presents the CEA activities for the year 2007 in these three main areas: science and technology working for nuclear deterrence and global security, the energies without greenhouse effect gases emission against the climatic change, researches in the information sciences and technologies for a better communication and health. The CEA safety, organization, communication and international relations are also presented. (A.L.B.)

CERN Technical Training: Open Places for September 2007 Courses

CERN Multimedia

2007-01-01

The following course sessions are scheduled in the framework of the CERN Technical Training Programme 2007. You may find the full Technical Training course program in our web-catalogue (http://cta.cern.ch/cta2/f?p=300 ) or in next weeks paper bulletin. OFFICE SOFTWARE Introduction to Dreamweaver MX (French): 3.9.-4.9.2007 (2 days, places available) CERN EDMS MTF en pratique (French): 4.9.2007 – 9:00-12:30 (1/2 day, places available) Word 2007 (Short Course III) – How to work with long documents (Bilangue): 14.9.2007 – 14:00-17:30 (1/2 day, places available) Word 2007 Niveau 1 (French): 20.9.-21-9.2007 (2 days, places available) ACCESS 2007 – Level 1: ECDL (English): 20.9.-21.9.2007 – 9:00-17:30 (2 days, places available) Excel 2007 (Short Course I) – How to work with formulae (Bilangue): 21.9.2007 – 14:00-17:30 (1/2 day, places available) CERN EDMS Introduction (English): 24.09.2007 (1 day, places available) Outlook 2007 (Short Course II) – Calendar, Task...

Geomorphology, Science (Experimental): 5343.09.

Science.gov (United States)

Dade County Public Schools, Miami, FL.

Performance objectives are stated for this secondary school instructional unit concerned with aspects of earth science with emphases on the internal and external forces that bring about changes in the earth's crust. Lists of films and state-adopted and other texts are presented. Included are a course outline summarizing the unit content; numerous…

Synergistic suppression of the PI3K inhibitor CAL-101 with bortezomib on mantle cell lymphoma growth

International Nuclear Information System (INIS)

Qu, Fu-Lian; Xia, Bing; Li, Su-Xia; Tian, Chen; Yang, Hong-Liang; Li, Qian; Wang, Ya-Fei; Yu, Yong; Zhang, Yi-Zhuo

2015-01-01

To investigate the effects of CAL-101, particularly when combined with bortezomib (BTZ) on mantle cell lymphoma (MCL) cells, and to explore its relative mechanisms. MTT assay was applied to detect the inhibitory effects of different concentrations of CAL-101. MCL cells were divided into four groups: control group, CAL-101 group, BTZ group, and CAL-101/BTZ group. The expression of PI3K-p110σ, AKT, ERK, p-AKT and p-ERK were detected by Western blot. The apoptosis rates of CAL-101 group, BTZ group, and combination group were detected by flow cytometry. The location changes of nuclear factor kappa-B (NF-κB) of 4 groups was investigated by NF-κB Kit exploring. Western blot was applied to detect the levels of caspase-3 and the phosphorylation of AKT in different groups. CAL-101 dose- and time-dependently induced reduction in MCL cell viability. CAL-101 combined with BTZ enhanced the reduction in cell viability and apoptosis. Western blot analysis showed that CAL-101 significantly blocked the PI3K/AKT and ERK signaling pathway in MCL cells. The combination therapy contributed to the inactivation of NF-κB and AKT in MCL cell lines. However, cleaved caspase-3 was up-regulated after combined treatment. Our study showed that PI3K/p110σ is a novel therapeutic target in MCL, and the underlying mechanism could be the blocking of the PI3K/AKT and ERK signaling pathways. These findings provided a basis for clinical evaluation of CAL-101 and a rationale for its application in combination therapy, particularly with BTZ

CALS - what are the potentials for SME’s ?

DEFF Research Database (Denmark)

Bilberg, Arne; Thomsen, Finn Tang; Larsen, Michael Holm

1997-01-01

the potentials for improvingbusiness processes by effective information management. The threecompanies involved will demonstrate practical and innovativeapplications of CALS solutions, that will serve as examples for awide variety of SMEs. The paper will focus on the industrial results and the CALSengineering...

The location of cemento enamel junction for CAL measurement: A clinical crisis

Directory of Open Access Journals (Sweden)

Vandana K

2009-01-01

Full Text Available Background: We face various problems while measuring the Clinical attachment level (CAL from Cemento-enamel junction (CEJ. This study aims to record and compare the CEJ location measurements using a xed reference point (FRP [Custom made stent] before and after ap elevation. Materials and Methods: A custom made stent and UNC-15 probe were used. Recording of CEJ location was made using a UNC-15 (Hu-Friedy probe, before (close CEJ and after (Open CEJ the reflection of the flap from the lower edge of the stent in those subjects who were indicated for flap surgery, at baseline. Results: We used statistical analysis involving intra-group comparison done by Paired-′t′ test. The close and the open CEJ measurements demonstrated a, statistically, non-significant difference. The equi-measurements of close and open CEJ numerical data were remarkably lower than the under and overestimation of measurements. Thus, despite certain disadvantages of stent, the FRP provides a simple solution for CAL measurement. Conclusion: The results of this study confirms the objective of the study and strongly suggests that CAL measurements done without FRP is subjected to great variation and the diagnostic and prognostic interpretation of CAL should be viewed seriously in periodontics.

Library and Information Science Research Areas: A Content Analysis of Articles from the Top 10 Journals 2007-8

Science.gov (United States)

Aharony, Noa

2012-01-01

The current study seeks to describe and analyze journal research publications in the top 10 Library and Information Science journals from 2007-8. The paper presents a statistical descriptive analysis of authorship patterns (geographical distribution and affiliation) and keywords. Furthermore, it displays a thorough content analysis of keywords and…

JUST Vol. 28 No. 2, August, 2007

African Journals Online (AJOL)

2007-08-02

Aug 2, 2007 ... Journal of Science and Technology, Volume 27 no. 2, August, 2007. Occupational ..... provided with rubber gloves and safety boots they perceived it not to be ..... News Agency (Accra), Handbook on Occu- pational Health ...

ATLAS TileCal Read Out Driver production

International Nuclear Information System (INIS)

Valero, A; Abdallah, J; Castillo, V; Cuenca, C; Ferrer, A; Fullana, E; Gonzalez, V; Higon, E; Poveda, J; Ruiz-MartInez, A; Saez, M A; Salvachua, B; SanchIs, E; Solans, C; Valls, J A

2007-01-01

The production tests of the 38 ATLAS TileCal Read Out Drivers (RODs) are presented in this paper. The hardware specifications and firmware functionality of the RODs modules, the test-bench and the test procedure to qualify the boards are described. Finally the performance results, the temperature studies and high rate tests are shown and discussed

CAMPARE and Cal-Bridge: Two Institutional Networks Increasing Diversity in Astronomy

Science.gov (United States)

Rudolph, Alexander L.; Impey, Chris David; Phillips, Cynthia B.; Povich, Matthew S.; Prather, Edward E.; Smecker-Hane, Tammy A.

2015-01-01

We describe two programs, CAMPARE and Cal-Bridge, with the common mission of increasing participation of groups traditionally underrepresented in astronomy, particularly underrepresented minorities and women, through summer research opportunities, in the case of CAMPARE, scholarships in the case of Cal-Bridge, and significant mentoring in both programs, leading to an increase in their numbers successfully pursuing a PhD in the field.CAMPARE is an innovative REU-like summer research program, currently in its sixth year, comprising a network of comprehensive universities and community colleges in Southern California and Arizona (most of which are minority serving institutions), and ten major research institutions (University of Arizona Steward Observatory, the SETI Institute, JPL, Caltech, and the five Southern California UC campuses, UCLA, UCI, UCSD, UCR, and UCSB).In its first five summers, CAMPARE sent a total of 49 students from 10 different CSU and community college campuses to 5 research sites of the program. Of these 49 participants, 25 are women and 24 are men; 22 are Hispanic, 4 are African American, and 1 is Native American, including 6 female Hispanic and 2 female African-American participants. Twenty-one (21) CAMPARE participants have graduated from college, and more than half (11) have attended or are attending a graduate program, including 8 enrolled in PhD or Master's-to-PhD programs. Over twenty CAMPARE students have presented at the AAS and other national meetings.The Cal-Bridge program is a diverse network of higher education institutions in Southern California, including 5 UC campuses, 8 CSU campuses, and 7 community colleges dedicated to the goal of increasing the number of underrepresented minority and female students attending graduate school in astronomy or related fields. We have recently selected our inaugural group of five 2014 Cal-Bridge Scholars, including four women (two Hispanic and one part Native American), and one Hispanic man

CalCOFI Larvae Counts, Scientific Names CI to CO

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names DH to EC

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names TF to U

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names HJ to ID

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names AN to AR

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names SJ to ST

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names CP to DE

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names C to CE

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names EV to GN

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names V to Z

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names ED to EU

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names SD to SI

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names MB to MO

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names LJ to MA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names AS to BA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names SB to SC

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names MP to NA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names SU to TE

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names PL to PO

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names IE to LA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names A to AM

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names HB to HI

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names OM to OX

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names Q to SA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names PP to PZ

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names GO to HA

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names NB to OL

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names LB to LI

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names BCE to BZ

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names CD to CH

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

CalCOFI Larvae Counts, Scientific Names OY to PI

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Fish larvae counts and standardized counts for larvae captured in CalCOFI icthyoplankton nets (primarily vertical [Calvet or Pairovet], oblique [bongo or ring nets],...

Hot deformation behaviors and processing maps of B{sub 4}C/Al6061 neutron absorber composites

Energy Technology Data Exchange (ETDEWEB)

Li, Yu-Li [School of Materials Science and Engineering, Taiyuan University Of Technology, Taiyuan 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials, Ministry of Education, Taiyuan University of Technology, Taiyuan 030024 (China); Wang, Wen-Xian, E-mail: Wangwenxian@tyut.edu.cn [School of Materials Science and Engineering, Taiyuan University Of Technology, Taiyuan 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials, Ministry of Education, Taiyuan University of Technology, Taiyuan 030024 (China); Zhou, Jun [School of Materials Science and Engineering, Taiyuan University Of Technology, Taiyuan 030024 (China); Department of Mechanical Engineering, Pennsylvania State University Erie, The Behrend College, Erie, PA 16563 (United States); Chen, Hong-Sheng [School of Materials Science and Engineering, Taiyuan University Of Technology, Taiyuan 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials, Ministry of Education, Taiyuan University of Technology, Taiyuan 030024 (China)

2017-02-15

In this study, the hot deformation behaviors of 30 wt.% B{sub 4}C/Al6061 neutron absorber composites (NACs) have been investigated by conducting isothermal compression tests at temperatures ranging from 653 K to 803 K and strain rates from 0.01 to 10 s{sup −1}. It was found that, during hot compression, the B{sub 4}C/Al6061 NACs exhibited a steady flow characteristic which can be expressed by the Zener-Hollomon parameter as a hyperbolic-sine function of flow stress. High average activation energy (185.62 kJ/mol) of B{sub 4}C/Al6061 NACs is noted in current study owing to the high content of B{sub 4}C particle. The optimum hot working conditions for B{sub 4}C/Al6061 NACs are found to be 760–803 K/0.01–0.05 s{sup −1} based on processing map and microstructure evolution. Typical material instabilities are thought to be attributed to void formation, adiabatic shear bands (ASB), particle debonding, and matrix cracking. Finally, the effect of the plastic deformation zones (PDZs) on the microstructure evolution in this 30 wt.% B{sub 4}C/Al6061 composite is found to be very important. - Highlights: •The hot deformation behavior of the 30 wt.% B{sub 4}C/Al6061 NACs was first analyzed. •The 3D efficiency map and the instability map are developed. •The optimum hot working conditions were identified and validated by SEM and TEM. •The hot deformation schematic diagram of 30 wt.% B{sub 4}C/Al6061 NACs is developed.

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

Criteria for evaluating internet tutorials in speech communication sciences

OpenAIRE

Bowerman, Chris; Eriksson, Anders; Huckvale, Mark; Rosner, Mike; Tatham, Mark; Wolters, Maria

1999-01-01

The Computer Aided Learning (CAL) working group of the SOCRATES thematic network in Speech Communication Science have studied how the Internet is being used and could be used for the provision of self-study materials for education. In this paper we follow up previous recommendations for the design of Internet tutorials with recommendations for their evaluation. The paper proposes that evaluation should be seen as a necessary quality assurance mechanism operating within the life-cycle of CAL m...

ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts; ChemSession'09 - 6. Warszawskie Seminarium Doktorantow Chemikow - Streszczenia

Energy Technology Data Exchange (ETDEWEB)

NONE

2009-07-01

Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6{sup th} Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found.

Reconstruction of the boundary between climate science and politics: the IPCC in the Japanese mass media, 1988-2007.

Science.gov (United States)

Asayama, Shinichiro; Ishii, Atsushi

2014-02-01

The Intergovernmental Panel on Climate Change (IPCC) plays a significant role in bridging the boundary between climate science and politics. Media coverage is crucial for understanding how climate science is communicated and embedded in society. This study analyzes the discursive construction of the IPCC in three Japanese newspapers from 1988 to 2007 in terms of the science-politics boundary. The results show media discourses engaged in boundary-work which rhetorically separated science and politics, and constructed the iconic image of the IPCC as a pure scientific authority. In the linkages between the global and national arenas of climate change, the media "domesticate" the issue, translating the global nature of climate change into a discourse that suits the national context. We argue that the Japanese media's boundary-work is part of the media domestication that reconstructed the boundary between climate science and politics reflecting the Japanese context.

TileCal TDAQ/DCS communication

CERN Document Server

Solans, C; Arabidze, G; Carneiro Ferreira, B; Sotto-Maior Peralva, B

2007-01-01

This document describes the communication between the TDAQ and DCS systems of the Hadronic Tile Calorimeter detector of the ATLAS experiment, currently under commissioning phase at CERN. It is a further step on the TDAQ and DCS communication for TileCal operation. The aim of the implementation is to increase the robustness and understanding of the detector from the two systems involved. The basic principle observed is that the two systems operate independently in parallel. Hence, the knowledge of the status of the whole detector from each of the two systems is required for further analysis of the archived data.

Frontline CALS - Extranet Enabled Support of Customer Relations Based on Product State Information

DEFF Research Database (Denmark)

Larsen, Michael Holm; Franck, Lesley Robert; Pedersen, Mogens Kühn

1999-01-01

commerce called Frontline CALS. Frontline CALS integrate three bodies of knowledge, i.e. Continuous Acquisition and Lifecycle Support, Electronic Commerce, and the Customer Consumption Chain in order to construct a concept that enhances the service quality for customers with time critical operations....... The essence of Frontline CALS is that it combines a product and a customer view with the aim of enhancing the service quality offered by the dealers in collaboration with the producer. The article further provides empirical insight from an early prototype implementation of a Web Service System intended......The electronic economy has proliferated during the past decade. Many initiatives are launched in order to support customer's interaction with the company, however, often fragmented. A more holistic approach is provided in this article. The article suggests a business model in the era of electronic...

An IPMI-compliant control system for the ATLAS TileCal Phase-II Upgrade PreProcessor module

CERN Document Server

Zuccarello, Pedro Diego; The ATLAS collaboration

2016-01-01

Abstract–The electronics of the hadronic calorimeter of the ATLAS detector (TileCal) is being redesigned as part of the works that will lead to the High Luminosity Large Hadron Collider (HL-LHC). TileCal electronics is divided in front and back-end subsystems. While the front-end is inside the detector, the back-end is located off-detector inserted in an ATCA shelf. The main objective of this paper is to describe the work being carried out in the hardware management aspects of the back-end electronics of TileCal.

Cal Poly Apparel Manufacturing Demonstration - Year 3 Final Technical Report

National Research Council Canada - National Science Library

2000-01-01

.... Since the Southern California apparel industry is primarily small businesses producing low volume fashion products, the Cal Poly Demo factory needed to reflect the size and capability of its customer...

Estabilização de solos com adição de cal : um estudo a respeito da reversibilidade das reações que acontecem no solo após a adição de cal

OpenAIRE

Azevedo, André Luis Cairo de

2010-01-01

Visando ampliar o conhecimento sobre a estabilização dos solos com adição de cal, este estudo pretende demonstrar que as reações do solo argiloso com cal podem ser reversíveis. Esta análise simula uma mistura de solo e cal sendo executada inicialmente numa usina, quando do início da obra, antes mesmo da terraplenagem concluída, armazenada durante um período de tempo determinado e posteriormente sendo executada como camada de pavimento. Para isso foram feitos moldados corpos de prova com amost...

Posibilidades estructurales de materiales a base de cal como conglomerante: primeros resultados

OpenAIRE

Estrada, Enrique; Barbero, José Miguel

1986-01-01

La cal es un material abundante y cuya producción suma a una tecnología muy accesible la ventaja de poder materializarse en pequeñas plantas dispersas, para poder reducir al mínimo la componente de costo debida al transporte. En el presente trabajo se ha planteado la posibilidad de obtener hormigones con fines estructurales, para viviendas de baja altura y que sean de fácil obtención, a base de cal y cenizas volantes o cenizas de cascara de arroz, variando sus proporciones, grados de finur...

Final Report Feasibility Study for the California Wave Energy Test Center (CalWavesm)

Energy Technology Data Exchange (ETDEWEB)

Blakeslee, Samuel Norman [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States). Inst. for Advanced Technology and Public Policy; Toman, William I. [Protean Wave Energy Ltd., Los Osos, CA (United States); Williams, Richard B. [Leidos Maritime Solutions, Reston, VA (United States); Davy, Douglas M. [CH2M, Sacramento, CA (United States); West, Anna [Kearns and West, Inc., San Francisco, CA (United States); Connet, Randy M. [Omega Power Engineers, LLC, Anaheim, CA (United States); Thompson, Janet [Kearns and West, Inc., San Francisco, CA (United States); Dolan, Dale [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States); Baltimore, Craig [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States); Jacobson, Paul [Electric Power Research Inst. (EPRI), Knoxville, TN (United States); Hagerman, George [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Potter, Chris [California Natural Resources Agency, Sacramento, CA (United States); Dooher, Brendan [Pacific Gas and Electric Company, San Francisco, CA (United States); Wendt, Dean [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States); Sheppard, Colin [Humboldt State Univ., Arcata, CA (United States); Harris, Andrew [Humboldt State Univ., Arcata, CA (United States); Lawson, W. Graham [Power Delivery Consultants, Inc., Albany, NY (United States)

2017-07-31

The California Wave Energy Test Center (CalWave) Feasibility Study project was funded over multiple phases by the Department of Energy to perform an interdisciplinary feasibility assessment to analyze the engineering, permitting, and stakeholder requirements to establish an open water, fully energetic, grid connected, wave energy test center off the coast of California for the purposes of advancing U.S. wave energy research, development, and testing capabilities. Work under this grant included wave energy resource characterization, grid impact and interconnection requirements, port infrastructure and maritime industry capability/suitability to accommodate the industry at research, demonstration and commercial scale, and macro and micro siting considerations. CalWave Phase I performed a macro-siting and down-selection process focusing on two potential test sites in California: Humboldt Bay and Vandenberg Air Force Base. This work resulted in the Vandenberg Air Force Base site being chosen as the most favorable site based on a peer reviewed criteria matrix. CalWave Phase II focused on four siting location alternatives along the Vandenberg Air Force Base coastline and culminated with a final siting down-selection. Key outcomes from this work include completion of preliminary engineering and systems integration work, a robust turnkey cost estimate, shoreside and subsea hazards assessment, storm wave analysis, lessons learned reports from several maritime disciplines, test center benchmarking as compared to existing international test sites, analysis of existing applicable environmental literature, the completion of a preliminary regulatory, permitting and licensing roadmap, robust interaction and engagement with state and federal regulatory agency personnel and local stakeholders, and the population of a Draft Federal Energy Regulatory Commission (FERC) Preliminary Application Document (PAD). Analysis of existing offshore oil and gas infrastructure was also performed

Crystallization and Preliminary Diffraction Analysis of the CAL PDZ Domain in Complex with a Selective Peptide Inhibitor

Energy Technology Data Exchange (ETDEWEB)

J Amacher; P Cushing; J Weiner; D Madden

2011-12-31

Cystic fibrosis (CF) is associated with loss-of-function mutations in the CF transmembrane conductance regulator (CFTR), which regulates epithelial fluid and ion homeostasis. The CFTR cytoplasmic C-terminus interacts with a number of PDZ (PSD-95/Dlg/ZO-1) proteins that modulate its intracellular trafficking and chloride-channel activity. Among these, the CFTR-associated ligand (CAL) has a negative effect on apical-membrane expression levels of the most common disease-associated mutant {Delta}F508-CFTR, making CAL a candidate target for the treatment of CF. A selective peptide inhibitor of the CAL PDZ domain (iCAL36) has recently been developed and shown to stabilize apical expression of {Delta}F508-CFTR, enhancing net chloride-channel activity, both alone and in combination with the folding corrector corr-4a. As a basis for structural studies of the CAL-iCAL36 interaction, a purification protocol has been developed that increases the oligomeric homogeneity of the protein. Here, the cocrystallization of the complex in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 35.9, b = 47.7, c = 97.3 {angstrom}, is reported. The crystals diffracted to 1.4 {angstrom} resolution. Based on the calculated Matthews coefficient (1.96 {angstrom}{sup 3} Da{sup -1}), it appears that the asymmetric unit contains two complexes.

João Pandiá Calógeras

Directory of Open Access Journals (Sweden)

Sílvio Fernandes Lopes

1961-12-01

Full Text Available A honra de ocupar uma cadeira numa instituição cientí-fica de renome, não é maior, decerto, do que aquela de o fazer à sombra de um vulto de primeira grandeza, a lhe servir de patrono. Dupla honra e dupla responsabilidade, portanto, o que neste momento me toca, pois se a Cadeira pertence ao Instituto Histórico e Geográfico de Santos, entidade que digni-fica a cultura da nossa terra e da nossa gente em vinte e dois anos de trajetória científica e social, a invocação pertence a uma das maiores figuras do Brasil República, o grande Caló-geras, que Afonso de Taunay chamou de "gigante do pensa-mento brasileiro", quando, em discurso de saudação a Rodol-fo Garcia na Academia Brasileira de Letras, verberava que, naquela Academia ilustre, não estivessem três gigantes do pen-samento brasileiro: Pandiá Calógeras, Martim Francisco e Ca-pistrano de Abreu.

ATLAS TileCal LVPS Upgrade Hardware and Testing

CERN Document Server

Hibbard, Michael James; The ATLAS collaboration; Hadavand, Haleh Khani

2018-01-01

UTA (University of Texas at Arlington) has been designing and producing new testing stations to ensure the reliability and quality of new TileLVPS (Low Voltage Power Supplies), also produced at UTA, which will power the next generation of upgraded hardware in the TileCal (Tile Calorimeter) system of ATLAS at CERN. UTA has produced two new types of testing stations, which build upon the previous generation of testing stations used in the initial production of the TileCal system. The first station is the Initial Test Station, and quickly quantifies a multitude of performance metrics of a LVPS. We have developed our own PC based program which graphically display and records onto file these metrics. A few notable metrics we are measuring are the system clock and its jitter. Excessive clock jitter in LVPS can affect system stability and derate the working range of the system duty cycle. This station also verifies protection circuitry of LVPS, which protects it from over temperature, current and voltage. The second...

National Science Foundation Assistant Director for Mathematics and Physical Sciences Tony Chan (USA) visiting LHCb experiment on 23rd May 2007 with Spokesperson T. Nakada, Advisor to CERN Director-General J. Ellis and I. Belyaev of Syracuse

CERN Multimedia

Maximilien Brice

2007-01-01

National Science Foundation Assistant Director for Mathematics and Physical Sciences Tony Chan (USA) visiting LHCb experiment on 23rd May 2007 with Spokesperson T. Nakada, Advisor to CERN Director-General J. Ellis and I. Belyaev of Syracuse

ATLAS TileCal submodule B-field measurement

International Nuclear Information System (INIS)

Budagov, Yu.A.; Fedorenko, S.B.; Kalinichenko, V.V.; Lomakin, Yu.F.; Vorozhtsov, S.B.; Nessi, M.

1997-01-01

The work was done to cross check of the previous measurement done at CERN and to simulate the magnetic structure in the vicinity of the symmetry plane of the TileCal. To perform magnetic measurements for submodule the magnet E2 was chosen. The magnetometer used in the magnetic test of the submodule consists of Hall current supply and Hall voltage measuring device. The indium antimonide Hall probe used in this measurement is a model PKhE 606. Experimental set-up provides a true measurement accuracy of order ± 1%. External magnetic field measurements were conducted at the outer surface of the submodule. Two levels of the external field were applied: 108 Gs and 400 Gs. The result of this measurement in general confirms the data, obtained at CERN, but the shielding capability of the submodule under consideration was ∼ 20% higher than there. The field at the tile location is < 150 Gs up to the external field level 500 Gs and the tile field grows much less than the external field level in this range. The data obtained in this measurement could be used as a benchmark when producing a computer model of the TileCal magnetic field distribution

Aurora musas nutrit. Die Jesuiten und die Kultur Mitteleuropas im 16.-18. Jahrhundert. Internationale interdisziplinäre Konferenz, Bratislava, 26.-28. září 2007

Czech Academy of Sciences Publication Activity Database

Škarpová, Marie; Kapsa, Václav

2008-01-01

Roč. 45, 3-4 (2008) ISSN 0018-7003. [Aurora musas nutrit. Die Jesuiten und die Kultur Mitteleuropas im 16.-18. Jahrhundert. Bratislava, 26.09.2007-29.09.2007] Institutional research plan: CEZ:AV0Z90580513 Keywords : music * conferences * report Subject RIV: AL - Art, Architecture, Cultural Heritage

Transfer of Air Force technical procurement bid set data to small businesses, using CALS and EDI: Test report

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-08-15

This report documents a test transfer of three Air Force technical procurement bid sets to one large and twelve small businesses, using the Department of Defense (DoD) Continuous Acquisition and Life-cycle Support (CALS) and ANSI ASC X12 Electronic Data Interchange (EDI) standards. The main goal of the test was to evaluate the effectiveness of using CALS technical data within the context of the DoD`s EDI-based standard approach to electronic commerce in procurement, with particular emphasis on receipt and use of the data by small contractors. Air Force procurement data was provided by the Sacramento Air Logistics Center at McClellan Air Force Base; the manufacturing participants were selected from among McClellan`s ``Blue Ribbon`` contractors, located throughout the US. The test was sponsored by the Air Force CALS Test Network, headquartered at Wright-Patterson Air Force Base. The test successfully demonstrated the technical feasibility of including CALS MIL-R-28002 (Raster) engineering data in an EDI Specification/Technical Information transaction set (ANSI ASC X12 841) when issuing electronic requests for quotation to small businesses. In many cases, the data was complete enough for the contractor participant to feel comfortable generating a quote. Lessons learned from the test are being fed back to the CALS and EDI standards organizations, and to future implementors of CALS-EDI based acquisition or contracting systems, which require the transfer of technical information, such as engineering data, manufacturing process data, quality test data, and other product or process data, in the form of a CALS or other digital datafile.

CRED REA Invertebrate Quantitative Assessments at Maug Islands, Marianas Archipelago, in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

CRED REA Invertebrate Quantitative Assessments at Pagan Island, Marianas Archipelago, in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

CRED REA Invertebrate Quantitative Assessments at Alamagan Island, Marianas Archipelago, in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

CRED REA Invertebrate Quantitative Assessments at Sarigan Island, Marianas Archipelago, in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

IPY 2007-2008 and Scientists, Science Organisations, and the Public

Science.gov (United States)

Carlson, D. J.

2006-12-01

An initial burst of enthusiasm resulted in more than 1000 expressions of interest and nearly 500 internationally coordinated proposals for polar research during IPY. An international committee has endorsed more than 200 of these proposals, and most other proposals and nearly all expressions of interest have found ways to join the endorsed programme. Ten nations have announced new IPY science funding totalling in excess of 300M USD for the two years of operations; several nations will make announcements soon. Most on-going funding for polar research, coming from at least 30 nations, approximately 1.6B USD over two years, will also support IPY activities. What should the thousands of scientists hoping to participate expect, personally and collectively? What should the overall science entity expect, during and after IPY? And, finally, what should the public expect, after much attention and the expenditure of 2B USD, not to mention the on-going and future costs of ice breakers and ice-monitoring satellites and polar bases? Many IPY scientists will initially experience disappointment. Funding, even with IPY infusions, will fall short of need, and initial proposal success rates will stay below 50% in almost every nation, far below in some nations. In many nations, however, a catch-up effect will occur, leading to more funds in 2008 or 2009 than in 2006 and 2007. A step-up effect will also occur, leading to increased on-going funds for polar research, although perhaps in smaller steps and in fewer countries than we might hope. Scientists should expect increased public attention to their work and increased demand for their cooperation and contribution to international data management and to public outreach. Individually and collectively, IPY scientists have the opportunity to interact with an amazing array of fellow scientists, exchanging experience and enthusiasm on topics from gravitational variations to genomic sequences to Gwich'in cultures. Science as an entity will

2007 Microbial Population Biology (July 22-26, 2007)

Energy Technology Data Exchange (ETDEWEB)

Anthony M. Dean

2008-04-01

Microbial Population Biology covers a diverse range of cutting edge issues in the microbial sciences and beyond. Firmly founded in evolutionary biology and with a strongly integrative approach, past meetings have covered topics ranging from the dynamics and genetics of adaptation to the evolution of mutation rate, community ecology, evolutionary genomics, altruism, and epidemiology. This meeting is never dull: some of the most significant and contentious issues in biology have been thrashed out here. We anticipate the 2007 meeting being no exception. The final form of the 2007 meeting is yet to be decided, but the following topics are likely to be included: evolutionary emergence of infectious disease and antibiotic resistance, genetic architecture and implications for the evolution of microbial populations, ageing in bacteria, biogeography, evolution of symbioses, the role of microbes in ecosystem function, and ecological genomics.

Diseño del sistema para extracción de gases de un horno para cal

OpenAIRE

Vega Basurto, Carlos W.; Martinez Lozano, Ernesto Rolando

2009-01-01

Esta tesis es realizada en una empresa distribuidora de material no metálico ubicada en la ciudad de Guayaquil en el kilómetro 12 ½ Vía a la costa. Es una planta que tiene dos procesos fundamentales que son obtención de Cal y de procesamiento de áridos (piedra y arena). Este trabajo se enfoca en la parte del proceso de obtención de Cal que tiene una gran demanda en estos momentos en el país. La empresa posee un horno de una capacidad de 80 Toneladas Por Día de Cal pero no logra cubrir to...

Suborbital Science Program: Dryden Flight Research Center

Science.gov (United States)

DelFrate, John

2008-01-01

This viewgraph presentation reviews the suborbital science program at NASA Dryden Flight Research Center. The Program Objectives are given in various areas: (1) Satellite Calibration and Validation (Cal/val)--Provide methods to perform the cal/val requirements for Earth Observing System satellites; (2) New Sensor Development -- Provide methods to reduce risk for new sensor concepts and algorithm development prior to committing sensors to operations; (3) Process Studies -- Facilitate the acquisition of high spatial/temporal resolution focused measurements that are required to understand small atmospheric and surface structures which generate powerful Earth system effects; and (4) Airborne Networking -- Develop disruption-tolerant networking to enable integrated multiple scale measurements of critical environmental features. Dryden supports the NASA Airborne Science Program and the nation in several elements: ER-2, G-3, DC-8, Ikhana (Predator B) & Global Hawk and Reveal. These are reviewed in detail in the presentation.

RELATIONSHIP BETWEEN PHYSICAL ACTIVITIES OF GIRLS AND THEIR PARENTS WITH GIRLS` ATTITUDES PHYSI CAL ACTIVITY

Directory of Open Access Journals (Sweden)

Nebojša Čokorilo

2007-05-01

Full Text Available The re se arch was con duc ted on the sam ple of 222 pa rents of ele men tary school - girls, aged 6-7 years from No vi Sad, Som bor, Srem ska Mi tro vi ca, Bač ka Pa lan ka and Zre nja nin. Physi cal ac ti vi ti es of ma le chil dren and the ir pa rents we re al so eva lu a ted by the ir pa rents. That is the ti me when chil dren can con sti tu te ha bits for physi cal exer ci ses. Pas si ve at ti tu de of fe ma le chil dren to wards physi cal exer ci ses are the con se qu en ces of the sa me at ti tu des sha red by pa rents. Wit hin re se arch it is fo und out that the re is a hu ge im por tan ce of pa rents’ par ti ci pa tion in chil dren’s ac ti vi ti es. That in clu des how much chil dren are physi cal ac ti ve per we ek.

CAL--ERDA program manual. [Building Design Language; LOADS, SYSTEMS, PLANT, ECONOMICS, REPORT, EXECUTIVE, CAL-ERDA

Energy Technology Data Exchange (ETDEWEB)

Hunn, B. D.; Diamond, S. C.; Bennett, G. A.; Tucker, E. F.; Roschke, M. A.

1977-10-01

A set of computer programs, called Cal-ERDA, is described that is capable of rapid and detailed analysis of energy consumption in buildings. A new user-oriented input language, named the Building Design Language (BDL), has been written to allow simplified manipulation of the many variables used to describe a building and its operation. This manual provides the user with information necessary to understand in detail the Cal-ERDA set of computer programs. The new computer programs described include: an EXECUTIVE Processor to create computer system control commands; a BDL Processor to analyze input instructions, execute computer system control commands, perform assignments and data retrieval, and control the operation of the LOADS, SYSTEMS, PLANT, ECONOMICS, and REPORT programs; a LOADS analysis program that calculates peak (design) zone and hourly loads and the effect of the ambient weather conditions, the internal occupancy, lighting, and equipment within the building, as well as variations in the size, location, orientation, construction, walls, roofs, floors, fenestrations, attachments (awnings, balconies), and shape of a building; a Heating, Ventilating, and Air-Conditioning (HVAC) SYSTEMS analysis program capable of modeling the operation of HVAC components including fans, coils, economizers, humidifiers, etc.; 16 standard configurations and operated according to various temperature and humidity control schedules. A plant equipment program models the operation of boilers, chillers, electrical generation equipment (diesel or turbines), heat storage apparatus (chilled or heated water), and solar heating and/or cooling systems. An ECONOMIC analysis program calculates life-cycle costs. A REPORT program produces tables of user-selected variables and arranges them according to user-specified formats. A set of WEATHER ANALYSIS programs manipulates, summarizes and plots weather data. Libraries of weather data, schedule data, and building data were prepared.

Annual Report 2007

International Nuclear Information System (INIS)

2008-01-01

This report represents all the activities and accomplishment of Philippine Nuclear Research Institute (PNRI) for the calendar year 2007 which aims to institutionalize nuclear knowledge management through knowledge generation, knowledge transfer and sharing, knowledge codification and mapping, knowledge preservation and repositories, and communities of practice and networking, thereby ultimately ensuring the availability of trained manpower in nuclear science and technology

Annual Report 2007

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-07-01

This report represents all the activities and accomplishment of Philippine Nuclear Research Institute (PNRI) for the calendar year 2007 which aims to institutionalize nuclear knowledge management through knowledge generation, knowledge transfer and sharing, knowledge codification and mapping, knowledge preservation and repositories, and communities of practice and networking, thereby ultimately ensuring the availability of trained manpower in nuclear science and technology.

Impact of CALS on Electronic Publishing Systems and Users.

Science.gov (United States)

Beazley, William G.

1990-01-01

The U.S. Department of Defense has begun using its buying power to enforce standards on the vendors and contractors of automatic data processing hardware and software. An example of this, the Computer-Aided Acquisition and Logistic Support (CALS) program, is described, and how it will affect electronic publishing systems is discussed. (five…

School Emphasis on Academic Success: Exploring Changes in Science Performance in Norway between 2007 and 2011 Employing Two-Level SEM

Science.gov (United States)

Nilsen, Trude; Gustafsson, Jan-Eric

2014-01-01

We study whether changes in school emphasis on academic success (SEAS) and safe schools (SAFE) may explain the increased science performance in Norway between TIMSS 2007 and 2011. Two-level structural equation modelling (SEM) of merged TIMSS data was used to investigate whether changes in levels of SEAS and SAFE mediate the changes in science…

Missouri local technical assistance program at Missouri University of Science and Technology (formerly University of Missouri--Rolla) : annual progress report January-December 2007.

Science.gov (United States)

2009-02-01

This annual report is a summary of the activities during 2007 for the Missouri Local Technical Assistance Program (Missouri LTAP), which is located at Missouri University of Science and Technology. The report highlights Missouri LTAPs performance ...

The upgrade of the laser calibration system for the ATLAS hadron calorimeter TileCal

CERN Document Server

Spalla, Margherita; The ATLAS collaboration

2014-01-01

The Tile Calorimeter (TileCal), the central section of the hadronic calorimeter of the ATLAS experiment, is a key detector component to detect hadrons, jets and taus and to measure the missing transverse energy. TileCal is built of steel and scintillating tiles coupled to optical fibers and read‐out by photomultipliers (PMT). The performance of TileCal relies on a continuous, high resolution calibration of the individual response of the 10,000 channels forming the detector. The calibration is based on a three level architecture: a charge injection system used to monitor the full electronics chain including front-end amplifiers, digitizers and event builder blocks for each individual channel; a distributed optical system using laser pulses to excite all PMTs; and a mobile Cesium radiative source which is driven through the detector cell floating inside a pipe system. This architecture allows for a cascade calibration of the electronics, of the PMT and electronics, and of full chain including the active detec...

Firmware Development for the ATLAS TileCal sROD

CERN Document Server

Moreno Marti, Pablo; The ATLAS collaboration; Valero, Alberto

2015-01-01

TileCal is the central hadronic calorimeter of the ATLAS experiment at the Large Hadron Collider (LHC) at CERN. A main upgrade of the LHC (also called Phase-II) is planned in order to increase the instantaneous luminosity in 2022. At the TileCal level, the upgrade involves the redesign of the complete read-out architecture, affecting both the front-end and the back-end electronics. In the new read-out architecture, the front-end electronics will transmit digitized information of the full detector to the back-end system every single bunch-crossing. Thus, the back-end system must provide digital calibrated information to the first level of trigger. Having all detector data per bunch crossing in the back-end will increase the precision and granularity of the trigger information, improving this way the trigger efficiencies. A reduced part of the detector, 1/256 of the total, will be equipped with the new electronics during 2015 to evaluate the proposed architecture in real conditions in the so-called “demonstra...

Firmware Development for the ATLAS TileCal sROD

CERN Document Server

Moreno Marti, Pablo; The ATLAS collaboration; Valero, Alberto

2015-01-01

TileCal is the central hadronic calorimeter of the ATLAS experiment at the Large Hadron Collider (LHC) at CERN. A main upgrade of the LHC (also called Phase-II) is planned in order to increase the instantaneous luminosity in 2022. For TileCal, the upgrade involves the redesign of the complete read-out architecture, affecting both the front-end and the back-end electronics. In the new read-out architecture, the front-end electronics will transmit digitized information of the full detector to the back-end system every single bunch-crossing. Thus, the back-end system must provide digital calibrated information to the first level of trigger. Having all detector data per bunch crossing in the back-end will increase the precision and granularity of the trigger information, improving this way the trigger efficiencies. A reduced part of the detector, 1/256 of the total, will be equipped with the new electronics during 2016 to evaluate the proposed architecture in real conditions in the so-called “demonstrator proje...

Retooling CalEnviroScreen: Cumulative Pollution Burden and Race-Based Environmental Health Vulnerabilities in California

Science.gov (United States)

2018-01-01

The California Community Environmental Health Screening Tool (CalEnviroScreen) advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California. PMID:29659481

Retooling CalEnviroScreen: Cumulative Pollution Burden and Race-Based Environmental Health Vulnerabilities in California

Directory of Open Access Journals (Sweden)

Raoul S. Liévanos

2018-04-01

Full Text Available The California Community Environmental Health Screening Tool (CalEnviroScreen advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California.

Retooling CalEnviroScreen: Cumulative Pollution Burden and Race-Based Environmental Health Vulnerabilities in California.

Science.gov (United States)

Liévanos, Raoul S

2018-04-16

The California Community Environmental Health Screening Tool (CalEnviroScreen) advances research and policy pertaining to environmental health vulnerability. However, CalEnviroScreen departs from its historical foundations and comparable screening tools by no longer considering racial status as an indicator of environmental health vulnerability and predictor of cumulative pollution burden. This study used conceptual frameworks and analytical techniques from environmental health and inequality literature to address the limitations of CalEnviroScreen, especially its inattention to race-based environmental health vulnerabilities. It developed an adjusted measure of cumulative pollution burden from the CalEnviroScreen 2.0 data that facilitates multivariate analyses of the effect of neighborhood racial composition on cumulative pollution burden, net of other indicators of population vulnerability, traffic density, industrial zoning, and local and regional clustering of pollution burden. Principal component analyses produced three new measures of population vulnerability, including Latina/o cumulative disadvantage that represents the spatial concentration of Latinas/os, economic disadvantage, limited English-speaking ability, and health vulnerability. Spatial error regression analyses demonstrated that concentrations of Latinas/os, followed by Latina/o cumulative disadvantage, are the strongest demographic determinants of adjusted cumulative pollution burden. Findings have implications for research and policy pertaining to cumulative impacts and race-based environmental health vulnerabilities within and beyond California.

Analyzing Turkey's data from TIMSS 2007 to investigate regional disparities in eighth grade science achievement

Science.gov (United States)

Erberber, Ebru

Turkey is expected to be a full member of the European Union (EU) by 2013. In the course of its integration into the EU, Turkey has been simultaneously facing access, quality, and equity issues in education. Over the past decade, substantial progress has been made on increasing the access. However, improving the country's low level of education quality and achieving equity in quality education across the regions continue to be a monumental challenge in Turkey. Most recently, results from the Trends in International Mathematics and Science Study (TIMSS) 2007 indicated that Turkey's educational achievement at the eighth grade, the end of compulsory primary education in Turkey, was far below that of other countries in the EU. Considering Turkey's long standing socioeconomic disparities between the western and eastern parts of the country, the challenges of improving overall education quality are coupled with the challenges of achieving equity in learning outcomes for students across the regions. This dissertation used data from TIMSS 2007 to document the extent of Turkey's regional differences in science achievement at the eighth grade and to investigate factors associated with these differences. Findings from a series of analyses using hierarchical linear models suggested that attempts to increase Turkish students' achievement and close the achievement gaps between regions should target the students in the undeveloped regions, particularly in Southeastern Anatolia and Eastern Anatolia. Designing interventions to improve competency in Turkish and to compensate for the shortcomings of insufficient parental education, limited home educational resources, poor school climate for academic achievement, and inadequate instructional equipment and facilities might be expected to close the regional achievement gaps as well as raise the overall achievement level in Turkey.

CEA Annual report 2007

International Nuclear Information System (INIS)

2007-01-01

The CEA, a prominent player in research development and innovation, is active in three main domains: energy, health care and information technology, defense and security. This annual report presents the CEA activities for the year 2007 in these three main areas: science and technology working for nuclear deterrence and global security, the energies without greenhouse effect gases emission against the climatic change, researches in the information sciences and technologies for a better communication and health. The CEA safety, organization, communication and international relations are also presented. (A.L.B.)

Real-time environmental monitoring system: drilling campaign BM-CAL-4 Block, Camanu-Almada Basin, Bahia, Brazil; Sistema de monitoramento ambiental em tempo-real: Bloco BM-CAL-4, Bacia de Camamu-Almada, Bahia, Brasil

Energy Technology Data Exchange (ETDEWEB)

Martins, Pedro [El Paso Oleo e Gas, Natal, RN (Brazil); Cabral, Alexandre P. [Fugro OceansatPeg (Brazil)

2008-07-01

Between February and November 2007, the El Paso Oleo e Gas do Brasil Ltda. carried out a second exploratory campaign at the BM-CAL-4 Block (Camamu-Almada Basin), installing a real-time transmission metocean data monitoring system. Two metocean Wavescan (WS) buoys from Fugro were installed, transmitting current, wave and wind data to the El Paso crises room. The WS1 was positioned near the oil (10,5 km from the shore, at 22m depth), and the WS2 was located near the entrance of Barra Grande area (4,w km from the coast, at 10m depth). The real rime data fed the mathematical simulation using an oil spill model from Fugro Oceansatpeg. The metocean data Real-Time Environmental Monitoring System proved to be an important tool in the environmental management of the drilling activity located near the coastline. The sampling and real-time transmission of the current, wind and wave data allowed a better decision making regarding the selection of the best response strategies, saving time and resources in the simulation exercises, a vital issue in case of a real oil spill accident. (author)

Dijk- en oeverval aan den cal. Willem Annapolder (Gem. Kapelle)

NARCIS (Netherlands)

Verhagen, H.J.

1936-01-01

Foto's van de aanleg van de dijk- en oeverval aan den cal. Willem Annapolder (Gem. Kapelle) 3. Linkerhelft dijkval Willem Annapolder. 30 Dec. 1936 4. Rechtehelft dijkval Willem Annapolder. 30 Dec. 1936 5. Overzicht dijkval Willem Annaolder. 30 Dec. 1936 6. Kleikisting binnendijks aangebacht. 14/15

Evolution of Information Management at the GSFC Earth Sciences (GES) Data and Information Services Center (DISC): 2006-2007

Science.gov (United States)

Kempler, Steven; Lynnes, Christopher; Vollmer, Bruce; Alcott, Gary; Berrick, Stephen

2009-01-01

Increasingly sophisticated National Aeronautics and Space Administration (NASA) Earth science missions have driven their associated data and data management systems from providing simple point-to-point archiving and retrieval to performing user-responsive distributed multisensor information extraction. To fully maximize the use of remote-sensor-generated Earth science data, NASA recognized the need for data systems that provide data access and manipulation capabilities responsive to research brought forth by advancing scientific analysis and the need to maximize the use and usability of the data. The decision by NASA to purposely evolve the Earth Observing System Data and Information System (EOSDIS) at the Goddard Space Flight Center (GSFC) Earth Sciences (GES) Data and Information Services Center (DISC) and other information management facilities was timely and appropriate. The GES DISC evolution was focused on replacing the EOSDIS Core System (ECS) by reusing the In-house developed disk-based Simple, Scalable, Script-based Science Product Archive (S4PA) data management system and migrating data to the disk archives. Transition was completed in December 2007

Application of polymeric foams for separation, storage and absorption of hydrogen

Czech Academy of Sciences Publication Activity Database

Pientka, Zbyněk; Nemestóthy, N.; Bélafi-Bakó, K.

2009-01-01

Roč. 241, 1-3 (2009), s. 106-110 ISSN 0011-9164. [Membrane Science and Technology Conference of Visegrad Countries PERMEA 2007 /3./. Siofok, 02.09.2007-06.09.2007] R&D Projects: GA ČR GA203/06/1207 Institutional research plan: CEZ:AV0Z40500505 Keywords : gas separation * hydrogen * polymeric foam Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.034, year: 2009

CRED REA Invertebrate Quantitative Assessments at Farallon De Pajaros Island, Marianas Archipelago, in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

Cal Poly Apparel Manufacturing Demonstration - Year 4 and 5 Final Technical Report

National Research Council Canada - National Science Library

2001-01-01

.... Since the Southern California apparel industry is primarily small businesses producing low volume fashion products, the Cal Poly Demo factory needed to reflect the size and capability of its customer...

2007 Sumpter Powder River Mine Lidar

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Watershed Sciences, Inc. (WS) collected Light Detection and Ranging (LiDAR) data for the USDA Forest Service on September 17, 2007. The project covers an 8-mile...

The VAEC - Annual report for 2007

Energy Technology Data Exchange (ETDEWEB)

Tan, Vuong Huu; Hong, Le Van; Anh, Nguyen Hoang; Trang, Nguyen Trong; Hong, Dang Thi [eds.

2007-11-15

The VAEC Annual Report for 2007 has been prepared as an account of works carried out at the Vietnam Atomic Energy Commission (VAEC) for the year 2007. The Report contains mains results from the VAEC's activities of research and development in following fields: nuclear physics; reactor physics, reactors and nuclear power; instrumentation; industrial applications; radiation protection and radioactive waste management; applications in ecology, geology and environment; applications in biology, agriculture and medicine; radiation technology, radiochemistry and materials sciences, computation and other topics. (NHA)

The VAEC - Annual report for 2007

International Nuclear Information System (INIS)

Vuong Huu Tan; Le Van Hong; Nguyen Hoang Anh; Nguyen Trong Trang; Dang Thi Hong

2007-11-01

The VAEC Annual Report for 2007 has been prepared as an account of works carried out at the Vietnam Atomic Energy Commission (VAEC) for the year 2007. The Report contains mains results from the VAEC's activities of research and development in following fields: nuclear physics; reactor physics, reactors and nuclear power; instrumentation; industrial applications; radiation protection and radioactive waste management; applications in ecology, geology and environment; applications in biology, agriculture and medicine; radiation technology, radiochemistry and materials sciences, computation and other topics. (NHA)

Micropores preparation in A3B5 semiconductors

Czech Academy of Sciences Publication Activity Database

Nohavica, Dušan; Gladkov, Petar; Zelinka, Jiří; Jarchovský, Zdeněk

-, mim. číslo (2007), s. 1-16 ISSN 1335-9053. [Development of Materials Science in Research and Education . Tatranská Štrba, 10.09.2007-14.09.2007] R&D Projects: GA ČR GA202/06/1315; GA MŠk ME 834 Institutional research plan: CEZ:AV0Z20670512 Keywords : porous semiconductors * III-V semiconductors * nanoelectronics Subject RIV: BM - Solid Matter Physics ; Magnetism http://www.mtf.stuba.sk/docs//internetovy_casopis/2007/mimorcis/nohavica.pdf

2008-09 National Rivers and Streams Assessment Fish Tissue Data Dictionary

Science.gov (United States)

The Office of Science and Technology (OST) is providing the fish tissue results from the 2008-09 National Rivers and Streams Assessment (NRSA). This document includes the “data dictionary” for Mercury, Selenium, PBDEs, PCBs, Pesticides and PFCs.

Annual report of R and D activities in Center for Computational Science and e-Systems from April 1, 2007 to March 31, 2009

International Nuclear Information System (INIS)

2010-01-01

This report provides an overview of research and development activities in Center for Computational Science and e-Systems (CCSE), JAEA, during the fiscal years 2007 and 2008 (Apr 1, 2007 - March 31, 2009). These research and development activities have been performed by the Simulation Technology R and D Office and Computer Science R and D Office. These activities include development of secure computational infrastructure for atomic energy research based on the grid technology, large scale seismic analysis of an entire nuclear reactor structure, large scale fluid dynamics simulation of J-PARC mercury target, large scale plasma simulation for nuclear fusion reactor, large scale atomic and subatomic simulations of nuclear fuels and materials for safety assessment, large scale quantum simulations of superconductor for the design of new devices and fundamental understanding of superconductivity, development of protein database for the identification of radiation-resistance gene, and large scale atomic simulation of proteins. (author)

Estudo de argamassa à base de cal e metacaulim para intervenções em revestimento das edificações históricas

OpenAIRE

Souza, Juliana Santa Cruz

2013-01-01

O objetivo deste trabalho é caracterizar argamassas a base de cal com teores diferenciados de metacaulim para a restauração de revestimento nas edificações históricas. Confrontou-se cinco traços de argamassa à base de cal, metacaulim e mistura binária de agregado miúdo, sendo mantida a proporção de ligante e agregado em massa constante 1:3. Os traços possuem modificação na proporção de cal e metacaulim, sendo a cal substituída em massa por metacaulim nas porcentagens de 0%, ...

Impact of climate variability on terrestrial environment in Western Europe between 45 and 9 kyr cal. BP: vegetation dynamics recorded by the Bergsee Lake (Black Forest, Germany).

Science.gov (United States)

Duprat-Oualid, Fanny; Begeot, Carole; Rius, Damien; Millet, Laurent; Magny, Michel

2016-04-01

changes at millennial/pluri-millennial scale. The well-known afforestation of the Late-Glacial interstadial and the Holocene (with pine and hazel-dominated forests respectively) are recorded. Our results also reveal a three-phase sequence in the Last-Glacial. The persistence of very cold conditions between 24 and 30 kyr cal. BP favored a drastic steppe grassland. In contrast, trees proportion increased during the two other periods (14.7-24 and 30-45 kyr cal. BP) in correlation with a relative favorable climate. Second, the respons of vegetation to centennial scale climatic events is characterized by the successive rapid establishment of two different landscapes. GS are dominated by steppic taxa (Artemisia, Helianthemum), whereas more or less complete ecological successions Juniperus-Betula-Pinus seem to occur for most GIs when edaphic conditions became more favorable. Therefore, we suggest a global forcing defined by the strong impact of the climate variability on vegetation changes. We also propose the contribution of local characteristics (latitude, topography) which favored flora migration and long distance pollen inputs from refuge areas. Heiri O., Koinig K.A., Spötl C., Barrett S, Brauer A., Drescher-Schneider R., Gaar D., Ivy-Ochs S., Kerschner H., Luetscher M., Moran A., Nicolussi K., Preusser F., Schmidt R., Schoeneich P., Schwörer C., Sprafke T., Terhorst B., Tinner W. -2014- "Palaeoclimate records 60-8 ka in the Austrian and Swiss Alps and their forelands", Quaternary Science Review, 106 : 186-205.

Influência de calços na orientação postural de indivíduos com escoliose idiopática

Directory of Open Access Journals (Sweden)

Dalva Minonroze Albuquerque Ferreira

Full Text Available INTRODUÇÃO: A relação entre a orientação dos segmentos e os ajustes que podem ser desencadeados por calços e palmilhas em pacientes escolióticos durante a manutenção da posição ortostática é pouco conhecida. OBJETIVO: Verificar alterações estáticas e associadas com mudanças unilaterais de calços na orientação postural de indivíduos com escoliose idiopática. MATERIAIS E MÉTODOS: Grupo experimental com dez indivíduos com escoliose idiopática com curva dupla (menor 10° e grupo controle com dez indivíduos sem escoliose (faixa etária de 13 a 24 anos. Participantes foram filmados na posição ortostática sem calço, com calço baixo (1 cm e com calço alto (3 cm; estes foram colocados sob o pé direito e pé esquerdo dos indivíduos. Em cada condição, o participante manteve a posição estática durante 15 segundos e marcadores refletivos foram colocados em pontos anatômicos específicos. Foram calculados ângulos posturais: torácico alto; torácico médio; toracolombar e lombar e ângulos segmentares: ombro; escápula; pelve e joelho. RESULTADOS: Na condição sem calço, diferenças foram observadas entre grupos para os ângulos posturais toracolombar e lombar e para o ângulo segmentar do ombro. Com calço baixo e alto, sob o pé direito, diferença foi observada entre calços para os ângulos lombar, da pelve e do joelho. Com calço baixo e alto, sob o pé esquerdo, diferença foi observada entre grupos para o ângulo toracolombar e entre calços para os ângulos da pelve e do joelho. CONCLUSÕES: A utilização de calço promove reorientação nas regiões mais baixas da coluna e nos segmentos da pelve e do joelho. Estes resultados sugerem que nas escolioses duplas, manipulação da base de apoio modifica o alinhamento do tronco que pode provocar reorganização das estruturas e busca de um novo arranjo entre segmentos em indivíduos com escoliose idiopática.

Summaries of research and development activities by using JAEA computer system in FY2007. April 1, 2007 - March 31, 2008

International Nuclear Information System (INIS)

2008-11-01

Center for Computational Science and e-Systems (CCSE) of Japan Atomic Energy Agency (JAEA) installed large computer systems including super-computers in order to support research and development activities in JAEA. This report presents usage records of the JAEA computer system and the big users' research and development activities by using the computer system in FY2007 (April 1, 2007 - March 31, 2008). (author)

Posibilidades estructurales de materiales a base de cal como conglomerante: primeros resultados

Directory of Open Access Journals (Sweden)

Estrada, Enrique

1986-11-01

Full Text Available Lime is a plentiful material which production combine a very accessible technology with the advantage that it must be prepared in little disperse plants, so that the transport charges can be reduced to the minimum. This work expound the possibility to obtain concretes with structural purposes, for housing of scarce height, of easy obtention, basically from flying ashes or rice husk ashes, varying its proportions and fineness degree and studying the initial and final resistance. Good results have been obtained mainly with rice husk ashes and lime, with 60 days resistance higher than 15 Mpa.La cal es un material abundante y cuya producción suma a una tecnología muy accesible la ventaja de poder materializarse en pequeñas plantas dispersas, para poder reducir al mínimo la componente de costo debida al transporte. En el presente trabajo se ha planteado la posibilidad de obtener hormigones con fines estructurales, para viviendas de baja altura y que sean de fácil obtención, a base de cal y cenizas volantes o cenizas de cascara de arroz, variando sus proporciones, grados de finura y estudiando la influencia de distintos factores en la resistencia inicial y final. Se han obtenido buenos resultados, principalmente con ceniza de cascara de arroz y cal con resistencias a 60 días superiores a los 15 MPa.

The Use of Ambulatory Blood Pressure Monitoring Among Medicare Beneficiaries in 2007-2010

OpenAIRE

Shimbo, Daichi; Kent, Shia T; Diaz, Keith M; Huang, Lei; Viera, Anthony J; Kilgore, Meredith; Oparil, Suzanne; Muntner, Paul

2014-01-01

The US Centers for Medicaid and Medicare Services reimburses ambulatory blood pressure monitoring (ABPM) for suspected white coat hypertension. We estimated ABPM use between 2007 and 2010 among a 5% random sample of Medicare beneficiaries (≥ 65 years). In 2007, 2008, 2009 and 2010, the percentage of beneficiaries with ABPM claims was 0.10%, 0.11%, 0.10%, and 0.09% respectively. A prior diagnosis of hypertension was more common among those with versus without an ABPM claim (77.7% versus 47.0%)...

Fellowship | Indian Academy of Sciences

Indian Academy of Sciences (India)

Ph.D. (Stanford), FNA, FNAE Council Service: 2007- ; Secretary: 2007-12; Treasurer: 2013-. Date of birth: 26 September 1947. Specialization: Climate Science and Solar Energy Address: Honorary Professor, Centre for Atmospheric and Oceanic Sciences, Indian Institute of Science, Bengaluru 560 012, Karnataka Contact:

Proceedings of the European Nuclear Conference - ENC 2007 Transactions, inspire yourself and others

International Nuclear Information System (INIS)

2007-01-01

From 16-20 September, the European Nuclear Conference 2007 (ENC 2007) took place at the VUB (Vrije Universiteit Brussel), in Brussels. ENC 2007 is a biannual European Nuclear Society (ENS) event - the largest international conference of its kind on the European event calendar. It provided a platform for the nuclear science community to share their experiences, to learn about the latest developments going on in nuclear research and their practical applications and to exploit synergy among scientists, industry representatives, policy-makers and citizens on wider societal issues that impact upon how the nuclear science community carries out its work. ENC 2007 was organised in co-operation with the Belgian Nuclear Society, the IAEA and OECD/NEA, and with the support of the American Nuclear Society (ANS) and the VUB. Among the sponsors were Suez, AREVA and Westinghouse. Among the subjects covered during the plenary sessions were The Politics of Science and Technology, Business and Institutions' View on Science and R and D, The Human Factor in Risk Governance, The Politics of Sustainable Development and The Benefits, Costs and Hurts of Nuclear Medicine. (authors)

Teaching Climate Change Science to Undergradutes with Diverse & Digital Pedagogical Techniquees

Science.gov (United States)

Kauffman, C.; Brey, J. A.; Nugnes, K. A.; Weinbeck, R. S.; Geer, I. W.

2015-12-01

California University of Pennsylvania (CalUPA) is unique relative to other undergraduate geoscience programs in that their climate science offerings are varied and inter-woven into an existing meteorology degree program, which aligns with the guidelines established by the American Meteorological Society (AMS). In addition to the rigorous meteorological requirements, the program strives to increase students' climate literacy. At the introductory course level, students are required to use the educational resources offered by the AMS—specifically their weather and climate studies materials, which have recently transitioned to a digital format. The Earth Sciences Program at CalUPA recently incorporated these new digital resources into a climatology course with novel pedagogical variants. These teaching strategies were well received by students and may benefit other climatology courses at similar institutions. For example, students were tasked with expounding upon textbook content from 'Topic In Depth' segments; they were required to present tangential climate topics in a digital presentation. Moreover, students mined the scientific literature listed at the end of each chapter in the text to identify climate scientists immersed in social media. Students were then required to follow these scientists and engage each other within a social media platform. Finally, as a culminating experience, students were required to create digital portfolios (e.g., infographic) related to climate science and the AMS materials. This presentation will further detail CalUPA's climatological course offerings and detail how the AMS resources were connected to course requirements listed herein.

The impact of BeamCal performance at different international linear ...

Indian Academy of Sciences (India)

Abstract. The ILC accelerator parameters and detector concepts are still under discus- sion in the world-wide community. As will be shown, the performance of the BeamCal, the calorimeter in the very forward area of the ILC detector, is very sensitive to the beam parameter and crossing angle choices. We propose here ...

HFI/NQI 2007

CERN Document Server

Pasquevich, A; Saitovitch, E. Baggio; Petrilli, H; 14th International Conference on Hyperfine Interactions and 18th International Symposium on Nuclear Quadrupole Interactions (HFI/NQI 2007)

2008-01-01

Proceedings of the 14th International Conference on Hyperfine Interactions and 18th International Symposium on Nuclear Quadrupole Interactions, HFI/NQI 2007, held in Iguazú Falls, Brazil, 5-10 August, 2007. Reprinted from Hyperfine Interactions (HYPE) Volume This volume focuses on the most recent studies on all aspects of hyperfine interaction detected by nuclear radiation and nuclear quadrupole interactions detected by resonance methods in the areas of materials, biological and medical science, as well as on contributions on new developments in instrumentation and methods, ab initio calculations and simulations. This volume comprises research papers, reviews, and short communications recording original investigations related to: Theory on Hyperfine Interactions (HFI) and Nuclear Moments; Magnetism and Magnetic Materials (Bulk and Thin Layers); HFI probes in Semiconductors, Metals and Insulators; Lattice Dynamics and Ion-Solid Interactions; Surfaces, Interfaces, Thin Films, and Nano-structures; Resonance Met...

76 FR 70520 - Rovac Corp., RS Group of Companies, Inc., Rymer Foods, Inc. Stratus Services Group, Inc., Sun Cal...

Science.gov (United States)

2011-11-14

...., Rymer Foods, Inc. Stratus Services Group, Inc., Sun Cal Energy, Inc., Sun Motor International, Inc... current and accurate information concerning the securities of Sun Cal Energy, Inc. because it has not... Sun Motor International, Inc. because it has not filed any periodic reports since the period ended...

Oceanographic profile data using bottle collected during CalCOFI cruises, North Pacific Ocean, 2015-04 to 2015-11 (NCEI Accession 0162193)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Bottle data collected during CalCOFI cruises 1504, 1507, and 1511, April 2015 - November 2015. The California Cooperative Oceanic Fisheries Investigations (CalCOFI)...

Het influenza seizoen 2007/'08 in Nederland: antigene variatie, resistentie tegen oseltamivir en de vaccinsamenstelling voor het seizoen 2008/09.

NARCIS (Netherlands)

Rimmelzwaan, G.F.; Jong, J.C. de; Donker, G.A.; Meijer, A.; Fouchier, R.A.M.; Osterhaus, A.D.M.E.

2008-01-01

The first signs of influenza activity during the 2007/’08 influenza season in the Netherlands were sporadic isolations of influenza viruses between week 40 and week 52 of 2007. The frequency of virus isolations and clinical influenza activity increased after week 1 of 2008 and peaked around week 9.

Study of TileCal scintillator irradiation using the minimum bias integrators

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00387867; The ATLAS collaboration

2016-01-01

The Tile Calorimeter (TileCal) is the central hadronic calorimeter of the ATLAS experiment at the LHC. It provides precise energy measurements of hadrons, jets, taus and missing transverse energy. The monitoring and calibration of the calorimeter response at each stage of the signal development is done by a movable $^{137}$Cs radioactive source, a laser calibration system and a charge injection system. Moreover, during LHC data taking, an integrator-based readout provides the signals coming from inelastic proton-proton collisions at predominantly low momentum transfer (minimum bias events) and allows monitoring of the instantaneous ATLAS luminosity as well as the response of calorimeter cells. The integrator currents have been used to detect and quantify the effect of TileCal scintillator irradiation using the data taken in 2012 and 2015 that correspond to about 22 fb$^{−1}$ and 4 fb$^{−1}$ of integrated luminosity, respectively. Finally, the response variation for an irradiated cell has been studied comb...

A Full Slice Test Version of a Tentative Upgraded Readout System for TileCal

CERN Document Server

Muschter, S; The ATLAS collaboration; Bohm, C; Eriksson, D; Kavianipour, H; Oreglia, M; Tang, F

2011-01-01

The upgrade plans on the ATLAS hadronic calorimeter (TileCal) include the full readout of all data to the counting room. In order to study functional requirements of the future upgraded TileCal readout system we have assembled a minimal TDAQ slice. The aim is to implement a tentative readout chain for TileCal, starting with a newly developed 3-in-1 FE-board from University of Chicago and ending with the storage of triggered data on a PC. Later we will use PMT pulses, amplified and shaped by the 3-in-1 board, as a data source. However, for simplicity we start by using well defined calibration pulses also generated by the 3-in-1 board. The pulses are sampled by a 12 bit ADC, which is connected to an ML605 evaluation board from XILINX. These boards emulate the new on-detector electronics. The ML605 communicates via two 5Gb/s optical links with a Virtex-6 FPGA development board from HighTech Global which emulates the off-detector electronics. The off-detector board is situated in a PC and uses PCIe for readout an...

Uncertainty in the area-related QPF for heavy convective precipitation

Czech Academy of Sciences Publication Activity Database

Řezáčová, Daniela; Zacharov, Petr, jr.; Sokol, Zbyněk

2009-01-01

Roč. 93, 1-3 (2009), s. 238-246 ISSN 0169-8095. [European Conference on Severe Storms /4./. Miramare -Trieste, 10.09.2007-14.09.2007] R&D Projects: GA ČR GA205/07/0905; GA MŠk OC 112 Institutional research plan: CEZ:AV0Z30420517 Keywords : Convective storm * Quantitative precipitation forecast * Uncertainty in precipitation forecasting * Ensemble forecasting * Numerical weather prediction model Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 1.811, year: 2009 http://www.sciencedirect.com/science/journal/01698095

CalTOX, a multimedia total exposure model for hazardous-waste sites

International Nuclear Information System (INIS)

McKone, T.E.

1993-06-01

CalTOX has been developed as a spreadsheet model to assist in health-risk assessments that address contaminated soils and the contamination of adjacent air, surface water, sediments, and ground water. The modeling effort includes a multimedia transport and transformation model, exposure scenario models, and efforts to quantify and reduce uncertainty in multimedia, multiple-pathway exposure models. This report provides an overview of the CalTOX model components, lists the objectives of the model, describes the philosophy under which the model was developed, identifies the chemical classes for which the model can be used, and describes critical sensitivities and uncertainties. The multimedia transport and transformation model is a dynamic model that can be used to assess time-varying concentrations of contaminants introduced initially to soil layers or for contaminants released continuously to air or water. This model assists the user in examining how chemical and landscape properties impact both the ultimate route and quantity of human contact. Multimedia, multiple pathway exposure models are used in the CalTOX model to estimate average daily potential doses within a human population in the vicinity of a hazardous substances release site. The exposure models encompass twenty-three exposure pathways. The exposure assessment process consists of relating contaminant concentrations in the multimedia model compartments to contaminant concentrations in the media with which a human population has contact (personal air, tap water, foods, household dusts soils, etc.). The average daily dose is the product of the exposure concentrations in these contact media and an intake or uptake factor that relates the concentrations to the distributions of potential dose within the population

Calázio e características demográficas dos portadores em uma amostra populacional

Directory of Open Access Journals (Sweden)

Marjorie Fornazier do Nascimento

2015-08-01

Full Text Available RESUMO Objetivo: Apresentar a frequência de ocorrência do calázio em uma amostra populacional, assim como as características de seus portadores. Métodos: Estudo transversal utilizando amostra populacional aleatorizada, realizado nos anos 2004/2005, na região centro-oeste do estado de São Paulo. Os participantes foram avaliados segundo variáveis demográficas e exame oftalmológico. Resultados: A frequência de ocorrência do calázio foi de 1,56%, sendo mais frequente em mulheres, portadores de astigmatismo ou hipermetropia de pequenos graus, com grande variação de idade de acometimento. Foi necessária prescrição de correção óptica e cirurgia em número expressivo de casos. Conclusão: O calázio tem baixa frequência de ocorrência na população geral. Ocorre predominantemente em mulheres e há associação importante com ametropia.

High School Longitudinal Study of 2009 (HSLS:09): Base-Year Data File Documentation. NCES 2011-328

Science.gov (United States)

Ingels, Steven J.; Pratt, Daniel J.; Herget, Deborah R.; Burns, Laura J.; Dever, Jill A.; Ottem, Randolph; Rogers, James E.; Jin, Ying; Leinwand, Steve

2011-01-01

The High School Longitudinal Study of 2009 (HSLS:09) is the fifth in a series of National Center for Education Statistics (NCES) secondary longitudinal studies. The core research questions for HSLS:09 explore secondary to postsecondary transition plans and the evolution of those plans; the paths into and out of science, technology, engineering,…

INL Seismic Monitoring Annual Report: January 1, 2007 - December 31, 2007

Energy Technology Data Exchange (ETDEWEB)

S. J. Payne; N. S. Carpenter; J. M. Hodges; R. G. Berg

2008-09-01

During 2007, the INL Seismic Monitoring Program evaluated 2,515 earthquakes from around the world, the western United States, and local region of the eastern Snake River Plain. 671 earthquakes and man-made blasts occurred within the local region outside and within a 161-km (or 100-mile) radius of INL. Of these events, eleven were small to moderate size earthquakes ranging in magnitude from 3.0 to 4.8. 341 earthquakes occurred within the 161-km radius of INL and the majority of these earthquakes were located in active regions of the Basin and Range Province that surrounds the ESRP. Three earthquakes were located within the ESRP at Craters of the Moon National Monument. The earthquakes were of Mc 0.9, 1.4, and 1.8. Since 1972, INL has recorded 36 small-magnitude microearthquakes (M < 2.0) within the ESRP.

Linguistic Resources Used in Grade 8 Students' Submicro Level Explanations—Science Items from TIMSS 2007

Science.gov (United States)

Frändberg, Birgitta; Lincoln, Per; Wallin, Anita

2013-12-01

Explanations involving submicro levels of representation are central to science education, but known to be difficult for students in secondary school. This study examines students' written explanations of physical and chemical phenomena regarding matter and changes in matter, in a large-scale test. This is done in order to understand linguistic challenges in constructing submicro level explanations involving the particle model of matter. Drawing from systemic functional linguistics, the lexicogrammatics used in explanations for realising experiential meaning in student explanations were analysed. We used answers to two partly constructed response items from the Swedish part of Trends in International Mathematics and Science Studies 2007, grade 8, to sort out explanations referring to the particle model of matter. These answers (86 from 954) were analysed regarding choices of vocabulary and grammar to distinguish between macro and submicro level of representation. The results show that students use a wide variety of lexicogrammatical resources to realise what happens on both macro and submicro level of representation, with greater diversity of verbs on the submicro level of explanation. The results suggest an uncertainty about the distinction between macro and submicro level of explanation.

JUST 27 No. 3 December 2007

African Journals Online (AJOL)

User

2007-12-03

Dec 3, 2007 ... growth and mineral nutrition responses of mycorrhizal and nonmycorrhizal cowpea, pigeon pea and groundnut were ... enhanced mycorrhization in cowpea and pigeon pea but it decreased it in groundnut. Superphos- phate-treated cowpea ... Journal of Science and Technology, Vol. 27, No. 3, December ...

PREFACE: International Conference on Computing in High Energy and Nuclear Physics (CHEP'09)

Science.gov (United States)

Gruntorad, Jan; Lokajicek, Milos

2010-11-01

The 17th International Conference on Computing in High Energy and Nuclear Physics (CHEP) was held on 21-27 March 2009 in Prague, Czech Republic. CHEP is a major series of international conferences for physicists and computing professionals from the worldwide High Energy and Nuclear Physics community, Computer Science, and Information Technology. The CHEP conference provides an international forum to exchange information on computing experience and needs for the community, and to review recent, ongoing and future activities. Recent conferences were held in Victoria, Canada 2007, Mumbai, India in 2006, Interlaken, Switzerland in 2004, San Diego, USA in 2003, Beijing, China in 2001, Padua, Italy in 2000. The CHEP'09 conference had 600 attendees with a program that included plenary sessions of invited oral presentations, a number of parallel sessions comprising 200 oral and 300 poster presentations, and an industrial exhibition. We thanks all the presenters, for the excellent scientific content of their contributions to the conference. Conference tracks covered topics on Online Computing, Event Processing, Software Components, Tools and Databases, Hardware and Computing Fabrics, Grid Middleware and Networking Technologies, Distributed Processing and Analysis and Collaborative Tools. The conference included excursions to Prague and other Czech cities and castles and a banquet held at the Zofin palace in Prague. The next CHEP conference will be held in Taipei, Taiwan on 18-22 October 2010. We would like thank the Ministry of Education Youth and Sports of the Czech Republic and the EU ACEOLE project for the conference support, further to commercial sponsors, the International Advisory Committee, the Local Organizing Committee members representing the five collaborating Czech institutions Jan Gruntorad (co-chair), CESNET, z.s.p.o., Prague Andrej Kugler, Nuclear Physics Institute AS CR v.v.i., Rez Rupert Leitner, Charles University in Prague, Faculty of Mathematics and

ChemSession'09 - 6. Warsaw Seminar of the PhD Students in Chemistry - Abstracts

International Nuclear Information System (INIS)

2009-01-01

Book of Abstracts contains short descriptions of presentations 3 lectures and 105 posters presented during ChemSession'09 - 6 th Warsaw Seminar of the PhD Students in Chemistry. Several posters were devoted to the radiochemistry, radiochemical analysis, radiation chemistry and radiobiology. Some posters on the material science dealing with materials important to nuclear sciences can be also found

The Space Weather Monitor Project: Bringing Hands-on Science to Students of the Developing World for the IHY2007

Science.gov (United States)

Scherrer, D. K.; Rabello-Soares, M. C.; Morrow, C.

2006-08-01

Stanford's Solar Center, Electrical Engineering Department, and local educators have developed inexpensive Space Weather Monitors that students around the world can use to track solar-induced changes to the Earth's ionosphere. Through the United Nations Basic Space Science Initiative (UNBSSI) and the IHY Education and Public Outreach Program, our Monitors are being deployed to 191 countries for the International Heliophysical Year, 2007. In partnership with Chabot Space and Science Center, we are designing and developing classroom and educator support materials to accompany the distribution. Materials will be culturally sensitive and will be translated into the six official languages of the United Nations (Arabic, Chinese, English, French, Russian, and Spanish). Monitors will be provided free of charge to developing nations and can be set up anywhere there is access to power.

Effects of an assimilation of radar and satellite data on a very-short range forecast of heavy convective rainfalls

Czech Academy of Sciences Publication Activity Database

Sokol, Zbyněk

2009-01-01

Roč. 93, 1-3 (2009), s. 188-206 ISSN 0169-8095. [European Conference on Severe Storms /4./. Miramare -Trieste, 10.09.2007-14.09.2007] R&D Projects: GA ČR GA205/07/0905; GA MŠk OC 112; GA MŠk 1P05ME748 Institutional research plan: CEZ:AV0Z30420517 Keywords : Precipitation forecast * NWP model * Assimilation of radar and satellite data * Local convective precipitation Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 1.811, year: 2009 http://www.sciencedirect.com/science/journal/01698095

Transfer of Air Force technical procurement bid set data to small businesses, using CALS and EDI. Summary report. Revision 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-01-10

This report provides a summary of the Air Force CALS Test Network (AFCTN) Test Report Transfer of Air Force Technical Procurement Bid Set Data to Small Businesses, Using CALS and EDI (AFCTN Test Report 94-034, UCRL-ID-118619). It represents a synthesis of the results, conclusions, and recommendations, as well as a more concise presentation of the issues and strategies as viewed from AFCTN`s perspective. This report documents a test transfer of three Air Force technical procurement bid sets to one large and twelve small businesses, using the Department of Defense (DoD) Continuous Acquisition and Life-cycle Support (CALS) and ANSI ASC X12 Electronic Data Interchange (EDI) standards. The main goal of the test was to evaluate the effectiveness of using CALS technical data within the context of the DoD`s EDI-based standard approach to electronic commerce in procurement, with particular emphasis on receipt and use of the data by small contractors. Air Force procurement data was provided by the Sacramento Air Logistics Center at McClellan Air Force Base; the manufacturing participants were selected from among McClellan`s {open_quote}Blue Ribbon{close_quote} contractors, located throughout the United States. The test was sponsored by the Air Force CALS Test Network, headquartered at Wright-Patterson Air Force Base. The test successfully demonstrated the technical feasibility of including CALS MIL-R-28002 (Raster) engineering data in an EDI Specification/Technical Information transaction set (ANSI ASC X12 841) when issuing electronic requests for quotation to small businesses. In many cases, the data was complete enough for the contractor participant to feel comfortable generating a quote.

The EuroSprite2005 Observational Campaign: an example of training and outreach opportunities for CAL young scientists

Directory of Open Access Journals (Sweden)

O. Chanrion

2007-07-01

Full Text Available The four year "Coupling of Atmospheric Layers (CAL" EU FP5 Research Training Network project studied unanswered questions related to transient luminous events (sprites, jets and elves in the upper atmosphere. Consisting of ten scientific work-packages CAL also included intensive training and outreach programmes for the young scientists hired. Educational activities were based on the following elements: national PhD programmes, activities at CAL and other meetings, a dedicated summer school, and two European sprite observational campaigns. The young scientists were strongly involved in the latter and, as an example, the "EuroSprite2005" observational campaign is presented in detail. Some of the young scientists participated in the instrument set-up, others in the campaign logistics, some coordinated the observations, and others gathered the results to build a catalogue. During the four-month duration of this campaign, all of them took turns in operating the system and making their own night observations. The ongoing campaign activities were constantly advertised and communicated via an Internet blog. In summary the campaign required all the CAL young scientists to embark on experimental work, to develop their organisational skills, and to enhance their ability to communicate their activities. The campaign was a unique opportunity to train and strengthen skills that will be an asset to their future careers and, overall, was most successful.

Medical Practitioners Act 2007: the increased medical record burden.

LENUS (Irish Health Repository)

Byrne, D

2010-03-01

New medical record keeping obligations are implemented by the Medical Practitioners Act (2007), effective July 2009. This audit, comprising review of 347 medical entries in 257 charts on one day, investigated compliance with the Act together with the general standard of medical record keeping. The Medical Council requirement was absent all but 3 (0.9%) of entries; there was no unique identifier or signature in 28 (8%) and 135 (39%) of entries respectively. The case for change is discussed.

CRED REA Line Point Intercept Surveys of Benthic Parameter Assessments at Guguan Island, Marianas Archipelago in 2007

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — To support a long-term NOAA Coral Reef Conservation Program (CRCP) for sustainable management and conservation of coral reef ecosystems, from 25 May - 09 June 2007,...

Investigação do método de desenvolvimento de calçados no pólo calçadista do Vale do Rio dos Sinos e Paranhana, no Estado do Rio Grande do Sul

OpenAIRE

Ronise Ferreira dos Santos

2008-01-01

O objetivo desta dissertação foi investigar o método de desenvolvimento de calçados utilizado por profissionais atuantes no Pólo calçadista do Vale do Rio dos Sinos e Paranhana, no Estado do Rio Grande do Sul. O grupo amostrado foi composto por 31 profissionais independentes que atuam para diversas empresas de pequeno, médio e grande porte da região e pelos 11 profissionais do grupo de desenvolvimento de produto de uma empresa de grande porte situada no Pólo. Os dados levantados com a ferrame...

Pressure study of magnetism in (Lu.sub.0.8./sub.Ce.sub.0.2./sub.).sub.2./sub.Fe.sub.17./sub. and Lu.sub.2./sub.Fe.sub.16.5./sub.Ru.sub.0.5./sub. single crystals

Czech Academy of Sciences Publication Activity Database

Andreev, Alexander V.; Kamarád, Jiří; Tereshina, Evgeniya; Komatsubara, T.; Satoh, I.

2008-01-01

Roč. 121, č. 3 (2008), 032010/1-032010/4 ISSN 1742-6588. [Joint AIRAPT /21./ and EHPRG /45./ International Conference on High Pressure Science and Technology. Catania, 17.09.2007-21.09.2007] R&D Projects: GA ČR GA202/06/0178; GA ČR(CZ) GA202/06/0185 Grant - others:GAUK(CZ) 1507/2007 Institutional research plan: CEZ:AV0Z10100520 Keywords : pressure effect * magnetic moment * anisotropy * intermetallic compounds * Fe Subject RIV: BM - Solid Matter Physics ; Magnetism

Windows Calorimeter Control (WinCal) program computer software configuration management plan

International Nuclear Information System (INIS)

1997-01-01

This document describes the system configuration management activities performed in support of the Windows Calorimeter Control (WinCal) system, in accordance with Site procedures based on Institute of Electrical and Electronic Engineers (IEEE) Standard 828-1990, Standard for Software Configuration Management Plans (IEEE 1990) and IEEE Standard 1042-1987, Guide to Software Configuration Management (IEEE 1987)

PREDICATIVE VALUE OF SOME COMMON MOBILITY TESTS CRUCIAL FOR FORMING MARK IN THE PHYiCAL EDUCATION TEACHING

Directory of Open Access Journals (Sweden)

Danijela Bulatović

2007-05-01

Full Text Available Up to the sam ple of 86 stu dents from 5th class of Ele men tary School »Ok to ih« in Pod go ri ca, we ma de re se arch in or der to esta blish the le vel of sta ti sti cal im por tan ce of the com mon mo bi lity tests in fl u en ce for for ming of the physi cal edu ca tion mark. By using of Pir son cor re la ti ve analysis, fol lo wed by the re gres si ve analysis, it was esta blis hed the im por tant mu tual con nec tion bet we en pre di ca ti ve and cri te rion va ri a ble. The co ef fi ci ent of cor re la tion has been spread from the mid dle (MT600= . 488, to the high nu me ri cal va lu es (MSDM =. 735.

The TileCal Online Energy Estimation for the Next LHC Operation Period

CERN Document Server

Peralva, B S; The ATLAS collaboration; Cerqueira, A S; Seixas, J M

2014-01-01

This work presents a study on the TileCal online energy estimation for the next LHC operation period (Run2). Due to hardware limitation, the algorithm that performs the online energy estimation must remain based on the linear and fast Optimal Filter (OF) technique, which envisages the use of the background covariance matrix in its design. During Run1, TileCal made use of an identity matrix to describe and the background covariance matrix, which showed to be a reasonable approximation for the low luminosity scenario. Under such conditions, the background for most of its cells comprised mainly electronic noise which can be approximated as a uncorrelated Gaussian process. However, as the pile-up introduces a non-Gaussian component to the background, the OF method presents larger variance and it becomes biased. The use of the background covariance matrix in the design of the OF weights is expected to improve the energy estimation performance. The results for the scenario considered show that for high occupancy ce...

Patterns of intravenous fluid resuscitation use in adult intensive care patients between 2007 and 2014

DEFF Research Database (Denmark)

Hammond, Naomi E; Taylor, Colman; Finfer, Simon

2017-01-01

BACKGROUND: In 2007, the Saline versus Albumin Fluid Evaluation-Translation of Research Into Practice Study (SAFE-TRIPS) reported that 0.9% sodium chloride (saline) and hydroxyethyl starch (HES) were the most commonly used resuscitation fluids in intensive care unit (ICU) patients. Evidence has e...

Risk of preterm birth by subtype among Medi-Cal participants with mental illness.

Science.gov (United States)

Baer, Rebecca J; Chambers, Christina D; Bandoli, Gretchen; Jelliffe-Pawlowski, Laura L

2016-10-01

Previous studies have demonstrated an association between mental illness and preterm birth (before 37 weeks). However, these investigations have not simultaneously considered gestation of preterm birth, the indication (eg, spontaneous or medically indicated), and specific mental illness classifications. The objective of the study was to examine the likelihood of preterm birth across gestational lengths and indications among Medi-Cal (California's Medicaid program) participants with a diagnostic code for mental illness. Mental illnesses were studied by specific illness classification. The study population was drawn from singleton live births in California from 2007 through 2011 in the birth cohort file maintained by the California Office of Statewide Health Planning and Development, which includes birth certificate and hospital discharge records. The sample was restricted to women with Medi-Cal coverage for prenatal care. Women with mental illness were identified using International Classification of Diseases, ninth revision, codes from their hospital discharge record. Women without a mental illness International Classification of Diseases, ninth revision, code were randomly selected at a 4:1 ratio. Adjusting for maternal characteristics and obstetric complications, relative risks and 95% confidence intervals were calculated for preterm birth comparing women with a mental illness diagnostic code with women without such a code. We identified 6198 women with a mental illness diagnostic code and selected 24,792 women with no such code. The risk of preterm birth in women with a mental illness were 1.2 times higher than women without a mental illness (adjusted relative risk, 1.2, 95% confidence interval, 1.1-1.3). Among the specific mental illnesses, schizophrenia, major depression, and personality disorders had the strongest associations with preterm birth (adjusted relative risks, 2.0, 2.0 and 3.3, respectively). Women receiving prenatal care through California's low

Chemical and Physical Properties of Hi-Cal-2

Science.gov (United States)

Spakowski, A. E.; Allen, Harrison, Jr.; Caves, Robert M.

1955-01-01

As part of the Navy Project Zip to consider various boron-containing materials as possible high-energy fuels, the chemical and physical properties of Hi-Cal-2 prepared by the Callery Chemical Company were evaluated at the NACA Lewis laboratory. Elemental chemical analysis, heat of combustion, vapor pressure and decomposition, freezing point, density, self ignition temperature, flash point, and blow-out velocity were determined for the fuel. Although the precision of measurement of these properties was not equal to that obtained for hydrocarbons, this special release research memorandum was prepared to make the data available as soon as possible.

Hong Kong domestic health spending: financial years 1989/90 to 2008/09.

Science.gov (United States)

Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V

2012-08-01

This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient

Applications of low-density foams for x-ray source studies and laser beam smoothing

Czech Academy of Sciences Publication Activity Database

Limpouch, J.; Renner, Oldřich; Borisenko, N.G.; Klír, D.; Kmetík, Viliam; Krouský, Eduard; Liska, R.; Mašek, Karel; Nazarov, W.; Ullschmied, Jiří

2008-01-01

Roč. 112, 042056 (2008), s. 1-4 ISSN 1742-6588. [The Fifth International Conference on Inertial Fusion Sciences and Applications (IFSA2007). Kobe, 09.09.2007-14.09.2007] R&D Projects: GA MŠk(CZ) LC528; GA ČR GA202/06/0801 Institutional research plan: CEZ:AV0Z10100523; CEZ:AV0Z20430508 Keywords : plasma * x-ray generation * energy transport in plasma * bremsstrahlung * laser-light transmission through inhomogeneous plasma * laser-propagation in undercritical plasma Subject RIV: BL - Plasma and Gas Discharge Physics http://www.iop.org/EJ/article/1742-6596/112/4/042056/jpconf8_112_042056.pdf

Preface: SciDAC 2007

Science.gov (United States)

Keyes, David E.

2007-09-01

community of leading scientists requires networked collaborative environments. Each of these elements is a research and development project in its own right. SciDAC does not replace theoretical programs oriented towards long-term basic research, but harvests them for contemporary, complementary state-of-the-art computational campaigns. By clustering researchers from applications and enabling technologies into coordinated, mission-driven projects, SciDAC accomplishes two ends with remarkable effectiveness: (1) it enriches the scientific perspective of both applications and enabling communities through mutual interaction and (2) it leverages between applications solutions and effort encapsulated in software. Though SciDAC is unique, its objective of multiscale science at extreme computational scale is shared and approached through different programmatic mechanisms, notably NNSA's ASC program, NSF's Cyberinfrastructure program, and DoD's CREATE program in the U.S., and RIKEN's computational simulation programs in Japan. Representatives of each of these programs were given the podium at SciDAC 2007 and communication occurred that will be valuable towards the ends of complementarity, leverage, and promulgation of best practices. The 2007 conference was graced with additional welcome program announcements. Michael Strayer announced a new program of postdoctoral research fellowships in the enabling technologies. (The computer science post-docs will be named after the late Professor Ken Kennedy, who briefly led the SciDAC project Center for Scalable Application Development Software (CScADS) until his untimely death in February 2007.) IBM announced its petascale BlueGene/P system on June 26. Meanwhile, at ISC07 in Dresden, the semi-annual posting of a revised Top 500 list on June 27 showed several new Top 10 systems accessible to various SciDAC participants. While SciDAC is dominated in 2007 by the classical scientific pursuit of understanding through reduction to components and

Final Report Feasibility Study for the California Wave Energy Test Center (CalWavesm) - Volume #2 - Appendices #16-17

Energy Technology Data Exchange (ETDEWEB)

Dooher, Brendan [Pacific Gas and Electric Company, San Ramon, CA (United States). Applied Technical Services; Toman, William I. [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States). Inst. of Advanced Technology and Public Policy; Davy, Doug M. [CH2M Hill Engineers, Inc., Sacramento, CA (United States); Blakslee, Samuel N. [California Polytechnic State Univ. (CalPoly), San Luis Obispo, CA (United States)

2017-07-31

The California Wave Energy Test Center (CalWave) Feasibility Study project was funded over multiple phases by the Department of Energy to perform an interdisciplinary feasibility assessment to analyze the engineering, permitting, and stakeholder requirements to establish an open water, fully energetic, grid connected, wave energy test center off the coast of California for the purposes of advancing U.S. wave energy research, development, and testing capabilities. Work under this grant included wave energy resource characterization, grid impact and interconnection requirements, port infrastructure and maritime industry capability/suitability to accommodate the industry at research, demonstration and commercial scale, and macro and micro siting considerations. CalWave Phase I performed a macro-siting and down-selection process focusing on two potential test sites in California: Humboldt Bay and Vandenberg Air Force Base. This work resulted in the Vandenberg Air Force Base site being chosen as the most favorable site based on a peer reviewed criteria matrix. CalWave Phase II focused on four siting location alternatives along the Vandenberg Air Force Base coastline and culminated with a final siting down-selection. Key outcomes from this work include completion of preliminary engineering and systems integration work, a robust turnkey cost estimate, shoreside and subsea hazards assessment, storm wave analysis, lessons learned reports from several maritime disciplines, test center benchmarking as compared to existing international test sites, analysis of existing applicable environmental literature, the completion of a preliminary regulatory, permitting and licensing roadmap, robust interaction and engagement with state and federal regulatory agency personnel and local stakeholders, and the population of a Draft Federal Energy Regulatory Commission (FERC) Preliminary Application Document (PAD). Analysis of existing offshore oil and gas infrastructure was also performed

The Cal-Bridge Program: Supporting Diverse Graduate Students in Astrophysics

Science.gov (United States)

Smecker-Hane, Tammy A.; Rudolph, Alexander L.; Abazajian, Kevork; Povich, Matthew S.

2018-06-01

The mission of the Cal-Bridge program is to increase the number of underrepresented minority and women students completing a bachelor’s degree and entering a PhD program in astronomy, physics, or closely-related fields. To do so, we have built a network of faculty at diverse higher education institutions, including University of California (UC) campuses, California State Universities (CSUs), and community colleges dedicated to this goal. Students selected for our program are known as Cal-Bridge Scholars, and we give them a wide variety of support: (1) financial scholarships in their junior/senior years at CSU and their first year of graduate school at a UC, (2) intensive mentoring by a pair of CSU and UC faculty members, (3) tutoring, (4) professional development workshops, (5) exposure to research opportunities at various universities, and (6) membership in a growing cohort of like-minded students. In this poster, we report on our work in designing an effective mentoring program and developing tools like our mentoring and graduate application handbooks, and we discuss our tutoring program and the professional development workshops we have designed, and we report on their effectiveness. Funding for this program is provided by NSF-SSTEM Grant #1356133.

Estado da arte do processo produtivo da cal na região Centro Oeste de Minas Gerais

Directory of Open Access Journals (Sweden)

Ricardo Carrasco Carpio

2013-11-01

Full Text Available As indústrias de cal são caracterizadas pelas altas emissões de dióxido de carbono (CO2 na atmosfera. Isto se deve ao fato das indústrias atuarem com tecnologias ultrapassadas, resultando em alto consumo de combustível, baixa eficiências energéticas e grandes impactos ambientais. Para diminuir os danos ambientais causados pela indústria de cal é necessário o conhecimento do processo produtivo, das tecnologias empregadas e dos impactos ambientais. Por essa razão, este trabalho tem por objetivo fazer uma análise do processo produtivo da cal, desde as jazidas até o produto final, mostrando as tecnologias empregadas em cada etapa do processo.Palavras-chave: Indústrias de cal. Processo produtivo. Impacto ambiental.State-of-the-art on the manufacturing process of lime in mid west region of Minas GeraisAbstractThe lime industries are characterized by high emissions of CO2 in the atmosphere. This is because the industries are using outdated technology, resulting in high fuel consumption, low energy efficiencies and high environmental impacts. To reduce the environmental damages caused by the lime industry, it is necessary to know the manufacturing process, the technologies used and the environmental impacts. Therefore this paper aims to analyze the manufacturing process of lime, from the limestone quarries to the final product, showing the technologies used in each step of the process.Keywords: Lime Industries. Manufacturing process. Environmental impact.

Long-term trends in child and youth injury mortality in Taiwan, 1989-2007

Directory of Open Access Journals (Sweden)

Yun-Lin Lu

2015-01-01

Full Text Available Background: Injuries are the leading causes of death and contribute greatly to morbidity in children. Our study examined injuries′ age and gender-specific variations over time among children 0-19, from 1989 to 2007. Materials and Methods: Numbers of deaths caused by injury are drawn from Taiwan′s official Vital Statistics System. Mortality was age-adjusted to the US 2000 standard population. Temporal trends were analyzed by linear regression. Results: Both genders′ annual mortality rates and proportional mortality ratios of unintentional injuries declined significantly during 1989-2007. Conversely, an increasing trend of intentional deaths occurred. In general, during 1992-2007, increasing the rates of suicide deaths in ages 10-19 and of homicide deaths in ages 0-9 occurred. Boys had more suicide deaths than did girls. Conclusions: Unlike unintentional injuries, intentional injuries increased over the 1989-2007 period. Deaths in the subgroups of ages 0-19 and categorized by genders were caused by varying injuries.

JAEA-Tokai tandem annual report 2007. April 1, 2007 - March 31, 2008

International Nuclear Information System (INIS)

Nagame, Yuichiro; Chiba, Satoshi; Ishikawa, Norito; Mitsuoka, Shinichi; Ishii, Tetsuro; Matsuda, Makoto

2008-11-01

The JAEA-Tokai tandem accelerator facility has been used in various research fields of heavy-ion nuclear science and material science not only by JAEA personnel but also by researchers from universities, institutes and companies. This annual report describes a summary of research activities carried out in the period between April 1, 2007 and March 31, 2008. The forty-nine summary reports from users were categorized into seven research/development fields: (1) accelerator operation and development, (2) nuclear structure, (3) nuclear reaction, (4) nuclear chemistry, (5) nuclear theory, (6) atomic physics and solid state physics, (7) radiation effects in materials. Also contained are lists of publications, meetings, technical staff, researchers in JAEA and cooperative researchers with universities. The 49 of the presented papers are indexed individually. (J.P.N.)

Teacher Learning from Girls' Informal Science Experiences

Science.gov (United States)

Birmingham, Daniel J.

2013-01-01

School science continues to fail to engage youth from non-dominant communities (Carlone, Huan-Frank & Webb, 2011). However, recent research demonstrates that informal science learning settings support both knowledge gains and increased participation in science among youth from non-dominant communities (Dierking, 2007; Falk et al., 2007; HFRP,…

[Analysis of funding of projects on obstetrics and gynecology supported by National Natural Science Foundation of China from 2007 to 2016].

Science.gov (United States)

Qin, S H; Huang, Q S; Yao, S Z

2017-04-25

Objective: To summarize the funding of scientific research projects on obstetrics and gynecology by National Natural Science Foundation of China (NSFC) from 2007 to 2016 and to display the hotspots of scientific research on obstetrics and gynecology. Methods: A systemic search was performed for the information of projects supported by NSFC from 2007 to 2016. The indicators for analysis included the number of projects, total investment, project categories, research units and research field. The research direction of each project was decided based on title, summary and key words provided by the profile of each project. Results: The total investment on obstetrics and gynecology by NSFC was 23.214 million with a total of 82 projects in 2007. It increased year by year and reached the peak in 2014 (359 projects 208.990 million). The investment and number of projects remained stable after 2014. General projects (1 109 projects 608.000 million) formed the majority of projects. Youth science fund projects (1 035 projects 214.976 million) increased steadily and the number was nearly equal to general projects. There were only a small amount of key projects (20 projects 54.720 million) and major projects (7 projects 38.400 million). The investment varied in different research units. The greatest 10 units (less than 6% of total), including 7 comprehensive universities, 2 medical universities and 1 institute of medicine, got 1 113 projects invested (43.84% of total, 1 113/2 539). The hot areas like gynecological tumor (920 projects 350.615 million), hypertensive disorders complicating pregnancy (91 projects 37.470 million) and polycystic ovarian syndrome (77 projects 29.540 million) were more likely to receive investment, while some interdisciplinary science like maternal and child health (28 projects 12.050 million), imaging and biomedicine (37 projects 14.770 million) began to achieve attention in recent years. Conclusions: The number of researches invested will be increased

The 3000-4000 cal. BP anthropogenic shift in fire regime in the French Pyrenees.

Science.gov (United States)

Rius, D.; Vannière, B.; Galop, D.; Richard, H.

2009-04-01

Fire is a key disturbing agent in a wide range of ecosystems: boreal biome (Pitkanen, 2000), Mediterranean area (Colombaroli et al., 2008) as well as temperate European mountain zones (Tinner et al., 1999). During the Holocene, climate may control fire regime by both ignition and fire spread-favouring conditions (i.e. composition, structure and moisture of biomass) whereas man may change charcoal accumulation patterns through type and intensity of agro-pastoral activities. In western and Mediterranean Europe, single sites charcoal analysis recorded the anthropogenic forcing over fire regime broadly between the mid and the late-Holocene. Turner et al (2008) showed that climate and fire had been disconnected since 1700 cal. BP in Turkey. In central Swiss, Mean Fire Interval decreased by two times 2000 years ago due to increasing human impact (Stahli et al., 2006). In Italy, climate and man have had a combined influence on fire-hazard since ca 4000 cal. BP (Vannière et al., 2008). In the Pyrenees Mountains, the linkage between agro-pastoral practices and fire could be dated back to ca 4000-3000 cal. BP with a clear succession of a clearance phase (high fire frequency) followed by a quite linear trend throughout Middle Ages and Modern times corresponding to a change in fire use (Vanniere et al., 2001; Galop et al., 2002, Rius et al., in press). The quantification of fire regimes parameters such as frequency with robust methodological tools (Inferred Fire Frequency, Mean Fire Interval) is needed to understand and characterise such shifts. Here we present two sequences from the Lourdes basin (col d'Ech peat bog) and from the occidental Pyrenees (Gabarn peat bog), which cover the last 9000 years with high temporal resolution. The main goals of this study were to (1) assess control factors of fire regime throughout the lateglacial and Holocene (climate and/or man) on the local scale, (2) evidence the local/regional significance of these control factors , (3) discuss the

Empresariado industrial e desenvolvimento socioeconômico: estudo do discurso do empresariado calçadista paulista frente ao mundo globalizado (1995-2010)

OpenAIRE

Guaraldo, Paula D'Andrea [UNESP

2014-01-01

A tese teve como objetivo desenvolver um estudo sobre a fração da classe empresarial brasileira composta pelo empresariado industrial calçadista. A proposta foi conhecer o discurso do empresariado calçadista paulista dos polos produtores calçadistas de Franca, Birigui e Jaú, frente às questões ligadas ao desenvolvimento econômico no contexto globalizado em que se encontra, por meio da análise de suas manifestações públicas em veículos de comunicação voltados ao empresariado nacional sobre o p...

SiPM-based azimuthal position sensor in ANITA-IV Hi-Cal Antarctic balloon experiment

Science.gov (United States)

Novikov, A.; Besson, D.; Chernysheva, I.; Dmitrenko, V.; Grachev, V.; Petrenko, D.; Prohira, S.; Shustov, A.; Ulin, S.; Uteshev, Z.; Vlasik, K.

2017-01-01

Hi-Cal (High-Altitude Calibration) is a balloon-borne experiment that will be launched in December, 2016 in Antarctica following ANITA-IV (Antarctic Impulsive Transient Antenna) and will generate a broad-band pulse over the frequency range expected from radiation induced by a cosmic ray shower. Here, we describe a device based on an array of silicon photomultipliers (SiPMs) for determination of the azimuthal position of Hi-Cal. The angular resolution of the device is about 3 degrees. Since at the float altitude of ˜38 km the pressure will be ˜0.5 mbar and temperature ˜ - 20 °C, the equipment has been tested in a chamber over a range of corresponding pressures (0.5 ÷ 1000) mbar and temperatures (-40 ÷ +50) °C.

SiPM-based azimuthal position sensor in ANITA-IV Hi-Cal Antarctic balloon experiment

International Nuclear Information System (INIS)

Novikov, A; Besson, D; Chernysheva, I; Dmitrenko, V; Grachev, V; Petrenko, D; Shustov, A; Ulin, S; Uteshev, Z; Vlasik, K; Prohira, S

2017-01-01

Hi-Cal (High-Altitude Calibration) is a balloon-borne experiment that will be launched in December, 2016 in Antarctica following ANITA-IV (Antarctic Impulsive Transient Antenna) and will generate a broad-band pulse over the frequency range expected from radiation induced by a cosmic ray shower. Here, we describe a device based on an array of silicon photomultipliers (SiPMs) for determination of the azimuthal position of Hi-Cal. The angular resolution of the device is about 3 degrees. Since at the float altitude of ∼38 km the pressure will be ∼0.5 mbar and temperature ∼ − 20 °C, the equipment has been tested in a chamber over a range of corresponding pressures (0.5 ÷ 1000) mbar and temperatures (−40 ÷ +50) °C. (paper)

The International Year of Planet Earth (2007-2009):Earth Sciences for Society

Institute of Scientific and Technical Information of China (English)

Eduardo F.J.de Mulder; Ted Nield; Edward Derbyshire

2006-01-01

Natural disasters like the 2004 tsunami bear graphic testimony to the Earth's incredible power. More effective use of geoscientific knowledge can save lives and protect property. Such knowledge also enables us to satisfy, in a sustainable manner,the growing need for Earth's resources by an expanding human population. Such knowledge is readily available in the practical experience and publications of some half a million Earth scientists all over the world, a professional community that is ready and willing to contribute to a safer, healthier and wealthier society if called upon by politicians and decision makers. Professional guidance by Earth scientists is available in many aspects of everyday life including, for example, identification of the best areas for urban expansion, sites to avoid for waste disposal, the location of new underground fresh water resources, and where certain toxic agents implicated in Earth-related diseases may be located, etc.The International Year of Planet Earth (2007-2009) aims to build on existing knowledge and make it more available for the improvement of everyday life, especially in the less developed countries, as expressed in the Year's subtitle: Earth sciences for Society. Ambitious outreach and science programmes constitute the backbone of the International Year, now politically endorsed by all 191 member states of the United Nations Organisation which has proclaimed 2008, the central year of the triennium, as the UN Year of Planet Earth. This paper describes who is behind the initiative,how it will work, and how the political process leading to United Nations proclamation proceeded. It also describes the financial and organisational aspects of the International Year, sets out the commitments necessary for the realization of the Year's ambitions by all nations, and explains how the raising of US$ 20 million will be approached.

The Adaptation Study of the Questionnaires of the Attitude towards CALL (A-CALL), the Attitude towards CAL (A-CAL), the Attitude towards Foreign Language Learning (A-FLL) to Turkish Language

Science.gov (United States)

Erdem, Cahit; Saykili, Abdullah; Kocyigit, Mehmet

2018-01-01

This study primarily aims to adapt the Foreign Language Learning (FLL), Computer assisted Learning (CAL) and Computer assisted Language Learning (CALL) scales developed by Vandewaetere and Desmet into Turkish context. The instrument consists of three scales which are "the attitude towards CALL questionnaire" ("A-CALL")…

A Lactose-Binding Lectin from the Marine Sponge Cinachyrella Apion (Cal) Induces Cell Death in Human Cervical Adenocarcinoma Cells

Science.gov (United States)

Rabelo, Luciana; Monteiro, Norberto; Serquiz, Raphael; Santos, Paula; Oliveira, Ruth; Oliveira, Adeliana; Rocha, Hugo; Morais, Ana Heloneida; Uchoa, Adriana; Santos, Elizeu

2012-01-01

Cancer represents a set of more than 100 diseases, including malignant tumors from different locations. Strategies inducing differentiation have had limited success in the treatment of established cancers. Marine sponges are a biological reservoir of bioactive molecules, especially lectins. Several animal and plant lectins were purified with antitumor activity, mitogenic, anti-inflammatory and antiviral, but there are few reports in the literature describing the mechanism of action of lectins purified from marine sponges to induce apoptosis in human tumor cells. In this work, a lectin purified from the marine sponge Cinachyrella apion (CaL) was evaluated with respect to its hemolytic, cytotoxic and antiproliferative properties, besides the ability to induce cell death in tumor cells. The antiproliferative activity of CaL was tested against HeLa, PC3 and 3T3 cell lines, with highest growth inhibition for HeLa, reducing cell growth at a dose dependent manner (0.5–10 µg/mL). Hemolytic activity and toxicity against peripheral blood cells were tested using the concentration of IC50 (10 µg/mL) for both trials and twice the IC50 for analysis in flow cytometry, indicating that CaL is not toxic to these cells. To assess the mechanism of cell death caused by CaL in HeLa cells, we performed flow cytometry and western blotting. Results showed that lectin probably induces cell death by apoptosis activation by pro-apoptotic protein Bax, promoting mitochondrial membrane permeabilization, cell cycle arrest in S phase and acting as both dependent and/or independent of caspases pathway. These results indicate the potential of CaL in studies of medicine for treating cancer. PMID:22690140

A Lactose-Binding Lectin from the Marine Sponge Cinachyrella Apion (Cal Induces Cell Death in Human Cervical Adenocarcinoma Cells

Directory of Open Access Journals (Sweden)

Adriana Uchoa

2012-03-01

Full Text Available Cancer represents a set of more than 100 diseases, including malignant tumors from different locations. Strategies inducing differentiation have had limited success in the treatment of established cancers. Marine sponges are a biological reservoir of bioactive molecules, especially lectins. Several animal and plant lectins were purified with antitumor activity, mitogenic, anti-inflammatory and antiviral, but there are few reports in the literature describing the mechanism of action of lectins purified from marine sponges to induce apoptosis in human tumor cells. In this work, a lectin purified from the marine sponge Cinachyrella apion (CaL was evaluated with respect to its hemolytic, cytotoxic and antiproliferative properties, besides the ability to induce cell death in tumor cells. The antiproliferative activity of CaL was tested against HeLa, PC3 and 3T3 cell lines, with highest growth inhibition for HeLa, reducing cell growth at a dose dependent manner (0.5–10 µg/mL. Hemolytic activity and toxicity against peripheral blood cells were tested using the concentration of IC50 (10 µg/mL for both trials and twice the IC50 for analysis in flow cytometry, indicating that CaL is not toxic to these cells. To assess the mechanism of cell death caused by CaL in HeLa cells, we performed flow cytometry and western blotting. Results showed that lectin probably induces cell death by apoptosis activation by pro-apoptotic protein Bax, promoting mitochondrial membrane permeabilization, cell cycle arrest in S phase and acting as both dependent and/or independent of caspases pathway. These results indicate the potential of CaL in studies of medicine for treating cancer.

The Cal-Bridge Program: Increasing the Gender and Ethnic Diversity of Astrophysics Students in Southern California

Science.gov (United States)

Smecker-Hane, Tammy A.; Rudolph, Alexander L.

2016-06-01

The mission of the Cal-Bridge program is to increase the number of underrepresented minority and women students completing a bachelor’s degree and entering a PhD program in astronomy, physics, or closely-related fields. The program has created a network of faculty at diverse higher education institutions, including 5 University of California (UC) campuses, 9 California State Universities (CSUs), and 10 community colleges in southern California, dedicated to this goal. Students selected for the program are know as “Cal-Bridge Scholars” and they are given a wide variety of support: (1) scholarships in their junior/senior years at CSU and their first year of graduate school at a UC, (2) intensive mentoring by a pair of CSU and UC faculty members, (3) tutoring, when needed, (4) professional development workshops, (5) exposure to research opportunities at various universities, and (6) membership in a growing cohort of like-minded students. We report on the structure of our program, lessons learned with our current 12 Cal-Bridge scholars, and the results of our first two years of operation. Funding for this program is provided by NSF-SSTEM Grant #1356133.

EDS'09: 13th International Conference on Elastic & Diffractive Scattering

CERN Document Server

CERN. Geneva

2009-01-01

The series of International Conferences on Elastic and Diffractive Scattering was founded in 1985 in the picturesque old French town of Blois, famous for its XIV - XVIIth century château, inside of which the first meeting took place. Since then, meetings have been organised every two years in different places of the world: New York (1987), Evanston (1989), Isola d'Elba (1991), Providence (1993), Blois (1995), Seoul (1997), Protvino (1999), Prague (2001), Helsinki (2003), Blois (2005) and Hamburg (2007). The conference will focus on the most recent experimental and theoretical results in particle physics with an emphasis on Quantum Chromodynamics (QCD). http://cern.ch/eds09/ The conference agenda is now full. No further contributions can be accepted.

Anomalies of hydrological cycle components during the 2007 heat wave in Bulgaria

Science.gov (United States)

Mircheva, Biliana; Tsekov, Milen; Meyer, Ulrich; Guerova, Guergana

2017-12-01

Heat waves have large adverse social, economic and environmental effects which include increased mortality, transport restrictions and a decreased agricultural production. The estimated economic losses of the 2007 heat wave in South-east Europe exceed 2 billion EUR with 19 000 hospitalisation in Romania only. Understanding the changes of the hydrological cycle components is essential for early forecasting of heat wave occurrence. Valuable insight of two components of the hydrological cycle, namely Integrated Water Vapour (IWV) and Terrestrial Water Storage Anomaly (TWSA), is now possible using observations from Global Navigation Satellite System (GNSS) and Gravity Recovery And Climate Experiment (GRACE) mission. In this study anomalies of temperature, precipitation, IWV and TWS in 2007 are compared to 2003-2013 period for Sofia, Bulgaria. In 2007, positive temperature anomalies are observed in January, February and July. There are negative IWV and precipitation anomalies in July 2007 that coincides with the heat wave in Bulgaria. TWSA in 2007 are negative in January, May and from July to October being largest in August. Long-term trends of: 1) temperatures have a local maximum in March 2007, 2) TWSA has a local minimum in May 2007, 3) IWV has a local minimum in September 2007, and 4) precipitation has a local maximum in July 2007. The TWSA interannual trends in Bulgaria, Hungary and Poland show similar behaviour as indicated by cross correlation coefficients of 0.9 and 0.7 between Bulgaria and Hungary and Bulgaria and Poland respectively. ALADIN-Climate describes the anomalies of temperature and IWV more successfully than those of precipitation and TWS.

Hypervelocity impact technology and applications: 2007.

Energy Technology Data Exchange (ETDEWEB)

Reinhart, William Dodd; Chhabildas, Lalit C. (Air Force Research Laboratory, AFRL/RWMW, Eglin AFB, FL)

2008-07-01

The Hypervelocity Impact Society is devoted to the advancement of the science and technology of hypervelocity impact and related technical areas required to facilitate and understand hypervelocity impact phenomena. Topics of interest include experimental methods, theoretical techniques, analytical studies, phenomenological studies, dynamic material response as related to material properties (e.g., equation of state), penetration mechanics, and dynamic failure of materials, planetary physics and other related phenomena. The objectives of the Society are to foster the development and exchange of technical information in the discipline of hypervelocity impact phenomena, promote technical excellence, encourage peer review publications, and hold technical symposia on a regular basis. It was sometime in 1985, partly in response to the Strategic Defense Initiative (SDI), that a small group of visionaries decided that a conference or symposium on hypervelocity science would be useful and began the necessary planning. A major objective of the first Symposium was to bring the scientists and researchers up to date by reviewing the essential developments of hypervelocity science and technology between 1955 and 1985. This Symposia--HVIS 2007 is the tenth Symposium since that beginning. The papers presented at all the HVIS are peer reviewed and published as a special volume of the archival journal International Journal of Impact Engineering. HVIS 2007 followed the same high standards and its proceedings will add to this body of work.

Obituary: Earle B. Mayfield (1923-2007)

Science.gov (United States)

Chapman, Gary

2011-12-01

Earle B. Mayfield passed away peacefully in his sleep 28 May 2007 in Los Osos, near San Luis Obispo. He retired there to grow orchids, make wine and teach part-time at California Polytechnic University, San Luis Obispo (Cal Poly SLO). He was born in Oklahoma City in 1923. After his discharge from the Coast Guard he went to UCLA where he graduated in physics in 1950. He married Peggy Masterson in 1952 after they met while they both worked at the China Lake Test Station. He obtained a Ph.D. in physics in 1959 from the University of Utah. He is survived by his wife, seven children and 14 grandchildren. In 1960 Mayfield joined The Aerospace Corporation where he became a strong proponent of expanding the Corporation's activities in solar research. In 1966, with Mayfield's support, observations of supergranulation were obtained from Thule, Greenland, that spanned nearly 62 hours of continuous coverage: the longest continuous solar observations at that time. He was instrumental in the effort to design and construct an advanced 24-inch aperture vacuum solar telescope. The resulting diffraction limited image had an un-vignetted field-of-view of about 0.8 Re. An auxiliary 11-inch vacuum telescope was available for full-disk observations. Both telescopes were F/20 with reflecting surfaces having proprietary overcoated silver. At the Coude focus was a vacuum spectroheliograph. It was determined that a peninsula jutting out into the Upper Van Norman Reservoir provided superior seeing conditions that was the site of an U.S. Air Force Air Weather Service station. This became the San Fernando Observatory, which was dedicated in February 1969 just before an ad hoc meeting of the Solar Physics Division in Pasadena. Mayfield was its first director. In 1971, under Mayfield's direction, Aerospace developed the first digital video magnetograph supported by a NASA grant. This provided real-time magnetograms of solar active regions. In 1973, James Underwood came to Aerospace and the

A PROPOSITO DE UN ENSAYO CON ABONOS (cal y harina de huesos EN ALFALFAl (Medicago sativa

Directory of Open Access Journals (Sweden)

Isidoro Mogilner

1960-01-01

Full Text Available En este trabajo, los autores estudian el efecto que sobre el rendimiento de la alfalfa (Medicago sativa produce la incorporación de diferentes dosis de cal y harina de huesos, en un suelo pobre de P y Ca; de una textura pesada con alto contenido de arcilla en todos los horizontes, de un pH ácido (5.1 a 6.2 y que es característico de la zona donde fué hecha la experiencia.Se han obtenido resultados referentes a la influencia de la inoculación de la semilla con Rhizobium y el agregado de cal y harina de huesos sobre los rendimientos.

Annual report of R and D activities in Center for Computational Science and e-Systems from April 1, 2006 to March 31, 2007

International Nuclear Information System (INIS)

2008-03-01

This report provides an overview of the research and development activities of the Center for Computational Science and e-Systems (CCSE), JAEA in fiscal year 2006 (April 1, 2006 - March 31, 2007). These research and development activities have been performed by the Simulation Technology Research and Development Office and the Computer Science Research and Development Office. The primary results of the research and development activities are the development of simulation techniques for a virtual earthquake testbed, an intelligent infrastructure for atomic energy research, computational biological disciplines to predict DNA repair function of protein, and material models for a neutron detection device, crack propagation, and gas bubble formation in nuclear fuel. (author)

The TileCal Online Energy Estimation for the Next LHC Operation Period

Science.gov (United States)

Sotto-Maior Peralva, B.; ATLAS Collaboration

2015-05-01

The ATLAS Tile Calorimeter (TileCal) is the detector used in the reconstruction of hadrons, jets and missing transverse energy from the proton-proton collisions at the Large Hadron Collider (LHC). It covers the central part of the ATLAS detector (|η| occupancy, the pile-up, which is often modeled by a non-Gaussian distribution, can be seen as outlier events. Consequently, the classical covariance matrix estimation does not describe correctly the second order statistics of the background for the majority of the events, as this approach is very sensitive to outliers. As a result, the OF (or MF) coefficients are miscalculated leading to a larger variance and biased energy estimator. This work evaluates the usage of a robust covariance estimator, namely the Minimum Covariance Determinant (MCD) algorithm, to be applied in the OF design. The goal of the MCD estimator is to find a number of observations whose classical covariance matrix has the lowest determinant. Hence, this procedure avoids taking into account low likelihood events to describe the background. It is worth mentioning that the background covariance matrix as well as the OF coefficients for each TileCal channel are computed offline and stored for both online and offline use. In order to evaluate the impact of the MCD estimator on the performance of the OF, simulated data sets were used. Different average numbers of interactions per bunch crossing and bunch spacings were tested. The results show that the estimation of the background covariance matrix through MCD improves significantly the final energy resolution with respect to the identity matrix which is currently used. Particularly, for high occupancy cells, the final energy resolution is improved by more than 20%. Moreover, the use of the classical covariance matrix degrades the energy resolution for the majority of TileCal cells.

Hawk-I - First results from science verification

NARCIS (Netherlands)

Kissler-Patig, M.; Larsen, S.S.|info:eu-repo/dai/nl/304833347; Wehner, E.M.|info:eu-repo/dai/nl/314114688

2008-01-01

The VLT wide-field near-infrared imager HAWK-I was commissioned in 2007 and Science Verification (SV) programmes were conducted in August 2007. A selection of results from among the twelve Science Verfication proposals are summarised.

The "Next Generation Science Standards" and the Life Sciences

Science.gov (United States)

Bybee, Rodger W.

2013-01-01

Publication of the "Next Generation Science Standards" will be just short of two decades since publication of the "National Science Education Standards" (NRC 1996). In that time, biology and science education communities have advanced, and the new standards will reflect that progress (NRC 1999, 2007, 2009; Kress and Barrett…

CalFitter: a web server for analysis of protein thermal denaturation data.

Science.gov (United States)

Mazurenko, Stanislav; Stourac, Jan; Kunka, Antonin; Nedeljkovic, Sava; Bednar, David; Prokop, Zbynek; Damborsky, Jiri

2018-05-14

Despite significant advances in the understanding of protein structure-function relationships, revealing protein folding pathways still poses a challenge due to a limited number of relevant experimental tools. Widely-used experimental techniques, such as calorimetry or spectroscopy, critically depend on a proper data analysis. Currently, there are only separate data analysis tools available for each type of experiment with a limited model selection. To address this problem, we have developed the CalFitter web server to be a unified platform for comprehensive data fitting and analysis of protein thermal denaturation data. The server allows simultaneous global data fitting using any combination of input data types and offers 12 protein unfolding pathway models for selection, including irreversible transitions often missing from other tools. The data fitting produces optimal parameter values, their confidence intervals, and statistical information to define unfolding pathways. The server provides an interactive and easy-to-use interface that allows users to directly analyse input datasets and simulate modelled output based on the model parameters. CalFitter web server is available free at https://loschmidt.chemi.muni.cz/calfitter/.

The TileCal Energy Reconstruction for LHC Run2 and Future Perspectives

CERN Document Server

Seixas, Jose; The ATLAS collaboration

2015-01-01

The Tile Calorimeter (TileCal) is the main hadronic calorimeter of ATLAS and it covers the central part of the detector (|η|<1.6). The energy deposited by the particles in TileCal is read out by approximately 10,000 channels. The signal provided by the readout electronics for each channel is digitized at 40 MHz and its amplitude is estimated by an optimal filtering algorithm. The increase of LHC luminosity leads to signal pile-up that deforms the signal of interest and compromises the amplitude estimation performance. This work presents the proposed algorithm for energy estimation during LHC Run 2. The method is based on the same approach used during LHC Run 1, namely the Optimal Filter (OF). The only difference is that the signal baseline (pedestal) will be subtracted from the received digitized samples, while in Run 1 this quantity was estimated on an event-by-event basis. The pedestal value is estimated through special calibration runs and it is stored in a data base for online and offline usage. Addit...

The TileCal Energy Reconstruction for LHC Run2 and Future Perspectives

CERN Document Server

INSPIRE-00517880

2015-01-01

The TileCal is the main hadronic calorimeter of ATLAS and it covers the central part of the detector ($|\\eta|$ < 1.6). The energy deposited by the particles in TileCal is read out by approximately 10,000 channels. The signal provided by the readout electronics for each channel is digitized at 40 MHz and its amplitude is estimated by an optimal filtering algorithm. The increase of LHC luminosity leads to signal pile-up that deforms the signal of interest and compromises the amplitude estimation performance. This work presents the proposed algorithm for energy estimation during LHC Run 2. The method is based on the same approach used during LHC Run 1, namely the Optimal Filter. The only difference is that the signal baseline (pedestal) will be subtracted from the received digitized samples, while in Run 1 this quantity was estimated on an event-by-event basis. The pedestal value is estimated through special calibration runs and it is stored in a data base for online and offline usage. Additionally, the backg...

The TileCal Energy Reconstruction for LHC Run2 and Future Perspectives

CERN Document Server

Seixas, Jose; The ATLAS collaboration

2015-01-01

The Tile Calorimeter (TileCal) is the main hadronic calorimeter of ATLAS and it covers the central part of the detector (|eta|<1.6). The energy deposited by the particles in TileCal is read out by approximately 10,000 channels. The signal provided by the readout electronics for each channel is digitized at 40 MHz and its amplitude is estimated by an optimal filtering algorithm. The increase of LHC luminosity leads to signal pile-up that deforms the signal of interest and compromises the amplitude estimation performance. This work presents the proposed algorithm for energy estimation during LHC Run 2. The method is based on the same approach used during LHC Run 1, namely the Optimal Filter (OF). The only difference is that the signal baseline (pedestal) will be subtracted from the received digitized samples, while in Run 1 this quantity was estimated on an event-by-event basis. The pedestal value is estimated through special calibration runs and it is stored in a data base for online and offline usage. Addi...

The TileCal Online Energy Estimation for the Next LHC Operation Period

CERN Document Server

Peralva, B S; The ATLAS collaboration

2014-01-01

The ATLAS Tile Calorimeter (TileCal) is the detector used in the reconstruction of hadrons, jets, muons and missing transverse energy from the proton-proton collisions at the Large Hadron Collider (LHC). It covers the central part of the ATLAS detector (|η|<1.6). The energy deposited by the particles is read out by approximately 5,000 cells, with double readout channels. The signal provided by the readout electronics for each channel is digitized at 40 MHz and its amplitude is estimated by an optimal filtering algorithm, which expects a single signal with a well-defined shape. However, the LHC luminosity is expected to increase leading to signal pile-up that deforms the signal of interest. Due to limited resources, the current DSP-based hardware setup does not allow the implementation of sophisticated energy estimation methods that deal with the pile-up. Therefore, the technique to be employed for online energy estimation in TileCal for next LHC operation period must be based on fast filters such as the M...

Supersoft X-Ray Source CAL 83: A Possible AE Aqr-like System

Directory of Open Access Journals (Sweden)

A. Odendaal

2015-02-01

Full Text Available CAL83 is a close binary supersoft X-ray source in the Large Magellanic Cloud. A ~67 s periodicity detected in supersoft X-rays is most probably associated with the spin period of a highly spun-up white dwarf (WD. The variability in the period is ascribed to the obscuration of the WD by the hydrogen burning envelope surrounding it, rotating with a period that is close to, but not quite synchronized with, the WD rotation period. Optical spectra obtained with SALT exhibit accretion disc emission lines with broad wing structures and P Cyg profiles, indicating mass outflows. Timing analysis of photometrical observations performed at the South African Astronomical Observatory (SAAO revealed variable signals at ≤1 mHz which are thought to be associated with quasi-periodic oscillations from an accretion disc. The short spin period inferred for CAL83 can be the result of spin-up by accretion disc torques during a long mass transfer history, placing this source on a similar evolutionary track as the cataclysmic variable AE Aqr.

Undergraduate Education with the WIYN 0.9-m Telescope

Science.gov (United States)

Pilachowski, Catherine A.

2017-01-01

Several models have been explored at Indiana University Bloomington for undergraduate student engagement in astronomy using the WIYN 0.9-m telescope at Kitt Peak. These models include individual student research projects using the telescope, student observations as part of an observational techniques course for majors, and enrichment activities for non-science majors in general education courses. Where possible, we arrange for students to travel to the telescope. More often, we are able to use simple online tools such as Skype and VNC viewers to give students an authentic observing experience. Experiences with the telescope motivate students to learn basic content in astronomy, including the celestial sphere, the electromagnetic spectrum, telescopes and detectors, the variety of astronomical objects, date reduction processes, image analysis, and color image creation and appreciation. The WIYN 0.9-m telescope is an essential tool for our program at all levels of undergraduate education

Does the Polynomial Hierarchy Collapse if Onto Functions are Invertible?

Czech Academy of Sciences Publication Activity Database

Buhrman, H.; Fortnow, L.; Koucký, Michal; Rogers, J.D.; Vereshchagin, N.K.

2010-01-01

Roč. 46, č. 1 (2010), s. 143-156 ISSN 1432-4350. [2nd International Computer Science Symposium in Russia ( CSR 2007). Ekaterinburg, 03.09.2007-07.09.2007] R&D Projects: GA ČR GP201/07/P276; GA MŠk(CZ) 1M0545 Institutional research plan: CEZ:AV0Z10190503 Keywords : one-way functions * polynomial hierarchy * Kolmogorov generic oracles Subject RIV: BA - General Mathematics Impact factor: 0.600, year: 2010 http://link.springer.com/article/10.1007%2Fs00224-008-9160-8

Sedimentary Evidence for a Rapid Sea Level Rise at 7,600 cal yr BP from North-Central Cuba

Science.gov (United States)

Peros, M. C.; Agosta G'meiner, A. M.; Collins, S.

2016-12-01

A lack of high-resolution relative sea level (RSL) proxy data has meant that the pattern of early Holocene RSL change in the Caribbean is poorly understood. A RSL curve published by Toscano and Macintyre (2003) using inter-tidal mangrove peats and submerged corals suggests RSL underwent a relatively fast and `smooth' curvilinear increase during the Holocene. However, others, such as Blanchon and Shaw (1995), suggest that RSL increased rapidly at around 7600 cal yr BP, in response to the final stages of the melting of the Laurentide Ice Sheet (melt water pulse 1C or catastrophic rise event 3). We investigated this question using multi-proxy data from a flooded sinkhole (Cenote Jennifer) on the north coast of central Cuba. Cenote Jennifer is located 7 m above mean sea level and 2 km from the Bahamas Channel and appears to have a high degree of connectivity with the ocean through a network of underground caverns. The water depth is 13 m and the bottommost 5 m is anoxic. A sediment core collected from Cenote Jennifer was studied using loss-on-ignition, pollen analysis, high-resolution XRF core-scanning, and grain size analysis. An age-depth model was generated for the core by AMS dating. The results show that the bottommost stratigraphic unit ( 9000 to 7600 cal yr BP) is a fine-grained carbonate-rich mud (i.e., marl). This unit abruptly transitions into finely laminated organic-rich sediment from 7600 cal yr BP to the present. The pollen analysis shows that the sinkhole supported a cattail (Typha) community until 7600 cal yr BP, indicating low water levels ( 1 m). At 7600 cal yr BP, the cattail community disappeared and the vegetation of the surrounding bedrock became dominated by a thorny coastal scrubland. In addition, a 3 cm thick fining-upward siliciclastic unit is present immediately above the marl-organic contact, suggesting: 1) a marine sediment source given the limestone-dominated nature of the region, and 2) the presence of a short-duration, high

Progress toward studies of bubble-geometry Bose-Einstein condensates in microgravity with a ground-based prototype of NASA CAL

Science.gov (United States)

Lundblad, Nathan; Jarvis, Thomas; Paseltiner, Daniel; Lannert, Courtney

2016-05-01

We have proposed using NASA's Cold Atom Laboratory (CAL, launching to the International Space Station in 2017) to generate bubble-geometry Bose-Einstein condensates through radiofrequency dressing of an atom-chip magnetic trap. This geometry has not been truly realized terrestrially due to the perturbing influence of gravity, making it an ideal candidate for microgravity investigation aboard CAL. We report progress in the construction of a functional prototype of the orbital BEC apparatus: a compact atom-chip machine loaded by a 2D+MOT source, conventional 3D MOT, quadrupole trap, and transfer coil. We also present preliminary modeling of the dressed trap uniformity, which will crucially inform the geometric closure of the BEC shell surface as atom number, bubble radius, and bubble aspect ratio are varied. Finally, we discuss plans for experimental sequences to be run aboard CAL guided by intuition from ground-based prototype operation. JPL 1502172.

Complex Treatment of Soils, Waste Water and Groundwater Contaminated by Halogenated Organic Compounds.

Czech Academy of Sciences Publication Activity Database

Kaštánek, František; Maléterová, Ywetta; Kaštánek, P.; Rott, J.; Jiřičný, Vladimír; Jirátová, Květa

2007-01-01

Roč. 211, č. 1-3, (2007) , s. 261-271 ISSN 0011-9164. [Environmental Science and Technology Symposium /9./. Rhodes, 01.09.2005-03.09.2005] R&D Project s: GA ČR(CZ) GA104/03/0407; GA MPO FI-IM3/050 Institutional research plan: CEZ:AV0Z40720504 Keywords : vinyl chloride * waste and underground water * fenton reaction Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 0.875, year: 2007

Organic Aerosol Composition and Sources in Pasadena, California during the 2010 CalNex Campaign

Science.gov (United States)

Organic aerosols (OA) in Pasadena are characterized using multiple measurements from the California Research at the Nexus of Air Quality and Climate Change (CalNex) campaign. Five OA components are identified using positive matrix factorization including hydrocarbon-like OA (HOA) ...

Time-domain electromagnetic soundings collected in Dawson County, Nebraska, 2007-09

Science.gov (United States)

Payne, Jason; Teeple, Andrew

2011-01-01

Between April 2007 and November 2009, the U.S. Geological Survey, in cooperation with the Central Platte Natural Resources District, collected time-domain electro-magnetic (TDEM) soundings at 14 locations in Dawson County, Nebraska. The TDEM soundings provide information pertaining to the hydrogeology at each of 23 sites at the 14 locations; 30 TDEM surface geophysical soundings were collected at the 14 locations to develop smooth and layered-earth resistivity models of the subsurface at each site. The soundings yield estimates of subsurface electrical resistivity; variations in subsurface electrical resistivity can be correlated with hydrogeologic and stratigraphic units. Results from each sounding were used to calculate resistivity to depths of approximately 90-130 meters (depending on loop size) below the land surface. Geonics Protem 47 and 57 systems, as well as the Alpha Geoscience TerraTEM, were used to collect the TDEM soundings (voltage data from which resistivity is calculated). For each sounding, voltage data were averaged and evaluated statistically before inversion (inverse modeling). Inverse modeling is the process of creating an estimate of the true distribution of subsurface resistivity from the mea-sured apparent resistivity obtained from TDEM soundings. Smooth and layered-earth models were generated for each sounding. A smooth model is a vertical delineation of calculated apparent resistivity that represents a non-unique estimate of the true resistivity. Ridge regression (Interpex Limited, 1996) was used by the inversion software in a series of iterations to create a smooth model consisting of 24-30 layers for each sounding site. Layered-earth models were then generated based on results of smooth modeling. The layered-earth models are simplified (generally 1 to 6 layers) to represent geologic units with depth. Throughout the area, the layered-earth models range from 2 to 4 layers, depending on observed inflections in the raw data and smooth model

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Biman Jana. Articles written in Journal of Chemical Sciences. Volume 119 Issue 5 September 2007 pp 343-350. Orientational dynamics and energy landscape features of thermotropic liquid crystals: An analogy with supercooled liquids · Biman Jana Biman Bagchi.

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. SRABANI TARAPHDER. Articles written in Journal of Chemical Sciences. Volume 119 Issue 5 September 2007 pp 545-552. Effect of electrostatic interactions on the formation of proton transfer pathways in human carbonic anhydrase II · Arijit Roy Srabani Taraphder.

Análisis bibliométrico de la producción científica de la Universidad de Málaga en el Social Sciences Citation Index (1998-2007

Directory of Open Access Journals (Sweden)

Maz-Machado, Alexander

2010-12-01

Full Text Available A bibliometric analysis was performed of the scholarly production of the University of Malaga published during 1998-2007 in journals indexed in the Social Sciences Citation Index (as accessed through the Web of Science. This paper examines productivity and chronological distribution, national and international collaboration, scientifi c production by departments, and the journals in which articles were published. The results reveal a slight increase in productivity, as well as a slightly higher level of co-authorship (2.85 than the average for social sciences in Spain, along with a good level of collaboration with national and foreign academic institutions.

Se realiza un análisis bibliométrico de la producción de la Universidad de Málaga durante el período 1998-2007 en las revistas indexadas en el Social Sciences Citation Index, accediendo a la base de datos a través de la Web of Science. Se ha estudiado la productividad y la distribución temporal, la colaboración nacional e internacional, la producción científi ca por facultades y las revistas en las que se publican los artículos. Los resultados revelan un leve incremento en la productividad, así como un grado de coautoría (2,85 ligeramente superior al establecido para las Ciencias Sociales en España y un buen nivel de colaboración con instituciones universitarias nacionales y extranjeras.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Articles written in Bulletin of Materials Science. Volume 30 Issue 4 August 2007 pp 301-308 Biomaterials. Adhesive B-doped DLC films on ... Volume 30 Issue 4 August 2007 pp 407-413 Alloys and Steels. Structural phase transitions and piezoelectric anomalies in ordered Sc0.5Ga0.5N alloys · A M Alsaad A A Ahmad.

THE MAY 23TH 2007 GULF OF MEXICO EARTHQUAKE

Science.gov (United States)

Yamamoto, J.; Jimenez, Z.

2009-12-01

On the 23th of May 2007 at 14:09 local time (19:09 UT) an insolated earthquake of local magnitude 5.2 occurred offshore northern Veracruz in the Gulf of Mexico. The seismic focus was located using local and regional data at 20.11° N, 97.38° W and 7.8 km depth at 175 km distance from Tuxpan a city of 134,394 inhabitants. The earthquake was widely felt along the costal states of southern Tamaulipas and Veracruz in which several schools and public buildings were evacuated. Neither Laguna Verde nuclear plant, located approximately 245 km from the epicenter, nor PEMEX petroleum company reported damage. First-motion data indicates that the rupture occurred as strike slip faulting along two possible planes, one oriented roughly north-south and the other east-west. In the present paper a global analysis of the earthquake is made to elucidate its origin and possible correlation with known geotectonic features of the region.

Recent trends in television tip over-related injuries among children aged 0-9 years.

Science.gov (United States)

Murray, K J; Griffin, R; Rue, L W; McGwin, G

2009-08-01

To describe recent trends in television tip over-related injuries among children aged 0-9 years, and to compare injury rates with sales of newer digital televisions. Digital television sales data were obtained from marketing data provided by the Television Bureau of Advertising. Data regarding television tip over-related injuries among children aged 0-9 years were obtained from the 1998-2007 National Electronic Injury Surveillance System. A Wald chi(2) test, estimated from logistic analysis, was used to determine whether the distribution of injury types differed by age group. Pearson's correlation was used to estimate the association between digital television sales and television tip over-related injuries. An estimated 42 122 (95% CI 35 199 to 49 122) injuries from television tip-overs were treated in US emergency departments from 1998 to 2007. The injury rate was highest for children aged 1-4 years (18.6/100 000). A majority of injuries (63.9%) involved the head and neck for children under 1 year of age, while a higher proportion of injuries among children aged 1-4 involved the hip and lower extremity (42.9% and 31.0%, respectively), and shoulder and upper extremity (16.8%) for children aged 5-9. A strong, positive correlation was observed between television sales and annual injury rates (r = 0.89, pdigital television sales were strongly correlated with increased injury rates, the lack of information regarding the type of television involved prevents inference regarding causation.

CalMagNet – an array of search coil magnetometers monitoring ultra low frequency activity in California

Directory of Open Access Journals (Sweden)

C. Dunson

2008-04-01

Full Text Available The California Magnetometer Network (CalMagNet consists of sixty-eight triaxial search-coil magnetometer systems measuring Ultra Low Frequency (ULF, 0.001–16 Hz, magnetic field fluctuations in California. CalMagNet provides data for comprehensive multi-point measurements of specific events in the Pc 1–Pc 5 range at mid-latitudes as well as a systematic, long-term study of ULF signals in active fault regions in California. Typical events include geomagnetic micropulsations and spectral resonant structures associated with the ionospheric Alfvén resonator. This paper provides a technical overview of the CalMagNet sensors and data processing systems. The network is composed of ten reference stations and fifty-eight local monitoring stations. The primary instruments at each site are three orthogonal induction coil magnetometers. A geophone monitors local site vibration. The systems are designed for future sensor expansion and include resources for monitoring four additional channels. Data is currently sampled at 32 samples per second with a 24-bit converter and time tagged with a GPS-based timing system. Several examples of representative magnetic fluctuations and signals as measured by the array are given.

Welfare Reform in California. State and County Implementation of CalWORKs in the Second Year

National Research Council Canada - National Science Library

Klerman, Jacob

2001-01-01

.... California's response to PRWORA was the California Work and Responsibility to Kids (CalWORKs) program-a "work-first" program that provides support services to help recipients move from welfare to work and toward self-sufficiency...

Fotosíntesis, crecimiento y aceites esenciales en morfotipos florales de caléndula (Calendula officinalis L.).

OpenAIRE

Salomé Abarca, Luis Francisco

2014-01-01

La caléndula (Calendula officinalis) es una especie herbácea originaria de Egipto, que se cree fue introducida a Europa en el siglo XII. En México es cultivada como una planta medicinal y de ornato, en lugares con clima semiseco y templado. En la zona de los valles centrales de México, Palma observó amplia diversidad fenotípica en una variedad común de caléndula, y eligió seis variantes en la morfología floral de esa población heterogénea, a las cuales denominó de la S1 a la S6. El objetivo ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. A Sakthivel. Articles written in Journal of Chemical Sciences. Volume 119 Issue 4 July 2007 pp 303-310. Synthesis, spectral characterization of Schiff base transition metal complexes: DNA cleavage and antimicrobial activity studies · N Raman J Dhaveethu Raja A Sakthivel.

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Mangala Sunder Krishnan. Articles written in Journal of Chemical Sciences. Volume 119 Issue 5 September 2007 pp 417-422. Effective Floquet Hamiltonian for spin = 1 in magic angle spinning NMR using contact transformation · Manoj Kumar Pandey Mangala Sunder ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. B Jayachander Rao. Articles written in Journal of Chemical Sciences. Volume 119 Issue 5 September 2007 pp 401-407. Reactive chemical dynamics through conical intersections · S Ghosal B Jayachander Rao S Mahapatra · More Details Abstract Fulltext PDF. Reaction ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. Hemant K Kashyap. Articles written in Journal of Chemical Sciences. Volume 119 Issue 5 September 2007 pp 391-399. Non-ideality in Born-free energy of solvation in alcohol-water and dimethylsulfoxide-acetonitrile mixtures: Solvent size ratio and ion size dependence.

Social complexity in the third millennium cal BC in southern Portugal

OpenAIRE

Soares, Joaquina

2016-01-01

The starting point of this paper is the extensive archaeological fieldwork developed at the Chalcolithic fortification of Porto das Carretas on the left bank of the Middle Guadiana River (Soares, 2013). The well-preserved stratigraphy and correlated radiocarbon dates of Porto das Carretas enabled a new and deep insight into the third millennium cal BC, displaying environmental, economic and social transformations from the first to the second half of the millenium. Furhermore, the integration ...

Aligning USGS senior leadership structure with the USGS science strategy

Science.gov (United States)

,

2010-01-01

The U.S. Geological Survey (USGS) is realigning its management and budget structure to further enhance the work of its science programs and their interdisciplinary focus areas related to the USGS Science Strategy as outlined in 'Facing Tomorrow's Challenges-U.S. Geological Survey Science in the Decade 2007-2017' (U.S. Geological Survey, 2007). In 2007, the USGS developed this science strategy outlining major natural-science issues facing the Nation and focusing on areas where natural science can make a substantial contribution to the well being of the Nation and the world. These areas include global climate change, water resources, natural hazards, energy and minerals, ecosystems, and data integration.

National Science Foundation Assistant Director for Mathematics and Physical Sciences Tony Chan (USA) visiting CMS experiment on 23rd May 2007 with Spokesperson T. Virdee, Deputy Spokesperson R. Cousins, Advisor to CERN Director-General J. Ellis, US CMS Research Program Deputy Manager D. Marlow and FNAL D. Green

CERN Multimedia

Maximilien Brice

2007-01-01

National Science Foundation Assistant Director for Mathematics and Physical Sciences Tony Chan (USA) visiting CMS experiment on 23rd May 2007 with Spokesperson T. Virdee, Deputy Spokesperson R. Cousins, Advisor to CERN Director-General J. Ellis, US CMS Research Program Deputy Manager D. Marlow and FNAL D. Green

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. K Chandra. Articles written in Bulletin of Materials Science. Volume 30 Issue 4 August 2007 pp 309-314 Biomaterials. Characteristics of porous zirconia coated with hydroxyapatite as human bones · V V Narulkar S Prakash K Chandra · More Details Abstract Fulltext PDF.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. Raji George. Articles written in Bulletin of Materials Science. Volume 30 Issue 2 April 2007 pp 183-185 Nanomaterials. Synthesis, characterization and gas sensitivity of MoO3 nanoparticles · Arnab Ganguly Raji George · More Details Abstract Fulltext PDF. Nanoparticles of ...

It's science after all, Homer!

Directory of Open Access Journals (Sweden)

Daniele Gouthier

2007-12-01

Full Text Available Within just a few months, new releases in the world of publishing have seen two books dealing with science and The Simpsons, one published in the US and the other in Italy: last spring, What's science ever done for us? by Paul Halpern (John Wiley & Sons, New York 2007 and, this autumn, La scienza dei Simpson by Marco Malaspina (Sironi Editore, Milano 2007.

Didier Chanat (1959-2007)

CERN Multimedia

2007-01-01

We deeply regret to announce the death of Mr Didier CHANAT on 05.09.2007. Mr Didier CHANAT, born on 27.05.1959, worked in the AT Department and had been employed at CERN since 01.06.1992. The Director-General has sent his family a message of condolence on behalf of the CERN staff. Social Affairs Tribute to Didier Chanat With a higher technical diploma and a specialisation in electrical engineering, Didier began his professional life at the CEA (France) in 1986. From then until 1990 he took part in developing control and supervision systems for the various Tore Supra tokamak systems at Cadarache, then in operating and upgrading the entire machine. From 1990 to 1992, Didier was a member of the Tore Supra Cryogenics Group, where he was responsible for operating and maintaining the cryogenic system. It was at this time that he developed an interest in cryogenics which was to remain the linchpin of the rest of his career...

FoCal – A high granularity electromagnetic calorimeter for forward direct photon measurements

NARCIS (Netherlands)

Zhang, C.

2017-01-01

The measurement of direct photon production at forward rapidity (y∼3−5) at the LHC provides access to the structure of protons and nuclei at very small values of fractional momentum (x∼10−5). FoCal, an extremely-high-granularity Forward Calorimeter covering 3.3<η<5.3 is proposed as a detector

Using TIMSS 2007 Data to Examine STEM School Effectiveness in an International Context

Science.gov (United States)

Stanco, Gabrielle

2012-01-01

Because results from TIMSS 2007 showed a gap in mathematics and science achievement between students in the United States and those in the top-performing countries, TIMSS 2007 data were used to investigate how school effectiveness factors known to be strongly associated with higher STEM achievement operated in the United States compared to Chinese…

A qualitative evaluation of UC CalFresh Plan, Shop, Save, Cook curriculum reveals additional outcomes

Directory of Open Access Journals (Sweden)

Andra Nicoli

2016-04-01

Full Text Available UC ANR Cooperative Extension (UCCE conducted six focus groups in 2013 with CalFresh-eligible adults to determine how to improve the existing evaluation method for the Plan, Shop, Save, Cook nutrition education classes. Focus group participants (n = 54 cited many behavior changes that are captured by the existing method. During the focus groups, changes in cooking practices and types of food purchased emerged as two domains that are not currently captured. A small pilot study conducted on 22 of the 54 focus group participants suggests that using a telephone interview to survey participants is a feasible and practical approach to collect follow-up data on long-term behavior changes. More rigorous follow-up studies may guide the development of policies aimed at increasing diet quality and food security of adult CalFresh participants.

Training teachers to promote Talent Development in Science Students In Science Education

NARCIS (Netherlands)

van der Valk, Ton

2014-01-01

In recent years, the interest of governments and schools in challenging gifted and talented (G+T) science students has grown (Taber, 2007). In the Netherlands, the government promotes developing science programmes for talented secondary science students. This causes a need for training teachers, but

All partial breakings in ${\\cal N}=2$ supergravity with a single hypermultiplet arXiv

CERN Document Server

Antoniadis, Ignatios; Petropoulos, P. Marios; Siampos, Konstantinos

We consider partial supersymmetry breaking in ${\\cal N}=2$ supergravity coupled to a single vector and a single hypermultiplet. This breaking pattern is in principle possible if the quaternion-K\\"ahler space of the hypermultiplet admits (at least) one pair of commuting isometries. For this class of manifolds, explicit metrics exist and we analyse a generic electro-magnetic (dyonic) gauging of the isometries. An example of partial breaking in Minkowski spacetime has been found long ago by Ferrara, Girardello and Porrati, using the gauging of two translation isometries on $SO(4,1)/SO(4)$. We demonstrate that no other example of partial breaking of ${\\cal N}=2$ supergravity in Minkowski spacetime exists. We also examine partial-breaking vacua in anti-de Sitter spacetime that are much less constrained and exist generically even for electric gaugings. On $SO(4,1)/SO(4)$, we construct the partially-broken solution and its global limit which is the Antoniadis-Partouche-Taylor model.

Loomakasvatus, 2007 = Livestock farming, 2007 / Tiiu Tamm

Index Scriptorium Estoniae

Tamm, Tiiu

2007-01-01

2007. aastal tapeti ning müüdi tapaks 105 000 tonni loomi ja linde, toodeti 689 700 tonni piima ning 155,8 miljonit muna. Diagramm. Tabelid. Vt. samas: Loomade ja piima kokkuost, 2007 = Purchase of livestock and milk, 2007

Satellite eye for Galathea 3. Annual report 2007

DEFF Research Database (Denmark)

Hasager, Charlotte Bay; Sørensen, Peter Brøgger; Pedersen, Leif Toudal

with a short text was published each week at the homepage www.satelliteeye.dk . During 2007 the Satellite Eye team jointly with Nature & science prepared an educational film ‘Satellite Eye – Galathea 3 fra rummet’. This work is funded by The Danish Ministry of Education, Tips- og Lottopuljen. The film...

Improvement by the Life Cycle Control System of University Production With Use of CALS-Tehnology

Directory of Open Access Journals (Sweden)

Yuriy I. Dreizis

2013-01-01

Full Text Available The mechanism of management by life cycle of production of university with use of CALS technologies is described. Tasks of service of marketing and the quality management department, connected with university product quality control are defined

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences. P A Nagarjun. Articles written in Journal of Chemical Sciences. Volume 119 Issue 1 January 2007 pp 29-34. Study of the spectroscopic characteristics of methyl (ligand) cobaloximes and their antibacterial activity · N Navaneetha P A Nagarjun S Satyanarayana · More Details ...

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. Sejal Shah. Articles written in Bulletin of Materials Science. Volume 30 Issue 5 October 2007 pp 477-480 Polymers. Study of microhardness and electrical properties of proton irradiated polyethersulfone (PES) · Nilam Shah Dolly Singh Sejal Shah Anjum Qureshi N L Singh K P ...

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. H P Sachin. Articles written in Bulletin of Materials Science. Volume 30 Issue 1 February 2007 pp 57-63 Electrochemistry. Polynitroaniline as brightener for zinc–nickel alloy plating from non-cyanide sulphate bath · H P Sachin Ganesha Achary Y Arthoba Naik T V Venkatesha.

Bering Sea Helicopter Surveys for Ice-Associated Seals (2007-08)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — In the spring of 2007 and 2008, researchers from the Alaska Fisheries Science Center conducted aerial surveys for ribbon, bearded, and spotted seals in the US sector...

Patient characteristics and service trends following abortion legalization in Mexico City, 2007-10.

Science.gov (United States)

Mondragón y Kalb, Manuel; Ahued Ortega, Armando; Morales Velazquez, Jorge; Díaz Olavarrieta, Claudia; Valencia Rodríguez, Jorge; Becker, Davida; García, Sandra G

2011-09-01

Legal abortion services have been available in public and private health facilities in Mexico City since April 2007 for pregnancies of up to 12 weeks gestation. As of January 2011, more than 50,000 procedures have been performed by Ministry of Health hospitals and clinics. We researched trends in service users' characteristics, types of procedures performed, post-procedure complications, repeat abortions, and postabortion uptake of contraception in 15 designated hospitals from April 2007 to March 2010. The trend in procedures has been toward more medication and manual vacuum aspiration abortions and fewer done through dilation and curettage. Percentages of post-procedure complications and repeat abortions remain low (2.3 and 0.9 percent, respectively). Uptake of postabortion contraception has increased over time; 85 percent of women selected a method in 2009-10, compared with 73 percent in 2007-08. Our findings indicate that the Ministry of Health's program provides safe services that contribute to the prevention of repeat unintended pregnancies.

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science. G Sasibhushana Rao. Articles written in Journal of Earth System Science. Volume 116 Issue 5 October 2007 pp 407-411. GPS satellite and receiver instrumental biases estimation using least squares method for accurate ionosphere modelling · G Sasibhushana Rao.

Dose measurements using thermoluminescent dosimeters and DoseCal software at two paediatric hospitals in Rio de Janeiro

International Nuclear Information System (INIS)

Mohamadain, K.E.M.; Azevedo, A.C.P.; Rosa, L.A.R. da; Guebel, M.R.N.; Boechat, M.C.B.

2003-01-01

A dosimetric survey in paediatric radiology is currently being carried out at the paediatric units of two large hospitals in Rio de Janeiro city: IPPMG (Instituto de Pediatria e Puericultura Martagao Gesteira, University Hospital of Federal University of Rio de Janeiro) and IFF (Instituto Fernandes Figueira, FIOCRUZ). Chest X-ray examination doses for AP, PA and LAT projections of paediatric patients have been obtained with thermoluminescent dosimeters (TLDs) and with use of a software package DoseCal. In IPPMG and IFF 100 patients have been evaluated with the use of the TLDs and another group of 100 patients with the DoseCal software. The aim of this work was to estimate the entrance skin dose (ESD) for frontal, back and lateral chest X-rays exposure of paediatric patients. For ESD evaluation, three different TL dosimeters have been used, namely LIF:Mg, Ti (TLD100), CaSO 4 :Dy and LiF:Mg, Cu, P (TLD100H). The age intervals considered were 0-1, 1-5, 5-10 and 10-15 years. The results obtained with all dosimeters are similar, and it is in good agreement with the DoseCal software, especially for AP and PA projections. However, some larger discrepancies are presented for the LAT projection

Waking-up to Science!

Science.gov (United States)

2007-03-01

The Science on Stage festival as an alarm clock for science teaching How is Europe to tackle its shortage of scientists? The EIROforum Science on Stage festival aims to give European teachers some of the answers they need to take up this urgent challenge. This unique event, showcasing the very best of today's science education, will feature science demonstrations, a science teaching fair with some 66 stands, and a Round Table discussion with the participation of the European Commissioner for Science and Research, Janez Potočnik. ESO PR Photo 14/07 ESO PR Photo 14/07 Science on Stage will have the city of Grenoble (France) buzzing from 2 to 6 April 2007. A rugby team and a hockey team will take on the power of the vacuum, a cook will demonstrate how science can inspire new culinary ideas, visitors will discover the real colour of the sun, an inflatable model of Borromini's gallery will help to explain the science of optical illusions, and Merlin himself will reveal all about how to make a cake float. These are just some of the exciting things that will be happening at the EIROforum Science on Stage festival. By showing how fascinating and entertaining science can be, the event aims to attract young people to science and ultimately help to reduce the shortage of scientists in Europe. With support from the European Commission, this international festival will bring together some 500 science educators from 27 European countries. The highlight of the festival will be a Round Table discussion on 'Science Education in the Age of the Knowledge Society - Strengthening Science Education in Europe', which will take place on 5 April 2007 with the participation of the European Commissioner for Science and Research, Janez Potočnik. The panellists - all high-ranking decision-makers - will include the Danish Minister for Education, Bertel Haarder, the MEP Vittorio Prodi, and the Chair of the UK's Engineering and Physical Sciences Research Council, Julia Higgins. "Curiosity is in

Science & Technology Review April 2007

Energy Technology Data Exchange (ETDEWEB)

Radousky, H B

2007-02-27

This month's issue has the following articles: (1) Shaking the Foundations of Solar-System Science--Commentary by William H. Goldstein; (2) Stardust Results Challenge Astronomical Convention--The first samples retrieved from a comet are a treasure trove of surprises to Laboratory researchers; (3) Fire in the Hole--Underground coal gasification may help to meet future energy supply challenges with a production process from the past; (4) Big Physics in Small Spaces--A newly developed computer model successfully simulates particle-laden fluids flowing through complex microfluidic systems; (5) A New Block on the Periodic Table--Livermore and Russian scientists add a new block to the periodic table with the creation of element 118; and (6) A Search for Patterns and Connections--Throughout his career, Edward Teller searched for mathematical solutions to explain the physical world.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. S S Samal. Articles written in Bulletin of Materials Science. Volume 30 Issue 4 August 2007 pp 379-386 Polymers. Carbon nanotube reinforced polymer composites—A state of the art · S Bal S S Samal · More Details Abstract Fulltext PDF. Because of their high mechanical ...

Setup, tests and results for the ATLAS TileCal Read Out Driver production

CERN Document Server

Valero, Alberto; Castillo, V; Cuenca, C; Ferrer, A; Fullana, E; González, V; Higón, E; Munar, A; Poveda, J; Ruiz-Martínez, A; Salvachúa, B; Sanchís, E; Solans, C; Soret, J; Torres, J; Valls, J A

2007-01-01

In this paper we describe the performance and test results of the production of the 38 ATLAS TileCal Read Out Drivers (RODs). We first describe the basic hardware specifications and firmware functionality of the modules, the test-bench setup used for production and the test procedure to qualify the boards. We then finally show and discuss the performance results.

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science. S Sajani. Articles written in Journal of Earth System Science. Volume 116 Issue 2 April 2007 pp 149-157. The role of low-frequency intraseasonal oscillations in the anomalous Indian summer monsoon rainfall of 2002 · S Sajani S Naseema Beegum K Krishna Moorthy.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. K B R Varma. Articles written in Bulletin of Materials Science. Volume 30 Issue 6 December 2007 pp 567-570 Ceramics and Glasses. Microwave synthesis and sintering characteristics of CaCu3Ti4O12 · P Thomas L N Sathapathy K Dwarakanath K B R Varma · More Details ...

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. Hui Shen. Articles written in Bulletin of Materials Science. Volume 30 Issue 2 April 2007 pp 101-104 Single Crystals. Piezoelectric properties of Sr3Ga2Ge4O14 single crystals · Anhua Wu Jiayue Xu Juan Zhou Hui Shen · More Details Abstract Fulltext PDF. A new piezoelectric ...

Adventures in Rocket Science. EG-2007-12-179-MSFC

Science.gov (United States)

Huegele, Vince; Hill, Kristy; Terry, Brenda

2008-01-01

This guide was prepared as a tool useful for informal education venues (4-H, Boys and Girls Clubs, Boy Scouts, Girl Scouts, etc.), science clubs and related programs, and can be adopted for formal education settings. An exciting and productive study in rocket science can be implemented using the selected activities for the above-mentioned…

Efficacy and Safety of Tranexamic Acid in Prehospital Traumatic Hemorrhagic Shock: Outcomes of the Cal-PAT Study

Directory of Open Access Journals (Sweden)

Michael M. Neeki

2017-04-01

following the administration of TXA (control: 6.95 units; intervention: 4.09 units; p=0.01. Conclusion: Preliminary evidence from the Cal-PAT study suggests that TXA administration may be safe in the prehospital setting with no significant change in adverse events observed and an associated decreased use of blood products in cases of trauma-induced hemorrhagic shock. Given the current sample size, a statistically significant decrease in mortality was not observed. Additionally, this study demonstrates that it may be feasible for paramedics to identify and safely administer TXA in the prehospital setting.

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

, Jeonbuk 561-756, Korea; Power Engineering School, Mongolian University of Science and Technology, Ulaanbaatar, Mongolia; School of Civil and Environmental Engineering, University of Technology, Sydney, Broadway NSW 2007, ...

Can TAD and CalTAD predict cut-out after extra-medullary fixation with new generation devices of proximal femoral fractures? A retrospective study.

Science.gov (United States)

Caruso, Gaetano; Andreotti, Mattia; Pari, Carlotta; Soldati, Francesco; Gildone, Alessandro; Lorusso, Vincenzo; Massari, Leo

2017-01-01

Intramedullary and extramedullary strategies of pertrochanteric fracture fixation are still controversial, but new percutaneous devices may give advantages regarding operative time, blood loss and rate of cardiovascular complications. We retrospectively analyze our cases regarding Anteversa ® plate (Intrauma, Turin, Italy) fixation of pertrochanteric femoral fractures, focusing on the correlation between two radiographical parameters (tip-apex distance "TAD" and calcar referenced tip-apex distance "CalTAD") and the occurrence of cut-out. The purpose of this study was to determine if these predicting factors of cut-out are reliable in the treatment of proximal femoral fractures with the Anteversa plate. A series of 77 patients with 53 31-A1 fracture types and 24-A2 fractures completed a 12-month-follow-up. Clinical outcomes were evaluated according to Parker-Palmer Mobility Score at the final follow-up. TAD and CalTAD were considered to determine their correlation with cut-out events. The mean Parker-Palmer Score was 6.94 in A1 group and 7.41 in A2 group ( p  = 0.47). Mean value of TAD index was 29.58, 29.81 in the A1 group and 29.08 in the A2 group, and mean value of CalTAD index was 30.87, 31.03 in the A1 group and 30.50 in the A2 group. We observed 3 cases of implant cut-out. We shared our sample in two groups, one group with TAD and CalTAD indices lower than 25 mm and another group higher than 25 mm to evaluate how the Palmer Parker score changed and no statistical differences were found between the two groups. Taking into consideration that good clinical results were obtained for TAD and CalTAD values superior to 25 mm, the prognostic value of 25 mm of TAD and CalTAD indices might not be appropriate to this new percutaneous plate.

Anthocyanins from black rice (Oryza sativa L.) demonstrate antimetastatic properties by reducing MMPs and NF-κB expressions in human oral cancer CAL 27 cells.

Science.gov (United States)

Fan, Ming-Jen; Wang, I-Chen; Hsiao, Yung-Ting; Lin, Hui-Yi; Tang, Nou-Ying; Hung, Tzu-Chieh; Quan, Christine; Lien, Jin-Cherng; Chung, Jing-Gung

2015-01-01

Aside from the commonly known white rice lines, colored varieties also exist. These varieties have historically been used in Chinese medicine. Anthocyanins, a large group of natural polyphenols existing in a variety of daily fruits and vegetables, have been widely recognized as cancer chemopreventive agents. The primary objective of cancer treatment strategies has traditionally focused on preventing the occurrence of metastasis. In this research the antimetastatic mechanism of anthocyanins on the invasion/migration of human oral CAL 27 cells was performed using a transwell to quantify the migratory potential of CAL 27 cells and the results show that anthocyanins can inhibit the in vitro migration and invasion of CAL 27 cancer cells. In addition, the gelatin zymography assay indicated that anthocyanins inhibited the activity of matrix metalloproteinases-2 (MMP-2). Western blotting assay also demonstrated that anthocyanins inhibited the associated protein expression of migration/invasion of CAL 27 cell. Immunofluorescence staining proved that anthocyanins inhibited nuclear factor kappa B p65 (NF-κB p65) expressions. These results demonstrated that anthocyanins from a species of black rice (selected purple glutinous indica rice cultivated at Asia University) could suppress CAL 27 cell metastasis by reduction of MMP-2, MMP-9, and NF-κB p65 expression through the suppression of PI3K/Akt pathway and inhibition of NF-κB levels.

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science. S Naseema Beegum. Articles written in Journal of Earth System Science. Volume 116 Issue 2 April 2007 pp 149-157. The role of low-frequency intraseasonal oscillations in the anomalous Indian summer monsoon rainfall of 2002 · S Sajani S Naseema Beegum K Krishna ...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science. S Gurubaran. Articles written in Journal of Earth System Science. Volume 116 Issue 3 June 2007 pp 179-186. Fairweather atmospheric electricity at Antarctica during local summer as observed from Indian station, Maitri · C Panneerselvam C Selvaraj K Jeeva K U Nair C P ...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science. C Selvaraj. Articles written in Journal of Earth System Science. Volume 116 Issue 3 June 2007 pp 179-186. Fairweather atmospheric electricity at Antarctica during local summer as observed from Indian station, Maitri · C Panneerselvam C Selvaraj K Jeeva K U Nair C P ...

NO2 fluxes from Tijuana using a mobile mini-DOAS during Cal-Mex 2010

Science.gov (United States)

Rivera, Claudia; Barrera, Hugo; Grutter, Michel; Zavala, Miguel; Galle, Bo; Bei, Naifang; Li, Guohui; Molina, Luisa T.

2013-05-01

NO2 fluxes were measured using a mobile mini-DOAS during Cal-Mex 2010 field study, between May 15 and June 30, 2010, from the urban area of Tijuana, Baja California as well as the Rosarito power plant. The average calculated NO2 fluxes were 328 ± 184 (269 ± 201) g s-1, and 23.4 ± 4.9 (12.9 ± 11.9) g s-1 for Tijuana urban area and Rosarito power plant, respectively, using model based wind fields and onsite measurements (in parenthesis). Wind speed and wind direction data needed to estimate the fluxes were both modeled and obtained from radiosondes launched regularly during the field campaign, whereas the mixing layer height throughout the entire field campaign was measured using a ceilometer. Large variations in the NO2 fluxes from both the Tijuana urban area and Rosarito power plant were observed during Cal-Mex 2010; however, the variability was less when model based wind fields were used. Qualitative comparisons of modeled and measured plumes from the Tijuana urban area and Rosarito power plant showed good agreement.

Severe storm in Bavaria, the Czech Republic and Poland on 12–13 July 1984: A statistic- and model-based analysis

Czech Academy of Sciences Publication Activity Database

Kašpar, Marek; Müller, Miloslav; Kakos, Vilibald; Řezáčová, Daniela; Sokol, Zbyněk

2009-01-01

Roč. 93, 1-3 (2009), s. 99-110 ISSN 0169-8095. [European Conference on Severe Storms /4./. Miramare -Trieste, 10.09.2007-14.09.2007] R&D Projects: GA ČR GA205/07/0905; GA AV ČR KJB300420701; GA AV ČR KJB300420802 Institutional research plan: CEZ:AV0Z30420517 Keywords : convective storm * synoptic anomaly * mesoscale condition * forecast verification * gust front Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 1.811, year: 2009 http://www. elsevier.com/locate/atmos

Dietary shift after 3600 cal yr BP and its influencing factors in northwestern China: Evidence from stable isotopes

Science.gov (United States)

Ma, Minmin; Dong, Guanghui; Jia, Xin; Wang, Hui; Cui, Yifu; Chen, Fahu

2017-04-01

:Human diets rely on natural resource availability and can reflect social and cultural values. When environments, societies, and cultures change, diets may also shift. This study traced the extent of dietary change and the factors influencing such change. Through stable carbon and nitrogen isotopic analysis of late Neolithic and early Bronze Age human and animal bone collagen, we found that significant shifts in human diets were closely associated with intercontinental cultural exchanges in Eurasia and climate change in northwestern China. The isotopic evidence indicated that human diets mainly consisted of C4 foodstuffs (presumably millet and/or animals fed with C4 foods) around 4000 calibrated years before the present (cal yr BP), corresponding to the flourishing of millet agriculture in the context of the optimal climate conditions of the mid-Holocene. Subsequently, more C3 foods (probably wheat, barley, and animals fed with C3 foods) were added to human diets post-3600 cal yr BP when the climate became cooler and drier. Such dietary variation is also consistent with the increasing intensity of long-distance exchange after 4000 cal yr BP. While many factors can lead to human dietary shifts (e.g. climate change, population growth, cultural factors, and human migration), climate may have been a key factor in Gansu and Qinghai.

Podpora rozhodování v klinické praxi interních oborů pomocí online informačních zdrojů

Czech Academy of Sciences Publication Activity Database

Papíková, Vendula; Papík, R.

2007-01-01

Roč. 53, 9 příloha (2007), s. 54-54 ISSN 0042-773X. [Kongres České internistické společnosti ČSL J.E. Purkyně /14./. 16.09.2007-19.09.2007, Praha] R&D Projects: GA MŠk(CZ) 1M06014 Grant - others:GA AV ČR(CZ) IAA701010606 Program:IA Institutional research plan: CEZ:AV0Z10300504 Keywords : podpora lékařského rozhodování * vědecké lékařské informace * lékařské informační zdroje Subject RIV: IN - Informatics, Computer Science

16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...

Science Self-Beliefs and Science Achievement of Adolescents in Gulf Cooperation Council Countries

Science.gov (United States)

Areepattamannil, Shaljan

2012-01-01

This study explored the predictive effects of science self-beliefs on science achievement for 24,680 13-year-old students from Gulf Cooperation Council member countries--Bahrain, Kuwait, Oman, Qatar, Saudi Arabia and the United Arab Emirates--who participated in the Trends in International Mathematics and Science Study (TIMSS) 2007. The…

ICENES 2007 Abstracts

Energy Technology Data Exchange (ETDEWEB)

Sahin, S [Gazi University, Technical Education Faculty, Ankara (Turkey)

2007-07-01

In this book Conference Program and Abstracts were included 13th International Conference on Emerging Nuclear Energy Systems which held between 03-08 June 2007 in Istanbul, Turkey. The main objective of International Conference series on Emerging Nuclear Energy Systems (ICENES) is to provide an international scientific and technical forum for scientists, engineers, industry leaders, policy makers, decision makers and young professionals who will shape future energy supply and technology , for a broad review and discussion of various advanced, innovative and non-conventional nuclear energy production systems. The main topics of 159 accepted papers from 35 countries are fusion science and technology, fission reactors, accelerator driven systems, transmutation, laser in nuclear technology, radiation shielding, nuclear reactions, hydrogen energy, solar energy, low energy physics and societal issues.

ICENES 2007 Abstracts

International Nuclear Information System (INIS)

Sahin, S.

2007-01-01

In this book Conference Program and Abstracts were included 13th International Conference on Emerging Nuclear Energy Systems which held between 03-08 June 2007 in Istanbul, Turkey. The main objective of International Conference series on Emerging Nuclear Energy Systems (ICENES) is to provide an international scientific and technical forum for scientists, engineers, industry leaders, policy makers, decision makers and young professionals who will shape future energy supply and technology , for a broad review and discussion of various advanced, innovative and non-conventional nuclear energy production systems. The main topics of 159 accepted papers from 35 countries are fusion science and technology, fission reactors, accelerator driven systems, transmutation, laser in nuclear technology, radiation shielding, nuclear reactions, hydrogen energy, solar energy, low energy physics and societal issues

Produtividade e jornada de trabalho na indústria de calçados de Franca - quem fica com os ganhos?

OpenAIRE

Corrêa, Lauro Henrique Guimarães

2005-01-01

O presente trabalho tem como eixo central a problematização das relações que permeiam a evolução e o desempenho de fatores econômicos tais como a produtividade, os níveis de emprego e a jornada de trabalho no contexto do modo de produção capitalista na particularidade da indústria calçadista de Franca (SP), o maior pólo brasileiro de fabricação de calçados masculinos. Inserindo-se no rol das formulações que advogam a necessidade, a importância e a justiça de se promover redu...

Aerodynamic design of the Cal Poly Da Vinci Human-Powered Helicopter

Science.gov (United States)

Larwood, Scott; Saiki, Neal

1990-01-01

This paper will discuss the methodology used in designing the rotor and drive propellers for the third generation Cal Poly Da Vinci Human-Powered Helicopter. The rotor was designed using a lifting surface, uniform inflow hover analysis code and the propeller was designed using a minimum induced-loss method. Construction, geometry, and operating considerations are discussed as they impact the designs. Optimization of the design performance is also explained. The propellers were tested in a wind tunnel and results are compared with theoretical data. Successful flight tests of the Da Vinci III are discussed.

CalTOX, a multimedia total exposure model for hazardous-waste sites; Part 1, Executive summary

Energy Technology Data Exchange (ETDEWEB)

McKone, T.E.

1993-06-01

CalTOX has been developed as a spreadsheet model to assist in health-risk assessments that address contaminated soils and the contamination of adjacent air, surface water, sediments, and ground water. The modeling effort includes a multimedia transport and transformation model, exposure scenario models, and efforts to quantify and reduce uncertainty in multimedia, multiple-pathway exposure models. This report provides an overview of the CalTOX model components, lists the objectives of the model, describes the philosophy under which the model was developed, identifies the chemical classes for which the model can be used, and describes critical sensitivities and uncertainties. The multimedia transport and transformation model is a dynamic model that can be used to assess time-varying concentrations of contaminants introduced initially to soil layers or for contaminants released continuously to air or water. This model assists the user in examining how chemical and landscape properties impact both the ultimate route and quantity of human contact. Multimedia, multiple pathway exposure models are used in the CalTOX model to estimate average daily potential doses within a human population in the vicinity of a hazardous substances release site. The exposure models encompass twenty-three exposure pathways. The exposure assessment process consists of relating contaminant concentrations in the multimedia model compartments to contaminant concentrations in the media with which a human population has contact (personal air, tap water, foods, household dusts soils, etc.). The average daily dose is the product of the exposure concentrations in these contact media and an intake or uptake factor that relates the concentrations to the distributions of potential dose within the population.

Ages of 24 widespread tephras erupted since 30,000 years ago in New Zealand, with re-evaluation of the timing and palaeoclimatic implications of the Lateglacial cool episode recorded at Kaipo bog

Science.gov (United States)

Lowe, David J.; Blaauw, Maarten; Hogg, Alan G.; Newnham, Rewi M.

2013-08-01

Tephras are important for the NZ-INTIMATE project because they link all three records comprising the composite inter-regional stratotype developed for the New Zealand climate event stratigraphy (NZ-CES). Here we firstly report new calendar ages for 24 widespread marker tephras erupted since 30,000 calendar (cal.) years ago in New Zealand to help facilitate their use as chronostratigraphic dating tools for the NZ-CES and for other palaeoenvironmental and geological applications. The selected tephras comprise 12 rhyolitic tephras from Taupo, nine rhyolitic tephras from Okataina, one peralkaline rhyolitic tephra from Tuhua, and one andesitic tephra each from Tongariro and Egmont/Taranaki volcanic centres. Age models for the tephras were obtained using three methods: (i) 14C-based wiggle-match dating of wood from trees killed by volcanic eruptions (these dates published previously); (ii) flexible depositional modelling of a high-resolution 14C-dated age-depth sequence at Kaipo bog using two Bayesian-based modelling programs, Bacon and OxCal's P_Sequence function, and the IntCal09 data set (with SH offset correction -44 ± 17 yr); and (iii) calibration of 14C ages using OxCal's Tau_Boundary function and the SHCal04 and IntCal09 data sets. Our preferred dates or calibrated ages for the 24 tephras are as follows (youngest to oldest, all mid-point or mean ages of 95% probability ranges): Kaharoa AD 1314 ± 12; Taupo (Unit Y) AD 232 ± 10; Mapara (Unit X) 2059 ± 118 cal. yr BP; Whakaipo (Unit V) 2800 ± 60 cal. yr BP; Waimihia (Unit S) 3401 ± 108 cal. yr BP; Stent (Unit Q) 4322 ± 112 cal. yr BP; Unit K 5111 ± 210 cal. yr BP; Whakatane 5526 ± 145 cal. yr BP; Tuhua 6577 ± 547 cal. yr BP; Mamaku 7940 ± 257 cal. yr BP; Rotoma 9423 ± 120 cal. yr BP; Opepe (Unit E) 9991 ± 160 cal. yr BP; Poronui (Unit C) 11,170 ± 115 cal. yr BP; Karapiti (Unit B) 11,460 ± 172 cal. yr BP; Okupata 11,767 ± 192 cal. yr BP; Konini (bed b) 11,880 ± 183 cal. yr BP; Waiohau 14,009 ± 155

Deslocamento de empresas para os estados do Ceará e da Bahia: o caso da indústria calçadista

OpenAIRE

Santos, Angela Maria Medeiros Martins; Correa, Abidack Raposo; Alexim, Flavia Menna Barreto; Peixoto, Gabriel Barros Tavares

2002-01-01

Este artigo objetiva apresentar o deslocamento do setor calçadista brasileiro das regiões Sul e Sudeste para o Nordeste, especialmente para os Estados do Ceará e da Bahia. Nesse sentido, procura-se mostrar as políticas de atração de novos investimentos do setor nesses estados, assim como suas perspectivas e seus principais problemas. Serão apresentadas as características gerais do setor no Ceará e na Bahia, os fatores que determinaram a migração de empresas calçadistas, a logística de suprime...

Preface: Phonons 2007

Science.gov (United States)

Perrin, Bernard

2007-06-01

logo.jpg" ALT="Conference logo"/> The conference PHONONS 2007 was held 15-20 July 2007 in the Conservatoire National des Arts et Métiers (CNAM) Paris, France. CNAM is a college of higher technology for training students in the application of science to industry, founded by Henri Grégoire in 1794. This was the 12th International Conference on Phonon Scattering in Condensed Matter. This international conference series, held every 3 years, started in France at Sainte-Maxime in 1972. It was then followed by meetings at Nottingham (1975), Providence (1979), Stuttgart (1983), Urbana-Champaign (1986), Heidelberg (1989), Ithaca (1992), Sapporo (1995), Lancaster (1998), Dartmouth (2001) and St Petersburg (2004). PHONONS 2007 was attended by 346 delegates from 37 different countries as follows: France 120, Japan 45, Germany 25, USA 25, Russia 21, Italy 13, Poland 9, UK 9, Canada 7, The Netherlands 7, Finland 6, Spain 6, Taiwan 6, Greece 4, India 4, Israel 4, Ukraine 4, Serbia 3, South Africa 3, Argentina 2, Belgium 2, China 2, Iran 2, Korea 2, Romania 2, Switzerland 2, and one each from Belarus, Bosnia-Herzegovina, Brazil, Bulgaria, Egypt, Estonia, Mexico, Moldova, Morocco, Saudi Arabia, Turkey. There were 5 plenary lectures, 14 invited talks and 84 oral contributions; 225 posters were presented during three poster sessions. The first plenary lecture was given by H J Maris who presented fascinating movies featuring the motion of a single electron in liquid helium. Robert Blick gave us a review on the new possibilities afforded by nanotechnology to design nano-electomechanical systems (NEMS) and the way to use them to study elementary and fundamental processes. The growing interest for phonon transport studies in nanostructured materials was demonstrated by Arun Majumdar. Andrey Akimov described how ultrafast acoustic solitons can monitor the optical properties of quantum wells. Finally, Maurice Chapellier told us how phonons can help tracking dark matter. These 328

The late Holocene dry period: multiproxy evidence for an extended drought between 2800 and 1850 cal yr BP across the central Great Basin, USA

Science.gov (United States)

Mensing, Scott A.; Sharpe, Saxon E.; Tunno, Irene; Sada, Don W.; Thomas, Jim M.; Starratt, Scott W.; Smith, Jeremy

2013-01-01

Evidence of a multi-centennial scale dry period between ∼2800 and 1850 cal yr BP is documented by pollen, mollusks, diatoms, and sediment in spring sediments from Stonehouse Meadow in Spring Valley, eastern central Nevada, U.S. We refer to this period as the Late Holocene Dry Period. Based on sediment recovered, Stonehouse Meadow was either absent or severely restricted in size at ∼8000 cal yr BP. Beginning ∼7500 cal yr BP, the meadow became established and persisted to ∼3000 cal yr BP when it began to dry. Comparison of the timing of this late Holocene drought record to multiple records extending from the eastern Sierra Nevada across the central Great Basin to the Great Salt Lake support the interpretation that this dry period was regional. The beginning and ending dates vary among sites, but all sites record multiple centuries of dry climate between 2500 and 1900 cal yr BP. This duration makes it the longest persistent dry period within the late Holocene. In contrast, sites in the northern Great Basin record either no clear evidence of drought, or have wetter than average climate during this period, suggesting that the northern boundary between wet and dry climates may have been between about 40° and 42° N latitude. This dry in the southwest and wet in the northwest precipitation pattern across the Great Basin is supported by large-scale spatial climate pattern hypotheses involving ENSO, PDO, AMO, and the position of the Aleutian Low and North Pacific High, particularly during winter.

2018-05-09T18:56:27Z https://www.ajol.info/index.php/all/oai oai:ojs ...

African Journals Online (AJOL)

article/20961 2018-05-09T18:56:27Z bcse:ART CONSTITUENTS OFERYTHRINA SIGMOIDEA Ndom, Jean Claude; Department of Chemistry, Faculty of Science, University of Douala, P.O. Box 24157, Douala, Cameroon Kouam, ; Department of ...

GKSS. Annual report 2007/2008. Science use

International Nuclear Information System (INIS)

2008-06-01

The following topics are dealt with: Titanium aluminide alloys, microscopy in materials research, a new generation of membranes based on nanostructured polymers, the GKSS Engineering Materials Science Synchrotron, regenerativ medicine, the colour of the coastal sea, news from the North German Climate Office, the climate change for the Baltic sea basin, polyfluorinated compounds as pollutant in the coastal environment, the FRG 1 research reactor. (HSI)

The Behavior of Pilot Trickle-Bed Reactor under Periodic Operation

Czech Academy of Sciences Publication Activity Database

Tukač, V.; Šimíčková, M.; Chyba, V.; Lederer, J.; Kolena, J.; Hanika, Jiří; Jiřičný, Vladimír; Staněk, Vladimír; Stavárek, Petr

2007-01-01

Roč. 62, 18-20 (2007), s. 4891-4895 ISSN 0009-2509. [International Symposium on Chemical Reaction Engineering - From Science to Innovative Engineering /19./. Potsdam/Berlin, 03.09.2006-06.09.2006] R&D Projects: GA MPO(CZ) FT-TA/039 Grant - others:CYCLOP(XE) G1RD/CT2000/00225 Institutional research plan: CEZ:AV0Z40720504 Source of funding: R - rámcový projekt EK Keywords : olefine hydrogenation * pilot-scale * trickle-bed reactor Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.775, year: 2007

Blocos solo-cal utilizando resíduo da construção civil Soil-lime bricks using building waste

Directory of Open Access Journals (Sweden)

S. M. R. Patricio

2013-03-01

Full Text Available Novas técnicas vêm sendo desenvolvidas com o objetivo de incentivar o desenvolvimento sustentável e tentar minimizar a degradação ambiental causada pela extração indiscriminada de recursos naturais além da constante geração de resíduos de construção e demolição. Esta pesquisa objetiva avaliar a utilização de resíduos da construção civil, oriundos de demolição, como agente pozolânico na fabricação de blocos solo-cal. As matérias primas convencionais e alternativas (resíduos foram caracterizados por meio dos seguintes ensaios: massa especifica real, área específica, análise granulométrica por peneiramento e por difração á laser,limites de liquidez e plasticidade, análise química e difração de raios X. Para os ensaios tecnológicos foram confeccionados corpos de prova solo-cal no traço 1:10 em peso, com substituição da cal por resíduos nas seguintes proporções: 0, 10, 20, 25, 30, 40, 50 e 75%. Os corpos de prova foram curados por períodos de 28, 60 e 90 dias, em câmara úmida com 100% de umidade relativa, em seguida determinada sua resistência à compressão simples e absorção de água. Com os melhores resultados de resistência a compressão simples, foram moldados blocos solo-cal e solo-cal-resíduo. Os resultados obtidos com os blocos solo-cal incorporados com resíduo evidenciaram valores dentro das especificações das normas da ABNT, apontando que existe viabilidade técnica no aproveitamento de resíduos de demolição para uso na fabricação de blocos solo-cal sem função estrutural.New techniques have been developed with the aim of encouraging sustainable development and try to minimize the environmental degradation caused by indiscriminate extraction of natural resources and the constant generation of building waste. This research aims to evaluate the use building waste, as pozzolanic agent in the soil-lime bricks manufacture. Raw materials conventional and alternatives (waste were

El Uso de cal para salvar muros de fortificaciones como un legado de la Arquitectura Militar de la Colonia

Directory of Open Access Journals (Sweden)

Walter Domínguez Vega

2009-01-01

Full Text Available Se aborda el uso de la cal en la restauración y conservación de las fortificaciones de la línea defensiva Holguin ¿Gibara. Se basa en la tendencia actual para la conservación sostenible de los bienes patrimoniales y culturales que orienta los materiales utilizados en los trabajos de intervención, se detiene sobre la relevancia y alcance histórico cultural del patrimonio fortificado en la provincia de Holguín, describe las características constructivas de sus muros, los morteros utilizados y las dificultades para la conservación de estas. Propone que se revitalice el uso de la cal en obras de conservación.

GKSS. Annual report 2007/2008. Science use; GKSS. Jahresbericht 2007/2008. Wissenschaft nutzen

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-06-15

The following topics are dealt with: Titanium aluminide alloys, microscopy in materials research, a new generation of membranes based on nanostructured polymers, the GKSS Engineering Materials Science Synchrotron, regenerativ medicine, the colour of the coastal sea, news from the North German Climate Office, the climate change for the Baltic sea basin, polyfluorinated compounds as pollutant in the coastal environment, the FRG 1 research reactor. (HSI)

Modeling of Trans-boundary Transport of Air Pollutants in the California-Mexico Border Region during Cal-Mex 2010

Science.gov (United States)

Bei, N.; Zavala, M. A.; Lei, W.; Li, G.; Molina, L. T.

2010-12-01

The US and Mexico share a common air basin along the ~200 km border between California and Baja California. The economical activities in this region are heavily influenced by the international trade and commerce between Mexico and the US that mainly occurs through the borders of the sister cities of San Diego-Tijuana and Calexico-Mexicali. The diversity and differences in the characteristics of emissions sources of air pollutants in the California-Mexico border region make this an important area for the study of the chemistry and trans-boundary transport of air pollutants. During May-June of 2010, the Cal-Mex 2010 field campaign included a series of measurements aimed at characterizing the emissions from major sources in the California-Mexico border region and assessing the possible impacts of these emissions on local and regional air quality. In this work we will present the results of the use of the Comprehensive Air quality model with extensions (CAMx) in a modeling domain that includes the sister cities of San Diego-Tijuana and Calexico-Mexicali for studying events of trans-boundary transport of air pollutants during Cal-Mex 2010. The measurements obtained during the Cal-Mex 2010 field campaign are used in the evaluation of the model performance and in the design of air quality improvement policies in the California-Mexico border region.

Creating a University System for the 21st Century. Analysis of 2009-2011 Legislative Appropriation

Science.gov (United States)

North Dakota University System, 2009

2009-01-01

The 2009-11 state general fund appropriation is $597.9 million for the eleven campuses, University of North Dakota (UND) School of Medicine and Health Sciences (SMHS), Forest Service and North Dakota University System Office, which is an increase of $153.4 million over the 2007-09 adjusted appropriation, less 07-09 one-time funding. This includes…

Stratus Ocean Reference Station (20 degs S, 85 degs W) Mooring Recovery and Deployment Cruise, STRATUS 8, R/V Ronald H. Brown Cruise 07-09, October 9, 2007-November 6, 2007

National Research Council Canada - National Science Library

Whelan, Sean; Lord, Jeff; Grados, Carmen; Yu, Lisan; Morales, Luis; Galbraith, Nancy; de Szoeke, Simon P; O'Leary, Megan; Weller, Robert; Bouchard, Paul

2007-01-01

.... During the October 2007 cruise on the NOAA ship Ronald H. Brown to the ORS Stratus site, the primary activities were recovery of the Stratus 7 WHOI surface mooring that had been deployed in October 2006, deployment of a new (Stratus...

Physical, biological and optical oceanographic data collected from moorings deployed in the Bering Strait from 08/27/2007 to 09/02/2009 (NODC Accession 0062860)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — From 2007 to 2009, a total of eight moorings were deployed, including A1W, A1, and A1E in the Russian channel of the Strait, A2W, A2, A4W (A4W for 2007 to 2008 and...

The X-ray eclipse geometry of the super-soft X-ray source CAL 87

Energy Technology Data Exchange (ETDEWEB)

Ribeiro, T.; Lopes de Oliveira, R. [Departamento de Física, Universidade Federal de Sergipe, Av. Marechal Rondon s/n, 49100-000 São Cristóvão, SE (Brazil); Borges, B. W., E-mail: tribeiro@ufs.br, E-mail: rlopes@ufs.br, E-mail: bernardo@astro.ufsc.br [Universidade Federal de Santa Catarina, Campus Araranguá, 88905-120 Araranguá, SC (Brazil)

2014-09-01

We explore XMM-Newton observations of the eclipsing super-soft X-ray source CAL 87 in order to map the accretion structures of the system. Indirect imaging techniques were applied in X-ray light curves to provide eclipse maps. The surface brightness distribution exhibits an extended and symmetric emission, and a feature is revealed from the hardest X-rays that is likely due to a bright spot. A rate of P-dot =(+6±2)×10{sup −10} for changes in the orbital period of the system was derived from the eclipses. There is no significant variation of the emission lines even during eclipses, arguing that the lines are formed in an extended region. The continuum emission dominates the decrease in flux that is observed during eclipses. The O VIII Lyα line reveals a broadening velocity that is estimated to be 365{sub −69}{sup +65} km s{sup –1} (at 1σ), marginal evidence for asymmetry in its profile, and sometimes shows evidence of double-peaked emission. Together, the results support that the wind-driven mass transfer scenario is running in CAL 87.

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...

CalWater Field Studies Designed to Quantify the Roles of Atmospheric Rivers and Aerosols in Modulating U.S. West Coast Precipitation in a Changing Climate

Energy Technology Data Exchange (ETDEWEB)

Ralph, F. M.; Prather, K. A.; Cayan, D.; Spackman, J. R.; DeMott, P.; Dettinger, M.; Fairall, C.; Leung, R.; Rosenfeld, D.; Rutledge, S.; Waliser, D.; White, A. B.; Cordeira, J.; Martin, A.; Helly, J.; Intrieri, J.

2016-07-01

The variability of precipitation and water supply along the U.S. West Coast creates major challenges to the region’s economy and environment, as evidenced by the recent California drought. This variability is strongly influenced by atmospheric rivers (AR), which deliver much of the precipitation along the U.S. West Coast and can cause flooding, and by aerosols (from local sources and transported from remote continents and oceans) that modulate clouds and precipitation. A better understanding of these processes is needed to reduce uncertainties in weather predictions and climate projections of droughts and floods, both now and under changing climate conditions.To address these gaps a group of meteorologists, hydrologists, climate scientists, atmospheric chemists, and oceanographers have created an interdisciplinary research effort, with support from multiple agencies. From 2009-2011 a series of field campaigns (CalWater 1) collected atmospheric chemistry, cloud microphysics and meteorological measurements in California and associated modeling and diagnostic studies were carried out. Based on remaining gaps, a vision was developed to extend these studies offshore over the Eastern North Pacific and to enhance land based measurements from 2014-2018 (CalWater 2). The data set and selected results from CalWater 1 are summarized here. The goals of CalWater-2, and measurements to date, are then described. CalWater is producing new findings and exploring new technologies to evaluate and improve global climate models and their regional performance and to develop tools supporting water and hydropower management. These advances also have potential to enhance hazard mitigation by improving near-term weather prediction and subseasonal and seasonal outlooks.

Swiss electricity statistics 2007; Schweizerische Elektrizitaetsstatistik 2007/Statistique suisse de l'electricite 2007

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-07-01

This comprehensive report made by the Swiss Federal Office of Energy (SFOE) presents the statistics on electricity production and usage in Switzerland for the year 2007. First of all, an overview of Switzerland's electricity supply in 2007 is presented. Details are noted of the amounts generated by different sources including nuclear, hydro-power, storage schemes and thermal power stations as well as energy transfer with neighbouring countries. A second chapter takes a look at the balance of imports and exports with illustrative flow diagrams along with tables for total figures from 1950 through to 2007. For the summer and winter periods, figures from 1997 to 2007 are presented. The third chapter examines the production of electricity in the various types of power stations and the developments over the years 1950 to 2007, whereby, for example, statistics on regional generation and power station type are looked at. The fourth chapter looks at electricity consumption in various sectors from 1984 to 2007 and compares the figures with international data. The fifth chapter looks at generation, consumption and loading on particular, selected days and chapter six considers energy exchange with Switzerland's neighbours. Chapter seven takes a look at possibilities for extending generation facilities in the period up to 2014.

Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik

ESN information bulletin. European science notes information bulletin reports on current European/Middle eastern science

Energy Technology Data Exchange (ETDEWEB)

Orendorf, C.R.

1989-10-01

The European Science Notes Information Bulletin (ESNIB) 89-09 is a compilation of reports on recent developments in European science of specific interest to the U.S. research and development community, and is issued in support of the mission of the Office of Naval Research European Office. Issue Number 89-09, in addition to European area news, notes, and abstracts, contains reports in the fields of Acoustics, Computer Science, Condensed-Matter Physics, Materials Science, Mathematics, Physics, Psychology, and Solid-State Physics. It is not intended to be part of the scientific literature. The value of the ESNIB to Americans is to call attention to current activity in European science and technology and to identify the institutions and people responsible for these efforts. The ESNIB authors are primarily ONREUR staff members; other reports are prepared by or in cooperation with staff members of the USAF European Office of Aero space Research and Development or the U.S. Army Research, Development and Standardization Group. Scientists from the U.S. who are traveling in Europe may also be invited to submit reports.

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

CERN Multimedia

Maximilien Brice

2007-01-01

Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

Enrique Balech Capdeville (1912–2007)

Digital Repository Service at National Institute of Oceanography (India)

Bhat, S.R.

sciences, specializing in marine plankton, at the Instituto Superior del Profesorado ‘J. V. González’ in Buenos Aires. At the age of 25, he became the Chief of the Laboratory of Protistology of the Museo Argentino de Ciencias Naturales ‘Bernar- dino... to the understand- ing of red tide events. His popular articles in the local language, and the book Geocidio’ La destrucción del Planeta published in 1978, speak about his concern for the deteriorating environ- ment. Balech passed away on 26 August 2007, a...

Mutual Events in the Uranian satellite system in 2007

Science.gov (United States)

Arlot, J. E.

2008-09-01

problem due to the "pole-on" observation of this system and shows the necessity to improve the knowledge of the inclinations of the orbits of the satellites since the positions in longitudes are better determined using recent astrometric observations. Other observations performed during the equinox At the same time of the observation of mutual events, direct imaging was made allowing astrometric measurements of the positions of most of the Uranian satellites including the small inner ones. As a result, it appears that the model published by Showalter and Lissauer [3] provides very small residuals showing a high quality. Making observations after the equinox on Uranus During the next five years, when the Uranian system will be seen from its equatorial plane, astrometric EPSC Abstracts, Vol. 3, EPSC2008-A-xxxx (Abstract number will be completed later on), 2008 European Planetary Science Congress, Author(s) 2008 EPSC Abstracts, Vol. 3, EPSC2008-A-00523, 2008 European Planetary Science Congress, Author(s) 2008 observations are urged to be made being the lonely period where observations provide information on the inclinations of the orbits of the satellites. The equinox on Jupiter and Saturn in 2009 The equinox on Jupiter will occur on June 22, 2009 allowing events as for the Uranian system. Since the opposition of Jupiter occurs on August 14, 2009, observations should be numerous. The negative declination of Jupiter will encourage the observers to use southern sites. The predictions of the mutual events has been made [4] and are also available at the web address: http://www.imcce.fr/phemu09. The equinox on Saturn will occur on August 12, 2009 allowing events as for the Uranian and Jovian systems. Since the opposition occurs on March 9, 2009, observations should be difficult to make and a special effort has to be made by the observers. The declination of Saturn is favourable for both hemispheres. Such event occurs every 14 years and the satellites are fainter than the Jovian

Climate Change: Science, Health and the Environment

Centers for Disease Control (CDC) Podcasts

2007-04-10

Climate Change: Science, Health and the Environment Howard Frumkin, MD, DrPH, Director of CDC's National Center for Environmental Health/Agency for Toxic Substances and Disease Registry, discusses the science of climate change, the potential for shifts in the natural world to affect our wellbeing, and the challenges of emerging issues in environmental health.  Created: 4/10/2007 by CDC National Center for Environmental Health.   Date Released: 4/13/2007.

It's science after all, Homer! (Italian original version

Directory of Open Access Journals (Sweden)

Daniele Gouthier

2007-12-01

Full Text Available Within just a few months, new releases in the world of publishing have seen two books dealing with science and The Simpsons, one published in the US and the other in Italy: last spring, What's science ever done for us? by Paul Halpern (John Wiley & Sons, New York 2007 and, this autumn, La scienza dei Simpson by Marco Malaspina (Sironi Editore, Milano 2007.

Control System for ATLAS TileCal HVRemote boards

CERN Document Server

AUTHOR|(SzGeCERN)739751; The ATLAS collaboration; Gurriana, Luis; Oleiro Seabra, Luis Filipe; Evans, Guiomar; Gomes, Agostinho; Maio, Amelia; Pinto Silva Rato, Catia Sofia; Almendra Sabino, Joao Maria; Augusto, Jose

2017-01-01

One of the proposed solutions for upgrading the high voltage (HV) system of TileCal, the ATLAS central hadron calorimeter, consists in removing the HV regulation boards from the detector and deploying them in a low-radiation room where there is permanent access for maintenance. This option requires many ∼100 m long HV cables but removes the requirement of radiation hard boards. This solution simplifies the control system of the HV regulation cards (called HVRemote). It consists of a Detector Control System (DCS) node linked to 256 HVRemote boards through a tree of Ethernet connections. Each HVRemote includes a smart Ethernet transceiver for converting data and commands from the DCS into serial peripheral interface (SPI) signals routed to SPI-capable devices in the HVRemote. The DCS connection to the transceiver and the control of some SPI-capable devices via Ethernet has been tested successfully. A test board (HVRemote-Ctrl) with the interfacing sub-system of the HVRemote was fabricated. It is being tested ...

Calculation of the TileCal magnetic forces using 3D Tosca model

International Nuclear Information System (INIS)

Morozov, N.A.; Samsonov, E.V.; Vorozhtsov, S.B.; Nessi, M.

1998-01-01

The purpose of the given paper is to contribute to the new summary (taking into account the latest information) of magnetic forces, acting on various parts of the TileCal of the ATLAS detector (LHC, CERN). To get an impression of the field distribution in the vicinity of the objects under consideration of existing 3D Tosca field model of the detector was used. The detailed distribution of forces along the border of various parts of the system, derived here, is valuable for understanding the mechanics of system performance

2018-05-05T09:36:39Z https://www.ajol.info/index.php/all/oai oai:ojs ...

African Journals Online (AJOL)

article/15613 2018-05-05T09:36:39Z dai:ART Plasma Lipid Profile and Target Organ Effect of Theobromine Extracts from Cocoa in Wistar Rats Eteng, M. U.; Department of Biochemistry, College of Medical Sciences, University of Calabar, P. M. B. ...

Produtividade, pressão e humilhação no trabalho: os trabalhadores e as novas fábricas de calçados no Ceará

Directory of Open Access Journals (Sweden)

Raquel Maria Rigotto

Full Text Available O objetivo deste artigo é mostrar o modo como as práticas organizacionais e a cultura dos locais de trabalho podem levar a experiências de humilhação e a situações constrangedoras no trabalho. A discussão baseia-se em entrevistas realizadas no decorrer de 2007, com 20 trabalhadores de três fábricas de calçados localizadas no Ceará. A análise de conteúdo das entrevistas indica que, apesar da humilhação e do constrangimento serem formas de violência conduzidas por indivíduos investidos de poder e autoridade na empresa, essas práticas transcendem as relações interpessoais e estão relacionadas às políticas de gestão organizacional centradas no estabelecimento de metas de produção a serem cumpridas pelos trabalhadores. As políticas determinam quanto e como produzir e, ao mesmo tempo, as relações interpessoais que se estabelecem dentro das fábricas.

PREFACE: International Symposium on `Vacuum Science and Technology' (IVS 2007)

Science.gov (United States)

Mittal, K. C.; Gupta, S. K.

2008-03-01

The Indian Vacuum Society (established in 1970) has organized a symposium every alternate year on various aspects of vacuum science and technology. There has been considerable participation from R & D establishments, universities and Indian industry in this event. In view of the current global scenario and emerging trends in vacuum technology, this year, the executive committee of IVS felt it appropriate to organize an international symposium at Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 from 29-30 November 2007. This symposium provided a forum for exchange of information among vacuum scientists, technologists and industrialists on recent advances made in the areas of large vacuum systems, vacuum production, its measurement and applications in industry, and material processing in vacuum. Vacuum science and technology has made vital contributions in high tech areas like space, high energy particle accelerators, large plasma systems, electronics, thin films, melting and refining of metals, extraction and processing of advanced materials etc. The main areas covered in the symposium were the production and measurement of vacuums, leak detection, large vacuum systems, vacuum metallurgy, vacuum materials and processing inclusive of applications of vacuum in industry. Large vacuum systems for high energy particle accelerators, plasma devices and light sources are of special significance for this symposium. Vacuum evaporation, hard coatings, thin films, joining techniques, sintering, melting and heat treatment, furnaces and thermo dynamics are also covered in this symposium. There were eighteen invited talks from the best experts in the respective fields and more than one hundred contributed papers. This fact itself indicates the interest that has been generated amongst the scientists, technologists and industrialists in this field. In view of the industrial significance of the vacuum technology, an exhibition of vacuum and vacuum processing related

Constraints on primary and secondary particulate carbon sources using chemical tracer and 14C methods during CalNex-Bakersfield

Data.gov (United States)

U.S. Environmental Protection Agency — The present study investigates primary and secondary sources of organic carbon for Bakersfield, CA, USA as part of the 2010 CalNex study. The method used here...

Target objectives in Spanish Marine Science within the European context (2003-2007

Directory of Open Access Journals (Sweden)

Beatriz Morales-Nin

2009-03-01

Full Text Available The analysis of the marine projects funded by the Spanish RTD funding agency between 2003 and 2007 in the framework of the European policies, showed that although the funds available have increased (232 projects and 33 Million € from 2003 to 2007 there are still research and strategic areas that are not covered. The relevance of marine related services and economic revenues for Spain requires that a strategy is developed to address the challenges that are emerging due to the growing competing uses of the sea, which include maritime transport, fishing, aquaculture, leisure activities, off-shore energy production and other forms of seabed exploitation. By helping to develop a more sophisticated understanding of the impact of human activities on marine systems, scientific research and technology may provide the key to carrying out sea-based activities without degrading the environment, and to predicting and mitigating as far as possible the effects of climate change.

Characterization of emissions sources in the California-Mexico Border Region during Cal-Mex 2010

Science.gov (United States)

Zavala, M. A.; Lei, W.; Li, G.; Bei, N.; Barrera, H.; Tejeda, D.; Molina, L. T.; Cal-Mex 2010 Emissions Team

2010-12-01

The California-Mexico border region provides an opportunity to evaluate the characteristics of the emission processes in rapidly expanding urban areas where intensive international trade and commerce activities occur. Intense anthropogenic activities, biomass burning, as well as biological and geological sources significantly contribute to high concentration levels of particulate matter (PM), polycyclic aromatic hydrocarbons (PAHs), nitrogen oxides (NOx), volatile organic compounds (VOCs), air toxics, and ozone observed in the California-US Baja California-Mexico border region. The continued efforts by Mexico and US for improving and updating the emissions inventories in the sister cities of San Diego-Tijuana and Calexico-Mexicali has helped to understand the emission processes in the border region. In addition, the recent Cal-Mex 2010 field campaign included a series of measurements aimed at characterizing the emissions from major sources in the California-Mexico border region. In this work we will present our analyzes of the data obtained during Cal-Mex 2010 for the characterization of the emission sources and their use for the evaluation of the recent emissions inventories for the Mexican cities of Tijuana and Mexicali. The developed emissions inventories will be implemented in concurrent air quality modeling efforts for understanding the physical and chemical transformations of air pollutants in the California-Mexico border region and their impacts.

Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) representative H. Ikukawa visiting ATLAS experiment with Collaboration Spokesperson P. Jenni, KEK representative T. Kondo and Advisor to CERN DG J. Ellis on 15 May 2007.

CERN Multimedia

Maximilien Brice

2007-01-01

Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) representative H. Ikukawa visiting ATLAS experiment with Collaboration Spokesperson P. Jenni, KEK representative T. Kondo and Advisor to CERN DG J. Ellis on 15 May 2007.

Temperature studies of the TileCal ROD G-Links for the validation of the air-cooling system

CERN Document Server

Valero, A; Abdallah, J; Castillo, V; Cuenca, C; Ferrer, A; Fullana, E; González, V; Higón, E; Munar, A; Poveda, J; Salvachúa, B; Sanchis, E; Solans, C; Torres, J; Valls, J A

2007-01-01

In this paper we show the results of the temperature studies performed on the TileCal ROD G-Links in order to validate the air-cooling system. In the first part of the note we present results on the characterization tests of the temperature monitor system for the G-Link chips of the TileCal ROD motherboard, performed at IFIC-Valencia. We report on the performance of the temperature behavior system and some cooling studies of a single ROD motherboard. We conclude that the present system can be successfully used to online monitor the temperature of the ROD G-Links. In the second part we show the results of the studies performed with multiple RODs in a standard 9U VME crate in the laboratory at IFIC, and in their final location in the ATLAS cavern. We conclude that the air-cooling provided by the standard VME crate fans is enough to keep the temperature of the G-Links well within specifications.

CEA financial report 2007; CEA rapport financier 2007

Energy Technology Data Exchange (ETDEWEB)

NONE

2007-07-01

This document provides financial data on the CEA for the year 2007. The management report (budget, resources, expenditures) and the accounting are detailed. The main management events of the year 2007 are presented. (A.L.B.)

77 FR 77183 - Union Pacific Railroad Company-Abandonment of Freight Easement Exemption-in Alameda County, Cal...

Science.gov (United States)

2012-12-31

...--Abandonment of Residual Common Carrier Obligation Exemption--in Alameda County, Cal. (San Jose Industrial Lead... easement on, and for SCVTA, the owner of the line, to abandon its residual common carrier obligation for, a portion of the San Jose Industrial Lead between mileposts 5.38 and 7.35 near the Warm Springs freight rail...

Fornecimento de cálcio para plantas de eucalyptus saligna por meio de aplicação de resíduo industrial lama de cal

Directory of Open Access Journals (Sweden)

Marcia Aparecida Simonete

2013-10-01

Full Text Available O resíduo industrial lama de cal, originado da produção de papel kraft branqueada de eucalipto, apresenta em sua composição quantidade considerável de cálcio (Ca, o que pode contribuir para reduzir o consumo de fertilizantes em plantios florestais. Com o objetivo de avaliar o efeito da lama de cal como fonte de Ca e seus efeitos sobre a disponibilidade de nutrientes e produção de matéria seca da parte aérea de plantas de eucalipto, foram conduzidos dois ensaios em vasos, em casa de vegetação, na área de pesquisa da Klabin Florestal do Paraná. Os solos utilizados foram um Neossolo Quartzarênico órtico (RQo e um Nitossolo Vermelho eutroférrico (NV. Os tratamentos constituíram-se de duas fontes de Ca, calcário dolomítico e lama de cal, e de uma testemunha, sendo identificados como: RQo testemunha, RQo calcário e RQo lama de cal; e NV testemunha, NV calcário e NV lama de cal. O delineamento experimental utilizado foi inteiramente casualizado, com quatro repetições. Para tanto, plantas de Eucalyptus saligna foram mantidas por 126 dias em vasos. Quantificou-se a produção de matéria seca e realizaram-se as análises de folhas e dos solos, por ocasião da coleta das plantas. Os dados revelaram que tanto a adição de calcário dolomítico quanto a lama de cal promoveram o fornecimento de Ca para as plantas de eucalipto, proporcionando aumentos na produção de matéria seca. Os teores de Ca e Na nas folhas de eucalipto foram acrescidos com a adição do resíduo ao solo, em comparação com o tratamento com calcário dolomítico, enquanto os teores de N, P, K e S foram semelhantes. As plantas cultivadas nos tratamentos RQo testemunha e RQo lama de cal apresentaram teores foliares de Mg abaixo da faixa considerada adequada. A adição de lama no solo elevou o pH e as concentrações de Ca e de Na, reduziu o Al trocável e não influenciou na disponibilidade de Mg, fato que pode proporcionar deficiência de Mg às plantas, em

2007 LDRD ANNUAL REPORT

Energy Technology Data Exchange (ETDEWEB)

French, T

2008-12-16

I am pleased to present the fiscal year 2007 Laboratory Directed Research and Development (LDRD) annual report. This represents the first year that SRNL has been eligible for LDRD participation and our results to date demonstrate we are off to an excellent start. SRNL became a National Laboratory in 2004, and was designated the 'Corporate Laboratory' for the DOE Office of Environmental Management (EM) in 2006. As you will see, we have made great progress since these designations. The LDRD program is one of the tools SRNL is using to enable achievement of our strategic goals for the DOE. The LDRD program allows the laboratory to blend a strong basic science component into our applied technical portfolio. This blending of science with applied technology provides opportunities for our scientists to strengthen our capabilities and delivery. The LDRD program is vital to help SRNL attract and retain leading scientists and engineers who will help build SRNL's future and achieve DOE mission objectives. This program has stimulated our research staff creativity, while realizing benefits from their participation. This investment will yield long term dividends to the DOE in its Environmental Management, Energy, and National Security missions.

Fellowship | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Fellowship. Fellow Profile. Elected: 2007 Section: Plant Sciences. Grover, Prof. Anil Ph.D. (IARI), FNASc, FNAAS, FNA. Date of birth: 15 August 1958. Specialization: Plant Abiotic Stress Responses, Plant Biotechnology, Molecular Biology and Crop Sciences Address: Professor, Department of Plant Molecular Biology, ...

Egyptian Journal of Biomedical Sciences

African Journals Online (AJOL)

The Egyptian Journal of Biomedical Sciences publishes in all aspects of biomedical research sciences. Both basic and clinical research papers are welcomed. Vol 23 (2007). DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT Subscription or Fee Access. Table of Contents. Articles. Phytochemical And ...

Assessment of selected contaminants in streambed- and suspended-sediment samples collected in Bexar County, Texas, 2007-09

Science.gov (United States)

Wilson, Jennifer T.

2011-01-01

Elevated concentrations of sediment-associated contaminants are typically associated with urban areas such as San Antonio, Texas, in Bexar County, the seventh most populous city in the United States. This report describes an assessment of selected sediment-associated contaminants in samples collected in Bexar County from sites on the following streams: Medio Creek, Medina River, Elm Creek, Martinez Creek, Chupaderas Creek, Leon Creek, Salado Creek, and San Antonio River. During 2007-09, the U.S. Geological Survey periodically collected surficial streambed-sediment samples during base flow and suspended-sediment (large-volume suspended-sediment) samples from selected streams during stormwater runoff. All sediment samples were analyzed for major and trace elements and for organic compounds including halogenated organic compounds and polycyclic aromatic hydrocarbons (PAHs). Selected contaminants in streambed and suspended sediments in watersheds of the eight major streams in Bexar County were assessed by using a variety of methods—observations of occurrence and distribution, comparison to sediment-quality guidelines and data from previous studies, statistical analyses, and source indicators. Trace elements concentrations were low compared to the consensus-based sediment-quality guidelines threshold effect concentration (TEC) and probable effect concentration (PEC). Trace element concentrations were greater than the TEC in 28 percent of the samples and greater than the PEC in 1.5 percent of the samples. Chromium concentrations exceeded sediment-quality guidelines more frequently than concentrations of any other constituents analyzed in this study (greater than the TEC in 69 percent of samples and greater than the PEC in 8 percent of samples). Mean trace element concentrations generally are lower in Bexar County samples compared to concentrations in samples collected during previous studies in the Austin and Fort Worth, Texas, areas, but considering the relatively

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

The performance of different cumulus parameterization schemes in simulating the 2006/2007 southern peninsular Malaysia heavy rainfall episodes. Wan Ahmad Ardie Khai ... Malaysia. Earth Observation Centre, Faculty of Social Sciences and Humanities, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia.

Navigating the financial crisis in Helvetic Waters: An analysis of the banking sector (2007-09

Directory of Open Access Journals (Sweden)

Elisabeth Paulet

2011-06-01

Full Text Available As has been argued throughout this paper, the different way in which banks have been affected by the crisis is closely linked to their distinct business model. Consequently, the characteristic structure of the balance sheet in big banks and ethical banks is correlated with their divergent dynamic during the crisis. While the financial turmoil has left the business approach of ethical banks unchanged, as evidenced in the striking stability of their balance sheet from 2007 to 2009, the pattern shown by big banks has substantially changed over this same period. These developments would tend to suggest the need to reform the business model of big banks. There is no clear empirical evidence that a banking system with a large number of small institutions would be any more stable than the system as it currently stands. Besides, financing certain big projects would always require the existence of large international banks. Both types of financial institutions are in fact complementary. How to regulate the banking and financial sector is thus a complex and multifaceted issue. One cannot impose the same requirements on big international-oriented banks and small domestic banks. As this paper has tried to demonstrate, both have a distinct business model.

Are Banks Passive Liquidity Backstops? Deposit Rates and Flows during the 2007-2009 Crisis

OpenAIRE

Viral V. Acharya; Nada Mora

2012-01-01

Can banks maintain their advantage as liquidity providers when they are heavily exposed to a financial crisis? The standard argument - that banks can - hinges on deposit inflows that are seeking a safe haven and provide banks with a natural hedge to fund drawn credit lines and other commitments. We shed new light on this issue by studying the behavior of bank deposit rates and inflows during the 2007-09 crisis. Our results indicate that the role of the banking system as a stabilizing liquidit...

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

All correspondence regarding subscription within India should be addressed to: The Circulation Department Indian Academy of Sciences, C V Raman Avenue, Bengaluru 560 080, India. Download the Order Form (2018): Institution and Personal. Please Note: Starting 2007, all International Subscriptions are handled by ...

Internalization of Malaysian mathematical and computer science journals

OpenAIRE

Zainab, A. N.

2008-01-01

The internationalization characteristics of two Malaysian journals, Bulletin of the Malaysian Mathematical Sciences Society ( indexed by ISI) and the Malaysian Journal of Computer Science ( indexed by Inspec and Scopus) is observed. All issues for the years 2000 to 2007 were looked at to obtain the following information, (i) total articles published between 2000 and 2007; (ii) the distribution of foreign and Malaysian authors publishing in the journals; (iii) the distribution of articles by c...

Chronostratigraphy in karst records from the Epipaleolithic to the Mid/Early Neolithic (c. 13.0-6.0 cal ka BP) in the Catalan Coastal Ranges of NE Iberia: environmental changes, sedimentary processes and human activity

Science.gov (United States)

Bergadà, M. Mercè; Cervelló, Josep M.; Edo, Manel; Cebrià, Artur; Oms, F. Xavier; Martínez, Pablo; Antolín, Ferran; Morales, Juan Ignacio; Pedro, Mireia

2018-03-01

The stratigraphic, sedimentary and palaeoenvironmental features reflected in cavities in the Catalan Coastal Ranges of NE Iberia (Can Sadurní and Guineu caves) characterize the periods of pronounced climatic and human complexity that occurred c. 13.0-6.0 cal ka BP. This includes the stages of the Younger Dryas and Mid/Early Holocene, the latter being one of the periods of so-called Rapid Climatic Changes (RCCs). These caves, like others in Mediterranean contexts, are the result of an old duct originating in the saturated zone of the karst system and open to the outside; recording a succession of different detrital and anthropic episodes of the Epipaleolithic, Mesolithic and Neolithic communities. From this study it can be seen that paleoclimatic events do not always present clear signals in the karst records, especially c. 12.7-7.4 cal ka BP, corresponding to the Epipaleolithic and Mesolithic. It is characterized by a stratigraphic discontinuity in which there are phases with predominantly detrital sedimentation alternating with hiatus intervals. Detrital sedimentation formed by fine material colluvium with gravitational movements or solifluction processes in fresh and humid conditions. It appears in the following chronological intervals: 12.7-12.2 cal ka BP, 11.5/11.1-10.7/10.4 cal ka BP and 8.2-8.0 cal ka BP (less humid). Hiatus phases are represented in the rest of the sequence up to c. 7.4 cal ka BP. From the sedimentary point of view these stages of hiatus are indicative of phases of stability or lack of episodes with seasonal contrasts; a fact that would cause interruptions to detrital deposition in the interior of the caves. In contrast, in the period c. 7.4 to 6.0 cal ka BP, attributed to the Middle and Early Neolithic, there is a certain stratigraphic continuity. From the sedimentary point of view it is distinguished by a variability of processes that responds to accumulative episodes of short duration characteristic of morphogenesis of the slopes in an

Morteros de cal : aplicación en el patrimonio histórico

OpenAIRE

Cazalla Vázquez, Olga

2013-01-01

Los morteros de cal, ha sido un material de construcción muy utilizado en sus múltiples funciones a lo largo de la historia. Se construía tras una selección especialmente cuidada de sus materias primas y eran totalmente compatibles con el resto de elementos de fábrica. Hoy en día, se tiende a reemplazarlos por morteros de cemento, que aunque tienen muy buenas propiedades físico-mecánicas, son totalmente incompatibles con los demás elementos de fábrica, ya que además producen un fuerte impacto...

Book review: H. Haeupler & T. Muer: Bildatlas der Farn- und Blütenpflanzen Deutschlands; Eugen Ulmer Verlag, Stuttgart, 2007, 789 pp

Czech Academy of Sciences Publication Activity Database

Petřík, Petr

2007-01-01

Roč. 42, č. 3 (2007), s. 237-239 ISSN 1211-9520 Institutional support: RVO:67985939 Keywords : distribution atlas * vascular plants * Germany Subject RIV: EF - Botanics OBOR OECD: Plant science s, botany Impact factor: 1.133, year: 2007

Sadhana | Indian Academy of Sciences

Indian Academy of Sciences (India)

It is a leading journal of Engineering Sciences in India since 1978. From 2007, Sadhana is co-published with the International Publisher, m/s Springer. ... computer science, Energy systems including solar and nuclear technologies, Smart cities, ... papers, or preliminary results of significant current research of wide interest.

Set Sail with Science

Science.gov (United States)

Soutar, Vicki; Parr, Rachael; Prescott, Ron; Di Iorio, Daniela

2010-01-01

In 2007 and 2008, three science teachers participated in research "cruises" to the Juan de Fuca Ridge off the coast of Washington. This opportunity was made possible by a National Science Foundation (NSF) CAREER grant awarded to Daniela Di Iorio, an oceanographer at the University of Georgia in Athens. The cruises helped renew their…

Science and Technology Review March 2007

International Nuclear Information System (INIS)

Radousky, H B

2007-01-01

This month's issue has the following articles: (1) Partnering to Enhance Americans Health--Commentary by Tomas Diaz de la Rubia; (2) Advancing the Frontiers in Cancer Research--Researchers at the University of California Davis Cancer Center and Lawrence Livermore are teaming up to fight cancer; (3) On the Leading Edge of Atmospheric Predictions--Continual research and development at the National Atmospheric Release Advisory Center help mitigate the consequences of toxic airborne hazards; (4) Climate and Agriculture: Change Begets Change--A Livermore researcher is using computer models to explore how a warmer climate may affect crop yields in California; (5) New Routes to High Temperatures and Pressures--With functionally graded density impactors composed of thin metal and polyethylene films, researchers can explore new areas of experimental physics; and (6) From Sound Waves to Stars: Teller's Contributions to Shock Physics--Edward Teller's interest in shock physics led to significant developments in both basic and applied science

Behavioural sciences at university of health sciences: the way forward

International Nuclear Information System (INIS)

Khan, J.S.; Mukhtar, O.; Tabasum, S.

2016-01-01

Background: The association of medical ethics with teaching and training and health profession has been informal, largely dependent on role modelling and the social contract of the physicians with the community that they abide by. This study was conducted to examine the effect, if any, of introducing the subject of Behavioural Sciences on students performance in the clinical years viva voce and patient interactions components of the examinations. Methods: A prospective study on four cohorts of students at UHS from 2007 to 2012 (8,155 candidates). Reliability was calculated through Cronbach Alpha. Linear Regression Analysis was applied to determine the relationship between the scores of Basic Medical Sciences, Behavioural Sciences and Forensic medicine with the viva voce and Structured Stations marks of the Clinical Sciences in OSCE. Gender and demographics analysis was also done. Results: Cronbach Alpha was 0.47, 0.63, 0.67 and 0.53 for the Papers of Behavioural Sciences from 2007 to 2010 respectively. Poor predictive value of Behavioural Sciences for performance in the clinical years viva voce and OSCE was identified. Basic Medical Sciences and Forensic Medicine were statistically significant predictors for the performance of female candidates in all four cohorts of the study (p<0.05). In Central Punjab, Behavioural Sciences statistically significantly predicted for better performance in all four cohorts of the study (p<0.05). Conclusion: It is premature to understand the results of Behavioural Sciences teaching at University of Health Sciences (UHS). We can still safely conclude that it can only have a positive sustained effect on the healthcare delivery systems and patient care in Pakistan if it is integrated within each subject and taught and learned not as a theoretical construct but rather an evaluation of one values within the code of conduct of medical professionalism in the larger context of the societal and cultural norms. (author)

The Use of Ambulatory Blood Pressure Monitoring Among Medicare Beneficiaries in 2007-2010

Science.gov (United States)

Shimbo, Daichi; Kent, Shia T; Diaz, Keith M; Huang, Lei; Viera, Anthony J; Kilgore, Meredith; Oparil, Suzanne; Muntner, Paul

2014-01-01

The US Centers for Medicaid and Medicare Services reimburses ambulatory blood pressure monitoring (ABPM) for suspected white coat hypertension. We estimated ABPM use between 2007 and 2010 among a 5% random sample of Medicare beneficiaries (≥ 65 years). In 2007, 2008, 2009 and 2010, the percentage of beneficiaries with ABPM claims was 0.10%, 0.11%, 0.10%, and 0.09% respectively. A prior diagnosis of hypertension was more common among those with versus without an ABPM claim (77.7% versus 47.0%). Among hypertensive beneficiaries, 95.2% of those with an ABPM claim were taking antihypertensive medication. Age 75-84 versus 65-74 years, having coronary heart disease, chronic kidney disease, multiple prior hypertension diagnoses, and having filled multiple classes of antihypertensive medication were associated with an increased odds for an ABPM claim among hypertensive beneficiaries. ABPM use was very low among Medicare beneficiaries and was not primarily used for diagnosing white coat hypertension in untreated individuals. PMID:25492832

Characterization of the influenza A H5N1 viruses of the 2008-09 outbreaks in India reveals a third introduction and possible endemicity.

Directory of Open Access Journals (Sweden)

Alok K Chakrabarti

Full Text Available Widespread infection of highly pathogenic avian influenza A H5N1 was reported from backyard and commercial poultry in West Bengal (WB, an eastern state of India in early 2008. Infection gradually spread to Tripura, Assam and Sikkim, the northeastern states, with 70 outbreaks reported between January 2008 and May 2009. Whole genome sequence analysis of three isolates from WB, one isolate from Tripura along with the analysis of hemagglutinin (HA and neuraminidase (NA genes of 17 other isolates was performed during this study. In the HA gene phylogenetic tree, all the 2008-09 Indian isolates belonged to EMA3 sublineage of clade 2.2. The closest phylogenetic relationship was found to be with the 2007-09 isolates from Bangladesh and not with the earlier 2006 and 2007 Indian isolates implying a third introduction into the country. The receptor-binding pocket of HA1 of two isolates from WB showed S221P mutation, one of the markers predicted to be associated with human receptor specificity. Two substitutions E119A (2 isolates of WB and N294S (2 other isolates of WB known to confer resistance to NA inhibitors were observed in the active site of neuraminidase. Several additional mutations were observed within the 2008-09 Indian isolates indicating genetic diversification. Overall, the study is indicative of a possible endemicity in the eastern and northeastern parts of the country, demanding active surveillance specifically in view of the critical mutations that have been observed in the influenza A H5N1 viruses.

Quality of Diabetes Care in Germany Improved from 2000 to 2007 to 2014, but Improvements Diminished since 2007. Evidence from the Population-Based KORA Studies.

Directory of Open Access Journals (Sweden)

Michael Laxy

Full Text Available Little is known about the development of the quality of diabetes care in Germany. The aim of this study is to analyze time trends in patient self-management, physician-delivered care, medication, risk factor control, complications and quality of life from 2000 to 2014.Analyses are based on data from individuals with type 2 diabetes of the population-based KORA S4 (1999-2001, n = 150, F4 (2006-2008, n = 203, FF4 (2013/14, n = 212 cohort study. Information on patient self-management, physician-delivered care, medication, risk factor control and quality of life were assessed in standardized questionnaires and examinations. The 10-year coronary heart disease (CHD risk was calculated using the UKPDS risk engine. Time trends were analyzed using multivariable linear and logistic regression models adjusted for age, sex, education, diabetes duration, and history of cardiovascular disease.From 2000 to 2014 the proportion of participants with type 2 diabetes receiving oral antidiabetic/cardio-protective medication and of those reaching treatment goals for glycemic control (HbA1c<7%, 60% to 71%, p = 0.09, blood pressure (<140/80 mmHg, 25% to 69%, p<0.001 and LDL cholesterol (<2.6 mmol/l, 13% to 27%, p<0.001 increased significantly. However, improvements were generally smaller from 2007 to 2014 than from 2000 to 2007. Modeled 10-year CHD risk decreased from 30% in 2000 to 24% in 2007 to 19% in 2014 (p<0.01. From 2007 to 2014, the prevalence of microvascular complications decreased and quality of life increased, but no improvements were observed for the majority of indicators of self-management.Despite improvements, medication and risk factor control has remained suboptimal. The flattening of improvements and deteriorations in quality of (self- care since 2007 indicate that more effort is needed to improve quality of care and patient self-management. Due to selection or lead time bias an overestimation of quality of care improvements cannot be ruled out.

Longitudinal Association Of Alcohol Consumption To Periodontitis

DEFF Research Database (Denmark)

Kongstad, Johanne; Hach, Maria; Hvidtfeldt, Ulla Arthur

pocket depth (PPD) and calculation of clinical attachment level (CAL). Periodontitis was defined according to severe periodontitis as ≥2 interproximal sites with CAL ≥6mm (not on the same tooth) and ≥1 interproximal site with PPD ≥5mm (Page & Eke 2007). Alcohol consumption and relevant covariates were...

Efecto antiinflamatorio preclínico del polvo seco de Caléndula officinalis

OpenAIRE

Núñez Figueredo, Yanier; Montero Alarcón, Claudia; Agüero Fernández, Sara; Muñoz Cernuda, Adriana

2007-01-01

Para demostrar la actividad antiinflamatoria del polvo seco Caléndula officinalis secado por atomización se emplearon dosis de 50, 150 y 450 mg/Kg y se evaluó el efecto sobre la inflamación aguda provocada por carragenina, dextrán, histamina y serotonina y granuloma inducido por discos de algodón en ratas y edema auricular inducido por aceite de crotón en ratones. El polvo seco mostró efecto inhibitorio sobre los diferentes modelos empleados sin afectar el peso del timo y las glándulas suprar...

Study of the $B^{0}\\rightarrow\\chi_{c1,2} K^{*0}$ decays at the LHCb experiment

CERN Document Server

Polyakov, Ivan

In this research, the ratios of the branching fractions of the $B^{0}\\rightarrow\\chi_{c1} K^{*0}$, $B^{0}\\rightarrow\\chi_{c2} K^{*0}$ and $B^{0}\\rightarrow J/\\psi K^{*0}$ decays are measured: \\begin{equation*} \\begin{array}{lll} \\dfrac{{\\cal B}(B^{0}\\rightarrow \\chi_{c1} K^{*0})}{{\\cal B}(B^{0}\\rightarrow J/\\psi K^{*0})} &=& (19.8~\\pm1.1~(stat)\\pm1.2~(syst)\\pm0.9\\,({\\cal B}_{\\chi_{c1}}))\\times 10^{-2}, \

EST Table: FS747376 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available milar to xaa-pro dipeptidase pepd/pepq(e.coli) [Nasonia vitripennis] 10/09/08 58 %/234 aa FBpp0241989|DwilGK...AP004775 10/09/10 low homology 10/09/10 54 %/235 aa gi|189233738|ref|XP_971576.2| PREDICTED: similar to xaa-pro dipeptidase pepd/pepq(e.coli) [Tribolium castaneum] FS768084 caL- ...

Trends of Science Education Research: An Automatic Content Analysis

Science.gov (United States)

Chang, Yueh-Hsia; Chang, Chun-Yen; Tseng, Yuen-Hsien

2010-01-01

This study used scientometric methods to conduct an automatic content analysis on the development trends of science education research from the published articles in the four journals of "International Journal of Science Education, Journal of Research in Science Teaching, Research in Science Education, and Science Education" from 1990 to 2007. The…

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Special Issues. Bulletin of Materials Science. pp 199-584 Volume 31 Issue 3 June 2008. Proceedings of the 'National Review and Coordination Meeting on Nanoscience and Nanotechnology', Hyderabad, 2007. Editor: S. B. Krupanidhi Guest Editors: G. Sundararajan and Tata Narasinga Rao. pp 547-651 Volume 29 Issue ...

Third quarter 2007 sales increased by nearly 10%. Sales as at 30 September 2007: -6.5% compared to -11 % as at 30 June 2007. 2007 financial objective confirmed

International Nuclear Information System (INIS)

2007-01-01

Paris, 30 October 2007 - During the third quarter of 2007, The Gaz de France Group achieved sales of euro 4,352 million, an increase of nearly 10 per cent compared to the third quarter of 2006. This growth reflects an improvement in the Group's business activities during the quarter in a background of almost neutral climatic conditions. Due to the good performance of the activities during the quarter, the change in sales over the nine first months of 2007 has improved to -6.5 per cent compared with -11 per cent over the first six months. As at 30 September 2007, Group sales amounted to euro 18,130 million compared to euro 19,391 million for the first nine months of 2006. In France, Group sales rose to euro 10,315 million. This was down by 7 per cent compared to the first nine months of 2006, mainly due to the exceptionally mild weather in the first half of 2007. Outside France, sales amount to euro 7,815 million, representing more than 40 per cent of Group sales. The third quarter of 2007 was also marked by the announcement, on 3 September 2007, of the new strategic direction of the planned merger with Suez. This project should be finalized as soon as possible during the first half of 2008. Gaz de France confirms its 2007 financial objective: '2007 will be a year of consolidation. The gross operating surplus should be in line with that of 2006'. This objective assumes average climate conditions during the last quarter of 2007

Third quarter 2007 sales increased by nearly 10%. Sales as at 30 September 2007: -6.5% compared to -11 % as at 30 June 2007. 2007 financial objective confirmed

Energy Technology Data Exchange (ETDEWEB)

NONE

2007-07-01

Paris, 30 October 2007 - During the third quarter of 2007, The Gaz de France Group achieved sales of euro 4,352 million, an increase of nearly 10 per cent compared to the third quarter of 2006. This growth reflects an improvement in the Group's business activities during the quarter in a background of almost neutral climatic conditions. Due to the good performance of the activities during the quarter, the change in sales over the nine first months of 2007 has improved to -6.5 per cent compared with -11 per cent over the first six months. As at 30 September 2007, Group sales amounted to euro 18,130 million compared to euro 19,391 million for the first nine months of 2006. In France, Group sales rose to euro 10,315 million. This was down by 7 per cent compared to the first nine months of 2006, mainly due to the exceptionally mild weather in the first half of 2007. Outside France, sales amount to euro 7,815 million, representing more than 40 per cent of Group sales. The third quarter of 2007 was also marked by the announcement, on 3 September 2007, of the new strategic direction of the planned merger with Suez. This project should be finalized as soon as possible during the first half of 2008. Gaz de France confirms its 2007 financial objective: '2007 will be a year of consolidation. The gross operating surplus should be in line with that of 2006'. This objective assumes average climate conditions during the last quarter of 2007.

CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

Science.gov (United States)

Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

2010-01-01

The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

GeNF - Experimental report 2007

Energy Technology Data Exchange (ETDEWEB)

Pranzas, P K; Schreyer, A; Willumeit, R [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Materialforschung

2008-11-05

At the Geesthacht Neutron Facility GeNF about 203 experiments were performed in 2007 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guests and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 70 contributions in the present annual experimental report for the year 2007. The contributions may contain one or also several combined experiments. During 2007 the GKSS research reactor FRG-1 achieved an operation time of 204 days at the full 5 MW reactor power providing a neutron flux of ca. 1.4 x 10{sup 14} thermal neutrons/cm{sup 2}s. In May/June 2007 the FRG-1 was upgraded with a new cold neutron source yielding a flux increase at the five instruments using cold neutrons of up to 40 %. The focus of the in house R and D work at GeNF instruments in 2007 was the characterisation of nano-structures in engineering materials, the analysis of stresses and textures in welds and technical structures at SANS-2, DCD, ARES-2 and TEX-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at NeRo, PNR, POLDI and ROeDI. The modern experiment control hardware and software based on LabView was continuously improved on all instruments. In the appendices I and II the experimental reports of the GKSS outstation at the FRM II are attached as well as of the GKSS outstation at DESY. At the neutron reflectometer REFSANS at FRM II measurements are possible using a broad range of the scattering vector with reflectivities up to 10{sup -7}. Three reports show the activities of GKSS in the field of texture measurement at the instrument STRESS-SPEC. The instrument HARWI II at DESY is accepted very well by the community and is overbooked in all fields

GeNF - Experimental report 2007

International Nuclear Information System (INIS)

Pranzas, P.K.; Schreyer, A.; Willumeit, R.

2008-01-01

At the Geesthacht Neutron Facility GeNF about 203 experiments were performed in 2007 by GKSS and by or for external users, partners or contractors. In most cases the measurements were performed and analysed in cooperation by the guests and by the GKSS staff or by the permanent external user group staff. The activities, which are based on a proposal procedure and on the in house R and D program, are reported in 70 contributions in the present annual experimental report for the year 2007. The contributions may contain one or also several combined experiments. During 2007 the GKSS research reactor FRG-1 achieved an operation time of 204 days at the full 5 MW reactor power providing a neutron flux of ca. 1.4 x 10 14 thermal neutrons/cm 2 s. In May/June 2007 the FRG-1 was upgraded with a new cold neutron source yielding a flux increase at the five instruments using cold neutrons of up to 40 %. The focus of the in house R and D work at GeNF instruments in 2007 was the characterisation of nano-structures in engineering materials, the analysis of stresses and textures in welds and technical structures at SANS-2, DCD, ARES-2 and TEX-2, the structural investigation of hydrogen containing substances such as polymers, colloids and biological macromolecules at SANS-1 as well as the characterisation of magnetic thin films at NeRo, PNR, POLDI and ROeDI. The modern experiment control hardware and software based on LabView was continuously improved on all instruments. In the appendices I and II the experimental reports of the GKSS outstation at the FRM II are attached as well as of the GKSS outstation at DESY. At the neutron reflectometer REFSANS at FRM II measurements are possible using a broad range of the scattering vector with reflectivities up to 10 -7 . Three reports show the activities of GKSS in the field of texture measurement at the instrument STRESS-SPEC. The instrument HARWI II at DESY is accepted very well by the community and is overbooked in all fields (tomography

Coordinated research activities: Annual report and statistics for 2007

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-07-15

In 2007, a total of Euro 6 606 194 were obligated for the Agency's Coordinated Research Activities (Euro 6 515 957 from the regular budget and Euro 90 237 from extrabudgetary resources). Most of the Coordinated Research Activities are carried out via Coordinated Research Projects (CRPs) which bring together research institutes in both developing and developed Member States to collaborate on research topics of common interest. At the end of 2007, work was being carried out on 115 CRPs, 37 in Major Programme 1 - Nuclear Power, Fuel Cycle and Nuclear Science, 71 in Major Programme 2 - Nuclear Techniques for Development and Environmental Protection, and 7 in Major Programme 3 - Nuclear Safety and Security. The total amount obligated for these activities in 2007 was 15% more than in 2006, largely due to the implementation of 28 new CRPs. At the end of 2007 work was being carried out under 976 contracts and 562 agreements with institutes in 110 Member States. 72% of the funds obligated for contracts in 2007 were in respect of institutions in developing countries, primarily in the areas of food and agriculture and human health. During 2007, 21% of the Chief Scientific Investigators participating in Agency CRPs were female researchers. Efforts will continue to increase the participation of women and younger researcher in the Coordinated Research Activities. The forty two completed CRPs evaluated in Appendix E resulted in 9 PhDs, one masters degree and in the publishing of about 800 articles and reports, scientific papers, proceedings of scientific conferences and contribution to international conferences, as well as 13 IAEA TECDOCs, and various scientific databases and websites. Detailed evaluation reports on the outputs, effectiveness, impact, recommended future action, and resulting publications of these completed CRPs are included in in Appendix E of this report. (author)

Coordinated research activities: Annual report and statistics for 2007

International Nuclear Information System (INIS)

2008-07-01

In 2007, a total of Euro 6 606 194 were obligated for the Agency's Coordinated Research Activities (Euro 6 515 957 from the regular budget and Euro 90 237 from extrabudgetary resources). Most of the Coordinated Research Activities are carried out via Coordinated Research Projects (CRPs) which bring together research institutes in both developing and developed Member States to collaborate on research topics of common interest. At the end of 2007, work was being carried out on 115 CRPs, 37 in Major Programme 1 - Nuclear Power, Fuel Cycle and Nuclear Science, 71 in Major Programme 2 - Nuclear Techniques for Development and Environmental Protection, and 7 in Major Programme 3 - Nuclear Safety and Security. The total amount obligated for these activities in 2007 was 15% more than in 2006, largely due to the implementation of 28 new CRPs. At the end of 2007 work was being carried out under 976 contracts and 562 agreements with institutes in 110 Member States. 72% of the funds obligated for contracts in 2007 were in respect of institutions in developing countries, primarily in the areas of food and agriculture and human health. During 2007, 21% of the Chief Scientific Investigators participating in Agency CRPs were female researchers. Efforts will continue to increase the participation of women and younger researcher in the Coordinated Research Activities. The forty two completed CRPs evaluated in Appendix E resulted in 9 PhDs, one masters degree and in the publishing of about 800 articles and reports, scientific papers, proceedings of scientific conferences and contribution to international conferences, as well as 13 IAEA TECDOCs, and various scientific databases and websites. Detailed evaluation reports on the outputs, effectiveness, impact, recommended future action, and resulting publications of these completed CRPs are included in in Appendix E of this report. (author)

Gale Digital Collections: Ray Abruzzi Interviewed by Luisa Calè and Ana Parejo Vadillo

Directory of Open Access Journals (Sweden)

Ray Abruzzi

2015-12-01

Full Text Available This interview addresses the commercial dimensions of the nineteenth-century digital archive. Luisa Calè and Ana Parejo Vadillo ask Ray Abruzzi, Vice President and Publisher for 'Gale Digital Collections' at Gale, about the company’s origins, its commercial approach to digital collections, and the challenges of digitization. In the context of the open access movement, the architecture of participation, and crowdsourcing, Abruzzi discusses how the company works with academic partners and interfaces with other digital libraries and platforms.

Deep water ventilation in the northwestern North Pacific during the last deglaciation and the early Holocene (15-5 cal. kyr B.P.) based on AMS 14C dating

International Nuclear Information System (INIS)

Minoshima, Kayo; Kawahata, Hodaka; Irino, Tomohisa; Ikehara, Ken; Aoki, Kaori; Uchida, Masao; Yoneda, Minoru; Shibata, Yasuyuki

2007-01-01

The difference between benthic and planktonic foraminifera radiocarbon (B-P 14 C) age differences in core PC6 (40 o 23.89' N, 143 o 29.87' E) retrieved from the northwestern North Pacific provide a clue to the reconstruction of deep water circulation during the last deglaciation and the early Holocene (15-5 cal. kyr B.P.). The observed B-P 14 C age differences ranged from 1030 to 1630 years, which are comparable to the present-day apparent ventilation age. It suggested that the ventilation generally remained similar during 15-5 cal. kyr B.P. However, B-P 14 C age difference slightly reduced at 14.6 cal. kyr B.P., indicating that the higher ventilation temporality could have occurred in the northwestern North Pacific (∼2200 m water depth)

Design de interface do ambiente virtual HyperCAL online

Directory of Open Access Journals (Sweden)

Jaire Passos

2010-12-01

Full Text Available A presente pesquisa objetiva propor uma metodologia que oriente o projeto de interface de ambiente virtual centrado no usuário que seja sistematizada como processo de produto com princípios de design de interação, considerando aspectos de usabilidade e ergonomia, de modo a favorecer o trabalho do usuário, permitindo a apropriação do conteúdo e a execução das tarefas através das funcionalidades do sistema. Para consecução do trabalho foram investigados: os elementos da experiência do usuário; as ferramentas de planejamento de produto; as técnicas engenharia de software; e os conceitos do design de interação. A validação da metodologia foi feita através do projeto de interface do módulo do desenvolvedor (professor/instrutor do HyperCalGD online. A interface projetada apresentou melhores condições para o desenvolvimento de materiais educacionais.

Durabilidade de tijolos solo-cal incorporados com resíduos de demolição da construção civil Durability of soil-lime bricks embedded with demolition construction residues

OpenAIRE

Suélen Silva Figueiredo; Cibelle Guimarães Silva; Gelmires A. Neves

2011-01-01

A incorporação dos resíduos de demolição da construção civil (RD) em tijolos solo-cal, substituindo parte do aglomerante, torna-se possível devido às propriedades cimentantes que esses resíduos podem apresentar quando finamente moídos. Essa pesquisa objetiva avaliar a durabilidade de tijolos solo-cal incorporados com resíduos de demolição da construção civil. Para o desenvolvimento dessa pesquisa foram confeccionados corpos-de-prova utilizando o traço 1:10 em massa, em proporção de cal:solo e...

Dicty_cDB: Contig-U01276-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available developm... 42 0.032 2 ( CX071007 ) UCRCS08_1C07_b Parent Washington Navel Orange Cal... 42 0.032 2 ( CX6381... Citrus reshni cDNA clone... 42 0.032 2 ( CX071008 ) UCRCS08_1C07_g Parent Washington Navel Orange Cal... 42...A09 Developing fruit flavedo at 80 DAF... 42 0.032 2 ( CX075462 ) UCRCS08_45A05_b Parent Washington Navel Or...lla cDNA cl... 42 0.032 2 ( CX075463 ) UCRCS08_45A05_g Parent Washington Navel Orange Ca... 42 0.032 2 ( CX2...30 ) C05811C09SK FerrChloR1 Citrus sinensis x Poncirus... 42 0.032 2 ( DN619505 ) UCRCS11_04A09_r Parent

Oceanographic profile data using bottle, collected during CalCOFI cruises, North Pacific Ocean, 2012-03 to 2013-01 (NODC Accession 0117293)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Bottle data collected during CalCOFI cruises 1203, 1207, 1210, and 1301, March 2012 - January 2013. The California Cooperative Oceanic Fisheries Investigations...

Oceanographic profile data using bottle collected during CalCOFI cruises, North Pacific Ocean, 2013-04 to 2014-02 (NCEI Accession 0126651)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Bottle data collected during CalCOFI cruises 1304, 1307, 1311, and 1402, April 2013 - February 2014. The California Cooperative Oceanic Fisheries Investigations...

Oceanographic profile data using bottle collected during CalCOFI cruises, North Pacific Ocean, 2014-03 to 2015-02 (NCEI Accession 0145016)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Bottle data collected during CalCOFI cruises 1404, 1407, 1411, and 1501, March 2014 - February 2015. The California Cooperative Oceanic Fisheries Investigations...

Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences; Volume 119; Issue 1. Issue front cover thumbnail. Volume 119, Issue 1. January 2007, pages 3-51. pp 3-9. Synthesis, structure, redox and spectra of green iridium complexes of tridentate azo-aromatic ligands · Manashi Panda Chayan Das Chen-Hsiung Hung Sreebrata ...

Bulletin of Materials Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science; Volume 30; Issue 5. Influence of additives on electrodeposition of bright Zn–Ni alloy on mild steel from acid sulphate bath. S Shivakumara U Manohar Y Arthoba Naik T V Venkatesha. Alloys and Steels Volume 30 Issue 5 October 2007 pp 455-462 ...

Journal of Chemical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Chemical Sciences; Volume 119; Issue 3. Issue front cover thumbnail. Volume 119, Issue 3. May 2007, pages 219-274. pp 219-230. Engineering macrocyclic figure-eight motif · V Haridas Harinder Singh Yogesh K Sharma Kashmiri Lal · More Details Abstract Fulltext PDF. The design and ...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science; Volume 116; Issue 5. Polyphase deformation and garnet growth in politic schists of Sausar Group in Ramtek area, Maharashtra, India: A study of porphyroblast–matrix relationship. A Chattopadhyay N Ghosh. Volume 116 Issue 5 October 2007 pp 423-432 ...

La banque de la Nouvelle-Calédonie. Existence éphémère, expérience oubliée (1874-1877)

OpenAIRE

Buttet, Catherine

2009-01-01

La Nouvelle-Calédonie, colonie pénale peu peuplée, était en 1870 tributaire des commerçants et du Trésor public pour l'ensemble des opérations bancaires. Née d'une société de colonisation d'initiative privée, la Banque de la Nouvelle-Calédonie fut une expérience distincte des anciennes banques coloniales et dont le nouveau cadre statutaire servit ensuite à la Banque d'Indochine. La banque reçut l'aval du gouvernement sous la forme d'une autorisation puis d'un privilège. Rapidement, la banque ...

Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound

Constituents of Propolis: Chrysin, Caffeic Acid, p-Coumaric Acid, and Ferulic Acid Induce PRODH/POX-Dependent Apoptosis in Human Tongue Squamous Cell Carcinoma Cell (CAL-27).

Science.gov (United States)

Celińska-Janowicz, Katarzyna; Zaręba, Ilona; Lazarek, Urszula; Teul, Joanna; Tomczyk, Michał; Pałka, Jerzy; Miltyk, Wojciech

2018-01-01

Propolis evokes several therapeutic properties, including anticancer activity. These activities are attributed to the action of polyphenols. Previously it has been demonstrated, that one of the most abundant polyphenolic compounds in ethanolic extracts of propolis are chrysin, caffeic acid, p -coumaric acid, and ferulic acid. Although their pro-apoptotic activity on human tongue squamous cell carcinoma cells (CAL-27) was established previously, the detailed mechanism of this process remains unclear. Considering the crucial role of proline metabolism and proline dehydrogenase/proline oxidase (PRODH/POX) in the regulation of cancer cell survival/apoptosis, we studied these processes in polyphenol-treated CAL-27 cells. All studied polyphenols evoked anti-proliferative activity, accompanied by increased PRODH/POX, P53, active caspases-3 and -9 expressions and decreased collagen biosynthesis, prolidase activity and proline concentration in CAL-27 cells. These data suggest that polyphenols of propolis induce PRODH/POX-dependent apoptosis through up-regulation of mitochondrial proline degradation and down-regulation of proline utilization for collagen biosynthesis.

Modeling the formation and aging of secondary organic aerosols in Los Angeles during CalNex 2010

Science.gov (United States)

Hayes, P. L.; Carlton, A. G.; Baker, K. R.; Ahmadov, R.; Washenfelder, R. A.; Alvarez, S.; Rappengluck, B.; Gilman, J. B.; Kuster, W. C.; de Gouw, J. A.; Zotter, P.; Prevot, A. S. H.; Szidat, S.; Kleindienst, T. E.; Offenberg, J. H.; Ma, P. K.; Jimenez, J. L.

2015-05-01

Four different literature parameterizations for the formation and evolution of urban secondary organic aerosol (SOA) frequently used in 3-D models are evaluated using a 0-D box model representing the Los Angeles metropolitan region during the California Research at the Nexus of Air Quality and Climate Change (CalNex) 2010 campaign. We constrain the model predictions with measurements from several platforms and compare predictions with particle- and gas-phase observations from the CalNex Pasadena ground site. That site provides a unique opportunity to study aerosol formation close to anthropogenic emission sources with limited recirculation. The model SOA that formed only from the oxidation of VOCs (V-SOA) is insufficient to explain the observed SOA concentrations, even when using SOA parameterizations with multi-generation oxidation that produce much higher yields than have been observed in chamber experiments, or when increasing yields to their upper limit estimates accounting for recently reported losses of vapors to chamber walls. The Community Multiscale Air Quality (WRF-CMAQ) model (version 5.0.1) provides excellent predictions of secondary inorganic particle species but underestimates the observed SOA mass by a factor of 25 when an older VOC-only parameterization is used, which is consistent with many previous model-measurement comparisons for pre-2007 anthropogenic SOA modules in urban areas. Including SOA from primary semi-volatile and intermediate-volatility organic compounds (P-S/IVOCs) following the parameterizations of Robinson et al. (2007), Grieshop et al. (2009), or Pye and Seinfeld (2010) improves model-measurement agreement for mass concentration. The results from the three parameterizations show large differences (e.g., a factor of 3 in SOA mass) and are not well constrained, underscoring the current uncertainties in this area. Our results strongly suggest that other precursors besides VOCs, such as P-S/IVOCs, are needed to explain the observed

Moda rápida na indústria calçadista: intervenção setorial no arranjo produtivo de Nova Serrana

Directory of Open Access Journals (Sweden)

Giancarlo Medeiros Pereira

2014-09-01

Full Text Available Em 2008, fabricantes de calçados da região de Nova Serrana juntamente com seus fornecedores de insumos articularam uma intervenção setorial destinada a aumentar a diversidade da oferta na cadeia de suprimentos, acelerar o desenvolvimento de novos produtos e reduzir os custos dos insumos. A despeito do interesse das partes, a intervenção não produziu os resultados desejados. Este artigo busca entender os motivos que bloquearam tais objetivos. Foram estudados quinze fabricantes de calçados e quinze fornecedores de insumos. O método de pesquisa foi o estudo de caso múltiplo. Em sessões de grupos focados com os empresários, foi construída uma estrutura de construtos e variáveis que desvelou a inter-relação entre a flexibilidade de suprimento e o desenvolvimento de produtos. Os achados sugerem que a demanda por exclusividade de insumos, imposta pelos grandes fabricantes de calçados, a possibilidade de conflito com os representantes dos grandes e médios fornecedores de insumos, o receio de cópia das criações, a desatenção a demandas locais e o desempenho insatisfatório em entregas causaram o insucesso da intervenção.

First International Earth Science Olympiad South Korea

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 12. First International Earth Science Olympiad - South Korea. Information and Announcements Volume 12 Issue 12 December 2007 pp 76-76. Fulltext. Click here to view fulltext PDF. Permanent link:

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Proceedings – Mathematical Sciences; Volume 118; Issue 2. Issue front cover thumbnail. Volume 118, Issue 2. May 2008, pages 159-320. pp 159-160. Note on Plagiarism · Gadadhar Misra N Mukunda · More Details Fulltext PDF. pp 161-182 Invited Article. Large Deviations: An Introduction to 2007 Abel ...

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Proceedings – Mathematical Sciences; Volume 117; Issue 2. Issue front cover thumbnail. Volume 117, Issue 2. May 2007, pages 147-285. pp 147-158. A Variant of Davenport's Constant · R Thangadurai · More Details Abstract Fulltext PDF. Let be a prime number. Let be a finite abelian -group of ...

Fertilidad de los suelos de la explotación Cal Martí de Gàver

OpenAIRE

Moreno Zeymer, Martín

2015-01-01

The study on soil fertility of the farm Cal Martí was performed to obtain objective results on the management of soil fertility. It also was tested the hypothesis that fertility in relation to soil organic matter increases in soil covered with permanent forage crops. There were executed different type of balances (humus, nitrogen, phosphorus and potassium) of the farm and there were analysed different parameters (texture, pH, EC, organic matter, macronutrients and micronutrients) of pieces of...

Proceedings of 7. international scientific conference 'Sakharov readings 2007: Ecological problems of XXI century'; Materialy 7-oj mezhdunarodnoj nauchnoj konferentsii 'Sakharovskie chteniya 2007 goda: Ehkologicheskie problemy XXI veka'

Energy Technology Data Exchange (ETDEWEB)

Kundas, S P; Mel' nov, S B; Poznyak, S S [International A. Sakharov environmental univ., Minsk (Belarus)

2007-05-15

Abstracts of the seventh international scientific conference 'Sakharov readings 2007: Ecological problems of XXI century', which was held in the International A. Sakharov environmental university, contents materials on topics: socio-ecological problems, medical ecology, biomonitoring and bioindication, biological ecology. The proceedings are intended for specialists in field of ecology and related sciences, teachers, students and post-graduate students. (authors)

Methods and Sources of Data Used to Develop Selected Water-Quality Indicators for Streams and Ground Water for EPA's 2007 Report on the Environment: Science Report

Science.gov (United States)

Baker, Nancy T.; Wilson, John T.; Moran, Michael J.

2008-01-01

The U.S. Geological Survey (USGS) was one of numerous governmental agencies, private organizations, and the academic community that provided data and interpretations for the U.S. Environmental Protection Agency?s (USEPA) 2007 Report on the Environment: Science Report. This report documents the sources of data and methods used to develop selected water?quality indicators for the 2007 edition of the report compiled by USEPA. Stream and ground?water?quality data collected nationally in a consistent manner as part of the USGS?s National Water?Quality Assessment Program (NAWQA) were provided for several water?quality indicators, including Nitrogen and Phosphorus in Streams in Agricultural Watersheds; Pesticides in Streams in Agricultural Watersheds; and Nitrate and Pesticides in Shallow Ground Water in Agricultural Watersheds. In addition, the USGS provided nitrate (nitrate plus nitrite) and phosphorus riverine load estimates calculated from water?quality and streamflow data collected as part of its National Stream Water Quality Accounting Network (NASQAN) and its Federal?State Cooperative Program for the Nitrogen and Phosphorus Discharge from Large Rivers indicator.

The LNG Industry - 2007

International Nuclear Information System (INIS)

2008-04-01

Estimates for the marketed production of natural gas in 2007 show a rise of about 1.6% over 2006. The share of LNG in the gas trade accounts for almost 24% of the total. This annual report presents: 1 - LNG contracts and trade, 2 - Contracts concluded in 2007, 3 - LNG imports - Sources of imports - Quantities received in 2007, 4 - LNG tankers, 5 - 35 Ships delivered 10 2007, 6 - Tanker distribution, 7 - Liquefaction plants, 8 - re-gasification plants, 9 - Long-term and medium-term contracts in force in 2007, 10 - Spot and short term quantities received in 2007 by the importing countries from the exporting countries, 11 - Sea transportation routes, 12 - Liquefaction plants (table), 13 - re-gasification plants (table), 14 - Delivery date of the LNG tankers

iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.

TEM study of soot, organic aerosol, and sea-salt particles collected during CalNex

Science.gov (United States)

Adachi, K.; Buseck, P. R.

2010-12-01

Anthropogenic aerosol particles are emitted in abundance from megacities. Those particles can have important effects on both human health and climate. In this study, aerosol particles having aerodynamic diameters between 50 and 300 nm were collected during the CalNex campaign at the Pasadena ground site from May 15 to June 15, 2010, ~15 km northeast of downtown Los Angeles. The samples were analyzed using transmission electron microscopes (TEMs) to characterize particle shapes and compositions. Most samples are dominated by soot, organic aerosol (OA), sulfate, sea salt, or combinations thereof. Sizes and amounts of OA particles increased during the afternoons, and most soot particles were internally mixed with OA and sulfate in the afternoons. The proportion of soot to other material in individual particles increased and soot particles were more compact during the nights and early mornings. Sea-salt particles were commonly internally mixed with other materials. They have high Na contents with lesser N, Mg, S, K, and Ca and almost no Cl, suggesting that the Cl was replaced by sulfate or nitrate in the atmosphere. There is less OA and more sea salt and sulfate in the CalNex samples than in the samples from Mexico City that were collected during the MILAGRO campaign. Our study indicates that compositions of internally mixed aerosol particles and shapes of soot particles change significantly within a day. These changes probably influence the estimates of their effects on human health and climate.

Momona Ethiopian Journal of Science

African Journals Online (AJOL)

The scope of the journal includes various aspects of natural and ... general and geology, chemistry, physics, biology and mathematical sciences in particular. ... and Marital Fertility from Information on CWR (0-9): An Application to India /States / ...

Proceedings – Mathematical Sciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Proceedings – Mathematical Sciences; Volume 117; Issue 3. Issue front cover thumbnail. Volume 117, Issue 3. August 2007, pages 287-427. pp 287-292. On the Cohomology of Orbit Space of Free Z Z p -Actions on Lens Spaces · Hemant Kumar Singh Tej Bahadur Singh · More Details Abstract Fulltext PDF.

Trends in health sciences library and information science research: an analysis of research publications in the Bulletin of the Medical Library Association and Journal of the Medical Library Association from 1991 to 2007.

Science.gov (United States)

Gore, Sally A; Nordberg, Judith M; Palmer, Lisa A; Piorun, Mary E

2009-07-01

This study analyzed trends in research activity as represented in the published research in the leading peer-reviewed professional journal for health sciences librarianship. Research articles were identified from the Bulletin of the Medical Library Association and Journal of the Medical Library Association (1991-2007). Using content analysis and bibliometric techniques, data were collected for each article on the (1) subject, (2) research method, (3) analytical technique used, (4) number of authors, (5) number of citations, (6) first author affiliation, and (7) funding source. The results were compared to a previous study, covering the period 1966 to 1990, to identify changes over time. Of the 930 articles examined, 474 (51%) were identified as research articles. Survey (n = 174, 37.1%) was the most common methodology employed, quantitative descriptive statistics (n = 298, 63.5%) the most used analytical technique, and applied topics (n = 332, 70%) the most common type of subject studied. The majority of first authors were associated with an academic health sciences library (n = 264, 55.7%). Only 27.4% (n = 130) of studies identified a funding source. This study's findings demonstrate that progress is being made in health sciences librarianship research. There is, however, room for improvement in terms of research methodologies used, proportion of applied versus theoretical research, and elimination of barriers to conducting research for practicing librarians.

Hollywood Science: Good for Hollywood, Bad for Science?

Science.gov (United States)

Perkowitz, Sidney

2009-03-01

Like it or not, most science depicted in feature films is in the form of science fiction. This isn't likely to change any time soon, if only because science fiction films are huge moneymakers for Hollywood. But beyond that, these films are a powerful cultural force. They reach millions as they depict scientific ideas from DNA and cloning to space science, whether correctly or incorrectly; reflect contemporary issues of science and society like climate change, nuclear power and biowarfare; inspire young people to become scientists; and provide defining images -- or stereotypes -- of scientists for the majority of people who've never met a real one. Certainly, most scientists feel that screen depictions of science and scientists are badly distorted. Many are, but not always. In this talk, based on my book Hollywood Science [1], I'll show examples of good and bad screen treatments of science, scientists, and their impact on society. I'll also discuss efforts to improve how science is treated in film and ways to use even bad movie science to convey real science. [4pt] [1] Sidney Perkowitz, Hollywood Science: Movies, Science, and the End of the World (Columbia University Press, New York, 2007). ISBN: 978-0231142809

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science; Volume 116; Issue 5. Volume 116, Issue 5. October 2007, pages 369-463. pp 369-384. Current status of multimodel superensemble and operational NWP forecast of the Indian summer monsoon · Akhilesh Kumar Mishra T N Krishnamurti · More Details Abstract Fulltext PDF.

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science; Volume 116; Issue 1. The effects of attenuation and site on the spectra of microearthquakes in the Jubilee Hills region of Hyderabad, India. Saurabh Baruah Devajit Hazarika Naba K Gogoi P Solomon Raju. Volume 116 Issue 1 February 2007 pp 37-47 ...

The United Nations Basic Space Science Initiative

Science.gov (United States)

Haubold, H. J.

2006-08-01

Pursuant to recommendations of the United Nations Conference on the Exploration and Peaceful Uses of Outer Space (UNISPACE III) and deliberations of the United Nations Committee on the Peaceful Uses of Outer Space (UNCOPUOS), annual UN/ European Space Agency workshops on basic space science have been held around the world since 1991. These workshops contribute to the development of astrophysics and space science, particularly in developing nations. Following a process of prioritization, the workshops identified the following elements as particularly important for international cooperation in the field: (i) operation of astronomical telescope facilities implementing TRIPOD, (ii) virtual observatories, (iii) astrophysical data systems, (iv) concurrent design capabilities for the development of international space missions, and (v) theoretical astrophysics such as applications of nonextensive statistical mechanics. Beginning in 2005, the workshops focus on preparations for the International Heliophysical Year 2007 (IHY2007). The workshops continue to facilitate the establishment of astronomical telescope facilities as pursued by Japan and the development of low-cost, ground-based, world-wide instrument arrays as lead by the IHY secretariat. Wamsteker, W., Albrecht, R. and Haubold, H.J.: Developing Basic Space Science World-Wide: A Decade of UN/ESA Workshops. Kluwer Academic Publishers, Dordrecht 2004. http://ihy2007.org http://www.unoosa.org/oosa/en/SAP/bss/ihy2007/index.html http://www.cbpf.br/GrupPesq/StatisticalPhys/biblio.htm

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...

TileCal Trigger Tower studies considering additional segmentation on the ATLAS upgrade for high luminosity at LHC

CERN Document Server

March, L; The ATLAS collaboration

2013-01-01

The Tile Calorimeter (TileCal) is the hadronic calorimeter covering the most central region of the ATLAS experiment at LHC. The TileCal readout consists of about 10000 channels and provides a compact information, called trigger towers (around 2000 signals), to the ATLAS first level online event selection system. The ATLAS upgrade program is divided in three phases: Phase 0 occurs during 2013- 2014 and prepares the LHC to reach peak luminosities of 10^34 cm2s-1; Phase 1, foreseen for 2018-1019, prepares the LHC for peak luminosity up to 2-3 x 10^34 cm2s-1, corresponding to 55 to 80 interactions per bunch-crossing with 25 ns bunch interval; and Phase 2 is foreseen for 2022-2023, whereafter the peak luminosity will reach 5-7 x 1034 cm2s-1 (HL-LHC). The ATLAS experiment is operating very well since 2009 providing large amount of data for physics analysis. The online event selection system (trigger system) was designed to reject the huge amount of background noise generated at LHC and is one of the main systems re...

What is new in Office 2007 - (IT3T/2007/2)

CERN Multimedia

CERN. Geneva

2007-01-01

IT3T/2007/2 - Quoi de neuf avec Office 2007 Nous allons présenter le nouveau type de site web disponible au CERN: "Collaboration Workspaces". Avec des fonctionnalités comme les forums de discussion, les pages wiki, la création rapide de formulaires web et les "document libraries", nous montrerons comment les Collaboration Workspaces permettent de publier, partager et récupérer l'information de manière plus simple et plus rapide, et permettent de collaborer de manière efficace sur les documents. IT3T/2007/2 - What is new in Office 2007 The presentation will introduce the new features of Microsoft Office 2007 including the new Microsoft Office Fluent user interface and explain how to use the Ribbon, Contextual Tabs, Galleries, and Live Preview. No special previous knowledge is required, at the same time a basic knowledge of Office 2003 applications (Word/Excel/PowerPoint) may be a convenient starting point.

Read your mail and more with Outlook 2007 - (IT3T/2007/4)

CERN Multimedia

CERN. Geneva

2007-01-01

IT3T/2007/4 - Lisez vos emails, et plus encore, avec Outlook 2007 Cette presentation vous expliquera, non seulement, comment utiliser Outlook 2007 pour envoyer et recevoir vos messages, mais aussi comment gérer un agenda, partager une boite aux lettres entre plusieurs personnes, conserver vos courriers dans votre ordinateur portable, utiliser la messagerie instantanée et configurer diverses options avancées comme le filtre anti-spam. IT3T/2007/4 - Read your mail and more with Outlook 2007 The presentation will explain how to use Outlook 2007 not only for sending and receiving messages but also for managing a personal calendar, sharing a mailbox between several people, keeping mails in a portable computer, using instant messaging and configuring various options including the anti-spam filter.

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Articles written in Journal of Earth System Science. Volume 116 Issue 1 February 2007 pp 73-79. Long range prediction of Indian summer monsoon ... Volume 121 Issue 1 February 2012 pp 203-210. Impact of global warming on cyclonic disturbances over south Asian region · Savita Patwardhan Ashwini Kulkarni K Krishna ...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science; Volume 116; Issue 1. Issue front cover thumbnail. Volume 116, Issue 1. February 2007, pages 1-79. pp 1-1. Editorial · More Details Fulltext PDF. pp 3-13. Platinum group elements and gold in ferromanganese crusts from Afanasiy–Nikitin seamount, equatorial Indian Ocean: ...

Supporting English-medium pedagogy through an online corpus of science and engineering lectures

Science.gov (United States)

Kunioshi, Nílson; Noguchi, Judy; Tojo, Kazuko; Hayashi, Hiroko

2016-05-01

As English-medium instruction (EMI) spreads around the world, university teachers and students who are non-native speakers of English (NNS) need to put much effort into the delivery or reception of content. Construction of scientific meaning in the process of learning is already complex when instruction is delivered in the first language of the teachers and students, and may become even more challenging in a second language, because science education depends greatly on language. In order to identify important pedagogical functions that teachers use to deliver content and to present different ways to realise each function, a corpus of lectures related to science and engineering courses was created and analysed. NNS teachers and students in science and engineering involved in EMI higher education can obtain insights for delivering and listening to lectures from the Online Corpus of Academic Lectures (OnCAL).

On-Detector Electronics for the ATLAS TileCal Demonstrator

CERN Document Server

Muschter, Steffen Lothar; The ATLAS collaboration; Anderson, Kelby; Bohm, Christian; Drake, Gary; Oreglia, Mark; Paramonov, Alexander; Tang, Fukun

2014-01-01

In the major upgrade of the LHC and its detectors around year 2023 the beam energy and luminosity will increase significantly. For TileCal, the hadron calorimeter in ATLAS, most of the on-detector and off-detector electronics will be replaced. A new design has been proposed with some alternative solutions for some of the parts. To gain experience with this design, a demonstrator project is on-going aiming at inserting a prototype module in ATLAS this summer or in the next possible shut-down. A caveat is that it must be able to operate seamlessly with the present system. This together with test beam studies will help to finalize the design. The on-detector part of the demonstrator electronics contains five parts: new front-end boards, digitizer boards with a link daughter board, a programmable high voltage power supply and a redundant low voltage power supply. Apart from improved performance reliability is a main concern. This will be achieved by increased modularity so that the consequences of a complete fail...

On-Detector Electronics for the ATLAS TileCal Demonstrator

CERN Document Server

Muschter, Steffen Lothar; The ATLAS collaboration; Akerstedt, Henrik; Anderson, Kelby; Bohm, Christian; Drake, Gary; Oreglia, Mark; Paramonov, Alexander; Tang, Fukun

2016-01-01

In the major upgrade of the LHC and its detectors around year 2023 the beam energy and luminosity will increase significantly. For TileCal, the hadron calorimeter in ATLAS, most of the on-detector and off-detector electronics will be replaced. A new design has been proposed with some alternative solutions for some of the parts. To gain experience with this design, a demonstrator project is on-going aiming at inserting a prototype module in ATLAS this summer or in the next possible shut-down. A caveat is that it must be able to operate seamlessly with the present system. This together with test beam studies will help to finalize the design. The on-detector part of the demonstrator electronics contains five parts: new front-end boards, digitizer boards with a link daughter board, a programmable high voltage power supply and a redundant low voltage power supply. Apart from improved performance reliability is a main concern. This will be achieved by increased modularity so that the consequences of a complete fail...

First observation of the decay $\\bar{B}^0_s \\to D^0 K^{*0}$ and a measurement of the ratio of branching fractions $\\frac{{\\cal B}(\\bar{B}^0_s \\to D^0 K^{*0})}{{\\cal B}(\\bar{B}^0 \\to D^0 \\rho^0)}$

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Bailey, D S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Brisbane, S; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Caicedo Carvajal, J M; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Conti, G; Contu, A; Cook, A; Coombes, M; Corti, G; Cowan, G A; Currie, R; D'Almagne, B; D'Ambrosio, C; David, P; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Deissenroth, M; Del Buono, L; Deplano, C; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; d'Enterria, D G; Esperante Pereira, D; Estéve, L; Falabella, A; Fanchini, E; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hofmann, W; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koblitz, S; Koppenburg, P; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kukulak, S; Kumar, R; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Le Gac, R; van Leerdam, J; Lees, J-P; Lefévre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Luisier, J; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Mclean, C; Meissner, M; Merk, M; Merkel, J; Messi, R; Miglioranzi, S; Milanes, D A; Minard, M-N; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nardulli, J; Nasteva, I; Nedos, M; Needham, M; Neufeld, N; Nguyen-Mau, C; Nicol, M; Nies, S; Niess, V; Nikitin, N; Nomerotski, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrella, A; Petrolini, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilar, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; du Pree, T; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shao, B; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skottowe, H P; Skwarnicki, T; Smith, A C; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Styles, N; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Torr, N; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Vervink, K; Viaud, B; Videau, I; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Voong, D; Vorobyev, A; Voss, H; Wacker, K; Wandernoth, S; Wang, J; Ward, D R; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zavertyaev, M; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zverev, E; Zvyagin, A

2011-01-01

The first observation of the decay $\\bar{B}^0_s \\to D^0 K^{*0}$ using $pp$ data collected by the LHCb detector at a centre-of-mass energy of 7 TeV, corresponding to an integrated luminosity of 36 pb$^{-1}$, is reported. A signal of $34.4 \\pm 6.8$ events is obtained and the absence of signal is rejected with a statistical significance of more than nine standard deviations. The $\\bar{B}^0_s \\to D^0 K^{*0}$ branching fraction is measured relative to that of $\\bar{B}^0 \\to D^0 \\rho^0$: $\\frac{{\\cal B}(\\bar{B}^0_s \\to D^0 K^{*0})}{{\\cal B}(\\bar{B}^0 \\to D^0 \\rho^0)} = 1.48 \\pm 0.34 \\pm 0.15 \\pm 0.12$, where the first uncertainty is statistical, the second systematic and the third is due to the uncertainty on the ratio of the $B^0$ and $B^0_s$ hadronisation fractions.

Uso de cal virgem para o controle de Salmonella spp. e Clostridium spp. em camas de aviário Quicklime for controlling Salmonella spp. and Clostridium spp in litter from floor pens of broilers

Directory of Open Access Journals (Sweden)

Marcos Antonio Dai Pra

2009-07-01

Full Text Available O objetivo deste trabalho foi avaliar a eficácia do uso de cal virgem (CaO para a redução de Salmonella spp. e Clostridium spp. em cama de aviário. Foram aplicados quatro tratamentos: T1- sem adição de cal virgem (controle, T2- aplicação de cal virgem na dose de 300g m-2, T3- aplicação de cal virgem na dose de 600g m-2 e T4- aplicação de cal virgem na dose de 900g m-2. Os valores médios observados para o pH da cama após o 12° dia de aplicação de cal virgem foram 8,95 e 9,91, 10,75 e 11,11 para os tratamentos 1, 2, 3 e 4, respectivamente. O número mais provável Log10 (UFC de Salmonella spp. e Clostridium spp foi reduzido em 82 e 97% com a aplicação de cal na dosagem de 300g m-2 e 100% na dosagem de 600 e 900g m-2, ambos diferindo significativamente em relação ao controle (antes da aplicação da cal. A atividade de água da cama reduziu progressivamente (de 0,2 a 3,82% com a utilização de níveis crescentes de cal. Conclui-se que o uso da cal na cama de aviário, mesmo nas doses mais baixas, reduz o número mais provável de Salmonella e Clostridium ssp.This study aimed to evaluate the efficacy of quicklime (CaO for reducing Salmonella and Clostridium spp. population in used litter from floor pens of broilers. Four treatments were tested: (T1 control (without quicklime; (T2 300g quicklime m-2; (T3 600g quicklime m-2; and (T4 900g quicklime m-2. The following average pH values were observed 12 days after adding quicklime: 8.95, 9.91, 10.75 and 11.11 for treatments 1, 2, 3 and 4, respectively. An 82 and 97% reduction in the most probable number Log10 (CFU of Salmonella and Clostridium spp, respectively, was observed when 300g m-2 of quicklime was added to the used litter from floor pens of broilers. Additionally, a 100% reduction was obtained when both 600 and 900g m-2 of quicklime were added, differing significantly from control (before adding quicklime. A progressive reduction in water activity (from 0.2 to 3.82% was

CERN Technical Training 2007: IT3T - IT Technical Training Tutorials (Autumn 2007)

CERN Multimedia

2007-01-01

CERN Technical Training and the Internet Services group of the IT department (IT/IS) are jointly organizing a series of free tutorials, addressing some topics of common interest: the IT Technical Training Tutorials (IT3T). The first IT3T series will be offered in October 2007, in French, with the following schedule: IT3T/2007/1 "Introduction to Collaboration Workspaces using SharePoint", October 23rd , 14:30-16:00, Alexandre Lossent IT3T/2007/2 "What is new in Office 2007", October 25th, 14:30-15:30, Emmanuel Ormancey IT3T/2007/3 "Working with Windows Vista at CERN", October 30th, 14:30-15:30, Michal Kwiatek IT3T/2007/4 "Read your mail and more with Outlook 2007", November 1st, 14:30-15:30, Sebastien Dellabella All IT Technical Training Tutorials will take place in the Training Centre Auditorium (building 593, room 11), at 14h30. The tutorials are free of charge, but separate registration to each is required. Participation to any of the tutorials is open: attendance to any ...

EST Table: FS750177 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available FS750177 E_ET_caL-_21J18_F_0 11/12/09 n.h 10/09/28 90 %/101 aa ref|NP_001036899.1| pro-corazon...in precursor [Bombyx mori] sp|Q86N75.1|CORZ_BOMMO RecName: Full=Pro-corazonin; Short=Crz; Short=B...CPRP; Flags: Precursor dbj|BAC66443.1| corazonin preprohormone [Bombyx mori] 10/09/08 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h FS750177 caL- ...

EST Table: FS755944 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available FS755944 E_ET_caL-_21J18_R_0 11/12/09 n.h 10/09/28 91 %/101 aa ref|NP_001036899.1| pro-corazon...in precursor [Bombyx mori] sp|Q86N75.1|CORZ_BOMMO RecName: Full=Pro-corazonin; Short=Crz; Short=B...CPRP; Flags: Precursor dbj|BAC66443.1| corazonin preprohormone [Bombyx mori] 10/09/08 n.h 10/08/28 n.h 10/09/10 n.h 10/09/10 n.h 10/09/10 n.h FS755944 caL- ...

Resonance – Journal of Science Education | Indian Academy of ...

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 8. The Evolution of Compilers. Priti Shankar. General Article Volume 12 Issue 8 August 2007 pp 8-26 ... Author Affiliations. Priti Shankar1. Department of Computer Science and Automation, Indian Institute of Science, Bangalore 560 012, India ...

Hitachi product data management system toward the 21st century by CALS approach

International Nuclear Information System (INIS)

Yoshinaga, Toshiaki; Kibushi, Haruo; Kitaur, Ayumu

1998-01-01

HIPDM21 (Hitachi Product Data Management System for the 21st century) is a comprehensive computer information management system which has been developed for the purpose of plant life cycle business support in terms of the electronics information exchange and sharing between the disciplines using the product data management technology. The system consists of core systems (Engineering Data Control System, Integrated Commodity Database system, and Document Management System) and business application systems. In the present development phase, the system is being enhanced to support CALS standards including EDT, SGML, and STEP, and to support information exchange and sharing with outside the company including clients, construction companies, and domestic/international vendors. (author)

Magnetocaloric response of La 0.70 Ca 0.1 Sr 0.2 Fe 0.1 Mn 0.9 O 3 ...

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science; Volume 38; Issue 1. Magnetocaloric response of La0.70Ca0.1Sr0.2Fe0.1Mn0.9O3 pervoskite for magnetic refrigeration. M S Anwar Faheem Ahmed Bon Heun Koo. Volume 38 Issue 1 February 2015 pp 101-104 ...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

Home; Journals; Journal of Earth System Science; Volume 116; Issue 6. Volume 116, Issue 6. December 2007, pages 465-597. pp 465-467. Editorial · T N Narasimhan · More Details Fulltext PDF. pp 469-495. Late Devonian and Triassic basalts from the southern continental margin of the East European Platform, tracers of ...

Proceedings of the 22. International Symposium on Physico-Chemical Methods of Separation - Ars Separatoria 2007

International Nuclear Information System (INIS)

Trochimczuk, A.W.; Walkowiak, W.

2007-01-01

Annual symposia '' Ars Separatoria '' offer the scientists and engineers information on the latest achievements in the separation sciences. In 2007 participants presented 9 plenary lectures, 15 communications and 45 posters. Of special interest were results obtained using solvent extraction and ion exchange methods

Proceedings of the 22. International Symposium on Physico-Chemical Methods of Separation - Ars Separatoria 2007

Energy Technology Data Exchange (ETDEWEB)

Trochimczuk, A W; Walkowiak, W [eds.

2007-07-01

Annual symposia '' Ars Separatoria '' offer the scientists and engineers information on the latest achievements in the separation sciences. In 2007 participants presented 9 plenary lectures, 15 communications and 45 posters. Of special interest were results obtained using solvent extraction and ion exchange methods.

Comportamiento de una pista experimental de pavimento flexible con base estabilizada con cal Behavior of an experimental track of flexible pavement with lime stabilized base

Directory of Open Access Journals (Sweden)

César Augusto Hidalgo Montoya

2010-01-01

Full Text Available En este trabajo se presentan resultados de una investigación realizada para determinar las propiedades de deformabilidad de bases estabilizadas con cal a partir de ensayos de campo no destructivos. Se realizaron ensayos de placa estática y viga Benkelman en un tramo de prueba de pavimento flexible de 70m de longitud. Se usaron diferentes mezclas de suelo-cal y varios espesores de la estructura para evaluar el comportamiento del pavimento. A partir de los resultados de estos ensayos fueron realizados retroanálisis del comportamiento del pavimento. El método de los elementos finitos y el modelo elástico de esfuerzos y deformaciones en sistema de capas múltiples se usaron en los retroanálisis para estimar los módulos de deformabilidad de la base estabilizada con cal. Se concluye que la adición de cal mejora sustancialmente las propiedades de los pavimentos evaluados.This paper presents results of a research carried out to determine the proprieties of deformation of lime stabilized bases using non destructive field tests. Static plate tests and Benkelman beam tests were made on an experimental track of flexible pavement of 70 m length. Several mixtures of soil-lime and several thickness of the stabilized base were used to evaluate the behavior of the pavement. With the results of these tests, back analysis of the behavior of pavement was carried out. The finite elements method and the elastic stress and strain in a multi layers system were used to estimate the deformation modulus of the lime stabilized bases. It is concluded that the lime addition significantly improves the properties of evaluated pavements.

Resonance – Journal of Science Education | Indian Academy of ...

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 12. Science Academies' Summer Research Fellowship Programme for Students and Teachers - 2008. Information and Announcements Volume 12 Issue 12 December 2007 pp 74-74 ...

The Microwave-assisted Synthesis of Polyethersulfone (PES as A Matrix in Immobilization of Candida antarctica Lipase B (Cal-B

Directory of Open Access Journals (Sweden)

Khusna Widhyahrini

2017-10-01

How to Cite: Widhyahrini, K., Handayani, N., Wahyuningrum, D., Nurbaiti, S., Radiman, C.L. (2017. The Microwave-assisted Synthesis of Polyethersulfone (PES as A Matrix in Immobilization of Candida antarctica Lipase B (Cal-B. Bulletin of Chemical Reaction Engineering & Catalysis, 12(3: 343-350 (doi:10.9767/bcrec.12.3.774.343-350

40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...

Laue 2007: international workshop on advanced Laue diffraction in frontier science

International Nuclear Information System (INIS)

Adachi, S.I.; Akgul, G.; Aksoy, F.; Andersen, K.; Andersson, M.; Anfinrud, Ph.; Baruchel, J.; Bastie, P.; Bau, R.; Blakeley, M.; Bourgeois, D.; Brau, D.; Bravin, A.; Cammarata, M.; Christensen, M.; Cole, J.; Courtois, P.; Cousson, A.; Eggonopoulos-Papadopoulos, B.; Daoud-Aladine, M.A.; Dera, P.; Feng, R.; Fiedler, St.; Fischer, H.; Fisher, St.; Folami, S.; Fosu, M.A.; Fuente, F.; Fullagar, W.; Fulla Marsa, D.; Ghosh, R.; Giles, C.; Goossens, D.; Goujon, A.; Gutmann, M.; Heger, G.; Henry, E.; Hewat, A.; Hossmann, Ch.; Ivanov, A.; Jauch, W.; Jorgensen, R.; Katona, G.; Keen, D.; Kong, Q.; Koshihara, Sh.Y.; Lauss, B.; Laue, M.V.; Lecomte, C.; Legrand, V.; Lemee-Cailleau, M.H.; Marmeggi, J.C.; Martinez-Criado, G.; Mason, S.; McIntyre, G.; Mailleur, F.; Micha, J.S.; Moffat, K.; Mohammed Mustapha, A.; Ouladdiaf, B.; Pahl, R.; Parise, J.; Pearson, A.; Pecaut, J.; Popov, A.; Prokleska, J.; Raitman, E.; Ren, Z.; Rodriguez-Carvajal, J.; Sasaki, J.; Schmidt, M.; Schotte, F.; Stirling, W.; Suominen Fuller, M.; Tanaka, I.; Timmins, P.; Tomking, P.; Turner, M.; Van Thor, J.; Vettier, Ch.; Wildes, A.; Wilson, Ch.; Wohri, A.; Wulf, M.; Zhao, Y.

2007-01-01

Laue diffraction is currently undergoing a lively renaissance due to new instrumental developments at both synchrotron X-ray and neutron sources. The aim of the workshop Laue-2007 is to offer state-of-the-art experimental methods and hands-on experience of data analysis for exploration, using single-crystal Laue diffraction, of the crystalline structure of complex materials in extreme cases. The oral sessions cover the following topics: -) history and renaissance of Laue diffraction, -) modern X-ray techniques, -) modern neutron techniques, -) applications, -) analysis and software demonstrations including hands-on experience, and -) future directions. This document gathers the abstracts of the presentations and of the posters

Laue 2007: international workshop on advanced Laue diffraction in frontier science

Energy Technology Data Exchange (ETDEWEB)

Adachi, S I; Akgul, G; Aksoy, F; Andersen, K; Andersson, M; Anfinrud, Ph; Baruchel, J; Bastie, P; Bau, R; Blakeley, M; Bourgeois, D; Brau, D; Bravin, A; Cammarata, M; Christensen, M; Cole, J; Courtois, P; Cousson, A; Eggonopoulos-Papadopoulos, B; Daoud-Aladine, M A; Dera, P; Feng, R; Fiedler, St; Fischer, H; Fisher, St; Folami, S; Fosu, M A; Fuente, F; Fullagar, W; Fulla Marsa, D; Ghosh, R; Giles, C; Goossens, D; Goujon, A; Gutmann, M; Heger, G; Henry, E; Hewat, A; Hossmann, Ch; Ivanov, A; Jauch, W; Jorgensen, R; Katona, G; Keen, D; Kong, Q; Koshihara, Sh Y; Lauss, B; Laue, M V; Lecomte, C; Legrand, V; Lemee-Cailleau, M H; Marmeggi, J C; Martinez-Criado, G; Mason, S; McIntyre, G; Mailleur, F; Micha, J S; Moffat, K; Mohammed Mustapha, A; Ouladdiaf, B; Pahl, R; Parise, J; Pearson, A; Pecaut, J; Popov, A; Prokleska, J; Raitman, E; Ren, Z; Rodriguez-Carvajal, J; Sasaki, J; Schmidt, M; Schotte, F; Stirling, W; Suominen Fuller, M; Tanaka, I; Timmins, P; Tomking, P; Turner, M; Van Thor, J; Vettier, Ch; Wildes, A; Wilson, Ch; Wohri, A; Wulf, M; Zhao, Y

2007-07-01

Laue diffraction is currently undergoing a lively renaissance due to new instrumental developments at both synchrotron X-ray and neutron sources. The aim of the workshop Laue-2007 is to offer state-of-the-art experimental methods and hands-on experience of data analysis for exploration, using single-crystal Laue diffraction, of the crystalline structure of complex materials in extreme cases. The oral sessions cover the following topics: -) history and renaissance of Laue diffraction, -) modern X-ray techniques, -) modern neutron techniques, -) applications, -) analysis and software demonstrations including hands-on experience, and -) future directions. This document gathers the abstracts of the presentations and of the posters.

Analog Readout and Digitizing System for ATLAS TileCal Demonstrator

CERN Document Server

Tang, F; The ATLAS collaboration

2014-01-01

The TileCal Demonstrator is a prototype for a future upgrade to the ATLAS hadron calorimeter when the Large Hadron Collider increases luminosity in year 2023 (HL-LHC). It will be used for functionality and performance tests. The Demonstrator has 48 channels of upgraded readout and digitizing electronics and a new digital trigger capability, but is backwards-compatible with the present detector system insofar as it also provides analog trigger signals. The Demonstrator is comprised of 4 identical mechanical mini-drawers, each equipped with up to 12 photomultipliers (PMTs). The on-detector electronics includes 45 Front-End Boards, each serving an individual PMT; 4 Main Boards, each to control and digitize up to 12 PMT signals, and 4 corresponding high-speed Daughter Boards serving as data hubs between on-detector and off-detector electronics. The Demonstrator is fully compatible with the present system, accepting ATLAS triggers, timing and slow control commands for the data acquisition, detector control, and de...

A inserção do design e da gestão de design : estudo de caso em uma indústria calçadista gaúcha

OpenAIRE

Galina, Andréa Capra; Bernardes, Mauricio Moreira e Silva

2012-01-01

O calçado gaúcho está perdendo mercado exportador considerando-se o número de pares exportados, porém esse segmento pertence ao estado brasileiro com maior faturamento gerado da exportação. Nesse contexto, o design assume um importante papel na gestão, promovendo a integração entre todos os setores, agindo em nível estratégico. Diante disso, este artigo, ao propor um estudo de caso baseado no modelo praticado por uma empresa calçadista do Rio Grande do Sul, busca entender como ocorre nesse es...

CERN Technical Training 2007: IT3T - IT Technical Training Tutorials (Autumn 2007)

CERN Multimedia

2008-01-01

Videos now available The videos of the first IT3T series, which was offered in French in October 2007 (Office 2007, Sharepoint collaboration workspace, Vista, Outlook 2007), are now available via Indico at: http://indico.cern.ch/categoryDisplay.py?categId=590Enjoy!

Fornecimento de cálcio para plantas de eucalyptus saligna por meio de aplicação de resíduo industrial lama de cal

OpenAIRE

Simonete,Marcia Aparecida; Chaves,Djalma Miler; Teixeira,Claudia Fernanda Almeida; Moro,Leticia; Neves,Cíntia Urbano

2013-01-01

O resíduo industrial lama de cal, originado da produção de papel kraft branqueada de eucalipto, apresenta em sua composição quantidade considerável de cálcio (Ca), o que pode contribuir para reduzir o consumo de fertilizantes em plantios florestais. Com o objetivo de avaliar o efeito da lama de cal como fonte de Ca e seus efeitos sobre a disponibilidade de nutrientes e produção de matéria seca da parte aérea de plantas de eucalipto, foram conduzidos dois ensaios em vasos, em casa de vegetação...

Climate Change Science Program Collection

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Climate Change Science Program (CCSP) Collection consists of publications and other resources produced between 2007 and 2009 by the CCSP with the intention of...

Practical Aspects of CALS in Design and Manufacturing of Sheet Metal Products

DEFF Research Database (Denmark)

Shpitalni, Moshe; Alting, Leo; Bilberg, Arne

1998-01-01

The transition from design to process planning and to the various stages of manufacturing is traditionally sequential. In many cases, practical problems associated with manufacturing cannot be resolved if only individual processes are examined. These problems can be overcome, however, by adopting...... with the design and manufacture of sheet metal parts. It is demonstrated that through implementation of the CALS approach, the overall process can be optimised and products can be manufactured significantly more accurately, faster and less expensively.......The transition from design to process planning and to the various stages of manufacturing is traditionally sequential. In many cases, practical problems associated with manufacturing cannot be resolved if only individual processes are examined. These problems can be overcome, however, by adopting...

Layered growth model and epitaxial growth structures for SiCAlN alloys

International Nuclear Information System (INIS)

Liu Zhaoqing; Ni Jun; Su Xiaoao; Dai Zhenhong

2009-01-01

Epitaxial growth structures for (SiC) 1-x (AlN) x alloys are studied using a layered growth model. First-principle calculations are used to determine the parameters in the layered growth model. The phase diagrams of epitaxial growth are given. There is a rich variety of the new metastable polytype structures at x=1/6 ,1/5 ,1/4 ,1/3 , and 1/2 in the layered growth phase diagrams. We have also calculated the electronic properties of the short periodical SiCAlN alloys predicted by our layered growth model. The results show that various ordered structures of (SiC) 1-x (AlN) x alloys with the band gaps over a wide range are possible to be synthesized by epitaxial growth.

Adequação de calçadas e travessias às condições mínimas de acessibilidade : um procedimento para estimativa de custos de serviços e obras

OpenAIRE

Pablo José Martinelli Guerreiro

2008-01-01

Esta dissertação apresenta um procedimento para determinação de custos de adequação de calçadas e travessias urbanas através da quantificação dos custos dos serviços necessários a realização das obras de reparos ou da reconstrução total de um trecho de calçada, além da adequação da travessia. O levantamento dos serviços necessários foi feito utilizando-se como padrão de projeto as especificações constantes do manual do projeto Calçada Cidadã da Prefeitura Municipal de Vitória ES. A avaliação ...

Report of the Defense Science Board Task Force on Strategic Communication

National Research Council Canada - National Science Library

2008-01-01

The 2007 Defense Science Board (DSB) Task Force on Strategic Communication has written this report within the context of a larger study, the DSB 2007 Summer Study on Challenges to Military Operations in Support of National Interests...

CERN Technical Training 2007: IT3T - IT Technical Training Tutorials (Autumn 2007)

CERN Multimedia

2008-01-01

Videos now available The videos of the first IT3T series which was offered in French in October 2007 (office 2007, Sharepoint collaboration workspace, Vista, Outlook 2007), are now available via Indico at the address: http://indico.cern.ch/categoryDisplay.py?categId=590Enjoy!

Trends in health sciences library and information science research: an analysis of research publications in the Bulletin of the Medical Library Association and Journal of the Medical Library Association from 1991 to 2007*

Science.gov (United States)

Gore, Sally A.; Nordberg, Judith M.; Palmer, Lisa A.

2009-01-01

Objective: This study analyzed trends in research activity as represented in the published research in the leading peer-reviewed professional journal for health sciences librarianship. Methodology: Research articles were identified from the Bulletin of the Medical Library Association and Journal of the Medical Library Association (1991–2007). Using content analysis and bibliometric techniques, data were collected for each article on the (1) subject, (2) research method, (3) analytical technique used, (4) number of authors, (5) number of citations, (6) first author affiliation, and (7) funding source. The results were compared to a previous study, covering the period 1966 to 1990, to identify changes over time. Results: Of the 930 articles examined, 474 (51%) were identified as research articles. Survey (n = 174, 37.1%) was the most common methodology employed, quantitative descriptive statistics (n = 298, 63.5%) the most used analytical technique, and applied topics (n = 332, 70%) the most common type of subject studied. The majority of first authors were associated with an academic health sciences library (n = 264, 55.7%). Only 27.4% (n = 130) of studies identified a funding source. Conclusion: This study's findings demonstrate that progress is being made in health sciences librarianship research. There is, however, room for improvement in terms of research methodologies used, proportion of applied versus theoretical research, and elimination of barriers to conducting research for practicing librarians. PMID:19626146

Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...

Journal of Earth System Science | Indian Academy of Sciences

Indian Academy of Sciences (India)

The Chandrayaan-1 mission to the Moon scheduled for launch in late 2007 will include a high energy X-ray spectrometer (HEX) for detection of naturally occurring emissions from the lunar surface due to radioactive decay of the 238U and 232Th series nuclides in the energy region 20 –250 keV.The primary science ...

Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...

International production on science oriented towards data: analysis of the terms data science and e-science in scopus and the web of science

Directory of Open Access Journals (Sweden)

Leilah Santiago Bufrem

2016-08-01

Full Text Available Introduction: current configuration in the dynamics of production and scientific communication reveals the role of Science Oriented Towards Data, a comprehensive conception represented, mainly, by terms such as "e-Science" and "Data Science". Objective: To present the global scientific production on Science Oriented Towards Data by using the terms "e-Science" and "Data Science" in Scopus and the Web of Science during 2006-2016. Methodology: The study is divided into five phases: a search for information in Scopus and the Web of Science data bases; b obtaining bibliometric records; c complementing keywords; d data correction and crossing; e analytical data representation. Results: The most important terms within the analyzed scientific production were Distributed computer systems (2006, Grid computing (2007-2013 and Big data (2014- 2016. In the area of Library and Information Science, the emphasis was on Digital Library and Open Access issues, highlighting the importance of the field for the discussions on the devices providing access to scientific information in digital media. Conclusions: Under a diachronic look, it was found a visible shift of focus, from issues approaching data exchange operations to an analytical perspective for finding patterns in large data volumes

Observation of $B^0_s\\rightarrow\\chi_{c1}\\phi$ decay and study of $B^0\\rightarrow\\chi_{c1,2}K^{*0}$ decays

CERN Document Server

INSPIRE-00258707; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Di Ruscio, F; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Holtrop, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; Mc Skelly, B; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polyakov, I; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The first observation of the decay $B^0_s\\rightarrow\\chi_{c1}\\phi$ and a study of $B^0\\rightarrow\\chi_{c1,2}K^{*0}$ decays are presented. The analysis is performed using a dataset, corresponding to an integrated luminosity of 1.0 fb$^{-1}$, collected by the LHCb experiment in pp collisions at a centre-of-mass energy of 7 TeV. The following ratios of branching fractions are measured: \\begin{equation*} \\begin{array}{lll} \\dfrac{\\cal{B}(B^0_s\\rightarrow\\chi_{c1}\\phi)}{\\cal{B}(B^0_s\\rightarrow J/\\psi\\phi)} &=& (18.9 \\pm1.8\\,(stat)\\pm1.3\\,(syst)\\pm0.8\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c1}K^{*0})}{\\cal{B}(B^0\\rightarrow J/\\psi K^{*0})} &=& (19.8 \\pm1.1\\,(stat)\\pm1.2\\,(syst)\\pm0.9\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c2}K^{*0})}{\\cal{B}(B^0\\rightarrow\\chi_{c 1}K^{*0})} &=& (17.1 \\pm5.0\\,(stat)\\pm1.7\\,(syst)\\pm1.1\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\end{array} \\end{equation*} where the third uncertainty is due to the limited knowledge o...

Redução do impacto ambiental: uma abordagem no setor de modelagem em uma empresa calçadista

Directory of Open Access Journals (Sweden)

carlos Augusto Nascimento

2016-12-01

Full Text Available Este artigo apresenta os resultados de uma pesquisa quali-quantitativa de caráter exploratório e de natureza aplicada, realizada no setor de modelagem de uma empresa calçadista, com a finalidade de implantar um novo fluxo processual para gestão de resíduos e de materiais sobressalentes. Para a elaboração do projeto empregou-se metodologia DMAIC, ferramentas da qualidade, ecodesign e a ferramenta 3Rs, visando à redução da variação do processo de maneira a incorporar ações sustentáveis, que permitam a diminuição do custo industrial. Como resultado, obteve-se a redução de passivo ambiental do estoque em processo, da baixa eficiência produtiva, das perdas energéticas e maior desempenho econômico-financeiro, por meio da fabricação de calçados, com o uso de resíduos e materiais sobressalentes e de novo material reciclável para a utilização em gabaritos produtivos.

Prevalence Rate of Using ٍEcstasy among Medical Sciences Students in Urmia University in 2007

Directory of Open Access Journals (Sweden)

Sh. Miri Ghaffarzadeh

2012-01-01

Full Text Available Introduction & Objective: The present study aims to achieve a comprehensive depiction of ecstasy consumption among the students of Urmia University of medical sciences in 2007.Materials & Methods: Totally 950 students were surveyed in this cross-sectional descriptive study. A census was used as a sampling method. A self-report questionnaire regarding demographic details and ecstasy consumption was completed by students. Data was stored in a database and then was analyzed through descriptive tests by SPSS software. Chi square test was used to determine the correlation coefficient.Results: There were 798 subjects of all target population who had never used this drug. However, 132 subjects (18 regularly, 56 occasionally for fun and 58 at least once consumed ecstasy pills. Thus the point prevalence of ecstasy consumption among the students was 14.19 percent. There were 232 subjects who had never heard of the term “ecstasy". Instead, the knowledge source of the rest about ecstasy was books (116 subject, internet (56 subjects, mass media (489 subjects, friends (28 subjects, and family (2 subjects. A significant relation was observed between ecstasy consumption and other variables (parents' education, residence in student campus, attending parties, smoking, canabis and opium consumption. Conclusion: Results of this study revealed that the point prevalence of ecstasy pills consumption among university students was 14.19% that raises the need for purposive intervention and the necessity of planning to prevent and decrease this phenomenon.(Sci J Hamadan Univ Med Sci 2012;18(4:67-72

Mental health consequences of overstretch in the UK Armed Forces, 2007-09: a population-based cohort study.

Science.gov (United States)

Rona, Roberto J; Jones, Margaret; Keeling, Mary; Hull, Lisa; Wessely, Simon; Fear, Nicola T

2014-12-01

Concerns have been raised about the effect of tour length on the mental health of the UK armed forces. In 2007, we reported that cumulative length of deployment was associated with mental illness in military personnel. Our findings provided empirical evidence to support the UK advisory policy for tour length, known as the Harmony Guidelines. If fully implemented, these guidelines could aid prevention of mental illnesses. We aimed to reassess the association between cumulative length of deployment and number of deployments with mental illness in the UK forces. Our analysis was based on data from a representative study of the military for UK regular personnel who had completed a questionnaire between Nov 2, 2007, and Sept 24, 2009, and were deployed in the 3 years before questionnaire completion. Study outcomes were presence of possible post-traumatic stress disorder (PTSD), psychological distress, multiple physical symptoms, alcohol misuse, problems at home during and after deployment, and relationship or family problems. The key independent factors were deployment for 13 months or more, and months and number of deployments in the past 3 years. 8278 regulars responded to the questionnaire, of whom 3982 (48%) had been deployed in the 3 years before questionnaire completion. Deployment for 13 months or more decreased from 22% in March, 2005, (median March 8, 2005 [IQR Oct 10, 2004 to April 28, 2005]), to 12% in May, 2008, (May 17, 2008, [Feb 14, 2008, to Dec 5, 2008]). We noted an association between cumulative time deployed as a continuous variable and a score of 40 or more on the PTSD checklist (p=0·002), presence of psychological distress (p=0·018), and multiple physical symptoms (p=0·030; table 2). Furthermore, 13 months or more of deployment was associated with multiple physical symptoms (adjusted odds ratio [OR] 2·15, 95% CI 1·39-3·32), a PTSD checklist score of 40 or more (2·02, 1·31-3·12), and problems at home, but not a PTSD checklist score of 50 or

Poverty monitor 2007

NARCIS (Netherlands)

Cok Vrooman; Stella Hoff; Ferdy Otten; Wim Bos

2007-01-01

Original title: Armoedemonitor 2007. The Poverty Monitor 2007 contains the most up-to-date figures on poverty in the Netherlands. The data were collected and analysed by the Netherlands Institute for Social Research/SCP in collaboration with Statistics Netherlands (CBS). The report describes

y bovina con hidróxido de sodio y cal común saturada

Directory of Open Access Journals (Sweden)

Alejandro Chac\\u00F3n Villalobos

2006-01-01

Full Text Available El presente estudio fue efectuado en el módulo de procesamiento de derivados lácteos de la Estación Experimental Alfredo Volio Mata de la Universidad de Costa Rica, durante los meses de mayo y junio del 2005. Una muestra compuesta de leche de cabra (Capra hircus de un hato Lamancha y una muestra compuesta de leche de vaca de un hato Jersey (Bos taurus, formadas ambas por la mezcla de tres ordeños aleatorios diferentes, fueron pasteurizadas (65 °C/ 30 min. y almacenadas durante seis días a 6 ºC. Dos operarios especializados del módulo, analizaron por sextuplicado cada 48 horas (iniciando a las 0 horas las muestras de ambos tipos de leche por medio de una valoración convencional de la acidez con una disolución patrón de NaOH 0,1N, y de una valoración con tres disoluciones saturadas de cal preparadas cada una con marcas comerciales diferentes. Los datos se evaluaron por medio de un diseño factorial para dos niveles del factor “analista” (analista A y B, cuatro niveles del factor “tipo de valoración” y cuatro niveles del factor “tiempo de almacenamiento”. La variable respuesta evaluada fue el porcentaje de acidez expresada como ácido láctico. Para los dos tipos de leche, los métodos de valoración que emplearon disoluciones saturadas de cal mostraron ser significativamente diferentes al método basado en NaOH (p ≤ 0,05. En ambos casos, para cada nivel del “tipo de valoración” determinado, el efecto de la determinación del porcentaje de acidez expresado como ácido láctico no se ve afectado por el analista

Aplicação de ferramentas Lean numa PME do setor do calçado

OpenAIRE

Teixeira, Ricardo Jorge Leite

2017-01-01

Dissertação de mestrado em Engenharia Industrial (área de especialização em Gestão Industrial) A indústria do calçado, é, ainda, uma indústria com uma forte componente de trabalho manual, operações sistemáticas e uma extensa cadeia produtiva. Nesse sentido, não raras vezes, problemas associados a longos leads times, estrangulamentos no fluxo produtivo e grandes quantidades de produto em vias de fabrico estão presentes no quotidiano de muitas organizações que operam no setor. Ne...

Bowhead Whale Feeding Ecology Study (BOWFEST): Aerial Survey in Chukchi and Beaufort Seas conducted from 2007-08-23 to 2011-09-16 (NCEI Accession 0131425)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The Bowhead Whale Feeding Ecology Study (BOWFEST) was initiated in May 2007 through an Interagency Agreement between the Bureau of Ocean Energy Management (BOEM)...

Application of CalME incremental-recursive method to the evaluation of the structural condition as asphalt pavements

International Nuclear Information System (INIS)

Mateos Moreno, A.; Perez Ayuso, J.; Cadavid Jauregui, B.; Marron Fernandez, J. O.

2011-01-01

CalME procedure represents one of the most advanced tools for the design, of flexible pavements world-wide. IT is an incremental-recursive method, which means that pavements service life must be divided into many time intervals where both structural integrity and environmental conditions can be regarded as constants. It also means that the damage calculated at the end of each interval must be considered as initial condition for the next one. The goal of this type of models is the prediction of the evolution of the different distress mechanisms. The advantages of incremental-recursive procedures versus classical analytical design are shown in this paper. Advantages are shown not only in terms of design, but also as a tool in order to support structural evaluation. In particular, the potential of asphalt fatigue model incorporated in CalME is presented. this model is initially calibrated in the laboratory, and it is then re-calibrated based on the actual performance observed from field deflection testing. The model provides a reliable prediction of the future evolution of the damage of the asphalt mixture. Fatigue model validation has been conducted based on the performance from several flexible sections evaluated in CEDEX full-scale pavements test track. (Author) 14 refs.

Neolithisation of the Aegean and Southeast Europe during the 6600–6000 calBC period of Rapid Climate Change

Directory of Open Access Journals (Sweden)

Bernhard Weninger

2014-12-01

Full Text Available In extension of the recently established ‘Rapid Climate Change (RCC Neolithisation Model’ (Clare 2013, in the present paper we demonstrate the existence of a remarkable coincidence between the exact (decadel-scale entry and departure dates of the Neolithic into/from the Aegean (~6600/6050 calBC with begin/end of RCC-conditions.

Resonance – Journal of Science Education | Indian Academy of ...

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. P K Srivastava. Articles written in Resonance – Journal of Science Education. Volume 12 Issue 8 August 2007 pp 85-96 Reflections. Remembering Newton · P K Srivastava · More Details Fulltext PDF ...

Physical, biological and optical oceanographic data collected from moored buoys in the Bering Strait from 08/16/2004 to 09/03/2007 (NODC Accession 0045300)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Physical, current meter, biological, and optical oceanographic data were collected in the Bering Strait from August 16, 2004 to September 3, 2007. These data were...

Influencia de los materiales cementantes suplementarios sobre la cinética de transporte de agua y las propiedades mecánicas de cal hidratada y morteros de cemento

OpenAIRE

Ince, C.; Derogar, S.; Michelitsch, T. M.

2015-01-01

El objetivo de este artículo es investigar el papel de los materiales cementantes suplementarios (SCMs) en la cinética de transporte del agua y en las propiedades mecánicas de los morteros de cal hidratada (CL90) y cemento Portland. Las propiedades de la cal hidratada son significativamente diferentes a las del cemento y por lo tanto el control de las propiedades de los morteros frescos y endurecidos es fundamental en la optimización mortero/substrato en albañilería. Los parámetros estudiados...

Review of research on simulation engineering in FY2007

International Nuclear Information System (INIS)

2009-02-01

Research on simulation engineering for nuclear applications, based on the plan for meeting the mid-term goal of the Japan Atomic Energy Agency', has been performed at Center for Computational Science and e-Systems, Japan Atomic Energy Agency (CCSE/JAEA). CCSE established the committee consisting outside experts and authorities which does research evaluation and advices for the assistance of the research and development. This report summarizes the result of the evaluation by the committee on the research on simulation engineering performed at CCSE/JAEA in FY2007. (author)

Facing tomorrow's challenges: U.S. Geological Survey science in the decade 2007-2017

Science.gov (United States)

,

2007-01-01

In order for the U.S. Geological Survey (USGS) to respond to evolving national and global priorities, it must periodically reflect on, and optimize, its strategic directions. This report is the first comprehensive science strategy since the early 1990s to examine critically major USGS science goals and priorities. The development of this science strategy comes at a time of global trends and rapidly evolving societal needs that pose important natural-science challenges. The emergence of a global economy affects the demand for all resources. The last decade has witnessed the emergence of a new model for managing Federal lands-ecosystem-based management. The U.S. Climate Change Science Program predicts that the next few decades will see rapid changes in the Nation's and the Earth's environment. Finally, the natural environment continues to pose risks to society in the form of volcanoes, earthquakes, wildland fires, floods, droughts, invasive species, variable and changing climate, and natural and anthropogenic toxins, as well as animal-borne diseases that affect humans. The use of, and competition for, natural resources on the global scale, and natural threats to those resources, has the potential to impact the Nation's ability to sustain its economy, national security, quality of life, and natural environment. Responding to these national priorities and global trends requires a science strategy that not only builds on existing USGS strengths and partnerships but also demands the innovation made possible by integrating the full breadth and depth of USGS capabilities. The USGS chooses to go forward in the science directions proposed here because the societal issues addressed by these science directions represent major challenges for the Nation's future and for the stewards of Federal lands, both onshore and offshore. The six science directions proposed in this science strategy are listed as follows. The ecosystems strategy is listed first because it has a dual nature

[Inpatient Salivary Gland Surgery in Germany: A DRG-Based Nationwide Analysis, 2007-2011].

Science.gov (United States)

Jensen, J E; Schlattmann, P; Guntinas-Lichius, O

2016-09-01

This is the first population-based analysis of inpatient salivary gland surgery across Germany. Nationwide Diagnosis-Related Groups (DRG) statistics for 2007 to 2011 were analyzed regarding indications for salivary gland surgery based on ICD-10 codes. Age specific surgery rates were calculated for both sexes. Inpatient salivary gland surgical rates in 2007-2011 amounted for incisions (OPS [Classification of Operations and Procedures] code 5-260) 1.43 per 100 000 population, for excisions (5-261) 2.06 per 100 000, for salivary gland resections (5-262) 2.06 per 100 000, and for external incisions (5-270) 0.43 per 100 000. Regarding the mentioned four OPS codes, the surgical rates for benign tumors accounted to 10.08 per 100 000, for sialadenitis (without sialoliths) to 4.00 per 100 000, for malignant tumors to 3.90 per 100 000, and for sialolithiasis to 2.09 per 100 000. The increase of surgical rates from 2007 to 2011 was significant for malignant and benign tumors as well as for salivary stones. The surgical rates were highest for patients>60 years. Especially surgery for malignant tumors was more frequent than expected. In spite of the introduction of minimal invasive technique the rates for salivary gland resections in case of sialadenitis or sialolithiasis still seem to be high. © Georg Thieme Verlag KG Stuttgart · New York.

Competence in Mathematics and Academic Achievement: An Analysis of Enrollees in the Bachelor of Science in Actuarial Science Program

Science.gov (United States)

Wamala, Robert; Maswere, Dyson W.; Mwanga, Yeko

2013-01-01

This study investigates the role of prior grounding attained in mathematics in predicting the academic achievement of enrollees in Bachelor of Science in Actuarial Science (BSAS). The investigation is based on administrative records of 240 BSAS enrollees at Makerere University, School of Statistics and Planning in the 2007-2009 cohorts. Students'…

Chemical and physical oceanographic profile data collected from CTD casts aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater Horizon oil spill event (NODC Accession 0069071)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...

ANALISIS SITIRAN ARTIKEL JURNAL LUAR NEGERI PADA LAPORAN PENELITIAN DI LEMBAGA PENELITIAN DAN PENGABDIAN KEPADA MASYARAKAT UGM YANG DIBIAYAI BADAN LITBANG PERTANIAN DEPARTEMEN PERTANIAN TAHUN 2007

Directory of Open Access Journals (Sweden)

Sri Junandi

2016-02-01

Community Services GMU funded by the Agricultural Research and Development Department of Agriculture in 2007, including 35 titles of the journal subscribed by Library Faculty of Agro complex in GMU, (2 The frequency of the citation of the 35 titles was that : Applied and Environmental Microbiology by 14 times (6,51%, Postharvest Biology and Technology and Trans of the ASAE by 12 (5,55%, J. of Food Engineering by 10 (4,65%, J. of Food Science by 10 (3,72%, Plant and Soil by 8 (3,26%, J. of Agriculture Eng. Research by 6 (2,79%, Bioresource Tech. by 5 (2,33%, Food Tech. and J. of Dairy Science by 4 respectively (1,86%, Intern. J. of Food Microbiology, J. Animal Science, J. of Biomass and Bioenergy, J. of Stored Product Research, and Solar Energy by 3 respectively (1,40%, Food Chemistry, J. Meat Science, J.of Bioscience and Bioengineering, and Soil Science Society of America Journal by each 2 (0,93%, Agriculture Ecosystems & Environment, Agricultural Systems, Agronomy J., Biosystems Engi., Biotechnology Letters, Cell, Computers and Electronics in Agricultural, Crop Science, Environmental and Experimental Botany, Food Control, Hort Science, Intern. Dairy J., J. of Food Microbiology, Soil Biology and Biochemistry, Trends in Food Science & Technology, and Trends in Plant Science by 1 each (0,47%. (3 There are also a relevancy between the scientific articles in research reports at the Institute for Research and Service to the Community financed GMU Agricultural Research Agency Ministry of Agriculture in 2007 with a study published in the journal referred abroad, and their utilization are more prone to support theoretical approaches and findings, (4 Journal publications are used abroad as a reference in a research report at Institute for Research and Community Services GMU funded by the Agricultural Research and Development Department of Agriculture in 2007 was included in a current category 60.47% or equal to 130 citation, not current category 40.01% or equel to 85 citastion, and

ICMCS-2007: 5. international conference on microelectronics and computer science. Proceedings. V. 1

International Nuclear Information System (INIS)

Kanter, V.; Balmus, I.

2007-01-01

This book includes articles which cover a vast range of subjects, such as: micro- and optoelectronics, nano science and nanotechnology, computer science, electronics and communications, new technologies for university education, etc.

Games in Science Education

DEFF Research Database (Denmark)

Magnussen, Rikke

2014-01-01

, 2007). Some of these newer formats are developed in partnerships between research and education institutions and game developers and are based on learning theory as well as game design methods. Games well suited for creating narrative framework or simulations where students gain first-hand experience......This paper presents a categorisation of science game formats in relation to the educational possibilities or limitations they offer in science education. This includes discussion of new types of science game formats and gamification of science. Teaching with the use of games and simulations...... in science education dates back to the 1970s and early 80s were the potentials of games and simulations was discussed extensively as the new teaching tool ( Ellington et al. , 1981). In the early 90s the first ITC -based games for exploration of science and technical subjects was developed (Egenfeldt...