WorldWideScience

Sample records for schroedinger francis crick

  1. Erwin Schroedinger, Francis Crick and epigenetic stability

    Directory of Open Access Journals (Sweden)

    Ogryzko Vasily V

    2008-04-01

    Full Text Available Abstract Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  2. Erwin Schroedinger, Francis Crick and epigenetic stability.

    Science.gov (United States)

    Ogryzko, Vasily V

    2008-04-17

    Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  3. The Francis Crick Institute.

    Science.gov (United States)

    Peters, Keith; Smith, Jim

    2017-04-01

    The Francis Crick Institute Laboratory, opened in 2016, is supported by the Medical Research Council, Cancer Research UK, the Wellcome Trust, and University College London, King's College London and Imperial College London. The emphasis on research training and early independence of gifted scientists in a multidisciplinary environment provides unique opportunities for UK medical science, including clinical and translational research. © Royal College of Physicians 2017. All rights reserved.

  4. Francis Crick (1916–2004)

    Indian Academy of Sciences (India)

    Administrator

    The death of Francis Crick deprives us of one of the great- est scientists of the 20th century, whose creativity and power of mind dominated molecular biology in its golden years. Many people have told the story of his achievements; here I would simply like to recollect some of the qualities of this remarkable man. The first ...

  5. Francis Crick, DNA, and the Central Dogma

    Science.gov (United States)

    Olby, Robert

    1970-01-01

    This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

  6. 60 years ago, Francis Crick changed the logic of biology.

    Directory of Open Access Journals (Sweden)

    Matthew Cobb

    2017-09-01

    Full Text Available In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  7. 60 years ago, Francis Crick changed the logic of biology.

    Science.gov (United States)

    Cobb, Matthew

    2017-09-01

    In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  8. Francis Crick: A Singular Approach to Scientific Discovery.

    Science.gov (United States)

    Lawrence, Peter A

    2016-12-01

    Francis' office window (at the Salk) commanded a panorama of the Pacific. "This grand natural scene was a physical correlate of Francis's intellectual world: wide-ranging, brilliantly lit, a little overawing, but also immensely inviting and above all an exciting place to be." (Mitchison, 2004). Copyright © 2016 Elsevier Inc. All rights reserved.

  9. On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.

    Science.gov (United States)

    Teive, Hélio A G

    2016-04-01

    The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  10. A world in one dimension: Linus Pauling, Francis Crick and the central dogma of molecular biology.

    Science.gov (United States)

    Strasser, Bruno J

    2006-01-01

    In 1957, Francis Crick outlined a startling vision of life in which the great diversity of forms and shapes of macromolecules was encoded in the one-dimensional sequence of nucleic acids. This paper situates Crick's new vision in the debates of the 1950s about protein synthesis and gene action. After exploring the reception of Crick's ideas, it shows how they differed radically from a different model of protein synthesis which enjoyed wide currency in that decade. In this alternative model, advocated by Linus Pauling and other luminaries, three-dimensional templates directed the folding of proteins. Even though it was always considered somewhat speculative, this theory was supported by a number of empirical results originating in different experimental systems. It was eventually replaced by a model in which the forms and shapes of macromolecules resulted solely from their amino acid sequence, dramatically simplifying the problem of protein synthesis which Crick was attempting to solve in 1957.

  11. On the centenary of the birth of Francis H. C. Crick – from physics to genetics and neuroscience

    Directory of Open Access Journals (Sweden)

    Hélio A. G. Teive

    2016-04-01

    Full Text Available ABSTRACT The year 2016 marks the centenary of the birth of Francis Crick (1916–2004, who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  12. Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience.

    Science.gov (United States)

    Aicardi, Christine

    2016-02-01

    The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a 'cross-worlds influencer' who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise 'un-disciplined' new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against 'vitalism': anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of 'doing science' and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: 'follow the cross-worlds influencers' who worked to build and organise these semi-institutional gatherings and institutional structures. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

  13. Of the Helmholtz Club, South-Californian seedbed for visual and cognitive neuroscience, and its patron Francis Crick.

    Science.gov (United States)

    Aicardi, Christine

    2014-03-01

    Taking up the view that semi-institutional gatherings such as clubs, societies, research schools, have been instrumental in creating sheltered spaces from which many a 20th-century project-driven interdisciplinary research programme could develop and become established within the institutions of science, the paper explores the history of one such gathering from its inception in the early 1980s into the 2000s, the Helmholtz Club, which brought together scientists from such various research fields as neuroanatomy, neurophysiology, psychophysics, computer science and engineering, who all had an interest in the study of the visual system and of higher cognitive functions relying on visual perception such as visual consciousness. It argues that British molecular biologist turned South Californian neuroscientist Francis Crick had an early and lasting influence over the Helmholtz Club of which he was a founding pillar, and that from its inception, the club served as a constitutive element in his long-term plans for a neuroscience of vision and of cognition. Further, it argues that in this role, the Helmholtz Club served many purposes, the primary of which was to be a social forum for interdisciplinary discussion, where 'discussion' was not mere talk but was imbued with an epistemic value and as such, carefully cultivated. Finally, it questions what counts as 'doing science' and in turn, definitions of success and failure-and provides some material evidence towards re-appraising the successfulness of Crick's contribution to the neurosciences. Copyright © 2013 The Author. Published by Elsevier Ltd.. All rights reserved.

  14. Crick, Prof. Francis Harry Compton

    Indian Academy of Sciences (India)

    Date of death: 29 July 2004. Last known address: The Salk Institute for Biological, Studies, P.O. Box 85800, San Diego, CA 92186-5800, ... Posted on 21 December 2017. ASTROPHYSICS: An Observational View of the Universe. Math Art and Design: MAD about Math, Math Education and Outreach. Math and Finance ...

  15. London home for Crick archive.

    Science.gov (United States)

    Williams, Nigel

    2002-01-08

    Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.

  16. Several outstanding obituaries of Crick have been penned by his ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 9; Issue 11. Francis Crick (1916-2004). S Mahadevan. Article-in-a-Box Volume 9 Issue 11 November 2004 pp 3-7. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/009/11/0003-0007. Author Affiliations.

  17. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  18. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  19. The Schroedinger eigenvalue march

    Energy Technology Data Exchange (ETDEWEB)

    Tannous, C; Langlois, J, E-mail: tannous@univ-brest.fr [Laboratoire de Magnetisme de Bretagne, CNRS-FRE 3117, Universite de Bretagne Occidentale, BP: 809 Brest CEDEX 29285 (France)

    2011-11-15

    A simple numerical method for the determination of Schroedinger equation eigenvalues is introduced. It is based on a marching process that starts from an arbitrary point, proceeds in two opposite directions simultaneously and stops after a tolerance criterion is met. The method is applied to solving several 1D potential problems including symmetric double-well (ammonia inversion problem) and Johnson asymmetric potentials, 3D hydrogen atom and Morse potential. Band structure calculation can equally be tackled by extending marching to the complex plane as illustrated with the Kronig-Penney problem.

  20. Effective Schroedinger equations on submanifolds

    Energy Technology Data Exchange (ETDEWEB)

    Wachsmuth, Jakob

    2010-02-11

    In this thesis the time dependent Schroedinger equation is considered on a Riemannian manifold A with a potential that localizes a certain class of states close to a fixed submanifold C, the constraint manifold. When the potential is scaled in the directions normal to C by a small parameter epsilon, the solutions concentrate in an epsilon-neighborhood of the submanifold. An effective Schroedinger equation on the submanifold C is derived and it is shown that its solutions, suitably lifted to A, approximate the solutions of the original equation on A up to errors of order {epsilon}{sup 3} vertical stroke t vertical stroke at time t. Furthermore, it is proved that, under reasonable conditions, the eigenvalues of the corresponding Hamiltonians below a certain energy coincide upto errors of order {epsilon}{sup 3}. These results holds in the situation where tangential and normal energies are of the same order, and where exchange between normal and tangential energies occurs. In earlier results tangential energies were assumed to be small compared to normal energies, and rather restrictive assumptions were needed, to ensure that the separation of energies is maintained during the time evolution. The most important consequence of this thesis is that now constraining potentials that change their shape along the submanifold can be treated, which is the typical situation in applications like molecular dynamics and quantum waveguides.

  1. Schroedinger's Cat is not Alone

    CERN Document Server

    Gato, Beatriz

    2010-01-01

    We introduce the `Complete Wave Function' and deduce that all living beings, not just Schroedinger's cat, are actually described by a superposition of `alive' and `dead' quantum states; otherwise they would never die. Therefore this proposal provides a quantum mechanical explanation to the world-wide observation that we all pass away. Next we consider the Measurement problem in the framework of M-theory. For this purpose, together with Schroedinger's cat we also place inside the box Rasputin's cat, which is unaffected by poisson. We analyse the system identifying its excitations (catons and catinos) and we discuss its evolution: either to a classical fight or to a quantum entanglement. We also propose the $BSV\\Psi$ scenario, which implements the Complete Wave Function as well as the Big Bang and the String Landscape in a very (super)natural way. Then we test the gravitational decoherence of the entangled system applying an experimental setting due to Galileo. We also discuss the Information Loss paradox. For ...

  2. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  3. Schroedinger equation for bosons and fermions

    Energy Technology Data Exchange (ETDEWEB)

    Kaniadakis, G. [Politecnico di Torino (Italy). Dipt. di Fisica]|[Istituto Nazionale di Fisica della Materia, Unita del Politecnico di Torino, Turin (Italy)]|[Istituto Nazionale di Fisica Nucleare, Turin (Italy)

    1995-10-09

    We propose a non-linear Schroedinger equation describing the dynamics of bosons or fermions in an effective external force field. This equation is obtained by quantization of a stochastic Markovian process obeying a generalized exclusion principle. (orig.).

  4. Philosophy of Erwin Schroedinger: a diachronic view of Schroedinger's thoughts

    Energy Technology Data Exchange (ETDEWEB)

    Melgar, M.F.

    1988-03-01

    There is no agreement within the scientific community about the philosophy of Schroedinger. Some people think that he was a realist, while others defend him as an idealist. In this paper we study a number of Schroedinger's works and we show that the epithets of realist and idealist do not do him justice. Toward the end we conclude that it would be more adequate to place him in the trend known as the philosophy of immanence.

  5. A reliable treatment for nonlinear Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Khani, F. [Department of Mathematics, Ilam University, PO Box 69315516, Ilam (Iran, Islamic Republic of); Department of Mathematics, Bakhtar Institute of Higher Education, PO Box 696, Ilam (Iran, Islamic Republic of)], E-mail: farzad_khani59@yahoo.com; Hamedi-Nezhad, S. [Department of Mathematics, Bakhtar Institute of Higher Education, PO Box 696, Ilam (Iran, Islamic Republic of)], E-mail: s_hamedi2001@yahoo.com; Molabahrami, A. [Department of Mathematics, Ilam University, PO Box 69315516, Ilam (Iran, Islamic Republic of)], E-mail: a_m_bahrami@yahoo.com

    2007-11-12

    Exp-function method is used to find a unified solution of nonlinear wave equation. Nonlinear Schroedinger equations with cubic and power law nonlinearity are selected to illustrate the effectiveness and simplicity of the method. It is shown that the Exp-function method, with the help of symbolic computation, provides a powerful mathematical tool for solving nonlinear equation.

  6. Schroedinger upper bounds to semirelativistic eigenvalues

    Energy Technology Data Exchange (ETDEWEB)

    Hall, Richard L [Department of Mathematics and Statistics, Concordia University, 1455 de Maisonneuve Boulevard West, Montreal, Quebec, H3G 1M8 (Canada); Lucha, Wolfgang [Institut fuer Hochenergiephysik, Oesterreichische Akademie der Wissenschaften, Nikolsdorfergasse 18, A-1050 Vienna (Austria)

    2005-09-16

    Problems posed by semirelativistic Hamiltonians of the form H = {radical}(m{sup 2} + p{sup 2}) + V(r) are studied. It is shown that energy upper bounds can be constructed in terms of certain related Schroedinger operators; these bounds include free parameters which can be chosen optimally.

  7. A life of Erwin Schroedinger. 2. ed.; Erwin Schroedinger. Eine Biographie

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Walter J.

    2015-07-01

    Erwin Schroedinger (1887-1961) was a pioneer of quantum physics, one of the most important scientist of the 20th century at all and a charming Austrian. He was a man with a passionate interest for men and ideas. Mostly known he became by his representation of quantum theory in the form of wave mechanics, for which he obtained the Nobel prize for physics and naturally by the famous thought experiment ''Schroedingers cat''. Walter Moore's biography is quite near to the person of Schroedinger and presents his scientific work in the context of his friendships, his interset for mysticism, and in front of the moving background of the political events in Germany and Austria.

  8. Derivation of the Crick-Wyman equation for allosteric proteins defining the difference between the number of binding sites and the Hill coefficient.

    Science.gov (United States)

    Poitevin, Frédéric; Edelstein, Stuart J

    2013-05-13

    In response to a 100-word footnote in the 1965 article by Monod, Wyman, and Changeux, a detailed manuscript signed by Francis Crick and Jeffries Wyman with 6000 words and 30 equations entitled "A Footnote on Allostery" circulated in 1965 among a limited group of scientists interested in allosteric interactions. This interesting and provocative document is published in this special issue for the first time. An intriguing equation in their text relates the difference between n (the number of ligand binding sites) and n' (the Hill coefficient) to the ratio of the saturation functions Y¯, for oligomers with n-1 and n binding sites. A compact derivation of this equation was not provided by Crick and Wyman, but one is presented here based on a definition of Y¯ involving the binding polynomial and its first derivative. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Orbital stability of standing waves for some nonlinear Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Cazenave, T.; Lions, P.L.

    1982-08-01

    We present a general method which enables as to prove the orbital stability of some standing waves in nonlinear Schroedinger equations. For example, we treat the cases of nonlinear Schroedinger equations arising in laser beams, of time-dependent Hartree equations.

  10. Francis Bacon's behavioral psychology.

    Science.gov (United States)

    MacDonald, Paul S

    2007-01-01

    Francis Bacon offers two accounts of the nature and function of the human mind: one is a medical-physical account of the composition and operation of spirits specific to human beings, the other is a behavioral account of the character and activities of individual persons. The medical-physical account is a run-of-the-mill version of the late Renaissance model of elemental constituents and humoral temperaments. The other, less well-known, behavioral account represents an unusual position in early modern philosophy. This theory espouses a form of behavioral psychology according to which (a) supposed mental properties are "hidden forms" best described in dispositional terms, (b) the true character of an individual can be discovered in his observable behavior, and (c) an "informed" understanding of these properties permits the prediction and control of human behavior. Both of Bacon's theories of human nature fall under his general notion of systematic science: his medical-physical theory of vital spirits is theoretical natural philosophy and his behavioral theory of disposition and expression is operative natural philosophy. Because natural philosophy as a whole is "the inquiry of causes and the production of effects," knowledge of human nature falls under the same two-part definition. It is an inquisition of forms that pertains to the patterns of minute motions in the vital spirits and the production of effects that pertains both to the way these hidden motions produce behavioral effects and to the way in which a skillful agent is able to produce desired effects in other persons' behavior. (c) 2007 Wiley Periodicals, Inc.

  11. The Schroedinger-Virasoro algebra. Mathematical structure and dynamical Schroedinger symmetries

    Energy Technology Data Exchange (ETDEWEB)

    Unterberger, Jeremie [Henri Poincare Univ., Vandoeuvre-les-Nancy (France). Inst. Elie Cartan; Roger, Claude [Lyon I Univ., Villeurbanne (France). Dept. de Mathematiques

    2012-07-01

    This monograph provides the first up-to-date and self-contained presentation of a recently discovered mathematical structure the Schroedinger-Virasoro algebra. Just as Poincare invariance or conformal (Virasoro) invariance play a key role in understanding, respectively, elementary particles and two-dimensional equilibrium statistical physics, this algebra of non-relativistic conformal symmetries may be expected to apply itself naturally to the study of some models of non-equilibrium statistical physics, or more specifically in the context of recent developments related to the non-relativistic AdS/CFT correspondence. The study of the structure of this infinite-dimensional Lie algebra touches upon topics as various as statistical physics, vertex algebras, Poisson geometry, integrable systems and supergeometry as well as representation theory, the cohomology of infinite-dimensional Lie algebras, and the spectral theory of Schroedinger operators. (orig.)

  12. Schroedinger operators and evolutionary strategies; Schroedinger-Operatoren und Evolutionaere Strategien

    Energy Technology Data Exchange (ETDEWEB)

    Asselmeyer, T.

    1997-12-22

    First we introduce a simple model for the description of evolutionary algorithms, which is based on 2nd order partial differential equations for the distribution function of the individuals. Then we turn to the properties of Boltzmann's and Darwin's strategy. the next chapter is dedicated to the mathematical properties of Schroedinger operators. Both statements on the spectral density and their reproducibility during the simulation are summarized. The remaining of this chapter are dedicated to the analysis of the kernel as well as the dependence of the Schroedinger operator on the potential. As conclusion from the results of this chapter we obtain the classification of the strategies in dependence of the fitness. We obtain the classification of the evolutionary strategies, which are described by a 2nd order partial differential equation, in relation to their solution behaviour. Thereafter we are employed with the variation of the mutation distribution.

  13. Cubic nonlinear Schroedinger equation with vorticity

    Energy Technology Data Exchange (ETDEWEB)

    Caliari, M; Morato, L M; Zuccher, S [Dipartimento di Informatica, Universita di Verona, Ca' Vignal 2, Strada Le Grazie 15, 37134 Verona (Italy); Loffredo, M I [Dipartimento di Scienze Matematiche ed Informatiche, Universita di Siena, Pian dei Mantellini 44, 53100 Siena (Italy)], E-mail: marco.caliari@univr.it, E-mail: loffredo@unisi.it, E-mail: laura.morato@univr.it, E-mail: zuccher@sci.univr.it

    2008-12-15

    In this paper, we introduce a new class of nonlinear Schroedinger equations (NLSEs), with an electromagnetic potential (A,{phi}), both depending on the wavefunction {psi}. The scalar potential {phi} depends on |{psi}|{sup 2}, whereas the vector potential A satisfies the equation of magnetohydrodynamics with coefficient depending on {psi}. In Madelung variables, the velocity field comes to be not irrotational in general and we prove that the vorticity induces dissipation, until the dynamical equilibrium is reached. The expression of the rate of dissipation is common to all NLSEs in the class. We show that they are a particular case of the one-particle dynamics out of dynamical equilibrium for a system of N identical interacting Bose particles, as recently described within stochastic quantization by Lagrangian variational principle. The cubic case is discussed in particular. Results of numerical experiments for rotational excitations of the ground state in a finite two-dimensional trap with harmonic potential are reported.

  14. The coevolution of genes and genetic codes: Crick's frozen accident revisited.

    Science.gov (United States)

    Sella, Guy; Ardell, David H

    2006-09-01

    The standard genetic code is the nearly universal system for the translation of genes into proteins. The code exhibits two salient structural characteristics: it possesses a distinct organization that makes it extremely robust to errors in replication and translation, and it is highly redundant. The origin of these properties has intrigued researchers since the code was first discovered. One suggestion, which is the subject of this review, is that the code's organization is the outcome of the coevolution of genes and genetic codes. In 1968, Francis Crick explored the possible implications of coevolution at different stages of code evolution. Although he argues that coevolution was likely to influence the evolution of the code, he concludes that it falls short of explaining the organization of the code we see today. The recent application of mathematical modeling to study the effects of errors on the course of coevolution, suggests a different conclusion. It shows that coevolution readily generates genetic codes that are highly redundant and similar in their error-correcting organization to the standard code. We review this recent work and suggest that further affirmation of the role of coevolution can be attained by investigating the extent to which the outcome of coevolution is robust to other influences that were present during the evolution of the code.

  15. Diophantine approximation and the solubility of the Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Kristensen, Simon

    2003-07-21

    We characterise the set of periods for which number theoretical obstructions prevent us from finding periodic solutions of the Schroedinger equation on a two-dimensional torus as well as the asymptotic occurrence of possible resonances.

  16. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  17. Francis Bacon: Back to Degas

    OpenAIRE

    Hammer, Martin

    2012-01-01

    Providing the first focused account of Francis Bacon’s artistic dialogue with Edgar Degas, Martin Hammer argues that the French painter was a consistent source of inspiration to Bacon throughout his career, informing his decisions about subject matter, style and medium.

  18. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  19. Watson-Crick hydrogen bonding of unlocked nucleic acids.

    Science.gov (United States)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-11-15

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Spectral Target Detection using Schroedinger Eigenmaps

    Science.gov (United States)

    Dorado-Munoz, Leidy P.

    Applications of optical remote sensing processes include environmental monitoring, military monitoring, meteorology, mapping, surveillance, etc. Many of these tasks include the detection of specific objects or materials, usually few or small, which are surrounded by other materials that clutter the scene and hide the relevant information. This target detection process has been boosted lately by the use of hyperspectral imagery (HSI) since its high spectral dimension provides more detailed spectral information that is desirable in data exploitation. Typical spectral target detectors rely on statistical or geometric models to characterize the spectral variability of the data. However, in many cases these parametric models do not fit well HSI data that impacts the detection performance. On the other hand, non-linear transformation methods, mainly based on manifold learning algorithms, have shown a potential use in HSI transformation, dimensionality reduction and classification. In target detection, non-linear transformation algorithms are used as preprocessing techniques that transform the data to a more suitable lower dimensional space, where the statistical or geometric detectors are applied. One of these non-linear manifold methods is the Schroedinger Eigenmaps (SE) algorithm that has been introduced as a technique for semi-supervised classification. The core tool of the SE algorithm is the Schroedinger operator that includes a potential term that encodes prior information about the materials present in a scene, and enables the embedding to be steered in some convenient directions in order to cluster similar pixels together. A completely novel target detection methodology based on SE algorithm is proposed for the first time in this thesis. The proposed methodology does not just include the transformation of the data to a lower dimensional space but also includes the definition of a detector that capitalizes on the theory behind SE. The fact that target pixels and

  1. Random discrete Schroedinger operators from random matrix theory

    Energy Technology Data Exchange (ETDEWEB)

    Breuer, Jonathan [Institute of Mathematics, Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Forrester, Peter J [Department of Mathematics and Statistics, University of Melbourne, Parkville, Vic 3010 (Australia); Smilansky, Uzy [Department of Physics of Complex Systems, Weizmann Institute, Rehovot 76100 (Israel)

    2007-02-02

    We investigate random, discrete Schroedinger operators which arise naturally in the theory of random matrices, and depend parametrically on Dyson's Coulomb gas inverse temperature {beta}. They are similar to the class of 'critical' random Schroedinger operators with random potentials which diminish as vertical bar x vertical bar{sup -1/2}. We show that as a function of {beta} they undergo a transition from a regime of (power-law) localized eigenstates with a pure point spectrum for {beta} < 2 to a regime of extended states with a singular continuous spectrum for {beta} {>=} 2. (fast track communication)

  2. Intertwining operator method and supersymmetry for effective mass Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Suzko, A.A. [Joint Institute for Nuclear Research, 141980 Dubna (Russian Federation); JIPENP, National Academy of Sciences of Belarus, Minsk (Belarus)], E-mail: suzko@cv.jinr.ru; Schulze-Halberg, A. [Mathematics Department, University of Colima, Bernal Diaz del Castillo 340, Colima 28045 (Mexico)], E-mail: xbat@ucol.mx

    2008-09-08

    By application of the intertwining operator method to Schroedinger equations with position-dependent (effective) mass, we construct Darboux transformations, establish the supersymmetry factorization technique and show equivalence of both formalisms. Our findings prove equivalence of the intertwining technique and the method of point transformations.

  3. Evaluation of eigenvalues of a smooth potential via Schroedinger ...

    Indian Academy of Sciences (India)

    Evaluation of eigenvalues of a smooth potential via Schroedinger transmission across multi-step potential. BASUDEB SAHU1,∗, BIDHUBHUSAN SAHU1 and SANTOSH K AGARWALLA2. 1Department of Physics, North Orissa University, Baripada 757 003, India. 2Department of Applied Physics and Ballistics, Fakir Mohan ...

  4. Ehrenfest theorem, Galilean invariance and nonlinear Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Kaelbermann, G [Soil and Water Department, Faculty of Agriculture, Rehovot 76100 (Israel)

    2004-02-25

    We prove that Galilean invariant Schroedinger equations derived from Lagrangian densities necessarily obey the Ehrenfest theorem for velocity-independent potentials. The conclusion holds as well for Lagrangians describing nonlinear self-interactions. An example of Doebner and Goldin motivates the result.

  5. Representations of the Schroedinger group and matrix orthogonal polynomials

    Energy Technology Data Exchange (ETDEWEB)

    Vinet, Luc [Centre de recherches mathematiques, Universite de Montreal, CP 6128, succ. Centre-ville, Montreal, QC H3C 3J7 (Canada); Zhedanov, Alexei, E-mail: luc.vinet@umontreal.ca, E-mail: zhedanov@fti.dn.ua [Donetsk Institute for Physics and Technology, Donetsk 83114 (Ukraine)

    2011-09-02

    The representations of the Schroedinger group in one space dimension are explicitly constructed in the basis of the harmonic oscillator states. These representations are seen to involve matrix orthogonal polynomials in a discrete variable that have Charlier and Meixner polynomials as building blocks. The underlying Lie-theoretic framework allows for a systematic derivation of the structural formulas (recurrence relations, difference equations, Rodrigues' formula, etc) that these matrix orthogonal polynomials satisfy. (paper)

  6. Solution of the Schroedinger equation in two and three dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Hajj, F.Y. (National Council for Scientific Research, Beirut (Lebanon))

    1985-01-14

    Eigenvalues and eigenfunctions of the Schroedinger equation are computed by a finite-difference method that is very simple and fast. In two dimensions, the ground state of helium and that of the hydride ion are computed in the S-limit approximation. In three dimensions, the computations include the ground state of the unapproximated helium atom and that of the lithium atom in the S-limit approximation.

  7. Francis Bacon and the Technology of Style.

    Science.gov (United States)

    Baker, Christopher

    1983-01-01

    Examines Francis Bacon's intentionally devised style for scientific writings and the theoretical basis of that style. Discusses his emphasis on a truly objective point of view, and his use of aphorisms to adapt to his audience. (HTH)

  8. Dr. Francis Collins Is New NIH Director

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Dr. Francis Collins Is New NIH Director Past Issues / ... for NIH and for science in this country." "Dr. Collins is one of our generation's great scientific ...

  9. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  10. Schroedinger invariant solutions of type IIB with enhanced supersymmetry

    Energy Technology Data Exchange (ETDEWEB)

    Donos, Aristomenis [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gauntlett, Jerome P. [Imperial College, London (United Kingdom). Theoretical Physics Group; Imperial College, London (United Kingdom). Inst. for Mathematical Sciences

    2009-07-15

    We construct the Killing spinors for a class of supersymmetric solutions of type IIB supergravity that are invariant under the non-relativistic Schroedinger algebra. The solutions depend on a five-dimensional Sasaki- Einstein space and it has been shown that they admit two Killing spinors. Here we will show that, for generic Sasaki-Einstein space, there are special subclasses of solutions which admit six Killing spinors and we determine the corresponding superisometry algebra. We also show that for the special case that the Sasaki-Einstein space is the round five-sphere, the number of Killing spinors can be increased to twelve. (orig.)

  11. Numerical stochastic perturbation theory in the Schroedinger functional

    Energy Technology Data Exchange (ETDEWEB)

    Brambilla, Michele; Di Renzo, Francesco; Hesse, Dirk [Parma Univ. (Italy); INFN, Parma (Italy); Dalla Brida, Mattia [Trinity College Dublin (Ireland). School of Mathematics; Sint, Stefan [Trinity College Dublin (Ireland). School of Mathematics; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2013-11-15

    The Schroedinger functional (SF) is a powerful and widely used tool for the treatment of a variety of problems in renormalization and related areas. Albeit offering many conceptual advantages, one major downside of the SF scheme is the fact that perturbative calculations quickly become cumbersome with the inclusion of higher orders in the gauge coupling and hence the use of an automated perturbation theory framework is desirable. We present the implementation of the SF in numerical stochastic perturbation theory (NSPT) and compare first results for the running coupling at two loops in pure SU(3) Yang-Mills theory with the literature.

  12. A new method for the solution of the Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Amore, Paolo [Facultad de Ciencias, Universidad de Colima, Bernal DIaz del Castillo 340, Colima, Colima (Mexico); Aranda, Alfredo [Facultad de Ciencias, Universidad de Colima, Bernal DIaz del Castillo 340, Colima, Colima (Mexico); De Pace, Arturo [Istituto Nazionale di Fisica Nucleare, Sezione di Torino, Via P Giuria 1, I-10125, Torino (Italy)

    2004-03-12

    We present a new method for the solution of the Schroedinger equation applicable to problems of a non-perturbative nature. The method works by identifying three different scales in the problem, which then are treated independently: an asymptotic scale, which depends uniquely on the form of the potential at large distances; an intermediate scale, still characterized by an exponential decay of the wavefunction; and, finally, a short distance scale, in which the wavefunction is sizable. The notion of optimized perturbation is then used in the last two regimes. We apply the method to the quantum anharmonic oscillator and find it suitable to treat both energy eigenvalues and wavefunctions, even for strong couplings.

  13. Asymptotics of weakly collapsing solutions of nonlinear Schroedinger equation

    CERN Document Server

    Ovchinnikov, Yu N

    2001-01-01

    One studied possible types of asymptotic behavior of weakly collapsing solution of the 3-rd nonlinear Schroedinger equation. It is shown that within left brace A, C sub 1 right brace parameter space there are two neighboring lines along which the amplitude of oscillation terms is exponentially small as to C sub 1 parameter. The same lines locates values of left brace A, C sub 1 right brace parameters at which the energy is equal to zero. With increase of C sub 1 parameter the accuracy of numerical determination of points with zero energy drops abruptly

  14. Rapidly decaying solutions of the nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Cazenave, T. (Paris-6 Univ., 75 (France). Lab. d' Analyse Numerique); Weissler, F.B. (ENS, 94 - Cachan (France). Centre de Mathematiques Paris-7 Univ., 94 - Creteil (France). UFR de Sciences)

    1992-06-01

    We consider global solutions of the nonlinear Schroedinger equation iu{sub t}+{Delta}u={lambda}vertical strokeuvertical stroke{sup {alpha}}u, in R{sup N}, (NLS) where {lambda}{epsilon}R and 0<{alpha}< 4/N-2. In particular, for {alpha}>{alpha}{sub 0}=(2-N+{radical}(N{sup 2}+12N+4))/2N, we show that for every ({phi}{epsilon}H{sup 1}(R{sup N}) such that x{phi}(x){epsilon}L{sup 2}(R{sup N}), the solution of (NLS) with initial value {phi}(x)e{sup i(bvertical} {sup strokexvertical} {sup stroke2/4)} is global and rapidly decaying as t{yields}{infinity} if b is large enough. Furthermore, by applying the pseudo-conformal transformation and studying the resulting nonautonomous nonlinear Schroedinger equation, we obtain both new results and simpler proofs of some known results concerning the scattering theory. In particular, we construct the wave operators for 4/N+2<{alpha}<4/N-2. Also, we establish a low energy scattering theory for the same range of {alpha} and show that, at least for {lambda}<0, the lower bound on {alpha} is optimal. Finally, if {lambda}>0, we prove asymptotic completeness for {alpha}{sub 0}{<=}{alpha}<4/N-2. (orig.).

  15. A numerical study of the Schroedinger-Newton equations

    CERN Document Server

    Harrison, R I

    2001-01-01

    and added perturbations oscillate at frequencies determined by the linear perturbation theory. The higher states are shown to be unstable, emitting scatter and leaving a rescaled ground state. The rate at which they decay is controlled by the complex eigenvalues of the linear perturbation. Next we consider adding another dimension in two different ways: by considering the axisymmetric case and the 2-D equations. The stationary solutions are found. We modify the evolution method and find that the higher states are unstable. In 2-D case we consider rigidly rotating solutions and show they exist and are unstable. The Schroedinger-Newton (S-N) equations were proposed by Penrose [18] as a model for gravitational collapse of the wave-function. The potential in the Schroedinger equation is the gravity due to the density of vertical bar psi vertical bar sup 2 , where psi is the wave-function. As with normal Quantum Mechanics the probability, momentum and angular momentum are conserved. We first consider the spherical...

  16. Poetic and Francis Bacon's Ambivalence toward Language.

    Science.gov (United States)

    Pribble, Paula Tompkins

    Just as rhetoric is a way of knowing, so is poetic, both of which, for Francis Bacon, produce false knowledge. But Bacon is not entirely negative. When the poetic elements of language are used in strategic and public communication, like the scholarly communication Bacon attempts to reform, poetic and rhetoric work together to create a plurality of…

  17. The Schroedinger representation and its relation to the holomorphic representation in linear and affine field theory

    Energy Technology Data Exchange (ETDEWEB)

    Oeckl, Robert [Centro de Ciencias Matematicas, Universidad Nacional Autonoma de Mexico, Campus Morelia, C.P. 58190, Morelia, Michoacan (Mexico)

    2012-07-15

    We establish a precise isomorphism between the Schroedinger representation and the holomorphic representation in linear and affine field theory. In the linear case, this isomorphism is induced by a one-to-one correspondence between complex structures and Schroedinger vacua. In the affine case we obtain similar results, with the role of the vacuum now taken by a whole family of coherent states. In order to establish these results we exhibit a rigorous construction of the Schroedinger representation and use a suitable generalization of the Segal-Bargmann transform. Our construction is based on geometric quantization and applies to any real polarization and its pairing with any Kaehler polarization.

  18. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  19. Soliton-like solutions to the ordinary Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Zamboni-Rached, Michel [Universidade Estadual de Campinas (DMO/FEEC/UNICAMP), Campinas, SP (Brazil). Fac. de Engenharia Eletrica e de Computacao. Dept. de Microondas e Optica; Recami, Erasmo, E-mail: recami@mi.infn.i [Universita Statale di Bergamo, Bergamo (Italy). Facolta di Ingegneria

    2011-07-01

    In recent times it has been paid attention to the fact that (linear) wave equations admit of soliton-like solutions, known as Localized Waves or Non-diffracting Waves, which propagate without distortion in one direction. Such Localized Solutions (existing also for K-G or Dirac equations) are a priori suitable, more than Gaussian's, for describing elementary particle motion. In this paper we show that, mutatis mutandis, Localized Solutions exist even for the ordinary Schroedinger equation within standard Quantum Mechanics; and we obtain both approximate and exact solutions, also setting forth for them particular examples. In the ideal case such solutions bear infinite energy, as well as plane or spherical waves: we show therefore how to obtain nite-energy solutions. At last, we briefly consider solutions for a particle moving in the presence of a potential. (author)

  20. From qubits and actions to the Pauli-Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Mizrahi, Salomon S [Departamento de Fisica, Universidade Federal de Sao Carlos, Caixa Postal 676, Sao Carlos, 13565-905 Sao Paulo (Brazil)], E-mail: salomon@df.ufscar.br

    2009-07-15

    Here I show that a classical or quantum bit state plus one simple operation, an action, are sufficient ingredients to derive a quantum dynamical equation that rules the sequential changes of the state. Then, by assuming that a freely moving massive particle is the qubit carrier, it is found that both, the particle position in physical space and the qubit state, change in time according to the Pauli-Schroedinger equation. So, this approach suggests the following conjecture: because it carries one qubit of information the particle motion has its description enslaved by the very existence of the internal degree of freedom. It is compelled to be described no more classically but by a wavefunction. I also briefly discuss the Dirac equation in terms of qubits.

  1. The Schroedinger functional for Gross-Neveu models

    Energy Technology Data Exchange (ETDEWEB)

    Leder, B.

    2007-04-18

    Gross-Neveu type models with a finite number of fermion flavours are studied on a two-dimensional Euclidean space-time lattice. The models are asymptotically free and are invariant under a chiral symmetry. These similarities to QCD make them perfect benchmark systems for fermion actions used in large scale lattice QCD computations. The Schroedinger functional for the Gross-Neveu models is defined for both, Wilson and Ginsparg-Wilson fermions, and shown to be renormalisable in 1-loop lattice perturbation theory. In two dimensions four fermion interactions of the Gross-Neveu models have dimensionless coupling constants. The symmetry properties of the four fermion interaction terms and the relations among them are discussed. For Wilson fermions chiral symmetry is explicitly broken and additional terms must be included in the action. Chiral symmetry is restored up to cut-off effects by tuning the bare mass and one of the couplings. The critical mass and the symmetry restoring coupling are computed to second order in lattice perturbation theory. This result is used in the 1-loop computation of the renormalised couplings and the associated beta-functions. The renormalised couplings are defined in terms of suitable boundary-to-boundary correlation functions. In the computation the known first order coefficients of the beta-functions are reproduced. One of the couplings is found to have a vanishing betafunction. The calculation is repeated for the recently proposed Schroedinger functional with exact chiral symmetry, i.e. Ginsparg-Wilson fermions. The renormalisation pattern is found to be the same as in the Wilson case. Using the regularisation dependent finite part of the renormalised couplings, the ratio of the Lambda-parameters is computed. (orig.)

  2. Accurate calculation of the complex eigenvalues of the Schroedinger equation with an exponential potential

    Energy Technology Data Exchange (ETDEWEB)

    Amore, Paolo [Facultad de Ciencias, Universidad de Colima, Bernal Diaz del Castillo 340, Colima, Colima (Mexico)], E-mail: paolo.amore@gmail.com; Fernandez, Francisco M. [INIFTA (Conicet, UNLP), Division Quimica Teorica, Diag. 113 y 64 (S/N), Sucursal 4, Casilla de Correo 16, 1900 La Plata (Argentina)], E-mail: fernande@quimica.unlp.edu.ar

    2008-04-28

    We show that the Riccati-Pade method is suitable for the calculation of the complex eigenvalues of the Schroedinger equation with a repulsive exponential potential. The accuracy of the results is remarkable for realistic potential parameters.

  3. Breathers and solitons of generalized nonlinear Schroedinger equations as degenerations of algebro-geometric solutions

    Energy Technology Data Exchange (ETDEWEB)

    Kalla, C, E-mail: Caroline.Kalla@u-bourgogne.fr [Institut de Mathematiques de Bourgogne, Universite de Bourgogne, 9 avenue Alain Savary, 21078 Dijon (France)

    2011-08-19

    We present new solutions in terms of elementary functions of the multi-component nonlinear Schroedinger equations and known solutions of the Davey-Stewartson equations such as multi-soliton, breather, dromion and lump solutions. These solutions are given in a simple determinantal form and are obtained as limiting cases in suitable degenerations of previously derived algebro-geometric solutions. In particular, we present for the first time breather and rational breather solutions of the multi-component nonlinear Schroedinger equations.

  4. Francis Marion National Forest forest plan revision - ecosystems & restoration needs

    Science.gov (United States)

    Mark Danaher

    2016-01-01

    The Forest Service is currently revising the previous 1995 Forest Plan for the Francis Marion National Forest in Coastal South Carolina developed in the wake of Hurricane Hugo which devastated the forest in 1989. Since 1995, the human communities surrounding the Francis Marion National Forest have grown and changed significantly. The revised Francis Marion Forest Plan...

  5. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Unknown

    [Chandrasekhar K and Malathi R 2003 Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures; ... recognition sites for proteins, metal ions and small mole- cules (Jeffrey et al 1999; ..... From the sequence analysis (table 1, figure 1) we find an extreme ...

  6. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  7. Failure analysis of a Francis turbine runner

    Energy Technology Data Exchange (ETDEWEB)

    Frunzaverde, D; Campian, V [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta Traian Vuia 1-4, RO-320085, Resita (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Marginean, G [University of Applied Sciences Gelsenkirchen, Neidenburger Str. 10, 45877 Gelsenkirchen (Germany); Marsavina, L [Department of Strength, ' Politehnica' University of Timisoara, Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Terzi, R; Serban, V, E-mail: gabriela.marginean@fh-gelsenkirchen.d, E-mail: d.frunzaverde@uem.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A., Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)

    2010-08-15

    The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.

  8. Tolerance Stack Analysis in Francis Turbine Design

    Directory of Open Access Journals (Sweden)

    Indra Djodikusumo

    2010-05-01

    Full Text Available The tolerance stacking problem arises in the context of assemblies from interchangeable parts because of the inability to produce or to join parts exactly according to nominal dimensions. Either the relevant part’s dimension varies around some nominal values from part to part or the act of assembly that leads to variation. For example, as runner of Francis turbine is joined with turbine shaft via mechanical lock, there is not only variation in the diameter of runner and the concentricity between the runner hole and turbine shaft, but also the variation in concentricity between the outer parts of runner to runner hole. Thus, there is the possibility that the assembly of such interacting parts won’t function or won’t come together as planned. Research in this area has been conducted and 2 mini hydro Francis turbines (800 kW and 910 kW have been designed and manufactured for San Sarino and Sawi Dago 2 in Central Sulawesi. Experiences in analyzing the tolerance stacks have been documented. In this paper it will be demonstrated how the requirements of assembling performance are derived to be the designed tolerances of each interacting component, such a way that the assembling would be functioning and come together as planned.

  9. Development of a 5kw Francis Turbine Runner Using Computation ...

    African Journals Online (AJOL)

    A small scale Francis turbine runner for a turbine located at Awba dam in the University of Ibadan with designed head and flow rate of 6m and 0.244m3/s is designed. The basic design of the Francis turbine runner is completed based on basic fluid dynamics turbo machinery principles. A 2-D and 3-D steady state, ...

  10. On the chirally rotated Schroedinger functional with Wilson fermions

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Lopez, Jenifer

    2011-05-25

    There are many phenomena in nature, which are closely linked to the low energy regime of QCD. From a theoretical point of view, these low energy phenomena can be dealt with only by means of non-perturbative methods. It is the central goal of this thesis to provide a framework for such a nonperturbative renormalization. For that purpose, we employ a 4-dimensional lattice as a regulator of QCD. As a renormalization scheme, we propose a finite volume Schroedinger functional scheme and here in particular, the chirally rotated Schroedinger functional ({chi}SF). We first perform analytical studies of the {chi}SF at tree-level of perturbation theory, in the continuum and on the lattice. We study the eigenvalue spectrum of the continuum Dirac operator, equipped with chirally rotated SF boundary conditions, and derive the corresponding quark propagator. We then determine the tree-level quark propagator on the lattice, employing massless Wilson fermions as a regulator of the theory. Beyond tree-level, all studies are performed in the quenched approximation of QCD, as a first, computationally much simpler step to understand the properties of the newly proposed {chi}SF scheme. One of the main targets of the present work, has been to perform the non-perturbative tuning of the two required coefficients of the {chi}SF scheme, such that a well defined continuum limit can be reached. We demonstrate, as the first main result of this thesis, that the tuning is feasible and that, moreover, physical quantities are insensitive to the particular tuning condition. As in any lattice regularization with SF-like boundary conditions, there are also in the {chi}SF a couple of counterterms at the boundaries, whose coefficients need to be tuned in order to remove the O(a) discretization effects originated at the boundaries. However, besides these boundary O(a) effects, the {chi}SF is expected to be compatible with bulk automatic O(a)-improvement. We show here that, indeed, the scaling behavior

  11. Study of nonlinear waves described by the cubic Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Walstead, A.E.

    1980-03-12

    The cubic Schroedinger equation (CSE) is ubiquitous as a model equation for the long-time evolution of finite-amplitude near-monochromatic dispersive waves. It incorporates the effects of the radiation field pressure on the constitutive properties of the supporting medium in a self-consistent manner. The properties of the uniformly transiating periodic wave solutions of the one-dimensional CSE are studied here. These (so-called cnoidal) waves are characterized by the values of four parameters. Whitham's averaged variational principle is used to derive a system of quasilinear evolution equations (the modulational equations) for the values of these parameters when they are slowly varying in space and time. Explicit expressions for the characteristic velocities of the modulational equations are obtained for the full set of cnoidal waves. Riemann invariants are obtained for several limits for the stable case, and growth rates are obtained for several limits, including the solitary wave chain, for the unstable case. The results for several nontrivial limiting cases agree with those obtained by independent methods by others. The dynamics of the CSE generalized to two spatial dimensions are studied for the unstable case. A large class of similarity solutions with cylindrical symmetry are obtained systematically using infinitesimal transformation group techniques. The methods are adapted to obtain the symmetries of the action functional of the CSE and to deduce nine integral invariants. A numerical study of the self-similar solutions reveals that they are modulationally unstable and that singularities dominate the dynamics of the CSE in two dimensions. The CSE is derived using perturbation theory for a specific problem in plasma physics: the evolution of the envelope of a near-monochromatic electromagnetic wave in a cold magnetized plasma. 13 figures, 2 tables.

  12. Autism, Asperger's syndrome and the Crick-Mitchison theory of the biological function of REM sleep.

    Science.gov (United States)

    Brown, D W

    1996-11-01

    Autism, Asperger's syndrome and other autistic syndromes are developmental brain disorders that cause serious impairments in communication, social interaction, empathy, mood and play. In addition to such deficits, the autistic syndromes involve pathologically high levels of repetitive, stereotypic, ritualistic, compulsive or obsessive behavior, together with extreme resistance to change. According to the Crick-Mitchison theory of the biological function of rapid eye movement sleep, normal brain development in the fetus and infant depends on undisrupted function of a 'reverse learning' mechanism during rapid eye movement sleep. Could abnormalities in this hypothetical reverse learning during rapid eye movement sleep in the fetus explain some aspects of the autistic syndromes? Does the Crick-Mitchison theory suggest if a drug could interfere with rapid eye movement sleep and cross the placental barrier, then that drug might cause developmental brain disorders in the fetus? Should all pregnant women completely avoid caffeine or any agent that might disrupt serotonergic or cholinergic systems?

  13. Solitons on nanotubes and fullerenes as solutions of a modified non-linear Schroedinger equation

    OpenAIRE

    Brihaye, Yves; Hartmann, Betti

    2004-01-01

    Fullerenes and nanotubes consist of a large number of carbon atoms sitting on the sites of a regular lattice. For pratical reasons it is often useful to approximate the equations on this lattice in terms of the continuous equation. At the moment, the best candidate for such an equation is the modified non-linear Schroedinger equation. In this paper, we study the modified non-linear Schroedinger equation, which arises as continuous equation in a system describing an excitation on a hexagonal l...

  14. Analytical solutions to a class of nonlinear Schroedinger equations with PT-like potentials

    Energy Technology Data Exchange (ETDEWEB)

    Musslimani, Ziad H [Department of Mathematics, Florida State University, Tallahassee, 32306-4510 FL (United States); Makris, Konstantinos G; El-Ganainy, Ramy; Christodoulides, Demetrios N [College of Optics and Photonics-CREOL, University of Central Florida, Orlando, 32816 FL (United States)

    2008-06-20

    We present closed form solutions to a certain class of one- and two-dimensional nonlinear Schroedinger equations involving potentials with broken and unbroken PT symmetry. In the one-dimensional case, these solutions are given in terms of Jacobi elliptic functions, hyperbolic and trigonometric functions. Some of these solutions are possible even when the corresponding PT-symmetric potentials have a zero threshold. In two-dimensions, hyperbolic secant type solutions are obtained for a nonlinear Schroedinger equation with a non-separable complex potential.

  15. Blow-up in nonlinear Schroedinger equations. I. A general review

    DEFF Research Database (Denmark)

    Juul Rasmussen, Jens; Rypdal, K.

    1986-01-01

    The general properties of a class of nonlinear Schroedinger equations: iut + p:∇∇u + f(|u|2)u = 0 are reviewed. Conditions for existence, uniqueness, and stability of solitary wave solutions are presented, along with conditions for blow-up and global existence for the Cauchy problem.......The general properties of a class of nonlinear Schroedinger equations: iut + p:∇∇u + f(|u|2)u = 0 are reviewed. Conditions for existence, uniqueness, and stability of solitary wave solutions are presented, along with conditions for blow-up and global existence for the Cauchy problem....

  16. Francis Balkwill and the physiology of mastication.

    Science.gov (United States)

    Fereday, R C

    1994-05-21

    The contribution of Francis Balkwill to the understanding of the masticatory system is virtually unknown in this country. In 1866 he presented the results of considerable research on this subject to the Odontological Society of Great Britain, but his observations were ignored and the paper remained 'buried' in the Transactions for nearly 50 years. In 1912 a copy of the paper was to sent to Professor Gysi in Zurich who immediately published a most generous tribute to the value of his work. The observations made in this 1866 paper are reviewed here together with the 'rediscoveries' made by later workers. It is suggested that Balkwill's neglected work was in fact the most far-seeing and comprehensive piece of research on this subject carried out during the 19th Century.

  17. Francis Galton: his approach to polygenic disease.

    Science.gov (United States)

    Galton, D J; Galton, C J

    1997-01-01

    Gregor Mendel is considered to be the founding father of modern genetics, and his laws of inheritance have led to the successful analysis of rare monogenic diseases such as cystic fibrosis, Duchenne muscular dystrophy, familial hypercholesterolaemia, and many others. Francis Galton chose multifactorial inheritance as his starting point, and his methods of analysis have withstood the test of time. He used detailed family records to study the inherited tendency of complex traits between parents and offspring, and between identical and non-identical twins to refine the analysis, and devised new statistics to attempt to measure the extent of inheritance. For all these reasons, he can be considered the founding father of quantitative genetics.

  18. Investigation of seal technology for Francis turbine

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Wei

    2012-06-01

    Leakage loss and disk friction loss caused by the clearance gap flow at the back of a runner have a major impact on the efficiency of hydraulic turbines. Accordingly, it is extremely important to develop and improve the seal technology by investigating the gap flow. Generally, there are two types of the gap flow: axial gap flow between a rotating disk and a stator (e.g. the flow at the back of a runner) and the annular gap flow (e.g. the flow at an annular seal). Firstly, the overview of previous researches on labyrinth seal, rotating disk flow and Taylor-Couette flow are summarized. Labyrinth seals are the primary type of seals for turbo machinery. However, most researchers studied it for compressible flow only. It is also found that the enclosed rotating disk flow with through-flow can be studied instead of the gap flow in a hydraulic machine. Furthermore, the above mentioned annular gap flow is similar to the Taylor-Couette flow. The Taylor-vortices are formed in the annular gap due to the rotation of disk, which could be used as a resistance of flow. Therefore, in the present work, three parts are investigated. The first part is the investigation of the labyrinth seal for Francis turbines. The second part is the investigation of the gap flow between two stationary walls. The third part is investigation of the annular gap flow between one stationary and one rotating wall, based on the theory of Taylor-Couette flow. Afterwards, the theoretical formulas for leakage flow of a traditional labyrinth seal used in high head Francis turbine is derived and is verified to give acceptable results. The theoretical model is useful to predict the leakage flow by the measurements of Francis turbine at the Aabjoera Power plant. For straight-through labyrinth seal, the effects of cavity dimensions, numbers and locations on the leakage flow are investigated numerically. Smaller cavity depth, longer cavity length and fewer cavity numbers are required in order to reduce leakage

  19. The first Australian painting of schizophrenia by Ivor Francis.

    Science.gov (United States)

    Kaplan, Robert M

    2014-06-01

    This article examines the 1943 surrealistic painting Schizophrenia by Ivor Francis, the first major Australian art work depicting a mental disorder. Francis was influenced by Max Harris who encouraged him to read works on surrealism and psychoanalysis, but took his ideas from the book on schizophrenia by the radical Melbourne psychiatrist, Reg Ellery. Ivor Francis produced a riveting painting that stands as an enduring visual beacon in the cultural history of Antipodean psychiatry. © The Royal Australian and New Zealand College of Psychiatrists 2014.

  20. Assessing Attitude towards Religion: The Astley-Francis Scale of Attitude towards Theistic Faith

    Science.gov (United States)

    Astley, Jeff; Francis, Leslie J.; Robbins, Mandy

    2012-01-01

    This study builds on the research tradition modelled by the Francis Scale of Attitude towards Christianity, the Katz-Francis Scale of Attitude towards Judaism, the Sahin-Francis Scale of Attitude towards Islam and the Santosh-Francis Scale of Attitude towards Hinduism to propose a generic instrument concerned with attitudes towards theistic faith.…

  1. Asymptotic stability of multi-soliton solutions for nonlinear Schroedinger eqations

    OpenAIRE

    Perelman, G.

    2003-01-01

    We consider the Cauchy problem for the nonlinear Schroedinger eqiation with initial data close to a sum of N decoupled solitons. Under some suitable assumptions on the spectral structure of the one soliton linearizations we prove that for large time the asymptotics of the solution is given by a sum of solitons with slightly modified parameters and a small dispersive term.

  2. Solutions of type IIB and D=11 supergravity with Schroedinger(z) symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Donos, Aristomenis [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gauntlett, Jerome P. [Imperial College, London (United Kingdom). Theoretical Physics Group; Imperial College, London (United Kingdom). Inst. for Mathematical Sciences

    2009-05-15

    We construct families of supersymmetric solutions of type IIB and D=11 supergravity that are invariant under the non-relativistic Schroedinger(z) algebra for various values of the dynamical exponent z. The new solutions are based on five- and seven-dimensional Sasaki-Einstein manifolds, respectively, and include supersymmetric solutions with z=2. (orig.)

  3. A study on the d-dimensional Schroedinger equation with a power-law nonlinearity

    Energy Technology Data Exchange (ETDEWEB)

    Shidfar, A. [Department of Mathematics, Iran University of Science and Technology, Tehran (Iran, Islamic Republic of)], E-mail: shidfar@iust.ac.ir; Molabahrami, A. [Department of Mathematics, Iran University of Science and Technology, Tehran (Iran, Islamic Republic of); Department of Mathematics, Ilam University, PO Box 69315516, Ilam (Iran, Islamic Republic of)], E-mail: a_m_bahrami@iust.ac.ir; Babaei, A.; Yazdanian, A. [Department of Mathematics, Iran University of Science and Technology, Tehran (Iran, Islamic Republic of)

    2009-11-30

    In this paper, the homotopy perturbation method (HPM) is applied to obtain series pattern solutions of the Cauchy problem for the d-dimensional Schroedinger equation with a power-law nonlinearity. We introduce the recurrent relation to solve the mentioned Cauchy problem. For some cases of given initial condition, we obtain the closed form of the exact solutions.

  4. Magnetic virial identities and applications to blow-up for Schroedinger and wave equations

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Andoni, E-mail: andoni.garcia@ehu.es [Departamento de Matematicas, Universidad del Pais Vasco, Apartado 644, 48080 Bilbao (Spain)

    2012-01-13

    We prove blow-up results for the solution of the initial-value problem with negative energy of the focusing mass-critical and supercritical nonlinear Schroedinger and the focusing energy-subcritical nonlinear wave equations with electromagnetic potential. (paper)

  5. The solution of the Schroedinger equation for complex Hamiltonian systems in two dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Chand, Fakir [Department of Physics, Kurukshetra University, Kurukshetra-136 119, Haryana (India); Singh, Ram Mehar [Department of Physics, Haryana College of Technology and Management, Kaithal-136 027, Haryana (India); Kumar, Narender [Department of Physics, Kurukshetra University, Kurukshetra-136 119, Haryana (India); Mishra, S C [Department of Physics, Kurukshetra University, Kurukshetra-136 119, Haryana (India)

    2007-08-17

    We investigate the ground state solutions of the Schroedinger equation for complex (non-Hermitian) Hamiltonian systems in two dimensions within the framework of an extended complex phase-space approach. The eigenvalues and eigenfunctions of some two-dimensional complex potentials are found.

  6. Obituary: Lyman Francis Kells, 1917-2004

    Science.gov (United States)

    Hockey, Thomas

    2007-12-01

    Lyman Francis Kells was born in Seattle, Washington, on 19 May 1917. He earned a 1938 BS in Chemistry from the University of Washington. He received a PhD. in 1944, also from the University of Washington. Kells held research positions at the Carbide and Carbon Chemicals Corporation of New York, New York, from 1944 through 1946; the Standard Oil Development Company of New Jersey, from 1946 through 1948; and Allied Chemical Corporation of Morristown, New Jersey, from 1951 through 1961. His wartime work involved the separation of Uranium isotopes by gaseous diffusion, based on a method developed in part by Harold Urey. Kells was on the faculty of Hunter College 1948-1949, an Assistant Professor at Iona College 1949-1951, a Special Lecturer at Newark College of Engineering in 1961, an Assistant Professor of Chemistry at East Tennessee State University 1962-1964, and a Professor of Chemistry at Westmar College 1964-1974. He died on 4 November 2004 in Seattle, Washington. Kells was a member of the American Association for the Advancement of Science, the American Chemical Society, the Astronomical Society of the Pacific, and the New York Academy of Science, as well as this Society. He was a Unitarian. Kells is survived by his daughters Leila Stefani Newcomb and Christina V. Cohen.

  7. HydroHillChart – Francis module. Software used to Calculate the Hill Chart of the Francis Hydraulic Turbines

    Directory of Open Access Journals (Sweden)

    Dorian Nedelcu

    2015-07-01

    Full Text Available The paper presents the Hydro Hill Chart - Francis module application, used to calculate the hill chart of the Pelton, Francis and Kaplan hydraulic turbine models, by processing the data measured on the stand. After describing the interface and menu, the input data is graphically presented and the universal characteristic for measuring scenarios ao=const. and n11=const is calculated. Finally, the two calculated hill charts are compared through a graphical superimposition of the isolines.

  8. Obtention of Schroedinger-Cat-Like-States through canonical transformations in the quantum phase space; Obtencion de estados tipo gato de Schroedinger mediante transformaciones canonicas en el espacio fase cuantico

    Energy Technology Data Exchange (ETDEWEB)

    Zuniga S, A. [Instituto Politecnico Nacional, Departamento de Fisica, Escuela Superior de Fisica y Matematicas, Edificio 9, Unidad Profesional Adolfo Lopez Mateos, 07738 Mexico D.F. (Mexico)

    2003-07-01

    Employing canonical transformations defined in the coherent-state representation of quantum mechanics, we introduce Schroedinger-Cat- Like-States. The squeezed displaced number states with real squeezing parameter are contained in these states. (Author)

  9. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  10. Strong enhancement of vibrational relaxation by Watson-Crick base pairing.

    Science.gov (United States)

    Woutersen, Sander; Cristalli, Gloria

    2004-09-15

    We have studied the ultrafast dynamics of NH-stretch vibrational excitations in Watson-Crick base pairs consisting of adenine and uracil derivatives. To estimate the influence of the A:U hydrogen bonding on the vibrational dynamics, we have also studied the uracil derivative in monomeric form. The vibrational relaxation of the NH-stretching mode is found to occur much faster in the Watson-Crick base pair than in monomeric uracil. From the delay dependence of the transient vibrational spectra, it can be concluded that both in base-paired and monomeric uracil, the energy relaxation takes place in two steps, the first step being a rapid transfer of energy from the NH-stretching mode to an accepting mode, the second step the relaxation of this accepting mode. The transient spectra show evidence that in the base pair the hydrogen bond between the nucleobases acts as the accepting mode, and that the hydrogen bonding between the bases is responsible for the extremely fast vibrational relaxation in this system.

  11. Do pictórico em Francis Ponge = Francis Ponge on the pictorial

    Directory of Open Access Journals (Sweden)

    Barbosa, Roseli de Fátima D. A.

    2011-01-01

    Full Text Available Este trabalho apresenta um estudo sobre a relação entre literatura e artes plásticas em dois textos de Francis Ponge. Esse poeta relacionou-se e escreveu sobre artistas plásticos durante sua vida. A intenção é estudar como se dá essa relação e como podemos identificá-la através de marcas pictóricas que revelam a maneira como trata e escreve sobre o mundo da pintura com seus respectivos pintores. Esse autor tem a poesia como meio de falar de objetos do cotidiano, artes plásticas e pintores, animais e paisagens

  12. On the effect of random inhomogeneities in Kerr media modelled by a nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Villarroel, Javier [Facultad de Ciencias, Universidad de Salamanca, Plaza Merced s/n, E-37008 Salamanca (Spain); Montero, Miquel, E-mail: javier@usal.e, E-mail: miquel.montero@ub.ed [Departament de FIsica Fonamental, Universitat de Barcelona, Diagonal 647, E-08028 Barcelona (Spain)

    2010-07-14

    We consider the propagation of optical beams under the interplay of dispersion and Kerr nonlinearity in optical fibres with impurities distributed at random uniformly on the fibre. By using a model based on the nonlinear Schroedinger equation we clarify how such inhomogeneities affect different aspects such as the number of solitons present and the intensity of the signal. We also obtain the mean distance for the signal to dissipate to a given level.

  13. Baecklund transformations and exact soliton solutions for nonlinear Schroedinger-type equations

    Energy Technology Data Exchange (ETDEWEB)

    Khater, A. H. [Cairo Univ. (Egypt). Faculty of science, Dept. of Mathematics]|[Antwerp Univ. (Belgium). Dept. of Physics; Callebaut, D. K. [Antwerp Univ. (Belgium). Dept. of Physics; El-Kalaawy, O. H. [Cairo Univ. (Egypt). Faculty of science, Dept. of Mathematics

    1998-09-01

    Using the Baecklund transformations (BTs) and the Darboux-Bargmann technique, the Authors consider the nonlinear Schroedinger-type (NLS-type) equations solvable by the inverse scattering method of Zakharov-Shabat/Ablowitz-Kaup-Newell-Segur (ZS/AKNS) system and the ZS/AKNS wave functions corresponding to the soliton solutions of NLS-type equations. Thus, families of new soliton solutions for NLS- type equations are obtained.

  14. General soliton solutions of an n-dimensional nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Khater, A. H.; Seadawy, A. R. [Cairo Univ., Cairo (Egypt). Faculty of Science, Mathematics Dept.; Helal, M. A. [Cairo Univ., Cairo (Egypt). Faculty of Science, Mathematics Dept.

    2000-11-01

    Applying the function transformation method, an n-dimensional nonlinear Schroedinger (NDNLS) equation is transformed into a sinh-Gordon equation and other equations, which depend only on one function {zeta} leads to a general soliton solution of the NDNLS equation. It contains some interesting specific solutions such as the N multiple solitons, the propagational breathers and the quadric solitons. Their properties are simply discussed.

  15. Instability of stationary states in nonlinear Schroedinger or Klein-Gordon equations

    Energy Technology Data Exchange (ETDEWEB)

    Berestycki, H.; Cazenave, T. (Universite Pierre et Marie Curie, Paris (France))

    1981-11-09

    In this note, we prove the instability of stationary states for the Schroedinger equation and for the Klein-Gordon equation. Here, u(x) is a ground state solution of the nonlinear scalar field equation -..delta..u+..omega..u=g(u) in Rsup(N). Indeed, under certain assumptions on g, we show that there exist initial conditions, arbitrarily close to the stationary states, such that the solutions of these equations blow up in finite time.

  16. Analytic doubly periodic wave patterns for the integrable discrete nonlinear Schroedinger (Ablowitz-Ladik) model

    Energy Technology Data Exchange (ETDEWEB)

    Chow, K.W. [Department of Mechanical Engineering, University of Hong Kong, Pokfulam, Hong Kong (China)]. E-mail: kwchow@hkusua.hku.hk; Conte, Robert [Service de Physique de l' etat Condense (URA 2464), CEA-Saclay, F-91191 Gif-sur-Yvette Cedex (France)]. E-mail: conte@drecam.saclay.cea.fr; Xu, Neil [Department of Mathematics, California Institute of Technology, Pasadena, CA 91125 (United States)]. E-mail: naijie@caltech.edu

    2006-01-23

    We derive two new solutions in terms of elliptic functions, one for the dark and one for the bright soliton regime, for the semi-discrete cubic nonlinear Schroedinger equation of Ablowitz and Ladik. When considered in the complex plane, these two solutions are identical. In the continuum limit, they reduce to known elliptic function solutions. In the long wave limit, the dark one reduces to the collision of two discrete dark solitons, and the bright one to a discrete breather.

  17. NLO anomalous dimension of multiplicatively renormalizable four-fermion operators in Schroedinger Functional schemes

    Energy Technology Data Exchange (ETDEWEB)

    Palombi, Filippo [' E. Fermi' Research Center, c/o Compendio Viminale - pal. F, I-00184 Rome (Italy); Pena, Carlos [DESY, Theory Group, Notkestrasse 85, D-22603 Hamburg (Germany); Sint, Stefan [Departamento de Fisica Teorica C-XI and Instituto de Fisica Teorica C-XVI, Universidad Autonoma de Madrid, Cantoblanco, E-28049 Madrid (Spain)

    2005-03-15

    Renormalization constants for multiplicatively renormalizable parity-odd four-fermion operators are computed in various different Schroedinger Functional (SF) schemes and lattice regularizations with Wilson quarks at one-loop order in perturbation theory. Our results are used in the calculation of their NLO anomalous dimensions, through matching to continuum schemes. They also enable a comparison of the two-loop perturbative RG running to the previously obtained nonperturbative one in the region of small renormalized coupling.

  18. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  19. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  20. Impact of startup scheme on Francis runner life expectancy

    Energy Technology Data Exchange (ETDEWEB)

    Gagnon, M; Tahan, S A; Bocher, P [Department of Mechanical Engineering, Ecole de technologie superieure (ETS) 1100, rue Notre-Dame Ouest, Montreal (Canada); Thibault, D, E-mail: martin.gagnon.8@ens.etsmtl.c [Institut de recherche d' Hydro-Quebec (IREQ), 1800, boul. Lionel-Boulet, Varennes, J3X 1S1 (Canada)

    2010-08-15

    Francis runners are subject to complex dynamic forces which might lead to eventual blade cracking and the need for corrective measure. Damage due to cracks in runner blades are usually not a safety issues but might generate unexpected down time and high repair cost. Avoiding the main damaging operating conditions is often the only option left to plant operators to maximize the life expectancy of their runner. The startup scheme is one of the available parameter which is controlled by the end user and could be used to minimize the damage induced to the runner. In this study, two startup schemes have been used to investigate life expectancy of Francis runner using in situ measurements. The results obtained show that the induced damage during the startup event could be significantly reduced with change to the startup scheme. In our opinion, an optimization of the startup scheme with regard to fatigue damage could extend significantly the life expectancy and the reliability of Francis runner.

  1. 78 FR 8683 - Environmental Impact Statement: Theodore Francis Green Airport, Warwick, RI

    Science.gov (United States)

    2013-02-06

    ... Environmental Impact Statement (EIS) Re-evaluation has been prepared for Theodore Francis Green Airport, Warwick, Rhode Island. FOR FURTHER INFORMATION CONTACT: Richard Doucette, Environmental Program Manager, Federal... Federal Aviation Administration Environmental Impact Statement: Theodore Francis Green Airport, Warwick...

  2. Hvad danske politikere kan lære af Francis Fukuyama

    DEFF Research Database (Denmark)

    Böss, Michael

    2009-01-01

    Introduktion til Francis Fukuyamas teorier om social kapital og social tillid Udgivelsesdato: Forår 2009......Introduktion til Francis Fukuyamas teorier om social kapital og social tillid Udgivelsesdato: Forår 2009...

  3. Approaching the political in citizenship education: the perspectives of Paulo Freire and Bernard Crick

    Directory of Open Access Journals (Sweden)

    Tristan McCowan

    2006-06-01

    Full Text Available Abstract: The forms that political education should take, and indeed its very presence in schools, are strongly contested questions. This paper explores these ideas in the light of the work of two theorists, Bernard Crick and Paulo Freire. There is first an analysis of their conceptions of politics and the political, their justifications for political education and their proposals for the curriculum. While the two theorists share the aim of political empowerment for all, there are significant differences in their understandings of society and of the potential of education for social transformation. The juxtaposition is seen to raise some important issues for citizenship education provision in England and Wales, concerning, in particular, its existence as a separate subject, its role in promoting conformity, the dangers of indoctrination and the means of promoting political agency.

  4. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  5. Morpholino oligonucleotides do not participate perfectly in standard Watson-Crick complexes with RNA.

    Science.gov (United States)

    Xiao, Gaoping; Wesolowski, Donna; Izadjoo, Mina; Altman, Sidney

    2010-11-01

    RNase P from E. coli will cleave a RNA at a site designated in a complex with an external guide sequence (EGS). The location of the site is determined by the Watson-Crick complementary sequence that can be formed between the RNA and the EGS. Morpholino oligonucleotides (PMOs) that have the same base sequences as any particular EGS will not direct cleavage by RNase P of the target RNA at the expected site in three mRNAs. Instead, cleavage occurs at a secondary site that does not correspond exactly to the expected Watson-Crick sequence in the PMO. This cleavage in the mRNA for a drug resistance gene, CAT mRNA, is at least second order in the concentration of the PMOs, but the mechanism is not understood yet and might be more complicated than a simple second-order reaction. EGSs and PMOs inhibit the reactions of each other effectively in a competitive fashion. A basic peptide attached to the PMO (PPMO) is more effective because of its binding properties to the mRNA as a substrate. However, a PMO is just as efficient as a PPMO on a mRNA that is mutated so that the canonical W-C site has been altered. The altered mRNA is not recognizable by effective extensive W-C pairing to an EGS or PMO. The complex of a PMO on a mutated mRNA as a substrate shows that the dimensions of the modified oligonucleotide cannot be the same as a naked piece of single-stranded RNA.

  6. Francis Fukuyama and the End of History | Herwitz | South African ...

    African Journals Online (AJOL)

    Francis Fukuyama has argued that history has come to an end. His argument is a philosophical reading of history which derives philosophical implications from empirical views about human economy, society, recent history and the human conditions for self-realization and flourishing. It is this movement between empirical ...

  7. Francis Bacon and the Historiography of Scientific Rhetoric.

    Science.gov (United States)

    Zappen, James P.

    1989-01-01

    Reviews three twentieth-century interpretations of Francis Bacon's science and rhetoric: positivistic science and the plain style; institutionalized science and its more highly figured style; and democratic science. Presents the author's own interpretation, and concludes that each interpretation reflects different perceptions of the good of the…

  8. Scientific Cousins: The Relationship between Charles Darwin and Francis Galton

    Science.gov (United States)

    Fancher, Raymond E.

    2009-01-01

    This article traces the personal as well as the intellectual and scientific relationship between Charles Darwin and his younger half-cousin Francis Galton. Although they had been on friendly terms as young men, and Darwin had in some ways been a role model for Galton, the two did not share major scientific interests until after the publication of…

  9. Intestinal volvulus at St Francis Hospital, Kampala | Kakande | East ...

    African Journals Online (AJOL)

    A review of sixty patients with intestinal volvulus was undertaken at St Francis Hospital, Nsambya, Kampala. Forty three (71.7%) of the patients presented with sigmoid volvulus while 12 (20°0) had ileosigmoid knotting. There were 53 males and seven females. The ages of sigmoid volvulus patients ranged between 20- 87 ...

  10. Experimental and Numerical Studies of a High-Head Francis Turbine: A Review of the Francis-99 Test Case

    Directory of Open Access Journals (Sweden)

    Chirag Trivedi

    2016-01-01

    Full Text Available Hydraulic turbines are widely used to meet real-time electricity demands. Computational fluid dynamic (CFD techniques have played an important role in the design and development of such turbines. The simulation of a complete turbine requires substantial computational resources. A specific approach that is applied to investigate the flow field of one turbine may not work for another turbine. A series of Francis-99 workshops have been planned to discuss and explore the CFD techniques applied within the field of hydropower with application to high-head Francis turbines. The first workshop was held in December 2014 at the Norwegian University of Science and Technology, Norway. The steady-state measurements were conducted on a model Francis turbine. Three operating points, part load, best efficiency point, and high load, were investigated. The complete geometry, meshing, and experimental data concerning the hydraulic efficiency, pressure, and velocity were provided to the academic and industrial research groups. Various researchers have conducted extensive numerical studies on the high-head Francis turbine, and the obtained results were presented during the workshop. This paper discusses the presented numerical results and the important outcome of the extensive numerical studies on the Francis turbine. The use of a wall function assuming equilibrium between the production and dissipation of turbulence is widely used in the simulation of hydraulic turbines. The boundary layer of hydraulic turbines is not fully developed because of the continuously-changing geometry and large pressure gradients. There is a need to develop wall functions that enable the estimation of viscous losses under boundary development for accurate simulations. Improved simulations and results enable reliable estimation of the blade loading. Numerical investigations on leakage flow through the labyrinth seals were conducted. The volumetric efficiency and losses in the seals were

  11. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Applications

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, J. Gonzalez [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Renner, D.B. [Jefferson Lab, Newport News, VA (United States); Shindler, A. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik

    2012-08-24

    In a previous paper (J. G. Lopez et al.,2012) we have discussed the non-perturbative tuning of the chirally rotated Schroedinger functional ({chi}SF). This tuning is required to eliminate bulk O(a) cutoff effects in physical correlation functions. Using our tuning results obtained in this paper we perform scaling and universality tests analyzing the residual O(a) cutoff effects of several step-scaling functions and we compute renormalization factors at the matching scale. As an example of possible application of the {chi}SF we compute the renormalized strange quark mass using large volume data obtained from Wilson twisted mass fermions at maximal twist. (orig.)

  12. Some Exact Results for the Schroedinger Wave Equation with a Time Dependent Potential

    Science.gov (United States)

    Campbell, Joel

    2009-01-01

    The time dependent Schroedinger equation with a time dependent delta function potential is solved exactly for many special cases. In all other cases the problem can be reduced to an integral equation of the Volterra type. It is shown that by knowing the wave function at the origin, one may derive the wave function everywhere. Thus, the problem is reduced from a PDE in two variables to an integral equation in one. These results are used to compare adiabatic versus sudden changes in the potential. It is shown that adiabatic changes in the p otential lead to conservation of the normalization of the probability density.

  13. Some exact results for the Schroedinger wave equation with a time-dependent potential

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Joel [NASA Langley Research Center, MS 488, Hampton, VA 23681 (United States)], E-mail: joel.f.campbell@nasa.gov

    2009-09-11

    The time-dependent Schroedinger equation with a time-dependent delta function potential is solved exactly for many special cases. In all other cases the problem can be reduced to an integral equation of the Volterra type. It is shown that by knowing the wavefunction at the origin, one may derive the wavefunction everywhere. Thus, the problem is reduced from a PDE in two variables to an integral equation in one. These results are used to compare adiabatic versus sudden changes in the potential. It is shown that adiabatic changes in the potential lead to the conservation of the normalization of the probability density.

  14. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Non-preturbative tuning

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, J. Gonzalez [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Renner, D.B. [Jefferson Lab, Newport News, VA (United States); Shindler, A. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik

    2012-08-23

    The use of chirally rotated boundary conditions provides a formulation of the Schroedinger functional that is compatible with automatic O(a) improvement of Wilson fermions up to O(a) boundary contributions. The elimination of bulk O(a) effects requires the non-perturbative tuning of the critical mass and one additional boundary counterterm. We present the results of such a tuning in a quenched setup for several values of the renormalized gauge coupling, from perturbative to nonperturbative regimes, and for a range of lattice spacings. We also check that the correct boundary conditions and symmetries are restored in the continuum limit. (orig.)

  15. Strong correlations in model of the scale-invariance (2+1) dimensional nonlinear Schroedinger equation

    CERN Document Server

    Protogenov, A P

    2001-01-01

    The brief review of events, conditioned by the nonlinear modes strong correlations in the planar systems is presented. The analysis is limited by the Schroedinger nonlinear equation model. The fields stationary distributions are determined. The dependence of the particles number on the parameter characterizing the degree of looking, of the universal oscillation lines, is obtained. It is shown that by small values of this parameter there exists on the two-dimensional lattice the universal gravitation, which may be the dynamic cause of transition to the coherent state. The connection of the chiral nonlinear boundary modes with the violations of the Galilean-invariance of the considered system is discussed

  16. Blow-up in nonlinear Schroedinger equations. II. Similarity structure of the blow-up singularity

    DEFF Research Database (Denmark)

    Rypdal, K.; Juul Rasmussen, Jens

    1986-01-01

    A critical review of the literature on similarity solutions of nonlinear Schroedinger equations is presented. We demonstrate that the self-similar blow-up solutions discovered hitherto are all associated either with a simple stretching invariance, or with a slightly more complicated conformal...... invariance and generalizations of the latter. This generalized "quasi-invariance" reveals the nature of the blow-up singularity and resolves an old controversy. Most of the previous work has been done on the cubic nonlinearity. We generalize the results to an arbitrary power nonlinearity....

  17. Cole-Hopf-like transformation for Schroedinger equations containing complex nonlinearities

    Energy Technology Data Exchange (ETDEWEB)

    Kaniadakis, G.; Scarfone, A.M. [Dipartimento di Fisica, Politecnico di Torino, Torino (Italy) and Istituto Nazionale di Fisica della Materia, Unita del Politecnico di Torino, Torino (Italy)]. E-mails: kaniadakis@polito.it; scarfone@polito.it

    2002-03-01

    We consider systems which conserve the particle number and are described by Schroedinger equations containing complex nonlinearities. In the case of canonical systems, we study their main symmetries and conservation laws. We introduce a Cole-Hopf-like transformation both for canonical and noncanonical systems, which changes the evolution equation into another one containing purely real nonlinearities, and reduces the continuity equation to the standard form of the linear theory. This approach allows us to treat, in a unifying scheme, a wide variety of canonical and noncanonical nonlinear systems, some of them already known in the literature. (author)

  18. Quaternionic factorization of the Schroedinger operator and its applications to some first-order systems of mathematical physics

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, Viktor G [Faculdade de Ciencias y Tecnologia, Universidade do Algarve, Campus de Gambelas, 8000 Faro (Portugal); Kravchenko, Vladislav V [Depto de Telecomunicaciones, SEPI ESIME Zacatenco, Instituto Politecnico Nacional, Av. IPN S/N, Edif. 1 CP 07738, DF (Mexico)

    2003-11-07

    We show that an ample class of physically meaningful partial differential systems of first order such as the Dirac equation with different one-component potentials, static Maxwell's system and the system describing the force-free magnetic fields are equivalent to a single quaternionic equation which in its turn reduces in general to a Schroedinger equation with quaternionic potential, and in some situations this last can be diagonalized. The rich variety of methods developed for different problems corresponding to the Schroedinger equation can be applied to the systems considered in the present work.

  19. Automated lattice perturbation theory in the Schroedinger functional. Implementation and applications in HQET

    Energy Technology Data Exchange (ETDEWEB)

    Hesse, Dirk

    2012-07-13

    The author developed the pastor software package for automated lattice perturbation theory calculations in the Schroedinger functional scheme. The pastor code consists of two building blocks, dealing with the generation of Feynman rules and Feynman diagrams respectively. Accepting a rather generic class of lattice gauge and fermion actions, passed to the code in a symbolic form as input, a low level part of pastor will generate Feynman rules to an arbitrary order in the bare coupling with a trivial or an Abelian background field. The second, high level part of pastor is a code generator whose output relies on the vertex generator. It writes programs that evaluate Feynman diagrams for a class of Schroedinger functional observables up to one loop order automatically, the relevant O(a) improvement terms are taken into account. We will describe the algorithms used for implementation of both parts of the code in detail, and provide cross checks with perturbative and non-perturbative data to demonstrate the correctness of our code. We demonstrate the usefulness of the pastor package through various applications taken from the matching process of heavy quark effective theory with quantum chromodynamics. We have e.g. completed a one loop analysis for new candidates for matching observables timely and with rather small effort, highlighting two advantages of an automated software setup. The results that were obtained so far will be useful as a guideline for further non-perturbative studies.

  20. Bell's theorem and quantum realism. Reassessment in light of the Schroedinger paradox

    Energy Technology Data Exchange (ETDEWEB)

    Shakur, Asif M. [Salisbury Univ., MD (United States). Dept. of Physics; Hemmick, Douglas L.

    2012-07-01

    Quantum theory presents a strange picture of the world, offering no real account of physical properties apart from observation. Neils Bohr felt that this reflected a core truth of nature: ''There is no quantum world. There is only an abstract mathematical description.'' Among the most significant developments since Bohr's day has been the theorem of John S. Bell. It is important to consider whether Bell's analysis supports such a denial of microrealism. In this book, we evaluate the situation in terms of an early work of Erwin Schroedinger. Doing so, we see how Bell's theorem is conceptually related to the Conway and Kochen Free Will theorem and also to all the major anti-realism efforts. It is easy to show that none of these analyses imply the impossibility of objective realism. We find that Schroedinger's work leads to the derivation of a new series of theoretical proofs and potential experiments, each involving ''entanglement,'' the link between particles in some quantum systems. (orig.)

  1. Francis Bacon: The Real's Brutality. The Figure and the Other

    Directory of Open Access Journals (Sweden)

    Guido Mannucci

    2014-03-01

    Full Text Available Getting in front of painting by Francis Bacon touches you deeply. I’m talking about aesthetics, sensations: resounding flow that strikes abruptly, making futile any search for meaning. Francis Bacon circumvents the figurative, the meaning, he aims to the figural: to feelings, not words. Beauty, in his paintings, shows itself in the peaceful union of the positive and of its contrary; if the negative wasn’t there, though, his paintings wouldn’t exude such a brutal sense of reality. This essay investigates the figure of Francis Bacon and the spectator – the Other – as he tries to confront the painting. Bacon will be analysed using a purely phenomenological approach, with references that range from Merleau-Ponty to Martin Heidegger; the meeting-collision between the spectator and the painting, instead, will be examined taking inspiration from the Winnicott’s thesis on the relationship between Bacon and mirrors in the painter’s childhood. In order to take distance from Winnicott’s psychoanalytical approach, this essay will focus on the relationship between spectator and painting from a more anthropological point of view. 

  2. Time-dependent Schroedinger equations with effective mass in (2 + 1) dimensions: intertwining relations and Darboux operators

    Energy Technology Data Exchange (ETDEWEB)

    Cobian, Hector [Facultad de Ciencias, Universidad de Colima, Bernal DIaz del Castillo 340, 28045 Colima, Colima (Mexico); Schulze-Halberg, Axel, E-mail: horus.cobian@gmail.com, E-mail: xbataxel@gmail.com, E-mail: axgeschu@iun.edu [Department of Mathematics and Actuarial Science, Indiana University Northwest, 3400 Broadway, Gary, IN 46408 (United States)

    2011-07-15

    We construct Darboux transformations for time-dependent Schroedinger equations with position-dependent mass in (2 + 1) dimensions. Several examples illustrate our results, which complement and generalize former findings for the constant mass case in two spatial variables (Schulze-Halberg 2010 J. Math. Phys. 51 033521).

  3. Schroedinger Eigenmaps with nondiagonal potentials for spatial-spectral clustering of hyperspectral imagery

    Science.gov (United States)

    Cahill, Nathan D.; Czaja, Wojciech; Messinger, David W.

    2014-06-01

    Schroedinger Eigenmaps (SE) has recently emerged as a powerful graph-based technique for semi-supervised manifold learning and recovery. By extending the Laplacian of a graph constructed from hyperspectral imagery to incorporate barrier or cluster potentials, SE enables machine learning techniques that employ expert/labeled information provided at a subset of pixels. In this paper, we show how different types of nondiagonal potentials can be used within the SE framework in a way that allows for the integration of spatial and spectral information in unsupervised manifold learning and recovery. The nondiagonal potentials encode spatial proximity, which when combined with the spectral proximity information in the original graph, yields a framework that is competitive with state-of-the-art spectral/spatial fusion approaches for clustering and subsequent classification of hyperspectral image data.

  4. Light bullets in the spatiotemporal nonlinear Schroedinger equation with a variable negative diffraction coefficient

    Energy Technology Data Exchange (ETDEWEB)

    Zhong Weiping [Department of Electronic and Information Engineering, Shunde Polytechnic, Guangdong Province, Shunde 528300 (China); Belic, Milivoj [Texas A and M University at Qatar, 23874 Doha (Qatar); Institute of Physics, University of Belgrade, P. O. Box 68, 11001 Belgrade (Serbia); Assanto, Gaetano [NooEL, Nonlinear Optics and OptoElectronics Lab, University of Rome ' ' Roma Tre,' ' I-00146 Rome (Italy); Malomed, Boris A. [Department of Physical Electronics, School of Electrical Engineering, Faculty of Engineering, Tel Aviv University, Tel Aviv 69978 (Israel); ICFO-Institut de Ciencies Fotoniques, Mediterranean Technology Park, E-08860 Castelldefels (Barcelona) (Spain); Huang, Tingwen [Texas A and M University at Qatar, 23874 Doha (Qatar)

    2011-10-15

    We report approximate analytical solutions to the (3+1)-dimensional spatiotemporal nonlinear Schroedinger equation, with the uniform self-focusing nonlinearity and a variable negative radial diffraction coefficient, in the form of three-dimensional solitons. The model may be realized in artificial optical media, such as left-handed materials and photonic crystals, with the anomalous sign of the group-velocity dispersion (GVD). The same setting may be realized through the interplay of the self-defocusing nonlinearity, normal GVD, and positive variable diffraction. The Hartree approximation is utilized to achieve a suitable separation of variables in the model. Then, an inverse procedure is introduced, with the aim to select a suitable profile of the modulated diffraction coefficient supporting desirable soliton solutions (such as dromions, single- and multilayer rings, and multisoliton clusters). The validity of the analytical approximation and stability of the solutions is tested by means of direct simulations.

  5. Design of large Francis turbine using optimal methods

    Science.gov (United States)

    Flores, E.; Bornard, L.; Tomas, L.; Liu, J.; Couston, M.

    2012-11-01

    Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China -32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.

  6. Cost of enlarged operating zone for an existing Francis runner

    Science.gov (United States)

    Monette, Christine; Marmont, Hugues; Chamberland-Lauzon, Joël; Skagerstrand, Anders; Coutu, André; Carlevi, Jens

    2016-11-01

    Traditionally, hydro power plants have been operated close to best efficiency point, the more stable operating condition for which they have been designed. However, because of changes in the electricity market, many hydro power plants operators wish to operate their machines differently to fulfil those new market needs. New operating conditions can include whole range operation, many start/stops, extensive low load operation, synchronous condenser mode and power/frequency regulation. Many of these new operating conditions may impose more severe fatigue damage than the traditional base load operation close to best efficiency point. Under these conditions, the fatigue life of the runner may be significantly reduced and reparation or replacement cost might occur sooner than expected. In order to design reliable Francis runners for those new challenging operating scenarios, Andritz Hydro has developed various proprietary tools and design rules. These are used within Andritz Hydro to design mechanically robust Francis runners for the operating scenarios fulfilling customer's specifications. To estimate residual life under different operating scenarios of an existing runner designed years ago for best efficiency base load operation, Andritz Hydro's design rules and tools would necessarily lead to conservative results. While the geometry of a new runner can be modified to fulfil all conservative mechanical design rules, the predicted fatigue life of an existing runner under off-design operating conditions may appear rather short because of the conservative safety factor included in the calculations. The most precise and reliable way to calculate residual life of an existing runner under different operating scenarios is to perform a strain gauge measurement campaign on the runner. This paper presents the runner strain gage measurement campaign of a mid-head Francis turbine over all the operating conditions available during the test, the analysis of the measurement signals

  7. Water quality investigation of Francis Slocum Lake, Luzerne County, Pennsylvania

    Science.gov (United States)

    Barker, James L.

    1978-01-01

    This report summarizes water-quality data collected in the Francis Slocum Lake drainage basin, Pennsylvania, during an assessment from October 1976 to September 1977. Data were collected for nitrogen, phosphorus, carbon, and fecal coliform and fecal streptococcal bacteria.Results of the restricted sampling indicate that nutrient recycling within the lake is sufficient to support the periodic luxurient growth of algae and aquatic weeds. Inflows are not contributing high concentrations of nutrients to the ecosystem. Sampling for enteric bacteria indicate the sanitary quality is sufficiently high for water-contact recreation.

  8. 78 FR 59913 - Revision of the Land Management Plan for the Francis Marion National Forest

    Science.gov (United States)

    2013-09-30

    ... Forest Service Revision of the Land Management Plan for the Francis Marion National Forest AGENCY: Forest... initiating the development of a land management plan revision (forest plan) for the Francis Marion National... the National Forest Management Act (NFMA) of 1976 describe the strategic direction for management of...

  9. Teaching and Leading through Dialogue: Pope Francis and Catholic Higher Education

    Science.gov (United States)

    Curran, Joseph

    2015-01-01

    The early pontificate of Francis has been marked by substantial changes in the style of papal governance and teaching. Francis's engagement in dialogue with members of the media corresponds to a willingness to foster meaningful dialogue among the bishops and to use teaching documents to raise questions rather than answer them. At the Extraordinary…

  10. A general formula for Rayleigh-Schroedinger perturbation energy utilizing a power series expansion of the quantum mechanical Hamiltonian

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, J.M.

    1997-02-01

    Perturbation theory has long been utilized by quantum chemists as a method for approximating solutions to the Schroedinger equation. Perturbation treatments represent a system`s energy as a power series in which each additional term further corrects the total energy; it is therefore convenient to have an explicit formula for the nth-order energy correction term. If all perturbations are collected into a single Hamiltonian operator, such a closed-form expression for the nth-order energy correction is well known; however, use of a single perturbed Hamiltonian often leads to divergent energy series, while superior convergence behavior is obtained by expanding the perturbed Hamiltonian in a power series. This report presents a closed-form expression for the nth-order energy correction obtained using Rayleigh-Schroedinger perturbation theory and a power series expansion of the Hamiltonian.

  11. Solution of the Schroedinger equation for time-dependent 1D harmonic oscillators using the orthogonal functions invariant

    Energy Technology Data Exchange (ETDEWEB)

    Guasti, M Fernandez [Depto de Fisica, CBI, Universidad A Metropolitana - Iztapalapa, 09340 Mexico, DF, Apdo Postal 55-534 (Mexico); Moya-Cessa, H [INAOE, Coordinacion de Optica, Apdo Postal 51 y 216, 72000 Puebla, Pue. (Mexico)

    2003-02-28

    An extension of the classical orthogonal functions invariant to the quantum domain is presented. This invariant is expressed in terms of the Hamiltonian. Unitary transformations which involve the auxiliary function of this quantum invariant are used to solve the time-dependent Schroedinger equation for a harmonic oscillator with time-dependent parameter. The solution thus obtained is in agreement with the results derived using other methods which invoke the Lewis invariant in their procedures.

  12. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Sir Francis Galton and the birth of eugenics.

    Science.gov (United States)

    Gillham, N W

    2001-01-01

    The eugenics movement was initiated by Sir Francis Galton, a Victorian scientist. Galton's career can be divided into two parts. During the first, Galton was engaged in African exploration, travel writing, geography, and meteorology. The second part began after he read the Origin of Species by his cousin Charles Darwin. The book convinced Galton that humanity could be improved through selective breeding. During this part of his career he was interested in the factors that determine what he called human "talent and character" and its hereditary basis. Consequently, he delved into anthropometrics and psychology and played a major role in the development of fingerprinting. He also founded the field of biometrics, inventing such familiar statistical procedures as correlation and regression analysis. He constructed his own theory of inheritance in which nature and not nurture played the leading role. He actively began to promote eugenics and soon gained important converts.

  14. Simulations of Steady Cavitating Flow in a Small Francis Turbine

    Directory of Open Access Journals (Sweden)

    Ahmed Laouari

    2016-01-01

    Full Text Available The turbulent flow through a small horizontal Francis turbine is solved by means of Ansys-CFX at different operating points, with the determination of the hydrodynamic performance and the best efficiency point. The flow structures at different regimes reveal a large flow eddy in the runner and a swirl in the draft tube. The use of the mixture model for the cavity/liquid two-phase flow allowed studying the influence of cavitation on the hydrodynamic performance and revealed cavitation pockets near the trailing edge of the runner and a cavitation vortex rope in the draft tube. By maintaining a constant dimensionless head and a distributor vane opening while gradually increasing the cavitation number, the output power and efficiency reached a critical point and then had begun to stabilize. The cavitation number corresponding to the safety margin of cavitation is also predicted for this hydraulic turbine.

  15. Francis Bacon: constructing natural histories of the invisible.

    Science.gov (United States)

    Rusu, Doina-Cristina

    2012-01-01

    The natural histories contained in Francis Bacon's Historia naturalis et experimentalis seem to differ from the model presented in De augmentis scientiarum and the Descriptio globi intellectualis in that they are focused on the defining properties of matter, its primary schematisms and the spirits. In this respect, they are highly speculative. In this paper I aim to describe the Historia naturalis et experimentalis as a text about matter theory, the histories of which are ascending from what is most evident to the senses to what is least accessible to them. Moreover, the Latin natural histories are parts of a methodological procedure in which the provisional rules and axioms obtained in one history can be used as theoretical assumptions for another history, thereby permitting one to delve ever more profoundly into the structure of nature.

  16. The "Visual Shock" of Francis Bacon: an essay in neuroesthetics.

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a "visual shock."We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his "visual shock" because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  17. Francis Bacon: teory, method and contributions to the education

    Directory of Open Access Journals (Sweden)

    Roberto Carlos Simões Galvão

    2007-04-01

    Full Text Available In the present article, we propose a brief analysis of Francis Bacon’s thought (1561-1626 and his contributions to the Education. With Bacon, the old religious or metaphysical character of knowledge was substituted by the objectivity of the experimental science, something unknown until then. The science started to represent a means in search of an end, i.e., man’s control over nature. The desire of Bacon to promote a reorganization of the power of the human knowledge, not based on the old scholastic knowledge, but in the new scientific knowledge, was shared by educators, philosophers and statesmen of his time. The role of the school would be to assure the dissemination of this new knowledge which, properly unified, would be within reach of all the children

  18. A formal derivation of the Gibbs entropy for classical systems following the Schroedinger quantum mechanical approach

    Energy Technology Data Exchange (ETDEWEB)

    Santillan, M [Cinvestav-IPN, Unidad Monterrey, Parque de Investigacion e Innovacion Tecnologica, Autopista Monterrey-Aeropuerto Km 10, 66600 Apodaca NL (Mexico); Zeron, E S [Departamento de Matematicas, Cinvestav-IPN, 07000 Mexico DF (Mexico); Rio-Correa, J L del [Departamento de Fisica, Universidad Autonoma Metropolitana Iztapalapa, 09340 Mexico DF (Mexico)], E-mail: msantillan@cinvestav.mx, E-mail: eszeron@math.cinvestav.mx, E-mail: jlrc@xanum.uam.mx

    2008-05-15

    In the traditional statistical mechanics textbooks, the entropy concept is first introduced for the microcanonical ensemble and then extended to the canonical and grand-canonical cases. However, in the authors' experience, this procedure makes it difficult for the student to see the bigger picture and, although quite ingenuous, the subtleness of the demonstrations to pass from the microcanonical to the canonical and grand-canonical ensembles is hard to grasp. In the present work, we adapt the approach used by Schroedinger to introduce the entropy definition for quantum mechanical systems to derive a classical mechanical entropy definition, which is valid for all ensembles and is in complete agreement with the Gibbs entropy. Afterwards, we show how the specific probability densities for the microcanonical and canonical ensembles can be obtained from the system macrostate, the entropy definition and the second law of thermodynamics. After teaching the approach introduced in this paper for several years, we have found that it allows a better understanding of the statistical mechanics foundations. On the other hand, since it demands previous knowledge of thermodynamics and mathematical analysis, in our experience this approach is more adequate for final-year undergraduate and graduate physics students.

  19. Plasmons and Coulomb drag in Dirac/Schroedinger hybrid electron systems

    Science.gov (United States)

    Principi, Alessandro; Carrega, Matteo; Asgari, Reza; Pellegrini, Vittorio; Polini, Marco

    2013-03-01

    We show that the plasmon spectrum of an ordinary two-dimensional electron gas (2DEG) hosted in a GaAs heterostructure is significantly modified when a graphene sheet is placed on the surface of the semiconductor in close proximity to the 2DEG. Long-range Coulomb interactions between massive electrons and massless Dirac fermions lead to a new set of optical and acoustic intra-subband plasmons. Here we compute the dispersion of these coupled modes within the Random Phase Approximation, providing analytical expressions in the long-wavelength limit that shed light on their dependence on the Dirac velocity and Dirac-fermion density. We also evaluate the resistivity in a Coulomb-drag transport setup. These Dirac/Schroedinger hybrid electron systems are experimentally feasible and open new research opportunities for fundamental studies of electron-electron interaction effects in two spatial dimensions. Work in Pisa was supported by MIUR through the program ``FIRB - Futuro in Ricerca 2010.'' Grant no. RBFR10M5BT (``Plasmons and terahertz devices in graphene'').

  20. An asymptotic solution of the Schroedinger equation for the elliptic wire in the magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Bejenari, I; Kantser, V [Institute of Electronic Engineering and Industrial Technologies, Academiei str., 3/3, MD2028 Chisinau (Moldova, Republic of)], E-mail: bejenari@iieti.asm.md

    2008-10-03

    An asymptotic solution of the Schroedinger equation with non-separable variables is obtained for a particle confined to an infinite elliptic cylinder potential well under an applied uniform longitudinal magnetic field. Using the standard-problem method, dimension-quantized eigenvalues have been calculated when the magnetic length is large enough in comparison with the half of the distance between the boundary ellipse focuses. In semi-classical approximation, the confined electron (hole) states are divided into the boundary states (BS), ring states (RS), hyperbolic caustic states (HCS) and harmonic oscillator states (HOS). For large angular momentum quantum numbers and small radial quantum numbers, the BS and RS are grouped into the 'whispering gallery' mode. They associate with particles moving along the wire cross section boundary. The motion is limited from the wire core by the elliptic caustic. Consisting of the HCS and HOS, the 'jumping ball' modes correspond to the states of particle moving along a wire diameter when the angular momentum quantum number is much less than the radial quantum number. In this case, the motion is restricted by the hyperbolic caustics and two boundary ellipse arcs. For excited hole states in a Bi wire, the energy spectrum and space probability distribution are analyzed.

  1. State of the art in numerical simulation of high head Francis turbines

    Directory of Open Access Journals (Sweden)

    Trivedi Chirag

    2016-01-01

    Full Text Available The Francis-99 test case consists in a high head Francis turbine model, which geometry together with meshes and detailed experimental measurements is freely available at www.francis-99.org. Three workshops were initially planned to exchange experience on numerical investigations of the test case concerning steady state operating conditions, transient operating conditions and fluid structure analysis. The first workshop was held in Trondheim, Norway in December 2014. Some results of the 14 contributions are presented. They are concerned with the influence of the near wall space discretization and turbulence modelling in order to capture hydraulic efficiency, torque, pressure and velocity with a good uncertainty at three operating conditions.

  2. 6PM: EPA Administrator joining Georgetown Discussion on Pope Francis Encyclical and the Environment

    Science.gov (United States)

    WASHINGTON - Today, Environmental Protection Agency (EPA) Administrator Gina McCarthy will participate in a panel discussion on the moral and policy implications of Pope's Francis' Encyclical on the Environment hosted by the Initiative on Catholic S

  3. Francis Galton on twins, heredity and social class.

    Science.gov (United States)

    Burbridge, D

    2001-09-01

    In 1875 Francis Galton was the first to study twins as a test of the relative strenght of heredity and environment. This paper examines Galton's work on twins, using his surviving working papers. It shows that his enquiry was larger and more systematic than previously realized. Galton issued several hundred questionnaires to parents of twins, with the aim of establishing how far the similarities and differences between twins were affected by their life experiences. The paper also discusses Galton's study in relation to his understanding of the physiology of twinning and his theory of heredity. The modern concept of monozygotic twins had not yet been established, and the similarity between Galton's work and modern twin studies should not be overstated. While Galton's work was important as a pioneering study, in some respects his conclusions went beyond his evidence. The paper finally examines whether Galton's twin studies influenced his position on the links between social class, heredity and social mobility, and surveys the evidence for his views on these issues.

  4. Application of variable speed operation on Francis Turbines

    Directory of Open Access Journals (Sweden)

    G. P. Heckelsmueller

    2015-04-01

    Full Text Available Francis turbines that are directly coupled to a synchronous generator operate at constant rotational speed around a design point characterized by a given water head, flow and guide vane aperture. When important changes occur in headwater level in power stations with large reservoirs, the turbines suffer a significant loss of efficiency. By applying variable speed technology it may be possible to adapt the runner speed and to operate with a higher efficiency over a wide range of water heads. This investigation is intended to reveal the possible benefits of using variable speed operation in regard to gains in efficiency and power output. Based on model test data it is possible to determine the characteristic curves of unitary speed and unitary flow of the respective prototype turbine for varying guide vane apertures. By varying rotor speed it is possible to maintain values that correspond to maximum efficiency. An analysis is made keeping guide vane aperture constant and introducing a proportionality factor of water flow to corresponding power output. The results show that for guide vane apertures and heads different from the design point, best efficiencies can be kept by adjusting rotor speed. At heads lower than the design head, significant efficiency gains can be achieved. Consequently, a significant proportion of the flow can be saved while generating the same amount of power.

  5. The medical philosophy of Francis Bacon (1561-1626).

    Science.gov (United States)

    Boss, J

    1978-01-01

    Francis Bacon's view of man is dualistic but, although he takes note of mental faculties, he makes the relation between mind and body, rather than the substance of mind, the basis for enquiry into mental processes and, more particularly, for the medically relevant study of mind. (He uses "mind" and "soul" as equivalent terms.) The healing of the body requires study of the body, and the ineffectiveness of physicians is due to their failure in this respect rather than to the body's complexity. To learn about the body requires clinical observation and recording, together with the comparison of bodies, experiments on living animals and attention to pathological changes. The aims of medicine should include not only the restoration of health but also the relief of suffering and they are not to be limited by putting aside a disease as incurable. To learn from treatment it must be fixed in its ordering with controlled and limited variation. Bacon has no separation of medicine from natural science; his philosophy of medicine is his general philosophy of the advancement of knowledge, but limited to a particular field of application. If medicine is separated from natural philosophy it is changed wholly or greatly into empiricism.

  6. The Visual Shock of Francis Bacon: An essay in neuroesthetics

    Directory of Open Access Journals (Sweden)

    Semir eZeki

    2013-12-01

    Full Text Available In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a visual shock. We explore what this means in terms of brain activity and what insights into the brain’s visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs and cars. We show that viewing face and house stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his visual shock because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  7. Charge capture and impact excitation processes in H{sup +} on He{sup +} collisions: a case study by the time-dependent Schroedinger equation method

    Energy Technology Data Exchange (ETDEWEB)

    Tong Xiaomin [Cold Trapped Ions Project, ICORP, Japan Science and Technology Corporation (JST), Axis 3F, 1-40-2 Fuda Chofu, Tokyo 182-0024 (Japan)]. E-mail: tong@hci.jst.go.jp; Kato, Daiji; Watanabe, Tsutomu [Cold Trapped Ions Project, ICORP, Japan Science and Technology Corporation (JST), Axis 3F, 1-40-2 Fuda Chofu, Tokyo 182-0024 (Japan); Ohtani, Shunsuke [Cold Trapped Ions Project, ICORP, Japan Science and Technology Corporation (JST), Axis 3F, 1-40-2 Fuda Chofu, Tokyo 182-0024 (Japan); University of Electro-Communication, Chofu, Tokyo 182-0021 (Japan)

    2000-12-28

    We have studied the charge capture and impact excitation processes in H{sup +} on He{sup +} collisions over a wide range of collision energies by solving the time-dependent Schroedinger equation with the classical trajectory approximation for the projectile. The time-dependent Schroedinger equation is solved by the split-operator method with a generalized pseudospectral (non-uniform grid) method in the energy representation. The calculated charge capture cross sections are in good agreement with the available experimental measurements. Our calculated charge capture and impact excitation cross sections are also in reasonable agreement with various close-coupling calculations. Combined with time-dependent density functional theory, our Schroedinger equation method (time propagation) holds significant promise for studying many-electron processes in atom-ion collisions. (author)

  8. Parametric resonance for solitons in the nonlinear Schroedinger equation model with time-dependent harmonic oscillator potential

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez-Tenorio, C. [Benemerita Universidad Autonoma de Puebla, 7200 Puebla (Mexico) and Universidad Autonoma del Estado de Mexico (Mexico)]. E-mail: celso1@hotmail.com; Belyaeva, T.L. [Universidad Autonoma del Estado de Mexico (Mexico); Serkin, V.N. [Benemerita Universidad Autonoma de Puebla, 7200 Puebla (Mexico)

    2007-09-01

    The dynamics of nonlinear solitary waves is studied in the framework of the nonlinear Schroedinger equation model with time-dependent harmonic oscillator potential. The model allows one to analyse on general basis a variety of nonlinear phenomena appearing both in Bose-Einstein condensate, condensed matter physics, nonlinear optics, and biophysics. The soliton parametric resonance is investigated by using two complementary methods: the adiabatic perturbation theory and direct numerical experiments. Conditions for reversible and irreversible denaturation of soliton bound states are also considered.

  9. Dise\\~no de una Arquitectura para la Solucion de la Ecuacion de Schroedinger usando el Metodo de Numerov

    CERN Document Server

    Rodriguez-Toro, Victor A; Velasco-Medina, Jaime

    2011-01-01

    This paper presents a first approach in order to design an optimal architecture to implement the Numerov method, which solves the time-independent Schroedinger equation (TISE) for one dimension. The design and simulation have been performed by using 64-bits floating-point megafunctions available in Quartus II (Version 9.0). The verification of these results was done by using Matlab. According to these results, it is possible to extend this design to parallel structures, which would be able to calculate several TISE solutions.

  10. On the reduction of the multidimensional stationary Schroedinger equation to a first-order equation and its relation to the pseudoanalytic function theory

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, Vladislav V [Departmento de Telecomunicaciones, SEPI, Escuela Superior de IngenierIa Mecanica y Electrica, Instituto Politecnico Nacional, CP 07738 Mexico DF (Mexico)

    2005-01-28

    Given a particular solution of a one-dimensional stationary Schroedinger equation this equation of second order can be reduced to a first-order linear ordinary differential equation. This is done with the aid of an auxiliary Riccati differential equation. In the present work we show that the same fact is true in a multidimensional situation also. For simplicity we consider the case of two or three independent variables. One particular solution of the stationary Schroedinger equation allows us to reduce this second-order equation to a linear first-order quaternionic differential equation. As in the one-dimensional case this is done with the aid of an auxiliary quaternionic Riccati equation. The resulting first-order quaternionic equation is equivalent to the static Maxwell system and is closely related to the Dirac equation. In the case of two independent variables it is the well-known Vekua equation from theory of pseudoanalytic (or generalized analytic) functions. Nevertheless, we show that even in this case it is very useful to consider not only complex valued functions, solutions of the Vekua equation, but complete quaternionic functions. In this way the first-order quaternionic equation represents two separate Vekua equations, one of which gives us solutions of the Schroedinger equation and the other one can be considered as an auxiliary equation of a simpler structure. Moreover for the auxiliary equation we always have the corresponding Bers generating pair (F, G), the base of the Bers theory of pseudoanalytic functions, and what is very important, the Bers derivatives of solutions of the auxiliary equation give us solutions of the main Vekua equation and as a consequence of the Schroedinger equation. Based on this fact we obtain an analogue of the Cauchy integral theorem for solutions of the stationary Schroedinger equation. Other results from theory of pseudoanalytic functions can be written for solutions of the Schroedinger equation. Moreover, for an ample

  11. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  12. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  13. 77 FR 68821 - Notice of Inventory Completion: U.S. Department of Agriculture, Forest Service, Ozark-St. Francis...

    Science.gov (United States)

    2012-11-16

    ... 3ST12 and 3ST26, on private property, by Don Williams, USDA-Forest Service Geologist, also in Stone... Inventory Completion: U.S. Department of Agriculture, Forest Service, Ozark-St. Francis National Forests... Agriculture (USDA), Forest Service, Ozark-St. Francis National Forests has completed an inventory of human...

  14. 77 FR 68819 - Notice of Inventory Completion: U.S. Department of Agriculture, Forest Service, Ozark-St. Francis...

    Science.gov (United States)

    2012-11-16

    ... Inventory Completion: U.S. Department of Agriculture, Forest Service, Ozark-St. Francis National Forests... Agriculture (USDA), Forest Service, Ozark-St. Francis National Forests has completed an inventory of human... (Wichita, Keechi, Waco & Tawakonie), Oklahoma. History and Description of the Remains In 1970 and 1971...

  15. Ultrashort self-similar solutions of the cubic-quintic nonlinear Schroedinger equation with distributed coefficients in the inhomogeneous fiber

    Energy Technology Data Exchange (ETDEWEB)

    Dai Chaoqing; Wang Yueyue; Wang Xiaogang, E-mail: dcq424@126.com [School of Sciences, Zhejiang A and F University, Lin' an, Zhejiang 311300 (China)

    2011-04-15

    By means of the similarity transformation, we obtain exact self-similar solutions (similaritons) of the generalized cubic-quintic (CQ) nonlinear Schroedinger equation with spatially inhomogeneous group velocity dispersion, CQ nonlinearity and amplification or attenuation. Exact balance conditions between the dispersion, nonlinearity and the gain/loss have been obtained. As an example, we investigate their propagation dynamics in the dispersion decreasing fiber (DDF). Considering the fluctuation of the fiber parameter in real application, the exact balance conditions do not satisfy, and so we perform direct numerical analysis with initial 10% white noise for the bright similariton in both the DDF and the periodic distributed amplification system. Numerical calculations indicate stable propagation of the bright similariton over tens of dispersion lengths. These ultrashort self-similar optical waves are potentially useful for all-optical data-processing schemes and the design of beam compressors and amplifiers.

  16. The initial value problem, scattering and inverse scattering, for Schroedinger equations with a potential and a non-local nonlinearity

    Energy Technology Data Exchange (ETDEWEB)

    Romero, MarIa de los Angeles Sandoval; Weder, Ricardo [Instituto de Investigaciones en Matematicas Aplicadas y en Sistemas, Universidad Nacional Autonoma de Mexico, Apartado Postal 20-726, Mexico DF 01000 (Mexico)

    2006-09-15

    We consider nonlinear Schroedinger equations with a potential, and non-local nonlinearities, that are models in mesoscopic physics, for example of a quantum capacitor, and that are also models of molecular structure. We study in detail the initial value problem for these equations, in particular, existence and uniqueness of local and global solutions, continuous dependence on the initial data and regularity. We allow for a large class of unbounded potentials. We have no restriction on the growth at infinity of the positive part of the potential. We also construct the scattering operator in the case of potentials that go to zero at infinity. Furthermore, we give a method for the unique reconstruction of the potential from the small amplitude limit of the scattering operator. In the case of the quantum capacitor, our method allows us to uniquely reconstruct all the physical parameters from the small amplitude limit of the scattering operator.

  17. Analytical solutions of the Schroedinger equation for a two-dimensional exciton in magnetic field of arbitrary strength

    Energy Technology Data Exchange (ETDEWEB)

    Hoang-Do, Ngoc-Tram; Hoang, Van-Hung; Le, Van-Hoang [Department of Physics, Ho Chi Minh City University of Pedagogy, 280 An Duong Vuong Street, District 5, Ho Chi Minh City (Viet Nam)

    2013-05-15

    The Feranchuk-Komarov operator method is developed by combining with the Levi-Civita transformation in order to construct analytical solutions of the Schroedinger equation for a two-dimensional exciton in a uniform magnetic field of arbitrary strength. As a result, analytical expressions for the energy of the ground and excited states are obtained with a very high precision of up to four decimal places. Especially, the precision is uniformly stable for the whole range of the magnetic field. This advantage appears due to the consideration of the asymptotic behaviour of the wave-functions in strong magnetic field. The results could be used for various physical analyses and the method used here could also be applied to other atomic systems.

  18. Inventing Citizens, Imagining Gender Justice: The Suffrage Rhetoric of Virginia and Francis Minor

    Science.gov (United States)

    Ray, Angela G.; Richards, Cindy Koenig

    2007-01-01

    From the late 1860s through the mid-1870s, woman suffrage activists developed an ingenious legal argument, claiming that the U.S. Constitution already enfranchised women citizens. The argument, first articulated by St. Louis activists Virginia and Francis Minor, precipitated rhetorical performances by movement activists on public platforms and in…

  19. Teaching Psychology and Literature: Melancholia as Motivation in the Novels of Dick Francis

    Science.gov (United States)

    Wagner, Elaine

    2010-01-01

    Teaching literature from a psychological perspective provides a basis for the study and analysis of human motivation and behavior, as psychology and literature make mutual contributions to the study of both disciplines. Melancholia is a recurring theme in the novels of Dick Francis, and the first-person accounts of despair and depression are…

  20. Francis Bacon's New Science: Rhetoric and the Transformative Power of Print.

    Science.gov (United States)

    Heckel, David

    The process of projecting textual models onto the phenomenal world began with the invention of writing and accelerated through the manuscript culture of classical antiquity and the Middle Ages into the age of print. In Francis Bacon's work, the book (a metaphor for the phenomenal world) adapted to the demands of the printed text and reflects the…

  1. Following Francis: to build a safe NHS we must go from targets to teams

    OpenAIRE

    Cotton, Elizabeth

    2015-01-01

    This week saw the third Francis report about how to build a safe NHS and end the workplace culture of bullying. Elizabeth Cotton reviews the report and writes that we must move away system based on top down political targets towards one that actually delivers personalised care.

  2. Cardiovascular Risk in Rheumatoid Arthritis Patients, Diagnosis and Treatment: a report of the FRANCIS

    NARCIS (Netherlands)

    D.F. Van Breukelen-van der Stoep (Deborah)

    2017-01-01

    markdownabstractAll the research in this thesis is based on the Franciscus Rheumatoid Arthritis aNd Cardiovascular Intervention Study (FRANCIS), an open label randomized clinical trial. The main focus of this thesis is on the role of traditional CVD risk factors on CVD in RA; their prevalence, their

  3. Francis Moto The aim of this paper is to describe tonal mobility in ...

    African Journals Online (AJOL)

    Francis Moto. The aim of this paper is to describe tonal mobility in. Chichewa. We will establish that the surface positions of. Chichewa tonal contrasts do not always con-espond to their original locations in the underlying structure, but rather that their point of origin may be in preceding syllables, morphemes or even words, ...

  4. The Culture of Science and the Rhetoric of Scientism: From Francis Bacon to the Darwin Fish

    Science.gov (United States)

    Lessl, Thomas M.

    2007-01-01

    The culture of modern science continues to establish its public identity by appealing to values and historical conceptions that reflect its appropriation of various religious ideals during its formative period, most especially in the rhetoric of Francis Bacon. These elements have persisted because they continue to achieve similar goals, but the…

  5. "Ajaloo lõpp" on lähedal / Francis Fukuyama ; interv. Adam Piore

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2003-01-01

    Ajakirjas Newsweek ilmunud intervjuus vastab filosoof Francis Fukuyama küsimustele 2004. aasta kõige olulisemate probleemide, EL-i, Cancunis toimunud Maailma Kaubandusorganisatsiooni kõneluste, ajaloo lõppu jõudmise, Pakistani presidendile tehtud atentaadi kohta

  6. Francis Farley presenting his novel "Catalysed Fusion" in the CERN Library

    CERN Multimedia

    Farley, Irina

    2013-01-01

    "Catalysed Fusion" is described by its author Francis Farley, 92, as a "true-to-life fantasy woven around particle physics" set in 1980s Geneva – "the city where nations meet and particles collide". Farley presented the book in the program "Literature in Focus" on Tuesday 16th April 2013.

  7. Power Swing Generated in Francis Turbines by Part Load and Overload Instabilities

    Directory of Open Access Journals (Sweden)

    David Valentín

    2017-12-01

    Full Text Available Hydropower plays a key role in the actual energy market due to its fast response and regulation capacity. In that way, hydraulic turbines are increasingly demanded to work at off-design conditions, where complex flow patterns and cavitation appear, especially in Francis turbines. The draft tube cavitation surge is a hydraulic phenomenon that appears in Francis turbines below and above its Best Efficiency Point (BEP. It is a low frequency phenomenon consisting of a vortex rope in the runner outlet and draft tube, which can become unstable when its frequency coincides with a natural frequency of the hydraulic circuit. At this situation, the output power can significantly swing, endangering the electrical grid stability. This study is focused on the detection of these instabilities in Francis turbines and their relationship with the output power swings. To do so, extensive experimental tests for different operating conditions have been carried out in a large prototype Francis turbine (444 MW of rated power within the frame of the European Project Hyperbole (FP7-ENERGY-2013-1. Several sensors have been installed in the hydraulic circuit (pressure sensors in the draft tube, spiral casing, and penstock, in the rotating and static structures (vibration sensors, proximity probes, and strain gauges in the runner and in the shaft, as well as in the electrical side (output power, intensity, and voltage. Moreover, a numerical Finite Element Method (FEM has been also used to relate the hydraulic excitation with the output power swing.

  8. Ionization of atoms by strong infrared fields: Solution of the time-dependent Schroedinger equation in momentum space for a model based on separable potentials

    Energy Technology Data Exchange (ETDEWEB)

    Tetchou Nganso, Hugues [Universite Catholique de Louvain (Belgium); University of Douala (Cameroon); Popov, Yuri [Moscow State University (Russian Federation); Piraux, Bernard [Universite Catholique de Louvain (Belgium); Madronero, Javier [Technische Universitaet Muenchen (Germany); Kwato Njock, Moise Godfroy [University of Douala (Cameroon)

    2011-07-01

    We consider the ionization of atomic hydrogen by a strong infrared field. By starting from the corresponding time-dependent Schroedinger equation in momentum space, we develop a model in which the kernel of the non-local Coulomb potential is replaced by a finite sum of separable potentials. Each separable potential supports one bound state of atomic hydrogen. Here, we consider only the 1s, 2s and 2p states. In this way, the full 3-dimensional Schroedinger equation reduces to a system of a few coupled 1-dimensional linear Volterra integral equations. This model is a theoretical tool to understand the actual role of the atomic potential in the intensity regime where tunnel ionization is supposed to take place and where the experimental data for the first ATI peaks are in contradiction with the theoretical predictions based on the strong field approximation model.

  9. Cardiovascular Risk in Rheumatoid Arthritis Patients, Diagnosis and Treatment: a report of the FRANCIS

    OpenAIRE

    Van Breukelen-van der Stoep, Deborah

    2017-01-01

    markdownabstractAll the research in this thesis is based on the Franciscus Rheumatoid Arthritis aNd Cardiovascular Intervention Study (FRANCIS), an open label randomized clinical trial. The main focus of this thesis is on the role of traditional CVD risk factors on CVD in RA; their prevalence, their association with subclinical atherosclerosis and whether a tight treatment protocol on CVD risk factors results in improved treatment of traditional CVD risk factors. We investigated the prevalenc...

  10. What Ever happened to Francis Glisson? Albrecht Haller and the Fate of Eighteenth-Century Irritability

    OpenAIRE

    Giglioni, Guido

    2008-01-01

    This article investigates the reasons behind the disappearance of Francis Glisson’s theory of irritability during the eighteenth century. At a time when natural investigations were becoming increasingly polarized between mind and matter in the attempt to save both man’s consciousness and the inert nature of the res extensa, Glisson’s notion of a natural perception embedded in matter did not satisfy the new science’s basic injunction not to superimpose perceptions and appetites on nature. Know...

  11. Hydroacoustic simulation of rotor-stator interaction in resonance conditions in Francis pump-turbine

    Energy Technology Data Exchange (ETDEWEB)

    Nicolet, C [Power Vision Engineering sarl, Ch. des Champs-Courbes 1, CH-1024 Ecublens (Switzerland); Ruchonnet, N; Alligne, S; Avellan, F [EPFL Laboratory for Hydraulic Machines, Av. de Cour 33bis, CH-1007 Lausanne (Switzerland); Koutnik, J, E-mail: christophe.nicolet@powervision-eng.c [Voith Hydro Holding GmbH and Co. KG, Alexanderstr. 11, 89522 Heidenheim (Germany)

    2010-08-15

    Combined effect of rotating pressure field related to runner blade and wakes of wicket gates leads to rotor stator interactions, RSI, in Francis pump-turbines. These interactions induce pressures waves propagating in the entire hydraulic machine. Superposition of those pressure waves may result in standing wave in the spiral casing and rotating diametrical mode in the guide vanes and can cause strong pressure fluctuations and vibrations. This paper presents the modeling, simulation and analysis of Rotor-Stator Interaction of a scale model of a Francis pump-turbine and related test rig using a one-dimensional approach. The hydroacoustic modeling of the Francis pump-turbine takes into account the spiral casing, the 20 guide vanes, the 9 rotating runner vanes. The connection between stationary and rotating parts is ensured by a valve network driven according to the unsteady flow distribution between guide vanes and runner vanes. Time domain simulations are performed for 2 different runner rotational speeds in turbine mode. The simulation results are analyzed in frequency domain and highlights hydroacoustic resonance between RSI excitations and the spiral case. Rotating diametrical mode in the vaneless gap and standing wave in the spiral case are identified. The influence of the resonance on phase and amplitude of pressure fluctuations obtained for both the spiral case and the vaneless gap is analyzed. The mode shape and frequencies are confirmed using eigenvalues analysis.

  12. Numerical study on unidirectional fluid–solid coupling of Francis turbine runner

    Directory of Open Access Journals (Sweden)

    Kan Kan

    2015-03-01

    Full Text Available To analyze the fluid–solid coupling stress characteristics of the Francis turbine runner comprehensively, based on the Reynolds-averaged Navier–Stokes equations and shear stress transport k-ω turbulence model, this article performs numerical simulation of three-dimensional steady incompressible turbulent flow through the whole passage of a certain large Francis turbine under multiple operating conditions with Computational Fluid Dynamic software CFX and contrasts the result with that model test conversion. With the help of ANSYS workbench platform, equivalent stress, deformation distribution, and variation of the runner under multiple operating conditions are obtained through loading the water pressure on the runner blade as structural plane load to blades by the method of unidirectional fluid–solid coupling. The results show that under small flow operating conditions, flow patterns in the runner are disordered, the stress on the blade distributes unevenly, and the maximum stress lies on the influent side of the blades connected to the band; as the flow increases, the stress appears intensively around the effluent side of the blades connected to the runner crown. The maximum deformation first decreases and then increases as the flow increases. The deformation area expands from the middle effluent side of blades to the band. The results can be found in the researches on the structure design and the safety and stability of the Francis turbine runner.

  13. Mystic of St. Seraphim of Sarov and St. Francis of Assisi

    Directory of Open Access Journals (Sweden)

    Mirosław Białous

    2015-11-01

    Full Text Available This paper presents figures of St. Seraphim and St. Francis, comparing their mystic. Both saints are regarded as typical representatives of his age and his milieu: St. Seraphim – of the Eastern Orthodox Christian mystic, St. Francis – of the Christian West, the Roman Catholic mysticism. Similar was their life of poverty, similar the joy of life and the attitude towards nature, similar the ecclesial and sacramental dimension of their spirituality. But there were differences. St. Francis’ mystic is more associated with the sphere of emotional and material world, with the earthly reality. And St. Seraphim is a faithful follower of the monastic tradition of Mount Sinai, of Athos and of the other representatives of hesychasm who remaining in the earthly body experienced the spiritual liberation. These differences are visible, if we compare the experience of Christ by Seraphim on Great Thursday and the vision of St Francis on the mountain of Alvernia.

  14. Dos obras del escultor neoclásico inglés John Francis (1780- 1861 en una colección particular española

    Directory of Open Access Journals (Sweden)

    Quintanilla Martínez, Emilio

    2012-09-01

    Full Text Available Two previously unknown works by the British neoclassical sculptor John Francis dating from the second quarter of the 19th century, representing the 1st Duke of Sutherland and, most likely, the sculptor Sir John Francis, have been located in a Spanish private collection.

    Dos obras, hasta ahora inéditas, del escultor neoclásico inglés John Francis del segundo cuarto del siglo XIX, y que representan al primer duque de Sutherland y seguramente al escultor Sir John Francis, en colección privada española.

  15. A Song in the Dark. Francis of Assisi’s Canticle of Brother Sun

    Directory of Open Access Journals (Sweden)

    Speelman Willem Marie

    2016-10-01

    Full Text Available The Canticle of the Creatures or Canticle of Brother Sun is based on a particular way of perceiving reality. Francis, who had turned away from ‘the world’, discovered a different way of looking at it. This is a divine way of perceiving, in which the senses do not grasp reality, but accept it as it communicates itself. This way of perceiving is only possible if one does not attempt to master the environment, but allows one’s senses to be weak. It is significant, therefore, that this song of praise was born at a moment of the utmost despair and weakness. The song’s content is in line with this weak perception: it is not about Francis who praises God and (or for His creatures, but rather it is a testimony that the creatures-the elements-are already praising God, and a prayer that He should let Himself be praised by the creatures. Also in line with this weak perception is the fact that the creatures are praised just as they communicate themselves to Francis: as bodies. The theology of this song is that the creatures through their bodies resonate (strengthen, and colour the blessings that come from God, thereby making His blessing present here on earth. Francis’ role is to give a voice and a language to the heavenly praises as they resound in his environment. The transformative power of this song is that we, whether consciously or not, do the same thing when we participate in this song.

  16. Francis Bacon's Valerius Terminus and the Voyage to the "Great Instauration".

    Science.gov (United States)

    Serjeantson, Richard

    2017-01-01

    Francis Bacon's earliest surviving natural philosophical treatise (composed circa 1603) bears the title Valerius Terminus of the Interpretation of Nature. This study, resting on fresh attention to the surviving authorial manuscript, has three goals. It begins by identifying a lost precursor work apparently entitled "Of Active Knowledge." It then examines the significance of the pseudonyms Bacon chose to introduce his ideas, considering especially his invocation of Erasmus's emblem, the Roman deity Terminus. Finally, it shows how the Valerius Terminus's global vision of contemporary knowledge ultimately helped shape the iconography of Bacon's published Instauratio magna.

  17. The Rule of Three for Prizes in Science and the Bold Triptychs of Francis Bacon.

    Science.gov (United States)

    Goldstein, Joseph L

    2016-09-22

    For many scientific awards, such as Nobels and Laskers, the maximum number of recipients is three. This Rule of Three forces selection committees to make difficult decisions that increase the likelihood of singling out those individuals who open a new field and continue to lead it. The Rule of Three is reminiscent of art's three-panel triptych, a form that the modern master Francis Bacon used to distill complex stories in a bold way. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Numerically exact dynamics of the interacting many-body Schroedinger equation for Bose-Einstein condensates. Comparison to Bose-Hubbard and Gross-Pitaevskii theory

    Energy Technology Data Exchange (ETDEWEB)

    Sakmann, Kaspar

    2010-07-21

    In this thesis, the physics of trapped, interacting Bose-Einstein condensates is analyzed by solving the many-body Schroedinger equation. Particular emphasis is put on coherence, fragmentation and reduced density matrices. First, the ground state of a trapped Bose-Einstein condensate and its correlation functions are obtained. Then the dynamics of a bosonic Josephson junction is investigated by solving the time-dependent many-body Schroedinger equation numerically exactly. These are the first exact results in literature in this context. It is shown that the standard approximations of the field, Gross-Pitaevskii theory and the Bose-Hubbard model fail at weak interaction strength and within their range of expected validity. For stronger interactions the dynamics becomes strongly correlated and a new equilibration phenomenon is discovered. By comparison with exact results it is shown that a symmetry of the Bose- Hubbard model between attractive and repulsive interactions must be considered an artefact of the model. A conceptual innovation of this thesis are time-dependent Wannier functions. Equations of motion for time-dependent Wannier functions are derived from the variational principle. By comparison with exact results it is shown that lattice models can be greatly improved at little computational cost by letting the Wannier functions of a lattice model become time-dependent. (orig.)

  19. The Schroedinger-Poisson equations as the large-N limit of the Newtonian N-body system. Applications to the large scale dark matter dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Briscese, Fabio [Northumbria University, Department of Mathematics, Physics and Electrical Engineering, Newcastle upon Tyne (United Kingdom); Citta Universitaria, Istituto Nazionale di Alta Matematica Francesco Severi, Gruppo Nazionale di Fisica Matematica, Rome (Italy)

    2017-09-15

    In this paper it is argued how the dynamics of the classical Newtonian N-body system can be described in terms of the Schroedinger-Poisson equations in the large N limit. This result is based on the stochastic quantization introduced by Nelson, and on the Calogero conjecture. According to the Calogero conjecture, the emerging effective Planck constant is computed in terms of the parameters of the N-body system as ℎ ∝ M{sup 5/3}G{sup 1/2}(N/ left angle ρ right angle){sup 1/6}, where is G the gravitational constant, N and M are the number and the mass of the bodies, and left angle ρ right angle is their average density. The relevance of this result in the context of large scale structure formation is discussed. In particular, this finding gives a further argument in support of the validity of the Schroedinger method as numerical double of the N-body simulations of dark matter dynamics at large cosmological scales. (orig.)

  20. Symbolic derivation of high-order Rayleigh-Schroedinger perturbation energies using computer algebra: Application to vibrational-rotational analysis of diatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, John M. [Kansas State Univ., Manhattan, KS (United States). Dept. of Chemistry

    1997-01-01

    Rayleigh-Schroedinger perturbation theory is an effective and popular tool for describing low-lying vibrational and rotational states of molecules. This method, in conjunction with ab initio techniques for computation of electronic potential energy surfaces, can be used to calculate first-principles molecular vibrational-rotational energies to successive orders of approximation. Because of mathematical complexities, however, such perturbation calculations are rarely extended beyond the second order of approximation, although recent work by Herbert has provided a formula for the nth-order energy correction. This report extends that work and furnishes the remaining theoretical details (including a general formula for the Rayleigh-Schroedinger expansion coefficients) necessary for calculation of energy corrections to arbitrary order. The commercial computer algebra software Mathematica is employed to perform the prohibitively tedious symbolic manipulations necessary for derivation of generalized energy formulae in terms of universal constants, molecular constants, and quantum numbers. As a pedagogical example, a Hamiltonian operator tailored specifically to diatomic molecules is derived, and the perturbation formulae obtained from this Hamiltonian are evaluated for a number of such molecules. This work provides a foundation for future analyses of polyatomic molecules, since it demonstrates that arbitrary-order perturbation theory can successfully be applied with the aid of commercially available computer algebra software.

  1. Prediction Method for the Complete Characteristic Curves of a Francis Pump-Turbine

    Directory of Open Access Journals (Sweden)

    Wei Huang

    2018-02-01

    Full Text Available Complete characteristic curves of a pump-turbine are essential for simulating the hydraulic transients and designing pumped storage power plants but are often unavailable in the preliminary design stage. To solve this issue, a prediction method for the complete characteristics of a Francis pump-turbine was proposed. First, based on Euler equations and the velocity triangles at the runners, a mathematical model describing the complete characteristics of a Francis pump-turbine was derived. According to multiple sets of measured complete characteristic curves, explicit expressions for the characteristic parameters of characteristic operating point sets (COPs, as functions of a specific speed and guide vane opening, were then developed to determine the undetermined coefficients in the mathematical model. Ultimately, by combining the mathematical model with the regression analysis of COPs, the complete characteristic curves for an arbitrary specific speed were predicted. Moreover, a case study shows that the predicted characteristic curves are in good agreement with the measured data. The results obtained by 1D numerical simulation of the hydraulic transient process using the predicted characteristics deviate little from the measured characteristics. This method is effective and sufficient for a priori simulations before obtaining the measured characteristics and provides important support for the preliminary design of pumped storage power plants.

  2. Prediction of Francis Turbine Prototype Part Load Pressure and Output Power Fluctuations with Hydroelectric Model

    Science.gov (United States)

    Alligné, S.; Nicolet, C.; Béguin, A.; Landry, C.; Gomes, J.; Avellan, F.

    2017-04-01

    The prediction of pressure and output power fluctuations amplitudes on Francis turbine prototype is a challenge for hydro-equipment industry since it is subjected to guarantees to ensure smooth and reliable operation of the hydro units. The European FP7 research project Hyperbole aims to setup a methodology to transpose the pressure fluctuations induced by the cavitation vortex rope from the reduced scale model to the prototype generating units. A Francis turbine unit of 444MW with a specific speed value of ν = 0.29, is considered as case study. A SIMSEN model of the power station including electrical system, controllers, rotating train and hydraulic system with transposed draft tube excitation sources is setup. Based on this model, a frequency analysis of the hydroelectric system is performed for all technologies to analyse potential interactions between hydraulic excitation sources and electrical components. Three technologies have been compared: the classical fixed speed configuration with Synchronous Machine (SM) and the two variable speed technologies which are Doubly Fed Induction Machine (DFIM) and Full Size Frequency Converter (FSFC).

  3. Francis Bacon's natural history and the Senecan natural histories of early modern Europe.

    Science.gov (United States)

    Jalobeanu, Dana

    2012-01-01

    At various stages in his career, Francis Bacon claimed to have reformed and changed traditional natural history in such a way that his new "natural and experimental history" was unlike any of its ancient or humanist predecessors. Surprisingly, such claims have gone largely unquestioned in Baconian scholarship. Contextual readings of Bacon's natural history have compared it, so far, only with Plinian or humanist natural history. This paper investigates a different form of natural history, very popular among Bacon's contemporaries, but yet unexplored by contemporary students of Bacon's works. I have provisionally called this form of natural history'Senecan' natural history, partly because it took shape in the Neo-Stoic revival of the sixteenth-century, partly because it originates in a particular cosmographical reading of Seneca's Naturales quaestiones. I discuss in this paper two examples of Senecan natural history: the encyclopedic and cosmographical projects of Pierre de la Primaudaye (1546-1619) and Samuel Purchas (1577-1626). I highlight a number of similarities between these two projects and Francis Bacon's natural history, and argue that Senecan natural history forms an important aspect in the historical and philosophical background that needs to be taken into consideration if we want to understand the extent to which Bacon's project to reform natural history can be said to be new.

  4. Dynamic stresses in a Francis model turbine at deep part load

    Science.gov (United States)

    Weber, Wilhelm; von Locquenghien, Florian; Conrad, Philipp; Koutnik, Jiri

    2017-04-01

    A comparison between numerically obtained dynamic stresses in a Francis model turbine at deep part load with experimental ones is presented. Due to the change in the electrical power mix to more content of new renewable energy sources, Francis turbines are forced to operate at deep part load in order to compensate stochastic nature of wind and solar power and to ensure grid stability. For the extension of the operating range towards deep part load improved understanding of the harsh flow conditions and their impact on material fatigue of hydraulic components is required in order to ensure long life time of the power unit. In this paper pressure loads on a model turbine runner from unsteady two-phase computational fluid dynamics simulation at deep part load are used for calculation of mechanical stresses by finite element analysis. Therewith, stress distribution over time is determined. Since only few runner rotations are simulated due to enormous numerical cost, more effort has to be spent to evaluation procedure in order to obtain objective results. By comparing the numerical results with measured strains accuracy of the whole simulation procedure is verified.

  5. 3D unsteady turbulent simulations of transients of the Francis turbine

    Science.gov (United States)

    Li, J.; Yu, J.; Wu, Y.

    2010-08-01

    3D unsteady turbulent simulations of runaway and load-rejection transients of the Francis turbine with RNG k- epsilon turbulence model are presented in this paper. Sliding mesh method is applied to the runner for both transients in order to obtain a time-accurate solution of the rotor-stator interaction, and dynamic mesh method is used to simulate guide vane closing for the load rejection transient. For the runaway transient, comparisons about unit discharge and unit speed are carried out between numerical predictions and experimental data when the Francis turbine arrives at the runaway situation, showing that the relative error of each parameter is in the range of ±5% and that the simulation method has good accuracy. As to the load-rejection transient, comparisons are made about rotational speed, pressure fluctuations at the spiral casing inlet and upstream of the tube cone between numerical predictions and measurement data, indicating that both rotational speed and pressure fluctuations at upstream of the tube cone are well predicted, yet there is some difference on pressure fluctuations at the spiral casing inlet. As a whole, the numerical method in this paper can predict both transients well, although some improvements should be made for further research.

  6. On the performance of a high head Francis turbine at design and off-design conditions

    Science.gov (United States)

    Aakti, B.; Amstutz, O.; Casartelli, E.; Romanelli, G.; Mangani, L.

    2015-01-01

    In the present paper, fully 360 degrees transient and steady-state simulations of a Francis turbine were performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL), using different numerical approaches for the pressure-velocity coupling. The simulation domain includes the spiral casing with stay and guide vanes, the runner and the draft tube. The main target of the investigations is the numerical prediction of the overall performance of the high head Francis turbine model as well as local and integral quantities of the complete machine in different operating conditions. All results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with a new in-house, 3D, unstructured, object-oriented finite volume code within the framework of the open source OpenFOAM library. The novel fully coupled pressure-based solver is designed to solve the incompressible RANS- Equations and is capable of handling multiple references of frame (MRF). The obtained results show that the overall performance is well captured by the simulations. Regarding the local flow distributions within the inlet section of the draft-tube, the axial velocity is better estimated than the circumferential component.

  7. Velocity and pressure measurements in guide vane clearance gap of a low specific speed Francis turbine

    Science.gov (United States)

    Thapa, B. S.; Dahlhaug, O. G.; Thapa, B.

    2016-11-01

    In Francis turbine, a small clearance gap between the guide vanes and the cover plates is usually required to pivot guide vanes as a part of governing system. Deflection of cover plates and erosion of mating surfaces causes this gap to increase from its design value. The clearance gap induces the secondary flow in the distributor system. This effects the main flow at the runner inlet, which causes losses in efficiency and instability. A guide vane cascade of a low specific speed Francis turbine has been developed for experimental investigations. The test setup is able to produce similar velocity distributions at the runner inlet as that of a reference prototype turbine. The setup is designed for particle image velocimetry (PIV) measurements from the position of stay vane outlet to the position of runner inlet. In this study, velocity and pressure measurements are conducted with 2 mm clearance gap on one side of guide vane. Leakage flow is observed and measured together with pressure measurements. It is concluded that the leakage flow behaves as a jet and mixes with the main flow in cross-wise direction and forms a vortex filament. This causes non-uniform inlet flow conditions at runner blades.

  8. A highly efficient Francis turbine designed for energy recovery in cooling towers

    Directory of Open Access Journals (Sweden)

    Daqing Zhou

    2015-03-01

    Full Text Available In China, cooling water entering cooling towers still retains surplus pressure between 39,240 and 147,150 Pa. In order to utilize this wasted energy, it is suggested that the surplus water energy can be harnessed to drive a type of hydroturbine installed in the inner platform of cooling tower and make the fan rotate via its coupled shafts. However, conventional hydroturbines are not suited for this job because of their low efficiency or unmatched rotating speed with that of the fan under the operating conditions of cooling towers. In this article, according to the requirements of turbine work environment in cooling towers, a new type of hydroturbine, Francis turbine with ultra-low specific speed (ns  = 50 m.kW, was designed to replace the fan motor in a cooling tower. Primarily, the shape, position, and number of runner blades were designed and optimized through theoretical analyses and computational fluid dynamics simulations. Additionally, metal elliptical volute and single-row ring guide vanes were applied to scale down the structural dimensions. Finally, the optimal scheme of the new Francis turbine was proven to have a high efficiency of 88% and good operation stability through testing of a physical model and can achieve the goal of harvesting renewable energy in the cooling tower.

  9. On Fair Lotteries

    OpenAIRE

    Stone, Peter

    2008-01-01

    PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

  10. Aesthetic of the subversion and the violence in Francis Bacon and Frida Kahlo’s WorKs of Art

    Directory of Open Access Journals (Sweden)

    Catarina Pinheiro

    2014-06-01

    Full Text Available Having Frida Kahlo and Francis Bacon ́s work as a starting point, the authors discuss the dimensions of violence and trauma present in their creative forms and on the impact produced on the spectator. They also reflect on its connections with the clinic on the impact/countertransference phenomenon and its transformational possibilities.

  11. The Ouachita and Ozark- St. Francis National Forests: A History of the Lands and USDA Forest Service Tenure

    Science.gov (United States)

    Stephen Strausberg; Walter A. Hough

    1997-01-01

    A brief history of the Ouachita and Ozark-St. Francis National Forests shows that many factors influenced the land, vegetation, wildlife, and other resources that have beenunder USDA Forest Serviceadministration for almost 90 years. This history indicates that laws, acts, and regulations not only created the national forests in Arkansas and Oklahoma but continue to...

  12. The Southern Society for Philosophy and Psychology and Francis Cecil Sumner.

    Science.gov (United States)

    Thomas, Roger K

    2011-01-01

    In 1939, a psychologist could become a member of the Southern Society for Philosophy and Psychology (SSPP) automatically with the endorsement of two members, payment of dues, and membership in the American Psychological Association (APA). Non-APA members with endorsements and payment of dues had to be voted in by the membership. In 1940, the rules for admission were changed to eliminate the automatic membership for APA members. Francis Cecil Sumner, the first African American PhD in psychology, qualified for SSPP membership as a member of the APA in 1939, but the SSPP's council delayed his membership and introduced the amendment to its constitution that eliminated Sumner's route to membership. This article examines the circumstances surrounding council's actions and the role that Sumner's application for membership played in it as an example of the role that race and discrimination played in the decision to change the route to SSPP membership for members of the APA.

  13. Adam Smith e Francis Ysidro Edgeworth: uma crítica do utilitarismo

    Directory of Open Access Journals (Sweden)

    Solange Regina Marin

    2012-01-01

    Full Text Available Sugerimos, nesse trabalho, a investigação das concepções de Adam Smith e a de Francis Ysidro Edgeworth do utilitarismo. Ambas as concepções foram utilizadas para desenvolver a Ciência Econômica. Porém, também apresentaram as limitações da teoria econômica, cujas fronteiras vislumbradas pelos autores remetem para a necessidade de avaliar as ações e condutas humanas com teoria moral diferente do utilitarismo. Entendemos que a teoria moral de Adam Smith, esquecida pela história do pensamento econômico, se apresenta como alternativa e, em decorrência, uma ideia promissora para aperfeiçoar o estudo das ações e condutas ditas econômicas.

  14. The Welcoming Pope: Images of Pope Francis in the Catholicism under mediatization

    Directory of Open Access Journals (Sweden)

    Tatiane MILANI

    2017-12-01

    Full Text Available In the context of the society in mediatization more and more the social fields are inserted in an ambiance in which borders are constantly tensioned, meaning that social practices are crossed by the logic of other fields, rather than their own place of knowing. It is perceived that the social/political/religious conjuncture interpenetrates with the logic of mediatization, and this phenomenon arouses transformations in all Christianity. The objective of this work is to analyze the circulation of Pope Francis' images in the media which formulate, in the collective imaginary, a mediated totem image of the Pope of embrace or of the welcoming Pope, what adheres to the new media technologies.

  15. Unsteady hydraulic simulation of the cavitating part load vortex rope in Francis turbines

    Science.gov (United States)

    Brammer, J.; Segoufin, C.; Duparchy, F.; Lowys, P. Y.; Favrel, A.; Avellan, F.

    2017-04-01

    For Francis turbines at part load operation a helical vortex rope is formed due to the swirling nature of the flow exiting the runner. This vortex creates pressure fluctuations which can lead to power swings, and the unsteady loading can lead to fatigue damage of the runner. In the case that the vortex rope cavitates there is the additional risk that hydro-acoustic resonance can occur. It is therefore important to be able to accurately simulate this phenomenon to address these issues. In this paper an unsteady, multi-phase CFD model was used to simulate two part-load operating points, for two different cavitation conditions. The simulation results were validated with test-rig data, and showed very good agreement. These results also served as an input for FEA calculations and fatigue analysis, which are presented in a separate study.

  16. Transposition of Francis turbine cavitation compliance at partial load to different operating conditions

    Science.gov (United States)

    Gomes, J.; Favrel, A.; Landry, C.; Nicolet, C.; Avellan, F.

    2017-04-01

    Francis turbines operating in part load conditions experience a swirling flow at the runner outlet leading to the development of a precessing cavitation vortex rope in the draft tube. This cavitation vortex rope changes drastically the velocity of pressure waves traveling in the draft tube and may lead to resonance conditions in the hydraulic circuit. The wave speed being strongly related to the cavitation compliance, this research work presents a simple model to explain how it is affected by variations of operating conditions and proposes a method to transpose its values. Even though the focus of this paper is on transpositions within the same turbine scale, the methodology is also expected to be tested for the model to prototype transposition in the future. Comparisons between measurements and calculations are in good agreement.

  17. Scanning-PIXE analysis of gold lace embroideries in a relic of St. Francis

    Energy Technology Data Exchange (ETDEWEB)

    Migliori, A. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Firenze, Via G. Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy)], E-mail: migliori@fi.infn.it; Grassi, N.; Mando, P.A. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Firenze, Via G. Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy)

    2008-05-15

    In this work, we describe the compositional analysis performed by scanning-mode PIXE on the metal threads of a XIII century embroidery. The precious work analysed is the pillow-case used to cover the pillow, on which - according to tradition - St. Francis of Assisi was resting his head when he died. Measurements were performed in order to characterise the embroideries of the two sides and the passementerie in the lateral hems. Several areas, each of the order of two square millimetres, were scanned with a 3 MeV proton external beam of 20 {mu}m size on target, using the external micro-beam facility of our laboratory, with list-mode acquisition. Analysis of elemental maps and spectra from selected homogeneous sub-areas allowed us to extract the quantitative composition of the gilded tape and estimates of its thickness.

  18. Images of trauma: pain, recognition, and disavowal in the works of Frida Kahlo and Francis Bacon.

    Science.gov (United States)

    Bose, Joerg

    2005-01-01

    The role of art in the encounter with trauma and destructiveness is comparatively studied in the works of Frida Kahlo and Francis Bacon as examples of a direct and a more indirect way of dealing with such experiences. A creative product may function intrapsychically as a kind of messenger between dissociated self-states and consciousness, and it may also serve as a witnessing presence in a self-supporting and self-constituting way. Artistic work may thus be used by the artist for an expressive as well as for a protective purpose, as a means of sympathetic participation in painful experience, or as a medium for a view from the outside. The act itself of finding and of making expressive forms at the time of traumatic experience is a remarkable assertion of the human capability to synthesize and to counteract fragmenting dissociative processes.

  19. Special article: Francis Hoeffer McMechan, MD: creator of modern anesthesiology?

    Science.gov (United States)

    Bacon, Douglas R

    2012-12-01

    If one person can be credited with the creation of the infrastructure of modern anesthesiology, that individual would be Francis Hoeffer McMechan. He has been largely forgotten since his death in 1939 despite his remarkable and enduring accomplishments. McMechan edited the first national journal devoted to anesthesiology, created and managed almost all of the national and regional societies devoted to the specialty between 1912 and his death, and created the first international physician certification as a specialist in anesthesiology. His accomplishments are even more amazing given the severe arthritis that left him wheelchair-bound for almost his entire professional life and denied him the ability to practice anesthesia. Our specialty owes an incredible debt to this largely unknown and unsung hero.

  20. Francis Bacon's concept of objectivity and the idols of the mind.

    Science.gov (United States)

    Zagorin, P

    2001-12-01

    This paper examines the concept of objectivity traceable in Francis Bacon's natural philosophy. After some historical background on this concept, it considers the question of whether it is not an anachronism to attribute such a concept to Bacon, since the word 'objectivity' is a later coinage and does not appear anywhere in his writings. The essay gives reasons for answering this question in the negative, and then criticizes the accounts given of Bacon's understanding of objectivity by Lorraine Daston and Julie Robin Solomon. It argues that this understanding is most directly and fully expressed in his discussion of the idols of the mind. In this connection, the paper notes Bacon's critical attitude to sixteenth-century scepticism and its relevance to the idea of objectivity implicit in his comments on the idols. In conclusion, the paper argues that Bacon was not a pure empiricist and describes the place assigned to theories and hypotheses in his natural philosophy.

  1. Numerical investigation of flow structure and pressure pulsation in the Francis-99 turbine during startup

    Science.gov (United States)

    Minakov, A.; Sentyabov, A.; Platonov, D.

    2017-01-01

    We performed numerical simulation of flow in a laboratory model of a Francis hydroturbine at startup regimes. Numerical technique for calculating of low frequency pressure pulsations in a water turbine is based on the use of DES (k-ω Shear Stress Transport) turbulence model and the approach of “frozen rotor”. The structure of the flow behind the runner of turbine was analysed. Shows the effect of flow structure on the frequency and intensity of non-stationary processes in the flow path. Two version of the inlet boundary conditions were considered. The first one corresponded measured time dependence of the discharge. Comparison of the calculation results with the experimental data shows the considerable delay of the discharge in this calculation. Second version corresponded linear approximation of time dependence of the discharge. This calculation shows good agreement with experimental results.

  2. Francis Turbine Blade Design on the Basis of Port Area and Loss Analysis

    Directory of Open Access Journals (Sweden)

    Zhenmu Chen

    2016-03-01

    Full Text Available In this study, a Francis turbine with specific speed of 130 m-kW was designed on the basis of the port area and loss analysis. The meridional shape of the runner was designed focusing mainly on the combination of the guide vane loss analysis and experience. The runner blade inlet and outlet angles were designed by calculation of Euler’s head, while the port area of blade was modified by keeping constant angles of the blade at inlet and outlet. The results show that the effect of the port area of runner blade on the flow exit angle from runner passage is significant. A correct flow exit angle reduces the energy loss at the draft tube, thereby improving the efficiency of the turbine. The best efficiency of 92.6% is achieved by this method, which is also similar to the design conditions by the one dimension loss analysis.

  3. Classics in psychiatry and the law: Francis Wharton on involuntary confessions.

    Science.gov (United States)

    Weiss, Kenneth J

    2012-01-01

    Philadelphia attorney Francis Wharton was a key intellectual figure in linking the sciences of medicine and law. In 1860, he published a monograph on involuntary confessions, which represented the closing chapter of Wharton and Stillé's Treatise on Medical Jurisprudence. He had already published A Monograph on Mental Unsoundness in 1855, the first book of the Treatise in its first edition. Wharton was convinced that many criminals had an inner compulsion to confess or to be caught, explained as divine jurisprudence. His remarks on confessions include a typology spanning psychodynamics to police tactics, using contemporaneous, historical, and literary examples. This remarkable document provides insight into the dynamics of unintended and involuntary confessions and is compatible, in part, with current scholarship. The author contrasts Wharton's schema with those of his English predecessor Jeremy Bentham, the psychoanalyst Theodore Reik, and others, and concludes that it represents an important transition toward a psychological approach to the criminology of confessions.

  4. Modelling and Internal Fuzzy Model Power Control of a Francis Water Turbine

    Directory of Open Access Journals (Sweden)

    Klemen Nagode

    2014-02-01

    Full Text Available This paper presents dynamic modelling of a Francis turbine with a surge tank and the control of a hydro power plant (HPP. Non-linear and linear models include technical parameters and show high similarity to measurement data. Turbine power control with an internal model control (IMC is proposed, based on a turbine fuzzy model. Considering appropriate control responses in the entire area of turbine power, the model parameters of the process are determined from a fuzzy model, which are further included in the internal model controller. The results are compared to a proportional-integral (PI controller tuned with an integral absolute error (IAE objective function, and show an improved response of internal model control.

  5. Experimental and numerical analysis of pressure pulses characteristics in a Francis turbine with partial load

    Energy Technology Data Exchange (ETDEWEB)

    Yexiang, X; Zhengwei, W; Zongguo, Y; Jin, Z, E-mail: xiaoyex@mail.tsinghua.edu.c [State Key Laboratory of Hydroscience and Engineering and Department of Thermal Engineering, Tsinghua University Beijing, 100084 (China)

    2010-08-15

    This study experimentally and numerically investigates the pressure pulses characteristics and unsteady flow behavior in a Francis turbine with partial load. Unsteady wall pressure measurements with partial load condition are performs to investigate thoroughly pressure fields in the spiral case, runner head cover and straight draft tube dynamically. The unsteady Reynolds- averaged Navier-Stokes equations with the k-{omega}based SST turbulence model were used to model the unsteady flow within the entire flow passage of the Francis turbine. The dominate frequency of the predicted pressure pulses at runner inlet agree with the experimental results in the head cover. The influence of the blade passing frequency causes the simulated peak-to-peak amplitudes in the runner inlet to be larger than in the head cover. The measured and predicted pressure pulses at different positions along the runner are comparable. The predicted pressure fluctuations in the draft tube agree well with the experimental results. However the peak-to-peak amplitudes in the spiral case are not as well predicted so the calculation domain and the inlet boundary conditions need to be improved. At the most unstable operating condition, the pulse in the flow passage are due to the rotor-stator interference (RSI) between the runner and the guide vanes, the blade channel vortex in the runner blade passage and the vortex rope in the draft tube. The unsteady flow patterns in the turbine, including the blade channel vortex in the runner and the helical vortex rope in the draft tube, are classified numerically.

  6. Experimental and numerical analysis of pressure pulses characteristics in a Francis turbine with partial load

    Science.gov (United States)

    Yexiang, X.; Zhengwei, W.; Zongguo, Y.; Jin, Z.

    2010-08-01

    This study experimentally and numerically investigates the pressure pulses characteristics and unsteady flow behavior in a Francis turbine with partial load. Unsteady wall pressure measurements with partial load condition are performs to investigate thoroughly pressure fields in the spiral case, runner head cover and straight draft tube dynamically. The unsteady Reynolds- averaged Navier-Stokes equations with the k-ωbased SST turbulence model were used to model the unsteady flow within the entire flow passage of the Francis turbine. The dominate frequency of the predicted pressure pulses at runner inlet agree with the experimental results in the head cover. The influence of the blade passing frequency causes the simulated peak-to-peak amplitudes in the runner inlet to be larger than in the head cover. The measured and predicted pressure pulses at different positions along the runner are comparable. The predicted pressure fluctuations in the draft tube agree well with the experimental results. However the peak-to-peak amplitudes in the spiral case are not as well predicted so the calculation domain and the inlet boundary conditions need to be improved. At the most unstable operating condition, the pulse in the flow passage are due to the rotor-stator interference (RSI) between the runner and the guide vanes, the blade channel vortex in the runner blade passage and the vortex rope in the draft tube. The unsteady flow patterns in the turbine, including the blade channel vortex in the runner and the helical vortex rope in the draft tube, are classified numerically.

  7. Evaluation of the PA10 robot`s ability to repair a Francis wheel; Evaluation du robot PA10 pour la reparation d`une roue Francis

    Energy Technology Data Exchange (ETDEWEB)

    Jan, P.

    1996-08-01

    The R and D D has been working in collaboration with EDF`s hydro-electric maintenance workshop for several years now on the robotized repair of turbine wheels. Traditionally, the wheels have been taken out of the power generating stations and repaired in the workshop. However, for certain parts of a critical size which cannot be dismantled, the option of repairing them on-site would be highly advantageous. The new generation of small, light robots is beginning to make its way onto the market, and these could perhaps be used to solve the problem. From these products we decided to study the behaviour of the Mitsubishi PA10 (7 axes, 30 kg) purchased by the R and D D in 1995. The operation chosen to feature in the evaluation was the weld build-up of a Francis-type wheel which required 3 successive stages to be validated. the results are presented in this report: CAD simulation of the operation; developing the welding cell in the laboratory; validation in the workshop. The results of these tests showed that the PA 10 robot is well suited to welding operations although there are a few problems which need to be solved before it can be used industrially which relate to the communication between the power cabinet and the command and control when the ambient temperature rises above a certain level and the poor reliability of the axis zeros. The equipment only took half a day to install in the workshop, and thanks to the simulation and development work carried out beforehand, no jams occurred. These results are encouraging and should enable on-site robotization to develop rapidly. (authors)

  8. Large-distance and long-time asymptotic behavior of the reduced density matrix in the non-linear Schroedinger model

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.K.

    2010-12-15

    Starting from the form factor expansion in finite volume, we derive the multidimensional generalization of the so-called Natte series for the zero-temperature, time and distance dependent reduced density matrix in the non-linear Schroedinger model. This representation allows one to read-off straightforwardly the long-time/large-distance asymptotic behavior of this correlator. Our method of analysis reduces the complexity of the computation of the asymptotic behavior of correlation functions in the so-called interacting integrable models, to the one appearing in free fermion equivalent models. We compute explicitly the first few terms appearing in the asymptotic expansion. Part of these terms stems from excitations lying away from the Fermi boundary, and hence go beyond what can be obtained by using the CFT/Luttinger liquid based predictions. (orig.)

  9. Long-time and large-distance asymptotic behavior of the current-current correlators in the non-linear Schroedinger model

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.K. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Terras, V. [CNRS, ENS Lyon (France). Lab. de Physique

    2010-12-15

    We present a new method allowing us to derive the long-time and large-distance asymptotic behavior of the correlations functions of quantum integrable models from their exact representations. Starting from the form factor expansion of the correlation functions in finite volume, we explain how to reduce the complexity of the computation in the so-called interacting integrable models to the one appearing in free fermion equivalent models. We apply our method to the time-dependent zero-temperature current-current correlation function in the non-linear Schroedinger model and compute the first few terms in its asymptotic expansion. Our result goes beyond the conformal field theory based predictions: in the time-dependent case, other types of excitations than the ones on the Fermi surface contribute to the leading orders of the asymptotics. (orig.)

  10. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  11. On the sloshing free surface in the draft tube cone of a Francis turbine operating in synchronous condenser mode

    Science.gov (United States)

    Vagnoni, E.; Andolfatto, L.; Avellan, F.

    2017-04-01

    Hydropower plants may be required to operate in synchronous condenser mode in order to supply reactive power to the grid for compensating the fluctuations introduced by the intermittent renewable energies such wind and solar. When operating in this mode, the tail water in the Francis turbine or pump-turbine is depressed below the runner by injecting pressurized air in order to spin in air to reduce the power consumption. Many air-water interaction phenomena occur in the machine causing air losses and a consequent power consumption to recover the air lost. In this paper, the experimental investigation of the sloshing motion in the cone of a dewatered Francis turbine performed by image visualization and pressure measurements is presented. The developed image post processing method for identifying the amplitude and frequency of the oscillation of the free surface is described and the results obtained are illustrated and discussed.

  12. Fukuyama : kõigepealt hea valitsus, siis demokraatia ja ajaloo lõpp / Francis Fukuyama ; interv. Nathan Gardels

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2005-01-01

    Francis Fukuyama sõnul vajab riik oma arenguks esmajoones head valitsemist. Kõige olulisem on, et oleks toimiv riik, mis suudab tagada julgeoleku ja majandusarengu elementaarsed tingimused. Iraagi praeguste probleemide põhjus on selles, et USA ei suutnud ette näha, kuidas riik Saddami kukkudes kokku variseb, kuid tuleb mõista, et aeg-ajalt on USA ja kogu maailma huvides kusagil maailma nurgas riigi ehitamine tõsiselt ette võtta, ütleb autor

  13. Numerical analysis of solid–liquidtwo-phase turbulent flow in Francis turbine runner with splitter bladesin sandy water

    Directory of Open Access Journals (Sweden)

    Hua Hong

    2015-03-01

    Full Text Available As the key component of a hydroelectric power generation system, hydraulic turbine plays a decisive role in the overall performance of the system. There are many sandy rivers in the world, and turbines working in these rivers are seriously damaged. Therefore, the research of flow in sandy water has great theoretical significance and practical value. Based on the specific hydrological conditions of a hydropower station, the solid–liquid two-phase flow in the whole flow passage of a Francis turbine with splitter blades in sandy water was numerically studied. A geometric model of the whole flow passage of the Francis turbine was established on the basis of given design parameters. The solid–liquid two-phase turbulent flows in Francis turbine runner under three different loads were numerically analyzed by using this model. The three different loads are as follows: Condition 1: single unit with 1/4 load, Condition 2: single unit with 1/2 load, and Condition 3: single unit with full load. The distributions of pressure and sand concentration on the leading side and the suction side of the runner blades, as well as the velocity vector distribution of water and sand on the horizontal section of the runner, were obtained under different load conditions. Therefore, the damages to various flow passage components by sand can be qualitatively predicated under various conditions. To guarantee the safety and stability of the unit, the adverse conditions shall be avoided, which can provide certain reference for plant operation.

  14. Expected load spectra of prototype Francis turbines in low-load operation using numerical simulations and site measurements

    Science.gov (United States)

    Eichhorn, M.; Taruffi, A.; Bauer, C.

    2017-04-01

    The operators of hydropower plants are forced to extend the existing operating ranges of their hydraulic machines to remain competitive on the energy market due to the rising amount of wind and solar power. Faster response times and a higher flexibility towards part- and low-load conditions enable a better electric grid control and assure therefore an economic operation of the power plant. The occurring disadvantage is a higher dynamic excitation of affected machine components, especially Francis turbine runners, due to pressure pulsations induced by unsteady flow phenomena (e.g. draft tube vortex ropes). Therefore, fatigue analysis becomes more important even in the design phase of the hydraulic machines to evaluate the static and dynamic load in different operating conditions and to reduce maintenance costs. An approach including a one-way coupled fluid-structure interaction has been already developed using unsteady CFD simulations and transient FEM computations. This is now applied on two Francis turbines with different specific speeds and power ranges, to obtain the load spectra of both machines. The results are compared to strain gauge measurements on the according Francis turbines to validate the overall procedure.

  15. Parametric design of a Francis turbine runner by means of a three-dimensional inverse design method

    Energy Technology Data Exchange (ETDEWEB)

    Daneshkah, K [Advanced Design Technology, London WC1E 7JN (United Kingdom); Zangeneh, M, E-mail: k.daneshkhah@adtechnology.co.u [Department of Mechanical Engineering, University College London, London WC1E 7JE (United Kingdom)

    2010-08-15

    The present paper describes the parametric design of a Francis turbine runner. The runner geometry is parameterized by means of a 3D inverse design method, while CFD analyses were performed to assess the hydrodymanic and suction performance of different design configurations that were investigated. An initial runner design was first generated and used as baseline for parametric study. The effects of several design parameter, namely stacking condition and blade loading was then investigated in order to determine their effect on the suction performance. The use of blade parameterization using the inverse method lead to a major advantage for design of Francis turbine runners, as the three-dimensional blade shape is describe by parameters that closely related to the flow field namely blade loading and stacking condition that have a direct impact on the hydrodynamics of the flow field. On the basis of this study, an optimum configuration was designed which results in a cavitation free flow in the runner, while maintaining a high level of hydraulic efficiency. The paper highlights design guidelines for application of inverse design method to Francis turbine runners. The design guidelines have a general validity and can be used for similar design applications since they are based on flow field analyses and on hydrodynamic design parameters.

  16. Investigation on internal flow of draft tube at overload condition in low specific speed Francis turbine

    Science.gov (United States)

    Tamura, Yuta; Tani, Kiyohito

    2016-11-01

    The cavitating vortices causes the unsteady phenomena like the pressure fluctuation, the noise and the vibration in the draft tube at the overload condition which is the far operating point from the design point. Because the full load was normally near the design point, there were few troubles due to cavitating vortices at the full load. Today, however, the design point is sometimes set to lower load to achieve the high efficiency from the partial load to the full load in low specific speed Francis turbines, which have good performance to a change in a discharge. Then, the full load is relatively further from the design point. As the result, the potential for the cavitating vortices at the full load is increased. To control of the unsteady phenomena at the full load, the study focused on the cavitating vortices at the overload condition is important. This paper presents the unsteady behavior of the cavitating vortices at the overload condition with the scaled model of specific speed NQE=0.083. On the experimental approach, the pressure pulsation in the upper draft tube was measured and the unsteady behavior of cavitating vortices was taken movies with a high speed camera. On the numerical approach, Computational Fluid Dynamics (CFD) adopting a two-phase unsteady analysis was carried out. The pressure fluctuation and the velocity distribution of two runners, an original and a newly designed, were compared.

  17. Francis Bacon and the "Interpretation of Nature" in the late Renaissance.

    Science.gov (United States)

    Serjeantson, Richard

    2014-12-01

    The "interpretation of nature" (interpretatio naturae) is the leading idea in Francis Bacon's natural philosophy. But by contrast with his ideas about method, induction, or experiment, the significance of the "interpretation of nature" has received very little scholarly attention. This essay tests the originality of Bacon's idea by means of a focused survey of existing forms of Renaissance natural knowledge-Aristotelian and anti-Aristotelian natural philosophy, Galenic and Paracelsian medicine, natural magic, physiognomy, natural history-before turning to consider the much more prominent place of "interpretation" in the fields of Renaissance logic, revealed and natural theology, and law. It finds that Bacon's application of the idea of "interpretation" to nature was highly original, but also that certain important aspects of his conception have analogies in Renaissance civil law. The essay concludes by exploring the implications of these findings for a recent body of scholarship in the history of the sciences that invokes the notion of the "interpretation of nature" to characterize pre-Baconian natural philosophy more generally.

  18. Predicting the performance of a high head Francis turbine using a fully implicit mixing plane

    Science.gov (United States)

    Amstutz, O.; Aakti, B.; Casartelli, E.; Mangani, L.; Hanimann, L.

    2015-01-01

    In the present paper numerical investigations of a complete high head Francis turbine comprehensive of a spiral casing, stay and guide vanes and draft tube have been performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL). The main target of the investigations is to assess the prediction accuracy of a reduced domain of the complete turbine using a novel mixing-plane formulation. The computational domain is simplified simulating one single passage of the runner, thus assuming rotational periodicity and steady state conditions. The results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with an in-house adapted, 3D, unstructured, object-oriented finite volume code based on the OpenFOAM-V2.2 framework and designed to solve steady-state incompressible RANS-Equations. The pressure-based solver uses a SIMPLE-C like algorithm and is capable of handling multiple references of frame (MRF). The influence of the turbulence has been considered applying the shear-stress transport model (SST). Full second order upwind scheme for advection discretization has been used for all computations.

  19. Francis Omaswa: From cardiothoracic surgeon to village health advocate. Interview by Charles Wendo.

    Science.gov (United States)

    Omaswa, Francis

    2004-04-01

    Uganda's Director General of Health Services, Prof. Francis Omaswa says that abolition of user fees in his country has enabled more people to access health services. "Development partners now agree that it was a mistake to require people to pay for health services. the rest of the world should go that way" From high tech practice in the UK and Nairobi, Prof Omaswa established a model rural operation theatre in a poor rural area in Ngora, Eastern Uganda that became the envy of East Africa. He established model village health teams to provide the backbone of a district health system. When he became the head of Uganda's ministry of health he pushed for these teams country wide. This, together with President Museveni's open and multi sectoral approach to the HIV/AIDS epidemic, has contributed to Uganda's success story: HIV prevalence rates have plummeted from 30% to 5%. Charles Wendo caught up with him and gives a rare glimpse into this remarkable son of Africa: surgeon, public health advocate with rare leadership skills.

  20. From medicine to natural philosophy: Francis Hauksbee's way to the air-pump.

    Science.gov (United States)

    Brundtland, Terje

    2008-06-01

    Francis Hauksbee (1660-1713) is well known for his double-barrelled air-pump. However, the origin of this pump, and Hauksbee's background, are often described as a mystery. This text seeks to dispel the riddle. It is argued that Hauksbee's competence as an exceptional maker of air-pumps was developed between 1699 and 1703 as a result of his experiences with the construction, manufacturing and sale of cupping-glasses. His cupping utensils embodied a new design, where syringes were used to evacuate the glasses, instead of the traditional way by fire or mouth suction. These syringes, which in fact were small air-pumps, were perfected between 1699 and 1701. A larger syringe, introduced in 1701, served as a transition from the cupping-syringe to his first air-pump for use in natural philosophy. This syringe was described as a 'combined engine', which could serve as an air-pump, a condensing engine and a syringe for injecting air, wax or mercury into pathological specimens. Hauksbee's first air-pump was a single-barrelled model introduced in 1702, based on the combined engine. Its various features, such as easy and convenient leak-tightening, exact pressure measurements by an in-built barometer and an air-inlet function for readmission of air into the receiver, are discussed. Finally, it is shown that these activities gave Hauksbee the reputation of being an outstanding instrument-maker, years before the double-barrelled air-pump was in sight.

  1. Deciphering the language of nature: cryptography, secrecy, and alterity in Francis Bacon.

    Science.gov (United States)

    Clody, Michael C

    2011-01-01

    The essay argues that Francis Bacon's considerations of parables and cryptography reflect larger interpretative concerns of his natural philosophic project. Bacon describes nature as having a language distinct from those of God and man, and, in so doing, establishes a central problem of his natural philosophy—namely, how can the language of nature be accessed through scientific representation? Ultimately, Bacon's solution relies on a theory of differential and duplicitous signs that conceal within them the hidden voice of nature, which is best recognized in the natural forms of efficient causality. The "alphabet of nature"—those tables of natural occurrences—consequently plays a central role in his program, as it renders nature's language susceptible to a process and decryption that mirrors the model of the bilateral cipher. It is argued that while the writing of Bacon's natural philosophy strives for literality, its investigative process preserves a space for alterity within scientific representation, that is made accessible to those with the interpretative key.

  2. Investigation of a High Head Francis Turbine at Runaway Operating Conditions

    Directory of Open Access Journals (Sweden)

    Chirag Trivedi

    2016-03-01

    Full Text Available Hydraulic turbines exhibit total load rejection during operation because of high fluctuations in the grid parameters. The generator reaches no-load instantly. Consequently, the turbine runner accelerates to high speed, runaway speed, in seconds. Under common conditions, stable runaway is only reached if after a load rejection, the control and protection mechanisms both fail and the guide vanes cannot be closed. The runner life is affected by the high amplitude pressure loading at the runaway speed. A model Francis turbine was used to investigate the consequences at the runaway condition. Measurements and simulations were performed at three operating points. The numerical simulations were performed using standard k-ε, k-ω shear stress transport (SST and scale-adaptive simulation (SAS models. A total of 12.8 million hexahedral mesh elements were created in the complete turbine, from the spiral casing inlet to the draft tube outlet. The experimental and numerical analysis showed that the runner was subjected to an unsteady pressure loading up to three-times the pressure loading observed at the best efficiency point. Investigates of unsteady pressure pulsations at the vaneless space, runner and draft tube are discussed in the paper. Further, unsteady swirling flow in the blade passages was observed that was rotating at a frequency of 4.8-times the runaway runner angular speed. Apart from the unsteady pressure loading, the development pattern of the swirling flow in the runner is discussed in the paper.

  3. Water hammer effect in the spiral case and penstock of Francis turbines

    Science.gov (United States)

    Pepa, D.; Ursoniu, C.; Gillich, R. N.; Campian, C. V.

    2017-01-01

    Sudden pressure increases in the penstock or spiral case of a hydraulic turbine are the effect of sudden flow variation that occur during transient processes of type opening / closing or load rejection of the hydro unit. The consequence of the pressure rise in the spiral case and penstock is the water hammer phenomenon, whose effects can be devastating in some cases, up to breaking pipes and calamities produced in the area. This paper aims to analyze the method of calculation of the maximum pressure values that might occur in load rejection situations to a hydraulic turbine, in spiral case and in penstock, conditioned by the limiting of the values of the over speed and measures of limiting the increase in pressure in conjunction with limiting the increase in speed in these specific processes. As an example, we studied and analyzed the situation of a hydroelectric power plant equipped with a 7.8 MW Francis turbine without pressure regulator and the inflow surge. The results of analytical calculation overlaid on the experimental measurements performed during the performance tests of the hydro unit lead to the conclusion that the calculation algorithm proposed has been chosen correctly and the 2-stage closing law of the wicket gate promoted in this case is effective in such situations.

  4. The mine and the furnace: Francis Bacon, Thomas Russell, and early Stuart mining culture.

    Science.gov (United States)

    Pastorino, Cesare

    2009-01-01

    Notwithstanding Francis Bacon's praise for the philosophical role of the mechanical arts, historians have often downplayed Bacon's connections with actual artisans and entrepreneurs. Addressing the specific context of mining culture, this study proposes a rather different picture. The analysis of a famous mining metaphor in The Advancement of Learning shows us how Bacon's project of reform of knowledge could find an apt correspondence in civic and entrepreneurial values of his time. Also, Bacon had interesting and so far unexplored links with the early modern English mining enterprises, like the Company of Mineral and Battery Works, ofwhich he was a shareholder. Moreover, Bacon's notes in a private notebook, Commentarius Solutus, and records of patents of invention, allow us to start grasping Bacon's connections with the metallurgist and entrepreneur Thomas Russell. Lastly, this paper argues that, to fully understand Bacon's links with the world of Stuart technicians and entrepreneurs, it is necessary to consider a different and insufficiently studied aspect of Bacon's interests, namely his work as patents referee while a Commissioner of Suits.

  5. The “Visual Shock” of Francis Bacon: an essay in neuroesthetics

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a “visual shock.”We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his “visual shock” because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts. PMID:24339812

  6. The 'root-brain' hypothesis of Charles and Francis Darwin: Revival after more than 125 years.

    Science.gov (United States)

    Baluska, Frantisek; Mancuso, Stefano; Volkmann, Dieter; Barlow, Peter W

    2009-12-01

    This year celebrates the 200(th) aniversary of the birth of Charles Darwin, best known for his theory of evolution summarized in On the Origin of Species. Less well known is that, in the second half of his life, Darwin's major scientific focus turned towards plants. He wrote several books on plants, the next-to-last of which, The Power of Movement of Plants, published together with his son Francis, opened plants to a new view. Here we amplify the final sentence of this book in which the Darwins proposed that: "It is hardly an exaggeration to say that the tip of the radicle thus endowed [with sensitivity] and having the power of directing the movements of the adjoining parts, acts like the brain of one of the lower animals; the brain being seated within the anterior end of the body, receiving impressions from the sense-organs, and directing the several movements." This sentence conveys two important messages: first, that the root apex may be considered to be a 'brain-like' organ endowed with a sensitivity which controls its navigation through soil; second, that the root apex represents the anterior end of the plant body. In this article, we discuss both these statements.

  7. When sleep-related hypermotor epilepsy (SHE) met Charles Darwin and Francis Galton.

    Science.gov (United States)

    Parrino, Liborio; Pavesi, Giovanni

    2017-08-01

    Sleep-related hypermotor epilepsy (SHE) is characterized by short-lasting seizures patterned by repetitive and stereotyped motor events in the same person. In autosomal dominant SHE, genetic factors play a well-known key role. In The Expression of Emotions in Man and Animals, Charles Darwin quotes a plausible example of SHE illustrated by his cousin Sir Francis Galton: "the gentleman…lay fast asleep on his back in bed, raising his right arm slowly in front of his face, up to his forehead, and then dropping it with a jerk, so that the wrist fell heavily on the bridge of his nose. The trick did not occur every night, but occasionally, and was independent of any ascertained cause. Sometimes it was repeated incessantly for an hour or more." Similar manifestations during sleep occurred also in the patient's son and granddaughter, suggesting an autosomal inheritance without sex relationship. Differential diagnosis with REM behavior disorder and other parasomnias is discussed. To our knowledge, this could be the first description of a stereotyped SHE pattern with genetic transmission. © 2017 American Academy of Neurology.

  8. Numerical investigation of the flow phenomena around a low specific speed Francis turbine's guide vane cascade

    Science.gov (United States)

    Chitrakar, Sailesh; Singh Thapa, Biraj; Dahlhaug, Ole Gunnar; Prasad Neopane, Hari

    2016-11-01

    Guide vanes of Francis turbines convey a significant influence on the flow field at the inlet of the runner. This influence is in the form of pressure pulsation, caused due to rotor-stator-interaction. A guide vane cascade containing a single blade passage was developed to predict the flow field experimentally. Firstly, this paper investigates flow phenomena around the guide vane cascade through computational techniques. A numerical model is prepared with three different turbulence models. The velocity distribution obtained from these models are compared with experimental results at two circumferential midspan locations. Secondly, the influence of increasing the clearance gap on the flow is studied. Such gaps are expected to increase when the flow containing eroding particles passes through the turbine. This paper also shows that the pressure difference between the pressure and the suction side of guide vane influences the leakage flow through the gap. Hence, reduction of the pressure gradient will reduce leakages through clearance gaps, hereby condensing the subsequent effect of pressure pulsations and erosion. This study also shows that the effect of the gap is prominent in the near wall regions which are close to the gap, whereas it dissipates gradually towards the midspan.

  9. Detecting Unsteady Blade Row Interaction in a Francis Turbine using a Phase-Lag Boundary Condition

    Science.gov (United States)

    Wouden, Alex; Cimbala, John; Lewis, Bryan

    2013-11-01

    For CFD simulations in turbomachinery, methods are typically used to reduce the computational cost. For example, the standard periodic assumption reduces the underlying mesh to a single blade passage in axisymmetric applications. If the simulation includes only a single array of blades with an uniform inlet condition, this assumption is adequate. However, to compute the interaction between successive blade rows of differing periodicity in an unsteady simulation, the periodic assumption breaks down and may produce inaccurate results. As a viable alternative the phase-lag boundary condition assumes that the periodicity includes a temporal component which, if considered, allows for a single passage to be modeled per blade row irrespective of differing periodicity. Prominently used in compressible CFD codes for the analysis of gas turbines/compressors, the phase-lag boundary condition is adapted to analyze the interaction between the guide vanes and rotor blades in an incompressible simulation of the 1989 GAMM Workshop Francis turbine using OpenFOAM. The implementation is based on the ``direct-storage'' method proposed in 1977 by Erdos and Alzner. The phase-lag simulation is compared with available data from the GAMM workshop as well as a full-wheel simulation. Funding provided by DOE Award number: DE-EE0002667.

  10. Experimental Investigation on the Characteristics of Hydrodynamic Stabilities in Francis Hydroturbine Models

    Directory of Open Access Journals (Sweden)

    Wen-Tao Su

    2014-03-01

    Full Text Available This paper presents an experimental investigation of flow phenomena related to the characteristic frequencies of pressure fluctuation in Francis hydroturbine models. The experiments were carried out on two test rigs with two model runners having hydraulic similarities. Flow field around the guide vanes was measured with a particle image velocimetry (PIV on the first PIV test rig. Flow structures at the inlet region of runner and in draft tube at different operating conditions were visualized on another hydrodynamic test rig. Analyses of dominant frequency of unsteady hydraulic behaviors in the tested hydroturbines were performed. It was observed that the main frequency of flow over the guide vanes and the dominant frequency of channel vortex equal the blade passing frequency; the dominant frequency of flow separation at the suction side of blade inlet equals the vane passing frequency; the vortex rope in the draft tube displays a low-frequency nature. The flow instabilities and fluctuations directly influence the running of hydroturbine, thus these experimental results could provide important evidence for the stability study of a real hydroturbine.

  11. Experiences with the hydraulic design of the high specific speed Francis turbine

    Science.gov (United States)

    Obrovsky, J.; Zouhar, J.

    2014-03-01

    The high specific speed Francis turbine is still suitable alternative for refurbishment of older hydro power plants with lower heads and worse cavitation conditions. In the paper the design process of such kind of turbine together with the results comparison of homological model tests performed in hydraulic laboratory of ČKD Blansko Engineering is introduced. The turbine runner was designed using the optimization algorithm and considering the high specific speed hydraulic profile. It means that hydraulic profiles of the spiral case, the distributor and the draft tube were used from a Kaplan turbine. The optimization was done as the automatic cycle and was based on a simplex optimization method as well as on a genetic algorithm. The number of blades is shown as the parameter which changes the resulting specific speed of the turbine between ns=425 to 455 together with the cavitation characteristics. Minimizing of cavitation on the blade surface as well as on the inlet edge of the runner blade was taken into account during the design process. The results of CFD analyses as well as the model tests are mentioned in the paper.

  12. Time-of-travel and dispersion studies, Lehigh River, Francis E. Walter Lake to Easton, Pennsylvania

    Science.gov (United States)

    Kauffman, C.D.

    1983-01-01

    Results of time-of-travel and dispersion studies are presented for the 77.0 mile reach of the Lehigh River from Francis E. Walter Lake to Easton, Pennsylvania. Rhodamine WT dye was injected at several points for a variety of several common flow conditions and its downstream travel was monitored at a number of downstream points by means of a fluorometer. Time-of-travel data have been related to stream discharge, distance along the river channel and dispersion. If 2.205 pounds of a conservative water soluble contaminant were accidentally spilled into the Lehigh River at Penn Haven Junction at Black Creek 6.09 miles downstream from Rockport, Pennsylvania, when the discharge at Walnutport, Pennsylvania, was 600 cubic feet per second, the leading edge, peak, and trailing edge of the contaminant would arrive 31.6 miles downstream at the Northhampton, Pennsylvania, water intakes 45, 54, and 66 hours later, respectively. The maximum concentration expected at the intakes would be about 1.450 micrograms per liter. From data and relations presented, time-of-travel and maximum concentration estimates can be made for any two points within the reach. (USGS)

  13. Pope Francis and Joseph Selling: A New Approach to Mercy in Catholic Sexual Ethics

    Directory of Open Access Journals (Sweden)

    Mary Catherine O’Reilly-Gindhart

    2017-12-01

    Full Text Available Since the Apostolic Exhortation of Amoris Laetitia in May 2016 and Apostolic Letter Misericordia et Misera in November 2016, Pope Francis has stirred a new discussion on mercy and the role of mercy in certain matters of sexual ethics including divorced, remarried, and cohabiting couples. During the same year, moral theologian Joseph A. Selling published a revolutionary book which provides a new vision of virtues and examines how people consider and arrive at ethical judgements. This article examines Pope Francis’s understanding of mercy using Selling’s method of the “virtuous trapezium” as a way to actively illustrate Pope Francis’s new approach to matters concerning Catholic sexuality. In matters of human sexuality, the Catholic moral tradition has focused for years on an act-centered morality, but Selling’s method instead considers the goals of ethical living before making an ethical judgment. This article contributes to the current discussion in theological ethics concerning Pope Francis’s recent pronouncements on mercy and Catholic sexual ethics, as well as brings into conversation Selling’s new method and approach to understanding virtue.

  14. Numerical Simulation and Validation of a High Head Model Francis Turbine at Part Load Operating Condition

    Science.gov (United States)

    Goyal, Rahul; Trivedi, Chirag; Kumar Gandhi, Bhupendra; Cervantes, Michel J.

    2017-07-01

    Hydraulic turbines are operated over an extended operating range to meet the real time electricity demand. Turbines operated at part load have flow parameters not matching the designed ones. This results in unstable flow conditions in the runner and draft tube developing low frequency and high amplitude pressure pulsations. The unsteady pressure pulsations affect the dynamic stability of the turbine and cause additional fatigue. The work presented in this paper discusses the flow field investigation of a high head model Francis turbine at part load: 50% of the rated load. Numerical simulation of the complete turbine has been performed. Unsteady pressure pulsations in the vaneless space, runner, and draft tube are investigated and validated with available experimental data. Detailed analysis of the rotor stator interaction and draft tube flow field are performed and discussed. The analysis shows the presence of a rotating vortex rope in the draft tube at the frequency of 0.3 times of the runner rotational frequency. The frequency of the vortex rope precession, which causes severe fluctuations and vibrations in the draft tube, is predicted within 3.9% of the experimental measured value. The vortex rope results pressure pulsations propagating in the system whose frequency is also perceive in the runner and upstream the runner.

  15. Computation and analysis of cavitating flow in Francis-class hydraulic turbines

    Science.gov (United States)

    Leonard, Daniel J.

    Hydropower is the most proven renewable energy technology, supplying the world with 16% of its electricity. Conventional hydropower generates a vast majority of that percentage. Although a mature technology, hydroelectric generation shows great promise for expansion through new dams and plants in developing hydro countries. Moreover, in developed hydro countries, such as the United States, installing generating units in existing dams and the modern refurbishment of existing plants can greatly expand generating capabilities with little to no further impact on the environment. In addition, modern computational technology and fluid dynamics expertise has led to substantial improvements in modern turbine design and performance. Cavitation has always presented a problem in hydroturbines, causing performance breakdown, erosion, damage, vibration, and noise. While modern turbines are usually designed to be cavitation-free at their best efficiency point, due to the variable demand of the energy market it is fairly common to operate at off-design conditions. Here, cavitation and its deleterious effects are unavoidable, and hence, cavitation is a limiting factor on the design and operation of these turbines. Multiphase Computational Fluid Dynamics (CFD) has been used in recent years to model cavitating flow for a large range of problems, including turbomachinery. However, CFD of cavitating flow in hydroturbines is still in its infancy. This dissertation presents steady-periodic Reynolds-averaged Navier-Stokes simulations of a cavitating Francis-class hydroturbine at model and prototype scales. Computational results of the reduced-scale model and full-scale prototype, undergoing performance breakdown, are compared with empirical model data and prototype performance estimations based on standard industry scalings from the model data. Mesh convergence of the simulations is also displayed. Comparisons are made between the scales to display that cavitation performance breakdown

  16. Prevalence of hyperglycaemia first detected during pregnancy and subsequent obstetric outcomes at St. Francis Hospital Nsambya.

    Science.gov (United States)

    Nakabuye, Betty; Bahendeka, Silver; Byaruhanga, Romano

    2017-05-02

    Women with hyperglycaemia detected during pregnancy are at greater risk for adverse pregnancy outcomes. Data on hyperglycaemia in pregnancy in sub-Saharan Africa is scanty and varied depending on the populations studied and the methodologies used to define hyperglycaemia in pregnancy. With the recent 2013 World Health Organisation (WHO) diagnostic criteria and classification, there is yet no sufficient data on the prevalence of hyperglycaemia in sub-Saharan Africa. The objective was to determine the prevalence of Hyperglycaemia first detected during pregnancy and subsequent obstetric outcomes among patients attending antenatal care (ANC) at St. Francis Hospital Nsambya. A prospective cohort study. All women with no history of diabetes mellitus attending at or after 24 weeks gestation were eligible to participate in the study. Participants underwent a standard 75 g oral glucose tolerance test (OGTT) after an informed written consent. The primary outcome was diagnosis of hyperglycaemia. Enrolled participants were followed up to delivery to assess obstetric outcomes (secondary outcomes were birth weight, neonatal admission, maternal genital trauma, delivery mode, neonatal and maternal status at discharge). 251 women were screened between December 2013 and February 2014. The prevalence of hyperglycaemia first detected in pregnancy was 31.9%. We found 23.8 % of women with hyperglycaemia had no known risk factor. Macrosomia was the only obstetric outcome that was significantly associated with hyperglycaemia. The prevalence of hyperglycaemia first detected in pregnancy was high in the studied population. Clinicians, therefore, should become more vigilant to screen for the condition. Selective screening may miss 23.8% of pregnant women with hyperglycaemia. However the cost/benefit implications of screening strategy and the recent 2013 WHO diagnostic criteria need to be studied in our setting.

  17. Politics and the New African Novel: A Study of the Fiction of Francis Bebey

    Directory of Open Access Journals (Sweden)

    W. Curtis Schade

    1980-01-01

    Full Text Available From its inception African fiction has been strongly marked by political themes. In the late 1950's the virulent satire of Mongo Béti and Ferdinand Oyono stated the case against the denigration of African values inherent in all aspects of the colonial system. Their style and message subsequently gave way to novels focusing upon the drama of the transition of power at the moment of Independence. Whether optimistic or disillusioned, many of these novels featured real events and people, often thinly disguised, and sought to give an «inside» picture of that historical moment. Other tendencies developed in the late 60's, most notably a strongly autocritical, often radical, body of fiction represented by such writers as Ousmane Sembène and Alioum Fangouré, and the more distant, philosophical study of politics and society of writers like Ahmadou Kourouma. In all of these examples the contemporary political situation, whether viewed globally or as it affected the life of a simple man, was the primary moving force within the novel. By contrast, this paper will concentrate upon the work of Francis Bebey, exemplary of another current trend, fiction which, while continuing to deal with political concerns, does so in a different light, creating different tones, using different techniques. In the three novels and one short-story studied, politics is subordinated to other concerns and is treated less reverently than heretofore. We see in the work of Bebey a re-assessment of politics and its place in the life of contemporary (African man.

  18. Numerical Simulation of the Francis Turbine and CAD used to Optimized the Runner Design (2nd).

    Science.gov (United States)

    Sutikno, Priyono

    2010-06-01

    , medium head Francis type, with following value for the most important parameter, the rated specific speed ns.

  19. Sobre as afinidades entre a filosofia de Francis Bacon e o ceticismo

    Directory of Open Access Journals (Sweden)

    Luiz A. A. Eva

    2006-06-01

    Full Text Available Este texto se ocupa de um exame, em caráter introdutório, das relações entre a reflexão de Bacon acerca das limitações de nossas faculdades e o ceticismo filosófico - um tema pouco considerado pela literatura mais recente, a despeito das muitas referências a tal filosofia. Ainda que, à primeira vista, tais referências possam parecer vagas e imprecisas, pensamos que um exame adequado de algumas delas pode revelar, não apenas a importância do tema para a compreensão de aspectos do seu próprio empreendimento, mas o interesse de Bacon pela literatura cética contemporânea. As peculiaridades de sua própria interpretação, por sua vez, parecem antecipar traços do modo como essa filosofia foi compreendida por filósofos posteriores, como Hume.This text focuses, in a preliminary way, on the relations between Francis Bacon's reflections on the limits of our cognitive faculties and philosophical skepticism, a theme not much considered by most of recent commentaries, in spite of Bacon's own explicit and numerous allusions to this philosophy. Even if these allusions seem at first sight somewhat loose and not very sharp, some of them reveal, we think, not only its relevance for understanding of some aspects of his own enterprise, but also Bacon's attention to the skeptical literature produced on the period. Moreover, the particularities of his own interpretation of skepticism seem to anticipate important features of the way this philosophy was understood by later philosophers as Hume.

  20. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Natural knowledge as a propaedeutic to self-betterment: Francis Bacon and the transformation of natural history.

    Science.gov (United States)

    Lancaster, James A T

    2012-01-01

    This paper establishes the 'emblematic' use of natural history as a propaedeutic to self-betterment in the Renaissance; in particular, in the natural histories of Gessner and Topsell, but also in the works of Erasmus and Rabelais. Subsequently, it investigates how Francis Bacon's conception of natural history is envisaged in relation to them. The paper contends that, where humanist natural historians understood the use of natural knowledge as a preliminary to individual improvement, Bacon conceived self-betterment foremost as a means to Christian charity, or social-betterment. It thus examines the transformation of the moralizing aspect of Renaissance natural history in Bacon's conception of his Great Instauration.

  2. Abortion, metaphysics and morality: a review of Francis Beckwith's defending life: a moral and legal case against abortion choice.

    Science.gov (United States)

    Nobis, Nathan

    2011-06-01

    In Defending Life: A Moral and Legal Case Against Abortion Choice (2007) and an earlier article in this journal, "Defending Abortion Philosophically"(2006), Francis Beckwith argues that fetuses are, from conception, prima facie wrong to kill. His arguments are based on what he calls a "metaphysics of the human person" known as "The Substance View." I argue that Beckwith's metaphysics does not support his abortion ethic: Moral, not metaphysical, claims that are part of this Substance View are the foundation of the argument, and Beckwith inadequately defends these moral claims. Thus, Beckwith's arguments do not provide strong support for what he calls the "pro-life" view of abortion.

  3. THE DESIRE FOR RECOGNITION IN THE CONTEXT OF FRANCIS FUKUYAMA’S UNIVERSAL HISTORY

    Directory of Open Access Journals (Sweden)

    T. V. Danylova

    2016-12-01

    Full Text Available Introduction. Francis Fukuyama in his famous book “The End of History and the Last Man” assumes that human history should be considered as the battle of ideologies that reaches its goal in the universalization of Western liberal democracy. Author’s ideas have gained many supporters. At the same time, they were subjected to severe criticism that reflected the important trends of political life and ideological preferences. Leaving aside the criticism based on geopolitical and civilizational confrontation and confusion which confronts Fukuyama’s theory, it should be stated that anthropological aspect of Fukuyama’s theory has vastly evaded philosophical comprehension. Purpose. This article attempts to test Fukuyama’s theory through the lens of philosophical anthropology and analyze human desire for recognition in the context of Fukuyama’s World History. Methodology. The analysis is focused on human desire for recognition as a significant dimension of human nature. The author has used hermeneutical methodology and anthropological integrative approach. Theoretical basis and results. Fukuyama is not satisfied by merely economic interpretation of history emphasizing that human is not simply an economic animal. Economic development fails to explain why people advocate the principles of liberal democracy. The author goes back to Hegel’s non-materialistic view of history based on the struggle for recognition. According to Fukuyama, this deeply rooted human desire for recognition is the great motor of history and cause of tyranny, conflicts, and wars. But at the same time, it also acts as a psychological foundation of many virtues – the spirit of citizenship, courage, and justice. Throughout history, this desire for recognition was not satisfied. Only modern liberal democracy provides universal recognition of all humans ensuring and protecting their rights. Originality. Fukuyama’s concept is important and interesting because it draws

  4. Francis Bacon sob o olhar de Gilles Deleuze: a imagem como intensidade

    Directory of Open Access Journals (Sweden)

    Osvaldo Fontes Filho

    2007-12-01

    Full Text Available O ensaio de Gilles Deleuze La logique de la sensation é texto que se detém principalmente na prática e na eficácia da imagem. A pintura de Francis Bacon é ali tomada como paradigma de modernidade ao investir contra os clichês expressivos e ao produzir imagem junto à brutalidade dos fatos, como um contra-efeito do narrativo. Em uma obra que conjura todo modelo a representar, toda história a contar, “alguma coisa se passa”, explica Deleuze, “que define o funcionamento da pintura”. Algo se passa, tem lugar: o acontecimento de uma catástrofe e de uma histeria no ato de pintura que acomete a Figura de modo a transmitir uma potencial violência de reação e de expressão. O “Bacon” de Deleuze apresenta a realidade vivida em uma nova e não-convencional ordem de sensação. Neste artigo, são comentados os modos como o filósofo interpreta os atos físicos da pintura de Bacon — marcas aleatórias, varredura da massa pictural, escansão das superfícies —, procedimentos que introduzem no mundo visual da figuração a variedade caótica dos fatos e sentidos. Mostra-se como as faces e as figuras contorcidas, distorcidas, escorchadas de Bacon recebem uma voz conceitual complementar no texto de Deleuze. Consequentemente, focaliza-se a disposição de alguns conceitos do filósofo: diagrama, Figura, diferença, espaço háptico. Locados no espaço afetivo ou na “lógica da sensação” da pintura baconiana, esses conceitos atribuem legitimidade ao entrelaçamento e à co-implicação entre arte e filosofia. Uma última observação dá conta do fato de a prática da imagem em Bacon, apresentada por Deleuze no palco de uma modernidade particularmente solapada por um “dilúvio anestésico de imagens reprimindo a possibilidade de pensar”, evidenciar para o filósofo os rumos necessariamente sinuosos, “reptilíneos”, do pensamento moderno. Tanto o conceito como a forma criam por catástrofe, por conflagração, por varia

  5. Francis full-load surge mechanism identified by unsteady 2-phase CFD

    Energy Technology Data Exchange (ETDEWEB)

    Doerfler, P K; Keller, M; Braun, O, E-mail: peter.doerfler@andritz.co [R and D Department, Andritz Hydro Ltd., Zurich (Switzerland)

    2010-08-15

    Francis turbines may produce spontaneous pulsations of pressure and output power when operating at very high discharge. In such cases there is a cavitating central vortex in the draft tube with variable cavity volume V{sub c}. Until today, researchers agree that the main destabilizing agent is the so-called mass flow gain factor, defined as the derivative of cavity volume by the local discharge. Recent studies about 1D high-load stability analysis assumed that the mass-flow gain factor obtained from steady-state vortex data acts on the transient discharge downstream of the cavity. There are however good reasons to question this assumption. Most strikingly, the direct cause of the mass flow gain effect is the increase of swirl produced at the runner exit and hence upstream, not downstream of the cavity. To enhance the reliability of full-load stability predictions, the authors directly investigated the vortex dynamics. The development of the transient cavitating flow in the draft tube was simulated by means of unsteady 2-phase CFD. CFD work started with 1-phase calculations as presented by other authors. This was then extended to a more realistic 2-phase calculation. To contain the computing time within acceptable limits, given the very fine mesh and short time step required, the simulation domain was restricted to the draft tube and, at the same time, the problem was reduced to a basically 2-dimensional rotationally symmetric case. The response of the cavitating draft tube flow to a time-dependent inflow and time-dependent pressure at the draft tube exit was simulated. The results were input to a statistical identification procedure to check possible 1D transient models and find representative parameter values in the sense of a best fit between 1D model and CFD result. As we had suspected, the conventional vortex model with mass flow gain controlled by downstream discharge is not compatible with direct simulation and needs to be modified. The CFD results correspond

  6. The Revels of a Young Republic: Revolutionary Possibilities of the Fandango in Timothy Flint’s 1826 Francis Berrian

    Directory of Open Access Journals (Sweden)

    Paul D. Naish

    2015-01-01

    Full Text Available Francis Berrian, de Timothy Flint (1826, la primera novela de temática latinoamericana escrita en Estados Unidos presenta a un joven de Massachusetts que rescata a la hija de un Conde de una banda de Comanches, y llega a participar en la Guerra de la Independencia de México. Un fandango en la hacienda de la mujer forma la escena central, donde ancianos y jóvenes, padres e hijos, amos y sirvientes se entremezclan en un baile lleno de posibilidades que anticipa una futura unión provechosa entre México y los Estados Unidos. Sin embargo, al tedioso norteamericano esta exhibición de familiaridad entre clases le incomoda, y la mexicana aristocrática le reprocha su esnobismo. Quizás, sin querer, Francis Berrian nos sugiere que las ideas de igualdad y fraternidad son mejor recibidas en una pista del México aristocrático que en la Republica de los Estados Unidos.

  7. Numerical Predictions of the Incipient and Developed Interblade Vortex Lines of a Model Francis Turbine by Cavitation Calculations

    Directory of Open Access Journals (Sweden)

    Zhigang Zuo

    2013-01-01

    Full Text Available The existence of runner interblade vortices can cause instability problems in Francis turbines, for example, pressure fluctuations, vibrations of runners, noise, and so forth. It is favorable in engineering practice to have the knowledge of the appearance of the incipient and developed inter blade vortex lines on the Hill diagram in unit parameters. Most numerical research on the inter blade vortices has been focused on the study of the characteristics of pressure fluctuations by single-phase flow calculations. However, since the two vortex lines are distinguished by observations of visible vortices, which contain cavitating flows, it is clear that cavitation calculations are needed for their predictions. A method by solving RANS equations with RNG k – ∊ turbulence model and ZGB cavitation model was proposed for the predictions in a Francis model turbine. Modifications of the turbulence viscosity were made for better simulation results. Vorticity criterion was chosen to identify the vortices. The fact that the results of cavitation calculations have a better agreement with experimental observations than single-phase calculations proves the validity of this prediction method.

  8. Influence of 3D Guide Vanes on the Channel Vortices in the Runner of a Francis Turbine

    Science.gov (United States)

    Liu, Shuhong; Zhang, Liang; Wu, Yulin; Luo, Xianwu; Nishi, Michihiro

    It is known that the pressure fluctuation in the runner will become large when a Francis turbine operates at the low flow rate and high head. One of the reasons is the occurrence of channel vortices, which are caused by the three-dimensional flow separating from the suction side of runner blades. In this study, two three-dimensional guide vanes (1# 3D GV, 2# 3D GV) are designed so as to depress the channel vortices and improve the operation performance of a Francis turbine. The flow rate equation for 3D GV is derived firstly in this paper. Then, in order to show the influence of 3D GV on the turbine characteristic, performance test and video-recording of the channel vortices are conducted. Numerical simulation for a part load operation is applied finally to the entire turbine flow passage (from the inlet of spiral case to the outlet of draft tube) using the RNG k-ɛ turbulence model to make clear the three-dimensional internal flow. From evaluation of both the experimental and calculation results, it is noted that the channel vortices from the blade suction side were suppressed effectively by 3D GV, and the turbine efficiency with 3D GV was 0.41 % higher than that with the conventional 2D GV.

  9. Andrew Francis : What in God’s Name are you Eating? How Can Christians Live and Eat Responsibly in Today’s Global Village?

    OpenAIRE

    Ruhlmann, Sandrine

    2016-01-01

    FRANCIS A. 2015. What in God’s Name are you Eating? How Can Christians Live and Eat Responsibly in Today’s Global Village? Cambridge: The Lutterworth Press. 157 p. Andrew Francis, théologien anabaptiste-mennonite, auteur de Hospitality and Community after Christendom (2012), s’interroge sur les pratiques alimentaires des communautés religieuses, en particulier la commensalité fondée sur une conception de l’hospitalité chez les chrétiens. Dans son nouveau livre What in God’s Name are you Eatin...

  10. Selecting One Among the Many: A Simple Network Implementing Shifts in Selective Visual Attention.

    Science.gov (United States)

    1984-01-01

    Acknowledgments: We would like to thank Francis Crick , Ellen Hildreth, James Mahoney and Tomaso Poggio for their enlightening comments. Gady Geiger pointed out...the visual field -- (Atkinson, Campbell & Francis 1976). Consider next the problem of performing a conjunctive search task (Treisman & Gelade, 1080...central representation. Interestingly, Crick proposed recently (1984; see also Yingling & Skinner, 1977) - - that the attentional searchlight is controlled

  11. Más allá del laboratorio: las dimensiones sociológicas de la ecuación de Schroedinger Más allá del laboratorio: las dimensiones sociológicas de la ecuación de Schroedinger

    Directory of Open Access Journals (Sweden)

    Miguel A.V. Ferreira

    2007-03-01

    Full Text Available In the present work it is exposed synthetically part of an empirical investigation in the field of the sociology of scientific knowledge. From the sociological perspective that assumes the (social activity producing scientific knowledge as one of the epistemological components of this knowledge, it is exposed as, from an autobservational methodology, it has been possible to state the constituently reflexive nature of this activity. A reflexivity in which the formal and formalizeable it is intermingled very indisociably with the existential and informalizable. We present, from these methodologic foundations a (sociological vision of Schroedinger equation that reveals it in its social nataure: beyond its neutral appearance, formal and mathematical, it shows one agencial and active potentiality, shows all the dimensions of an authentic social subject.En el presente trabajo se expone sintéticamente parte de lo que ha sido una investigación empírica en el campo de la sociología del conocimiento científico. Desde la perspectiva sociológica que asume la actividad (social productora de conocimiento científico como uno de los constituyentes epistemológicos de dicho conocimiento, se expone cómo a partir de una metodología autobservacional se ha podido constatar la naturaleza constitutivamente reflexiva de dicha actividad. Una reflexividad en la que lo formal y formalizable se entremezcla indisociablemente con lo informal y vivencial. Presentamos, a partir de estos fundamentos metodológicos, una visión (sociológica de la ecuación de Schroedinger que la revela en su naturaleza social: más allá de su apariencia neutra, formal y matemática, muestra una virtualidad agencial y activa, muestra todas las dimensiones de un auténtico sujeto social. Proponemos, para culminar, que el tipo de reflexividad que entendemos constitutivo de la práctica científica y, por extensión, de cualquier práctica social, se distancia de lo que ha venido defini

  12. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  13. Rotor optimization of a Francis type hydraulic turbine through the computer flow analysis (CFD); Optimizacion del rodete de una turbina hidraulica tipo Francis a traves del analisis computacional del flujo (CFD)

    Energy Technology Data Exchange (ETDEWEB)

    Rosado Tamariz, Erick

    2007-06-15

    In the analysis of fluid behavior through hydraulic turbines, two basic methodologies for flow analysis and optimization processes in turbines are used, which are: a) modeled of flow through the entire turbine (joint), or modeled one of each component separately, obtaining satisfactory results by both methodologies. The analysis of computational fluids dynamics (CFD) to geometries improved by means of finite volume method (FVM) with their corresponding initials and boundary conditions is made, to solve a system differential equations of second order that correspond to the flow around the dominion of runner blades; considering nonviscous flow and the implementation of the two equations models for the solution of the equations that govern the turbulent flow. Also, used parameterization techniques based in a parametric geometry an objective function and the diminution of cavitation. This work presents the optimization of a runner from a Francis hydro turbine for a 75 MW considering three different load conditions (75%, 85% and 100%) through CFD as a part of the hydraulic analysis for modernization of the actual condition of a power generation unit. Francis runner optimization is made, through a previous analysis of CFD by means of the FVM, considering the viscous effects of the fluid and the model of turbulence developed by Sparlart and Allmaras; modeling the wicket and runner separately. Later the generation of a parametric model of the runner is made and the simulation for the generation of data base is formed. Finally an objective function is considered to develop the optimal geometry of the runner blades. The results are presented in a graphic form in such a way, that it shows the distributions of pressure and speed around the blades runner, the geometrical and performance (efficiency and power) comparison between original and optimized model. [Spanish] En el analisis del comportamiento del fluido a traves de turbinas hidraulicas, se emplean dos metodologias

  14. Renaissance Epyllions: A Comparative Reading of Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus"

    Science.gov (United States)

    Mahmoudi, Yazdan

    2016-01-01

    The present paper is supposed to compare and contrast three of these masterpieces written the Renaissance period. The epyllions under study are Christopher Marlowe's "Hero and Leander," Thomas Lodge's "Scylla's Metamorphosis" and Francis Beaumont's "Salmacis and Hermaphroditus." Bush believes that "the influence…

  15. The Battle between the Biometricians and the Mendelians: How Sir Francis Galton's Work Caused His Disciples to Reach Conflicting Conclusions about the Hereditary Mechanism

    Science.gov (United States)

    Gillham, Nicholas W.

    2015-01-01

    Francis Galton, Charles Darwin's cousin, had wide and varied interests. They ranged from exploration and travel writing to fingerprinting and the weather. After reading Darwin's "On the Origin of Species," Galton reached the conclusion that it should be possible to improve the human stock through selective breeding, as was the…

  16. Francis Bacon czyli Diego Velázquez na fotelu dentystycznym - malarskie i inne cytaty jako "dodatek" do rozpraszającego się życia

    NARCIS (Netherlands)

    van Nieukerken, A.

    2014-01-01

    "Francis Bacon or Diego Velázquez in a dentist’s chair" - pictorial and other kinds of quotations as an addition to a disintegrating life The mature poetry of Tadeusz Różewicz seems to be at odds with both modernist and postmodern literary tenets. It undeniably makes abundant use of intertextuality

  17. The Red-Attractiveness Effect, Applying the Ioannidis and Trikalinos (2007b) Test, and the Broader Scientific Context: A Reply to Francis (2013)

    Science.gov (United States)

    Elliot, Andrew J.; Maier, Markus A.

    2013-01-01

    Francis (2013) tested for and found evidence of publication bias in 1 of the 3 focal relations examined in Elliot et al. (2010), that between red and attractiveness. He then called into question the research as a whole and the field of experimental psychology more generally. Our reply has 3 foci. First, we attend to the bottom line regarding the…

  18. If Auditors Are Like Belgian Beers, Which Style Would You Prefer? : Discussion of “Auditor Style and Financial Statement Comparability” by Francis, Pinnuck, and Watanabe .

    NARCIS (Netherlands)

    Bruynseels, L.M.L.; Brenk, van H.M.

    2016-01-01

    Recent research by Francis, Pinnuck, and Watanabe (2014) has shown that financial reporting outcomes are influenced by the audit firm’s unique audit style. They argue that audit firm styles are driven by their “unique set of internal working rules that guide the auditor’s application of accounting

  19. Il De uno alla luce dell’Exemplum tractatus de iustitia universali, sive de fontibus iuris di Francis Bacon

    Directory of Open Access Journals (Sweden)

    Romana Bassi

    2016-11-01

    Full Text Available [Reading “De uno” in light of Francis Bacon’s “Exemplum tractatus de iustitia universali, sive de fontibus iuris”]. Although Vico was admittedly disappointed by Bacon’s Exemplum tractatus, a parallel reading of this text and De uno can provide insights as to how Vico ended up having to confront a series of issues: how does the universal law project itself into history? Where does the law stem from? Is there a link between law, occasion, and utility? What are the sources and the scope of authority? How does violence affect the law? What role for religion and piety? How to devise a philology for the laws and ancient fables? Bacon’s scattered aphorisms offer glimpses into problems which find a solution in the all-encompassing order of De uno.

  20. Critical notice--defending life: a moral and legal case against abortion choice by Francis J Beckwith.

    Science.gov (United States)

    Stretton, D

    2008-11-01

    Francis Beckwith's Defending life: a moral and legal case against abortion choice defends the pro-life position on moral, legal and political grounds. In this critical notice I consider three key issues and argue that Beckwith's treatment of each of them is unpersuasive. The issues are: (1) whether abortion is politically justified by the principle that we should err on the side of liberty in the face of reasonable disagreement over the moral status of the fetus; (2) whether the fetus's natural capacity or genetic propensity to develop rationality and communication is sufficient to give it a moral right to life; and (3) whether abortion is morally justified on the basis of bodily rights. I also show that Beckwith's book fails to consider several important issues and arguments.

  1. FRamework Assessing Notorious Contributing Influences for Error (FRANCIE): Perspective on Taxonomy Development to Support Error Reporting and Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Lon N. Haney; David I. Gertman

    2003-04-01

    Beginning in the 1980s a primary focus of human reliability analysis was estimation of human error probabilities. However, detailed qualitative modeling with comprehensive representation of contextual variables often was lacking. This was likely due to the lack of comprehensive error and performance shaping factor taxonomies, and the limited data available on observed error rates and their relationship to specific contextual variables. In the mid 90s Boeing, America West Airlines, NASA Ames Research Center and INEEL partnered in a NASA sponsored Advanced Concepts grant to: assess the state of the art in human error analysis, identify future needs for human error analysis, and develop an approach addressing these needs. Identified needs included the need for a method to identify and prioritize task and contextual characteristics affecting human reliability. Other needs identified included developing comprehensive taxonomies to support detailed qualitative modeling and to structure meaningful data collection efforts across domains. A result was the development of the FRamework Assessing Notorious Contributing Influences for Error (FRANCIE) with a taxonomy for airline maintenance tasks. The assignment of performance shaping factors to generic errors by experts proved to be valuable to qualitative modeling. Performance shaping factors and error types from such detailed approaches can be used to structure error reporting schemes. In a recent NASA Advanced Human Support Technology grant FRANCIE was refined, and two new taxonomies for use on space missions were developed. The development, sharing, and use of error taxonomies, and the refinement of approaches for increased fidelity of qualitative modeling is offered as a means to help direct useful data collection strategies.

  2. LDV survey of cavitation and resonance effect on the precessing vortex rope dynamics in the draft tube of Francis turbines

    Science.gov (United States)

    Favrel, A.; Müller, A.; Landry, C.; Yamamoto, K.; Avellan, F.

    2016-11-01

    The large-scale penetration of the electrical grid by intermittent renewable energy sources requires a continuous operating range extension of hydropower plants. This causes the formation of unfavourable flow patterns in the draft tube of turbines and pump-turbines. At partial load operation, a precessing cavitation vortex rope is formed at the Francis turbine runner outlet, acting as an excitation source for the hydraulic system. In case of resonance, the resulting high-amplitude pressure pulsations can put at risk the stability of the machine and of the electrical grid to which it is connected. It is therefore crucial to understand and accurately simulate the underlying physical mechanisms in such conditions. However, the exact impact of cavitation and hydro-acoustic resonance on the flow velocity fluctuations in the draft tube remains to be established. The flow discharge pulsations expected to occur in the draft tube in resonance conditions have for instance never been verified experimentally. In this study, two-component Laser Doppler Velocimetry is used to investigate the axial and tangential velocity fluctuations at the runner outlet of a reduced scale physical model of a Francis turbine. The investigation is performed for a discharge equal to 64 % of the nominal value and three different pressure levels in the draft tube, including resonance and cavitation-free conditions. Based on the convective pressure fluctuations induced by the vortex precession, the periodical velocity fluctuations over one typical precession period are recovered by phase averaging. The impact of cavitation and hydro-acoustic resonance on both axial and tangential velocity fluctuations in terms of amplitude and phase shift is highlighted for the first time. It is shown that the occurrence of resonance does not have significant effects on the draft tube velocity fields, suggesting that the synchronous axial velocity fluctuations are surprisingly negligible compared to the velocity

  3. Steady and unsteady numerical simulations of the flow in the Tokke Francis turbine model, at three operating conditions

    Science.gov (United States)

    Stoessel, Lucien; Nilsson, Håkan

    2015-01-01

    This work investigates the flow in the scale model of the high-head Tokke Francis turbine at part load, best efficiency point and high load, as a contribution to the first Francis-99 workshop. The work is based on the FOAM-extend CFD software, which is a recent fork of the OpenFOAM CFD software that contains new features for simulations in rotating machinery. Steady-state mixing plane RANS simulations are conducted, with an inlet before the guide vanes and an outlet after the draft tube. Different variants of the k-epsilon and k-ω turbulence models are used and a linear explicit algebraic Reynolds stress model is implemented. Sliding grid URANS simulations, using a general grid interface coupling, are performed including the entire turbine geometry, from the inlet to the spiral casing to the outlet of the draft tube. For the unsteady simulations, the k-ω SSTF model is implemented and used in addition to the standard k-epsilon model. Both the steady and unsteady simulations give good predictions of the pressure distribution in the turbine compared to the experimental results. The velocity profiles at the runner outlet are well predicted at off-design conditions. A strong swirl is however obtained at best efficiency point, which is not observed in the experiments. While the steady-state simulations strongly overestimate the efficiency, the unsteady simulations give good predictions at best efficiency point (error of 1.16%) with larger errors at part load (10.67%) and high load (2.72%). Through the use of Fourier decomposition, the pressure fluctuations in the turbine are analysed, and the main rotor-stator interaction frequencies are predicted correctly at all operating conditions.

  4. Controlling the Flow of Visual Information through the Lateral Geniculate Nucleus: From Single Cells to Neural Networks.

    Science.gov (United States)

    1991-10-31

    Department of Anesthesiology at the Medical School of the University of Rochester, Dr. Francis Crick at the Salk Institute in La Jolla and Prof. Heinz...by a single object in coherent motion. Given the great relevance we attach to synchronously firing neuronal populations (see Crick and Koch, 1990 and...considered to be an epiphenomenon. The neuronal basis of visual awareness We published several papers ( Crick and Koch, 1990, 1991; Koch and Crick , 1991

  5. Hidden Statistics of Schroedinger Equation

    Science.gov (United States)

    Zak, Michail

    2011-01-01

    Work was carried out in determination of the mathematical origin of randomness in quantum mechanics and creating a hidden statistics of Schr dinger equation; i.e., to expose the transitional stochastic process as a "bridge" to the quantum world. The governing equations of hidden statistics would preserve such properties of quantum physics as superposition, entanglement, and direct-product decomposability while allowing one to measure its state variables using classical methods.

  6. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  7. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  8. Road Bridges and Culverts, MDTA Culverts, Culverts on John F. Kennedy Highway (I95), Baltimore Harbor Tunnel Throughway, Francis Scott Key Bridge, Bay bridge, Nice Bridge, Published in 2010, 1:1200 (1in=100ft) scale, Maryland Transportation Authority.

    Data.gov (United States)

    NSGIC State | GIS Inventory — Road Bridges and Culverts dataset current as of 2010. MDTA Culverts, Culverts on John F. Kennedy Highway (I95), Baltimore Harbor Tunnel Throughway, Francis Scott Key...

  9. Frozen Rotor and Sliding Mesh Models Applied to the 3D Simulation of the Francis-99 Tokke Turbine with Code_Saturne

    Science.gov (United States)

    Tonello, N.; Eude, Y.; de Laage de Meux, B.; Ferrand, M.

    2017-01-01

    The steady-state operation of the Francis-99, Tokke turbine [1-3] has been simulated numerically at different loads using the open source, CAD and CFD software, SALOME [4] Code_Saturne [5]. The full 3D mesh of the Tokke turbine provided for the Second Francis-99 Workshop has been adapted and modified to work with the solver. Results are compared for the frozen-rotor and the unsteady, conservative sliding mesh approach over three operating points, showing that good agreement with the experimental data is obtained with both models without having to tune the CFD models for each operating point. Approaches to the simulation of transient operation are also presented with results of work in progress.

  10. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  11. Molecular structure of deoxycytidyl-3'-methylphosphonate (RP) 5'-deoxyguanidine, d[Cp(CH3)G]. A neutral dinucleotide with Watson-Crick base pairing and a right handed helical twist.

    Science.gov (United States)

    Han, F; Watt, W; Duchamp, D J; Callahan, L; Kézdy, F J; Agarwal, K

    1990-01-01

    The crystal structure of d[Cp(CH3)G] has been determined as part of a project to study the mechanism of the B----Z transition in DNA. The asymmetric unit contains two dinucleotides and the equivalent of 7.5 water molecules, partially disordered over 12 definable positions. The two symmetry-independent dinucleotides form a duplex with Watson-Crick base-pairing and a right-handed helical sense. Comparison with previously determined structures of the B and A conformation showed that this duplex is closer to B than to A but significantly different from B. It corresponds to a stretched out helix with a 4 A rise per base pair and a helical twist of 32 degrees. This structure may serve as a model for the bending of DNA in certain situations. The configuration at the methyl phosphonate is RP, and a mechanism, based on this assignment, is presented for the B----Z transition in DNA. PMID:2339061

  12. Nonlinear dynamic analysis and robust controller design for Francis hydraulic turbine regulating system with a straight-tube surge tank

    Science.gov (United States)

    Liang, Ji; Yuan, Xiaohui; Yuan, Yanbin; Chen, Zhihuan; Li, Yuanzheng

    2017-02-01

    The safety and stability of hydraulic turbine regulating system (HTRS) in hydropower plants become increasingly important since the rapid development and the broad application of hydro energy technology. In this paper, a novel mathematical model of Francis hydraulic turbine regulating system with a straight-tube surge tank based on a few state-space equations is introduced to study the dynamic behaviors of the HTRS system, where the existence of possible unstable oscillations of this model is studied extensively and presented in the forms of the bifurcation diagram, time waveform plot, phase trajectories, and power spectrum. To eliminate these undesirable behaviors, a specified fuzzy sliding mode controller is designed. In this hybrid controller, the sliding mode control law makes full use of the proposed model to guarantee the robust control in the presence of system uncertainties, while the fuzzy system is applied to approximate the proper gains of the switching control in sliding mode technique to reduce the chattering effect, and particle swarm optimization is developed to search the optimal gains of the controller. Numerical simulations are presented to verify the effectiveness of the designed controller, and the results show that the performances of the nonlinear HTRS system assisted with the proposed controller is much better than that with the commonly used optimal PID controller.

  13. Les livres de recettes « francisés » au Mexique au XIXe siècle

    Directory of Open Access Journals (Sweden)

    Sarah Bak-Geller Corona

    2008-05-01

    Full Text Available L’apparition des premiers livres de cuisine au Mexique - publiés par des maisons d’édition françaises spécialisées en ouvrages en espagnol - marque le début de l’histoire de la cuisine mexicaine. Cet événement s’inscrit par ailleurs dans une histoire plus large : celle de la construction de l’État-nation, entre nationalisme et cosmopolitisme. L’article s’intéresse aux idéaux de nation et de cuisine cohabitant dans deux des livres de recettes francisés du XIXe siècle au Mexique : l’Arte novísimo de cocina et le Nuevo cocinero americano/mexicano en forma de diccionario.French-fashioned Mexican recipe books in the 19th century. Globalization and construction of a national culinary modelThe first Mexican recipe books were published in the early 1830’s by French publishing houses specialized in Spanish written books. This article deals with the different nationalistic and cuisine models in two French-fashioned Mexican recipe books -the Arte novísimo de cocina and the Nuevo cocinero americano/mexicano en forma de diccionario- and their relationship with the nation-building context in nineteenth century Mexico.

  14. La prolongation de la vie humaine selon Francis Bacon. Ou : quel Tithon voulons-nous être ?

    Directory of Open Access Journals (Sweden)

    Dominique Weber

    2011-07-01

    Full Text Available Afin de comprendre avec exactitude la manière dont Francis Bacon envisage la question de la prolongation de la vie humaine, il faut impérativement examiner l’assise théologique de la réflexion du philosophe à ce sujet. Il convient aussi de restituer l’intégration de cette réflexion dans les objectifs plus amples de la philosophie naturelle nouvelle. Enfin, il est nécessaire de comprendre les dimensions proprement morales de la question. Car la prolongation de la vie humaine n’est pas seulement, au sein de la philosophie naturelle nouvelle, un cas parmi d’autres des recherches qu’il faut désormais effectuer : en réalité, c’est elle qui lui donne et qui lui fixe son sens ; avec elle se joue l’effectivité de l’identité espérée entre science et puissance. Mais il faut encore préciser qu’il ne s’agit aucunement pour l’homme de vieillir pour vieillir : il s’agit pour lui de pouvoir vieillir bien. Les leçons que Bacon tire de la fable de Tithon sont ici véritablement décisives.

  15. An Intelligent Optimization Method for Vortex-Induced Vibration Reducing and Performance Improving in a Large Francis Turbine

    Directory of Open Access Journals (Sweden)

    Xuanlin Peng

    2017-11-01

    Full Text Available In this paper, a new methodology is proposed to reduce the vortex-induced vibration (VIV and improve the performance of the stay vane in a 200-MW Francis turbine. The process can be divided into two parts. Firstly, a diagnosis method for stay vane vibration based on field experiments and a finite element method (FEM is presented. It is found that the resonance between the Kármán vortex and the stay vane is the main cause for the undesired vibration. Then, we focus on establishing an intelligent optimization model of the stay vane’s trailing edge profile. To this end, an approach combining factorial experiments, extreme learning machine (ELM and particle swarm optimization (PSO is implemented. Three kinds of improved profiles of the stay vane are proposed and compared. Finally, the profile with a Donaldson trailing edge is adopted as the best solution for the stay vane, and verifications such as computational fluid dynamics (CFD simulations, structural analysis and fatigue analysis are performed to validate the optimized geometry.

  16. Experimental evidence of inter-blade cavitation vortex development in Francis turbines at deep part load condition

    Science.gov (United States)

    Yamamoto, K.; Müller, A.; Favrel, A.; Avellan, F.

    2017-10-01

    Francis turbines are subject to various types of cavitation flow depending on the operating condition. To enable a smooth integration of the renewable energy sources, hydraulic machines are now increasingly required to extend their operating range, especially down to extremely low discharge conditions called deep part load operation. The inter-blade cavitation vortex is a typical cavitation phenomenon observed at deep part load operation. However, its dynamic characteristics are insufficiently understood today. In an objective of revealing its characteristics, the present study introduces a novel visualization technique with instrumented guide vanes embedding the visualization devices, providing unprecedented views on the inter-blade cavitation vortex. The binary image processing technique enables the successful evaluation of the inter-blade cavitation vortex in the images. As a result, it is shown that the probability of the inter-blade cavitation development is significantly high close to the runner hub. Furthermore, the mean vortex line is calculated and the vortex region is estimated in the three-dimensional domain for the comparison with numerical simulation results. In addition, the on-board pressure measurements on a runner blade is conducted, and the influence of the inter-blade vortex on the pressure field is investigated. The analysis suggests that the presence of the inter-blade vortex can magnify the amplitude of pressure fluctuations especially on the blade suction side. Furthermore, the wall pressure difference between pressure and suction sides of the blade features partially low or negative values near the hub at the discharge region where the inter-blade vortex develops. This negative pressure difference on the blade wall suggests the development of a backflow region caused by the flow separation near the hub, which is closely related to the development of the inter-blade vortex. The development of the backflow region is confirmed by the numerical

  17. SCAN TO BIM FOR 3D RECONSTRUCTION OF THE PAPAL BASILICA OF SAINT FRANCIS IN ASSISI IN ITALY

    Directory of Open Access Journals (Sweden)

    M. G. Angelini

    2017-05-01

    Full Text Available The historical building heritage, present in the most of Italian cities centres, is, as part of the construction sector, a working potential, but unfortunately it requires planning of more complex and problematic interventions. However, policies to support on the existing interventions, together with a growing sensitivity for the recovery of assets, determine the need to implement specific studies and to analyse the specific problems of each site. The purpose of this paper is to illustrate the methodology and the results obtained from integrated laser scanning activity in order to have precious architectural information useful not only from the cultural heritage point of view but also to construct more operative and powerful tools, such as BIM (Building Information Modelling aimed to the management of this cultural heritage. The Papal Basilica and the Sacred Convent of Saint Francis in Assisi in Italy are, in fact, characterized by unique and complex peculiarities, which require a detailed knowledge of the sites themselves to ensure visitor’s security and safety. For such a project, we have to take in account all the people and personnel normally present in the site, visitors with disabilities and finally the needs for cultural heritage preservation and protection. This aim can be reached using integrated systems and new technologies, such as Internet of Everything (IoE, capable of connecting people, things (smart sensors, devices and actuators; mobile terminals; wearable devices; etc., data/information/knowledge and processes to reach the desired goals. The IoE system must implement and support an Integrated Multidisciplinary Model for Security and Safety Management (IMMSSM for the specific context, using a multidisciplinary approach.

  18. Scan to Bim for 3d Reconstruction of the Papal Basilica of Saint Francis in Assisi in Italy

    Science.gov (United States)

    Angelini, M. G.; Baiocchi, V.; Costantino, D.; Garzia, F.

    2017-05-01

    The historical building heritage, present in the most of Italian cities centres, is, as part of the construction sector, a working potential, but unfortunately it requires planning of more complex and problematic interventions. However, policies to support on the existing interventions, together with a growing sensitivity for the recovery of assets, determine the need to implement specific studies and to analyse the specific problems of each site. The purpose of this paper is to illustrate the methodology and the results obtained from integrated laser scanning activity in order to have precious architectural information useful not only from the cultural heritage point of view but also to construct more operative and powerful tools, such as BIM (Building Information Modelling) aimed to the management of this cultural heritage. The Papal Basilica and the Sacred Convent of Saint Francis in Assisi in Italy are, in fact, characterized by unique and complex peculiarities, which require a detailed knowledge of the sites themselves to ensure visitor's security and safety. For such a project, we have to take in account all the people and personnel normally present in the site, visitors with disabilities and finally the needs for cultural heritage preservation and protection. This aim can be reached using integrated systems and new technologies, such as Internet of Everything (IoE), capable of connecting people, things (smart sensors, devices and actuators; mobile terminals; wearable devices; etc.), data/information/knowledge and processes to reach the desired goals. The IoE system must implement and support an Integrated Multidisciplinary Model for Security and Safety Management (IMMSSM) for the specific context, using a multidisciplinary approach.

  19. Did one ear infection in France change the history of Britain? The illness and death of Francis II (1544-60).

    Science.gov (United States)

    Srouji, Ibrahim Albert

    2009-11-01

    The middle ear has long been considered a continuum of the upper respiratory tract and modern physicians recognize the impact of upper respiratory tract pathology on the middle ear and are familiar with the possible neurosurgical complications of any resultant chronic or acute middle ear infection. In the 16th century, lack of this knowledge may have led to a sequence of events and one of the most important turning points for the British monarchy. This paper on the illness and death of King Francis II of France uncovers interesting aspects of ENT practice from the French Renaissance period and the intrigue surrounding this royal patient's well-documented but little discussed illness.

  20. Espíritos cheios de bichos: A fauna nas viagens de Louis Agassiz e Richard Francis Burton pelo Brasil oitocentista

    Directory of Open Access Journals (Sweden)

    Janaina Zito Losada

    2015-04-01

    Full Text Available O Brasil do século XIX foi alvo de inúmeras viagens realizadas por cientistas estrangeiros. O objetivo deste artigo é analisar as impressões sobre a fauna brasileira presentes nos relatos das viagens realizadas pelo naturalista suíço Louis Agassiz, em 1865, e pelo explorador inglês Richard Francis Burton, em 1868. Destes relatos privilegiam-se as descrições do meio natural de diferentes regiões brasileiras e das particularidades da fauna silvestre por eles encontrada.

  1. Modelos microscópicos de herança no século XIX: a teoria das estirpes de Francis Galton

    OpenAIRE

    Polizello, Andreza

    2009-01-01

    Francis Galton (1822-1911) trouxe importantes contribuições para diversos campos da ciência. Entre outras coisas, ele foi o fundador da Escola biometricista desenvolvida por Karl Pearson e Walter Frank Raphael Weldon. O objetivo desta dissertação é discutir as idéias de Galton acerca da herança desenvolvidas durante o período compreendido entre 1855 (quando ele publicou seus primeiros trabalhos sobre o assunto) e 1889 (quando ele publicou seu livro Natural inheritance), focalizando especialme...

  2. Mark, Prof. Herman Francis

    Indian Academy of Sciences (India)

    Academy Public Lecture. Posted on 19 January 2018. Seasonal and Pandemic Influenza by Prof. Kanta Subbarao 25 January 2018 at 1600 hrs. Ground floor, Main auditorium, New Biological Sciences Building, IISc. Event Poster ...

  3. okoronkwo, ike francis

    African Journals Online (AJOL)

    Valued Acer Customer

    submission here, I deploy the net (an abbreviation for the internet) as a cultural tool that has had great impact in ... JULY, 2014. internet) definitely records dissimilarities according to localities and this can also be traced to the ... observes: At no moment in history has the truth been clearer than it is today, that movement is the.

  4. Making and Selling the “Rock Star Pope”: The Celebritization of Pope Francis during His Five-Day Visit to the Philippines

    Directory of Open Access Journals (Sweden)

    Gerry M. Lanuza

    2017-12-01

    Full Text Available This paper is an attempt to provide an analysis of the celebritization and celebrification of Pope Francis when he visited the Philippines from January 15 to 19, 2015. Employing the analytic concept of “culture industry” developed by the members of the Frankfurt School, and combining it with the current analyses in existing celebrity study under late capitalism, this paper will show how the local giant media corporations, namely, GMA and ABS-CBN, staged a grand “media event” that nationally mediatized and publicly magnified the celebrity status of the so-called “rock star Pope.” The current study contributes to the growing literature on celebrity study by focusing on the popular and charismatic religious leader of 1.2 billion Catholics worldwide. Toward the end of this paper, consistent with the critical slant of the Frankfurt School’s critique of mass deception, it is argued that the celebrity culture that created the “spectacle” of Pope Francis must be distinguished from his prophetic message. And this must be explored in future studies.

  5. The rise and fall of central dogmas.

    Science.gov (United States)

    Klein, George; Klein, Eva

    2016-01-01

    Stimulated by Francis Cricks "central dogma of molecular biology" open to criticism and rebuttal, five statements are formulated on current notions of tumor biology, inviting the criticism of the reader.

  6. The Language of Colours. A Semiotic Analysis of Colours and Symbolic Imagery in Francis Ford Coppola’s "Bram Stoker’s Dracula" (1992

    Directory of Open Access Journals (Sweden)

    Veronika Bernard

    2011-10-01

    Full Text Available Reviews referring to Francis Ford Coppola’s Columbia Pictures Bram Stoker’s Dracula classic of 1992 recurrently mention the images owing to the camera work of Michael Ballhaus as the striking feature of the movie and highly praise them for their thematically coherent effect.. The colours, if mentioned at all, leave reviewers undecided to sceptical when it comes to evaluating their contribution to the overall composition of the film, though. By providing a semiotic analysis of colours and symbolic imagery the below article will show how colours and imagery in their inter-relatedness create coherence and cohesion with Coppola’s interpretation of Stoker’s Dracula as a religiously inspired morality play set in the context of Victorian cultural values and self-perception.

  7. Richard Francis Burton e a inserÃÃo do kama-sutras como um manual sexual entre os vitorianos (Inglaterra, 1883)

    OpenAIRE

    Felipe Salvador Weissheimer

    2014-01-01

    Dentre os vÃrios âKama-sutrasâ difundidos no mercado, a versÃo clÃssica foi escrita por Vatsyayana (sÃculo I-IV, aproximadamente) e publicada na Inglaterra em 1883 pela Sociedade Hindu Kama-Shastra. Richard Francis Burton foi o membro de maior importÃncia na Sociedade Hindu Kama-Shastra, pois, alÃm de fomentar a publicaÃÃo, auxiliou na traduÃÃo, editou e enunciou vÃrios comentÃrios ao longo da obra. Em seus comentÃrios, percebemos que o projeto da traduÃÃo e publicaÃÃo do Kama-sutras visava e...

  8. Human radiation studies: Remembering the early years: Oral history of cell biologist Don Francis Petersen, Ph.D., conducted November 29, 1994

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-08-01

    This report is a transcript of an interview of Dr. Don Francis Petersen by representatives of the US DOE Office of Human Radiation Experiments. Dr. Petersen was selected for this interview because of his long research career at Los Alamos and his knowledge of the Atomic Energy Commission`s biomedical program. Dr. Petersen did not personally conduct research on human subjects. After a brief biographical sketch Dr. Petersen discusses his remembrances of the early use of radionuclides as biological tracers, aspects of nuclear weapons testing in the 1940`s and 1950`s including fallout studies, the means by which research projects were approved, use of humans in the whole-body counter, and the Health Division Biomedical responsibilities.

  9. Los usos políticos del cuerpo: los dos cuerpos del rey en la filosofía política de Francis Bacon

    Directory of Open Access Journals (Sweden)

    Silvia Manzo

    2008-01-01

    Full Text Available Como figure destacada en el complejo escenario político de la transición entre la dinastía Tudor y la dinastía Estuardo de Inglaterra, Francis Bacon (1561-1626 adoptó la teoría de los dos cuerpos del rey en sus textos políticos y jurídicos. Su uso de esta teoría tiene una estrecha conexión con conceptos centrales de su filosofía natural que testimonia la profunda conexión que Bacon encuentra entre la política y la naturaleza. En este trabajo, analizaré su utilización de la teoría medieval de los dos cuerpos del rey y la vinculación que esta tiene con el resto de la filosofía baconiana. Tomaré como eje para el análisis su discurso sobre la naturalización de los escoceses nacidos después de la subida al trono de James I, donde Bacon trata el concepto de los dos cuerpos del rey con más profundidad.As a prominent intellectual figure in the complex political arena of England, during the transition from Tudor to Stuart dinasties, Francis Bacon (1561-1626 assumes the medieval King's two bodies theory in his political and juridical writings. His use of this theory is extremely linked to central concepts of his natural philosphy, which testifies to the deep connection that Bacon finds between politics and nature. This paper addresses Bacon's use of the King's two bodies theory and its link to the rest of the Baconian philosophy. The focus of this study will be his discourse on the naturalization of Scots born after James I assumption of power, where Bacon deals more deeply with the King's two bodies theory.

  10. Chemical Carcinogen-Induced Changes in tRNA Metabolism in Human Cells

    Science.gov (United States)

    1984-11-20

    According to the wobble hypothesis of codon-anticodon pairing proposed by Francis Crick , inosine in the first position of the anticodon of tRNAs could base...U,C,A *The purine and pyrimidine bases of the nucleosides listed in the table were predicted by Francis Crick to be able to base-pair in the tRNA...allopurinol proposed by Crick (2) states that inosine in the first position (Como n tof te aticdonof RN~, culdbas par wth ridne, DEAE-cellulose Column

  11. Temporal Influence on Awareness

    Science.gov (United States)

    1995-12-01

    Sensation and Perception (2nd Edition). Academic Press, Inc. 5. Crick , Francis and Christoff Koch. "The Problem of Consciousness." Scientific American...Distributed Assemblies: Simulations of Results from Cat Visual Cortex," Neural Computation, (2):293-307 (1990). 7. Francis , Gregory and Stephen Grossberg

  12. Study of the use of a micro hydro in knockdown container completed with a cylindrical form housing of francis hydraulic turbine to support the development program of energy self-sustainability for remote and isolated areas in Indonesia

    Directory of Open Access Journals (Sweden)

    Kamal Samsul

    2017-01-01

    It shows that the implementation of the unit in a remote area has reduced the total site construction time by 1/3 compared to the predicted one with conventional unit. The performance of the Francis turbine with cylindrical form housing has shown comparable with the conventional one which has volute form housing. The superiority was even more pronounced by introducing a deflection insert in its input flow channel. The insertion was capable to create more distributed flow into the runner. Efficiency of the turbine up to 80% was performed in this research. Local manufacture for turbine usually use many craft work and welding to built a volute form housing for the Francis turbine. The cylindrical form housing here has also proven significantly in reducing the time and price for the turbine manufacturing process.

  13. Gossip; Gift and Commodity in Francis Coventry’s History of Pompey the Little; or; The Life and Adventures of a Lap-Dog (1751

    Directory of Open Access Journals (Sweden)

    Ana Vogrinčič

    2007-06-01

    Full Text Available Francis Coventry’s History of Pompey the Little represents one of the better known examples of today otherwise neglected eighteenth-century English novels of non human-characters. By pointing at thus far unacknowledged dimensions of the text; the article challenges the established reading of the book as put forward by Liz Bellamy in the theory of the ‘novels of circulation’. According to Bellamy; the peregrinating animals and objects of these narratives represent circulating commodities and thus symbolize alienated commercial society. Demonstrating that Pompey the lapdog rather functions as a gift and a gossip; this essay offers an alternative interpretation which opens up a different perspective on Coventry’s representation of society. Following from this; the paper aims at situating Pompey the Little’ within broader socio-cultural context of eighteenth-century England; as well as reflects on its place in fiction of the period. As such it advocates socio-historical approaches to literature.

  14. Discussion of ``relationships between mineralization and silicic volcanism in the Central Andes'' by P.W. Francis, C. Halls and M.C.W. Baker

    Science.gov (United States)

    Clark, A. H.; Farrar, E.; Zentilli, M.

    1985-05-01

    In their stimulating paper, Francis et al. (1983) present convincing evidence for the association of several Central Andean tin and copper vein/stockwork deposits with felsic volcanic domes, rather than with stratovolcanoes (ef. Sillitoe, 1973). They also reexamine the problem of the relationships between caldera formation (and voluminous ash-flow tuff eruption) and large-scale hydrothermal activity (see e.g., McKee, 1979; Sillitoe, 1980), concluding that protracted cooling histories of sub-caldera plutons may be reflected in the long time lags (1-10 m.y.) documented between caldera collapse and superimposed mineralization. They cite, inter alia, the El Salvador porphyry copper deposit, northern Chile (lat. 26°17'S) as revealing such a sequence of events, and provide LANDSAT evidence for the presence of an extensively dissected, ca. 15 km wide, caldera in the mine area. We consider the authors' case to be persuasive in general, but suggest that their argument regarding El Salvador is weakened by an apparent mis-reading of Gustafson and Hunt's (1975) brief description of the pre-mineralization geological evolution of the Indio Muerto complex. In particular, they conflate two distinct episodes of subaerial volcanism. Because Mercado (1978) also in part misinterprets the regional and local stratigraphic relationships in her 1 : 25,000 geological map of the area, there is considerable potential for confusion.

  15. Repensar el Caribe desde los Estudios Culturales: Literatura, Nación, Racialidad y Género en Donnete Francis, April Shemak y Rosamond King

    Directory of Open Access Journals (Sweden)

    Marcelo José Cabarcas Ortega

    2015-01-01

    Full Text Available Desde los estudios literarios y culturales, estas autoras se unen a un creciente número de expertas interesadas en analizar el impacto de las dinámicas neoliberales en los aspectos étnicos, sexuales y de género en el Caribe, ya sea en el archipiélago o en sus bordes continentales. Respecto a este análisis se pueden afirmar, por lo menos, dos rasgos relevantes: el primero es la importancia otorgada a las nuevas diásporas y su efecto en la actualidad; el segundo es la necesidad de ampliar el archivo literario mediante la integración de la música, la fotografía y el performance al proceso tradicional de hermenéutica. Así, al plantearse formas más incluyentes de interpretación, la crítica busca superar lugares comunes ya desgastados por el excesivo uso y sintonizarse con las inquietudes de creadoras y creadores jóvenes respecto a las realidades de la migración y su influjo en el actual redimensionamiento político del cuerpo. En esa medida, April Shemak, Donnete Francis y Rosamond King y otras escritoras problematizan la idea de un Caribe de puro contacto y difusión.

  16. Toward an epistemology of nano-technosciences: Probing technoscience from a historical perspective: on today's surprising prevalence and relevance of Francis Bacon.

    Science.gov (United States)

    Schmidt, Jan C

    2011-12-01

    This paper aims to contribute to the attempts to clarify and classify the vague notion of "technosciences" from a historical perspective. A key question that is raised is as follows: Does Francis Bacon, one of the founding fathers of the modern age, provide a hitherto largely undiscovered programmatic position, which might facilitate a more profound understanding of technosciences? The paper argues that nearly everything we need today for an ontologically well-informed epistemology of technoscience can be found in the works of Bacon-this position will be called epistemological real-constructivism. Rather than realist or constructivist, empiricist or rationalist, Bacon's position can best be understood as real-constructivist since it challenges modern dichotomies. Reflection upon the contemporary relevance of Bacon could contribute to the expanding and critical discussion on technoscience. In the following I will reconstruct the term "technoscience". My finding is that at least four different understandings or types of the term "technoscience" co-exist. In a second step, I will analyze and elaborate on Bacon's epistemological position. I will identify central elements of the four different understandings in Bacon's work. Finally, I will conclude that the epistemology of technoscience is, indeed, very old-it is the epistemological position put forward by Bacon.

  17. Characterization of Fish Passage Conditions through a Francis Turbine, Spillway, and Regulating Outlet at Detroit Dam, Oregon, Using Sensor Fish, 2009

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, Joanne P.; Carlson, Thomas J.

    2011-05-06

    Fish passage conditions through two spillways, a Francis turbine, and a regulating outlet (RO) at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions, identifying potential fish injury regions within the routes. The study was performed in July, October, and December 2009 concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish data were analyzed to estimate 1) exposure conditions, particularly exposure to severe strike, collision, and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates. Comparison of the three passage routes evaluated at Detroit Dam indicates that the RO passage route through the 5-ft gate opening was relatively the safest route for fish passage under the operating conditions tested; turbine passage was the most deleterious. These observations were supported also by the survival and malady estimates obtained from live-fish testing. Injury rates were highest for turbine and spillway passage. However, none of the passage routes tested is safe for juvenile salmonid passage.

  18. Characterization of Fish Passage Conditions through a Francis Turbine and Regulating Outlet at Cougar Dam, Oregon, Using Sensor Fish, 2009–2010

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, Joanne P.

    2011-05-23

    Fish passage conditions through a Francis turbine and a regulating outlet (RO) at Cougar Dam on the south fork of the McKenzie River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers, Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions, identifying potential fish injury regions encountered during passage via specific routes. The RO investigation was performed in December 2009 and the turbine evaluation in January 2010, concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish data were analyzed to estimate 1) exposure conditions, particularly exposure to severe collision, strike, and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates. Comparison of the three passage routes evaluated at Cougar Dam indicates that the RO passage route through the 3.7-ft gate opening was relatively the safest route for fish passage under the operating conditions tested; turbine passage was the most deleterious. These observations were supported also by the survival and malady estimates obtained from live-fish testing. Injury rates were highest for turbine passage. Compared to mainstem Columbia River passage routes, none of the Cougar Dam passage routes as tested are safe for juvenile salmonid passage.

  19. The Nine Lives of Schroedinger's Cat

    OpenAIRE

    Schreiber, Zvi

    1995-01-01

    This MSc dissertation surveys nine interpretations of non-relativistic quantum mechanics. Extensive references are given. The interpretations covered are: the orthodox interpretation, Bohr's interpretation, the idea that the mind causes collapse, hidden variables, the many-worlds interpretation, the many-minds interpretation, Bohm's interpretation and two interpretations based on decoherent histories.

  20. Quantum measurements without Schroedinger cat states

    Energy Technology Data Exchange (ETDEWEB)

    Spehner, D [Institut Fourier, 100 rue des Maths, 38402 Saint-Martin d' Heres (France); Haake, F [Fachbereich Physik, Universitaet Duisburg-Essen, Lotharstrasse 1, 47048 Duisburg (Germany)

    2007-10-15

    We report and give an alternative derivation of some results on a model for a quantum measurement studied in [1]. The measured microscopic system is coupled to the position of a macroscopic pointer, which itself interacts with its environment via its momentum. The entanglement between the system and the pointer produced by their mutual interaction is simultaneous with the decoherence of distinct pointer readings resulting from leakage of information to the environment. After a discussion on the various time scales in the model we calculate the matrix elements of the system-pointer density operator between eigenstates of the measured observable with distinct eigenvalues. In general, the decay with time of these coherences is neither exponential nor gaussian. We determine the decoherence (decay) time in terms of the strength of the system-pointer and pointer-environment couplings. This decoherence time does not depend upon the details of the pointer-bath coupling as soon as it is smaller than the bath correlation time (non-Markov regime). In contrast, in the Markov regime it depends strongly on whether this coupling is Ohmic or super-Ohmic.

  1. Derivation of an applied nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Pitts, Todd Alan [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Laine, Mark Richard [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Schwarz, Jens [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Rambo, Patrick K. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Karelitz, David B. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2015-01-01

    We derive from first principles a mathematical physics model useful for understanding nonlinear optical propagation (including filamentation). All assumptions necessary for the development are clearly explained. We include the Kerr effect, Raman scattering, and ionization (as well as linear and nonlinear shock, diffraction and dispersion). We explain the phenomenological sub-models and each assumption required to arrive at a complete and consistent theoretical description. The development includes the relationship between shock and ionization and demonstrates why inclusion of Drude model impedance effects alters the nature of the shock operator. Unclassified Unlimited Release

  2. Solving Schroedinger's equation using random walks

    Science.gov (United States)

    Aspuru-Guzik, Alan

    Exact and almost exact solutions for energies and properties of atoms and molecules can be obtained by quantum Monte Carlo (QMC) methods. This thesis is composed of different contributions to various QMC methodologies, as well as applications to electronic excitations of biological systems. We propose a wave function optimization functional that is robust regarding the presence of outliers. Our work, and subsequent applications by others, has shown the convergence properties and robustness of the absolute deviation (AD) functional as compared to the variance functional (VF). We apply the method to atoms from the second row of the periodic table, as well as third-row transition metal atoms, including an all-electron calculation of Sc. In all cases, the AD functional converges faster than the VF. Soft effective core potentials (ECPs) with no divergence at the origin are constructed and validated for second- an third-row atoms of the periodic table. The ECPs we developed have been used by others in several successful studies. As an application of the DMC approach to biochemical problems, we studied the electronic excitations of free-base porphyrin and obtained results in excellent agreement with experiment. These findings validate the use of the DMC approach for these kinds of systems. A study of the role of spheroidene in the photo-protection mechanism of Rhodobacter sphaeroides is described. At the time of writing, calculations for the estimation of excitation energies for the bacteriochlorophyll and spheroidene molecules as well as storage of the random walkers for future prediction of the excitation energy transfer rate are being performed. To date, the calculations mentioned above are the largest all-electron studies on molecules. For the computation of these systems, a sparse linear-scaling DMC algorithm was developed. This algorithm provides a speedup of at least a factor of ten over previously published methods. The method is validated on systems up to 390 electrons. A summary of the Fermion Monte Carlo (FMC) algorithm as well as an application to the Be atom are discussed. The Zori package, a linear-scaling massively-parallel open-source program that uses modern programming libraries, was developed. The program is made available to the public under the GNU/General Public License (GPL). The capabilities of the Zori program are summarized.

  3. Collective impact of conventional cardiovascular risk factors and coronary calcium score on clinical outcomes with or without statin therapy: The St Francis Heart Study.

    Science.gov (United States)

    Waheed, Salman; Pollack, Simcha; Roth, Marguerite; Reichek, Nathaniel; Guerci, Alan; Cao, Jie J

    2016-12-01

    The efficacy of statin therapy remains unknown in patients eligible for statin therapy with and without elevated coronary calcium score (CAC). The study sought to evaluate how cardiovascular risk factors, expressed in terms of statin eligibility for primary prevention, and CAC modify clinical outcomes with and without statin therapy. We conducted a post-hoc analysis of the St. Francis Heart Study treatment trial, a double-blind, placebo-controlled randomized controlled trial of atorvastatin (20 mg), vitamin C (1 g), and vitamin E (1000 U) daily, versus placebos in 990 asymptomatic individuals with CAC ≥ 80th percentile for age and gender. Primary cardiovascular outcomes included non-fatal myocardial infarction or coronary death, coronary revascularization, stroke, and peripheral arterial revascularization. We further stratified the treatment and placebo groups by eligibility (eligible when statin indicated) for statin therapy based on 2013 ACC/AHA guidelines and based on CAC categories. After a median follow-up of 4.8 years, cardiovascular events had occurred in 3.9% of the statin treated but not eligible, 4.6% of the untreated and not eligible, 8.9% of the treated and eligible and 13.4% of the untreated and eligible groups, respectively (p300) occurred frequently in more than 35% of the statin not eligible subjects and was associated with a high 10-year event rate (≥17 per 100 person-years). Risk prediction improved significantly when both clinical risk profile and CAC score were combined (net reclassification index p = 0.002). Under the current statin treatment guidelines a small number of statin eligible subjects with low CAC might not benefit from statin therapy within 5 years. However, the statin not eligible subjects with high CAC have high event rate attributing to loss of opportunity for effective primary prevention. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. The Battle Between the Biometricians and the Mendelians: How Sir Francis Galton's Work Caused his Disciples to Reach Conflicting Conclusions About the Hereditary Mechanism

    Science.gov (United States)

    Gillham, Nicholas W.

    2015-01-01

    Francis Galton, Charles Darwin's cousin, had wide and varied interests. They ranged from exploration and travel writing to fingerprinting and the weather. After reading Darwin's On the Origin of Species, Galton reached the conclusion that it should be possible to improve the human stock through selective breeding, as was the case for domestic animals and cultivated plants. Much of the latter half of Galton's career was devoted to trying to devise methods to distinguish men of good stock and then to show that these qualities were inherited. But along the way he invented two important statistical methods: regression and correlation. He also discovered regression to the mean. This led Galton to believe that evolution could not proceed by the small steps envisioned by Darwin, but must proceed by discontinuous changes. Galton's book Natural Inheritance (1889) served as the inspiration for Karl Pearson, W.F.R. Weldon and William Bateson. Pearson and Weldon were interested in continuously varying characters and the application of statistical techniques to their study. Bateson was fascinated by discontinuities and the role they might play in evolution. Galton proposed his Law of Ancestral Heredity in the last decade of the nineteenth century. At first this seemed to work well as an explanation for continuously varying traits of the type that interested Pearson and Weldon. In contrast, Bateson had published a book on discontinuously varying traits so he was in a position to understand and embrace Mendel's principles of inheritance when they were rediscovered in 1900. The subsequent battle between Weldon and Pearson, the biometricians, and Bateson, the Mendelian, went on acrimoniously for several years at the beginning of the twentieth century before Mendelian theory finally won out.

  5. Investigation of the fluid-structure interaction of a high head Francis turbine using OpenFOAM and Code_Aster

    Science.gov (United States)

    Eichhorn, M.; Doujak, E.; Waldner, L.

    2016-11-01

    The increasing energy consumption and highly stressed power grids influence the operating conditions of turbines and pump turbines in the present situation. To provide or use energy as quick as possible, hydraulic turbines are operated more frequent and over longer periods of time in lower part load at off-design conditions. This leads to a more turbulent behavior and to higher requirements of the strength of stressed components (e.g. runner, guide or stay vanes). The modern advantages of computational capabilities regarding numerical investigations allow a precise prediction of appearing flow conditions and thereby induced strains in hydraulic machines. This paper focuses on the calculation of the unsteady pressure field of a high head Francis turbine with a specific speed of nq ≈ 24 min-1 and its impact on the structure at different operating conditions. In the first step, unsteady numerical flow simulations are performed with the open-source CFD software OpenFOAM. To obtain the appearing dynamic flow phenomena, the entire machine, consisting of the spiral casing, the stay vanes, the wicket gate, the runner and the draft tube, is taken into account. Additionally, a reduced model without the spiral casing and with a simplified inlet boundary is used. To evaluate the accuracy of the CFD simulations, operating parameters such as head and torque are compared with the results of site measurements carried out on the corresponding prototype machine. In the second part, the obtained pressure fields are used for a fluid-structure analysis with the open-source Finite Element software Code_Aster, to predict the static loads on the runner.

  6. Secondary flow fields in Francis turbines. Mapping and analyzing dynamics in rotor-stator interaction and draft tube flow with novel methods

    Energy Technology Data Exchange (ETDEWEB)

    Finstad, Paal Henrik Enger

    2012-07-01

    Hydropower, and especially Francis turbines, for electricity production has a history of more than 100 years and has proved to be one of the most efficient ways of utilizing renewable energy for electricity production. Yet, there are several problems to be solved regarding producing and running cost effective, high efficient and durable turbines. Secondary flow fields are all unwanted flow patterns present in the turbine. The major fluctuating flow fields in Francis turbines are caused by rotor-stator interaction when the runner vane passes the guide vane wake and the swirling flow in the draft tube at off-design operation. Such flow fields have a negative effect in terms of causing losses, vibrations, noise or damage to the turbine structure. The flow through a Francis turbine, especially at off-design operation is not optimal, and is characterized by a dynamic and fluctuating flow pattern. It is difficult, but important to understand the behavior of the dynamics to better predict the negative effects of the fluctuating flows, and also in order to minimize or remove the unwanted effects by e.g. geometry modifying or flow control.This work aims to introduce new methods helping to obtain a deeper understanding on the dynamics present in wake flow and in rotor-stator interaction. It is investigated whether vortex generators, VGs, can have a positive effect on the wake with respect to rotor-stator interaction. Experimental TRPIV (Transient Particle Image Velocimetry) wake data recorded at 10 000 Samples/sec from a cylinder in a stream at 1-6 m/s and hydrofoils in a stream at 9 m/s are studied. Both plain hydrofoils, and hydrofoils where Vortex Generators, VGs, are mounted are used in the study. The Reynolds number is in the range of 1.2x104, 7.3x105. The velocity fields from both the cylinder and the hydrofoils are used as inlet boundary condition in a 2D CFD-case simulating rotor-stator interaction. The characteristic frequencies of the system are the vortex shedding

  7. Preliminary study for the revitalisation of the 'Duersteller' small hydropower installation in Wetzikon, Switzerland; Vorstudie Kleinwasserkraftwerk J. Duersteler and Co AG Wetzikon ZH. Revitalisierungsvorhaben des Kraftwerkes mit seinen 80-jaehrigen Francis-Doppelturbinen

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-07-01

    This report for the Swiss Federal Office of Energy (SFOE) discusses the possibility of revitalising an 80-year-old, small industrial hydropower plant fitted with twin Francis turbines. The present situation and the condition of the turbines and their associated water channels are described and the hydrological data of the Aabach stream is presented. Details are given on the presently installed technical apparatus and the legal and ownership situation. Environmental and historical aspects are discussed. The economics of the proposed revitalisation project are discussed and possible restrictions that could be enforced by the authorities are looked at. The report is concluded with recommendations for further action.

  8. St Francis Hydro, Soils data

    Data.gov (United States)

    U.S. Environmental Protection Agency — We collected data 2012-2016 covering spatially-explicit, soil layering, bulk density, drainage rate (2012, 2015) infiltration into rain garden mulch and mineral soil...

  9. Identiteet ja migratsioon / Francis Fukuyama

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2007-01-01

    Autor peab islamiäärmuslust immigrantide identiteedikriisi ilminguks ning arutleb identiteedipoliitika olemuse ja tuleviku üle Euroopa ja Ameerika postmodernses multikultuurilises ühiskonnas. Vt. samas: Jeffrey Goldstein: Euroopa ja USA - konkurendid või partnerid

  10. Study of the use of a micro hydro in knockdown container completed with a cylindrical form housing of francis hydraulic turbine to support the development program of energy self-sustainability for remote and isolated areas in Indonesia

    Science.gov (United States)

    Kamal, Samsul; Prajitno; Pardadi, Janu

    2017-11-01

    With an intention to reduce the consumption of energy from fossil fuels and the CO2 emission in relation with the climate change solution, Indonesian Government has targeted that the role of the New and Renewable Energy (NRE) resources reaches at least 23% , or about 27 GW , in 2025 and it is expected to increase to the extent of about 134 GW in 2050 within the scenario of mixed energy supply. Geographically Indonesia has many remote and isolated areas with lack of appropriate infrastructure supports. But in the most of the areas, huge potential of new and renewable energy are available such as hydro energy is about 75 GW, biomass energy is about 32 GW and bio fuel is about 32 GW. The total utilization of the energy from small hydro energy up to this year for example is only about 300 MW. The significant obstacle in optimizing the utilization of small hydro energy in the areas is mainly on the infrastructure conditions and the local manufacture capabilities. Difficulties in mobilization of experts, skill worker , parts and constructions material result in very time consuming and costly for site construction. In this research a hydro turbine built in knock down container completed with a Francis turbine in cylindrical form housing is proposed and reported its performance on implementation. The hydro in a knock down container concept comes from the idea to manufacture hydro power solutions in a knock down container, readymade to be transported to installation sites. It can be easily manufactured in a quality controlled and cost effective environment, transported and installed in remote areas, to operate and maintain with minimal amount of equipment. It shows that the implementation of the unit in a remote area has reduced the total site construction time by 1/3 compared to the predicted one with conventional unit. The performance of the Francis turbine with cylindrical form housing has shown comparable with the conventional one which has volute form housing. The

  11. Intrathalamic mechanisms of visual attention.

    Science.gov (United States)

    Mayo, J Patrick

    2009-03-01

    The classical model of visual processing emphasizes the lateral geniculate nucleus (LGN) as the major intermediary between the retina and visual cortex. Yet, anatomical findings inspired Francis Crick to suggest an alternative model in which the thalamic reticular nucleus, which envelops the LGN, acts as the "guardian" of visual cortex by modulating LGN activity. Recent work by McAlonan and colleagues supports Crick's hypothesis, thereby enhancing our understanding of the early stages of visual processing.

  12. The discovery of the structure of DNA

    Science.gov (United States)

    Squires, G. L.

    2003-04-01

    On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

  13. Sheer Blue Milken Dreaminess:Galway Kinnell’s Answer to Logopoeia in “The Fly,” “Saint Francis and the Sow,” and “Blackberry Eating”

    Directory of Open Access Journals (Sweden)

    Tanya Long Bennett

    2010-08-01

    Full Text Available An analysis of Galway Kinnell's poems "The Fly, "Saint Francis and the Sow," and "Blackberry Eating," reveals Kinnell's treatment of the concept of logopoeia, a term coined by Ezra Pound to describe a particular use of language in poetry. Pound defined the term through illustration in the poems of Mina Loy and Jules Laforgue; it refers to the use of abstract, ironic vocabulary, which generates an objective, anti-sentimental, and satirical poetic stance. Kinnell, who adopts a distinctly Romantic role as a poet, nonetheless employs key aspects of logopoeia in order to adapt the Romantic ideology to the contemporary reader. Through a unique integration of Romantic sentiment with the intellectually playful, logopoeic use of diction, Kinnell produces poetry that both exploits and celebrates language and its multiple levels of meaning as well as addressing the painful wounds of the contemporary psych.

  14. An interview with Jim Smith.

    Science.gov (United States)

    Maartens, Aidan

    2017-08-01

    Jim Smith is Director of Science at the Wellcome Trust and a group leader at the Francis Crick Institute, where he was formerly Director of Research. A Fellow of both the Royal Society and the Academy of Medical Sciences, he was knighted for his services to medical research and science education in 2016. His lab works on mesoderm induction in the early vertebrate embryo. We met Jim in the Crick to hear about his life in science, his visions for the Crick and the Wellcome Trust, and his advice for early career scientists. © 2017. Published by The Company of Biologists Ltd.

  15. Virus Structure: From Crick and Watson to a New Conjecture

    CERN Document Server

    Iorio, Alfredo

    2007-01-01

    We conjecture that certain patterns (scars), theoretically and numerically predicted to be formed by electrons arranged on a sphere to minimize the repulsive Coulomb potential (the Thomson problem) and experimentally found in spherical crystals formed by self-assembled polystyrene beads (an instance of the generalized Thomson problem), could be relevant to extend the classic Caspar and Klug construction for icosahedrally-shaped virus capsids. The main idea is that scars could be produced at an intermediate stage of the assembly of the virus capsids and the release of the bending energy present in scars into stretching energy could allow for a variety of non-spherical capsids' shapes. The conjecture can be tested in experiments on the assembly of artificial protein-cages where these scars should appear.

  16. Non-Watson-Crick RNA synthesis suited to origin functions.

    Science.gov (United States)

    Puthenvedu, Deepa; Majerfeld, Irene; Yarus, Michael

    2018-01-01

    A templated RNA synthesis is characterized in which G5'pp5'G accelerates synthesis of A5'pp5'A from pA and chemically activated ImpA precursors. Similar acceleration is not observable in the presence of UppU, CppC, AppG, AppA, or pG alone. Thus, it seems likely that AppA is templated by GppG via a form or forms of G:A base-pairing. AppA also appears, more slowly, via a previously known untemplated second-order chemical route. Such AppA synthesis requires only ordinary near-neutral solutions containing monovalent and divalent salts, and rates are only slightly sensitive to variation in pH. Templated synthesis rates are first order in pA, ImpA, and template GppG; thus third order overall. Therefore, this reaction resembles cross-templating of AppA on poly(U), but is notably slower and less sensitive to temperature. Viewing AppA as a coenzyme analog, GppG templating provides a simpler molecular route, termed para-templating, to encoded chemical functions. Para-templating can also arise from a single, localized nucleobase geosynthetic event which yields purines. It requires only a single backbone-forming chemistry. Thus it may have appeared earlier and served as evolutionary precursor for more complex forms of encoded genetic expression. © 2018 Puthenvedu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. Cortical Thought Theory: A Working Model of the Human Gestalt Mechanism.

    Science.gov (United States)

    1985-07-01

    of Josh McDowell, and then Francis Schaeffer, for the support of this statement.) Therefore, the third and fourth foundational presuppositions of...Cambridge, Mass: MIT Press, 196r - 23. Christofides, Nicos. E Tey: An Algorithm Approach. Academic Press: London, 1975. 24. Crick , F.H.C. "Thinking About the...Perception. Edited by A.T. Welford and L.H. Houssiadas. Taylornand- Francis Ltd: London, pp. 129-147, 1970. 61. Kandel, Eric R. "Small Systems of

  18. Francis Bacon or Diego Velázquez in a dentist’s chair” – pictorial and other kinds of quotations as an addition to a disintegrating life

    Directory of Open Access Journals (Sweden)

    Arent van Nieukerken

    2014-01-01

    Full Text Available The mature poetry of Tadeusz Różewicz seems to be at odds with both modernist and postmodern literary tenets. It undeniably makes abundant use of intertextuality (including self-quotations, but in spite of this [post]modernist tendency it does resist self-referential impersonality. Różewicz again immerses allusions to images, texts and other artifacts – which, according to formalist and structuralist interpretations, should disengage themselves from an artist’s biography in order to achieve aesthetic autonomy – in the current of life, devoid of an innate sense and always identical to itself. In fact, life cannot be apprehended by art, and precisely, Różewicz tries to thematize this impossibility by producing texts or rather poetical acts that could be classified as self-effacing artifacts. He even succeeded in discrediting the modernist epiphany (which has a double status, i.e. as a poetical device and a window on the transcendent by replacing it with loquacious anticlimaxes. The fragmentary, disintegrating form of his later poetry (the long poem “Francis Bacon or Diego Velázquez in a dentist’s chair” is a perfect – or rather consciously imperfect – implementation of this form does not pretend to be a representation of a human being’s disintegrating existence. This poetry is, above all, an existential act, or – in other words – a performance, and not a self-sufficient work of art.

  19. The role of biotechnology in the socio-economic advancement and ...

    African Journals Online (AJOL)

    Since 1953, when James Watson and Francis Crick identified the structure of deoxyribonucleic acid (DNA) as the genetic basis of all living organisms, the scientific understanding of biological and genetic processes has dramatically accelerated. The present molecular techniques such as cloning, genetic engineering, ...

  20. Commentary

    Indian Academy of Sciences (India)

    Unknown

    Biotechnology may change the world. Given the chances and risks of this new technology, the key question from an economic point of view is whether incentives and regulation are appropriate. Both allocational and distributional effects turn out to be important. Since James Watson and Francis Crick published their seminal ...

  1. Author Affiliations

    Indian Academy of Sciences (India)

    ... Scientific Data of Public Interest · Events · Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia. Home; Journals; Journal of Genetics; Volume 83; Issue 2. Francis Crick (1916–2004). Graeme Mitchison. Obituary Volume 83 Issue 2 August 2004 ...

  2. Ten Years of Reform in Primary Mathematics Education in England a Review of Effectiveness

    Science.gov (United States)

    2008-01-01

    W. and Deakin Crick , R., 2002, A systematic review of the impact of summative assessment and tests on students’ motivation for learning, Research...pp. 32–48). New York, NY: Routledge/Taylor and Francis . Wood, T. 1999, ‘Creating a context for argument in mathematics class.’ Journal for Research

  3. Technical Writing for Software Engineers

    Science.gov (United States)

    1990-05-01

    Chrlstensen78 Christensen, Francis , and Christensen, Bonniejean. Notes Toward a New Rhet- oric: Nine Essays for Teachers. New York: Harper & Row, 1978...science is rhetorical. Salient as- pects of the rhetoric ofscience are illustrated by Crick and Watson’s discovery of the structure of DNA, as recorded

  4. The History of Molecular Structure Determination Viewed through the Nobel Prizes.

    Science.gov (United States)

    Jensen, William P.; Palenik, Gus J.; Suh, Il-Hwan

    2003-01-01

    Discusses the importance of complex molecular structures. Emphasizes their individual significance through examination of the Nobel Prizes of the 20th century. Highlights prizes awarded to Conrad Rontgen, Francis H.C. Crick, James D. Watson, Maurice H.F. Wilkins, and others. (SOE)

  5. Development of Material Properties for Slurry Infiltrated Fiber Concrete (SIFCON)--Flexural Strength

    Science.gov (United States)

    1988-09-01

    at ultimate SIFCON strength Strength and deflection, A--The average calculated strength and measured deflection at the first crick point. Slope--The...Major equipment Specimen molding equipment Scale: Pelouze Scale Co. Model 333755, 206-lb capacity Mortar mixer: Francis Wagner, electric 6-ft 3

  6. A Two-Dimensional Multielectrode Microprobe for the Visual Cortex.

    Science.gov (United States)

    1979-12-01

    to Kabrisky’s pattern recognition theories. 89 _______________________________________ * ( Bibliography I. Crick , F. H. C. "Thinking About the Brai...Problems in Per- ception, A. T. Welford, Editor (129-147). London,- Taylor and Francis Ltd., 1970 3. Hubel, D. H. and T. N. Wiesel. "Brain Mechanisms

  7. The protein side of the central dogma: permanence and change.

    Science.gov (United States)

    Morange, Michel

    2006-01-01

    There are two facets to the central dogma proposed by Francis Crick in 1957. One concerns the relation between the sequence of nucleotides and the sequence of amino acids, the second is devoted to the relation between the sequence of amino acids and the native three-dimensional structure of proteins. 'Folding is simply a function of the order of the amino acids,' i.e. no information is required for the proper folding of a protein other than the information contained in its sequence. This protein side of the central dogma was elaborated in a scientific context in which the characteristics and functions of proteins, and the mechanisms of protein folding, were seen very differently. This context, which made the folding problem a simple one, supported the bold proposition of Francis Crick. The protein side of the central dogma was not challenged by the discovery of prions if one adopts the definition of information given by Francis Crick. It might have been challenged by the discovery that regulatory enzymes exist in different conformations, and the evidence for the existence of chaperones assisting protein folding. But it was not, and folding remains what it was for Francis Crick, 'simply a function of the order of amino acids'. But the meaning of 'function' has dramatically changed. It is no longer the result of simple physicochemical laws, but that of a long evolutionary process which has optimized protein folding. Molecular mechanistic explanations have to be allied with evolutionary explanations, in a way characteristic of present biology.

  8. Physiologically-Based Vision Modeling Applications and Gradient Descent-Based Parameter Adaptation of Pulse Coupled Neural Networks

    Science.gov (United States)

    1997-06-01

    Transactions on Systems, Man and Cybernetics, vol.SMC- 13, no.5, p. 815-26 (1983). 14. Crick , F. and C. Kosch. "The problem of consciousness." Mind and Brain...cortical maps via synchronization," Parallel Pro- cessing in Neural Systems and Computers, p. xv+626, 101-4 (1990). 25. Francis , Gregory and Stephen

  9. Proceedings of USAF Structural Integrity Program (ASIP, ENSIP) conference Held in Sacramento, California on 2-4 December 1986

    Science.gov (United States)

    1986-12-01

    conceots nave been accepted on craclJre necnanics techniques were used for all t’e basis of increaset safety. Clearly Vhe :LZ crick jrowth calculations...Brussels (Belgium) Francis Chang William D. Cowie General Dynamics 1841 Trebein Rd. MZ 5984 Xenia, OH 45385 P.O. Box 748 Forth Worth, TX 76101 Matt Creager

  10. The Search for Symmetries in the Genetic Code:

    Science.gov (United States)

    Antoneli, Fernando; Forger, Michael; Hornos, José Eduardo M.

    We give a full classification of the possible schemes for obtaining the distribution of multiplets observed in the standard genetic code by symmetry breaking in the context of finite groups, based on an extended notion of partial symmetry breaking that incorporates the intuitive idea of "freezing" first proposed by Francis Crick, which is given a precise mathematical meaning.

  11. Allies and Competitors as Enscripted Audiences in Scientific Writing.

    Science.gov (United States)

    Perry, Susan

    A set of much examined scientific papers which specifically portray a controversial topic and also manifest ally-peer and competitor-peer enscripted audiences are those written by James Watson and Francis Crick concerning their discovery of the structure of deoxyribose nucleic acid (DNA). The theoretical perspective of an ally-peer and…

  12. Toward the 'new century'of handedness in biology: In ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 41; Issue 2. Toward the 'new century' of handedness in biology: In commemoration of the 100th anniversary of the birth of Francis Crick. Koji Tamura. Clipboard Volume 41 Issue 2 June 2016 pp 169-170 ...

  13. Studies in Wave-Material Interaction and Design of Composite Materials

    Science.gov (United States)

    1990-08-10

    at the interface of any two homogeneous isotropic chiral media, provided that they are impedance-matched. 0950-0340189 S300 () 1989 Taylor & Francis ...examples include the famous Watson- Crick double-helix representation of the DNA molecule. But the underlying principle behind chirality is the mirror

  14. Excursions into Diverse Fields

    Indian Academy of Sciences (India)

    his biology sabbatical year he got to know James Watson, Francis. Crick, and other well-known biologists and became friends with them. The experience of his year in the biology department that pleased. Feynman the most was the response to him as a 'graduate teach- ing assistant'! In biology they put the students through ...

  15. Commentary

    Indian Academy of Sciences (India)

    Unknown

    2004-11-29

    Nov 29, 2004 ... Watson was the leader in the construction of the model, adopting a strategy previously used by Linus Pauling for the study of proteins. Given his excellent knowledge of crystallography and X-ray diffraction, Francis Crick had all the skills required to pro- vide the firm materials for the elaboration of the model ...

  16. Confronting Science: The Dilemma of Genetic Testing.

    Science.gov (United States)

    Zallen, Doris T.

    1997-01-01

    Considers the opportunities and ethical issues involved in genetic testing. Reviews the history of genetics from the first discoveries of Gregor Mendel, through the spurious pseudo-science of eugenics, and up to the discovery of DNA by James Watson and Francis Crick. Explains how genetic tests are done. (MJP)

  17. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 41; Issue 2. Issue front cover thumbnail. Volume 41, Issue 2. June 2016, pages 169-324. pp 169-170 Clipboard. Toward the 'new century' of handedness in biology: In commemoration of the 100th anniversary of the birth of Francis Crick · Koji Tamura · More Details Abstract ...

  18. The birth and development of the DNA theory of inheritance: sixty ...

    Indian Academy of Sciences (India)

    These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after ...

  19. X-Ray Diffraction and the Discovery of the Structure of DNA

    Science.gov (United States)

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  20. Mad Pursuit

    Indian Academy of Sciences (India)

    The book under review is by a giant in the field of molecular biology who is being honoured in this issue of Resonance, Francis. Crick. As the subtitle says, the book gives his. "personal view of scientific discovery". There is no better way to introduce the book than to repeat the quotation from Oscar Wilde given.

  1. Perspectives

    Indian Academy of Sciences (India)

    Unknown

    rees, no interviews – just gifted, highly motivated people picked by a few men of good judgement”. Max ran the lab in this spirit and spent most of his time on haemoglo- bin crystallography. Likewise John Kendrew, on myoglo- bin. At the other end from crystallography was molecular genetics with Francis Crick and Sydney ...

  2. The Discovery of the Double Helix

    CERN Multimedia

    CERN. Geneva

    2011-01-01

    Professor James D. Watson has kindly agreed to make a presentation on the 1953 finding of the Double Helix at the Cavendish Laboratory by Francis Crick and himself. Being one of the greatest scientific discoveries in human history, little else needs to be added.

  3. Consciousness.

    Science.gov (United States)

    Sejnowski, Terrence J

    2015-01-01

    No one did more to draw neuroscientists' attention to the problem of consciousness in the twentieth century than Francis Crick, who may be better known as the co-discoverer (with James Watson) of the structure of DNA. Crick focused his research on visual awareness and based his analysis on the progress made over the last fifty years in uncovering the neural mechanisms underlying visual perception. Because much of what happens in our brains occurs below the level of consciousness and many of our intuitions about unconscious processing are misleading, consciousness remains an elusive problem. In the end, when all of the brain mechanisms that underlie consciousness have been identified, will we still be asking: "What is consciousness?" Or will the question shift, just as the question "What is life?" is no longer the same as it was before Francis Crick?

  4. Genetic, epigenetic and exogenetic information in development and evolution.

    Science.gov (United States)

    Griffiths, Paul E

    2017-10-06

    The idea that development is the expression of information accumulated during evolution and that heredity is the transmission of this information is surprisingly hard to cash out in strict, scientific terms. This paper seeks to do so using the sense of information introduced by Francis Crick in his sequence hypothesis and central dogma of molecular biology. It focuses on Crick's idea of precise determination. This is analysed using an information-theoretic measure of causal specificity. This allows us to reconstruct some of Crick's claims about information in transcription and translation. Crick's approach to information has natural extensions to non-coding regions of DNA, to epigenetic marks, and to the genetic or environmental upstream causes of those epigenetic marks. Epigenetic information cannot be reduced to genetic information. The existence of biological information in epigenetic and exogenetic factors is relevant to evolution as well as to development.

  5. Embedded solitons in the third-order nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Pal, Debabrata; Ali, Sk Golam; Talukdar, B [Department of Physics, Visva-Bharati University, Santiniketan 731235 (India)], E-mail: binoy123@bsnl.in

    2008-06-15

    We work with a sech trial function with space-dependent soliton parameters and envisage a variational study for the nonlinear Schoedinger (NLS) equation in the presence of third-order dispersion. We demonstrate that the variational equations for pulse evolution in this NLS equation provide a natural basis to derive a potential model which can account for the existence of a continuous family of embedded solitons supported by the third-order NLS equation. Each member of the family is parameterized by the propagation velocity and co-efficient of the third-order dispersion.

  6. Schroedinger's interpolation problem through Feynman-Kac kernels

    OpenAIRE

    Garbaczewski, P.

    1998-01-01

    We discuss the so-called Schr{\\"o}dinger problem of deducing the microscopic (basically stochastic) evolution that is consistent with given positive boundary probability densities for a process covering a finite fixed time interval. The sought for dynamics may preserve the probability measure or induce its evolution, and is known to be uniquely reproducible, if the Markov property is required. Feynman-Kac type kernels are the principal ingredients of the solution and determine the transition ...

  7. Evaluation of eigenvalues of a smooth potential via Schroedinger ...

    Indian Academy of Sciences (India)

    Author Affiliations. Basudeb Sahu1 Bidubhusan Sahu1 Santosh K Agarwalla2. Department of Physics, North Orissa University, Baripada 757 003, India; Department of Applied Physics and Ballistics, Fakir Mohan University, Balasore, India ...

  8. Intestinal volvulus at St Francis Hospital, Kampala.

    African Journals Online (AJOL)

    53 males and seven females. The ages of sigmoid volvulus ... parietes or to the female pelvic organs. The objective of this study was ... Others (1 per tribe) 15. 25.1. TOTAL. 60. 100. Peasant / farmer. Business. Builder. Driver. Policeman. Butcher. Student. Engineer. Teacher. Technician. Pastor. Others. Not recorded. TOTAL ...

  9. 749-IJBCS-Article-Awah Francis M

    African Journals Online (AJOL)

    DR GATSING

    reduction of nitro blue tetrazolium (NBT) as described by Martinez et al. (2001) with slight modifications (Awah et al., 2010). Briefly, each 3.0 ml reaction mixture contained 0.05. M PBS (pH 7.8), 13 mM methionine, 2 μM riboflavin, 100 μM EDTA, NBT (75 μM) and. 1.0 ml of test sample solutions. The tubes were kept in front of ...

  10. Intestinal volvulus at St Francis Hospital, Kampala.

    African Journals Online (AJOL)

    Other varieties of volvulus, including small bowel (ileo-ileal) or ileocaecal, neonatal and transverse colonic volvulus, are very rarely seen. Khada et all1 reported that transverse colon volvulus constitutes only 1-3% of all colonic volvulus. Among the possible aetiologies they proposed are congenital malrotations of the gut, ...

  11. Dvorak. Concerto pour violoncelle / Francis Dresel

    Index Scriptorium Estoniae

    Dresel, Francis

    1992-01-01

    Uuest heliplaadist "Dvorak. Concerto pour violoncelle; Schumann: Concerto pour violoncelle. Orchestre Symphonique d'Estonie, Orchestre Symphonique de la Radio TV d'URSS, Neeme Järvi" Vogue "Archives Sovietiques" 651033 1978

  12. Francis Gilbert“, Samy Zalatz' and Fayez Semidap

    African Journals Online (AJOL)

    evolutionary ecology, under many different guises in the literature: reciprocal adaptation, arms races, or the 'Red Queen' hypothesis. The strongly subdivided habitat of the Sinai mountains is an ideal place in which to study micro- coevolution, coevolutionary differences between populations of the same coevolved species.

  13. Kunstnik avaldas kaaluta olekus austust Francis Baconile

    Index Scriptorium Estoniae

    2008-01-01

    Projekti "teha kunsti ebapraktilistes kohtades" raames tegid Londoni kunstnikud Nasser Azam ja Lyn Hagan kunsti paraboloidsel spetsiaallennul kaaluta olekus. Hagan filmis kassi ja hiirt ning Azam lõpetas kuus õlimaali

  14. 317-IJBCS-Article-Ngome Ajebesone francis

    African Journals Online (AJOL)

    Dr Gatsing

    organic P source. The mineral P and the FYM were applied at planting. The mineral N was top- dressed one month after crop emergence in a circular mode around the stems of the plants. All plots were kept weed-free throughout the experiment. No inoculants, fungicides or pesticides were used. Sample preparations.

  15. Francis Bacon On Understanding, Reason and Rhetoric

    Science.gov (United States)

    Wallace, Karl R.

    1971-01-01

    Bacon's views of the faculties of understanding and reason are presented and explained in reference to Baconian rhetoric. Understanding, Rhetoric, Insinuative and Imaginative Reason are defined. (Author/MS)

  16. St Francis Nursing Home, Kilkerrin, Ballinasloe, Galway.

    LENUS (Irish Health Repository)

    Raza, Kazim

    2012-02-01

    BACKGROUND AND IMPORTANCE: We report the case history of solitary hypoglossal paraganglioma in a 64-year-old woman. The surgical difficulties encountered in the removal of this challenging tumor are discussed and as a literature review provided. CLINICAL PRESENTATION: A 64-year-old woman presented with a short history of dysphonia, occasional dysphagia, tinnitus, altered taste, and unilateral left-sided tongue wasting. On examination, there was left lower motor hypoglossal paralysis. Imaging showed a discrete enhancing lobulated mass, measuring 2 x 2 cm, in the region of the hypoglossal nerve extending into the hypoglossal canal suggestive of hypoglossal paraganglioma. A left dorsolateral suboccipital craniotomy was performed with the patient in the sitting position. The hypoglossal nerve appeared to be enlarged, and the jugular foramen was normal. Complete surgical debulking of the tumor was not attempted because of its vascular nature. The nerve was decompressed, and neuropathology confirmed a low-grade paraganglioma arising from the hypoglossal nerve. The patient was scheduled to receive stereotactic radiation for further management. CONCLUSION: When a case of solitary hypoglossal paraganglioma is encountered in clinical practice, the aim of management should be mainly focused on achieving a diagnosis and preserving the hypoglossal nerve function. If there is evidence of vascularity in the lesion noted on magnetic resonance imaging, a preoperative angiogram should be obtained with a view for embolization. We decompressed the hypoglossal canal and achieved good improvement in the patient\\'s symptoms. We recommend stereotactic radiosurgery for remnant and small hypoglossal tumors and regular follow-up with magnetic resonance imaging scans.

  17. Ajalugu ajaloo lõpus / Francis Fukuyama

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2007-01-01

    Ilmunud ka: Molodjozh Estonii 3. apr. lk. 13. Autor käsitleb USA presidendi George W. Bushi põhjendusi sissetungil Iraaki. Ta ütleb, et ammu enne liberaalset demokraatiat peab olemas olema funktsioneeriv riik. Demokraatlikke ümberkorraldusi peavad juhtima ühiskonnad, mis ise tahavad demokraatiat, välised jõud saavad kaasa aidata, aga sunduslik režiimimuutus pole kunagi olnud demokraatiasse siirdumise võti

  18. Iraan Suurbritannia vastu : kes paindus? / Francis Fukuyama

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke 17. apr. lk. 7. Iraani sisepoliitikast seoses 15 Briti mereväejalaväelase arreteerimise ja vabastamisega, Iraani probleemist Islami Revolutsioonilise Kaardiväe (IRGC või Pasradan) ja sellega liidusuhetes olevate institutsioonidega nagu Basj sõjaväeline rühmitus. Autori arvates tahtsid mõned Iraani rühmitused teravdada vastasseisu Suurbritannia ja USA-ga

  19. Francis Fukuyama : demokraadid oleksid pidanud juba ammu võitma / Francis Fukuyama

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2008-01-01

    Politoloog usub, et George W. Bushi valitsuse unilateraalsus oli lihtsalt tema valitsusaja fenomen, president Barack Obama valitsus pühenduks põhimõtteliselt multilateraalsusele. Autori hinnangul on Gruusia ja Ukraina NATO-liikmesuse tagant torkimine vastutustundetu, sest nende osas on 5. artikli kohustusi võimatu täita. NATO ainuke õige vastus Venemaa tegevusele Gruusias oleks kaasata Soome. Terrorismivastasest sõjast

  20. Das DNA-Puzzle

    Science.gov (United States)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  1. Property Screening and Evaluation of Ceramic Turbine Engine Materials

    Science.gov (United States)

    1979-10-01

    doped with 1% MgO, 8% Y2 03, and 15% Y20 3 ) were of lower strength than the Norton NC-132 and NCX- 34 materials, Slow crick growth was in evidence...T.L. Francis and R.L. Coble, "Creep of Polycrystalline Silicon Carbide," Jour. Amer. Ceram. Soc., 51(2) pp. 115-6 (1968). 44. P.L. Farnsworth and R.L

  2. Do cells care about physics?

    Science.gov (United States)

    Guck, Jochen

    2009-07-01

    Ever since James Watson and Francis Crick cracked the code of life and laid the foundations for molecular biology, biologists have almost exclusively focused on the molecular aspects of biological systems. This cumulated in the mapping of the entire human genome a few years ago-the entire blueprint of every cell. So, does that mean we can stop? Is everything known that we can possibly know about cells? Far from it.

  3. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  4. The double helix and the 'wronged heroine'.

    Science.gov (United States)

    Maddox, Brenda

    2003-01-23

    In 1962, James Watson, Francis Crick and Maurice Wilkins received the Nobel prize for the discovery of the structure of DNA. Notably absent from the podium was Rosalind Franklin, whose X-ray photographs of DNA contributed directly to the discovery of the double helix. Franklin's premature death, combined with misogynist treatment by the male scientific establishment, cast her as a feminist icon. This myth overshadowed her intellectual strength and independence both as a scientist and as an individual.

  5. A representação do Cristo Seráfico na igreja da Ordem Terceira de São Francisco da Penitência do Rio de Janeiro The representation of the Seraphic Christ in the church of the Tertiary Order of Saint Francis Penitent in Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Márcia Cristina Leão Bonnet

    2008-12-01

    Full Text Available O presente artigo se propõe a investigar as origens iconográficas da representação do Cristo Seráfico, presente no retábulo-mor da Igreja da Ordem Terceira de São Francisco da Penitência do Rio de Janeiro. Através da utilização de fontes textuais e iconográficas, busca-se localizar as origens da representação e sua vinculação ao culto de franciscano, desde o surgimento da representação, na Idade Média, até o século XVIII, quando se acredita que possa ter ocorrido a fatura da peça em questão.This article intends to investigate the iconographic origins a representation of the Seraphic Christ, present in the main altarpiece of the Church of the Tertiary Order of Saint Francis Penitent in Rio de Janeiro. Using textual and iconographical sources the present paper will endeavour to locate the origins of the representation and its connections to the Franciscan cult since the appearance of the representation in the Middle Ages to the 18th century, when I believe that the work in question may have been conceived.

  6. Microalgae as a source of biofuels | Francis | International Journal of ...

    African Journals Online (AJOL)

    A number of bio-feedstocks are currently being experimented for biodiesel production and usage. Algal biomass has emerged as one of the most promising sources of biodiesel production. Although research into algae as a potential source of biodiesel is not new, the current oil crises and fast depleting fossil oil reserves ...

  7. Microalgae as a source of biofuels | Francis | International Journal of ...

    African Journals Online (AJOL)

    International Journal of Biological and Chemical Sciences. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 8, No 3 (2014) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF ...

  8. Women and sustainable fisheries exploitation: A review | Francis ...

    African Journals Online (AJOL)

    The biological attributes of these fauna and flora render them amenable to usage in manners that still allows their continuous existence for the profit of mankind. ... ecosystem-based approaches to fishery management; including simplified principles embedded within international instruments that form the legal frame work ...

  9. Programmatic Environmental Assessment, Francis E. Warren Air Force Base, Wyoming

    Science.gov (United States)

    2005-12-17

    the base has established a compost program. The facility accepts biodegradable materials such as wood landscaping materials, grass clippings ...intersecting grass runways. The airfield is generally compatible with surrounding area land uses. Accident Potential Zones (APZs) have been established... grasses ) dominates the base, covering over half the area. The largest concentrations of the grasses are found in the northern sectors of the base and

  10. Multi-fidelity design optimization of Francis turbine runner blades

    Science.gov (United States)

    Bahrami, S.; Tribes, C.; von Fellenberg, S.; Vu, T. C.; Guibault, F.

    2014-03-01

    A robust multi-fidelity design algorithm has been developed, focusing to efficiently handle industrial hydraulic runner design considerations. The computational task is split between low- and high-fidelity phases in order to properly balance the CFD cost and required accuracy in different design stages. In the low-fidelity phase, a derivative-free optimization method employs an inviscid flow solver to obtain the major desired characteristics of a good design in a relatively fast iterative process. A limited number of candidates are selected among feasible optimization solutions by a newly developed filtering process. The main function of the filtering process is to select some promising candidates to be sent into the high-fidelity phase, which have significantly different geometries, and also are dominant in their own territories. The high-fidelity phase aims to accurately evaluate those promising candidates in order to select the one which is closest to design targets. A low-head runner case study has shown the ability of this methodology to identify an optimized blade through a relatively low computational effort, which is significantly different from the base geometry.

  11. Development of a 5kw Francis Turbine Runner Using Computation ...

    African Journals Online (AJOL)

    First Lady

    ASME Journal of fluid Engineering. Jingchun W, Katsumasa S, Kiyohito T, Kazuo N, and Joushirou S (2007),. ―CFD-Based Design Optimization for Hydro Turbines‖. Journal of. Fluids Engineering, Vol. 129/159. Pg. 159 – 168. Ruprecht A, Maihöfer M, Heitele M and Helmrich T (2002). ―Massively parallel computation of ...

  12. Borodin: Les 3 Symphonies. Le Prince Igor / Francis Dresel

    Index Scriptorium Estoniae

    Dresel, Francis

    1992-01-01

    Uuest heliplaadist "Borodin: Les 3 Symphonies. Le Prince Igor: Ouverture. Danse des jeunes filles polovtsiennes. Danses polovtsiennes. Notturno. Dans les Steppes de l'Asie centrale. Petite Suite. Choeur et Orchestre Symphonique de Göteborg, Neeme Järvi" DG 435 757-2

  13. Francis Bacon and the Art-Nature Distinction.

    Science.gov (United States)

    Weeks, Sophie

    2007-07-01

    Commentators generally expound Bacon's position on the art-nature relationship in terms of how much it retained or departed from traditional conceptions. This paper argues that an appreciation of the Baconian meaning of the terms "art" and "nature" requires a close examination of his wider cosmogonical speculations. Bacon's cosmogonical account moves from a state of unbridled chaos to the relatively stable system for which the term "nature" is normally used. The fundamental principle lying at the heart of Baconian cosmogony is an enriched and appetitive matter: eternal, unchanging, and the plenipotentiary source of all things. Successive limitations of matter's absolute power produced a lazy and habitual nature, which Bacon labelled "nature free." To shift nature from this otiose condition, the Baconian operator recapitulates the original binding of matter. Bacon designated the systematic procedures of binding nature the science of magic. Magic is Bacon's human counterpart to the original cosmogonical process that gave rise to the current system of nature. In Bacon's cosmogony, all possible worlds unfold out of matter: the function of art is to shake out nature's hidden folds. Hence, the distinction between naturalia and artificialia maps on to the distinction between actual and potential. Nature free is without purpose, but art - nature bound - knowingly brings into being an alternative nature designed for human utility.

  14. Occam, Francis Bacon and the transformation of Zambian society

    NARCIS (Netherlands)

    Binsbergen, W.M.J.

    1977-01-01

    Review of Robert H. Bates, Rural Responses to Industrialization: A Study of Village Zambia, New Haven & London, 1976. Even though this book is important because it is a major step towards asking the right questions concerning the transformation of Central-African society, the reviewer argues that

  15. Francis Bacon and the classification of natural history.

    Science.gov (United States)

    Anstey, Peter

    2012-01-01

    This paper analyses the place of natural history within Bacon's divisions of the sciences in The Advancement of Learning (1605) and the later De dignitate et augmentis scientiarum (1623). It is shown that at various points in Bacon's divisions, natural history converges or overlaps with natural philosophy, and that, for Bacon, natural history and natural philosophy are not discrete disciplines. Furthermore, it is argued that Bacon's distinction between operative and speculative natural philosophy and the place of natural history within this distinction, are discontinuous with the later distinction between experimental and speculative philosophy that emerged in the methodology of the Fellows of the early Royal Society.

  16. Francis Bacon's natural history and civil history: a comparative survey.

    Science.gov (United States)

    Manzo, Silvia

    2012-01-01

    The aim of this paper is to offer a comparative survey of Bacon's theory and practice of natural history and of civil history, particularly centered on their relationship to natural philosophy and human philosophy. I will try to show that the obvious differences concerning their subject matter encompass a number of less obvious methodological and philosophical assumptions which reveal a significant practical and conceptual convergence of the two fields. Causes or axioms are prescribed as the theoretical end-products of natural history, whereas precepts are envisaged as the speculative outcomes derived from perfect civil history. In spite of this difference, causes and precepts are thought to enable effective action in order to change the state of nature and of man, respectively. For that reason a number of common patterns are to be found in Bacon's theory and practice of natural and civil history.

  17. St. Francis' Nursing Home, Mount Oliver, Dundalk, Louth.

    LENUS (Irish Health Repository)

    Owens, P

    2015-03-01

    As part of the National Clinical Programme on healthcare-associated infection prevention, a Royal College of Surgeons in Ireland (RCSI) and Royal College of Physicians of Ireland (RCPI) working group developed a quality improvement tool for prevention of surgical site infection (SS). We aimed to validate the effectiveness of an educational campaign, which utilises this quality improvement tool to prevent SSI in a tertiary hospital. Prior to the SSI educational campaign, surgical patients were prospectively audited and details of antibiotic administration recorded. Prophylactic antibiotic administration recommendations were delivered via poster and educational presentations. Post-intervention, the audit was repeated. 50 patients were audited pre-intervention, 45 post-intervention. Post-intervention, prophylaxis within 60 minutes prior to incision increased from 54% to 68% (p = 0.266). Appropriate postoperative prescribing improved from 71% to 92% (p = 0.075). A multifaceted educational program may be effective in changing SSI prevention practices.

  18. Colonel Francis Wayland Parker: Legacy of an Artist-Teacher.

    Science.gov (United States)

    Sidelnick, Mark

    1995-01-01

    Considers the career and accomplishments of Colonel Wayland Parker, a late-19th-century educator and reformer. Parker worked to establish art education as an essential part of every school's curriculum. He proposed integrating art into all of the daily subjects and recommended the establishment of studio and workshop spaces. (MJP)

  19. Taylor and Francis Journals under the critical lens of readability ...

    African Journals Online (AJOL)

    Purposive sampling technique was used to select the 11 journals used for the study. Flesch Reading Ease (FRE) and Flesch-Kincaid Grade Level (FKGL) indexes were used to compute the readability scores. Measures of central tendencies, one sample (with bootstrapping) T-test, and bar graph (with standard error bars) ...

  20. George Orwell, 'Seeing' and 'Saying': A Reply to Francis Dunlop.

    Science.gov (United States)

    McKenzie, P.

    1982-01-01

    Dunlop (Journal of Philosophy of Education; v14 p178 1980) suggests that people give up their capacity for independent judgment in face of coercive public standards. The author agrees, but believes Dunlop's appeal to intuition should be replaced with an appeal to universal criteria of rationality. (KC)

  1. Francis Gilbert * & Samy Zalat Introduction In collaboration with the ...

    African Journals Online (AJOL)

    Francis

    student:staff ratio is 14:1, of course with significant but not huge variation among disciplines. The total income of HE in the UK in 2004 was £ 16.9 billion (about LE 188 billion), only 60% of which comes from the UK government. The UK in general spends about 1.9% of its Gross National Product on science research.

  2. Crítica moral de Francis Bacon a la filosofía Francis Bacon's moral critique to philosophy

    OpenAIRE

    Maximiliano Prada Dussán

    2009-01-01

    Este escrito muestra la crítica moral de Bacon a la filosofía, presente en sus obras de juventud, la cual es desarrollada en tres niveles: primero, los cargos a la filosofía por su inutilidad, segundo, las acusaciones a la falta de verdad y de método y, finalmente, la denuncia de falta de caridad y humildad. En conclusión, este estudio intentará sustentar que 1. La reforma baconiana no se restringe a un nuevo método ni a una nueva teoría de la materia; más allá de esto, encuentra un sustento ...

  3. Crítica moral de Francis Bacon a la filosofía Francis Bacon's moral critique to philosophy

    Directory of Open Access Journals (Sweden)

    Maximiliano Prada Dussán

    2009-12-01

    Full Text Available Este escrito muestra la crítica moral de Bacon a la filosofía, presente en sus obras de juventud, la cual es desarrollada en tres niveles: primero, los cargos a la filosofía por su inutilidad, segundo, las acusaciones a la falta de verdad y de método y, finalmente, la denuncia de falta de caridad y humildad. En conclusión, este estudio intentará sustentar que 1. La reforma baconiana no se restringe a un nuevo método ni a una nueva teoría de la materia; más allá de esto, encuentra un sustento en una nueva posición moral del hombre frente a la naturaleza, y 2. Que su proyecto epistemológico encuentra sentido en el trasfondo moral.This paper is about Bacon's moral critique to philosophy. This critique is present in his youth work and it is developed in three levels: first, charges against philosophy because of its uselessness; second, accusations against philosophy's lack of truth and method; and, finally, charges against philosophy's lack of charity and humility. Briefly, this study will state and support two hypotheses. 1. Bacon´s reform is not restricted to a new method neither a new theory of matter; beyond this; it is a new moral position about man in relation to nature. 2. His epistemological project makes sense in the moral background.

  4. Francis Fukuyama : edukas lõimumine toetub omakasule, mitte kultuurile / Francis Fukuyama ; tõlk. Marek Laane

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2007-01-01

    Autor arutleb Huntingtoni tsivilisatsioonide kokkupõrke teooria üle ja väidab, et identiteetide konflikti aitavad ületada institutsioonidele ja reeglitele rajanev rahvusvaheline kord. Vt. samas: F. Fukuyama lühielulugu

  5. Francis-99: Transient CFD simulation of load changes and turbine shutdown in a model sized high-head Francis turbine

    Science.gov (United States)

    Mössinger, Peter; Jester-Zürker, Roland; Jung, Alexander

    2017-01-01

    With increasing requirements for hydropower plant operation due to intermittent renewable energy sources like wind and solar, numerical simulations of transient operations in hydraulic turbo machines become more important. As a continuation of the work performed for the first workshop which covered three steady operating conditions, in the present paper load changes and a shutdown procedure are investigated. The findings of previous studies are used to create a 360° model and compare measurements with simulation results for the operating points part load, high load and best efficiency. A mesh motion procedure is introduced, allowing to represent moving guide vanes for load changes from best efficiency to part load and high load. Additionally an automated re-mesh procedure is added for turbine shutdown to ensure reliable mesh quality during guide vane closing. All three transient operations are compared to PIV velocity measurements in the draft tube and pressure signals in the vaneless space. Simulation results of axial velocity distributions for all three steady operation points, during both load changes and for the shutdown correlated well with the measurement. An offset at vaneless space pressure is found to be a result of guide vane corrections for the simulation to ensure similar velocity fields. Short-time Fourier transformation indicating increasing amplitudes and frequencies at speed-no load conditions. Further studies will discuss the already measured start-up procedure and investigate the necessity to consider the hydraulic system dynamics upstream of the turbine by means of a 1D3D coupling between the 3D flow field and a 1D system model.

  6. A Reminiscence

    Science.gov (United States)

    Gobind Khorana, H.

    1997-12-01

    Leslie Orgel and Francis Crick with Gobind Khorana in Madison, Wisconsin (December 1965). I first met Leslie at the Endicott House (MIT) in February 1964. Leslie was then spending a period of time at MIT and the occasion was a party for him. During our conversation, Leslie talked about starting some experimental work. He seemed to be particularly interested in polyphosphates and the chemical activation of small molecules (building blocks). Shortly after his move to the Salk Institute in the Fall of 1964 I visited him in January 1965. He already had a lab going. I remember meeting Jim Ferris, in particular, and John Sulston sometime later. That particular time was exciting for my research as well. We had the first results on the Genetic Code using the chemical-biochemical approach that my lab had developed. Francis Crick was also at the Salk Institute during the time of my visit. Both Leslie and Francis were very excited by my results and they began to ask a lot of questions and gave me a whole lot of suggestions about further experiments. In fact, my thinking and planning of things that we were doing were so scrutinized and clarified during these discussions that, it seemed to me, my own group had only to turn out all the experiments that were needed. These interactions with Francis and Leslie continued intensively throughout that year and later. In fact, both Leslie and Francis accepted my invitation to Madison in December 1965 for more discussions. Since those early days of the Salk Institute, I have made numerous visits over the years to Leslie and his research group. It has always been very exciting to learn about the many discoveries bearing on chemical evolution that have unfolded from Leslie's research group. In addition, I have always benefitted from the insightful comments that Leslie invariably provided on my own research. I look forward to our continued interactions and friendship in the future. Leslie, A Happy Birthday!

  7. Solving the functional Schroedinger equation: Yang-Mills string tension and surface critical scaling

    Energy Technology Data Exchange (ETDEWEB)

    Mansfield, Paul E-mail: p.r.w.mansfield@durham.ac.uk

    2004-04-01

    Motivated by a heuristic model of the Yang-Mills vacuum that accurately describes the string-tension in three dimensions we develop a systematic method for solving the functional equation in a derivative expansion. This is applied to the Landau-Ginzburg theory that describes surface critical scaling in the Ising model. A Renormalisation Group analysis of the solution yields the value {eta} = 1.003 for the anomalous dimension of the correlation function of surface spins which compares well with the exact result of unity implied by Onsager's solution. We give the expansion of the corresponding {beta}-function to 17th order (which receives contributions from up to 17-loops in conventional perturbation theory). (author)

  8. Orbiting the moons of Pluto complex solutions to the Einstein, Maxwell, Schroedinger and Dirac equations

    CERN Document Server

    Rauscher, Elizabeth A

    2011-01-01

    The Maxwell, Einstein, Schrödinger and Dirac equations are considered the most important equations in all of physics. This volume aims to provide new eight- and twelve-dimensional complex solutions to these equations for the first time in order to reveal

  9. Semiclassical Limit of the Non-linear Schroedinger-Poisson Equation With Subcritical Initial Data

    Science.gov (United States)

    2002-12-01

    lim ∇xargψ. As noted earlier, this argument is self - consistent as long as the solution of the Euler- Poisson system (1.5)-(1.6) remains classical...00-2003 to 00-00-2003 4. TITLE AND SUBTITLE Semiclassical Limit of the Non-linear Schrodinger - Poisson Equation with Subcritical Initial Data 5a...classical limit of a self - consistent quantum-Vlasov equation in 3-D, Math. Models Methods Appl. Sci., 3 (1993), pp. 109–124. [SMM] C. Sparber, P. Markowich

  10. A footnote on allostery.

    Science.gov (United States)

    Crick, F H C; Wyman, Jeffries

    2013-05-13

    A manuscript on allostery signed by Francis Crick and Jeffries Wyman was sent by Crick to Jacques Monod in 1965. Monod transmitted a copy of the manuscript, upon which he had written several comments, to Jean-Pierre Changeux, then a post-doctoral fellow at the University of California Berkeley in the laboratory of Howard Schachman. Changeux provided a copy to Stuart Edelstein, a graduate student in the same laboratory. The manuscript was never submitted for publication, but Edelstein retained his copy since that time and has edited it for publication in the special issue on allostery. The text emphasized the interpretation of the properties of an allosteric oligomer by characterizing its equivalent monomer. The text also developed the concept of the allosteric range and included a simple equation for calculation of the Hill coefficient from the parameters of the Monod-Wyman-Changeux model. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. The design of an enzyme: a chronology on the controversy.

    Science.gov (United States)

    Buc, Henri

    2013-05-13

    After the publication of the Monod-Wyman-Changeux model, a controversy arose between Jacques Monod, Francis Crick and Jeffries Wyman about the comparison of the regulatory performances of an oligomer undergoing a concerted transition between two states and a monomer having the same composition and subjected to a similar conformational equilibrium. The controversy took place between September 1965 and March 1966. It gave rise to several unpublished notes. Numerous misunderstandings between the participants were not fully dissipated as the controversy abruptly ended. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Military Review. Volume 57, Number 5, May 1977

    Science.gov (United States)

    1977-05-01

    lhthtinf.l’ guC’rrilln wnr h1 n "> CricK or new di!!C::OVC"riC"s tht·uugh thl’ Jrwk of hllllilutionnl mt·mul’y, Ru.t~•R•ll Wt.•h!lt>y, lltstor11 of tltc...and MllitnTJI Budgets, Edited by William Schneider Jr. and Francis P. Hoeber, Crane, Russak &: Co., Inc., NY, 19~6, p 199. 7 Gans, OJ), C’it

  13. Attention: the claustrum.

    Science.gov (United States)

    Goll, Yael; Atlan, Gal; Citri, Ami

    2015-08-01

    The claustrum is a mysterious thin sheet of neurons lying between the insular cortex and the striatum. It is reciprocally connected with almost all cortical areas, including motor, somatosensory, visual, auditory, limbic, associative, and prefrontal cortices. In addition, it receives neuromodulatory input from subcortical structures. A decade ago, Sir Francis Crick and Christof Koch published an influential review proposing the claustrum as the 'seat of consciousness', spurring a revival of interest in the claustrum. We review the literature on the claustrum, emphasizing recent discoveries, and develop a detailed hypothesis describing a role for the claustrum in the segregation of attention. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  15. Historical review: another 50th anniversary--new periodicities in coiled coils.

    Science.gov (United States)

    Gruber, Markus; Lupas, Andrei N

    2003-12-01

    In 1953, Francis Crick and Linus Pauling both proposed models of supercoiled alpha helices ('coiled coils') for the structure of keratin. These were the first attempts at modelling the tertiary structure of a protein. Crick emphasized the packing mode of the side-chains ('knobs-into-holes'), which required a periodicity of seven residues over two helical turns (7/2) and a supercoil in the opposite sense of the constituent helices. By contrast, Pauling envisaged a broader set of periodicities (4/1, 7/2, 18/5, 15/4, 11/3) and supercoils of both senses. Crick's model became canonical and the 'heptad repeat' essentially synonymous with coiled coils, but 50 years later new crystal structures and protein sequences show that the less common periodicities envisaged by Pauling also occur in coiled coils, adding a variant packing mode ('knobs-to-knobs') to the standard model. Pauling's laboratory notebooks suggest that he searched unsuccessfully for this packing mode in 1953.

  16. (Mis)understanding Science: The Problem with Scientific Breakthroughs.

    Science.gov (United States)

    Evans, James P

    2016-09-01

    On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.

  17. After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

    Science.gov (United States)

    Creager, Angela N H; Morgan, Gregory J

    2008-06-01

    Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

  18. An Efficient and Accurate Quantum Lattice-Gas Model for the Many-Body Schroedinger Wave Equation

    Science.gov (United States)

    2002-01-01

    algorithnm against two probability amplitude field (e.g. a continuous complex well-known cases of harmonic oscillation in a parabolic field). 3 2.1...of qubits in any quantum computer is necessarily a finite number, where each ý21+a is a probability amplitude (e.g. com- the wave function will have to...an effective situated on the lattice with a probability amplitude cl field theory for our artificially discretized model, we associated with each

  19. Upper bounds on the number of bound states nsub(l)(E) below a certain energy E in Schroedinger theory

    Energy Technology Data Exchange (ETDEWEB)

    Requardt, M.

    1985-01-01

    For a large class of potentials the author proves upper bounds on the number of bound states in the various angular momentum channels below a certain energy E. As by-product he derives estimates on the maximal angular momentum etc. The class of allowed potentials enclose as typical candidate potentials with infinitely many bound states below the essential spectrum, respectively potentials which go to infinity for r ..-->.. infinity as e.g. the model potentials used in quarkonium physics like V(r) = -a(1/r) + br. Generalizations to the case of N-body quantum mechanics seem to be possible. (Auth.).

  20. Geologic Mapping of the Lunar South Pole, Quadrangle LQ-30: Volcanic History and Stratigraphy of Schroedinger Basin

    Science.gov (United States)

    Mest, S. C.; Berman, D. C.; Petro, N. E.

    2009-01-01

    In this study we use recent images and topographic data to map the geology and geomorphology of the lunar South Pole quadrangle (LQ-30) at 1:2.5M scale [1-4] in accordance with the Lunar Geologic Mapping Program. Mapping of LQ-30 began during Mest's postdoctoral appointment and has continued under the PG&G Program, from which funding became available in February 2009. Preliminary map-ping and analyses have been done using base materials compiled by Mest, but properly mosaicked and spatially registered base materials are being compiled by the USGS and should be received by the end of June 2009. The overall objective of this research is to constrain the geologic evolution of the lunar South Pole (LQ-30: 60deg -90deg S, 0deg - +/-180deg ) with specific emphasis on evaluation of a) the regional effects of basin formation on the structure and composition of the crust and b) the spatial distribution of ejecta, in particular resulting from formation of the South Pole-Aitken (SPA) basin and other large basins. Key scientific objectives include: 1) Constraining the geologic history of the lunar South Pole and examining the spatial and temporal variability of geologic processes within the map area. 2) Constraining the vertical and lateral structure of the lunar regolith and crust, assessing the distribution of impact-generated materials, and determining the timing and effects of major basin-forming impacts on crustal structure and stratigraphy in the map area. And 3) assessing the distribution of resources (e.g., H, Fe, Th) and their relationships with surface materials.

  1. Geological-Seismological Evaluation of Earthquake Hazards at Prompton and Francis E. Walter Damsites, Pennsylvania.

    Science.gov (United States)

    1986-09-01

    containing graphite , chrondodite, pyrozene, and other minerals. Contains zinc ores in Sussex County. Pre-Cambrian Granite Coarse-grained, rudely foliated...thin shales and coals; some coals mineable locally. * Anthracite Region Post-Pottsville Formations ,22 PBrown or gray sandstones and shales with some

  2. Francis Aliponse Chilipaine This paper is divided into two parts. In ...

    African Journals Online (AJOL)

    (je vais la pour vous fournir une preuve). Force est done de conclure que la meme phrase est susceptible d'au moins deux interpretations syntaxiques lorsque le verbe 'aller' est suivi d'un infinitif (~ condition que ce dernier ne soit ni un verbe de mouvement ni un verbe psychologique) et lorsqu'il a pour sujet un nom anime":.

  3. Historia and materia: the philosophical implications of Francis Bacon's natural history.

    Science.gov (United States)

    Giglioni, Guido

    2012-01-01

    This article examines the philosophical implications underlying Bacon's views on historical knowledge, paying special attention to that variety of historical knowledge described by Bacon as "natural." More specifically, this article explores the interplay of history (historia) and fable (fabula). In the sphere of thought, fabula is the equivalent to materia in nature. Both are described by Bacon as being "versatile" and "pliant." In Bacon's system of knowledge, philosophy, as the domain of reason, starts from historiae and fabulae, once memory and the imagination have fulfilled their cognitive tasks. This means that, for Bacon, there is no such thing as a pure use of reason. He advocates a kind of reason that, precisely because it is involved with matter's inner motions (its "appetites," in Bacon's characteristic language), is constitutively 'impure'. The article shows how the terms historia and fabula cover key semantic areas in defining Bacon's philosophy: historia may mean "history" as well as "story,"fabula "myth" as well "story". In both cases, we can see significant oscillations from a stronger meaning (close to those of matter and nature) to a weaker one (connected to wit and imagination), as if the power of nature decreases moving from histories and myths to stories. On the other hand, there are cases in which Bacon seems to stick to a diachronic view of the meaning of fables and histories, such that the transition from myths to history, especially natural history, is described as a collective effort towards reality and enlightenment.

  4. 76 FR 73619 - Francis Walter Hydro, LLC; Notice of Preliminary Permit Application Accepted for Filing and...

    Science.gov (United States)

    2011-11-29

    ... characters, without prior registration, using the eComment system at http://www.ferc.gov/docs-filing/ecomment... holder to perform any land-disturbing activities or otherwise enter upon lands or waters owned by others...

  5. Sufi, Christian or Buddhist? Richard Francis Burton’s “Parameters of Belief”

    Directory of Open Access Journals (Sweden)

    John Wallen

    2013-09-01

    Full Text Available Richard Burton has been interpreted and misinterpreted by literary critics as eminent as Edward Said and Louisa Pratt as well as by others such as Rana Kabbani and Reina Lewis. Biographers like Fawn Brody, Edward Rice, Mary Lovell and Jon Godsall have also had their say. Burton has been variously described as imperialist, sexist, gay, obssessed with pornography, racist, plagiarist, sexual libertine, scatologist, expert sociologist, profoundly deceitful and impotent. In spite of this negative press, interest in Burton is always high as his life and times are relevant to many scholars interested in the 19th century origins of modern thought and postcolonial ideas. In this paper presentation I will attempt to get beyond the confused and contradictory portrayals of Burton over the last 50 or so years by looking in some detail at Burton’s two long poems: Stone Talk and The Kasidah. In these works, published 15 years apart, Burton writes under pseudonyms and, as I will argue, is able to express many of his deepest beliefs, especially in The Kasidah where he is playing the part of Hadji Abu Al Yezid, a Sufi like-wise man who possesses some startling similarities to Burton himself. What emerges from this close examination of the texts is a sensitive relativist who, while adhering to the scientific method in all his practical dealings, is yet able to consider the possibility that everything we see around us and all our experience of the world might be, finally, nothing more than Maya and illusion.

  6. Installation Restoration Program, Phase 1, Records Search, Francis E. Warren, Air Force Base, Wyoming

    Science.gov (United States)

    1985-09-01

    Dursban 10 CR 10.6 Malathion 55 Malathion ULV-91 91 Dursban 41 Ficam Plus 29.5, 3.1 Knox-out 2FM 23 Killmaster II 2 Raze 0.025 Peters Rodent Killer 0.37...Phostoxin 55 Giant Destroyer 46, 34, 8 Rozol Tracking Powder 27 Dursban 4E 41.2 Sevimol - 4 40.4 Ficam W 76 Diazinon 48 Ficam W 76 Raid Wasp and

  7. 76 FR 61135 - Environmental Impact Statement: Theodore Francis Green Airport, Warwick, RI

    Science.gov (United States)

    2011-10-03

    ... safety areas, other safety improvements, a runway extension, and other efficiency improvements at... Post Rd, Warwick, Rhode Island, and at public libraries in Warwick and Cranston, Rhode Island. Issued...

  8. Integration of Landscape Ecosystem Classification and Historic Land Records in the Francis Marion National Forest

    Science.gov (United States)

    Peter U. Kennedy; Victor B. Shelburne

    2002-01-01

    Geographic Information Systems (GIS) data and historical plats ranging from 1716 to 1894 in the Coastal Flatwoods Region of South Carolina were used to quantify changes on a temporal scale. Combining the historic plats and associated witness trees (trees marking the boundaries of historic plats) with an existing database of the soils and other attributes was the basis...

  9. List of Reptiles and Amphibians brought from British India by Mr. Francis Day

    NARCIS (Netherlands)

    Hubrecht, A.A.W.

    1882-01-01

    In addition to the extensive collection of fishes which Mr. F. Day has brought home from India and which has furnished the material for his important and well-known standard works on the ichthyology of the Indian continent ¹) — the able counterparts of Bleeker’s Atlas of the Fishes from the

  10. Name etymology and its symbolic value in Francis Scott Fitzgerald's "The great Gatsby"

    Directory of Open Access Journals (Sweden)

    Vanja Avsenak

    2003-12-01

    Full Text Available The aim of my paper is to scrutinize the manifold interpretations of proper names and their possible symbolical value that the reading of F. S. Fitzgerald's classic leaves in the reader. On the whole, the novel's internal structure is rather comprised, which consequently makes the story exact, its plot condensed, but behind this seemingly concise and more or less simple language the author nevertheless manages to embody powerful symbolism that speaks for itself. It is disputable whether Fitzgerald truly aimed to produce such a strong metaphorical emphasis that would most minutely delineate America's social character in the turbulent twenties as projected in the personal stories of the novel's leading protagonists. Within this figurative scope, large as it is, 1 therefore focus only on the significance of proper names and their obvious contribution to the holistic social portrayal. It may be only a minor, but nevertheless one of the most reliable and crucial means of outlining the consequences of the postwar spiritual apathy that overwhelmed the American nation and was in­ duced by the societal downfall due to the disillusion of the American Dream. How this Dream influenced each individual's and society's destiny remains to be my goal in this article. For the purpose of analysis 1 rely on the 1994 Penguin edition. All direct quotes from now on are to be taken from this source.

  11. Francis Robert Lloyd and the celebrated traveller: a British Raj murder mystery.

    Science.gov (United States)

    Kumar, Sanjeev; Saxena, Susmita

    2013-07-01

    In 1854 the Schlagintweit brothers, scientist-explorers from Vienna were invited by the East India company to make a geological survey of the northern parts of the sub-continent. Adolphe Schlagintweit had wanted to cross into Central Asia from India. He had proceeded as far as Kashgar when he was allegedly murdered by a chief of one of the wandering tribes. His decapitated head became a source of intrigue. The paper describes the incident and the subsequent role of Dr F R Lloyd, a dentist from India, in the police investigation that followed. This is the first documented case from India of a legal case making use of forensic odontology.

  12. The development of Francis Galton's ideas on the mechanism of heredity.

    Science.gov (United States)

    Bulmer, M

    1999-01-01

    Galton greeted Darwin's theory of pangenesis with enthusiasm, and tried to test the assumption that the heredity particles circulate in the blood by transfusion experiments on rabbits. The failure of these experiments led him to reject this assumption, and in the 1870s he developed an alternative theory of heredity, which incorporated those parts of Darwin's theory that did not involve the transportation of hereditary particles throughout the system. He supposed that the fertilized ovum contains a large number of hereditary elements, which he collectively called the "stirp," a few of which are patent, developing into particular cell types, while the rest remain latent; the latent elements can be transmitted to the next generation, while the patent elements, with rare exceptions, cannot since they have developed into cells. The problem with this theory is that it does not explain the similarity between parent and child unless there is a high correlation between latent and patent elements. Galton probably came to realize this problem during his subsequent statistical work on heredity, and he quietly dropped the idea that patent elements are not transmitted in Natural Inheritance (1889). Galton thought that brothers and sisters had identical stirps, and he attributed differences between them to variability in the choice of patent elements from the stirp, that is to say to developmental variability. He attributed the likeness of monozygotic twins to the similarity of their developmental environment. Galton's twin method was to track the life history changes of twins to see whether twins who were similar at birth diverged in dissimilar environments or whether twins who were dissimilar at birth converged in similar environments. It is quite different from the modern twin method of comparing the similarities between monozygotic and dizygotic twins, on the assumption that monozygotic twins are genetically identical whereas dizygotic twins are not. It has been argued that Galton foreshadowed Weismann's theory in the continuity of the germ-plasm, but this is only true in a weak sense. They both believed that the inheritance of acquired characters was either rare or impossible, but Galton did not forestall the essential part of Weismann's theory, that the germ-plasm of the zygote is doubled, with one part being reserved for the formation of the germ-cells.

  13. New NIH Director Dr. Francis Collins on Medical Research That Benefits Everyone's Health

    Science.gov (United States)

    ... emphasize the importance of transparency, open government, public engagement, and collaboration. NIH uses a wide variety of ... identify and catalog the glitches that make a good cell go bad. This can be expanded to ...

  14. “We are not made for revelation”: Letters to Francis Bacon in the ...

    African Journals Online (AJOL)

    The postscript follows the signature of the letter or the text of the book. As an addition to a communication that has already taken place, it gestures to the inconclusiveness of the writing, its failure of closure. It is an afterthought that paradoxically draws attention to itself, simultaneously marking and transgressing the limits of ...

  15. Francis, fatalism and the fundamental attribution error: a reply to Philip Darbyshire.

    Science.gov (United States)

    Paley, John

    2015-03-01

    Philip Darbyshire has apparently gained the impression that I used 'gee-whiz' social psychology to 'absolve poor or negligent practice from any hint of personal responsibility and accountability'. In this reply, I first discuss the fundamental attribution error, which Darbyshire trivialises as the 'fundamental arrogance error' and a piece of 'linguistic puffery'. Second I examine Darbyshire's rather naive view of causation. Third, I suggest that, on a more defensible view of causality, situations as causes do not absolve nurses from 'any hint' of personal responsibility, but they do set limits to responbility, even if Darbyshire finds this morally incovenient. Finally, I argue that the focus on individual accountability should give way to a public health model of containment and prevention. I conclude with some remarks on 'outsider disbelief'. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Potential Natural Vegetation of the Mississippi Alluvial Valley: St. Francis Basin, Arkansas, Field Atlas

    Science.gov (United States)

    2012-09-01

    and pollution of receiving waters, including the Gulf of Mexico. Various government policies and private initiatives have been implemented to reverse...understory species. Vines and ground cover species are less abundant and diverse than on less flooded sites. Dominance may shift to baldcypress and water...distinguishes true depressions from vernal pools. Vines and ground cover species are uncommon. Within much of the Big Lake area, this type is the natural

  17. [Francis Bacon on the origin and preservation of life: theory and experiments].

    Science.gov (United States)

    Gemelli, Benedino

    2003-01-01

    The paper analyses Bacon's views of life, as contained in De Sapientia Veterum, Historia vitae et mortis, and in a newly published manuscript, entitled De vijs mortis. Bacon saw the prolongation of life as one of the main goals of science and medicine, According to him, life is the result of the action of spirits on matter. In order to preserve life, it is necessary to investigate various kinds of generation, notably, those which occurr without seeds. The study of putrefaction is also crucial for the prolongation of life.

  18. Mathematical subtleties and scientific knowledge: Francis Bacon and mathematics, at the crossing of two traditions.

    Science.gov (United States)

    Mori, Giuliano

    2017-03-01

    This article engages the much-debated role of mathematics in Bacon's philosophy and inductive method at large. The many references to mathematics in Bacon's works are considered in the context of the humanist reform of the curriculum studiorum and, in particular, through a comparison with the kinds of natural and intellectual subtlety as they are defined by many sixteenth-century authors, including Cardano, Scaliger and Montaigne. Additionally, this article gives a nuanced background to the 'subtlety' commonly thought to have been eschewed by Bacon and by Bacon's self-proclaimed followers in the Royal Society of London. The aim of this article is ultimately to demonstrate that Bacon did not reject the use of mathematics in natural philosophy altogether. Instead, he hoped that following the Great Instauration a kind of non-abstract mathematics could be founded: a kind of mathematics which was to serve natural philosophy by enabling men to grasp the intrinsic subtlety of nature. Rather than mathematizing nature, it was mathematics that needed to be 'naturalized'.

  19. Shereen El-Banna1*, Samy Zalat1, Ahmed Abo-Ghalia1 and Francis ...

    African Journals Online (AJOL)

    km south of Port Said (El-Raswa) represents an agricultural ecosystem with vegetation cover dominated by Medicago sp., and few patches of Lathyrus odoratus, Ficus nitida,. Lantana cámara, Dunata sp., Calendula sp. and Rosmarianus officinalis. The second site situated about 8 km south-east of Port Said, near Port Foad, ...

  20. Determination and generalization of the effects of design parameters on Francis turbine runner performance

    Directory of Open Access Journals (Sweden)

    Ece Ayli

    2016-01-01

    Full Text Available The runner design is the most challenging part of the turbine design process. Several parameters determine the performance and cavitation characteristics of the runner: the metal angle (flow beta angle, the alpha angle, the blade beta angle, the runner inlet and outlet diameters, and the blade height. All of these geometrical parameters need to be optimized to ensure that the head, flow rate and power requirements of the system are met. A hydraulic designer has to allocate time to optimize these parameters and should be experienced in carrying out the iterative design process. In this article, the turbine runner parameters that affect the performance and cavitation characteristics of designed turbines are examined in detail. Furthermore, turbines are custom designed according to the properties of hydroelectric power plants; this makes the design process even more challenging, as the rotational speed, runner geometry, system head and flow rate vary for each turbine. The effects of the design parameters are examined for four different turbine runners specifically designed and used in actual power plants in order to obtain general results and generalizations applicable to turbine design aided by computational fluid dynamics (CFD. The flow behavior, flow angles, head losses, pressure distribution, and cavitation characteristics are computed, analyzed, and compared. To assist hydraulic designers, the general influences of these parameters on the performance of turbines are summarized and empirical formulations are derived for runner performance characterization.

  1. Stress and resilience in a post-Francis world - a qualitative study of executive nurse directors.

    Science.gov (United States)

    Kelly, Daniel; Lankshear, Annette; Jones, Aled

    2016-12-01

    The aim of this study was to explore the role stressors experienced by executive nurse directors and strategies employed to maintain resilience. Recent financial pressures on and care quality scandals in the UK NHS impact on the work of executive nurse directors. The short length of tenure and the high number of vacancies for these posts point to the exacting demands of the role and raise questions about the support mechanisms available for the most senior nurses in NHS organizations. A grounded constructivist study. Semi-structured telephone interviews conducted between February-July, 2014. Stressors were both chronic (workload, lack of corporate responsibility for quality, reductions in quality team staffing, tensions between financial solvency and care quality and personal vulnerability) and acute (dealing with complaints and major incidents). Resilience required the support of fellow executives, peers, family and mentors and could be enhanced by self-discipline, good preparation for the post and ongoing coaching. Recent fiscal austerity and scandals relating to quality of care have increased pressure on executive nurse directors. Increasing size of organizations, limited resources devoted to quality combined with poorly defined limits of responsibility are all major stressors and executive nurse directors, both in the United Kingdom and internationally, need clear strategies to maintain resilience. Repetitive demands for data by oversight organizations may detract from more important quality assurance strategies. © 2016 John Wiley & Sons Ltd.

  2. Unsteady Flow Analysis of Pump Mode Small Discharge Condition for a Francis Pump-turbine

    Science.gov (United States)

    Xiaoran, ZHAO; Yexiang, XIAO; Jincai, XU; Wei, XU; Jianbo, SUN; Zhengwei, WANG; Yangyang, YAO

    2016-11-01

    Unsteady flow phenomena, including vortex flow at runner inlet, helical backflow in the draft tube and numerous vortexes inside the guide vanes, can occur in pump-turbines under off design conditions at pump mode and can impact normal operation of pump-turbines. All of these phenomena cause serious pressure pulsation, which is quite different from cases in normal pump mode. There is also a difference of pressure pulsation frequency and amplitude in different place through the runner. This paper builds a whole flow passage of a model pump-turbine, simulates flow characteristics in runner by CFD technology, analyses pressure pulsation in the runner and explores the origin and mechanism of pressure pulsations. The SST-CC turbulence model is adopted to perform unsteady simulations of the pump-turbine under 0.46Q BEP small discharge condition at pump mode. Unsteady flow structures are proceeded combined with hydraulic loss and pressure amplitude spectra. The results indicates that there is complicated disordered flow inside the runner under 0.46Q BEP small discharge condition at pump mode, shows the amplitude and frequency characteristic of pressure pulsations through runner flow passage.

  3. Diagnosing Guerilla Warfare: Was William Clarke Quantrill Missouri’s Francis Marion?

    Science.gov (United States)

    2010-04-28

    curriculum also has had numerous blocks of instruction dealing with insurgencies and counterinsurgency operations. The Civil War in Missouri became the...into a shipwreck that almost saw him die of starvation and exposure. Marion worked his family’s plantation and in 1773 purchased his own. Being a

  4. 15. Francis E.A. Owakah Race Ideology and the Conceptualization ...

    African Journals Online (AJOL)

    Owakah

    contributed to raising the status of philosophy in Africa. Key words. African philosophy, Racial ideology, Chauvinism, Logocentricism, dystopia,. Essentialism. Introduction. Since the publication of Bantu Philosophy by the Belgian Missionary Placide. Tempels, a lot has been written concerning African Philosophy. Tempels' ...

  5. Evaluation of runner cone extension to dampen pressure pulsations in a Francis model turbine

    Science.gov (United States)

    Gogstad, Peter Joachim; Dahlhaug, Ole Gunnar

    2016-11-01

    Today's energy market has a high demand of flexibility due to introduction of other intermittent renewables as wind and solar. To ensure a steady power supply, hydro turbines are often forced to operate more at part load conditions. Originally, turbines were built for steady operation around the best efficiency point. The demand of flexibility, combined with old designs has showed an increase in turbines having problems with hydrodynamic instabilities such as pressure pulsations. Different methods have been investigated to mitigate pressure pulsations. Air injection shows a significant reduction of pressure pulsation amplitudes. However, installation of air injection requires extra piping and a compressor. Investigation of other methods such as shaft extension shows promising results for some operational points, but may significantly reduce the efficiency of the turbine at other operational points. The installation of an extension of the runner cone has been investigated at NTNU by Vekve in 2004. This has resulted in a cylindrical extension at Litjfossen Power Plant in Norway, where the bolt suffered mechanical failure. This indicates high amplitude pressure pulsations in the draft tube centre. The high pressure pulsation amplitudes are believed to be related to high tangential velocity in the draft tube. The mentioned runner cone extension has further been developed to a freely rotating extension. The objective is to reduce the tangential velocity in the draft tube and thereby the pressure pulsation amplitudes.

  6. Longleaf Pine Ground-Layer Vegetation in Francis Marion National Forest: Reintroduction, Restoration, and Vegetation Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Glitzenstein, J.; Streng, D.; Wade, D.

    2001-01-01

    Study represents significant progress in understanding of compositional gradients in longleaf pine plant communities of Central South Carolina. Study shows the importance of water table depths as a controlling variable with vegetation patterns in the field and similar effects in a garden experiment. Grass planting study suggests that observed field distributions of dormant pine savannah grasses derive from complex interactive effects of fire history, hydrology and light environments. Use of regional longleaf data set to identify candidate species for introduction also appears to be a pioneering effort.

  7. Youth as research fieldworkers in a context of HIV/AIDS | Francis ...

    African Journals Online (AJOL)

    What are the strengths and limitations of using out-of-school youths as researchers in a study of the relationships among young people of the same group? While youth-to-youth research approaches have increased in both popularity and practice, our understanding of the processes and mechanisms underlying the ...

  8. La réputation de Francis Bacon au xviiie siècle

    OpenAIRE

    Tadié, Alexis

    2017-01-01

    Pendant que des adversaires peu instruits ou mal intentionnés faisoient ouvertement la guerre à la Philosophie, elle se réfugioit, pour ainsi dire, dans les Ouvrages de quelques grands hommes, qui, sans avoir l’ambition dangereuse d’arracher le bandeau des yeux de leurs contemporains, préparoient de loin dans l’ombre & le silence la lumiere dont le monde devoit être éclairé peu-à-peu & par degrés insensibles. A la tête de ces illustres personnages doit être placé l’immortel Chancelier d’Angle...

  9. Seven essential questions on G-quadruplexes.

    Science.gov (United States)

    König, Sebastian L B; Evans, Amanda C; Huppert, Julian L

    2010-08-01

    The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

  10. Instability Rules: The Ten Most Amazing Ideas of Modern Science

    Science.gov (United States)

    Flowers, Charles

    2002-03-01

    World-altering discoveries that reveal a universe of uncertainty and constant change Whether probing the farthest reaches of the vast universe or exploring the microscopic world of genetics and the subatomic world of quantum mechanics, Instability Rules is a remarkably informative and engaging look at ten milestone discoveries and their discoverers-a wide range of very human personalities whose insights have dramatically altered our most basic assumptions about human existence during the last century. The stories include Edwin Hubble and the expanding universe, Alfred Wegener and continental drift, Neils Bohr and quantum mechanics, Alan Turing and artificial intelligence, and James Watson and Francis Crick and DNA. Also covering discoveries of the twenty-first century that are already refining these and other ideas, Instability Rules is an exhilarating, sometimes amusing encounter with the defining scientific discoveries of our age.

  11. [DNA: from Miescher to Venter and beyond].

    Science.gov (United States)

    Gabryelska, Marta M; Szymański, Maciej; Barciszewski, Jan

    2009-01-01

    DNA, one of the most famous molecules is 140-years-old. Its history has engaged three centuries of experiments, leading us to a point, where the Homo sapiens genome sequence is known. The "DNA breakthrough" is dated on 1953, when James Watson and Francis Crick proposed the model of molecular structure of DNA. But the origin of that great achievement goes back to 1869 and early efforts of Friedrich Miescher, the Swiss doctor, who isolated DNA (than termed nuclein) for the first time. Since that time wealth information on "nuclein", its functions, structure and usage has been collected and formed a basis for modern molecular biology, chemical biology and biotechnology. This article describes the events and circumstances of the most important DNA discoveries since its first isolation up to completing the human genome project and deep DNA sequencing techniques application.

  12. What Froze the Genetic Code?

    Science.gov (United States)

    Ribas de Pouplana, Lluís; Torres, Adrian Gabriel; Rafels-Ybern, Àlbert

    2017-04-05

    The frozen accident theory of the Genetic Code was a proposal by Francis Crick that attempted to explain the universal nature of the Genetic Code and the fact that it only contains information for twenty amino acids. Fifty years later, it is clear that variations to the universal Genetic Code exist in nature and that translation is not limited to twenty amino acids. However, given the astonishing diversity of life on earth, and the extended evolutionary time that has taken place since the emergence of the extant Genetic Code, the idea that the translation apparatus is for the most part immobile remains true. Here, we will offer a potential explanation to the reason why the code has remained mostly stable for over three billion years, and discuss some of the mechanisms that allow species to overcome the intrinsic functional limitations of the protein synthesis machinery.

  13. Báze nejsou písmena / The Bases Are Not the Letters

    Directory of Open Access Journals (Sweden)

    Vladimír Matlach

    2016-06-01

    Full Text Available In this paper we show some interpretation of the genetic code design. We proceed from the discovery of DNA structure to current stage of the molecular biology. Generally we introduce the basic semiotic assumptions of molecular biology in the description of the structure of DNA, proteins and genetic code. We focus on interpretations of Francis Crick, another molecular biologists, biosemioticians and linguists. For the aims of the paper we describe some fundaments of molecular biology. Core of our text is quantitative analysis (n-gram structure, Zipf ’s law of mRNA strings and natural language text. We take into consideration representative quantitative analysis of DNA, RNA and proteins too. Our analysis of mRNA confirms the assumption that the design of the genetic code cannot analogize DNA bases and letters.

  14. The DNA double helix fifty years on.

    Science.gov (United States)

    Macgregor, Robert B; Poon, Gregory M K

    2003-10-01

    This year marks the 50th anniversary of the proposal of a double helical structure for DNA by James Watson and Francis Crick. The place of this proposal in the history and development of molecular biology is discussed. Several other discoveries that occurred in the middle of the twentieth century were perhaps equally important to our understanding of cellular processes; however, none of these captured the attention and imagination of the public to the same extent as the double helix. The existence of multiple forms of DNA and the uses of DNA in biological technologies is presented. DNA is also finding increasing use as a material due to its rather unusual structural and physical characteristics as well as its ready availability.

  15. Simplicity and complexity

    Science.gov (United States)

    Crutchfield, James; Wiesner, Karoline

    2010-02-01

    Is anything ever simple? When confronted with a complicated system, scientists typically strive to identify underlying simplicity, which we articulate as natural laws and fundamental principles. This simplicity is what makes nature appear so organized. Atomic physics, for example, approached a solid theoretical foundation when Niels Bohr uncovered the organization of electronic energy levels, which only later were redescribed as quantum wavefunctions. Charles Darwin's revolutionary idea about the "origin" of species emerged by mapping how species are organized and discovering why they came to be that way. And James Watson and Francis Crick's interpretation of DNA diffraction spectra was a discovery of the structural organization of genetic information - it was neither about the molecule's disorder (thermodynamic entropy) nor about the statistical randomness of its base-pair sequences.

  16. What Froze the Genetic Code?

    Directory of Open Access Journals (Sweden)

    Lluís Ribas de Pouplana

    2017-04-01

    Full Text Available The frozen accident theory of the Genetic Code was a proposal by Francis Crick that attempted to explain the universal nature of the Genetic Code and the fact that it only contains information for twenty amino acids. Fifty years later, it is clear that variations to the universal Genetic Code exist in nature and that translation is not limited to twenty amino acids. However, given the astonishing diversity of life on earth, and the extended evolutionary time that has taken place since the emergence of the extant Genetic Code, the idea that the translation apparatus is for the most part immobile remains true. Here, we will offer a potential explanation to the reason why the code has remained mostly stable for over three billion years, and discuss some of the mechanisms that allow species to overcome the intrinsic functional limitations of the protein synthesis machinery.

  17. A Journey in Science: Cell-Cycle Control.

    Science.gov (United States)

    Nurse, Paul

    2017-05-24

    Real innovations in medicine and science are historic and singular; the stories behind each occurrence are precious. At Molecular Medicine we have established the Anthony Cerami Award in Translational Medicine to document and preserve these histories. The monographs recount the seminal events as told in the voice of the original investigators who provided the crucial early insight. These essays capture the essence of discovery, chronicling the birth of ideas that created new fields of research; and launched trajectories that persisted and ultimately influenced how disease is prevented, diagnosed, and treated. In this volume, the Cerami Award Monograph is by Paul Nurse, Director, The Francis Crick Institute in London, UK. A visionary in the field of cell biology, this is the story of Dr. Nurse's scientific journey.

  18. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  19. Morphogens, modeling and patterning the neural tube: an interview with James Briscoe.

    Science.gov (United States)

    Briscoe, James

    2015-01-20

    James Briscoe has a BSc in Microbiology and Virology (from the University of Warwick, UK) and a PhD in Molecular and Cellular Biology (from the Imperial Cancer Research Fund, London, now Cancer Research UK). He started working on the development of the neural tube in the lab of Tom Jessel as a postdoctoral fellow, establishing that there was graded sonic hedgehog signaling in the ventral neural tube. He is currently a group leader and Head of Division in Developmental Biology at the MRC National Institute for Medical Research (which will become part of the Francis Crick Institute in April 2015). He is working to understand the molecular and cellular mechanisms of graded signaling in the vertebrate neural tube.We interviewed him about the development of ideas on morphogenetic gradients and his own work on modeling the development of the neural tube for our series on modeling in biology.

  20. Major Additions to the Linus Pauling Canon

    Science.gov (United States)

    Davenport, Derek A.

    2002-08-01

    The National Library of Medicine has also just posted a Web site on Linus Pauling in its Profiles of Science series. While by no means as rich as the various Oregon State University sites, it is well worth visiting. There are texts of various speeches (including his Nobel address), many downloadable photographs, correspondence (including a poignant letter to James Watson and Francis Crick concerning their "rival" structures for DNA), and much else besides. There is a certain irony in Linus Pauling being honored by the National Library of Medicine. Ever since his 1949 presidential address to the American Chemical Society, and perhaps earlier, Pauling had been at loggerheads, sometimes acrimoniously so, with the medical establishment. It is easy to imagine him somewhere in the timeless infinitude of the empyrean sporting his characteristic ear-to-ear grin.

  1. The birth and development of the DNA theory of inheritance: sixty years since the discovery of the structure of DNA.

    Science.gov (United States)

    Portin, Petter

    2014-04-01

    The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.

  2. Codon Distribution in Error-Detecting Circular Codes.

    Science.gov (United States)

    Fimmel, Elena; Strüngmann, Lutz

    2016-03-15

    In 1957, Francis Crick et al. suggested an ingenious explanation for the process of frame maintenance. The idea was based on the notion of comma-free codes. Although Crick's hypothesis proved to be wrong, in 1996, Arquès and Michel discovered the existence of a weaker version of such codes in eukaryote and prokaryote genomes, namely the so-called circular codes. Since then, circular code theory has invariably evoked great interest and made significant progress. In this article, the codon distributions in maximal comma-free, maximal self-complementary C³ and maximal self-complementary circular codes are discussed, i.e., we investigate in how many of such codes a given codon participates. As the main (and surprising) result, it is shown that the codons can be separated into very few classes (three, or five, or six) with respect to their frequency. Moreover, the distribution classes can be hierarchically ordered as refinements from maximal comma-free codes via maximal self-complementary C(3) codes to maximal self-complementary circular codes.

  3. Frozen Accident Pushing 50: Stereochemistry, Expansion, and Chance in the Evolution of the Genetic Code.

    Science.gov (United States)

    Koonin, Eugene V

    2017-05-23

    Nearly 50 years ago, Francis Crick propounded the frozen accident scenario for the evolution of the genetic code along with the hypothesis that the early translation system consisted primarily of RNA. Under the frozen accident perspective, the code is universal among modern life forms because any change in codon assignment would be highly deleterious. The frozen accident can be considered the default theory of code evolution because it does not imply any specific interactions between amino acids and the cognate codons or anticodons, or any particular properties of the code. The subsequent 49 years of code studies have elucidated notable features of the standard code, such as high robustness to errors, but failed to develop a compelling explanation for codon assignments. In particular, stereochemical affinity between amino acids and the cognate codons or anticodons does not seem to account for the origin and evolution of the code. Here, I expand Crick's hypothesis on RNA-only translation system by presenting evidence that this early translation already attained high fidelity that allowed protein evolution. I outline an experimentally testable scenario for the evolution of the code that combines a distinct version of the stereochemical hypothesis, in which amino acids are recognized via unique sites in the tertiary structure of proto-tRNAs, rather than by anticodons, expansion of the code via proto-tRNA duplication, and the frozen accident.

  4. Long-time solution of the time-dependent Schroedinger equation for an atom in an electromagnetic field using complex coordinate contours

    Energy Technology Data Exchange (ETDEWEB)

    Tao, Liang; Vanroose, Wim; Reps, Brian; Rescigno, Thomas N.; McCurdy, C. William

    2009-09-08

    We demonstrate that exterior complex scaling (ECS) can be used to impose outgoing wave boundary conditions exactly on solutions of the time-dependent Schrodinger equation for atoms in intense electromagnetic pulses using finite grid methods. The procedure is formally exact when applied in the appropriate gauge and is demonstrated in a calculation of high harmonic generation in which multiphoton resonances are seen for long pulse durations. However, we also demonstrate that while the application of ECS in this way is formally exact, numerical error can appear for long time propagations that can only be controlled by extending the finite grid. A mathematical analysis of the origins of that numerical error, illustrated with an analytically solvable model, is also given.

  5. The continuum Schroedinger-Coulomb and Dirac-Coulomb Sturmian functions. Corrigendum. J. Phys. A: Math. Gen. v. 31 p. 4963-90

    CERN Document Server

    Szmytkowski, R

    1998-01-01

    Equations (6), (41), (48), (131), (190) and (203) were printed incorrectly and are here corrected. The fourth line of equation (151) should start with 'x'. The fourth, fifth and sixth sentences of the paragraph following equation (149) should read as follows. 'This is indeed the case and initially we shall find the second set of orthogonality relations for the radial Sturmians of the second kind left brace(S-bar submu sub - sub b sub a sub r sub x (x) T-bar submu sub x (x)) sup T right brace. To this end we consider two differential equations of the form (133) satisfied by the functions (S-bar submu sub - sub b sub a sub r sub x (x') T-bar submu sub - sub b sub a sub r sub x (x')) sup T and S-bar submu sub - sub b sub a sub r sub ' sub x (x') T-bar submu sub - sub b sub a sub r sub ' sub x (x')) sup T , respectively. We premultiply the equation for (S-bar submu sub - sub b sub a sub r sub x (x') T-bar submu sub b sub - sub b sub a sub r sub x (x')) sup T by (S-bar submu sub - sub b sub a sub r sub ' sub x (x'...

  6. Solution Analytique De L'equation De Schroedinger Pour Un Potentiel Coulombien-plus-lineaire: Les Fonctions D'onde (french Text)

    CERN Document Server

    Plante, G

    2005-01-01

    Nous résolvons l'équation de Schrödinger indépendante du temps pour le cas d'un système quark-antiquark interagissant via un potentiel donné par la somme d'un potentiel coulombien et d'un potentiel linéaire. La solution en série de l'équation de Schrödinger pour ce potentiel mène à une équation récursive linéaire homogène à quatre termes et à coefficients variables reliant les coefficients du développement en série de puissances. Nous obtenons la solution de cette équation récursive en termes de fonctions appelées fonctions combinatoires. Les fonctions combinatoires sont définies par rapport à l'ensemble des partitions d'un intervalle en parts. Les parts disponibles pour la partition de l'intervalle sont les différences d'ordre entr...

  7. Browse Author Index

    African Journals Online (AJOL)

    Items 351 - 400 of 2288 ... Francis, Filbert · Francis, Filbert · Francis, Filbert · Francis, Filbert · Francis, Joel Msafiri · Franzeck, Fabian · Fredrick, Francis · Fredrick, Francis · Friis, Henrik · Frimpong, Christiana · Frumence, Gasto · Frumence, Gasto · Fukunaga, M · Fungo, S. Funkquist, Å · Fwalo, Frank · Fyumagwa, Robert D.

  8. O projeto da Grande Instauração de Francis Bacon e por que Kant lhe dedicou a Crítica = Francis Bacon’s project of the Instauratio Magna, and why Kant dedicated the Critique to him

    Directory of Open Access Journals (Sweden)

    Spinelli, Miguel

    2010-01-01

    Full Text Available O objetivo principal deste artigo consiste em averiguar os propósitos que levaram Bacon a compor o que chamou de Instauratio Magna: uma grande instauração da ciência futura nos termos de uma ampla restauração do passado da ciência. Trata-se de uma exposição de seu projeto (do que idealizou fazer em contraposição ao que efetivamente realizou. Visto que Kant dedicou a Bacon a Crítica da Razão pura, também se impôs como objetivo deste artigo a necessidade de buscar o motivo dessa dedicatória

  9. Performance optimization methodology in a Francis turbine vacuum cleaner based on the modification of the boundary conditions; Metodologia de optimizacion del rendimiento en un aspirador de turbina Francis en base a la modificacion de las condiciones de frontera

    Energy Technology Data Exchange (ETDEWEB)

    Galvan Gonzalez, S.; Rubio Maya, C.; Mendoza Covarrubias, C. [Universidad Michoacana de San Nicolas Hidalgo, Morelia, Michoacan (Mexico)]. E-mail: srgalvan@umich.mx; crmaya@umich.mx; cmendoza@umich.mx; Pacheco Ibarra, J.; Martinez Patino, J. [Universidad de Guanajuato, Salamanca, Guanajuato (Mexico)

    2010-11-15

    This paper focus on establishing an optimization methodology for maximizing the draft tube performance as a function of the inlet velocity profile. The overall work is defined by four steps: the inlet velocity profile parametrization, the numerical optimization set-up, the numerical computational fluid dynamics (CFD) draft tube model and the objective function definition. However as the inlet velocity profile is a new challenge, each step of the parametrization must be properly validated. In the first step, a suitable parametrization with an appropriate number of variables is chosen to approximate an experimental draft tube inlet velocity profile. The second step considers the reduction of the actual numerical model to develop the CFD calculations. In the third step, the optimization algorithm set-up is specified. Finally, the objective function is evaluated. As each step is properly validated, it is considered this proved methodology will help to find an inlet velocity profile shape which will be able to suppress or mitigate the undesirable draft tube flow characteristics. [Spanish] Este documento se enfoca en establecer una metodologia de optimizacion para maximizar el rendimiento del tubo de aspiracion en funcion de las condiciones de frontera del aspirador. El metodo es definido en cuatro etapas: la parametrizacion del perfil de velocidades, la evaluacion del algoritmo de optimizacion, la valoracion de la funcion objetivo y la validacion del modelo numerico. La parametrizacion se realiza con un numero de variables apropiado para aproximar el perfil de velocidades experimental. El segundo paso considera establecer los parametros del algoritmo de optimizacion, la funcion objetivo es obtenida mediante un estudio de sensibilidad y el modelo numerico es validado y reducido en la cantidad de elementos para adecuarlo al proceso de optimizacion. Se considera que esta metodologia ayudara a encontrar un perfil de velocidad de entrada el cual reduzca las perdidas de energia a lo largo de un tubo de aspiracion, logrando asi un incremento global en el rendimiento de la turbina.

  10. 77 FR 3010 - In the Matter of Mr. Francis Guilbeau; Order Prohibiting Involvement in NRC-Licensed Activities

    Science.gov (United States)

    2012-01-20

    ... days prior to going out on this job, Mr. Guilbeau chose the correct response to a question asking what... incident occurred on Mr. Guilbeau's first job back with Accurate NDE after several years working elsewhere... held on August 25, 2011, Mr. Guilbeau stated repeatedly that his primary aim was to get the ``pill...

  11. Inkulturace evangelia vincentské spirituality do prostředí Francie 17. století

    OpenAIRE

    Majerčíková, Jana

    2008-01-01

    ANGLICKÁ ANOTACE Enculturation of the gospel of Vincent de Paul's spirituality into the life of 17th century France The text is divided into four parts. The first part concerns the historical and religious framework of the French society in 16th and 17th century, which is the period connected with the efforts to restore the spiritual and moral life of the society. The second part is dedicated to the life and work of Vincent de Paul, the initiator of the spirituality, a great reformer of the i...

  12. Michael Francis Madelin (1931--2007): a pioneer in the biology and ecology of conidial fungi and slime moulds.

    Science.gov (United States)

    Campbell, Richard

    2008-12-01

    Michael F Madelin (1931--2007) was Programme Secretary, Vice-President, and President of the British Mycological Society. A summary of his research on Coprinopsis, various conidial fungi, Coelomomyces and myxomycetes is presented, with a full list of his publications. His teaching career was initially at Imperial College, University of London, and then mostly at the University of Bristol.

  13. Experimental analysis of the vibration on the draft tube of a Francis hydraulic turbine during operation at different power levels

    Directory of Open Access Journals (Sweden)

    Fernando Casanova García

    2010-01-01

    Full Text Available En el tubo de aspiración de una turbina hidráulica de 95 MW operando a carga parcial se presentan fuertes vibraciones. Debido a la inestabilidad hidráulica dentro del tubo se presentan fallas frecuentes en elementos estructurales de la planta, principalmente cuando la máquina opera a carga parcial. En este trabajo se midieron las presiones dentro del tubo de aspiración y los esfuerzos en la pared externa del tubo de aspiración a varios niveles de potencia para identificar la potencia donde las condiciones son críticas para la estructura. También, se realizaron mediciones a carga parcial con inyección de aire sobre los alabes fijos y con alivio de presión en el caracol. Se encontró que la inyección de aire reduce efectivamente las vibraciones mientras que el alivio de presión en el caracol no produce ningún efecto útil.

  14. Cultural Resource Investigations in the L’Anguille River Basin, Lee, St. Francis, Cross and Poinsett Counties, Arkansas.

    Science.gov (United States)

    1989-01-01

    up to 9 megaspores), bur reed, coontail (Ceratophyllum echinatum), ditch witch (Ruppia maritima , 4 fruits), mermaid weed, naiad, pondweed, stonewort...The study area can thus be viewed as something of a cultural laboratory for the analysis of subsistence change, as well as for the study of political ... political rivalries, ultimately based on the control of important resources such as trade routes, agricultural lands, or hunting territories (e.g

  15. Francis Saint-Dizier (dir.), Cinémas d’Amérique latine no 18

    OpenAIRE

    Rocío Guerrero

    2011-01-01

    El cine, agrupa en su concepción diferentes artes. La actuación, los diálogos, los paisajes, la música, la escenografía y la fotografía, se prestan a su servicio para transmitir mensajes e ideas dirigidas a diferentes grupos sociales. El cine latinoamericano, se caracteriza en su mayoría, por brindarle un interés particular a las historias de la vida real. Los héroes nacionales, los mitos urbanos, las independencias, los procesos revolucionarios, las injusticias sociales, son todos temas recu...

  16. Model measurement based identification of Francis turbine vortex rope parameters for prototype part load pressure and power pulsation prediction

    Science.gov (United States)

    Manderla, M.; Weber, W.; Koutnik, J.

    2016-11-01

    Pressure and power fluctuations of hydro-electric power plants in part-load operation are an important measure for the quality of the power which is delivered to the electrical grid. It is well known that the unsteadiness is driven by the flow patterns in the draft tube where a vortex rope is present. However, until today the equivalent vortex rope parameters for common numerical 1D-models are a major source of uncertainty. In this work, a new optimization-based grey box method for experimental vortex rope modelling and parameter identification is presented. The combination of analytical vortex rope and test rig modelling and the usage of dynamic measurements allow the identification of the unknown vortex rope parameters. Upscaling from model to prototype size is achieved via existing nondimensional parameters. In this work, a new experimental setup and system identification method is proposed which are suitable for the determination of the full set of part load vortex rope parameters in the lab. For the vortex rope, a symmetric model with cavity compliance, bulk viscosity and two pressure excitation sources is developed and implemented which shows the best correspondence with available measurement data. Due to the non-dimensional parameter definition, scaling is possible. This finally provides a complete method for the prediction of prototype part-load pressure and power oscillations. Since the proposed method is based on a simple limited control domain, limited modelling effort and also small modelling uncertainties are some major advantages. Due to the generality of the approach, a future application to other operating conditions such as full load will be straightforward.

  17. Archaeological Investigations at 3SF332: An Early Mississippian and Tenant Period Site on Cutoff Bayou, St. Francis County, Arkansas

    Science.gov (United States)

    1991-06-01

    socioeconomic status of different historic ceramics and, following Miller, many archaeologists are now focusing their analyses on decorative motifs and...Survey Research Series 13. Munsell Soil Color Charts 1990 Munsell Soil Color Charts. Munsell Color, MacBeth Division of Kollmorgen Instruments Corporation

  18. Alpha List of Prime Contract Awards. Oct 92-Sep 93. FY93. (Claude Ralph - Day Francis O Co. Inc.)

    Science.gov (United States)

    1994-03-01

    00000000000ooao 0000000000000000 (.D01(D (D AD 0 0. 11 4- 1 G 0 1t 1 4oM0o ii arn 0) cr~) c r ) rF’n-o0 - 3n -4 oo w0UU)L m .%-4 o co o o I0 U -4C )%.) 0-(vG WL... arn ) rnn n (T) 0rnl- i-Da " s-iD (ni0 s- - s-inM l’- l1 1 OON If0 UM v cn 10 0 r% P-.P r-. r P.4 < "’ 00 010 00Cl c0 L00 mn< U Z It4J I CDNC 11010n 0...0000((( III, "CiOOO Ný (0 ~0 a0 NNjCI If I Cc0a(0411 0(0(taw(COW tow WIDOW(COC0 0(0(0 (00(0W .-4 AdN CO Li.Lf In aNN.r 0.L 1144- I w004* 11 t0I(00q-4

  19. Mobile Technology and Health Care, From NIH Director Dr. Francis S. Collins | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... NIH will be running an institute on mobile technology for 25 junior investigators. It will run for five days, cover all aspects of the emerging discipline, and be managed by the NIH office of Behavioral and Social Science Research, with a variety of other partners. Winter ...

  20. Evaluative Archeological Investigations at Four Sites Along the Right Bank of Lake Francis Case, Lyman County, South Dakota. Volume 1

    Science.gov (United States)

    1991-02-01

    pigmentary specimens, most of which are associated with the burial mound interments. 13 Other sites in the general area that are apparently associated... colored coarse grained quartz and a glass- like but somewhat uneven fracture in the fine grained clear quartz. No source has been identified for this...material. Tongue River Silicified sediment is characterized by a gray, yellow or red colored silicified sand with occasional fossilized plant remains

  1. BOOK REVIEW SOCIOLOGY: UNDERSTANDING A DIVERSE SOCIETY (By: Andersen, Margaret L., and Howard, Francis T., Thomson Learning inc, 2008

    Directory of Open Access Journals (Sweden)

    Arif Makmun

    2014-04-01

    Full Text Available This book is really good to read which contains comprehensive source of insight into the mechanisms of social interaction between diverse social groups within a certain unit of society. The book is instrumental in providing an overview of the differences in ethnicity, gender, class, religion, as well as the geographical origins of individuals who can greatly influence one’s system of values, beliefs and stereotypes. The volume is based on extensive research work that has been carried out by the authors and covers a wide range of topics related to such sociological notions as culture, power, social change, stratification, crime, inequality, social interaction and social structure, among others. The first part of the book is focused on a discussion of sociological perspectives. Part two covers the topic of individuals and society and part three is about social inequalities. The fourth part is dedicated to social institutions and mechanisms of their functioning, whereas the fifth and last part covers the notion of social change.

  2. 77 FR 68822 - Notice of Inventory Completion: U.S. Department of Agriculture, Forest Service, Ozark-St. Francis...

    Science.gov (United States)

    2012-11-16

    ... minimum, one individual were removed from site 3NW405 in Newton County, AR, by Steve Erwin of the AAS. The... representing, at minimum, two individuals were removed from site 3NW408 in Newton County, AR, by Steve Erwin of...

  3. The Promise and Payoff of Rare Diseases Research, From NIH Director Dr. Francis S. Collins | NIH MedlinePlus the ...

    Science.gov (United States)

    ... version of this page please turn Javascript on. The Promise and Payoff of Rare Diseases Research, From ... them at the present time. How much does the mapping of the human genome help? The Human ...

  4. Nutrient and carbon cycling in agro-ecosystems and their interactions with ecosystem services. 27th Francis New Memorial Lecture

    NARCIS (Netherlands)

    Neeteson, J.J.

    2011-01-01

    Ecosystem services are the benefits people obtain from ecosystems. An ecosystem is the interacting system of living organisms and their associated non-living environment. Four types of ecosystem services can be distinguished: provisioning services, regulating services, cultural services, and

  5. Introducing the Astley-Francis Theology of Religions Index: Construct Validity among 13- to 15-Year-Old Students

    Science.gov (United States)

    Astley, Jeff; Francis, Leslie J.

    2016-01-01

    The "theology of religions" is concerned with the interpretation and evaluation of the divergent truth-claims and views of salvation that are asserted or implied by different religious traditions. This study proposes a new multi-choice index that distinguishes between six current positions within the theology of religions, characterised…

  6. tRNA's wobble decoding of the genome: 40 years of modification.

    Science.gov (United States)

    Agris, Paul F; Vendeix, Franck A P; Graham, William D

    2007-02-09

    The genetic code is degenerate, in that 20 amino acids are encoded by 61 triplet codes. In 1966, Francis Crick hypothesized that the cell's limited number of tRNAs decoded the genome by recognizing more than one codon. The ambiguity of that recognition resided in the third base-pair, giving rise to the Wobble Hypothesis. Post-transcriptional modifications at tRNA's wobble position 34, especially modifications of uridine 34, enable wobble to occur. The Modified Wobble Hypothesis proposed in 1991 that specific modifications of a tRNA wobble nucleoside shape the anticodon architecture in such a manner that interactions were restricted to the complementary base plus a single wobble pairing for amino acids with twofold degenerate codons. However, chemically different modifications at position 34 would expand the ability of a tRNA to read three or even four of the fourfold degenerate codons. One foundation of Crick's Wobble Hypothesis was that a near-constant geometry of canonical base-pairing be maintained in forming all three base-pairs between the tRNA anticodon and mRNA codon on the ribosome. In accepting an aminoacyl-tRNA, the ribosome requires maintenance of a specific geometry for the anticodon-codon base-pairing. However, it is the post-transcriptional modifications at tRNA wobble position 34 and purine 37, 3'-adjacent to the anticodon, that pre-structure the anticodon domain to ensure the correct codon binding. The modifications create both the architecture and the stability needed for decoding through restraints on anticodon stereochemistry and conformational space, and through selective hydrogen bonding. A physicochemical understanding of modified nucleoside contributions to the tRNA anticodon domain architecture and its decoding of the genome has advanced RNA world evolutionary theory, the principles of RNA chemistry, and the application of this knowledge to the introduction of new amino acids to proteins.

  7. 'Memory and molecular turnover,' 30 years after inception.

    Science.gov (United States)

    Meagher, Richard B

    2014-01-01

    In 1984 Sir Francis Crick hypothesized that memory is recorded in the brain as reversible modifications to DNA and protein, but acknowledged that most biomolecules turn over too rapidly to account for long-term memories. To accommodate this possible paradox he modeled an enzymatic mechanism to maintain modifications on hemi-modified multimeric symmetrical molecules. While studies on the turnover of chromatin modifications that may be involved in memory are in their infancy, an exploration of his model in the light of modern epigenetics produced somewhat surprising results. The molecular turnover rates for two classes of chromatin modifications believed to record and store durable memories were approximated from experiments using diverse approaches and were found to be remarkably short. The half-lives of DNA cytosine methylation and post-translationally modified nucleosomal histones are measured in hours and minutes, respectively, for a subset of sites on chromatin controlling gene expression. It appears likely that the turnover of DNA methylation in the brain and in neurons, in particular, is even more rapid than in other cell types and organs, perhaps accommodating neuronal plasticity, learning, and memory. The machinery responsible for the rapid turnover of DNA methylation and nucleosomal histone modifications is highly complex, partially redundant, and appears to act in a sequence specific manner. Molecular symmetry plays an important part in maintaining site-specific turnover, but its particular role in memory maintenance is unknown. Elucidating Crick's paradox, the contradiction between rapid molecular turnover of modified biomolecules and long-term memory storage, appears fundamental to understanding cognitive function and neurodegenerative disease.

  8. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be considered as a source of the mutagenic tautomers of the DNA bases, as the A·G base mispair dissociates during DNA replication exceptionally into the A and G monomers in the canonical tautomeric form. Copyright © 2013 Wiley Periodicals, Inc.

  9. The mystery of consciousness

    CERN Document Server

    Searle, John R

    1997-01-01

    It has long been one of the most fundamental problems of philosophy, and it is now, John Searle writes, "the most important problem in the biological sciences": What is consciousness? Is my inner awareness of myself something separate from my body? In what began as a series of essays in The New York Review of Books, John Searle evaluates the positions on consciousness of such well-known scientists and philosophers as Francis Crick, Gerald Edelman, Roger Penrose, Daniel Dennett, David Chalmers, and Israel Rosenfield. He challenges claims that the mind works like a computer, and that brain functions can be reproduced by computer programs. With a sharp eye for confusion and contradiction, he points out which avenues of current research are most likely to come up with a biological examination of how conscious states are caused by the brain. Only when we understand how the brain works will we solve the mystery of consciousness, and only then will we begin to understand issues ranging from artificial intelligence...

  10. Vedolizumab: toward a personalized therapy paradigm for people with ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Dart RJ

    2017-03-01

    Full Text Available Robin J Dart,1–3,* Mark A Samaan,1,* Nick Powell,1,4 Peter M Irving1 1Department of Gastroenterology, IBD Centre, St. Thomas’ Hospital, 2Immunosurveillance Laboratory, The Francis Crick Institute, London, 3Division of Immunology, Infection, and Inflammatory Disease (DIIID, King’s College London, 4Department of Experimental Immunobiology, Division of Transplantation and Mucosal Biology, King’s College London, London, UK *These authors contributed equally to this work Abstract: Ulcerative colitis (UC is a chronic relapsing and remitting inflammatory bowel disease, with a characteristic leukocytic infiltration of the mucosa. Immunosuppression including anti-TNF-α therapy is a mainstay of treatment for many; however, systemic immunosuppression is not universally effective and is associated with potential side effects. The gut-tropic integrin α4β7, which is expressed on leukocytes, mediates migration from the circulation to the intestinal mucosa. Vedolizumab is a monoclonal antibody which blocks the egress of leukocytes via α4β7, preventing accumulation in the mucosa, and attenuating inflammation without systemic immunosuppression. Vedolizumab has been evaluated in UC in a phase III trial, demonstrating efficacy as both an induction and a maintenance agent. In this article, we review the clinical trial data and also explore the growing body of “real-world” effectiveness data, investigating response and remission rates of vedolizumab in clinical practice. In addition, we review the increasing volume of data supporting the reassuring safety profile associated with vedolizumab. Keywords: vedolizumab, ulcerative colitis, personalized therapy

  11. HGSA DNA day essay contest winner 60 years on: still coding for cutting-edge science.

    Science.gov (United States)

    Yates, Patrick

    2013-08-01

    MESSAGE FROM THE EDUCATION COMMITTEE: In 2013, the Education Committee of the Human Genetics Society of Australasia (HGSA) established the DNA Day Essay Contest in Australia and New Zealand. The contest was first established by the American Society of Human Genetics in 2005 and the HGSA DNA Day Essay Contest is adapted from this contest via a collaborative partnership. The aim of the contest is to engage high school students with important concepts in genetics through literature research and reflection. As 2013 marks the 60th anniversary of the discovery of the double helix of DNA by James Watson and Francis Crick and the 10th anniversary of the first sequencing of the human genome, the essay topic was to choose either of these breakthroughs and explain its broader impact on biotechnology, human health and disease, or our understanding of basic genetics, such as genetic variation or gene expression. The contest attracted 87 entrants in 2013, with the winning essay authored by Patrick Yates, a Year 12 student from Melbourne High School. Further details about the contest including the names and schools of the other finalists can be found at http://www.hgsa-essay.net.au/. The Education Committee would like to thank all the 2013 applicants and encourage students to enter in 2014.

  12. Diffusible gradients are out - an interview with Lewis Wolpert. Interviewed by Richardson, Michael K.

    Science.gov (United States)

    Wolpert, Lewis

    2009-01-01

    In 1969, Lewis Wolpert published a paper outlining his new concepts of "pattern formation" and "positional information". He had already published research on the mechanics of cell membranes in amoebae, and a series of classic studies of sea urchin gastrulation with Trygve Gustavson. Wolpert had presented his 1969 paper a year earlier at a Woods Hole conference, where it received a very hostile reception: "I wasnt asked back to America for many years!". But with Francis Crick lining up in support of diffusible morphogen gradients, positional information eventually became established as a guiding principle for research into biological pattern formation. It is now clear that pattern formation is much more complex than could possibly have been imagined in 1969. But Wolpert still believes in positional information, and regards intercalation during regeneration as its best supporting evidence. However, he and others doubt that diffusible morphogen gradients are a plausible mechanism: "Diffusible gradients are too messy", he says. Since his retirement, Lewis Wolpert has remained active as a theoretical biologist and continues to publish in leading journals. He has also campaigned for a greater public understanding of the stigma of depression. He was interviewed at home in London on July 26th, 2007 by Michael Richardson.

  13. Codon Distribution in Error-Detecting Circular Codes

    Directory of Open Access Journals (Sweden)

    Elena Fimmel

    2016-03-01

    Full Text Available In 1957, Francis Crick et al. suggested an ingenious explanation for the process of frame maintenance. The idea was based on the notion of comma-free codes. Although Crick’s hypothesis proved to be wrong, in 1996, Arquès and Michel discovered the existence of a weaker version of such codes in eukaryote and prokaryote genomes, namely the so-called circular codes. Since then, circular code theory has invariably evoked great interest and made significant progress. In this article, the codon distributions in maximal comma-free, maximal self-complementary C3 and maximal self-complementary circular codes are discussed, i.e., we investigate in how many of such codes a given codon participates. As the main (and surprising result, it is shown that the codons can be separated into very few classes (three, or five, or six with respect to their frequency. Moreover, the distribution classes can be hierarchically ordered as refinements from maximal comma-free codes via maximal self-complementary C3 codes to maximal self-complementary circular codes.

  14. The Neurogenetic Correlates of Consciousness

    Science.gov (United States)

    Grandy, John K.

    2013-09-01

    The neurogenetic correlates of consciousness (NgCC) is a new field of consciousness studies that focuses on genes that have an effect on or are involved in the continuum of neuron-based consciousness. A framework of consciousness based on the neural correlates of consciousness (NCC) has already been established by Francis Crick and Christof Kock. In this work I propose that there are NgCC underlying the NCC which are both active during the conscious experience. So how are genes involved? There are two significant connections between DNA and neurons that are involved in the conscious experience. First, any brain system can be adversely affected by underlying genetic abnormalities which can be expressed in an individual at birth, in adulthood, or later in life. Second, the DNA molecule does not lay dormant while the neuron runs on autopilot. DNA is active in translating and transcribing RNA and protein products that are utilized during neuron functioning. Without these products being continuously produced by the DNA during a conscious experience the neurons would cease to function correctly and be rendered unable to provide a continuum of human consciousness. Consequently, in addition to NCC, NgCC must be factored in when appreciating a conscious event. In this work I will discuss and explain some NgCC citing several examples.

  15. Drugability of extracellular targets: discovery of small molecule drugs targeting allosteric, functional, and subunit-selective sites on GPCRs and ion channels.

    Science.gov (United States)

    Grigoriadis, Dimitri E; Hoare, Samuel R J; Lechner, Sandra M; Slee, Deborah H; Williams, John A

    2009-01-01

    Beginning with the discovery of the structure of deoxyribose nucleic acid in 1953, by James Watson and Francis Crick, the sequencing of the entire human genome some 50 years later, has begun to quantify the classes and types of proteins that may have relevance to human disease with the promise of rapidly identifying compounds that can modulate these proteins so as to have a beneficial and therapeutic outcome. This so called 'drugable space' involves a variety of membrane-bound proteins including the superfamily of G-protein-coupled receptors (GPCRs), ion channels, and transporters among others. The recent number of novel therapeutics targeting membrane-bound extracellular proteins that have reached the market in the past 20 years however pales in magnitude when compared, during the same timeframe, to the advancements made in the technologies available to aid in the discovery of these novel therapeutics. This review will consider select examples of extracellular drugable targets and focus on the GPCRs and ion channels highlighting the corticotropin releasing factor (CRF) type 1 and gamma-aminobutyric acid receptors, and the Ca(V)2.2 voltage-gated ion channel. These examples will elaborate current technological advancements in drug discovery and provide a prospective framework for future drug development.

  16. Probable relationship between partitions of the set of codons and the origin of the genetic code.

    Science.gov (United States)

    Salinas, Dino G; Gallardo, Mauricio O; Osorio, Manuel I

    2014-03-01

    Here we study the distribution of randomly generated partitions of the set of amino acid-coding codons. Some results are an application from a previous work, about the Stirling numbers of the second kind and triplet codes, both to the cases of triplet codes having four stop codons, as in mammalian mitochondrial genetic code, and hypothetical doublet codes. Extending previous results, in this work it is found that the most probable number of blocks of synonymous codons, in a genetic code, is similar to the number of amino acids when there are four stop codons, as well as it could be for a primigenious doublet code. Also it is studied the integer partitions associated to patterns of synonymous codons and it is shown, for the canonical code, that the standard deviation inside an integer partition is one of the most probable. We think that, in some early epoch, the genetic code might have had a maximum of the disorder or entropy, independent of the assignment between codons and amino acids, reaching a state similar to "code freeze" proposed by Francis Crick. In later stages, maybe deterministic rules have reassigned codons to amino acids, forming the natural codes, such as the canonical code, but keeping the numerical features describing the set partitions and the integer partitions, like a "fossil numbers"; both kinds of partitions about the set of amino acid-coding codons. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. The thalamic reticular nucleus: structure, function and concept.

    Science.gov (United States)

    Pinault, Didier

    2004-08-01

    On the basis of theoretical, anatomical, psychological and physiological considerations, Francis Crick (1984) proposed that, during selective attention, the thalamic reticular nucleus (TRN) controls the internal attentional searchlight that simultaneously highlights all the neural circuits called on by the object of attention. In other words, he submitted that during either perception, or the preparation and execution of any cognitive and/or motor task, the TRN sets all the corresponding thalamocortical (TC) circuits in motion. Over the last two decades, behavioural, electrophysiological, anatomical and neurochemical findings have been accumulating, supporting the complex nature of the TRN and raising questions about the validity of this speculative hypothesis. Indeed, our knowledge of the actual functioning of the TRN is still sprinkled with unresolved questions. Therefore, the time has come to join forces and discuss some recent cellular and network findings concerning this diencephalic GABAergic structure, which plays important roles during various states of consciousness. On the whole, the present critical survey emphasizes the TRN's complexity, and provides arguments combining anatomy, physiology and cognitive psychology.

  18. Programming peptidomimetic syntheses by translating genetic codes designed de novo.

    Science.gov (United States)

    Forster, Anthony C; Tan, Zhongping; Nalam, Madhavi N L; Lin, Hening; Qu, Hui; Cornish, Virginia W; Blacklow, Stephen C

    2003-05-27

    Although the universal genetic code exhibits only minor variations in nature, Francis Crick proposed in 1955 that "the adaptor hypothesis allows one to construct, in theory, codes of bewildering variety." The existing code has been expanded to enable incorporation of a variety of unnatural amino acids at one or two nonadjacent sites within a protein by using nonsense or frameshift suppressor aminoacyl-tRNAs (aa-tRNAs) as adaptors. However, the suppressor strategy is inherently limited by compatibility with only a small subset of codons, by the ways such codons can be combined, and by variation in the efficiency of incorporation. Here, by preventing competing reactions with aa-tRNA synthetases, aa-tRNAs, and release factors during translation and by using nonsuppressor aa-tRNA substrates, we realize a potentially generalizable approach for template-encoded polymer synthesis that unmasks the substantially broader versatility of the core translation apparatus as a catalyst. We show that several adjacent, arbitrarily chosen sense codons can be completely reassigned to various unnatural amino acids according to de novo genetic codes by translating mRNAs into specific peptide analog polymers (peptidomimetics). Unnatural aa-tRNA substrates do not uniformly function as well as natural substrates, revealing important recognition elements for the translation apparatus. Genetic programming of peptidomimetic synthesis should facilitate mechanistic studies of translation and may ultimately enable the directed evolution of small molecules with desirable catalytic or pharmacological properties.

  19. THADA Regulates the Organismal Balance between Energy Storage and Heat Production.

    Science.gov (United States)

    Moraru, Alexandra; Cakan-Akdogan, Gulcin; Strassburger, Katrin; Males, Matilda; Mueller, Sandra; Jabs, Markus; Muelleder, Michael; Frejno, Martin; Braeckman, Bart P; Ralser, Markus; Teleman, Aurelio A

    2017-04-10

    Human susceptibility to obesity is mainly genetic, yet the underlying evolutionary drivers causing variation from person to person are not clear. One theory rationalizes that populations that have adapted to warmer climates have reduced their metabolic rates, thereby increasing their propensity to store energy. We uncover here the function of a gene that supports this theory. THADA is one of the genes most strongly selected during evolution as humans settled in different climates. We report here that THADA knockout flies are obese, hyperphagic, have reduced energy production, and are sensitive to the cold. THADA binds the sarco/ER Ca2+ ATPase (SERCA) and acts on it as an uncoupler. Reducing SERCA activity in THADA mutant flies rescues their obesity, pinpointing SERCA as a key effector of THADA function. In sum, this identifies THADA as a regulator of the balance between energy consumption and energy storage, which was selected during human evolution. Copyright © 2017 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

  20. From the peas of Gregor Mendel to the human genome and beyond

    CERN Document Server

    Paces, V

    2008-01-01

    In the middle of the 19th century, Gregor Mendel conducted his experiments with peas. This took place in the Augustinian monastery in Brno (now the Czech Republic), where he was the abbot. These experiments laid the foundations of modern genetics. At around the same time Charles Darwin formulated his theory of evolution. Through their work, these two men inaugurated the age of modern biology. The next most important step came in 1953 when James Watson and Francis Crick solved the elusive DNA structure. Since then methods for ‘reading’ genetic information have developed quickly, and genomes of many organisms have been analysed, including our own. The human genome consists of 3 billion letters (nucleotides) and it comprises approximately 25,000 genes. The smallest natural genome is the genome of Mycoplasma genitalium. It consists of a mere 500,000 nucleotides and is composed of 500 genes. Yet, mycoplasma is capable of a completely independent life. It would appear from this fact that basic life itself is no...

  1. Chapter 24: the coming of molecular biology and its impact on clinical neurology.

    Science.gov (United States)

    Smith, Christopher U M

    2010-01-01

    Although the chemical study of the nervous system dates back well into the 19th century, molecular biology and especially molecular neurobiology only began to be established in the second half of the 20th century. This chapter reviews their impact on clinical neuroscience during the 50 years since Watson and Crick published their seminal paper. After a short review of the part played by F.O. Schmitt in establishing molecular neuroscience the chapter outlines work that led to a detailed understanding of the biochemical structure and function of nerve cell membranes and their embedded channel proteins, receptors, and other molecules. The chapter then turns to the numerous pathologies that result from disorders of these elements: the various channel and gap-junction pathologies. The chapter continues with a discussion of some of the diseases caused by defective DNA, especially the trinucleotide repeat expansion diseases (TREDs) and ends with a short account of the development of molecular approaches to prion diseases, myasthenia gravis, and the neurodegenerative diseases of old age. Francis Bacon said long ago that "knowledge is power." The hope is that increasing molecular knowledge will help cure some of the human suffering seen in the neurological ward and clinic.

  2. Frederick Sanger, Erwin Chargaff, and the metamorphosis of specificity.

    Science.gov (United States)

    Judson, H F

    1993-12-15

    That a transformation of ruling ideas in genetics and biochemistry took place at the dawn of molecular biology, in the late 1940s, is a commonplace; but the nature and components of that transformation are widely misunderstood. The change is often identified with the importation into biology of new styles of thought and new rigor by the many scientists trained in physics or chemistry who came into the nascent field--notably, Max Delbrück, Max Perutz, Francis Crick, John Kendrew, Maurice Wilkins, Rosalind Franklin. Most generally, the change is supposed to be the realization that genes are made not of protein but of nucleic acid--and this change was initiated, of course, by the work of Oswald Avery and his colleagues. These changes are not mutually exclusive, and both were surely important to the genesis of molecular biology. But logically prior to them, more fundamental, was another transformation in ruling preconceptions, one that has been neglected: the revolution in understanding of the chemical structures--the sequences of subunits--of proteins and of nucleic acids which was wrought by the work of Frederick Sanger and of Erwin Chargaff. This was a metamorphosis in the understanding of biochemical specificity, and while it astonished many biochemists it set free the small groups of those who were beginning to call themselves molecular biologists, enabling them to think of the relationship between genes and proteins in entirely new ways.

  3. EL RECEPTOR IONOTRÓPICO DE GLUTAMATO ACTIVADO POR N-METIL-D-ASPARTATO, MOLÉCULA CLAVE DE LA CONCIENCIA

    Directory of Open Access Journals (Sweden)

    L. Lareo

    2006-06-01

    Full Text Available Este trabajo presenta la propuesta de que una molécula, de relativo reciente conocimiento: el receptor ionotrópico de glutamato activado por N-metil-D-aspartato (iGluR-NMDA, es la molécula clave de la conciencia. Esta propuesta que se enmarcaría en lo que se puede llamar un Correlato Molecular de la Conciencia (CMC va más allá de las propuestas hechas por el premio Nóbel Francis Crick y Christof Koch cuando iniciaron esta ruta de investigación con lo que denominaron el Correlato Neuronal de la Conciencia (CNC y de la propuesta de Hans Flohr, centrada también en el iGluR-NMDA, pero fundamentada sólo en el papel que éste tiene en los procesos de anestesia. El CMC se justifica en aspectos no considerados hasta ahora como su expresión en corteza cerebral, las modificaciones moleculares subyacentes a los denominados estados alterados de la conciencia (EAC y las diferencias de composición evidenciadas entre animales y el hombre.

  4. Is Your Gut Conscious? Is an Extraterrestrial?

    Science.gov (United States)

    Vos Post, Jonathan

    2011-10-01

    This paper speculates on questions intending to be taken scientifically rather than metaphysically: "Can the human gut (enteric nervous system) be conscious?"; "Can your immune system think?"; "Could consciousness be coded in DNA?"; "What do we mean when asserting that an Extraterrestrial is Thinking, or is Conscious? We explore through reference to theory, experiment, and computational models by Christof Koch (Caltech), Barbara Wold (Caltech), and Stuart Kauffman (University of Calgary, Tampere University of Technology, Santa Fe Institute). We use a tentative new definition of thinking, designed to be applicable for humans, cetecea, corvids, artificial intelligences, and extraterrestrial intelligences of any substrate (i.e. Life as We Do Not Know It): "Thinking is the occurrence, transformation, and storage in a mind or brain (or simulation thereof) of information-bearing structures (representations) of one kind or another, such as thoughts, concept, percepts, ideas, impressions, notions, rules, schemas, images, phantasms, or subpersonal representations." We use the framework for Consciousness developed by Francis Crick and Christof Koch. We try to describe scientific goals, but discuss Philosophy sufficient to avoid naïve philosophical category errors (thus are careful not to conflate thought, consciousness, and language) Penrose, Hameroff, and Kauffman speculate (differently) that CNS consciousness is a macroscopic quantum phenomenon. Might intestinal, immune system, or genetic regulatory network dynamics exhibit emergent cooperative quantum effects? The speculations are in the context of Evolution by Natural Selection, presumed to operate throughout the Cosmos, and recent work in the foundations of Computational Biology and Quantum Mechanics.

  5. A Cultural Resources Literature Search and Record Review of The St. Francis River Seepage Project within Clay, Craighead, Mississippi and Poinsett Counties, Arkansas and Dunklin County, Missouri

    Science.gov (United States)

    1985-10-30

    2.24 Commerce Silt Loam 1.56 12.59 Convent Fine Sandy Loam .91 Cooter .04 Crevasse Loamy sand .42 .15 Crowley Silt Loam 1.97 Dexter Silt Loam .60 Dubbs...from Rogers , Al- bertson, Tom’s Brook, and Breckenridge Shelters (McMillian 1971, Kay 1980; Dickson 1982; Logan 1952; Bartlett 1963, 1964; WoodI 1963...ger iods 17,pog g OB. are best known from bluff shelter excavations in the Ozarks ( Rogers , Jakie’s, Calf Creek, Albertson, Breckenridge and Tom’s

  6. Archaeological Investigations at the Lewis Site (3LE266): A Twentieth- Century Black Owned Farmstead on the St. Francis Floodway, Lee County, Arkansas

    Science.gov (United States)

    1992-09-01

    twentieth-century scatters recently investigated by Garrow & Associates, Inc,. in eastern Arkansas. These scatters are dominated by kitchen refuse...Comparison of Kitchen Glass and Kitchen Ceramics. 65 3 9. Frequency Comparison of Ceramic Types. 66 10. Ranks by Indices of Agreement. 67 I ,I I I vi I...ponds, L S~Lewis Site Page- 6 U such as the flathead catfish (Pylodictis olivaris), alligator gar (Lepisosteus spatula ), drum (Pogonis cromis), buffalo

  7. Microbiological Evaluation of Production Procedures for Frozen Foil Pack Meals at the Central Preparation Facility of the Francis E. Warren Air Force Base

    Science.gov (United States)

    1976-01-01

    dessert are selected by the individual for reconstitution and consumption. The objectives of the study were to: 1. Conduct microbiological analysis...of food ingredients during processing. 2. Correlate the microbiological quality of the food ingredients during processing with processing parameters... ingredients used in frozen foil pack food 14 items 2 Analysis of processed items 15 3 Evaluation of equipment surfaces by Rodac plates 26 4 Evaluation of

  8. Cantico Delle Creature: A microtonal original composition for soprano and string quartet to a text by St. Francis of Assisi, including analytical commentary

    Science.gov (United States)

    Sabol, Jason A.

    Cantico delle Creature is an original piece of music for soprano and string quartet composed in 72 tone per octave equal temperament, dividing each semitone into six equal parts called twelfth-tones. This system of tuning makes it possible to combine just intonation and spectral principles based on the harmonic series with real imitation, modulation, and polyphony. Supplemental text discusses several aspects of microtonal structure and pedagogy, including the representation of the first 64 partials of the harmonic series in 72 tone equal temperament, performance of natural string harmonics, the relationship between interval size and vibration ratio, pitch to frequency conversion, and analysis of several passages in the musical score.

  9. A Survey Level Report of the Wappapello to Crowleys Ridge Channel Improvement and Scour Repair Project, St. Francis River Stoddard and Butler Counties, Missouri

    Science.gov (United States)

    1979-09-01

    Federal troops penetrated the area to attack Poplar Bluff, they, too, passed along this road. The deep division of loyalties among the inhabitants seems...Ellis 1929; Ogilvie 1967:529. 26 reveal data about transportation, economics, and customs during the years of their use. If the present roadbed for...state of the art of cultural resource management ( CRM ) has been the increased attention paid to the develop- ment and explicit use of research designs

  10. Politika Francie v Libyi po svrhnutí Kaddáfího: zajištění bezpečnosti, nebo demokratizace?

    OpenAIRE

    Mistrík, Peter

    2015-01-01

    The English school of international relations claims that the national interests of states and their behaviour in international relations are not only driven by selfish motives, but the so- called enlightened self-interest as well. The functioning of the community of the states is governed by common rules, laws, values and interests. According to the Solidarist current of the English school it is even acceptable to limit the sovereignty of the state which seriously violates international stan...

  11. Aspects of authority and power illustrated by the Portuguese canonization celebrations of Ignatius of Loyola and of Francis Javier Cristina Osswald Universidade Nova de Lisboa

    Directory of Open Access Journals (Sweden)

    Cristina Osswald

    2013-05-01

    Full Text Available The canonization of the founder of a Catholic religious order constitutes a milestone in the affirmation of authority by that order. As concerns to the Society of Jesus, it was a double canonization. Such an uncommon fact as this, clearly both demonstrates the power the Society had at the time at the Curia, and explains its intention of celebrating the auto-glorification. Its scenography, thus, aimed more to praise the triumph of the Society of Jesus through the use of allegorical figures such as Religion, Fame, Honour or Pomp, than anything else. The iconography of such festivities framed the first Jesuits saints within the history of the Society. Thus, the Portuguese jesuits paid homage, by means of the staging, to the beatified ones, the first jesuits and the martyrs. Moreover, the set pointed out its main devotions, characteristics and activities such as missionary work and teaching activities. Often canonizations of a certain figure were intimately related to political power in Early Modern Time. Therefore, Portuguese Jesuit festivities exalted, with a great vigour, feelings of nationalism during the Iberian Union’s time. In order to transmit the various aims, the organizers did not hesitate to use all Baroque celebrative resources (poetry, theatre, dance, music and visual arts. In other words, particularly luxurious and grandiose celebrations, including light, sound, colour, and odour spectacles or events (reference be made to the vases with perfume inside the churches took place by that time.

  12. Validation of mathematical models for predicting the swirling flow and the vortex rope in a Francis turbine operated at partial discharge

    DEFF Research Database (Denmark)

    Kuibin, P.A.; Okulov, Valery; Susan-Resiga, R.F.

    2010-01-01

    recover all this information without actually computing the full three-dimensional unsteady flow in the hydraulic turbine. As a result, we provide valuable mathematical tools for assessing the turbine behaviour at off-design operating regimes in the early stages of runner design, with computational effort...... several orders of magnitude less than the current approaches of simulating the complex turbine flow....

  13. Juan H. Vera and Grazyna Wilczek-Vera: Classical Thermodynamics of Fluid Systems: Principles and Applications. CRC Press, Taylor & Francis Group

    DEFF Research Database (Denmark)

    Kontogeorgis, Georgios

    2017-01-01

    The book Classical Thermodynamics of Fluid Systems: Principles and Applications written by professor Juan H. Vera and Dr. Grazyna Wilczek-Vera is undoubtably a book written in a most personal style by the two distinguished authors.The book contains four sections and a fifth one with appendices (m...

  14. [Fifty years ago, the double helix gave birth to molecular biology].

    Science.gov (United States)

    Lunardi, J

    2003-01-01

    Fifty years ago, a paper signed by two young scientists, James Watson and Francis Crick, and reporting a model for DNA based on a double helix structure was published in the scientific review Nature in date of april 25, 1953. Although this model of striking simplicity and rare elegance was actually worked out in a few months by the two men, it was the result of quite 100 years of research aimed at the definition of the structure of the genetic material present in living organisms. The double helix was the outcome of a multidisciplinary approach initiated in the mid 19th century by the genetic laws of Gregor Mendel and the discovery of the chemical nature of the desoxyribonucleic acid by Johann Friedrich Miesher. The discovery of the DNA structure had been at the origin of major scientific progress regarding mechanisms that rule the replication and the expression of the genetic information. Theses researches have given birth to a new scientific field, molecular biology, which everyone will see very soon is actually part in a quasi symbiotic manner of all other biological fields dealing with life. The spectacular development of molecular biology during the last fifty years was in great part possible thanks to a concomitant enormous development of the different methods of investigation of the biological molecules and structure. The present rising of biotechnology applications is the direct consequence of the tremendous amount of fundamental knowledge gained during the last few decennia. They open very important and attractive perspectives both on medical or on socio-economic point of views. There is no doubt that the next fifty years will be as fruitful as the last ones. Copyright John Libbey Eurotext 2003.

  15. Cortex, cognition and the cell: new insights into the pyramidal neuron and prefrontal function.

    Science.gov (United States)

    Elston, Guy N

    2003-11-01

    Arguably the most complex cortical functions are seated in human cognition, the how and why of which have been debated for centuries by theologians, philosophers and scientists alike. In his best-selling book, An Astonishing Hypothesis: A Scientific Search for the Soul, Francis Crick refined the view that these qualities are determined solely by cortical cells and circuitry. Put simply, cognition is nothing more, or less, than a biological function. Accepting this to be the case, it should be possible to identify the mechanisms that subserve cognitive processing. Since the pioneering studies of Lorent de Nó and Hebb, and the more recent studies of Fuster, Miller and Goldman-Rakic, to mention but a few, much attention has been focused on the role of persistent neural activity in cognitive processes. Application of modern technologies and modelling techniques has led to new hypotheses about the mechanisms of persistent activity. Here I focus on how regional variations in the pyramidal cell phenotype may determine the complexity of cortical circuitry and, in turn, influence neural activity. Data obtained from thousands of individually injected pyramidal cells in sensory, motor, association and executive cortex reveal marked differences in the numbers of putative excitatory inputs received by these cells. Pyramidal cells in prefrontal cortex have, on average, up to 23 times more dendritic spines than those in the primary visual area. I propose that without these specializations in the structure of pyramidal cells, and the circuits they form, human cognitive processing would not have evolved to its present state. I also present data from both New World and Old World monkeys that show varying degrees of complexity in the pyramidal cell phenotype in their prefrontal cortices, suggesting that cortical circuitry and, thus, cognitive styles are evolving independently in different species.

  16. Genome network medicine: innovation to overcome huge challenges in cancer therapy.

    Science.gov (United States)

    Roukos, Dimitrios H

    2014-01-01

    The post-ENCODE era shapes now a new biomedical research direction for understanding transcriptional and signaling networks driving gene expression and core cellular processes such as cell fate, survival, and apoptosis. Over the past half century, the Francis Crick 'central dogma' of single n gene/protein-phenotype (trait/disease) has defined biology, human physiology, disease, diagnostics, and drugs discovery. However, the ENCODE project and several other genomic studies using high-throughput sequencing technologies, computational strategies, and imaging techniques to visualize regulatory networks, provide evidence that transcriptional process and gene expression are regulated by highly complex dynamic molecular and signaling networks. This Focus article describes the linear experimentation-based limitations of diagnostics and therapeutics to cure advanced cancer and the need to move on from reductionist to network-based approaches. With evident a wide genomic heterogeneity, the power and challenges of next-generation sequencing (NGS) technologies to identify a patient's personal mutational landscape for tailoring the best target drugs in the individual patient are discussed. However, the available drugs are not capable of targeting aberrant signaling networks and research on functional transcriptional heterogeneity and functional genome organization is poorly understood. Therefore, the future clinical genome network medicine aiming at overcoming multiple problems in the new fields of regulatory DNA mapping, noncoding RNA, enhancer RNAs, and dynamic complexity of transcriptional circuitry are also discussed expecting in new innovation technology and strong appreciation of clinical data and evidence-based medicine. The problematic and potential solutions in the discovery of next-generation, molecular, and signaling circuitry-based biomarkers and drugs are explored. © 2013 Wiley Periodicals, Inc.

  17. The cutting edges in DNA repair, licensing, and fidelity: DNA and RNA repair nucleases sculpt DNA to measure twice, cut once.

    Science.gov (United States)

    Tsutakawa, Susan E; Lafrance-Vanasse, Julien; Tainer, John A

    2014-07-01

    To avoid genome instability, DNA repair nucleases must precisely target the correct damaged substrate before they are licensed to incise. Damage identification is a challenge for all DNA damage response proteins, but especially for nucleases that cut the DNA and necessarily create a cleaved DNA repair intermediate, likely more toxic than the initial damage. How do these enzymes achieve exquisite specificity without specific sequence recognition or, in some cases, without a non-canonical DNA nucleotide? Combined structural, biochemical, and biological analyses of repair nucleases are revealing their molecular tools for damage verification and safeguarding against inadvertent incision. Surprisingly, these enzymes also often act on RNA, which deserves more attention. Here, we review protein-DNA structures for nucleases involved in replication, base excision repair, mismatch repair, double strand break repair (DSBR), and telomere maintenance: apurinic/apyrimidinic endonuclease 1 (APE1), Endonuclease IV (Nfo), tyrosyl DNA phosphodiesterase (TDP2), UV Damage endonuclease (UVDE), very short patch repair endonuclease (Vsr), Endonuclease V (Nfi), Flap endonuclease 1 (FEN1), exonuclease 1 (Exo1), RNase T and Meiotic recombination 11 (Mre11). DNA and RNA structure-sensing nucleases are essential to life with roles in DNA replication, repair, and transcription. Increasingly these enzymes are employed as advanced tools for synthetic biology and as targets for cancer prognosis and interventions. Currently their structural biology is most fully illuminated for DNA repair, which is also essential to life. How DNA repair enzymes maintain genome fidelity is one of the DNA double helix secrets missed by James Watson and Francis Crick, that is only now being illuminated though structural biology and mutational analyses. Structures reveal motifs for repair nucleases and mechanisms whereby these enzymes follow the old carpenter adage: measure twice, cut once. Furthermore, to measure

  18. Update on hypoxia-inducible factors and hydroxylases in oxygen regulatory pathways: from physiology to therapeutics

    Directory of Open Access Journals (Sweden)

    Ratcliffe P

    2017-03-01

    Full Text Available Peter Ratcliffe,1,2 Peppi Koivunen,3 Johanna Myllyharju,3 Jiannis Ragoussis,4 Judith VMG Bovée,5 Ines Batinic-Haberle,6 Claire Vinatier,7 Valérie Trichet,8 Florence Robriquet,9 Lisa Oliver,9 Betty Gardie9,10 1Target Discovery Institute, University of Oxford, 2The Francis Crick Institute, London, UK; 3Oulu Center for Cell-Matrix Research, Biocenter Oulu and Faculty of Biochemistry and Molecular Medicine, University of Oulu, Oulu, Finland; 4McGill University and Genome Quebec Innovation Centre, McGill University, Montreal, Canada; 5Department of Pathology, Leiden University Medical Center, Leiden, the Netherlands; 6Department of Radiation Oncology, Duke University School of Medicine, Durham, NC, USA; 7INSERM UMR 1229, Regenerative Medicine and Skeleton-RMeS, Team STEP, University of Nantes, UFR Odontology, 8UMR 1238 INSERM, Université de Nantes, Faculté de Médecine, 9CRCINA, INSERM, Université de Nantes, Nantes, 10Ecole Pratique des Hautes Etudes, PSL Research University, Paris, France Abstract: The “Hypoxia Nantes 2016” organized its second conference dedicated to the field of hypoxia research. This conference focused on “the role of hypoxia under physiological conditions as well as in cancer” and took place in Nantes, France, in October 6–7, 2016. The main objective of this conference was to bring together a large group of scientists from different spheres of hypoxia. Recent advances were presented and discussed around different topics: genomics, physiology, musculoskeletal, stem cells, microenvironment and cancer, and oxidative stress. This review summarizes the major highlights of the meeting. Keywords: hypoxia, genomics, lipid metabolism, musculoskeletal, cancer, oxidative stress 

  19. Environmental Assessment for the Army Aviation Support Facility and Administrative Support Facility and the Joint Forces Headquarters, Readiness Center, and Field Maintenance Shop at Francis E. Warren Air Force Base, Cheyenne, Wyoming

    Science.gov (United States)

    2006-08-01

    transmission lines or electrocute themselves on power lines ; however, other than directly around facilities, all utility lines would be underground with the...Buildings/Structures 100 ft Buffer Proposed Site Locations Installation Boundary Comunication Lines LEGEND Prepared for: Environmental Assessment for...the southeast (Figure 4-10). This line would eventually connect into a system that is owned by Cheyenne Light, Fuel and Power . According to Cheyenne

  20. I--N-ov-ember

    Indian Academy of Sciences (India)

    After early schooling from the local "Grammar" school, Crick completed his schooling from the Mill Hill Public School in North London, where he received thorough ground- ing in the basic sciences and mathematics. At age twenty-one, Crick obtained a second- class Honors degree in physics from the University College, ...