WorldWideScience

Sample records for schroedinger francis crick

  1. Erwin Schroedinger, Francis Crick and epigenetic stability

    Directory of Open Access Journals (Sweden)

    Ogryzko Vasily V

    2008-04-01

    Full Text Available Abstract Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  2. Erwin Schroedinger, Francis Crick and epigenetic stability.

    Science.gov (United States)

    Ogryzko, Vasily V

    2008-04-17

    Schroedinger's book 'What is Life?' is widely credited for having played a crucial role in development of molecular and cellular biology. My essay revisits the issues raised by this book from the modern perspective of epigenetics and systems biology. I contrast two classes of potential mechanisms of epigenetic stability: 'epigenetic templating' and 'systems biology' approaches, and consider them from the point of view expressed by Schroedinger. I also discuss how quantum entanglement, a nonclassical feature of quantum mechanics, can help to address the 'problem of small numbers' that led Schroedinger to promote the idea of a molecular code-script for explaining the stability of biological order.

  3. The Francis Crick Institute.

    Science.gov (United States)

    Peters, Keith; Smith, Jim

    2017-04-01

    The Francis Crick Institute Laboratory, opened in 2016, is supported by the Medical Research Council, Cancer Research UK, the Wellcome Trust, and University College London, King's College London and Imperial College London. The emphasis on research training and early independence of gifted scientists in a multidisciplinary environment provides unique opportunities for UK medical science, including clinical and translational research. © Royal College of Physicians 2017. All rights reserved.

  4. Francis Crick (1916–2004)

    Indian Academy of Sciences (India)

    Administrator

    The death of Francis Crick deprives us of one of the great- est scientists of the 20th century, whose creativity and power of mind dominated molecular biology in its golden years. Many people have told the story of his achievements; here I would simply like to recollect some of the qualities of this remarkable man. The first ...

  5. Francis Crick, DNA, and the Central Dogma

    Science.gov (United States)

    Olby, Robert

    1970-01-01

    This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

  6. Francis Crick (1916–2004)

    Indian Academy of Sciences (India)

    Administrator

    him. When somebody gave a lecture, Francis was ready at the end (and often in the middle) to give them a lucid and exact account of what their work meant, for better or for worse. This made the Laboratory of Molecular Biology's end-of-year lectures a terrifying ordeal for many, but in- creased their intellectual value, and ...

  7. 60 years ago, Francis Crick changed the logic of biology.

    Directory of Open Access Journals (Sweden)

    Matthew Cobb

    2017-09-01

    Full Text Available In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  8. 60 years ago, Francis Crick changed the logic of biology

    Science.gov (United States)

    2017-01-01

    In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences. PMID:28922352

  9. 60 years ago, Francis Crick changed the logic of biology.

    Science.gov (United States)

    Cobb, Matthew

    2017-09-01

    In September 1957, Francis Crick gave a lecture in which he outlined key ideas about gene function, in particular what he called the central dogma. These ideas still frame how we understand life. This essay explores the concepts he developed in this influential lecture, including his prediction that we would study evolution by comparing sequences.

  10. On Francis Crick, the genetic code, and a clever kid.

    Science.gov (United States)

    Goldstein, Bob

    2018-04-02

    A few years ago, Francis Crick's son told me a story that I can't get out of my mind. I had contacted Michael Crick by email while digging through the background of the researchers who had cracked the genetic code in the 1960s. Francis had died in 2004, and I was contacting some of the people who knew him when he was struggling to decipher the code. Francis didn't appear to struggle often - he is known mostly for his successes - and, as it turns out, this one well-known struggle may have had a clue sitting just barely out of sight. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.

    Science.gov (United States)

    Teive, Hélio A G

    2016-04-01

    The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  12. Francis Crick: A Singular Approach to Scientific Discovery.

    Science.gov (United States)

    Lawrence, Peter A

    2016-12-01

    Francis' office window (at the Salk) commanded a panorama of the Pacific. "This grand natural scene was a physical correlate of Francis's intellectual world: wide-ranging, brilliantly lit, a little overawing, but also immensely inviting and above all an exciting place to be." (Mitchison, 2004). Copyright © 2016 Elsevier Inc. All rights reserved.

  13. A world in one dimension: Linus Pauling, Francis Crick and the central dogma of molecular biology.

    Science.gov (United States)

    Strasser, Bruno J

    2006-01-01

    In 1957, Francis Crick outlined a startling vision of life in which the great diversity of forms and shapes of macromolecules was encoded in the one-dimensional sequence of nucleic acids. This paper situates Crick's new vision in the debates of the 1950s about protein synthesis and gene action. After exploring the reception of Crick's ideas, it shows how they differed radically from a different model of protein synthesis which enjoyed wide currency in that decade. In this alternative model, advocated by Linus Pauling and other luminaries, three-dimensional templates directed the folding of proteins. Even though it was always considered somewhat speculative, this theory was supported by a number of empirical results originating in different experimental systems. It was eventually replaced by a model in which the forms and shapes of macromolecules resulted solely from their amino acid sequence, dramatically simplifying the problem of protein synthesis which Crick was attempting to solve in 1957.

  14. On the centenary of the birth of Francis H. C. Crick – from physics to genetics and neuroscience

    Directory of Open Access Journals (Sweden)

    Hélio A. G. Teive

    2016-04-01

    Full Text Available ABSTRACT The year 2016 marks the centenary of the birth of Francis Crick (1916–2004, who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

  15. Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience.

    Science.gov (United States)

    Aicardi, Christine

    2016-02-01

    The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a 'cross-worlds influencer' who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise 'un-disciplined' new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against 'vitalism': anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of 'doing science' and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: 'follow the cross-worlds influencers' who worked to build and organise these semi-institutional gatherings and institutional structures. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

  16. Francis Crick, cross-worlds influencer: A narrative model to historicize big bioscience

    Science.gov (United States)

    Aicardi, Christine

    2016-01-01

    The essay is an empirical case study of famed British scientist Francis Crick. Viewing him as a ‘cross-worlds influencer’ who was moreover dedicated to a cause, I have tried to understand how these two characteristics influenced the trajectory of his long career and how they shaped his contributions to the diverse research fields in which he was active, and concluded that these characteristics reconfigure Crick's career into a coherent whole. First, I identify a major thread running through Crick's career: helping organise ‘un-disciplined’ new research fields, and show that his successive choices were not serendipitous but motivated by what he construed as a crusade against ‘vitalism’: anti-vitalism was a defining driver of his career. I then examine how Crick put his skills as a crossworlds influencer to the service of his cause, by helping organise his chosen fields of intervention. I argue that his activities as a cross-worlds influencer were an integral part of his way of ‘doing science’ and that his contributions to science, neuroscience in particular, should be re-evaluated in this light. This leads me to advance a possible strategy for historians to investigate big bioscience fields. Following Abir-Am, I propose to trace their genealogies back to the fluctuating semi-institutional gatherings and the institutional structures that sustained them. My research on Crick supports the view that such studies can bring insights into the question of why the contours of contemporary big bioscience endeavours have come to be shaped the way they are. Further, the essay provides a heuristic device for approaching these enquiries: ‘follow the cross-worlds influencers’ who worked to build and organise these semi-institutional gatherings and institutional structures. PMID:26383132

  17. Of the Helmholtz Club, South-Californian seedbed for visual and cognitive neuroscience, and its patron Francis Crick.

    Science.gov (United States)

    Aicardi, Christine

    2014-03-01

    Taking up the view that semi-institutional gatherings such as clubs, societies, research schools, have been instrumental in creating sheltered spaces from which many a 20th-century project-driven interdisciplinary research programme could develop and become established within the institutions of science, the paper explores the history of one such gathering from its inception in the early 1980s into the 2000s, the Helmholtz Club, which brought together scientists from such various research fields as neuroanatomy, neurophysiology, psychophysics, computer science and engineering, who all had an interest in the study of the visual system and of higher cognitive functions relying on visual perception such as visual consciousness. It argues that British molecular biologist turned South Californian neuroscientist Francis Crick had an early and lasting influence over the Helmholtz Club of which he was a founding pillar, and that from its inception, the club served as a constitutive element in his long-term plans for a neuroscience of vision and of cognition. Further, it argues that in this role, the Helmholtz Club served many purposes, the primary of which was to be a social forum for interdisciplinary discussion, where 'discussion' was not mere talk but was imbued with an epistemic value and as such, carefully cultivated. Finally, it questions what counts as 'doing science' and in turn, definitions of success and failure-and provides some material evidence towards re-appraising the successfulness of Crick's contribution to the neurosciences. Copyright © 2013 The Author. Published by Elsevier Ltd.. All rights reserved.

  18. London home for Crick archive.

    Science.gov (United States)

    Williams, Nigel

    2002-01-08

    Unprecedented access to the archives of Francis Crick, just before the 50th anniversary next year of his famous paper co-authored with James Watson on the proposed double helix structure of DNA, looks set to go ahead. Nigel Williams reports.

  19. Schroedinger and the wave mechanics

    International Nuclear Information System (INIS)

    Bassalo, J.M.F.

    1987-01-01

    In commemoration of the centennial of Schroedinger's birth, in 1987, we show in this paper some aspects of his academic life, and his philosophical and scientific work. Among Schroedinger's innumerable contributions to almost all areas of philosophy and science, we choose here the creation of quantum mechanics (1926), considered one of the pillars of Modern quantum theory, and the importance of his philosophical essay What is life (1944). This publication was responsible for a great in the studies of biology, culminating in the discovery of the DNA molecular structure, in 1953, by Crick and Watson, thanks to the X-rays diffraction technique of the DNA developed by Wilkens. (author) [pt

  20. Erwin Schroedinger

    International Nuclear Information System (INIS)

    Hoffmann, D.

    1984-01-01

    Erwin Schroedinger (1887-1961) belongs without doubt to the most outstanding physicists of our century. His name is inseparably connected with the development of quantum theory with the formulation of his famous wave equation being his greatest achievement. This relation became generally known as the Schroedinger equation and its understanding was fundamental to the progress of modern quantum theory. In 1933 Schroedinger's work was honoured by the award of the Nobel Prize in physics. In the booklet Schroedinger's life, work and philosophical views are outlined against the social and physico-historical background of his time

  1. Schroedinger fluid

    International Nuclear Information System (INIS)

    Kan, K.K.

    1983-01-01

    The relationship of nuclear internal flow and collective inertia, the difference of this flow from that of a classical fluid, and the approach of this flow to rigid flow in independent-particle model rotation are elucidated by reviewing the theory of Schroedinger fluid and its implications for collective vibration and rotation. (author)

  2. Schroedinger's cat

    Energy Technology Data Exchange (ETDEWEB)

    Lubkin, E [Wisconsin Univ., Madison (USA). Dept. of Physics

    1979-08-01

    The issue is to seek quantum interference effects in an arbitrary field, in particular in psychology. For this a digest of quantum mechanics over finite-n-dimensional Hilbert space is invented. In order to match crude data not only von Neumann's mixed states are used but also a parallel notion of unsharp tests. The mathematically styled text (and earlier work on multibin tests, designated MB) deals largely with these new tests. Quantum psychology itself is only given a foundation. It readily engenders objections; its plausibility is developed gradually, in interlocking essays. There is also the empirically definite proposal that (state, test, outcome)-indexed counts be gathered to record data, then fed to a matrix format (MF) search for quantum models. A previously proposed experiment in visual perception which has since failed to find significant quantum correlations, is discussed. The suspicion that quantum mechanics is all around goes beyond MF, and Schroedinger's cat symbolizes this broader perspective.

  3. Schroedinger's cat

    International Nuclear Information System (INIS)

    Lubkin, E.

    1979-01-01

    The issue is to seek quantum interference effects in an arbitrary field, in particular in psychology. For this a digest of quantum mechanics over finite-n-dimensional Hilbert space is invented. In order to match crude data not only von Neumann's mixed states are used but also a parallel notion of unsharp tests. The mathematically styled text (and earlier work on multibin tests, designated MB) deals largely with these new tests. Quantum psychology itself is only given a foundation. It readily engenders objections; its plausibility is developed gradually, in interlocking essays. There is also the empirically definite proposal that (state, test, outcome)-indexed counts be gathered to record data, then fed to a 'matrix format' (MF) search for quantum models. A previously proposed experiment in visual perception which has since failed to find significant quantum correlations, is discussed. The suspicion that quantum mechanics is all around goes beyond MF, and 'Schroedinger's cat' symbolizes this broader perspective. (author)

  4. Fractional Schroedinger equation

    International Nuclear Information System (INIS)

    Laskin, Nick

    2002-01-01

    Some properties of the fractional Schroedinger equation are studied. We prove the Hermiticity of the fractional Hamilton operator and establish the parity conservation law for fractional quantum mechanics. As physical applications of the fractional Schroedinger equation we find the energy spectra of a hydrogenlike atom (fractional 'Bohr atom') and of a fractional oscillator in the semiclassical approximation. An equation for the fractional probability current density is developed and discussed. We also discuss the relationships between the fractional and standard Schroedinger equations

  5. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  6. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  7. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  8. The paradox of Schroedinger's waves

    International Nuclear Information System (INIS)

    Gribben, John.

    1987-01-01

    The paper examines the contribution of the work of Erwin Schroedinger in quantum physics. The Schroedinger equation was developed to explain the behavior of electrons within an atom in terms of waves, and it has proved one of the most useful tools in quantum physics. The Schroedinger 'Cat' experiment is also described and discussed. Finally Schroedinger's ideas on chromosomes in molecular biology are briefly outlined. (U.K.)

  9. Crystallized Schroedinger cat states

    International Nuclear Information System (INIS)

    Castanos, O.; Lopez-Pena, R.; Man'ko, V.I.

    1995-01-01

    Crystallized Schroedinger cat states (male and female) are introduced on the base of extension of group construction for the even and odd coherent states of the electromagnetic field oscillator. The Wigner and Q functions are calculated and some are plotted for C 2 , C 3 , C 4 , C 5 , C 3v Schroedinger cat states. Quadrature means and dispersions for these states are calculated and squeezing and correlation phenomena are studied. Photon distribution functions for these states are given explicitly and are plotted for several examples. A strong oscillatory behavior of the photon distribution function for some field amplitudes is found in the new type of states

  10. Francis Picabia hilislooming

    Index Scriptorium Estoniae

    1998-01-01

    Aastavahetusel Hamburgi teises Deichtorhalles olnud näitusest, kus eksponeeriti Francis Picabia (1879-1953) loomingut alates 1935. aastast. Näitus tutvustas Picabiat kui aktimaalijat, portretisti, fotograafi ja kirjameest

  11. Almost periodic Schroedinger operators

    International Nuclear Information System (INIS)

    Bellissard, J.; Lima, R.

    1984-01-01

    These lectures are devoted to recent developments in the theory of almost-periodic Schroedinger Operators. We specially describe the algebraic point of view, with applications to gap-labelling theorems. Particular models are also presented which exhibit various spectral properties. (orig.)

  12. Interviewing Francis Bacon

    OpenAIRE

    Kisters, Sandra

    2012-01-01

    British painter Francis Bacon (1909-1992) was known for the eloquence with which he talked about his art. He was easy to talk to, and was interviewed countless times by numerous critics. However, when studying Bacon's paintings one soon comes across the published interviews with art critic and curator David Sylvester (1924-2001), who interviewed him as many as 18 times between 1962 and 1986. Art historian Sandra Kisters argues that Sylvester's interviews with Bacon are carefully constructed a...

  13. The forced nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Kaup, D.J.; Hansen, P.J.

    1985-01-01

    The nonlinear Schroedinger equation describes the behaviour of a radio frequency wave in the ionosphere near the reflexion point where nonlinear processes are important. A simple model of this phenomenon leads to the forced nonlinear Schroedinger equation in terms of a nonlinear boundary value problem. A WKB analysis of the time evolution equations for the nonlinear Schroedinger equation in the inverse scattering transform formalism gives a crude order of magnitude estimation of the qualitative behaviour of the solutions. This estimation is compared with the numerical solutions. (D.Gy.)

  14. Philosophy of Erwin Schroedinger: a diachronic view of Schroedinger's thoughts

    International Nuclear Information System (INIS)

    Melgar, M.F.

    1988-01-01

    There is no agreement within the scientific community about the philosophy of Schroedinger. Some people think that he was a realist, while others defend him as an idealist. In this paper we study a number of Schroedinger's works and we show that the epithets of realist and idealist do not do him justice. Toward the end we conclude that it would be more adequate to place him in the trend known as the philosophy of immanence

  15. Properties of squeezed Schroedinger cats

    International Nuclear Information System (INIS)

    Obada, A.S.F.; Omar, Z.M.

    1995-09-01

    In this article we investigate some statistical properties of the even and odd squeezed (squeezed Schroedinger cat) states. The quasi-probability distribution functions especially W(α) and Q(α) are calculated and discussed for these states. The phase distribution function is discussed. A generation scheme is proposed for either the squeezed generalized Schroedinger cat, or the squeezed number state. (author). 35 refs, 5 figs

  16. The Schroedinger problem

    International Nuclear Information System (INIS)

    Da Costa, N.C.A.; Krause, D.; French, S.

    1992-01-01

    Schroedinger introduced discussions about the inconsistency between the classical conception of particles as individual entities and the way in which modern physics treats such particles. In particular, it is noted that quantal particles apparently appear to lack individuality, and that certain suppositions of quantum theory imply that permutations of 'identical' particles are not regarded as observable, hence implying that they must be taken as 'non-individuals' of some kind. An overview is presented in this paper of some results obtained by the authors in the field of non-reflexive logics, which have some bearings on these problems and which can perhaps provide an adequate mathematical tool for dealing with some of the fundamental features of elementary particles, such as for instance the fact that identity apparently lacks sense with respect to them, that particle permutations are not regarded as observable and that a collection of these entities cannot be considered as a set in the sense of the usual theories of sets. The main objective of the paper is to show that the nature of elementary particles can be described in terms of certain non-classical logics, despite the problems regarding their individuality. (authors). 28 refs

  17. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  18. A life of Erwin Schroedinger; Erwin Schroedinger. Eine Biographie

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Walter J.

    2012-07-01

    Erwin Schroedinger (1887-1961) was a pioneer of quantum physics, one of the most important scientists of the 20th century at all and - a charming Austrian. He was a man with a passionate interest in people and ideas. Mostly known he became by his representation of quantum theory in the form of wave mechanics, for which he got the Nobel prize for physics and naturally by the famous thought experiment ''Schroedinger's cat''. Walter Moore's biography is very close to the person of Schroedinger and presents his scientific work in the context of his private friendships, his interest in mysticism, and in front of the moving background of the political events in Germany and Austria.

  19. Schroedinger's variational method of quantization revisited

    International Nuclear Information System (INIS)

    Yasue, K.

    1980-01-01

    Schroedinger's original quantization procedure is revisited in the light of Nelson's stochastic framework of quantum mechanics. It is clarified why Schroedinger's proposal of a variational problem led us to a true description of quantum mechanics. (orig.)

  20. A life of Erwin Schroedinger

    International Nuclear Information System (INIS)

    Moore, Walter J.

    2012-01-01

    Erwin Schroedinger (1887-1961) was a pioneer of quantum physics, one of the most important scientists of the 20th century at all and - a charming Austrian. He was a man with a passionate interest in people and ideas. Mostly known he became by his representation of quantum theory in the form of wave mechanics, for which he got the Nobel prize for physics and naturally by the famous thought experiment ''Schroedinger's cat''. Walter Moore's biography is very close to the person of Schroedinger and presents his scientific work in the context of his private friendships, his interest in mysticism, and in front of the moving background of the political events in Germany and Austria.

  1. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  2. Francis Bacon's behavioral psychology.

    Science.gov (United States)

    MacDonald, Paul S

    2007-01-01

    Francis Bacon offers two accounts of the nature and function of the human mind: one is a medical-physical account of the composition and operation of spirits specific to human beings, the other is a behavioral account of the character and activities of individual persons. The medical-physical account is a run-of-the-mill version of the late Renaissance model of elemental constituents and humoral temperaments. The other, less well-known, behavioral account represents an unusual position in early modern philosophy. This theory espouses a form of behavioral psychology according to which (a) supposed mental properties are "hidden forms" best described in dispositional terms, (b) the true character of an individual can be discovered in his observable behavior, and (c) an "informed" understanding of these properties permits the prediction and control of human behavior. Both of Bacon's theories of human nature fall under his general notion of systematic science: his medical-physical theory of vital spirits is theoretical natural philosophy and his behavioral theory of disposition and expression is operative natural philosophy. Because natural philosophy as a whole is "the inquiry of causes and the production of effects," knowledge of human nature falls under the same two-part definition. It is an inquisition of forms that pertains to the patterns of minute motions in the vital spirits and the production of effects that pertains both to the way these hidden motions produce behavioral effects and to the way in which a skillful agent is able to produce desired effects in other persons' behavior. (c) 2007 Wiley Periodicals, Inc.

  3. Schroedinger operators and evolutionary strategies

    International Nuclear Information System (INIS)

    Asselmeyer, T.

    1997-01-01

    First we introduce a simple model for the description of evolutionary algorithms, which is based on 2nd order partial differential equations for the distribution function of the individuals. Then we turn to the properties of Boltzmann's and Darwin's strategy. the next chapter is dedicated to the mathematical properties of Schroedinger operators. Both statements on the spectral density and their reproducibility during the simulation are summarized. The remaining of this chapter are dedicated to the analysis of the kernel as well as the dependence of the Schroedinger operator on the potential. As conclusion from the results of this chapter we obtain the classification of the strategies in dependence of the fitness. We obtain the classification of the evolutionary strategies, which are described by a 2nd order partial differential equation, in relation to their solution behaviour. Thereafter we are employed with the variation of the mutation distribution

  4. Correspondence passed between Einstein and Schroedinger

    International Nuclear Information System (INIS)

    Balibar, F.

    1992-01-01

    The main points of the 26 year long correspondence between Einstein and Schroedinger are reviewed: from the de Broglie thesis and the Bose-Einstein statistics to the Schroedinger equation (1925-1926); from the EPR paradox to the cat parable (1935); a complete collaboration on unitary theories

  5. P-adic Schroedinger type equation

    International Nuclear Information System (INIS)

    Vladimirov, V.S.; Volovich, I.V.

    1988-12-01

    In p-adic quantum mechanics a Schroedinger type equation is considered. We discuss the appropriate notion of differential operators. A solution of the Schroedinger type equation is given. A new set of vacuum states for the p-adic quantum harmonic oscillator is presented. The correspondence principle with the standard quantum mechanics is discussed. (orig.)

  6. In search of Schroedinger's cat

    International Nuclear Information System (INIS)

    Gribbin, John.

    1984-01-01

    The book explains how the paradox of Schroedinger's cat led to an understanding of reality in quantum physics. The contents of the book is divided into three parts. Part one concerns light, atoms and Bohr's atom. Quantum mechanics is discussed in Part Two, including photons and electrons, matrices and waves, and applications of quanta. The last part deals with chance and uncertainty, paradoxes and possibilities, the experimental proof of the paradoxical reality of the quantum world, and the many-worlds interpretation of quantum mechanics. (U.K.)

  7. Introduction to Schroedinger inverse scattering

    International Nuclear Information System (INIS)

    Roberts, T.M.

    1991-01-01

    Schroedinger inverse scattering uses scattering coefficients and bound state data to compute underlying potentials. Inverse scattering has been studied extensively for isolated potentials q(x), which tend to zero as vertical strokexvertical stroke→∞. Inverse scattering for isolated impurities in backgrounds p(x) that are periodic, are Heaviside steps, are constant for x>0 and periodic for x<0, or that tend to zero as x→∞ and tend to ∞ as x→-∞, have also been studied. This paper identifies literature for the five inverse problems just mentioned, and for four other inverse problems. Heaviside-step backgrounds are discussed at length. (orig.)

  8. Effective Schroedinger equations on submanifolds

    Energy Technology Data Exchange (ETDEWEB)

    Wachsmuth, Jakob

    2010-02-11

    In this thesis the time dependent Schroedinger equation is considered on a Riemannian manifold A with a potential that localizes a certain class of states close to a fixed submanifold C, the constraint manifold. When the potential is scaled in the directions normal to C by a small parameter epsilon, the solutions concentrate in an epsilon-neighborhood of the submanifold. An effective Schroedinger equation on the submanifold C is derived and it is shown that its solutions, suitably lifted to A, approximate the solutions of the original equation on A up to errors of order {epsilon}{sup 3} vertical stroke t vertical stroke at time t. Furthermore, it is proved that, under reasonable conditions, the eigenvalues of the corresponding Hamiltonians below a certain energy coincide upto errors of order {epsilon}{sup 3}. These results holds in the situation where tangential and normal energies are of the same order, and where exchange between normal and tangential energies occurs. In earlier results tangential energies were assumed to be small compared to normal energies, and rather restrictive assumptions were needed, to ensure that the separation of energies is maintained during the time evolution. The most important consequence of this thesis is that now constraining potentials that change their shape along the submanifold can be treated, which is the typical situation in applications like molecular dynamics and quantum waveguides.

  9. Francis Bacon and Jacobean legitimation

    OpenAIRE

    Rodríguez García, José María

    1997-01-01

    Francis Bacon (1561-1626) maintained a lifelong interest in the institutional implementation of experimental science. What changed over the years were the rhetorical strategies employed to give this project legitimacy. I systematize those changes by dividing Bacon's works into three groups according to three criteria: what rite of officialization is enacted in each text (e.g., conversion, fatherly generation, royal delegation); who the inscribed addressee is (e.g., an imagin...

  10. Some threshold spectral problems of Schroedinger operators

    International Nuclear Information System (INIS)

    Jia, X.

    2009-01-01

    This Ph.D. thesis deals with some spectral problems of the Schroedinger operators. We first consider the semi-classical limit of the number of bound states of unique two-cluster N-body Schroedinger operator. Then we use Dirichlet-Neumann bracket to get semi-classical limit of Riesz means of the discrete eigenvalues of N-body Schroedinger operator. The effective potential of N-body Schroedinger operator with Coulomb potential is also considered and we find that the effective potential has critical decay at infinity. Thus, the Schroedinger operator with critical potential is studied in this thesis. We study the coupling constant threshold of Schroedinger operator with critical potential and the asymptotic expansion of resolvent of Schroedinger operator with critical potential. We use that expansion to study low-energy asymptotics of derivative of spectral shift function for perturbation with critical decay. After that, we use this result and the known result for high-energy asymptotic expansion of spectral shift function to obtain the Levinson theorem. (author)

  11. The Schroedinger operator as a generalized Laplacian

    International Nuclear Information System (INIS)

    Grabowska, Katarzyna; Urbanski, Pawel; Grabowski, Janusz

    2008-01-01

    The Schroedinger operators on the Newtonian spacetime are defined in a way which make them independent of the class of inertial observers. In this picture the Schroedinger operators act not on functions on the spacetime but on sections of a certain one-dimensional complex vector bundle-the Schroedinger line bundle. This line bundle has trivializations indexed by inertial observers and is associated with an U(1)-principal bundle with an analogous list of trivializations-the Schroedinger principal bundle. If an inertial frame is fixed, the Schroedinger bundle can be identified with the trivial bundle over spacetime, but as there is no canonical trivialization (inertial frame), these sections interpreted as 'wavefunctions' cannot be viewed as actual functions on the spacetime. In this approach, the change of an observer results not only in the change of actual coordinates in the spacetime but also in a change of the phase of wavefunctions. For the Schroedinger principal bundle, a natural differential calculus for 'wave forms' is developed that leads to a natural generalization of the concept of the Laplace-Beltrami operator associated with a pseudo-Riemannian metric. The free Schroedinger operator turns out to be the Laplace-Beltrami operator associated with a naturally distinguished invariant pseudo-Riemannian metric on the Schroedinger principal bundle. The presented framework does not involve any ad hoc or axiomatically introduced geometrical structures. It is based on the traditional understanding of the Schroedinger operator in a given reference frame-which is supported by producing right physics predictions-and it is proven to be strictly related to the frame-independent formulation of analytical Newtonian mechanics and Hamilton-Jacobi equations that makes a bridge between the classical and quantum theory

  12. Schroedinger representation in quantum field theory

    International Nuclear Information System (INIS)

    Luescher, M.

    1985-01-01

    Until recently, the Schroedinger representation in quantum field theory had not received much attention, even more so because there were reasons to believe that in the presence of interactions it did not exist in a mathematically well-defined sense. When Symanzik set out to solve this problem, he was motivated by a special 2-dimensional case, the relativistic string model, in which the Schroedinger wave functionals are the primary objects of physical interest. Also, he knew that if it were possible to demonstrate the existence of the Schroedinger representation, the (then unproven) ultraviolet finiteness of the Casimir force in renormalizable quantum field theories would probably follow. (orig./HSI)

  13. Reparametrization invariance and the Schroedinger equation

    International Nuclear Information System (INIS)

    Tkach, V.I.; Pashnev, A.I.; Rosales, J.J.

    1999-01-01

    A time-dependent Schroedinger equation for systems invariant under the reparametrization of time is considered. We develop the two-stage procedure of construction such systems from a given initial ones, which are not invariant under the time reparametrization. One of the first-class constraints of the systems in such description becomes the time-dependent Schroedinger equation. The procedure is applicable in the supersymmetric theories as well. The n = 2 supersymmetric quantum mechanics is coupled to world-line supergravity, and the local supersymmetric action is constructed leading to the square root representation of the time-dependent Schroedinger equation

  14. Derivation of the Crick-Wyman equation for allosteric proteins defining the difference between the number of binding sites and the Hill coefficient.

    Science.gov (United States)

    Poitevin, Frédéric; Edelstein, Stuart J

    2013-05-13

    In response to a 100-word footnote in the 1965 article by Monod, Wyman, and Changeux, a detailed manuscript signed by Francis Crick and Jeffries Wyman with 6000 words and 30 equations entitled "A Footnote on Allostery" circulated in 1965 among a limited group of scientists interested in allosteric interactions. This interesting and provocative document is published in this special issue for the first time. An intriguing equation in their text relates the difference between n (the number of ligand binding sites) and n' (the Hill coefficient) to the ratio of the saturation functions Y¯, for oligomers with n-1 and n binding sites. A compact derivation of this equation was not provided by Crick and Wyman, but one is presented here based on a definition of Y¯ involving the binding polynomial and its first derivative. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Stochastic effects on the nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Flessas, G P; Leach, P G L; Yannacopoulos, A N

    2004-01-01

    The aim of this article is to provide a brief review of recent advances in the field of stochastic effects on the nonlinear Schroedinger equation. The article reviews rigorous and perturbative results. (review article)

  16. Simulation of the Schroedinger equation on SHAC

    International Nuclear Information System (INIS)

    Stewart, A.

    1976-01-01

    A simulation of the Schroedinger wave equation for the hydrogen atom, on SHAC, a simple homogeneous analogue computer primarily intended for use in schools, is described. Due to the incorporation of FET switches very high speed switching from initial conditions to compute modes is possible. The techniques employed in the multiplier and divider are discussed and the flow diagram for the Schroedinger program shown. Results and photographs are discussed. (U.K.)

  17. Correspondence passed between Einstein and Schroedinger; La correspondance entre Einstein et Schroedinger

    Energy Technology Data Exchange (ETDEWEB)

    Balibar, F. [Paris-7 Univ., 75 (France)

    1992-12-31

    The main points of the 26 year long correspondence between Einstein and Schroedinger are reviewed: from the de Broglie thesis and the Bose-Einstein statistics to the Schroedinger equation (1925-1926); from the EPR paradox to the cat parable (1935); a complete collaboration on unitary theories.

  18. Exact Solutions to Nonlinear Schroedinger Equation and Higher-Order Nonlinear Schroedinger Equation

    International Nuclear Information System (INIS)

    Ren Ji; Ruan Hangyu

    2008-01-01

    We study solutions of the nonlinear Schroedinger equation (NLSE) and higher-order nonlinear Schroedinger equation (HONLSE) with variable coefficients. By considering all the higher-order effect of HONLSE as a new dependent variable, the NLSE and HONLSE can be changed into one equation. Using the generalized Lie group reduction method (GLGRM), the abundant solutions of NLSE and HONLSE are obtained

  19. Some studies of Schroedinger operators

    International Nuclear Information System (INIS)

    Liu Yang.

    1993-09-01

    This thesis consists of three papers. Paper 1 deals with the semiclassical approximation for a Schroedinger operator in one dimension with an arbitrary continuous potential. The basic result is that function in the range of a spectral projection associated with an interval are exponentially small (with respect to Plancks parameter h) in places where the potential exceeds the interval. As an application of this result, it is shown that the eigenvalues of the operator localized to the wells appear as resonances of the global operator. This is true also when the potential is not bounded from below. Such results were proved before for analytic potentials by analytic dilatation. In Paper 2, the potential is assumed to have the form of χ + V(χ) (the Stark Hamiltonian) with a well-behaved V(χ), an explicit spectral and scattering theory for such an operator was presented using the time-independent approach. In particular, we derive an eigenfunction expansion theorem which, combined with a construction of an intertwining operator, gives a solution of the inverse scattering problem according to L. Daddeev and A. Melin. The direct part of the second paper has a generalization to higher dimensions, and this was done in the third paper. Also in that paper, the condition on the potentials for doing the inverse scattering theory was relaxed, and an explicit formula for the potentials involving the first approximation of the scattering data was given

  20. Francis Bacon, un moderne intempestif

    OpenAIRE

    Mavrakis, Annie

    2017-01-01

    À propos de la peinture de Francis Bacon et en prenant appui sur des réflexions de Michel Leiris, cet article se propose de revenir sur la question de la modernité conçue non de façon absolue (LA modernité, non figurative, anti-littéraire) mais relative, dégagée d’une vision historiciste orientée de l’histoire de l’art. Cette modernité est intempestive puisque, s’opposant au classique (cf. La Querelle des Anciens et des Modernes) et non au périmé, elle fait revivre les grandes problématiques ...

  1. On the connection between Schroedinger- and Dirichlet forms

    International Nuclear Information System (INIS)

    Albeverio, S.; Bochum Univ.; Gesztesy, F.; Karwowski, W.; Streit, L.; Bielefeld Univ.

    Relations between Schroedinger forms associated with Schroedinger operators in L 2 (Ω;dsup(n)x), Ω is contained in Rsup(n) open, n >= 1 and the corresponding Dirichlet forms are investigated. Various concrete examples are presented. (orig.)

  2. Unifying quanta and relativity. Schroedinger`s attitude to relativistic quantum mechanics

    Energy Technology Data Exchange (ETDEWEB)

    Kragh, H. [Roskilde Universitetscenter (Denmark)

    1992-12-31

    A considerable part of Schroedinger`s scientific work focused on the relationship between quantum theory and the theory of relativity. This paper provides a historical analysis of his occupation on this subject in the period 1925-1934. The first section surveys the role played by relativity in Schroedinger`s formation of wave mechanics in 1925-1926; the second section analyzes his attempt to make sense of Dirac`s theory of the electron by proposing a relativistic wave equation with positive energies only. In this work, which took place in 1930-1931, Schroedinger discovered the Zitterbewegung that Dirac electrons will exhibit even in a field-free case. Schroedinger`s failed attempt to introduce an alternative to the Dirac theory was part of his general dissatisfaction with the current state of quantum mechanics. It is argued that, to a large extent, his work on the Dirac theory was philosophically motivated and that it contributed to his alienation from mainstream quantum physics in the 1930s. (author). 54 refs.

  3. Single-particle Schroedinger fluid. I. Formulation

    International Nuclear Information System (INIS)

    Kan, K.K.; Griffin, J.J.

    1976-01-01

    The problem of a single quantal particle moving in a time-dependent external potential well is formulated specifically to emphasize and develop the fluid dynamical aspects of the matter flow. This idealized problem, the single-particle Schroedinger fluid, is shown to exhibit already a remarkably rich variety of fluid dynamical features, including compressible flow and line vortices. It provides also a sufficient framework to encompass simultaneously various simplified fluidic models for nuclei which have earlier been postulated on an ad hoc basis, and to illuminate their underlying restrictions. Explicit solutions of the single-particle Schroedinger fluid problem are studied in the adiabatic limit for their mathematical and physical implications (especially regarding the collective kinetic energy). The basic generalizations for extension of the treatment to the many-body Schroedinger fluid are set forth

  4. A life of Erwin Schroedinger. 2. ed.

    International Nuclear Information System (INIS)

    Moore, Walter J.

    2015-01-01

    Erwin Schroedinger (1887-1961) was a pioneer of quantum physics, one of the most important scientist of the 20th century at all and a charming Austrian. He was a man with a passionate interest for men and ideas. Mostly known he became by his representation of quantum theory in the form of wave mechanics, for which he obtained the Nobel prize for physics and naturally by the famous thought experiment ''Schroedingers cat''. Walter Moore's biography is quite near to the person of Schroedinger and presents his scientific work in the context of his friendships, his interset for mysticism, and in front of the moving background of the political events in Germany and Austria.

  5. Some physical applications of fractional Schroedinger equation

    International Nuclear Information System (INIS)

    Guo Xiaoyi; Xu Mingyu

    2006-01-01

    The fractional Schroedinger equation is solved for a free particle and for an infinite square potential well. The fundamental solution of the Cauchy problem for a free particle, the energy levels and the normalized wave functions of a particle in a potential well are obtained. In the barrier penetration problem, the reflection coefficient and transmission coefficient of a particle from a rectangular potential wall is determined. In the quantum scattering problem, according to the fractional Schroedinger equation, the Green's function of the Lippmann-Schwinger integral equation is given

  6. Francis Bacon and the Technology of Style.

    Science.gov (United States)

    Baker, Christopher

    1983-01-01

    Examines Francis Bacon's intentionally devised style for scientific writings and the theoretical basis of that style. Discusses his emphasis on a truly objective point of view, and his use of aphorisms to adapt to his audience. (HTH)

  7. Francis Bacon and Magnetical Cosmology.

    Science.gov (United States)

    Wang, Xiaona

    2016-12-01

    A short-lived but important movement in seventeenth-century English natural philosophy—which scholars call “magnetical philosophy” or “magnetical cosmology”—sought to understand gravity (both terrestrial and celestial) by analogy with magnetism. The movement was clearly inspired by William Gilbert’s De magnete (1600) and culminated with Robert Hooke’s prefiguring of the universal principle of gravitation, which he personally communicated to Isaac Newton in 1679. But the magnetical cosmology, as professed by those in the movement, differed from Gilbert’s philosophy in highly significant ways. Proponents never accepted Gilbert’s animistic account of magnets and seem tacitly to have accepted a belief in action at a distance that Gilbert himself rejected. This essay argues that Francis Bacon (1561–1626) had already provided just the adaptations to Gilbert’s philosophy that the later thinkers adopted, including an important endorsement of action at a distance, and that he should be recognized as playing an important role in the movement.

  8. Quantum derivatives and the Schroedinger equation

    International Nuclear Information System (INIS)

    Ben Adda, Faycal; Cresson, Jacky

    2004-01-01

    We define a scale derivative for non-differentiable functions. It is constructed via quantum derivatives which take into account non-differentiability and the existence of a minimal resolution for mean representation. This justify heuristic computations made by Nottale in scale-relativity. In particular, the Schroedinger equation is derived via the scale-relativity principle and Newton's fundamental equation of dynamics

  9. A reliable treatment for nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Khani, F.; Hamedi-Nezhad, S.; Molabahrami, A.

    2007-01-01

    Exp-function method is used to find a unified solution of nonlinear wave equation. Nonlinear Schroedinger equations with cubic and power law nonlinearity are selected to illustrate the effectiveness and simplicity of the method. It is shown that the Exp-function method, with the help of symbolic computation, provides a powerful mathematical tool for solving nonlinear equation

  10. The Universe according to Schroedinger and Milo

    Science.gov (United States)

    Wolff, Milo

    2009-10-01

    The puzzling electron is due to the belief that it is a discrete particle. Schroedinger, (1937) eliminated discrete particles writing: What we observe as material bodies and forces are nothing but shapes and variations in the structure of space. Particles are just schaumkommen (appearances). Thus he rejected wave-particle duality. Schroedinger's concept was developed by Milo Wolff using a Scalar Wave Equation in 3D quantum space to find wave solutions. The resulting Wave Structure of Matter (WSM) contains all the electron's properties including the Schroedinger Equation. Further, Newton's Law F=ma is no longer a puzzle; It originates from Mach's principle of inertia (1883) that depends on the space medium and the WSM. These the origin of all the Natural Laws. Carver Mead (1999) at CalTech used the WSM to design Intel micro-chips and to correct errors of Maxwell's Equations. Applications of the WSM describe matter at molecular dimensions: Industrial alloys, catalysts, biology and medicine, molecular computers and memories. See book ``Schroedinger's Universe'' - at Amazon.com. Pioneers of the WSM are growing rapidly. Some are: SpaceAndMotion.com, QuantumMatter.com, treeincarnation.com/audio/milowolff.htm, daugerresearch.com/orbitals/index.shtml, glafreniere.com/matter.html =A new Universe.

  11. Schroedinger's Wave Structure of Matter (WSM)

    Science.gov (United States)

    Wolff, Milo; Haselhurst, Geoff

    2009-10-01

    The puzzling electron is due to the belief that it is a discrete particle. Einstein deduced this structure was impossible since Nature does not allow the discrete particle. Clifford (1876) rejected discrete matter and suggested structures in `space'. Schroedinger, (1937) also eliminated discrete particles writing: What we observe as material bodies and forces are nothing but shapes and variations in the structure of space. Particles are just schaumkommen (appearances). He rejected wave-particle duality. Schroedinger's concept was developed by Milo Wolff and Geoff Haselhurst (SpaceAndMotion.com) using the Scalar Wave Equation to find spherical wave solutions in a 3D quantum space. This WSM, the origin of all the Natural Laws, contains all the electron's properties including the Schroedinger Equation. The origin of Newton's Law F=ma is no longer a puzzle; It originates from Mach's principle of inertia (1883) that depends on the space medium and the WSM. Carver Mead (1999) at CalTech used the WSM to design Intel micro-chips correcting errors of Maxwell's magnetic Equations. Applications of the WSM also describe matter at molecular dimensions: alloys, catalysts, biology and medicine, molecular computers and memories. See ``Schroedinger's Universe'' - at Amazon.com

  12. Some spectral equivalences between Schroedinger operators

    International Nuclear Information System (INIS)

    Dunning, C; Hibberd, K E; Links, J

    2008-01-01

    Spectral equivalences of the quasi-exactly solvable sectors of two classes of Schroedinger operators are established, using Gaudin-type Bethe ansatz equations. In some instances the results can be extended leading to full isospectrality. In this manner we obtain equivalences between PT-symmetric problems and Hermitian problems. We also find equivalences between some classes of Hermitian operators

  13. Abelian Higgs mechanism in the Schroedinger picture

    International Nuclear Information System (INIS)

    Kim, S.K.; Namgung, W.; Soh, K.S.; Yee, J.H.

    1990-01-01

    We have studied symmetry-breaking phenomena in scalar electrodynamics by evaluating the effective potential at one-loop order in the Schroedinger picture. Contributions to the effective potential by the Higgs particle and the transverse and longitudinal components of a photon are compared with other previous works, and they are found to be consistent

  14. Spectral problem for the radial Schroedinger equation

    International Nuclear Information System (INIS)

    Vshivtsev, A.S.; Tatarintsev, A.V.; Prokopov, A.V.; Sorokin, V. N.

    1998-01-01

    For the first time, a procedure for determining spectra on the basis of generalized integral transformations is implemented for a wide class of radial Schroedinger equations. It is shown that this procedure works well for known types of potentials. Concurrently, this method makes it possible to obtain new analytic results for the Cornell potential. This may prove important for hadron physics

  15. The coevolution of genes and genetic codes: Crick's frozen accident revisited.

    Science.gov (United States)

    Sella, Guy; Ardell, David H

    2006-09-01

    The standard genetic code is the nearly universal system for the translation of genes into proteins. The code exhibits two salient structural characteristics: it possesses a distinct organization that makes it extremely robust to errors in replication and translation, and it is highly redundant. The origin of these properties has intrigued researchers since the code was first discovered. One suggestion, which is the subject of this review, is that the code's organization is the outcome of the coevolution of genes and genetic codes. In 1968, Francis Crick explored the possible implications of coevolution at different stages of code evolution. Although he argues that coevolution was likely to influence the evolution of the code, he concludes that it falls short of explaining the organization of the code we see today. The recent application of mathematical modeling to study the effects of errors on the course of coevolution, suggests a different conclusion. It shows that coevolution readily generates genetic codes that are highly redundant and similar in their error-correcting organization to the standard code. We review this recent work and suggest that further affirmation of the role of coevolution can be attained by investigating the extent to which the outcome of coevolution is robust to other influences that were present during the evolution of the code.

  16. Considerations on Bohr's, Heisenberg's and Schroedinger's philosophy

    International Nuclear Information System (INIS)

    Shimony, A.

    1981-01-01

    In denying that the words 'physical reality' are meaningful without reference to an experimental arrangement, Bohr renounces any knowledge of the 'thing-in-itself'. However, the relation of his epistemology to both idealism and positivism remains obscure. Heisenberg departs from Bohr in enunciating a metaphysical implication of quantum mechanics. Heisenberg asserts that there is an intermediate modality -potentiality- between logical possibility and existence. His attempts to explain the transition from potentiality to existence are not convincing. Schroedinger rejects Bohr's interpretation of quantum mechanics as a positivist exercise and seeks instead a realist interpretation. Nevertheless, the metaphysics of Schroedinger is fundamentally idealistic, maintaining that the material aspect of the world is composed of the same elements as mind, but in a different order [fr

  17. Schroedinger and the interpretation of quantum mechanics

    International Nuclear Information System (INIS)

    Rohrlich, F.

    1987-01-01

    On the occasion of the centennial of his birth, Schroedinger's life and views are sketched and his critique of the interpretation of quantum mechanics accepted at his time is examined. His own interpretation, which he had to abandon after a short time, provides a prime example of the way in which the tentative meaning of central theoretical terms in a new and revolutionary theory often fails. Schroedinger's strong philosophical convictions have played a key role in his refusal to break with many of the notions of classical physics. At the same time, they made him into a keen and incisive critic of the Copenhagen interpretation. His criticism is compared with present views on quantum mechanics

  18. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  19. Replication infidelity via a mismatch with Watson–Crick geometry

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C.; Kunkel, Thomas A.

    2011-01-01

    In describing the DNA double helix, Watson and Crick suggested that “spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms.” Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson–Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base–base mismatch with Watson–Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson–Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson–Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G•T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA. PMID:21233421

  20. Measurement theory and the Schroedinger equation

    International Nuclear Information System (INIS)

    Schwarz, A.S.; Tyupkin, Yu.S.

    1987-01-01

    The paper is an analysis of the measuring process in quantum mechanics based on the Schroedinger equation. The arguments employed use an assumption reflecting, to some extent, the statistical properties of the vacuum. A description is given of the cases in which different incoherent superpositions of pure states in quantum mechanics are physically equivalent. The fundamental difference between quantum and classical mechanics as explained by the existence of unobservable variables is discussed. (U.K.)

  1. Exchange effects in Relativistic Schroedinger Theory

    International Nuclear Information System (INIS)

    Sigg, T.; Sorg, M.

    1998-01-01

    The Relativistic Schroedinger Theory predicts the occurrence of exchange and overlap effects in many-particle systems. For a 2-particle system, the interaction energy of the two particles consists of two contributions: Coulomb energy and exchange energy, where the first one is revealed to be the same as in standard quantum theory. However the exchange energy is mediated by an exchange potential, contrary to the kinematical origin of the exchange term in the standard theory

  2. Schroedinger covariance states in anisotropic waveguides

    International Nuclear Information System (INIS)

    Angelow, A.; Trifonov, D.

    1995-03-01

    In this paper Squeezed and Covariance States based on Schroedinger inequality and their connection with other nonclassical states are considered for particular case of anisotropic waveguide in LiNiO 3 . Here, the problem of photon creation and generation of squeezed and Schroedinger covariance states in optical waveguides is solved in two steps: 1. Quantization of electromagnetic field is provided in the presence of dielectric waveguide using normal-mode expansion. The photon creation and annihilation operators are introduced, expanding the solution A-vector(r-vector,t) in a series in terms of the Sturm - Liouville mode-functions. 2. In terms of these operators the Hamiltonian of the field in a nonlinear waveguide is derived. For such Hamiltonian we construct the covariance states as stable (with nonzero covariance), which minimize the Schroedinger uncertainty relation. The evolutions of the three second momenta of q-circumflex j and p-circumflex j are calculated. For this Hamiltonian all three momenta are expressed in terms of one real parameters s only. It is found out how covariance, via this parameter s, depends on the waveguide profile n(x,y), on the mode-distributions u-vector j (x,y), and on the waveguide phase mismatching Δβ. (author). 37 refs

  3. The Schroedinger equation and canonical perturbation theory

    International Nuclear Information System (INIS)

    Graffi, S.; Paul, T.

    1987-01-01

    Let T 0 (ℎ,ω)+εV be the Schroedinger operator corresponding to the classical Hamiltonian H 0 (ω)+εV, where H 0 (ω) is the d-dimensional harmonic oscillator with non-resonant frequencies ω=(ω 1 ..., ω d ) and the potential V(q 1 , ..., q d ) is an entire function of order (d+l) -1 . We prove that the algorithm of classical, canonical perturbation theory can be applied to the Schroedinger equation in the Bargmann representation. As a consequence, each term of the Rayleigh-Schroedinger series near any eigenvalue of T 0 (ℎ,ω) admits a convergent expansion in powers of ℎ of initial point the corresponding term of the classical Birkhoff expansion. Moreover if V is an even polynomial, the above result and the KAM theorem show that all eigenvalues λ n (ℎ,ε) of T 0 +εV such that nℎ coincides with a KAM torus are given, up to order ε ∞ , by a quantization formula which reduces to the Bohr-Sommerfeld one up to first order terms in ℎ. (orig.)

  4. A life of Erwin Schroedinger. 2. ed.; Erwin Schroedinger. Eine Biographie

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Walter J.

    2015-07-01

    Erwin Schroedinger (1887-1961) was a pioneer of quantum physics, one of the most important scientist of the 20th century at all and a charming Austrian. He was a man with a passionate interest for men and ideas. Mostly known he became by his representation of quantum theory in the form of wave mechanics, for which he obtained the Nobel prize for physics and naturally by the famous thought experiment ''Schroedingers cat''. Walter Moore's biography is quite near to the person of Schroedinger and presents his scientific work in the context of his friendships, his interset for mysticism, and in front of the moving background of the political events in Germany and Austria.

  5. An implicit spectral formula for generalized linear Schroedinger equations

    International Nuclear Information System (INIS)

    Schulze-Halberg, A.; Garcia-Ravelo, J.; Pena Gil, Jose Juan

    2009-01-01

    We generalize the semiclassical Bohr–Sommerfeld quantization rule to an exact, implicit spectral formula for linear, generalized Schroedinger equations admitting a discrete spectrum. Special cases include the position-dependent mass Schroedinger equation or the Schroedinger equation for weighted energy. Requiring knowledge of the potential and the solution associated with the lowest spectral value, our formula predicts the complete spectrum in its exact form. (author)

  6. Poetic and Francis Bacon's Ambivalence toward Language.

    Science.gov (United States)

    Pribble, Paula Tompkins

    Just as rhetoric is a way of knowing, so is poetic, both of which, for Francis Bacon, produce false knowledge. But Bacon is not entirely negative. When the poetic elements of language are used in strategic and public communication, like the scholarly communication Bacon attempts to reform, poetic and rhetoric work together to create a plurality of…

  7. Feynman path integral related to stochastic schroedinger equation

    International Nuclear Information System (INIS)

    Belavkin, V.P.; Smolyanov, O.G.

    1998-01-01

    The derivation of the Schroedinger equation describing the continuous measurement process is presented. The representation of the solution of the stochastic Schroedinger equation for continuous measurements is obtained by means of the Feynman path integral. The connection with the heuristic approach to the description of continuous measurements is considered. The connection with the Senon paradox is established [ru

  8. Solving the Schroedinger equation using Smolyak interpolants

    International Nuclear Information System (INIS)

    Avila, Gustavo; Carrington, Tucker Jr.

    2013-01-01

    In this paper, we present a new collocation method for solving the Schroedinger equation. Collocation has the advantage that it obviates integrals. All previous collocation methods have, however, the crucial disadvantage that they require solving a generalized eigenvalue problem. By combining Lagrange-like functions with a Smolyak interpolant, we device a collocation method that does not require solving a generalized eigenvalue problem. We exploit the structure of the grid to develop an efficient algorithm for evaluating the matrix-vector products required to compute energy levels and wavefunctions. Energies systematically converge as the number of points and basis functions are increased

  9. Dual Schroedinger Equation as Global Optimization Algorithm

    International Nuclear Information System (INIS)

    Huang Xiaofei; eGain Communications, Mountain View, CA 94043

    2011-01-01

    The dual Schroedinger equation is defined as replacing the imaginary number i by -1 in the original one. This paper shows that the dual equation shares the same stationary states as the original one. Different from the original one, it explicitly defines a dynamic process for a system to evolve from any state to lower energy states and eventually to the lowest one. Its power as a global optimization algorithm might be used by nature for constructing atoms and molecules. It shall be interesting to verify its existence in nature.

  10. Inversion transformation in the Schroedinger equation

    International Nuclear Information System (INIS)

    Demkov, Yu.N.; Semenova, N.V.

    1984-01-01

    Using the inversion with respect to a sphere in the coordinate space, the equivalence between the Schroedinger equations with different potentials is established. It is shown that the zero-energy equation for a spherically symmetric potential is equivalent to the equation with an axially symmetric potential of a special form. The particular exact solutions of the zero-energy problem for the motion of a particle in the field of two Maxwell ''fish-eye'' potentials and potentials with the two Coulomb singularities are found

  11. Mobile localization in nonlinear Schroedinger lattices

    International Nuclear Information System (INIS)

    Gomez-Gardenes, J.; Falo, F.; Floria, L.M.

    2004-01-01

    Using continuation methods from the integrable Ablowitz-Ladik lattice, we have studied the structure of numerically exact mobile discrete breathers in the standard discrete nonlinear Schroedinger equation. We show that, away from that integrable limit, the mobile pulse is dressed by a background of resonant plane waves with wavevectors given by a certain selection rule. This background is seen to be essential for supporting mobile localization in the absence of integrability. We show how the variations of the localized pulse energy during its motion are balanced by the interaction with this background, allowing the localization mobility along the lattice

  12. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  13. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  14. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  15. Scale calculus and the Schroedinger equation

    International Nuclear Information System (INIS)

    Cresson, Jacky

    2003-01-01

    This paper is twofold. In a first part, we extend the classical differential calculus to continuous nondifferentiable functions by developing the notion of scale calculus. The scale calculus is based on a new approach of continuous nondifferentiable functions by constructing a one parameter family of differentiable functions f(t,ε) such that f(t,ε)→f(t) when ε goes to zero. This led to several new notions as representations: fractal functions and ε-differentiability. The basic objects of the scale calculus are left and right quantum operators and the scale operator which generalizes the classical derivative. We then discuss some algebraic properties of these operators. We define a natural bialgebra, called quantum bialgebra, associated with them. Finally, we discuss a convenient geometric object associated with our study. In a second part, we define a first quantization procedure of classical mechanics following the scale relativity theory developed by Nottale. We obtain a nonlinear Schroedinger equation via the classical Newton's equation of dynamics using the scale operator. Under special assumptions we recover the classical Schroedinger equation and we discuss the relevance of these assumptions

  16. Cavitation erosion prediction on Francis turbines

    Energy Technology Data Exchange (ETDEWEB)

    Bourdon, P.; Farhat, M.; Simoneau, R.; Lavigne, P. [Hydro-Quebec, Montreal, PQ (Canada); Pereira, F.; Dupont, P.; Avellan, F.; Caron, J.F. [IMHEF/EPFL, (France); Dorey, J.M.; Archer, A. [Electricite de France (EDF), 92 - Clamart (France). Dir. des Etudes et Recherches; and others

    1997-12-31

    On-board aggressiveness measurement methods were tested on a severely eroded prototype blade of a 266 MW Francis turbine: pressure, pit counting, DECER electrochemical and vibration measurements. The test program provided understanding of the heterogeneous erosion distribution of the prototype blades and quantitative data for comparison in subsequent tests on the model of the machine. Model tests and flow analysis were also performed, to detect cavitation on a Francis turbine model. The results are compared to those obtained on the prototype measurements. The model used for that study is built on the basis of a geometrical recovery of one of the most eroded blade of the prototype. Different methods were investigated to predict cavitation erosion on Francis turbines from model. They are based on measurement of pitting, pressure fluctuations and acceleration. The methods proposed are suitable to measure cavitation aggressiveness on model and on prototype, and that the level on the model is several orders of magnitude smaller than on the prototype. (author) 18 refs.

  17. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  18. Schroedinger operators and evolutionary strategies; Schroedinger-Operatoren und Evolutionaere Strategien

    Energy Technology Data Exchange (ETDEWEB)

    Asselmeyer, T.

    1997-12-22

    First we introduce a simple model for the description of evolutionary algorithms, which is based on 2nd order partial differential equations for the distribution function of the individuals. Then we turn to the properties of Boltzmann's and Darwin's strategy. the next chapter is dedicated to the mathematical properties of Schroedinger operators. Both statements on the spectral density and their reproducibility during the simulation are summarized. The remaining of this chapter are dedicated to the analysis of the kernel as well as the dependence of the Schroedinger operator on the potential. As conclusion from the results of this chapter we obtain the classification of the strategies in dependence of the fitness. We obtain the classification of the evolutionary strategies, which are described by a 2nd order partial differential equation, in relation to their solution behaviour. Thereafter we are employed with the variation of the mutation distribution.

  19. On the Schroedinger equation for the minisuperspace models

    International Nuclear Information System (INIS)

    Tkach, V.I.; Pashnev, A.I.; Rosales, J.J.

    2000-01-01

    We obtain a time-dependent Schroedinger equation for the Friedmann-Robertson-Walker (FRW) model interacting with a homogeneous scalar matter field. We show that for this purpose it is necessary to include an additional action invariant under the reparametrization of time. The last one does not change the equations of motion of the system, but changes only the constraint which at the quantum level becomes time-dependent Schroedinger equation. The same procedure is applied to the supersymmetric case and the supersymmetric quantum constraints are obtained, one of them is a square root of the Schroedinger operator

  20. Interaction of Schroedinger electrons and photons

    International Nuclear Information System (INIS)

    Haller, K.; Sohn, R.B.

    1979-01-01

    The effect of transformations carried out on the Hamiltonian for the Schroedinger electron-photon system is studied. These transformations include gauge transformations and certain similarity and ''hybrid'' transformations. The last named involve unitary transformations of either operators or states, but not both. Unitary and hybrid transformation are discussed, which affect the transverse components of the electromagnetic vector potentials and therefore are distinct from gauge transformations. A hybrid transformation is identified which leads to a form of the Hamiltonian that contains no reference to the transverse vector potential and includes electric and magnetic fields as well as nonlocal interactions of charges and currents. The behavior of the scattering matrix under the influence of these hybrid transformations is discussed. Comments are made on two-photon absorption calculations

  1. Formalism and physical interpretation in Schroedinger

    International Nuclear Information System (INIS)

    Paty, M.

    1992-01-01

    The question of the relation between a formalism and its physical interpretation arises not only when theoretical and conceptual systems are reorganized, but in the theoretical elaboration as well. The Schroedinger's work and thought are examined in this paper with this double concern. His work on the mathematical formalism is constantly sustained by a proper physical thought which takes the form of a wave intuition that guarantees him intelligibility. Concerning his interpretation of quantum mechanics, his thought remains characterized, through its evolution, by a w ave image of the world . The way he deals with space-time structure in General Relativity and favours the possibility of a direct interpretation of space-time geometrical quantities, is also studied. (author). 75 refs

  2. Generalized non-linear Schroedinger hierarchy

    International Nuclear Information System (INIS)

    Aratyn, H.; Gomes, J.F.; Zimerman, A.H.

    1994-01-01

    The importance in studying the completely integrable models have became evident in the last years due to the fact that those models present an algebraic structure extremely rich, providing the natural scenery for solitons description. Those models can be described through non-linear differential equations, pseudo-linear operators (Lax formulation), or a matrix formulation. The integrability implies in the existence of a conservation law associated to each of degree of freedom. Each conserved charge Q i can be associated to a Hamiltonian, defining a time evolution related to to a time t i through the Hamilton equation ∂A/∂t i =[A,Q i ]. Particularly, for a two-dimensions field theory, infinite degree of freedom exist, and consequently infinite conservation laws describing the time evolution in space of infinite times. The Hamilton equation defines a hierarchy of models which present a infinite set of conservation laws. This paper studies the generalized non-linear Schroedinger hierarchy

  3. Structural invariance of the Schroedinger equation and chronoprojective geometry

    International Nuclear Information System (INIS)

    Burdet, G.; Perrin, M.

    1983-07-01

    We describe an extension of the chronoprojective geometry and show how its automorphisms are related to the invariance properties of the Schroedinger equation describing a quantum test particle in any Newton-Cartan structure

  4. Monodromy of the matrix Schroedinger equations and Darboux transformations

    CERN Document Server

    Goncharenko, V M

    1998-01-01

    A Schroedinger operator L=-d sup 2 /dz sup 2 +U(z) with a matrix-valued rational potential U(z) is said to have trivial monodromy if all the solutions of the corresponding Schroedinger equations L psi=lambda psi are single-valued in the complex plane z is an element of C for any lambda. A local criterion of this property in terms of the Laurent coefficients of the potential U near its singularities, which are assumed to be regular, is found. It is proved that any such operator with a potential vanishing at infinity can be obtained by a matrix analogue of the Darboux transformation from the Schroedinger operator L sub o =-d sup 2 /dz sup 2. This generalizes the well known Duistermaat-Gruenbaum result to the matrix case and gives the explicit description of the Schroedinger operators with trivial monodromy in this case. (author)

  5. Homage to Francis Perrin - 1901-1992

    International Nuclear Information System (INIS)

    1994-05-01

    Francis Perrin had a brilliant and rapid career. He was a strict and honest man. He had a fast intelligence, a huge knowledge, he was faithful. Finally his courtesy and his generosity had made of him an outstanding and model personality very little known because of his extreme discretion. He lived his professional career (1920-1970) with passion. He thought that science might be one mankind heritage. He worked in CEA and played a crucial role in the CERN creation. He was an accomplished scientist since he tackled the mathematics, physics, and even chemistry scope. 52 refs

  6. Schroedinger operators - geometric estimates in terms of the occupation time

    International Nuclear Information System (INIS)

    Demuth, M.; Kirsch, W.; McGillivray, I.

    1995-01-01

    The difference of Schroedinger and Dirichlet semigroups is expressed in terms of the Laplace transform of the Brownian motion occupation time. This implies quantitative upper and lower bounds for the operator norms of the corresponding resolvent differences. One spectral theoretical consequence is an estimate for the eigenfunction for a Schroedinger operator in a ball where the potential is given as a cone indicator function. 12 refs

  7. Wigner function and Schroedinger equation in phase-space representation

    International Nuclear Information System (INIS)

    Chruscinski, Dariusz; Mlodawski, Krzysztof

    2005-01-01

    We discuss a family of quasidistributions (s-ordered Wigner functions of Agarwal and Wolf [Phys. Rev. D 2, 2161 (1970); Phys. Rev. D 2, 2187 (1970); Phys. Rev. D 2, 2206 (1970)]) and its connection to the so-called phase space representation of the Schroedinger equation. It turns out that although Wigner functions satisfy the Schroedinger equation in phase space, they have a completely different interpretation

  8. Discrete transparent boundary conditions for Schroedinger-type equations

    International Nuclear Information System (INIS)

    Schmidt, F.; Yevick, D.

    1997-01-01

    We present a general technique for constructing nonlocal transparent boundary conditions for one-dimensional Schroedinger-type equations. Our method supplies boundary conditions for the θ-family of implicit one-step discretizations of Schroedinger's equation in time. The use of Mikusinski's operator approach in time avoids direct and inverse transforms between time and frequency domains and thus implements the boundary conditions in a direct manner. 14 refs., 9 figs

  9. Linearised collective Schroedinger equation for nuclear quadrupole surface vibrations

    International Nuclear Information System (INIS)

    Greiner, M.; Heumann, D.; Scheid, W.

    1990-11-01

    The linearisation of the Schroedinger equation for nuclear quadrupole surface vibrations yields a new spin degree of freedom, which is called collective spin and has a value of 3/2. With the introduction of collective spin dependent potentials, this linearised Schroedinger equation is then used for the description of low energy spectra and electromagnetic transition probabilities of some even-odd Xe, Ir and Au nuclei which have a spin 3/2 in their groundstate. (orig.)

  10. Failure analysis of a Francis turbine runner

    Energy Technology Data Exchange (ETDEWEB)

    Frunzaverde, D; Campian, V [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta Traian Vuia 1-4, RO-320085, Resita (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Marginean, G [University of Applied Sciences Gelsenkirchen, Neidenburger Str. 10, 45877 Gelsenkirchen (Germany); Marsavina, L [Department of Strength, ' Politehnica' University of Timisoara, Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Terzi, R; Serban, V, E-mail: gabriela.marginean@fh-gelsenkirchen.d, E-mail: d.frunzaverde@uem.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A., Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)

    2010-08-15

    The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.

  11. Failure analysis of a Francis turbine runner

    International Nuclear Information System (INIS)

    Frunzaverde, D; Campian, V; Muntean, S; Marginean, G; Marsavina, L; Terzi, R; Serban, V

    2010-01-01

    The variable demand on the energy market requires great flexibility in operating hydraulic turbines. Therefore, turbines are frequently operated over an extended range of regimes. Francis turbines operating at partial load present pressure fluctuations due to the vortex rope in the draft tube cone. This phenomenon generates strong vibrations and noise that may produce failures on the mechanical elements of the machine. This paper presents the failure analysis of a broken Francis turbine runner blade. The failure appeared some months after the welding repair work realized in situ on fatigue cracks initiated near to the trailing edge at the junction with the crown, where stress concentration occurs. In order to determine the causes that led to the fracture of the runner blade, the metallographic investigations on a sample obtained from the blade is carried out. The metallographic investigations included macroscopic and microscopic examinations, both performed with light and scanning electron microscopy, as well as EDX - analyses. These investigations led to the conclusion, that the cracking of the blade was caused by fatigue, initiated by the surface unevenness of the welding seam. The failure was accelerated by the hydrogen embrittlement of the filling material, which appeared as a consequence of improper welding conditions. In addition to the metallographic investigations, numerical computations with finite element analysis are performed in order to evaluate the deformation and stress distribution on blade.

  12. Development of a 5kw Francis Turbine Runner Using Computation ...

    African Journals Online (AJOL)

    A small scale Francis turbine runner for a turbine located at Awba dam in the University of Ibadan with designed head and flow rate of 6m and 0.244m3/s is designed. The basic design of the Francis turbine runner is completed based on basic fluid dynamics turbo machinery principles. A 2-D and 3-D steady state, ...

  13. Singular continuous spectrum for palindromic Schroedinger operators

    International Nuclear Information System (INIS)

    Hof, A.; Knill, O.; Simon, B.

    1995-01-01

    We give new examples of discrete Schroedinger operators with potentials taking finitely many values that have purely singular continuous spectrum. If the hull X of the potential is strictly ergodic, then the existence of just one potential x in X for which the operator has no eigenvalues implies that there is a generic set in X for which the operator has purely singular continuous spectrum. A sufficient condition for the existence of such an x is that there is a z element of X that contains arbitrarily long palindromes. Thus we can define a large class of primitive substitutions for which the operators are purely singularly continuous for a generic subset in X. The class includes well-known substitutions like Fibonacci, Thue-Morse, Period Doubling, binary non-Pisot and ternary non-Pisot. We also show that the operator has no absolutely continuous spectrum for all x element of X if X derives from a primitive substitution. For potentials defined by circle maps, x n =l J (θ 0 +nα), we show that the operator has purely singular continuous spectrum for a generic subset in X for all irrational α and every half-open interval J. (orig.)

  14. Spectrum of the ballooning Schroedinger equation

    International Nuclear Information System (INIS)

    Dewar, R.L.

    1997-01-01

    The ballooning Schroedinger equation (BSE) is a model equation for investigating global modes that can, when approximated by a Wentzel-Kramers-Brillouin (WKB) ansatz, be described by a ballooning formalism locally to a field line. This second order differential equation with coefficients periodic in the independent variable θ k is assumed to apply even in cases where simple WKB quantization conditions break down, thus providing an alternative to semiclassical quantization. Also, it provides a test bed for developing more advanced WKB methods: e.g. the apparent discontinuity between quantization formulae for open-quotes trappedclose quotes and open-quotes passingclose quotes modes, whose ray paths have different topologies, is removed by extending the WKB method to include the phenomena of tunnelling and reflection. The BSE is applied to instabilities with shear in the real part of the local frequency, so that the dispersion relation is inherently complex. As the frequency shear is increased, it is found that trapped modes go over to passing modes, reducing the maximum growth rate by averaging over θ k

  15. Independent particle Schroedinger Fluid: moments of inertia

    International Nuclear Information System (INIS)

    Kan, K.K.; Griffin, J.J.

    1977-10-01

    This philosophy of the Single Particle Schroedinger Fluid, especially as regards the velocity fields which find such a natural role therein, is applied to the study of the moments of inertia of independent Fermion system. It is shown that three simplified systems exhibit the rigid-body rotational velocity field in the limit of large A, and that the leading deviations, both on the average and fluctuating, from this large A limit can be described analytically, and verified numerically. For a single particle in a Hill-Wheeler box the moments are studied numerically, and their large fluctuations identified with the specific energy level degeneracies of its parallelepiped shape. The full assemblage of these new and old results is addressed to the question of the necessary and sufficient condition that the moment have the rigid value. Counterexamples are utilized to reject some conditions, and the conjecture is argued that Unconstrained Shape Equilibrium might be the necessary and sufficient condition. The spheroidal square well problem is identified as a promising test case

  16. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  17. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  18. [Sir Francis Galton: the father of eugenics].

    Science.gov (United States)

    Aubert-Marson, Dominique

    2009-01-01

    Not only was Sir Francis Galton a famous geographer and statistician, he also invented "eugenics" in 1883. Eugenics, defined as the science of improving racial stock, was developed from a new heredity theory, conceived by Galton himself, and from the evolution theory of Charles Darwin, transposed to human society by Herbert Spencer. Galton's eugenics was a program to artificially produce a better human race through regulating marriage and thus procreation. Galton put particular emphasis on "positive eugenics", aimed at encouraging the physically and mentally superior members of the population to choose partners with similar traits. In 1904, he presented his ideas in front of a vast audience of physicians and scientists in London. His widely-publicized lecture served as the starting point for the development of eugenics groups in Europe and the United States during the first half of the 20th century.

  19. O duplo legado de Francis Poulenc

    Directory of Open Access Journals (Sweden)

    Joana Resende

    2009-12-01

    Full Text Available Déjàvu,or better,déjà écouté is an appropriate expression to describe an audition of certain works by Francis Poulenc (1899-1963. A sui-generis character in 20th century music, Poulenc has questioned the whole heritage that came before him, French or not, according to the premises of the group he belonged to, Les Six, although not always reaching similar results. His main concern was to make good music, an ideal not far from that of Debussy, “music should humbly seek to please” (Harry Halbreich. This article approaches the use of quotation and other processes of allusion in the works by Poulenc, as seen in his voice and piano mélodies cycle La fraîcheur et le feu, identifying thematic, melodic, and harmonic, origins used coherently in several pieces. and helping to solidly build his musical language.

  20. Spectral Target Detection using Schroedinger Eigenmaps

    Science.gov (United States)

    Dorado-Munoz, Leidy P.

    Applications of optical remote sensing processes include environmental monitoring, military monitoring, meteorology, mapping, surveillance, etc. Many of these tasks include the detection of specific objects or materials, usually few or small, which are surrounded by other materials that clutter the scene and hide the relevant information. This target detection process has been boosted lately by the use of hyperspectral imagery (HSI) since its high spectral dimension provides more detailed spectral information that is desirable in data exploitation. Typical spectral target detectors rely on statistical or geometric models to characterize the spectral variability of the data. However, in many cases these parametric models do not fit well HSI data that impacts the detection performance. On the other hand, non-linear transformation methods, mainly based on manifold learning algorithms, have shown a potential use in HSI transformation, dimensionality reduction and classification. In target detection, non-linear transformation algorithms are used as preprocessing techniques that transform the data to a more suitable lower dimensional space, where the statistical or geometric detectors are applied. One of these non-linear manifold methods is the Schroedinger Eigenmaps (SE) algorithm that has been introduced as a technique for semi-supervised classification. The core tool of the SE algorithm is the Schroedinger operator that includes a potential term that encodes prior information about the materials present in a scene, and enables the embedding to be steered in some convenient directions in order to cluster similar pixels together. A completely novel target detection methodology based on SE algorithm is proposed for the first time in this thesis. The proposed methodology does not just include the transformation of the data to a lower dimensional space but also includes the definition of a detector that capitalizes on the theory behind SE. The fact that target pixels and

  1. Algorithm for research of mathematical physics equations symmetries. Symmetries of the free Schroedinger equation

    International Nuclear Information System (INIS)

    Kotel'nikov, G.A.

    1994-01-01

    An algorithm id proposed for research the symmetries of mathematical physics equation. The application of this algorithm to the Schroedinger equation permitted to establish, that in addition to the known symmetry the Schroedinger equation possesses also the relativistic symmetry

  2. Construction of stable explicit finite-difference schemes for Schroedinger type differential equations

    Science.gov (United States)

    Mickens, Ronald E.

    1989-01-01

    A family of conditionally stable, forward Euler finite difference equations can be constructed for the simplest equation of Schroedinger type, namely u sub t - iu sub xx. Generalization of this result to physically realistic Schroedinger type equations is presented.

  3. Schroedinger operators with singular perturbation potentials

    International Nuclear Information System (INIS)

    Harrell, E.M. II.

    1976-01-01

    This is a perturbative analysis of the eigenvalues and eigenfunctions of Schroedinger operators of the form -Δ + A + lambda V, defined on the Hilbert space L 2 (R/sup n/). A is a potential function (a smooth, real multiplication operator), and V is a ''spikelike'' perturbation, i.e., a perturbative potential function which diverges at some finite point. Lambda is a small real or complex parameter. The emphasis is on one-dimensional problems, and in particular the typical example is the ''spiked harmonic oscillator'' Hamiltonian, -d 2 /dx 2 + x 2 + lambda x/sup -α/, where α is a positive constant. An earlier study by L. Detwiler and J. R. Klauder [Phys. Rev. D 11 (1975) 1436] indicated that the lowest-order corrections to the ground-state eigenvalue of the spiked harmonic oscillator with lambda greater than 0 were proportional to lambda ln lambda when α = 3, and to lambda/sup 1/(α-2) when α is greater than 3. These and analogous results for a large class of operators and arbitrary eigenvalues are proved. Explicit constants in a modified perturbation series with a complicated dependence on lambda are determined and exhibited. Higher-order corrections for real lambda and lowest-order corrections for complex lambda are also discussed. While the substance of the dissertation is mathematical, its main applications are to quantum physics. The immediate cause of interest in such problems was the use of their peculiar convergence properties by J. R. Klauder as models for the behavior of nonrenormalizable quantum field theories. However, the results of this study are likely to be of greater importance in chemical or nuclear physics, as positive spikelike perturbations represent repulsive core interactions for quantum mechanical particles. The modified perturbation series are a new calculation technique for this situation

  4. Assessing Attitude towards Religion: The Astley-Francis Scale of Attitude towards Theistic Faith

    Science.gov (United States)

    Astley, Jeff; Francis, Leslie J.; Robbins, Mandy

    2012-01-01

    This study builds on the research tradition modelled by the Francis Scale of Attitude towards Christianity, the Katz-Francis Scale of Attitude towards Judaism, the Sahin-Francis Scale of Attitude towards Islam and the Santosh-Francis Scale of Attitude towards Hinduism to propose a generic instrument concerned with attitudes towards theistic faith.…

  5. Generalized fractional Schroedinger equation with space-time fractional derivatives

    International Nuclear Information System (INIS)

    Wang Shaowei; Xu Mingyu

    2007-01-01

    In this paper the generalized fractional Schroedinger equation with space and time fractional derivatives is constructed. The equation is solved for free particle and for a square potential well by the method of integral transforms, Fourier transform and Laplace transform, and the solution can be expressed in terms of Mittag-Leffler function. The Green function for free particle is also presented in this paper. Finally, we discuss the relationship between the cases of the generalized fractional Schroedinger equation and the ones in standard quantum

  6. Dispersive estimates for the Schroedinger and Klein-Gordon equations

    Energy Technology Data Exchange (ETDEWEB)

    Kopylova, Elena A [Institute for Information Transmission Problems, Russian Academy of Sciences, Moscow (Russian Federation)

    2010-01-01

    This is a survey of results on the long-time asymptotic behaviour of solutions of the Schroedinger and Klein-Gordon equations in weighted energy norms. Results obtained from 1975 to 2001 in the spectral scattering theory of Agmon, Jensen-Kato, Jensen-Nenciu, and Murata are described for the Schroedinger equation, along with the author's recent results obtained jointly with A.I. Komech for the Klein-Gordon equation. The methods used develop the spectral approach as applied to relativistic equations. Bibliography: 40 titles.

  7. Francis Goyat kuuleb pühapäeval

    Index Scriptorium Estoniae

    2003-01-01

    Belgia kitarristist Francis Goyast, kontsertidest Pärnu kontserdimajas 19. nov., Tartus Vanemuise kontserdimajas 21.nov ja Tallinnas Estonia kontserdisaalis 23. nov., heliplaadist "Pleased to meet You, Mr. Valgre"

  8. Francis Bacon: “pintar sensações” (Francis Bacon: “to paint sensations”)

    OpenAIRE

    Borges, Sonia; UVA

    2013-01-01

    RESUMO O texto aborda, pela via da psicanálise, o que consideramos como o “método” de Francis Bacon: “pintar sensações”. Para isto, tomo, como referências principais, a Carta 52 (1896), da correspondência de Freud com Fliess, e Em busca do tempo perdido, romance de Marcel Proust ([1922] 1995), observando a possibilidade de considerar o que Proust nomeia como “memória involuntária” e o seu papel no processo criativo como uma ilustração esclarecedora do que Freud nos traz na Carta sobre a estr...

  9. A POÉTICA DE FRANCIS BACON

    Directory of Open Access Journals (Sweden)

    Sonia Borges

    2013-02-01

    Full Text Available A partir da perspectiva psicanalítica, a autora aborda a obra de Francis Bacon se utilizando de uma concepção estética que a reconhece como uma realidade ontológica. Dessa forma, considera que como obra de arte, são seus próprios elementos constitutivos, numa tensão interna, que são capazes de provocar efeitos ou as sensações que são o seu objetivo último conforme defendia Bacon. Em sua análise a autora examina e discute a dialética “tempo - espaço”, revelada pelo poeta pintor, como sendo de especial interesse para a clínica psicanalítica na medida em que esclarece importantes questões relativas ao Real como impossível, tal como o compreendeu Lacan. A pintura de Bacon examinada como referência à “sublimação criacionista da pulsão de morte” permite, segundo a autora, vislumbrarmos o para além da cadeia significante. Conclui que a arte, assim como a clínica psicanalítica, supõe deslocamentos subjetivos que implicam corte - rompimento com a tendência unificadora e pacificadora de Eros.

  10. HydroHillChart – Francis module. Software used to Calculate the Hill Chart of the Francis Hydraulic Turbines

    Directory of Open Access Journals (Sweden)

    Dorian Nedelcu

    2015-07-01

    Full Text Available The paper presents the Hydro Hill Chart - Francis module application, used to calculate the hill chart of the Pelton, Francis and Kaplan hydraulic turbine models, by processing the data measured on the stand. After describing the interface and menu, the input data is graphically presented and the universal characteristic for measuring scenarios ao=const. and n11=const is calculated. Finally, the two calculated hill charts are compared through a graphical superimposition of the isolines.

  11. Numerical Clifford Analysis for the Non-stationary Schroedinger Equation

    International Nuclear Information System (INIS)

    Faustino, N.; Vieira, N.

    2007-01-01

    We construct a discrete fundamental solution for the parabolic Dirac operator which factorizes the non-stationary Schroedinger operator. With such fundamental solution we construct a discrete counterpart for the Teodorescu and Cauchy-Bitsadze operators and the Bergman projectors. We finalize this paper with convergence results regarding the operators and a concrete numerical example

  12. Studying the gradient flow coupling in the Schroedinger functional

    Energy Technology Data Exchange (ETDEWEB)

    Fritzsch, P. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Ramos, A. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2013-08-15

    We discuss the setup and features of a new definition of the running coupling in the Schroedinger functional scheme based on the gradient flow. Its suitability for a precise continuum limit in QCD is demonstrated on a set of N{sub f}=2 gauge field ensembles in a physical volume of L{proportional_to}0.4 fm.

  13. Chronoprojective invariance of the five-dimensional Schroedinger formalism

    International Nuclear Information System (INIS)

    Perrin, M.; Burdet, G.; Duval, C.

    1984-10-01

    Invariance properties of the five-dimensional Schroedinger formalism describing a quantum test particle in the Newton-Cartan theory of gravitation are studied. The geometry which underlies these invariance properties is presented as a reduction of the 0(5,2) conformal geometry various applications are given

  14. New method for solving three-dimensional Schroedinger equation

    International Nuclear Information System (INIS)

    Melezhik, V.S.

    1990-01-01

    The method derived recently for solving a multidimensional scattering problem is applied to a three-dimensional Schroedinger equation. As compared with direct three-dimensional calculations of finite elements and finite differences, this approach gives sufficiently accurate upper and lower approximations to the helium-atom binding energy, which demonstrates its efficiency. 15 refs.; 1 fig.; 2 tabs

  15. Consequences of the Schroedinger equation for atomic and molecular physics

    International Nuclear Information System (INIS)

    Thirring, W.E.

    1986-01-01

    The non-relativistic Schroedinger equation for a system of nuclei and electrons is considered and general properties of Hamiltonian H are treated and commented: self-adjontness of H, the spectrum of H, the discrete spectrum, the continuous spectrum, the limit of infinite nuclear mass, the limit of infinite nuclear charge. (G.Q.)

  16. Quantum osp-invariant non-linear Schroedinger equation

    International Nuclear Information System (INIS)

    Kulish, P.P.

    1985-04-01

    The generalizations of the non-linear Schroedinger equation (NS) associated with the orthosymplectic superalgebras are formulated. The simplest osp(1/2)-NS model is solved by the quantum inverse scattering method on a finite interval under periodic boundary conditions as well as on the wholeline in the case of a finite number of excitations. (author)

  17. Remarks on the Schroedinger operator with singular complex potentials

    International Nuclear Information System (INIS)

    Brezis, Haim; Kato, Tosio

    1979-01-01

    To describe this method in a simple case Section 2 begin with real valued potentials. The main results in Section 2 are essentially known. In Section 3 the case of complex potentials is exposed. Schroedinger operators with complex potentials have been studied by Nelson. This results were extended. Here more general singularities are exposed

  18. On the invariant measure for the nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Zhidkov, P.R.

    1991-01-01

    The invariant measure for the nonlinear Schroedinger equation is constructed. In fact, it is assumed that the nonlinearity in the equation is semilinear. The main aim of the paper is the explanation of the Fermi - Past - Ulam phenomenon. Poincare theorem gives the answer to this question. 17 refs

  19. Exact solutions for the cubic-quintic nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Zhu Jiamin; Ma Zhengyi

    2007-01-01

    In this paper, the cubic-quintic nonlinear Schroedinger equation is solved through the extended elliptic sub-equation method. As a consequence, many types of exact travelling wave solutions are obtained which including bell and kink profile solitary wave solutions, triangular periodic wave solutions and singular solutions

  20. On the recovering of a coupled nonlinear Schroedinger potential

    Energy Technology Data Exchange (ETDEWEB)

    Corona, Gulmaro Corona [Area de Analisis Matematico y sus Aplicaciones, Universidad Autonoma Metropolitana, Atzcapotzalco, DF (Mexico)]. E-mail: ccg@hp9000a1.uam.mx

    2000-04-28

    We establish a priori conditions for a Gel'fand-Levitan (GL) integral using some results of the Fredholm theory. As consequence, we obtain a recovering formula for the potential of the coupled nonlinear Schroedinger equations. The remarkable fact is that the recovering formula is given in terms of the solutions of a classical GL-integral equation. (author)

  1. Exact solutions to two higher order nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Xu Liping; Zhang Jinliang

    2007-01-01

    Using the homogeneous balance principle and F-expansion method, the exact solutions to two higher order nonlinear Schroedinger equations which describe the propagation of femtosecond pulses in nonlinear fibres are obtained with the aid of a set of subsidiary higher order ordinary differential equations (sub-equations for short)

  2. Asymptotic Value Distribution for Solutions of the Schroedinger Equation

    International Nuclear Information System (INIS)

    Breimesser, S. V.; Pearson, D. B.

    2000-01-01

    We consider the Dirichlet Schroedinger operator T=-(d 2 /d x 2 )+V, acting in L 2 (0,∞), where Vis an arbitrary locally integrable potential which gives rise to absolutely continuous spectrum. Without any other restrictive assumptions on the potential V, the description of asymptotics for solutions of the Schroedinger equation is carried out within the context of the theory of value distribution for boundary values of analytic functions. The large x asymptotic behaviour of the solution v(x,λ) of the equation Tf(x,λ)=λf(x,λ), for λ in the support of the absolutely continuous part μ a.c. of the spectral measure μ, is linked to the spectral properties of this measure which are determined by the boundary value of the Weyl-Titchmarsh m-function. Our main result (Theorem 1) shows that the value distribution for v'(N,λ)/v(N,λ) approaches the associated value distribution of the Herglotz function m N (z) in the limit N → ∞, where m N (z) is the Weyl-Titchmarsh m-function for the Schroedinger operator -(d 2 /d x 2 )+Vacting in L 2 (N,∞), with Dirichlet boundary condition at x=N. We will relate the analysis of spectral asymptotics for the absolutely continuous component of Schroedinger operators to geometrical properties of the upper half-plane, viewed as a hyperbolic space

  3. Travelling solitons in the parametrically driven nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Barashenkov, I.V.; Zemlyanaya, E.V.; Baer, M.

    2000-01-01

    We show that the parametrically driven nonlinear Schroedinger equation has wide classes of travelling soliton solutions, some of which are stable. For small driving strengths stable nonpropagating and moving solitons co-exist while strongly forced solitons can only be stable when moving sufficiently fast

  4. Erwin Schroedinger, Philosophy and the birth of quantum mechanics

    International Nuclear Information System (INIS)

    Bitbol, M.; Darrigol, O.

    1992-01-01

    The purpose of this collection of articles is to highlight the relation between Schroedinger's less well known research and his thoughts on quantum mechanics: philosophy, statistical mechanics, general relativity, cosmology, unified field theories, etc. Some articles are devoted to contemporary extensions of his work, and in particular on current echoes of his interpretation of quantum mechanics

  5. Erwin Schroedinger: Collected papers V. 1. Contributions to statistical mechanics

    International Nuclear Information System (INIS)

    Schroedinger, E.

    1984-01-01

    38 publications reprinted in this volume show that the interest for statistical problems accompanied Schroedinger during his entire scientific career. Already in his second paper he worked on the magnetism of solid states. The classical considerations come close to the heart of diamagnetism and also to the origin of paramagnetism. In classical investigations of the specific heat Schroedinger helped through abstract theory but also by analysing a gigantic amount of experimental material. In 1926 he and F. Kohlrausch actually played the 'Urngame of Ehrenfest' as a model of the H-curve and published the results. Inclination towards experimenting, sequences of measurements and statistical evaluation of experimental data led to papers on the foundation of the theory of probability, where he tries to put the subjective probability concept on into a systematic framework. Two earlier papers on dynamics of the elastic chain remained particularly valuable. By solving the initial value problem with Bessel-functions this many-body-problem is led to an explicit discussion. These studies are likely to be the roots of another keynote in Schroedinger's thinking, namely, the irreversibility. 1945 a statistical theory of chain-reactions was published under the inconspicuous title of 'Probability Problems in Nuclear Chemistry'. In his last work Schroedinger turns off in a wrong direction: it is that energy should only be a statistical concept and should not be conserved in elementary processes, but somehow only in the mean. These short remarks only illuminate the diversity of the material in this volume, but testify Schroedinger's deep understanding in this field. (W.K.)

  6. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  7. Measurement of pressure pulsations in Francis turbines

    Energy Technology Data Exchange (ETDEWEB)

    Kobro, Einar

    2010-11-15

    The work presented in this thesis involves preparation and execution of measurements on Francis runners. The measurements were performed by means of onboard measuring equipment both in model runners and full-scale prototype runners. Also, analysis of the measured data, and the discussion of the results, is presented. The measurements resulted in large data sets. These data sets were used by the author to investigate the dynamic pressure and strain in the runners. The results of the analysis can be used as input in future turbine design. Andritz Hydro AG has used the data for verification of their numerical simulation tools. In connection with the refurbishment of Tokke power plant, two model runners were made available for onboard pressure measurements. To investigate the dynamic pressure in these runners, methods for integration of pressure transducers in the runner blades needed to be developed. After initial difficulties during the preparation, successful measurements were obtained from both model runners. At Tokke power plant, both the original and replacement runners were made accessible for onboard pressure and strain gauge measurements. On the original Kvaerner Brug AS runner, the test was prepared and performed by the author. This test failed, due to water intrusion in the logging chain. The second test was performed on the Andritz Hydro AG replacement runner. This test was prepared and performed by the author in close cooperation with Andritz Hydro AG, and the results were successful. The analysis results from both model and prototype runners show that the wake leaving the guide vanes is the most severe source of dynamic pressure in the runner. The draft tube vortex rope pulsation propagates upstream the runner, but does not appear as a significant frequency in the runner strain measurements. (Author)

  8. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  9. Numerical Study of a High Head Francis Turbine with Measurements from the Francis-99 Project

    International Nuclear Information System (INIS)

    Wallimann, H; Neubauer, R

    2015-01-01

    For the Francis-99 project initiated by the Norwegian University of Science and Technology (NTNU, Norway) and the Luleå University of Technology (LTU, Sweden) numerical flow simulation has been performed and the results compared to experimentally obtained data. The full machine including spiral casing, stay vanes, guide vanes, runner and draft tube was simulated transient for three operating points defined by the Francis-99 organisers. Two sets of results were created with differing time steps. Additionally, a reduced domain was simulated in a stationary manner to create a complete cut along constant prototype head and constant prototype discharge. The efficiency values and shape of the curves have been investigated and compared to the experimental data. Special attention has been given to rotor stator interaction (RSI). Signals from several probes and their counterpart in the simulation have been processed to evaluate the pressure fluctuations occurring due to the RSI. The direct comparison of the hydraulic efficiency obtained by the full machine simulation compared to the experimental data showed no improvement when using a 1° time step compared to a coarser 2° time step. At the BEP the 2° time step even showed a slightly better result with an absolute deviation 1.08% compared with 1.24% for the 1° time step. At the other two operating points the simulation results were practically identical but fell short of predicting the measured values. The RSI evaluation was done using the results of the 2° time step simulation, which proved to be an adequate setting to reproduce pressure signals with peaks at the correct frequencies. The simulation results showed the highest amplitudes in the vaneless space at the BEP operating point at a location different from the probe measurements available. This implies that not only the radial distance, but the shape of the vaneless space influences the RSI

  10. Solution of the Schroedinger equation by a spectral method

    International Nuclear Information System (INIS)

    Feit, M.D.; Fleck, J.A. Jr.; Steiger, A.

    1982-01-01

    A new computational method for determining the eigenvalues and eigenfunctions of the Schroedinger equation is described. Conventional methods for solving this problem rely on diagonalization of a Hamiltonian matrix or iterative numerical solutions of a time independent wave equation. The new method, in contrast, is based on the spectral properties of solutions to the time-dependent Schroedinger equation. The method requires the computation of a correlation function from a numerical solution psi(r, t). Fourier analysis of this correlation function reveals a set of resonant peaks that correspond to the stationary states of the system. Analysis of the location of these peaks reveals the eigenvalues with high accuracy. Additional Fourier transforms of psi(r, t) with respect to time generate the eigenfunctions. The effectiveness of the method is demonstrated for a one-dimensional asymmetric double well potential and for the two-dimensional Henon--Heiles potential

  11. New method for solving three-dimensional Schroedinger equation

    International Nuclear Information System (INIS)

    Melezhik, V.S.

    1992-01-01

    A new method is developed for solving the multidimensional Schroedinger equation without the variable separation. To solve the Schroedinger equation in a multidimensional coordinate space X, a difference grid Ω i (i=1,2,...,N) for some of variables, Ω, from X={R,Ω} is introduced and the initial partial-differential equation is reduced to a system of N differential-difference equations in terms of one of the variables R. The arising multi-channel scattering (or eigenvalue) problem is solved by the algorithm based on a continuous analog of the Newton method. The approach has been successfully tested for several two-dimensional problems (scattering on a nonspherical potential well and 'dipole' scatterer, a hydrogen atom in a homogenous magnetic field) and for a three-dimensional problem of the helium-atom bound states. (author)

  12. Schroedinger operators with point interactions and short range expansions

    International Nuclear Information System (INIS)

    Albeverio, S.; Hoeegh-Krohn, R.; Oslo Univ.

    1984-01-01

    We give a survey of recent results concerning Schroedinger operators with point interactions in R 3 . In the case where the point interactions are located at a discrete set of points we discuss results about the resolvent, the spectrum, the resonances and the scattering quantities. We also discuss the approximation of point interactions by short range local potentials (short range or low energy expansions) and the one electron model of a 3-dimensional crystal. Moreover we discuss Schroedinger operators with Coulomb plus point interactions, with applications to the determination of scattering lengths and of level shifts in mesic atoms. Further applications to the multiple well problem, to multiparticle systems, to crystals with random impurities, to polymers and quantum fields are also briefly discussed. (orig.)

  13. Integrable discretization s of derivative nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Tsuchida, Takayuki

    2002-01-01

    We propose integrable discretizations of derivative nonlinear Schroedinger (DNLS) equations such as the Kaup-Newell equation, the Chen-Lee-Liu equation and the Gerdjikov-Ivanov equation by constructing Lax pairs. The discrete DNLS systems admit the reduction of complex conjugation between two dependent variables and possess bi-Hamiltonian structure. Through transformations of variables and reductions, we obtain novel integrable discretizations of the nonlinear Schroedinger (NLS), modified KdV (mKdV), mixed NLS, matrix NLS, matrix KdV, matrix mKdV, coupled NLS, coupled Hirota, coupled Sasa-Satsuma and Burgers equations. We also discuss integrable discretizations of the sine-Gordon equation, the massive Thirring model and their generalizations. (author)

  14. Verdade e método em Francis Bacon

    OpenAIRE

    Secco, Márcio

    2004-01-01

    Dissertação (mestrado) - Universidade Federal de Santa Catarina, Centro de Filosofia e Ciências Humanas. Programa de Pós-Graduação em Filosofia. Estudo sobre o método e o conceito de verdade defendido por Francis Bacon, sendo nossos principais objetivos nesse trabalho: a) esclarecer algumas questões relativas ao método baconiano, principalmente no que se refere ao uso de hipóteses; b) apresentar uma interpretação falibilista da teoria de Francis Bacon, mostrando que a verdade e a utilidade...

  15. The Schroedinger equation as a singular perturbation problem

    International Nuclear Information System (INIS)

    Jager, E.M. de; Kuepper, T.

    1978-01-01

    Comparisons are made of the eigenvalues and the corresponding eigenfunctions of the eigenvalue problem connected with the one dimensional Schroedinger equation in Hilbert space. The difference of the eigenvalues is estimated by applying Weyl's monotonicity principle and the minimum maximum principle. The difference of the eigenfunctions is estimated in L 2 norm and in maximum norm obtained by using simple tools from operator theory in Hilbert spaces. An application concerning perturbations of the Planck ideal linear oscillator is given. (author)

  16. Strong phase correlations of solitons of nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Litvak, A.G.; Mironov, V.A.; Protogenov, A.P.

    1994-06-01

    We discuss the possibility to suppress the collapse in the nonlinear 2+1 D Schroedinger equation by using the gauge theory of strong phase correlations. It is shown that invariance relative to q-deformed Hopf algebra with deformation parameter q being the fourth root of unity makes the values of the Chern-Simons term coefficient, k=2, and of the coupling constant, g=1/2, fixed; no collapsing solutions are present at those values. (author). 21 refs

  17. The quantum nonlinear Schroedinger model with point-like defect

    International Nuclear Information System (INIS)

    Caudrelier, V; Mintchev, M; Ragoucy, E

    2004-01-01

    We establish a family of point-like impurities which preserve the quantum integrability of the nonlinear Schroedinger model in 1+1 spacetime dimensions. We briefly describe the construction of the exact second quantized solution of this model in terms of an appropriate reflection-transmission algebra. The basic physical properties of the solution, including the spacetime symmetry of the bulk scattering matrix, are also discussed. (letter to the editor)

  18. Inhomogeneous critical nonlinear Schroedinger equations with a harmonic potential

    International Nuclear Information System (INIS)

    Cao Daomin; Han Pigong

    2010-01-01

    In this paper, we study the Cauchy problem of the inhomogeneous nonlinear Schroedinger equation with a harmonic potential: i∂ t u=-div(f(x)∇u)+|x| 2 u-k(x)|u| 4/N u, x is an element of R N , N≥1, which models the remarkable Bose-Einstein condensation. We discuss the existence and nonexistence results and investigate the limiting profile of blow-up solutions with critical mass.

  19. Schroedinger propagation of initial discontinuities leads to divergence of moments

    International Nuclear Information System (INIS)

    Marchewka, A.; Schuss, Z.

    2009-01-01

    We show that the large phase expansion of the Schroedinger propagation of an initially discontinuous wave function leads to the divergence of average energy, momentum, and displacement, rendering them unphysical states. If initially discontinuous wave functions are considered to be approximations to continuous ones, the determinant of the spreading rate of these averages is the maximal gradient of the initial wave function. Therefore a dilemma arises between the inclusion of discontinuous wave functions in quantum mechanics and the requirement of finite moments.

  20. Schroedinger propagation of initial discontinuities leads to divergence of moments

    Energy Technology Data Exchange (ETDEWEB)

    Marchewka, A., E-mail: avi.marchewka@gmail.co [Ruppin Academic Center, Emek-Hefer 40250 (Israel); Schuss, Z., E-mail: schuss@post.tau.ac.i [Department of Mathematics, Tel-Aviv University, Ramat-Aviv, 69978 Tel-Aviv (Israel)

    2009-09-21

    We show that the large phase expansion of the Schroedinger propagation of an initially discontinuous wave function leads to the divergence of average energy, momentum, and displacement, rendering them unphysical states. If initially discontinuous wave functions are considered to be approximations to continuous ones, the determinant of the spreading rate of these averages is the maximal gradient of the initial wave function. Therefore a dilemma arises between the inclusion of discontinuous wave functions in quantum mechanics and the requirement of finite moments.

  1. The Schroedinger's paradox and the tranformation of quantum systems

    International Nuclear Information System (INIS)

    Bitsakis, E.I.

    1980-01-01

    The Schroedinger's paradox is analysed, as an illustration of certain weaknesses of the Copenhagen's interpretation of quantum mechanics and of the limits of the quantum-mechanical description of phenomena. A realistic approach of the paradox indicates the necessity of a theory that would permit not only the calculation of probabilities, but also the description of physical processes, as taking place in space and time

  2. Iteration of some discretizations of the nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Ross, K.A.; Thompson, C.J.

    1986-01-01

    We consider several discretizations of the nonlinear Schroedinger equation which lead naturally to the study of some symmetric difference equations of the form PHIsub(n+1) + PHIsub(n-1) = f(PHIsub(n)). We find a variety of interesting and exotic behaviour from simple closed orbits to intricate patterns of orbits and loops in the (PHIsub(n+1),PHIsub(n)) phase-plane. Some analytical results for a special case are also presented. (orig.)

  3. Integrability in the theory of Schroedinger operator and harmonic analysis

    International Nuclear Information System (INIS)

    Chalykh, O.A.; Veselov, A.P.

    1993-01-01

    The algebraic integrability for the Schroedinger equation in R n and the role of the quantum Calogero-Sutherland problem and root systems in this context are discussed. For the special values of the parameters in the potential the explicit formula for the eigenfunction of the corresponding Sutherland operator is found. As an application the explicit formula for the zonal spherical functions on the symmetric spaces SU 2 * n /Sp n (type A II in Cartan notations) is presented. (orig.)

  4. Improved Rosen's conditions on bound states of Schroedinger operators

    International Nuclear Information System (INIS)

    Exner, P.

    1984-01-01

    We derive a necessary condition on a Schroedinger operator H=-Δ+V on Lsup(2)(Rsup(d)), d>=3 to have a bound state below a given energy epsilon, and a lower bound to the ground-state energy of H. These conditions are expressed in terms of the potential V alone, and generalize the recent results of Rosen to the dimensions d>3 and to the potentials that are not necessarily rapidly decreasing. Some examples are given

  5. Quantum field theory in flat Robertson-Walker space-time functional Schroedinger picture

    International Nuclear Information System (INIS)

    Pi, S.Y.

    1989-01-01

    Quantum field theory in Robertson-Walker space-time is intrinsically time-dependent and the functional Schroedinger picture provides a useful description. We discuss free and self-interacting bosonic quantum field theories: Schroedinger picture quantization, time-dependent Gaussian approximations based on variational principles describing time evolution of pure and mixed states, and renormalizability of the Schroedinger picture. The techniques introduced can be used to study various dynamical questions in early universe processes. (author)

  6. Erwin Schroedinger and the rise of wave mechanics. I. Schroedinger's scientific work before the creation of wave mechanics

    International Nuclear Information System (INIS)

    Mehra, J.

    1987-01-01

    This paper, the first part of a three-part article, gives an account of Erwin Schroedinger's growing up and studies in Vienna, his scientific work--first in Vienna from 1911 to 1920, then in Zurich from 1920 to 1925--on the dielectric properties of matter, atmospheric electricity and radioactivity, general relativity, color theory and physiological optics, and on kinetic theory and statistical mechanics

  7. Francis Bacon and the Historiography of Scientific Rhetoric.

    Science.gov (United States)

    Zappen, James P.

    1989-01-01

    Reviews three twentieth-century interpretations of Francis Bacon's science and rhetoric: positivistic science and the plain style; institutionalized science and its more highly figured style; and democratic science. Presents the author's own interpretation, and concludes that each interpretation reflects different perceptions of the good of the…

  8. Scientific Cousins: The Relationship between Charles Darwin and Francis Galton

    Science.gov (United States)

    Fancher, Raymond E.

    2009-01-01

    This article traces the personal as well as the intellectual and scientific relationship between Charles Darwin and his younger half-cousin Francis Galton. Although they had been on friendly terms as young men, and Darwin had in some ways been a role model for Galton, the two did not share major scientific interests until after the publication of…

  9. Master equation and runaway speed of the Francis turbine

    Science.gov (United States)

    Zhang, Zh.

    2018-04-01

    The master equation of the Francis turbine is derived based on the combination of the angular momentum (Euler) and the energy laws. It relates the geometrical design of the impeller and the regulation settings (guide vane angle and rotational speed) to the discharge and the power output. The master equation, thus, enables the complete characteristics of a given Francis turbine to be easily computed. While applying the energy law, both the shock loss at the impeller inlet and the swirling loss at the impeller exit are taken into account. These are main losses which occur at both the partial load and the overloads and, thus, dominantly influence the characteristics of the Francis turbine. They also totally govern the discharge of the water through the impeller when the impeller is found in the standstill. The computations have been performed for the discharge, the hydraulic torque and the hydraulic efficiency. They were also compared with the available measurements on a model turbine. Excellent agreement has been achieved. The computations also enable the runaway speed of the Francis turbine and the related discharge to be determined as a function of the setting angle of the guide vanes.

  10. Sunrayce 97 Continues Day 7 - Smith Center to St. Francis

    Science.gov (United States)

    Manager (202) 586-0713 St. Francis, Kan. -- It was a close race for the top three places on the 7th day of running great. It's a solid car. We may not have the fastest or most efficient vehicle in the race, but we withdraw from the race yesterday due to suspension problems. The team was presented an "Inspector's

  11. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  12. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  13. Major historical developments in the design of water wheels and Francis hydroturbines

    International Nuclear Information System (INIS)

    Lewis, B J; Cimbala, J M; Wouden, A M

    2014-01-01

    The first record of water wheels dates back to ancient Greece. Over the next several centuries the technology spread all over the world. The process of arriving at the design of the modern Francis runner lasted from 1848 to approximately 1920. Though the modern Francis runner has little resemblance to the original turbines designed by James B. Francis in 1848, it became know as the Francis turbine around 1920, in honor of his many contributions to hydraulic engineering analysis and design. The modern Francis turbine is the most widely used turbine design today, particularly for medium head and large flow rate situations, and can achieve over 95% efficiency

  14. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  15. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  16. An introduction to the self-adjointness and spectral analysis of Schroedinger operators

    International Nuclear Information System (INIS)

    Simon, B.

    1977-01-01

    The author first explains the basic results about self adjointness, from a point of view which emphasizes the connection with solvability of the Schroedinger equation. He then describes four methods that define self ajoint Hamiltonians, for most Schroedinger operators and discusses types of spectra, closing by considering the essential spectrum in the two body case. (P.D.)

  17. The frictional Schroedinger-Newton equation in models of wave function collapse

    Energy Technology Data Exchange (ETDEWEB)

    Diosi, Lajos [Research Institute for Particle and Nuclear Physics, H-1525 Budapest 114, PO Box 49 (Hungary)

    2007-05-15

    Replacing the Newtonian coupling G by -iG, the Schroedinger--Newton equation becomes {sup f}rictional{sup .} Instead of the reversible Schroedinger-Newton equation, we advocate its frictional version to generate the set of pointer states for macroscopic quantum bodies.

  18. On the solution of the Schroedinger equation through continued fractions

    International Nuclear Information System (INIS)

    Mignaco, J.A.

    1979-05-01

    The domain of interest for the applications of a method to solve the Schroedinger equation through continued fractions is studied. It is argued that the method applies almost equally well to quantum mechanical regimes (lower energy levels, low energy scattering) as well as to semiclassical ones simultaneously; this is illustrated by the example of the central power law potentials r sup(ν)(ν>o). The explanation of this behaviour is given in terms of the mathematical approximations involved and its relationship to physically interesting quantities. (Author) [pt

  19. Schroedinger operators with Rudin-Shapiro potentials are not palindromic

    International Nuclear Information System (INIS)

    Allouche, J.

    1997-01-01

    We prove a conjecture of A. Hof, O. Knill and B. Simon [Commun. Math. Phys. 174, 149 endash 159 (1995)] by showing that the Rudin-Shapiro sequence is not palindromic, i.e., does not contain arbitrarily long palindromes. We prove actually this property for all paperfolding sequences and all Rudin-Shapiro sequences deduced from paperfolding sequences. As a consequence and as guessed by the above authors, their method cannot be used for establishing that discrete Schroedinger operators with Rudin-Shapiro potentials have a purely singular continuous spectrum. copyright 1997 American Institute of Physics

  20. On quantization, the generalised Schroedinger equation and classical mechanics

    International Nuclear Information System (INIS)

    Jones, K.R.W.

    1991-01-01

    A ψ-dependent linear functional operator, was defined, which solves the problem of quantization in non-relativistic quantum mechanics. Weyl ordering is implemented automatically and permits derivation of many of the quantum to classical correspondences. The parameter λ presents a natural C ∞ deformation of the dynamical structure of quantum mechanics via a non-linear integro-differential 'Generalised Schroedinger Equation', admitting an infinite family of soliton solutions. All these solutions are presented and it is shown that this equation gives an exact dynamic and energetic reproduction of classical mechanics with the correct measurement theoretic limit. 23 refs

  1. Numerical solution of the Schroedinger equation with a polynomial potential

    International Nuclear Information System (INIS)

    Campoy, G.; Palma, A.

    1986-01-01

    A numerical method for solving the Schroedinger equation for a potential expressed as a polynomial is proposed. The basic assumption relies on the asymptotic properties of the solution of this equation. It is possible to obtain the energies and the stationary state functions simultaneously. They analyze, in particular, the cases of the quartic anharmonic oscillator and a hydrogen atom perturbed by a quadratic term, obtaining its energy eigenvalues for some values of the perturbation parameter. Together with the Hellmann-Feynman theorem, they use their algorithm to calculate expectation values of x'' for arbitrary positive values of n. 4 tables

  2. Connection between Dirac and matrix Schroedinger inverse-scattering transforms

    International Nuclear Information System (INIS)

    Jaulent, M.; Leon, J.J.P.

    1978-01-01

    The connection between two applications of the inverse scattering method for solving nonlinear equations is established. The inverse method associated with the massive Dirac system (D) : (iσ 3 d/dx - i q 3 σ 1 - q 1 σ 2 + mσ 2 )Y = epsilonY is rediscovered from the inverse method associated with the 2 x 2 matrix Schroedinger equation (S) : Ysub(xx) + (k 2 -Q)Y = 0. Here Q obeys a nonlinear constraint equivalent to a linear constraint on the reflection coefficient for (S). (author)

  3. Perturbative approach to non-Markovian stochastic Schroedinger equations

    International Nuclear Information System (INIS)

    Gambetta, Jay; Wiseman, H.M.

    2002-01-01

    In this paper we present a perturbative procedure that allows one to numerically solve diffusive non-Markovian stochastic Schroedinger equations, for a wide range of memory functions. To illustrate this procedure numerical results are presented for a classically driven two-level atom immersed in an environment with a simple memory function. It is observed that as the order of the perturbation is increased the numerical results for the ensemble average state ρ red (t) approach the exact reduced state found via Imamog-barlu ' s enlarged system method [Phys. Rev. A 50, 3650 (1994)

  4. Properties of some nonlinear Schroedinger equations motivated through information theory

    International Nuclear Information System (INIS)

    Yuan, Liew Ding; Parwani, Rajesh R

    2009-01-01

    We update our understanding of nonlinear Schroedinger equations motivated through information theory. In particular we show that a q-deformation of the basic nonlinear equation leads to a perturbative increase in the energy of a system, thus favouring the simplest q = 1 case. Furthermore the energy minimisation criterion is shown to be equivalent, at leading order, to an uncertainty maximisation argument. The special value η = 1/4 for the interpolation parameter, where leading order energy shifts vanish, implies the preservation of existing supersymmetry in nonlinearised supersymmetric quantum mechanics. Physically, η might be encoding relativistic effects.

  5. The gradient flow coupling in the Schroedinger functional

    International Nuclear Information System (INIS)

    Fritzsch, Patrick; Ramos, Alberto

    2013-01-01

    We study the perturbative behavior of the Yang-Mills gradient flow in the Schroedinger Functional, both in the continuum and on the lattice. The energy density of the flow field is used to define a running coupling at a scale given by the size of the finite volume box. From our perturbative computation we estimate the size of cutoff effects of this coupling to leading order in perturbation theory. On a set of N f =2 gauge field ensembles in a physical volume of L∝0.4 fm we finally demonstrate the suitability of the coupling for a precise continuum limit due to modest cutoff effects and high statistical precision.

  6. A new method for the solution of the Schroedinger equation

    International Nuclear Information System (INIS)

    Amore, Paolo; Aranda, Alfredo; De Pace, Arturo

    2004-01-01

    We present a new method for the solution of the Schroedinger equation applicable to problems of a non-perturbative nature. The method works by identifying three different scales in the problem, which then are treated independently: an asymptotic scale, which depends uniquely on the form of the potential at large distances; an intermediate scale, still characterized by an exponential decay of the wavefunction; and, finally, a short distance scale, in which the wavefunction is sizable. The notion of optimized perturbation is then used in the last two regimes. We apply the method to the quantum anharmonic oscillator and find it suitable to treat both energy eigenvalues and wavefunctions, even for strong couplings

  7. Localization for random Schroedinger operators with correlated potentials

    Energy Technology Data Exchange (ETDEWEB)

    Von Dreifus, H [Princeton Univ., NJ (USA). Dept. of Physics; Klein, A [California Univ., Irvine (USA). Dept. of Mathematics

    1991-08-01

    We prove localization at high disorder or low energy for lattice Schroedinger operators with random potentials whose values at different lattice sites are correlated over large distances. The class of admissible random potentials for our multiscale analysis includes potentials with a stationary Gaussian distribution whose covariance function C(x,y) decays as vertical strokex-yvertical stroke{sup -{theta}}, where {theta}>0 can be arbitrarily small, and potentials whose probability distribution is a completely analytical Gibbs measure. The result for Gaussian potentials depends on a multivariable form of Nelson's best possible hypercontractive estimate. (orig.).

  8. Schroedinger invariant solutions of type IIB with enhanced supersymmetry

    Energy Technology Data Exchange (ETDEWEB)

    Donos, Aristomenis [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gauntlett, Jerome P. [Imperial College, London (United Kingdom). Theoretical Physics Group; Imperial College, London (United Kingdom). Inst. for Mathematical Sciences

    2009-07-15

    We construct the Killing spinors for a class of supersymmetric solutions of type IIB supergravity that are invariant under the non-relativistic Schroedinger algebra. The solutions depend on a five-dimensional Sasaki- Einstein space and it has been shown that they admit two Killing spinors. Here we will show that, for generic Sasaki-Einstein space, there are special subclasses of solutions which admit six Killing spinors and we determine the corresponding superisometry algebra. We also show that for the special case that the Sasaki-Einstein space is the round five-sphere, the number of Killing spinors can be increased to twelve. (orig.)

  9. Numerical stochastic perturbation theory in the Schroedinger functional

    International Nuclear Information System (INIS)

    Brambilla, Michele; Di Renzo, Francesco; Hesse, Dirk; Dalla Brida, Mattia; Sint, Stefan; Deutsches Elektronen-Synchrotron

    2013-11-01

    The Schroedinger functional (SF) is a powerful and widely used tool for the treatment of a variety of problems in renormalization and related areas. Albeit offering many conceptual advantages, one major downside of the SF scheme is the fact that perturbative calculations quickly become cumbersome with the inclusion of higher orders in the gauge coupling and hence the use of an automated perturbation theory framework is desirable. We present the implementation of the SF in numerical stochastic perturbation theory (NSPT) and compare first results for the running coupling at two loops in pure SU(3) Yang-Mills theory with the literature.

  10. Philosophical and methodological aspects of the Schroedinger paradox

    International Nuclear Information System (INIS)

    Juha, L.; Krajca, R.; Smatera, M.

    1989-01-01

    Methodological aspects of the foundations of quantum theory are dealt with in relation to the quantum description of macroscopic systems, biological in particular. Attention is paid to the philosophical content of the problems of 1) the logical status of the reduction postulate in quantum mechanics, and 2) the paradox of Schroedinger's cat, whose physical solution has not yet been attained. The problem of the quantum description of complex macroscopic systems is also treated, as is Herbert Froehlich's important concept of the excitation of dominant modes in biological systems. (author). 61 refs

  11. Equivalence of two alternative approaches to Schroedinger equations

    International Nuclear Information System (INIS)

    Goenuel, B; Koeksal, K

    2006-01-01

    A recently developed simple approach for the exact/approximate solution of Schroedinger equations with constant/position-dependent mass, in which the potential is considered as in the perturbation theory, is shown to be equivalent to the one leading to the construction of exactly solvable potentials via the solution of second-order differential equations in terms of known special functions. The formalism in the former solves difficulties encountered in the latter in revealing the corrections explicitly to the unperturbed piece of the solutions whereas the other obviates cumbersome procedures used in the calculations of the former

  12. Travelling solitons in the damped driven nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Barashenkov, I.V.; Zemlyanaya, E.V.

    2003-01-01

    The well known effect of the linear damping on the moving nonlinear Schroedinger soliton (even when there is energy supply via the spatially homogeneous driving) is to quench its momentum to zero. Surprisingly, the zero momentum does not necessarily mean zero velocity. We show that two or more parametrically driven damped solitons can form a complex travelling with zero momentum at a nonzero constant speed. All travelling complexes we have found so far, turned out to be unstable. Thus, the parametric driving is capable of sustaining the uniform motion of damped solitons, but some additional agent is required to make this motion stable

  13. Numerical stochastic perturbation theory in the Schroedinger functional

    Energy Technology Data Exchange (ETDEWEB)

    Brambilla, Michele; Di Renzo, Francesco; Hesse, Dirk [Parma Univ. (Italy); INFN, Parma (Italy); Dalla Brida, Mattia [Trinity College Dublin (Ireland). School of Mathematics; Sint, Stefan [Trinity College Dublin (Ireland). School of Mathematics; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2013-11-15

    The Schroedinger functional (SF) is a powerful and widely used tool for the treatment of a variety of problems in renormalization and related areas. Albeit offering many conceptual advantages, one major downside of the SF scheme is the fact that perturbative calculations quickly become cumbersome with the inclusion of higher orders in the gauge coupling and hence the use of an automated perturbation theory framework is desirable. We present the implementation of the SF in numerical stochastic perturbation theory (NSPT) and compare first results for the running coupling at two loops in pure SU(3) Yang-Mills theory with the literature.

  14. Integrability of a system of two nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Zhukhunashvili, V.Z.

    1989-01-01

    In recent years the inverse scattering method has achieved significant successes in the integration of nonlinear models that arise in different branches of physics. However, its region of applicability is still restricted, i.e., not all nonlinear models can be integrated. In view of the great mathematical difficulties that arise in integration, it is clearly worth testing a model for integrability before turning to integration. Such a possibility is provided by the Zakharov-Schulman method. The question of the integrability of a system of two nonlinear Schroedinger equations is resolved. It is shown that the previously known cases exhaust all integrable variants

  15. Quantum gravitational corrections to the functional Schroedinger equation

    International Nuclear Information System (INIS)

    Kiefer, C.; Singh, T.P.

    1990-10-01

    We derive corrections to the Schroedinger equation which arise from the quantization of the gravitational field. This is achieved through an expansion of the full functional Wheeler-DeWitt equation with respect to powers of the Planck mass. We demonstrate that the corrections terms are independent of the factor ordering which is chosen for the gravitational kinetic term. Although the corrections are numerically extremely tiny, we show how they lead, at least in principle, to shift in the spectral lines of hydrogen type atoms. We discuss the significance of these corrections for quantum field theory near the Planck scale. (author). 35 refs

  16. Stochastic optimal control, forward-backward stochastic differential equations and the Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Paul, Wolfgang; Koeppe, Jeanette [Institut fuer Physik, Martin Luther Universitaet, 06099 Halle (Germany); Grecksch, Wilfried [Institut fuer Mathematik, Martin Luther Universitaet, 06099 Halle (Germany)

    2016-07-01

    The standard approach to solve a non-relativistic quantum problem is through analytical or numerical solution of the Schroedinger equation. We show a way to go around it. This way is based on the derivation of the Schroedinger equation from conservative diffusion processes and the establishment of (several) stochastic variational principles leading to the Schroedinger equation under the assumption of a kinematics described by Nelson's diffusion processes. Mathematically, the variational principle can be considered as a stochastic optimal control problem linked to the forward-backward stochastic differential equations of Nelson's stochastic mechanics. The Hamilton-Jacobi-Bellmann equation of this control problem is the Schroedinger equation. We present the mathematical background and how to turn it into a numerical scheme for analyzing a quantum system without using the Schroedinger equation and exemplify the approach for a simple 1d problem.

  17. Chern--Simons theory in the Schroedinger representation

    International Nuclear Information System (INIS)

    Dunne, G.V.; Jackiw, R.; Trugenberger, C.A.

    1989-01-01

    We quantize the (2+1)-dimensional Chern--Simons theory in the functional Schroedinger representation. The realization of gauge transformations on states involves a 1-cocycle. We determine this cocycle; we show how solving the Gauss law constraint in the non-Abelian theory requires quantizing the parameter that normalizes the action; we trivialize the 1-cocycle with a spatially non-local cochain related to a 2-dimensional fermion determinant and we find the physical states that satisfy the Gauss law constraint. The quantum holonomy of physical states involves a contribution that is missed when the constraint is solved before quantization. We compute this quantity for the Abelian theory in Minkowski space, where it exhibits an interesting group theoretic structure. (In a note added in proof the corresponding non-Abelian computation is presented.) Also we consider coupling to external sources and offer yet another derivation of the anomalous statistics and spin of the charge and flux carrying particles---a calculation which is especially simple in the functional Schroedinger representation. copyright 1989 Academic Press, Inc

  18. Nonrelativistic Schroedinger equation in quasi-classical theory

    International Nuclear Information System (INIS)

    Wignall, J.W.G.

    1987-01-01

    The author has recently proposed a quasi-classical theory of particles and interactions in which particles are pictured as extended periodic disturbances in a universal field chi(x,t), interacting with each other via nonlinearity in the equation of motion for chi. The present paper explores the relationship of this theory to nonrelativistic quantum mechanics; as a first step, it is shown how it is possible to construct from chi a configuration-space wave function Psi(x 1 , X 2 , t), and that the theory requires that Psi satisfy the two-particle Schroedinger equation in the case where the two particles are well separated from each other. This suggests that the multiparticle Schroedinger equation can be obtained as a direct consequence of the quasi-classical theory without any use of the usual formalism (Hilbert space, quantization rules, etc.) of conventional quantum theory and in particular without using the classical canonical treatment of a system as a crutch theory which has subsequently to be quantized. The quasi-classical theory also suggests the existence of a preferred absolute gauge for the electromagnetic potentials

  19. Inverse Schroedinger equation and the exact wave function

    International Nuclear Information System (INIS)

    Nakatsuji, Hiroshi

    2002-01-01

    Using the inverse of the Hamiltonian, we introduce the inverse Schroedinger equation (ISE) that is equivalent to the ordinary Schroedinger equation (SE). The ISE has the variational principle and the H-square group of equations as the SE has. When we use a positive Hamiltonian, shifting the energy origin, the inverse energy becomes monotonic and we further have the inverse Ritz variational principle and cross-H-square equations. The concepts of the SE and the ISE are combined to generalize the theory for calculating the exact wave function that is a common eigenfunction of the SE and ISE. The Krylov sequence is extended to include the inverse Hamiltonian, and the complete Krylov sequence is introduced. The iterative configuration interaction (ICI) theory is generalized to cover both the SE and ISE concepts and four different computational methods of calculating the exact wave function are presented in both analytical and matrix representations. The exact wave-function theory based on the inverse Hamiltonian can be applied to systems that have singularities in the Hamiltonian. The generalized ICI theory is applied to the hydrogen atom, giving the exact solution without any singularity problem

  20. On the Schroedinger representation of the Euclidean quantum field theory

    International Nuclear Information System (INIS)

    Semmler, U.

    1987-04-01

    The theme of the present thesis is the Schroedinger representation of the Euclidean quantum field theory: We define the time development of the quantum field states as functional integral in a novel, mathematically precise way. In the following we discuss the consequences which result from this approach to the Euclidean quantum field theory. Chapter 1 introduces the theory of abstract Wiener spaces which is here proved as suitable mathematical tool for the treatment of the physical problems. In chapter 2 the diffusion theory is formulated in the framework of abstract Wiener spaces. In chapter 3 we define the field functional ψ 5 u, t 7 as functional integral, determine the functional differential equation which ψ satisfies (Schroedinger equation), and summarize the consequences resulting from this. Chapter 4 is dedicated to the attempt to determine the kernel of the time-development operator, by the knowledge of which the time development of each initial state is fixed. In chapter 5 the consequences of the theory presented in chapter 3 and 4 are discussed by means of simple examples. In chapter 6 the renormalization which results for the φ 4 potential from the definition of the functional integral in chapter 3 is calculated up to the first-order perturbation theory, and it is shown that the problems in the Symanzik renormalization procedure can be removed. (orig./HSI) [de

  1. Francis Bacon: The Real's Brutality. The Figure and the Other

    Directory of Open Access Journals (Sweden)

    Guido Mannucci

    2014-03-01

    Full Text Available Getting in front of painting by Francis Bacon touches you deeply. I’m talking about aesthetics, sensations: resounding flow that strikes abruptly, making futile any search for meaning. Francis Bacon circumvents the figurative, the meaning, he aims to the figural: to feelings, not words. Beauty, in his paintings, shows itself in the peaceful union of the positive and of its contrary; if the negative wasn’t there, though, his paintings wouldn’t exude such a brutal sense of reality. This essay investigates the figure of Francis Bacon and the spectator – the Other – as he tries to confront the painting. Bacon will be analysed using a purely phenomenological approach, with references that range from Merleau-Ponty to Martin Heidegger; the meeting-collision between the spectator and the painting, instead, will be examined taking inspiration from the Winnicott’s thesis on the relationship between Bacon and mirrors in the painter’s childhood. In order to take distance from Winnicott’s psychoanalytical approach, this essay will focus on the relationship between spectator and painting from a more anthropological point of view. 

  2. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  3. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  4. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  5. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  6. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  7. A global numerical solution of the radial Schroedinger equation by second-order perturbation theory

    International Nuclear Information System (INIS)

    Adam, G.

    1979-01-01

    A global numerical method, which uses second-order perturbation theory, is described for the solution of the radial Schroedinger equation. The perturbative numerical (PN) solution is derived in two stages: first, the original potential is approximated by a piecewise continuous parabolic function, and second, the resulting Schroedinger equation is solved on each integration step by second-order perturbation theory, starting with a step function reference approximation for the parabolic potential. We get a manageable PN algorithm, which shows an order of accuracy equal to six in the solution of the original Schroedinger equation, and is very stable against round off errors. (author)

  8. Soliton-like solutions to the ordinary Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Zamboni-Rached, Michel [Universidade Estadual de Campinas (DMO/FEEC/UNICAMP), Campinas, SP (Brazil). Fac. de Engenharia Eletrica e de Computacao. Dept. de Microondas e Optica; Recami, Erasmo, E-mail: recami@mi.infn.i [Universita Statale di Bergamo, Bergamo (Italy). Facolta di Ingegneria

    2011-07-01

    In recent times it has been paid attention to the fact that (linear) wave equations admit of soliton-like solutions, known as Localized Waves or Non-diffracting Waves, which propagate without distortion in one direction. Such Localized Solutions (existing also for K-G or Dirac equations) are a priori suitable, more than Gaussian's, for describing elementary particle motion. In this paper we show that, mutatis mutandis, Localized Solutions exist even for the ordinary Schroedinger equation within standard Quantum Mechanics; and we obtain both approximate and exact solutions, also setting forth for them particular examples. In the ideal case such solutions bear infinite energy, as well as plane or spherical waves: we show therefore how to obtain nite-energy solutions. At last, we briefly consider solutions for a particle moving in the presence of a potential. (author)

  9. Fractional integration, Morrey spaces and a Schroedinger equation

    International Nuclear Information System (INIS)

    Olsen, P.A.

    1995-01-01

    Let V : R 3 → R be the potential for the 3-dimensional Schroedinger operator -Δ + V. It was shown by Cwikel, Lieb and Rosenblum, [8], that the number of bound states, N(V), of -Δ + V is bounded by N(V) ≤ C ∫ R3 |V(x)| 3/2 dx. Later Fefferman and phong, [4], improved on this inequality. Make a dyadic decomposition of R 3 into cubes. Define a dyadic cube Q to be minimal with respect to ε > 0 if ∫ q |V(x)| p dx ≥ ε p |Q| 1-2p/3 and ∫ Q ' |V(x)| p dx p |Q'| 1-2p/3 for all dyadic cubes Q' contained-in Q. 10 refs., 4 figs., 1 tab

  10. The Schroedinger and Dirac free particle equations without quantum mechanics

    International Nuclear Information System (INIS)

    Ord, G.N.

    1996-01-01

    Einstein close-quote s theory of Brownian Movement has provided a well accepted microscopic model of diffusion for many years. Until recently the relationship between this model and Quantum Mechanics has been completely formal. Brownian motion provides a microscopic model for diffusion, but quantum mechanics and diffusion are related by a formal analytic continuation, so the relationship between Brownian motion and Quantum Mechanics has been correspondingly vague. Some recent work has changed this picture somewhat and here we show that a random walk model of Brownian motion produces the diffusion equation or the telegraph equations as a descriptions of particle densities, while at the same time the correlations in the space-time geometry of these same Brownian particles obey the Schroedinger and Dirac equations respectively. This is of interest because the equations of Quantum Mechanics appear here naturally in a classical context without the problems of interpretation they have in the usual context. copyright 1996 Academic Press, Inc

  11. Lower bounds for solutions of the Schroedinger equation

    International Nuclear Information System (INIS)

    Froese, R.G.

    1983-01-01

    For a large class of generalized N-body Hamiltonians H = -Δ + V the large absolute value x behavior of solutions to the Schroedinger equation H psi = H psi is studied. If E lies below the essential spectrum of H, then it is proved that lim R -1 log (absolute value psi/sub R/) = -α 0 R → infinity where absolute value psi/sub R/ 2 is the integral of absolute value psi 2 over a sphere of radius R and α 0 2 + E is a threshold or α 0 0. For E not necessarily below the essential spectrum of H, the same equation holds with absolute value psi/sub R/ 2 replaced by an integral of absolute value psi 2 over a spherical shell

  12. Soliton-like solutions to the ordinary Schroedinger equation

    International Nuclear Information System (INIS)

    Zamboni-Rached, Michel; Recami, Erasmo

    2011-01-01

    In recent times it has been paid attention to the fact that (linear) wave equations admit of soliton-like solutions, known as Localized Waves or Non-diffracting Waves, which propagate without distortion in one direction. Such Localized Solutions (existing also for K-G or Dirac equations) are a priori suitable, more than Gaussian's, for describing elementary particle motion. In this paper we show that, mutatis mutandis, Localized Solutions exist even for the ordinary Schroedinger equation within standard Quantum Mechanics; and we obtain both approximate and exact solutions, also setting forth for them particular examples. In the ideal case such solutions bear infinite energy, as well as plane or spherical waves: we show therefore how to obtain nite-energy solutions. At last, we briefly consider solutions for a particle moving in the presence of a potential. (author)

  13. Limited-diffraction solutions to Maxwell and Schroedinger equations

    International Nuclear Information System (INIS)

    Lu, Jian-yu; Greenleaf, J.F.

    1996-10-01

    The authors have developed a new family of limited diffraction electromagnetic X-shaped waves based on the scalar X-shaped waves discovered previously. These waves are diffraction-free in theory and particle-like (wave packets), in that they maintain their shape as they propagate to an infinite distance. The 'X waves' possess (theoretically) infinitely extended 'arms' and - at least, the ones studied in this paper - have an infinite total energy: therefore, they are not physically realizable. However, they can be truncated in both space and time and 'approximated' by means of a finite aperture radiator so to get a large enough depth of interest (depth of field). In addition to the Maxwell equations, X wave solutions to the free Schroedinger equation are also obtained. Possible applications of these new waves are discussed. Finally, the authors discuss the appearance of the X-shaped solutions from the purely geometric point of view of the special relativity theory

  14. The gradient flow coupling in the Schroedinger functional

    Energy Technology Data Exchange (ETDEWEB)

    Fritzsch, Patrick [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Ramos, Alberto [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC

    2013-01-15

    We study the perturbative behavior of the Yang-Mills gradient flow in the Schroedinger Functional, both in the continuum and on the lattice. The energy density of the flow field is used to define a running coupling at a scale given by the size of the finite volume box. From our perturbative computation we estimate the size of cutoff effects of this coupling to leading order in perturbation theory. On a set of N{sub f}=2 gauge field ensembles in a physical volume of L{proportional_to}0.4 fm we finally demonstrate the suitability of the coupling for a precise continuum limit due to modest cutoff effects and high statistical precision.

  15. Soliton interaction in the coupled mixed derivative nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Zhang Haiqiang; Tian Bo; Lue Xing; Li He; Meng Xianghua

    2009-01-01

    The bright one- and two-soliton solutions of the coupled mixed derivative nonlinear Schroedinger equations in birefringent optical fibers are obtained by using the Hirota's bilinear method. The investigation on the collision dynamics of the bright vector solitons shows that there exists complete or partial energy switching in this coupled model. Such parametric energy exchanges can be effectively controlled and quantificationally measured by analyzing the collision dynamics of the bright vector solitons. The influence of two types of nonlinear coefficient parameters on the energy of each vector soliton, is also discussed. Based on the significant energy transfer between the two components of each vector soliton, it is feasible to exploit the future applications in the design of logical gates, fiber directional couplers and quantum information processors.

  16. Extensions of the auxiliary field method to solve Schroedinger equations

    International Nuclear Information System (INIS)

    Silvestre-Brac, Bernard; Semay, Claude; Buisseret, Fabien

    2008-01-01

    It has recently been shown that the auxiliary field method is an interesting tool to compute approximate analytical solutions of the Schroedinger equation. This technique can generate the spectrum associated with an arbitrary potential V(r) starting from the analytically known spectrum of a particular potential P(r). In the present work, general important properties of the auxiliary field method are proved, such as scaling laws and independence of the results on the choice of P(r). The method is extended in order to find accurate analytical energy formulae for radial potentials of the form aP(r) + V(r), and several explicit examples are studied. Connections existing between the perturbation theory and the auxiliary field method are also discussed

  17. Extensions of the auxiliary field method to solve Schroedinger equations

    Energy Technology Data Exchange (ETDEWEB)

    Silvestre-Brac, Bernard [LPSC Universite Joseph Fourier, Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Avenue des Martyrs 53, F-38026 Grenoble-Cedex (France); Semay, Claude; Buisseret, Fabien [Groupe de Physique Nucleaire Theorique, Universite de Mons-Hainaut, Academie universitaire Wallonie-Bruxelles, Place du Parc 20, B-7000 Mons (Belgium)], E-mail: silvestre@lpsc.in2p3.fr, E-mail: claude.semay@umh.ac.be, E-mail: fabien.buisseret@umh.ac.be

    2008-10-24

    It has recently been shown that the auxiliary field method is an interesting tool to compute approximate analytical solutions of the Schroedinger equation. This technique can generate the spectrum associated with an arbitrary potential V(r) starting from the analytically known spectrum of a particular potential P(r). In the present work, general important properties of the auxiliary field method are proved, such as scaling laws and independence of the results on the choice of P(r). The method is extended in order to find accurate analytical energy formulae for radial potentials of the form aP(r) + V(r), and several explicit examples are studied. Connections existing between the perturbation theory and the auxiliary field method are also discussed.

  18. Bound states for non-symmetric evolution Schroedinger potentials

    Energy Technology Data Exchange (ETDEWEB)

    Corona, Gulmaro Corona [Area de Analisis Matematico y sus Aplicaciones, Universidad Autonoma Metropolitana-Azcapotalco, Atzcapotzalco, DF (Mexico)). E-mail: ccg@correo.azc.uam.mx

    2001-09-14

    We consider the spectral problem associated with the evolution Schroedinger equation, (D{sup 2}+ k{sup 2}){phi}=u{phi}, where u is a matrix-square-valued function, with entries in the Schwartz class defined on the real line. The solution {phi}, called the wavefunction, consists of a function of one real variable, matrix-square-valued with entries in the Schwartz class. This problem has been dealt for symmetric potentials u. We found for the present case that the bound states are localized similarly to the scalar and symmetric cases, but by the zeroes of an analytic matrix-valued function. If we add an extra condition to the potential u, we can determine these states by an analytic scalar function. We do this by generalizing the scalar and symmetric cases but without using the fact that the Wronskian of a pair of wavefunction is constant. (author)

  19. Nonlinear Schroedinger equation with U(p,q) isotopical group

    International Nuclear Information System (INIS)

    Makhankov, V.G.; Pashaev, O.K.

    1981-01-01

    The properties of the nonlinear Schroedinger equation (NLS) with U(1,1) isogroup are considered in detail. This example illustrates the essential difference between the system and the well-known ''vector'' NLS, i.e. the large set of allowed boundary conditions on the fields that leads to a rich set of solutions of the system. Four types of boundary conditions and related soliton solutions are considered. The Bohr-Sommerfeld quantization allows to interpret them in terms of ''drops'' and ''bubbles'' as bound states of a large number of constituent bosons subject to the thermodynamical relations for gas mixtures. The U(1,1) system under the vanishing boundary conditions may be considered as continuous analog of the Hubbard model and therefore the paper is concluded by studying the inverse scattering equations for this case [ru

  20. Collective states of externally driven, damped nonlinear Schroedinger solitons

    International Nuclear Information System (INIS)

    Barashenkov, I.V.; Smirnov, Yu.S.

    1997-01-01

    We study bifurcations of localized stationary solitons of the externally driven, damped nonlinear Schroedinger equation iΨ t + Ψ xx + 2|Ψ| 2 Ψ=-iγΨ-h e iΩt , in the region of large γ (γ>1/2). For each pair of h and γ, there are two coexisting solitons, Ψ + and Ψ - . As the driver's strength h increases for the fixed γ, the Ψ + soliton merges with the flat background while the Ψ - forms a stationary collective state with two 'psi-pluses': Ψ - → Ψ (+ - +) . We obtain other stationary solutions and identify them as multisoliton complexes Ψ (++) , Ψ (--) , Ψ (-+) , Ψ (---) , Ψ (-+- ) etc. The corresponding intersoliton separations are compared to predictions of a variational approximation

  1. Global spacetime symmetries in the functional Schroedinger picture

    International Nuclear Information System (INIS)

    Halliwell, J.J.

    1991-01-01

    In the conventional functional Schroedinger quantization of field theory, the background spacetime manifold is foliated into a set of three-surfaces and the quantum state of the field is represented by a wave functional of the field configurations on each three-surface. Although this procedure may be covariantly described, the wave functionals generally fail to carry a representation of the complete spacetime symmetry group of the background, such as the Poincare group in Minkowski spacetime, because spacetime symmetries generally involve distortions or motions of the three-surfaces themselves within that spacetime. In this paper, we show that global spacetime symmetries in the functional Schroedinger picture may be represented by parametrizing the field theory---raising to the status of dynamical variables the embedding variables describing the spacetime location of each three-surface. In particular, we show that the embedding variables provide a connection between the purely geometrical operation of an isometry group on the spacetime and the operation of the usual global symmetry generators (constructed from the energy-momentum tensor) on the wave functionals of the theory. We study the path-integral representation of the wave functionals of the parametrized field theory. We show how to construct, from the path integral, wave functionals that are annihilated by the global symmetry generators, i.e., that are invariant under global spacetime symmetry groups. The invariance of the class of histories summed over in the path integral is identified as the source of the invariance of the wave functionals. We apply this understanding to a study of vacuum states in the de Sitter spacetime. We make mathematically precise a previously given heuristic argument for the de Sitter invariance of the matter wave functionals defined by the no-boundary proposal of Hartle and Hawking

  2. Derivation of the Schroedinger equation from stochastic mechanics

    International Nuclear Information System (INIS)

    Wallstrom, T.C.

    1988-01-01

    The thesis is divided into four largely independent chapters. The first three chapters treat mathematical problems in the theory of stochastic mechanics. The fourth chapter deals with stochastic mechanisms as a physical theory and shows that the Schroedinger equation cannot be derived from existing formulations of stochastic mechanics, as had previously been believed. Since the drift coefficients of stochastic mechanical diffusions are undefined on the nodes, or zeros of the density, an important problem has been to show that the sample paths stay away from the nodes. In Chapter 1, it is shown that for a smooth wavefunction, the closest approach to the nodes can be bounded solely in terms of the time-integrated energy. The ergodic properties of stochastic mechanical diffusions are greatly complicated by the tendency of the particles to avoid the nodes. In Chapter 2, it is shown that a sufficient condition for a stationary process to be ergodic is that there exist positive t and c such that for all x and y, p t (x,y) > cp(y), and this result is applied to show that the set of spin-1/2 diffusions is uniformly ergodic. Nelson has conjectured that in the limit as the particle's moment of inertia I goes to zero, the projections of the Bopp-Haag-Dankel diffusions onto IR 3 converge to a Markovian limit process. This conjecture is proved for the spin-1/2 case in Chapter 3, and the limit process identified as the diffusion naturally associated with the solution to the regular Pauli equation. In Chapter 4 it is shown that the general solution of the stochastic Newton equation does not correspond to a solution of the Schroedinger equation

  3. The chirally rotated Schroedinger functional. Theoretical expectations and perturbative tests

    International Nuclear Information System (INIS)

    Dalla Brida, Mattia

    2016-03-01

    The chirally rotated Schroedinger functional (χSF) with massless Wilson-type fermions provides an alternative lattice regularization of the Schroedinger functional (SF), with different lattice symmetries and a common continuum limit expected from universality. The explicit breaking of flavour and parity symmetries needs to be repaired by tuning the bare fermion mass and the coefficient of a dimension 3 boundary counterterm. Once this is achieved one expects the mechanism of automatic O(a) improvement to be operational in the χSF, in contrast to the standard formulation of the SF. This is expected to significantly improve the attainable precision for step-scaling functions of some composite operators. Furthermore, the χSF offers new strategies to determine finite renormalization constants which are traditionally obtained from chiral Ward identities. In this paper we consider a complete set of fermion bilinear operators, define corresponding correlation functions and explain the relation to their standard SF counterparts. We discuss renormalization and O(a) improvement and then use this set-up to formulate the theoretical expectations which follow from universality. Expanding the correlation functions to one-loop order of perturbation theory we then perform a number of non-trivial checks. In the process we obtain the action counterterm coefficients to one-loop order and reproduce some known perturbative results for renormalization constants of fermion bilinears. By confirming the theoretical expectations, this perturbative study lends further support to the soundness of the χSF framework and prepares the ground for non-perturbative applications.

  4. The Schroedinger functional for Gross-Neveu models

    International Nuclear Information System (INIS)

    Leder, B.

    2007-01-01

    Gross-Neveu type models with a finite number of fermion flavours are studied on a two-dimensional Euclidean space-time lattice. The models are asymptotically free and are invariant under a chiral symmetry. These similarities to QCD make them perfect benchmark systems for fermion actions used in large scale lattice QCD computations. The Schroedinger functional for the Gross-Neveu models is defined for both, Wilson and Ginsparg-Wilson fermions, and shown to be renormalisable in 1-loop lattice perturbation theory. In two dimensions four fermion interactions of the Gross-Neveu models have dimensionless coupling constants. The symmetry properties of the four fermion interaction terms and the relations among them are discussed. For Wilson fermions chiral symmetry is explicitly broken and additional terms must be included in the action. Chiral symmetry is restored up to cut-off effects by tuning the bare mass and one of the couplings. The critical mass and the symmetry restoring coupling are computed to second order in lattice perturbation theory. This result is used in the 1-loop computation of the renormalised couplings and the associated beta-functions. The renormalised couplings are defined in terms of suitable boundary-to-boundary correlation functions. In the computation the known first order coefficients of the beta-functions are reproduced. One of the couplings is found to have a vanishing betafunction. The calculation is repeated for the recently proposed Schroedinger functional with exact chiral symmetry, i.e. Ginsparg-Wilson fermions. The renormalisation pattern is found to be the same as in the Wilson case. Using the regularisation dependent finite part of the renormalised couplings, the ratio of the Lambda-parameters is computed. (orig.)

  5. Cost of enlarged operating zone for an existing Francis runner

    Science.gov (United States)

    Monette, Christine; Marmont, Hugues; Chamberland-Lauzon, Joël; Skagerstrand, Anders; Coutu, André; Carlevi, Jens

    2016-11-01

    Traditionally, hydro power plants have been operated close to best efficiency point, the more stable operating condition for which they have been designed. However, because of changes in the electricity market, many hydro power plants operators wish to operate their machines differently to fulfil those new market needs. New operating conditions can include whole range operation, many start/stops, extensive low load operation, synchronous condenser mode and power/frequency regulation. Many of these new operating conditions may impose more severe fatigue damage than the traditional base load operation close to best efficiency point. Under these conditions, the fatigue life of the runner may be significantly reduced and reparation or replacement cost might occur sooner than expected. In order to design reliable Francis runners for those new challenging operating scenarios, Andritz Hydro has developed various proprietary tools and design rules. These are used within Andritz Hydro to design mechanically robust Francis runners for the operating scenarios fulfilling customer's specifications. To estimate residual life under different operating scenarios of an existing runner designed years ago for best efficiency base load operation, Andritz Hydro's design rules and tools would necessarily lead to conservative results. While the geometry of a new runner can be modified to fulfil all conservative mechanical design rules, the predicted fatigue life of an existing runner under off-design operating conditions may appear rather short because of the conservative safety factor included in the calculations. The most precise and reliable way to calculate residual life of an existing runner under different operating scenarios is to perform a strain gauge measurement campaign on the runner. This paper presents the runner strain gage measurement campaign of a mid-head Francis turbine over all the operating conditions available during the test, the analysis of the measurement signals

  6. Design of large Francis turbine using optimal methods

    Science.gov (United States)

    Flores, E.; Bornard, L.; Tomas, L.; Liu, J.; Couston, M.

    2012-11-01

    Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China -32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.

  7. Design of large Francis turbine using optimal methods

    International Nuclear Information System (INIS)

    Flores, E; Bornard, L; Tomas, L; Couston, M; Liu, J

    2012-01-01

    Among a high number of Francis turbine references all over the world, covering the whole market range of heads, Alstom has especially been involved in the development and equipment of the largest power plants in the world : Three Gorges (China −32×767 MW - 61 to 113 m), Itaipu (Brazil- 20x750 MW - 98.7m to 127m) and Xiangjiaba (China - 8x812 MW - 82.5m to 113.6m - in erection). Many new projects are under study to equip new power plants with Francis turbines in order to answer an increasing demand of renewable energy. In this context, Alstom Hydro is carrying out many developments to answer those needs, especially for jumbo units such the planned 1GW type units in China. The turbine design for such units requires specific care by using the state of the art in computation methods and the latest technologies in model testing as well as the maximum feedback from operation of Jumbo plants already in operation. We present in this paper how a large Francis turbine can be designed using specific design methods, including the global and local optimization methods. The design of the spiral case, the tandem cascade profiles, the runner and the draft tube are designed with optimization loops involving a blade design tool, an automatic meshing software and a Navier-Stokes solver, piloted by a genetic algorithm. These automated optimization methods, presented in different papers over the last decade, are nowadays widely used, thanks to the growing computation capacity of the HPC clusters: the intensive use of such optimization methods at the turbine design stage allows to reach very high level of performances, while the hydraulic flow characteristics are carefully studied over the whole water passage to avoid any unexpected hydraulic phenomena.

  8. Transient CFD simulation of a Francis turbine startup

    International Nuclear Information System (INIS)

    Nicolle, J; Morissette, J F; Giroux, A M

    2012-01-01

    To assess the life expectancy of hydraulic turbines, it is essential to obtain the loading on the blades, especially during transient operations known to be the most damaging. This paper presents a simplified CFD setup to model the startup phase of a Francis turbine while it goes from rest to speed no-load condition. The fluid domain included one distributor sector coupled with one runner passage. The guide vane motion and change in the angular velocity were included in a commercial code with user functions. Comparisons between numerical results and measurements acquired on a full-size turbine showed that most of the flow physics occurring during startup were captured.

  9. A relation connecting scale transformation, Galilean transformation and Baecklund transformation for the nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Steudel, H.

    1980-01-01

    It is shown that the two-parameter manifold of Baecklund transformations known for the nonlinear Schroedinger equation can be generated from one Baecklund transformation with specified parameters by use of scale transformation and Galilean transformation. (orig.)

  10. On symmetry reduction and exact solutions of the linear one-dimensional Schroedinger equation

    International Nuclear Information System (INIS)

    Barannik, L.L.

    1996-01-01

    Symmetry reduction of the Schroedinger equation with potential is carried out on subalgebras of the Lie algebra which is the direct sum of the special Galilei algebra and one-dimensional algebra. Some new exact solutions are obtained

  11. New trace formulae for a quadratic pencil of the Schroedinger operator

    International Nuclear Information System (INIS)

    Yang Chuanfu

    2010-01-01

    This work deals with the eigenvalue problem for a quadratic pencil of the Schroedinger operator on a finite closed interval with the two-point boundary conditions. We will obtain new regularized trace formulas for this class of differential pencil.

  12. Wave-packet revival for the Schroedinger equation with position-dependent mass

    International Nuclear Information System (INIS)

    Schmidt, Alexandre G.M.

    2006-01-01

    We study the temporal evolution of solutions of 1D Schroedinger equation with position-dependent mass inside an infinite well. Revival of wave-packet is shown to exist and partial revivals are different from the usual ones

  13. Localization for off-diagonal disorder and for continuous Schroedinger operators

    International Nuclear Information System (INIS)

    Delyon, F.; Souillard, B.; Simon, B.

    1987-01-01

    We extend the proof of localization by Delyon, Levy, and Souillard to accommodate the Anderson model with off-diagonal disorder and the continuous Schroedinger equation with a random potential. (orig.)

  14. Some applications of perturbation theory to numerical integration methods for the Schroedinger equation

    International Nuclear Information System (INIS)

    Killingbeck, J.

    1979-01-01

    By using the methods of perturbation theory it is possible to construct simple formulae for the numerical integration of the Schroedinger equation, and also to calculate expectation values solely by means of simple eigenvalue calculations. (Auth.)

  15. Combined solitary-wave solution for coupled higher-order nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Tian Jinping; Tian Huiping; Li Zhonghao; Zhou Guosheng

    2004-01-01

    Coupled nonlinear Schroedinger equations model several interesting physical phenomena. We used a trigonometric function transform method based on a homogeneous balance to solve the coupled higher-order nonlinear Schroedinger equations. We obtained four pairs of exact solitary-wave solutions including a dark and a bright-soliton pair, a bright- and a dark-soliton pair, a bright- and a bright-soliton pair, and the last pair, a combined bright-dark-soliton pair

  16. Finiteness of the discrete spectrum of the three-particle Schroedinger operator

    International Nuclear Information System (INIS)

    Abdullaev, Janikul I.; Khalkhujaev, Axmad, M.

    2001-08-01

    We analyse the spectrum of the three-particle Schroedinger operator with pair contact and three-particle interactions on the neighboring nodes on a three-dimensional lattice. We show that the essential spectrum of this operator is the union of two segments, one of which coincides with the spectrum of an unperturbed operator and the other called two-particle branch. We will prove finiteness of the discrete spectrum of the Schroedinger operator at all parameter values of the problem. (author)

  17. Efficiency limit factor analysis for the Francis-99 hydraulic turbine

    Science.gov (United States)

    Zeng, Y.; Zhang, L. X.; Guo, J. P.; Guo, Y. K.; Pan, Q. L.; Qian, J.

    2017-01-01

    The energy loss in hydraulic turbine is the most direct factor that affects the efficiency of the hydraulic turbine. Based on the analysis theory of inner energy loss of hydraulic turbine, combining the measurement data of the Francis-99, this paper calculates characteristic parameters of inner energy loss of the hydraulic turbine, and establishes the calculation model of the hydraulic turbine power. Taken the start-up test conditions given by Francis-99 as case, characteristics of the inner energy of the hydraulic turbine in transient and transformation law are researched. Further, analyzing mechanical friction in hydraulic turbine, we think that main ingredients of mechanical friction loss is the rotation friction loss between rotating runner and water body, and defined as the inner mechanical friction loss. The calculation method of the inner mechanical friction loss is given roughly. Our purpose is that explore and research the method and way increasing transformation efficiency of water flow by means of analysis energy losses in hydraulic turbine.

  18. The green roof dilemma - discussion of Francis and Lorimer (2011).

    Science.gov (United States)

    Henry, Alexandre; Frascaria-Lacoste, Nathalie

    2012-08-15

    Urban ecosystems are the most complex mosaics of vegetative land cover that can be found. In a recent paper, Francis and Lorimer (2011) evaluated the reconciliation potential of living roofs and walls. For these authors, these two techniques for habitat improvement have strong potential for urban reconciliation ecology. However they have some ecological and societal limitations such as the physical extreme environmental characteristics, the monetary investment and the cultural perceptions of urban nature. We are interested in their results and support their conclusions. However, for a considerable time, green roofs have been designed to provide urban greenery for buildings and the green roof market has only focused on extensive roof at a restricted scale within cities. Thus, we have strong doubts about the relevance of their use as possible integrated elements of the network. Furthermore, without dynamic progress in research and the implementation of well-thought-out policies, what will be the real capital gain from green roofs with respect to land-use complementation in cities? If we agree with Francis and Lorimer (2011) considering that urban reconciliation ecology between nature and citizens is a current major challenge, then "adaptive collaborative management" is a fundamental requirement. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. LDA measurements in the Francis-99 draft tube cone

    International Nuclear Information System (INIS)

    Sundstrom, L R J; Amiri, K; Cervantes, M J; Bergan, C; Dahlhaug, O G

    2014-01-01

    Velocity measurements were performed in the draft tube cone of a 1:5.1 scaled model of the Tokke hydropower plant, Norway; also known as the Francis-99 model. Results from the laser Doppler anemometry measurements undertaken at three operating points will be used as validation data for an upcoming workshop on the state of the art of Francis turbine numerical simulation. With the turbine operating at the best efficiency point, a sensitivity analysis of the flow parameters head, flow rate and runner rotational speed shows that the effects on the dimensionless velocity profiles are small as long as n ED and Q ED are held constant. The results indicate a well-functioning turbine at the best efficiency point and high load. At the part load operating point, a vortex breakdown occurs which distorts the velocity profiles and significantly lowers the turbine's hydraulic efficiency. Frequency spectrums of each LDA signal at part load reveals a peak which is asynchronous to that of the runner angular speed. The peaks might be related to the precession of a rotating vortex rope but the characteristics of the LDA signals are different compared to previous studies involving rotating vortex ropes

  20. The Second Christ, Saint Francis of Assisi and ecological consciousness

    Directory of Open Access Journals (Sweden)

    Hendrik Viviers

    2014-01-01

    Full Text Available Even though the life stories of Jesus and the so-called second Christ, Francis of Assisi, incline to the fantastical, their value for a modern ecological consciousness is defendable. Behind Francis� personification of nature and his mystical experiences of nature lie an intuitive sense of interconnectedness and interdependence, of being fully part of the natural web of life (confirmed by empirical science. The same is true of the immanence of Jesus. Religious figures like Francis and Jesus can provide a sound moral attitude towards caring for the natural world, but attitudes need to be informed by scientific knowledge to act ecologically correct. A partnership between attitudes and knowledge hopefully contains good news for a sustainable �green� planet.Intradisciplinary and/or�interdisciplinary�implications: Ecological hermeneutics (part of liberation theology or hermeneutics challenges traditional theologies� often anthropocentric bias in the intra-disciplinary arena. It respects the interconnectedness or interdependence of human and non-human life, including the non-organic, empirically substantiated by natural science. This shared realisation allows for a fruitful inter-disciplinary discourse with science to address the global ecological crisis.

  1. Effect of Guide Vane Clearance Gap on Francis Turbine Performance

    Directory of Open Access Journals (Sweden)

    Ravi Koirala

    2016-04-01

    Full Text Available Francis turbine guide vanes have pivoted support with external control mechanism, for conversion of pressure to kinetic energy and to direct them to runner vanes. This movement along the support is dependent on variation of load and flow (operating conditions. Small clearance gaps between facing plates and the upper and lower guide vane tips are available to aid this movement, through which leakage flow occurs. This secondary flow disturbs the main flow stream, resulting performance loss. Additionally, these increased horseshoe vortex, in presence of sand, when crosses through the gaps, both the surfaces are eroded. This causes further serious effect on performance and structural property by increasing gaps. This paper discusses the observation of the severity in hydropower plants and effect of clearance gaps on general performance of the Francis turbine through computational methods. It also relates the primary result with the empirical relation for leakage flow prediction. Additionally, a possible method to computationally estimate thickness depletion has also been presented. With increasing clearance gap, leakage increases, which lowers energy conversion and turbine efficiency along with larger secondary vortex.

  2. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  4. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  5. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  6. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  7. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  8. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  9. Analytical exact solution of the non-linear Schroedinger equation

    International Nuclear Information System (INIS)

    Martins, Alisson Xavier; Rocha Filho, Tarcisio Marciano da

    2011-01-01

    Full text: In this work we present how to classify and obtain analytical solutions of the Schroedinger equation with a generic non-linearity in 1+1 dimensions. Our approach is based on the determination of Lie symmetry transformation mapping solutions into solutions, and non-classical symmetry transformations, mapping a given solution into itself. From these symmetries it is then possible to reduce the equation to a system of ordinary differential equations which can then be solved using standard methods. The generic non-linearity is handled by considering it as an additional unknown in the determining equations for the symmetry transformations. This results in an over-determined system of non-linear partial differential equations. Its solution can then be determined in some cases by reducing it to the so called involutive (triangular) form, and then solved. This reduction is very tedious and can only performed using a computer algebra system. Once the determining system is solved, we obtain the explicit form for the non-linearity admitting a Lie or non-classical symmetry. The analytical solutions are then derived by solving the reduced ordinary differential equations. The non-linear determining system for the non-classical symmetry transformations and Lie symmetry generators are obtaining using the computer algebra package SADE (symmetry analysis of differential equations), developed at our group. (author)

  10. Center manifold for nonintegrable nonlinear Schroedinger equations on the line

    International Nuclear Information System (INIS)

    Weder, R.

    2000-01-01

    In this paper we study the following nonlinear Schroedinger equation on the line, where f is real-valued, and it satisfies suitable conditions on regularity, on growth as a function of u and on decay as x → ± ∞. The generic potential, V, is real-valued and it is chosen so that the spectrum of H:= -d 2 /dx 2 +V consists of one simple negative eigenvalue and absolutely-continuous spectrum filling (0,∞). The solutions to this equation have, in general, a localized and a dispersive component. The nonlinear bound states, that bifurcate from the zero solution at the energy of the eigenvalue of H, define an invariant center manifold that consists of the orbits of time-periodic localized solutions. We prove that all small solutions approach a particular periodic orbit in the center manifold as t→ ± ∞. In general, the periodic orbits are different for t→ ± ∞. Our result implies also that the nonlinear bound states are asymptotically stable, in the sense that each solution with initial data near a nonlinear bound state is asymptotic as t→ ± ∞ to the periodic orbits of nearby nonlinear bound states that are, in general, different for t→ ± ∞. (orig.)

  11. Francis Bacon: constructing natural histories of the invisible.

    Science.gov (United States)

    Rusu, Doina-Cristina

    2012-01-01

    The natural histories contained in Francis Bacon's Historia naturalis et experimentalis seem to differ from the model presented in De augmentis scientiarum and the Descriptio globi intellectualis in that they are focused on the defining properties of matter, its primary schematisms and the spirits. In this respect, they are highly speculative. In this paper I aim to describe the Historia naturalis et experimentalis as a text about matter theory, the histories of which are ascending from what is most evident to the senses to what is least accessible to them. Moreover, the Latin natural histories are parts of a methodological procedure in which the provisional rules and axioms obtained in one history can be used as theoretical assumptions for another history, thereby permitting one to delve ever more profoundly into the structure of nature.

  12. The "Visual Shock" of Francis Bacon: an essay in neuroesthetics.

    Science.gov (United States)

    Zeki, Semir; Ishizu, Tomohiro

    2013-01-01

    In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a "visual shock."We explore what this means in terms of brain activity and what insights into the brain's visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs, and cars. We show that viewing stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his "visual shock" because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  13. Francis Bacon: teory, method and contributions to the education

    Directory of Open Access Journals (Sweden)

    Roberto Carlos Simões Galvão

    2007-04-01

    Full Text Available In the present article, we propose a brief analysis of Francis Bacon’s thought (1561-1626 and his contributions to the Education. With Bacon, the old religious or metaphysical character of knowledge was substituted by the objectivity of the experimental science, something unknown until then. The science started to represent a means in search of an end, i.e., man’s control over nature. The desire of Bacon to promote a reorganization of the power of the human knowledge, not based on the old scholastic knowledge, but in the new scientific knowledge, was shared by educators, philosophers and statesmen of his time. The role of the school would be to assure the dissemination of this new knowledge which, properly unified, would be within reach of all the children

  14. Experimental vibration level analysis of a Francis turbine

    International Nuclear Information System (INIS)

    Bucur, D M; Dunca, G; Calinoiu, C

    2012-01-01

    In this study the vibration level of a Francis turbine is investigated by experimental work in site. Measurements are carried out for different power output values, in order to highlight the influence of the operation regimes on the turbine behavior. The study focuses on the turbine shaft to identify the mechanical vibration sources and on the draft tube in order to identify the hydraulic vibration sources. Analyzing the vibration results, recommendations regarding the operation of the turbine, at partial load close to minimum values, in the middle of the operating domain or close to maximum values of electric power, can be made in order to keep relatively low levels of vibration. Finally, conclusions are drawn in order to present the real sources of the vibrations.

  15. Simulations of Steady Cavitating Flow in a Small Francis Turbine

    Directory of Open Access Journals (Sweden)

    Ahmed Laouari

    2016-01-01

    Full Text Available The turbulent flow through a small horizontal Francis turbine is solved by means of Ansys-CFX at different operating points, with the determination of the hydrodynamic performance and the best efficiency point. The flow structures at different regimes reveal a large flow eddy in the runner and a swirl in the draft tube. The use of the mixture model for the cavity/liquid two-phase flow allowed studying the influence of cavitation on the hydrodynamic performance and revealed cavitation pockets near the trailing edge of the runner and a cavitation vortex rope in the draft tube. By maintaining a constant dimensionless head and a distributor vane opening while gradually increasing the cavitation number, the output power and efficiency reached a critical point and then had begun to stabilize. The cavitation number corresponding to the safety margin of cavitation is also predicted for this hydraulic turbine.

  16. Prediction of dynamic blade loading of the Francis-99 turbine

    International Nuclear Information System (INIS)

    Nicolle, J; Cupillard, S

    2015-01-01

    CFD simulations focusing on capturing dynamic fluctuations of the flow for three operating points were performed for a scale model of a high head Francis turbine. A mesh sensitivity study showed an influence of the near wall resolution, consequently a low Reynolds mesh with a SST turbulence model was used. Rotor/stator fluctuations are well reproduced with the full turbine simulation at all operating points. Velocity contours and average velocity profiles from LDV measurements in the draft tube confirm that the flow physics is generally well reproduced. Simplified approaches such as profile transform and Fourier transform underestimated the measured fluctuations. As full turbine simulations were time-consuming, a simulation with only the draft tube was performed at part load to predict the fluctuations in the draft tube cone. The SAS-SST turbulence model was able to capture the vortex rope behavior

  17. The phase space of the focused cubic Schroedinger equation: A numerical study

    Energy Technology Data Exchange (ETDEWEB)

    Burlakov, Yuri O. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    1998-05-01

    In a paper of 1988 [41] on statistical mechanics of the nonlinear Schroedinger equation, it was observed that a Gibbs canonical ensemble associated with the nonlinear Schroedinger equation exhibits behavior reminiscent of a phase transition in classical statistical mechanics. The existence of a phase transition in the canonical ensemble of the nonlinear Schroedinger equation would be very interesting and would have important implications for the role of this equation in modeling physical phenomena; it would also have an important bearing on the theory of weak solutions of nonlinear wave equations. The cubic Schroedinger equation, as will be shown later, is equivalent to the self-induction approximation for vortices, which is a widely used equation of motion for a thin vortex filament in classical and superfluid mechanics. The existence of a phase transition in such a system would be very interesting and actually very surprising for the following reasons: in classical fluid mechanics it is believed that the turbulent regime is dominated by strong vortex stretching, while the vortex system described by the cubic Schroedinger equation does not allow for stretching. In superfluid mechanics the self-induction approximation and its modifications have been used to describe the motion of thin superfluid vortices, which exhibit a phase transition; however, more recently some authors concluded that these equations do not adequately describe superfluid turbulence, and the absence of a phase transition in the cubic Schroedinger equation would strengthen their argument. The self-induction approximation for vortices takes into account only very localized interactions, and the existence of a phase transition in such a simplified system would be very unexpected. In this thesis the authors present a numerical study of the phase transition type phenomena observed in [41]; in particular, they find that these phenomena are strongly related to the splitting of the phase space into

  18. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  19. State of the art in numerical simulation of high head Francis turbines

    Directory of Open Access Journals (Sweden)

    Trivedi Chirag

    2016-01-01

    Full Text Available The Francis-99 test case consists in a high head Francis turbine model, which geometry together with meshes and detailed experimental measurements is freely available at www.francis-99.org. Three workshops were initially planned to exchange experience on numerical investigations of the test case concerning steady state operating conditions, transient operating conditions and fluid structure analysis. The first workshop was held in Trondheim, Norway in December 2014. Some results of the 14 contributions are presented. They are concerned with the influence of the near wall space discretization and turbulence modelling in order to capture hydraulic efficiency, torque, pressure and velocity with a good uncertainty at three operating conditions.

  20. On the chirally rotated Schroedinger functional with Wilson fermions

    International Nuclear Information System (INIS)

    Gonzalez Lopez, Jenifer

    2011-01-01

    There are many phenomena in nature, which are closely linked to the low energy regime of QCD. From a theoretical point of view, these low energy phenomena can be dealt with only by means of non-perturbative methods. It is the central goal of this thesis to provide a framework for such a nonperturbative renormalization. For that purpose, we employ a 4-dimensional lattice as a regulator of QCD. As a renormalization scheme, we propose a finite volume Schroedinger functional scheme and here in particular, the chirally rotated Schroedinger functional (χSF). We first perform analytical studies of the χSF at tree-level of perturbation theory, in the continuum and on the lattice. We study the eigenvalue spectrum of the continuum Dirac operator, equipped with chirally rotated SF boundary conditions, and derive the corresponding quark propagator. We then determine the tree-level quark propagator on the lattice, employing massless Wilson fermions as a regulator of the theory. Beyond tree-level, all studies are performed in the quenched approximation of QCD, as a first, computationally much simpler step to understand the properties of the newly proposed χSF scheme. One of the main targets of the present work, has been to perform the non-perturbative tuning of the two required coefficients of the χSF scheme, such that a well defined continuum limit can be reached. We demonstrate, as the first main result of this thesis, that the tuning is feasible and that, moreover, physical quantities are insensitive to the particular tuning condition. As in any lattice regularization with SF-like boundary conditions, there are also in the χSF a couple of counterterms at the boundaries, whose coefficients need to be tuned in order to remove the O(a) discretization effects originated at the boundaries. However, besides these boundary O(a) effects, the χSF is expected to be compatible with bulk automatic O(a)-improvement. We show here that, indeed, the scaling behavior of physical

  1. On the chirally rotated Schroedinger functional with Wilson fermions

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Lopez, Jenifer

    2011-05-25

    There are many phenomena in nature, which are closely linked to the low energy regime of QCD. From a theoretical point of view, these low energy phenomena can be dealt with only by means of non-perturbative methods. It is the central goal of this thesis to provide a framework for such a nonperturbative renormalization. For that purpose, we employ a 4-dimensional lattice as a regulator of QCD. As a renormalization scheme, we propose a finite volume Schroedinger functional scheme and here in particular, the chirally rotated Schroedinger functional ({chi}SF). We first perform analytical studies of the {chi}SF at tree-level of perturbation theory, in the continuum and on the lattice. We study the eigenvalue spectrum of the continuum Dirac operator, equipped with chirally rotated SF boundary conditions, and derive the corresponding quark propagator. We then determine the tree-level quark propagator on the lattice, employing massless Wilson fermions as a regulator of the theory. Beyond tree-level, all studies are performed in the quenched approximation of QCD, as a first, computationally much simpler step to understand the properties of the newly proposed {chi}SF scheme. One of the main targets of the present work, has been to perform the non-perturbative tuning of the two required coefficients of the {chi}SF scheme, such that a well defined continuum limit can be reached. We demonstrate, as the first main result of this thesis, that the tuning is feasible and that, moreover, physical quantities are insensitive to the particular tuning condition. As in any lattice regularization with SF-like boundary conditions, there are also in the {chi}SF a couple of counterterms at the boundaries, whose coefficients need to be tuned in order to remove the O(a) discretization effects originated at the boundaries. However, besides these boundary O(a) effects, the {chi}SF is expected to be compatible with bulk automatic O(a)-improvement. We show here that, indeed, the scaling behavior

  2. Study of nonlinear waves described by the cubic Schroedinger equation

    International Nuclear Information System (INIS)

    Walstead, A.E.

    1980-01-01

    The cubic Schroedinger equation (CSE) is ubiquitous as a model equation for the long-time evolution of finite-amplitude near-monochromatic dispersive waves. It incorporates the effects of the radiation field pressure on the constitutive properties of the supporting medium in a self-consistent manner. The properties of the uniformly transiating periodic wave solutions of the one-dimensional CSE are studied here. These (so-called cnoidal) waves are characterized by the values of four parameters. Whitham's averaged variational principle is used to derive a system of quasilinear evolution equations (the modulational equations) for the values of these parameters when they are slowly varying in space and time. Explicit expressions for the characteristic velocities of the modulational equations are obtained for the full set of cnoidal waves. Riemann invariants are obtained for several limits for the stable case, and growth rates are obtained for several limits, including the solitary wave chain, for the unstable case. The results for several nontrivial limiting cases agree with those obtained by independent methods by others. The dynamics of the CSE generalized to two spatial dimensions are studied for the unstable case. A large class of similarity solutions with cylindrical symmetry are obtained systematically using infinitesimal transformation group techniques. The methods are adapted to obtain the symmetries of the action functional of the CSE and to deduce nine integral invariants. A numerical study of the self-similar solutions reveals that they are modulationally unstable and that singularities dominate the dynamics of the CSE in two dimensions. The CSE is derived using perturbation theory for a specific problem in plasma physics: the evolution of the envelope of a near-monochromatic electromagnetic wave in a cold magnetized plasma. 13 figures, 2 tables

  3. Study of nonlinear waves described by the cubic Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Walstead, A.E.

    1980-03-12

    The cubic Schroedinger equation (CSE) is ubiquitous as a model equation for the long-time evolution of finite-amplitude near-monochromatic dispersive waves. It incorporates the effects of the radiation field pressure on the constitutive properties of the supporting medium in a self-consistent manner. The properties of the uniformly transiating periodic wave solutions of the one-dimensional CSE are studied here. These (so-called cnoidal) waves are characterized by the values of four parameters. Whitham's averaged variational principle is used to derive a system of quasilinear evolution equations (the modulational equations) for the values of these parameters when they are slowly varying in space and time. Explicit expressions for the characteristic velocities of the modulational equations are obtained for the full set of cnoidal waves. Riemann invariants are obtained for several limits for the stable case, and growth rates are obtained for several limits, including the solitary wave chain, for the unstable case. The results for several nontrivial limiting cases agree with those obtained by independent methods by others. The dynamics of the CSE generalized to two spatial dimensions are studied for the unstable case. A large class of similarity solutions with cylindrical symmetry are obtained systematically using infinitesimal transformation group techniques. The methods are adapted to obtain the symmetries of the action functional of the CSE and to deduce nine integral invariants. A numerical study of the self-similar solutions reveals that they are modulationally unstable and that singularities dominate the dynamics of the CSE in two dimensions. The CSE is derived using perturbation theory for a specific problem in plasma physics: the evolution of the envelope of a near-monochromatic electromagnetic wave in a cold magnetized plasma. 13 figures, 2 tables.

  4. Investigation of solutions of boundary-value singular perturbated problem for Schroedinger equation of 4th order

    International Nuclear Information System (INIS)

    Amirkhanov, I.V.; Zhidkov, E.P.; Konnova, S.V.

    2000-01-01

    For the case of spherical-symmetrical potential we have considered the convergence of the solution of singular-perturbated Schroedinger equation of the 4th order to the solution of the corresponding standard nonrelativistic Schroedinger equation by numerical and analytical methods. The questions of existence of the solutions are explored. Numerical results are given. (author)

  5. Singular vectors and invariant equations for the Schroedinger algebra in n ≥ 3 space dimensions. The general case

    International Nuclear Information System (INIS)

    Dobrev, V. K.; Stoimenov, S.

    2010-01-01

    The singular vectors in Verma modules over the Schroedinger algebra s(n) in (n + 1)-dimensional space-time are found for the case of general representations. Using the singular vectors, hierarchies of equations invariant under Schroedinger algebras are constructed.

  6. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  7. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  8. Reliability of the Francis Scale of Attitude Toward Christianity among 8-yr-olds.

    Science.gov (United States)

    Robbins, Mandy; Francis, Leslie J; Williams, Naomi

    2003-02-01

    The Francis Scale of Attitude Toward Christianity was completed by 78 8-yr.-olds (40 boys and 38 girls) whose data support reliability measured as the internal consistency of the scale for this young sample.

  9. The Power of the Word and the Mastery of Nature: Renaissance Magic and Francis Bacon

    Czech Academy of Sciences Publication Activity Database

    Špelda, Daniel

    19/43/, - (2005), s. 7-36. ISBN 80-7007-236-9. ISSN 0231-5955 Institutional research plan: CEZ:AV0Z90090514 Keywords : magic * renaissance philosophy * Francis Bacon Subject RIV: AA - Philosophy ; Religion

  10. Equivalence transformations and differential invariants of a generalized nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Senthilvelan, M; Torrisi, M; Valenti, A

    2006-01-01

    By using Lie's invariance infinitesimal criterion, we obtain the continuous equivalence transformations of a class of nonlinear Schroedinger equations with variable coefficients. We construct the differential invariants of order 1 starting from a special equivalence subalgebra E χ o . We apply these latter ones to find the most general subclass of variable coefficient nonlinear Schr?dinger equations which can be mapped, by means of an equivalence transformation of E χ o , to the well-known cubic Schroedinger equation. We also provide the explicit form of the transformation

  11. Exponential and Bessel fitting methods for the numerical solution of the Schroedinger equation

    International Nuclear Information System (INIS)

    Raptis, A.D.; Cash, J.R.

    1987-01-01

    A new method is developed for the numerical integration of the one dimensional radial Schroedinger equation. This method involves using different integration formulae in different parts of the range of integration rather than using the same integration formula throughout. Two new integration formulae are derived, one which integrates Bessel and Neumann functions exactly and another which exactly integrates certain exponential functions. It is shown that, for large r, these new formulae are much more accurate than standard integration methods for the Schroedinger equation. The benefit of using this new approach is demonstrated by considering some numerical examples based on the Lennard-Jones potential. (orig.)

  12. Exact solitary and periodic wave solutions for a generalized nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Sun Chengfeng; Gao Hongjun

    2009-01-01

    The generalized nonlinear Schroedinger equation (GNLS) iu t + u xx + β | u | 2 u + γ | u | 4 u + iα (| u | 2 u) x + iτ(| u | 2 ) x u = 0 is studied. Using the bifurcation of travelling waves of this equation, some exact solitary wave solutions were obtained in [Wang W, Sun J,Chen G, Bifurcation, Exact solutions and nonsmooth behavior of solitary waves in the generalized nonlinear Schroedinger equation. Int J Bifucat Chaos 2005:3295-305.]. In this paper, more explicit exact solitary wave solutions and some new smooth periodic wave solutions are obtained.

  13. Estimate of the difference between the Kac operator and the Schroedinger semigroup

    International Nuclear Information System (INIS)

    Ichinose, T.; Satoshi, S.

    1997-01-01

    An operator norm estimate of the difference between the Kac operator and the Schroedinger semigroup is proved and used to give a variant of the Trotter product formula for Schroedinger operators in the L p operator norm. This extends Helffer's result in the L 2 operator norm to the case in the L p operator norm for more general scalar potentials and with vector potentials. The method of the proof is probabilistic based on the Feynman-Kac a nd Feynman-Kac-Ito formula. (orig.)

  14. On reduction and exact solutions of nonlinear many-dimensional Schroedinger equations

    International Nuclear Information System (INIS)

    Barannik, A.F.; Marchenko, V.A.; Fushchich, V.I.

    1991-01-01

    With the help of the canonical decomposition of an arbitrary subalgebra of the orthogonal algebra AO(n) the rank n and n-1 maximal subalgebras of the extended isochronous Galileo algebra, the rank n maximal subalgebras of the generalized extended classical Galileo algebra AG(a,n) the extended special Galileo algebra AG(2,n) and the extended whole Galileo algebra AG(3,n) are described. By using the rank n subalgebras, ansatze reducing the many dimensional Schroedinger equations to ordinary differential equations is found. With the help of the reduced equation solutions exact solutions of the Schroedinger equation are considered

  15. Non self-similar collapses described by the non-linear Schroedinger equation

    International Nuclear Information System (INIS)

    Berge, L.; Pesme, D.

    1992-01-01

    We develop a rapid method in order to find the contraction rates of the radially symmetric collapsing solutions of the nonlinear Schroedinger equation defined for space dimensions exceeding a threshold value. We explicitly determine the asymptotic behaviour of these latter solutions by solving the non stationary linear problem relative to the nonlinear Schroedinger equation. We show that the self-similar states associated with the collapsing solutions are characterized by a spatial extent which is bounded from the top by a cut-off radius

  16. Mathematical analysis of the dimensional scaling technique for the Schroedinger equation with power-law potentials

    International Nuclear Information System (INIS)

    Ding Zhonghai; Chen, Goong; Lin, Chang-Shou

    2010-01-01

    The dimensional scaling (D-scaling) technique is an innovative asymptotic expansion approach to study the multiparticle systems in molecular quantum mechanics. It enables the calculation of ground and excited state energies of quantum systems without having to solve the Schroedinger equation. In this paper, we present a mathematical analysis of the D-scaling technique for the Schroedinger equation with power-law potentials. By casting the D-scaling technique in an appropriate variational setting and studying the corresponding minimization problem, the D-scaling technique is justified rigorously. A new asymptotic dimensional expansion scheme is introduced to compute asymptotic expansions for ground state energies.

  17. Three-Step Predictor-Corrector of Exponential Fitting Method for Nonlinear Schroedinger Equations

    International Nuclear Information System (INIS)

    Tang Chen; Zhang Fang; Yan Haiqing; Luo Tao; Chen Zhanqing

    2005-01-01

    We develop the three-step explicit and implicit schemes of exponential fitting methods. We use the three-step explicit exponential fitting scheme to predict an approximation, then use the three-step implicit exponential fitting scheme to correct this prediction. This combination is called the three-step predictor-corrector of exponential fitting method. The three-step predictor-corrector of exponential fitting method is applied to numerically compute the coupled nonlinear Schroedinger equation and the nonlinear Schroedinger equation with varying coefficients. The numerical results show that the scheme is highly accurate.

  18. The auxiliary field method and approximate analytical solutions of the Schroedinger equation with exponential potentials

    Energy Technology Data Exchange (ETDEWEB)

    Silvestre-Brac, Bernard [LPSC Universite Joseph Fourier, Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Avenue des Martyrs 53, F-38026 Grenoble-Cedex (France); Semay, Claude; Buisseret, Fabien [Groupe de Physique Nucleaire Theorique, Universite de Mons-Hainaut, Academie universitaire Wallonie-Bruxelles, Place du Parc 20, B-7000 Mons (Belgium)], E-mail: silvestre@lpsc.in2p3.fr, E-mail: claude.semay@umh.ac.be, E-mail: fabien.buisseret@umh.ac.be

    2009-06-19

    The auxiliary field method is a new and efficient way to compute approximate analytical eigenenergies of the Schroedinger equation. This method has already been successfully applied to the case of central potentials of power-law and logarithmic forms. In the present work, we show that the Schroedinger equation with exponential potentials of the form -{alpha}r{sup {lambda}}exp(-{beta}r) can also be analytically solved by using the auxiliary field method. Closed formulae giving the critical heights and the energy levels of these potentials are presented. Special attention is drawn to the Yukawa potential and the pure exponential potential.

  19. The auxiliary field method and approximate analytical solutions of the Schroedinger equation with exponential potentials

    International Nuclear Information System (INIS)

    Silvestre-Brac, Bernard; Semay, Claude; Buisseret, Fabien

    2009-01-01

    The auxiliary field method is a new and efficient way to compute approximate analytical eigenenergies of the Schroedinger equation. This method has already been successfully applied to the case of central potentials of power-law and logarithmic forms. In the present work, we show that the Schroedinger equation with exponential potentials of the form -αr λ exp(-βr) can also be analytically solved by using the auxiliary field method. Closed formulae giving the critical heights and the energy levels of these potentials are presented. Special attention is drawn to the Yukawa potential and the pure exponential potential

  20. Quantum theory of single events: Localized de Broglie-wavelets, Schroedinger waves and classical trajectories

    International Nuclear Information System (INIS)

    Barut, A.O.

    1990-06-01

    For an arbitrary potential V with classical trajectories x-vector=g-vector(t) we construct localized oscillating three-dimensional wave lumps ψ(x-vector,t,g-vector) representing a single quantum particle. The crest of the envelope of the ripple follows the classical orbit g-vector(t) slightly modified due to potential V and ψ(x-vector,t;g-vector) satisfies the Schroedinger equation. The field energy, momentum and angular momentum calculated as integrals over all space are equal to particle energy, momentum and angular momentum. The relation to coherent states and to Schroedinger waves are also discussed. (author). 6 refs

  1. Solving the Schroedinger equation using the finite difference time domain method

    International Nuclear Information System (INIS)

    Sudiarta, I Wayan; Geldart, D J Wallace

    2007-01-01

    In this paper, we solve the Schroedinger equation using the finite difference time domain (FDTD) method to determine energies and eigenfunctions. In order to apply the FDTD method, the Schroedinger equation is first transformed into a diffusion equation by the imaginary time transformation. The resulting time-domain diffusion equation is then solved numerically by the FDTD method. The theory and an algorithm are provided for the procedure. Numerical results are given for illustrative examples in one, two and three dimensions. It is shown that the FDTD method accurately determines eigenfunctions and energies of these systems

  2. On the construction of coherent states of position dependent mass Schroedinger equation endowed with effective potential

    International Nuclear Information System (INIS)

    Chithiika Ruby, V.; Senthilvelan, M.

    2010-01-01

    In this paper, we propose an algorithm to construct coherent states for an exactly solvable position dependent mass Schroedinger equation. We use point canonical transformation method and obtain ground state eigenfunction of the position dependent mass Schroedinger equation. We fix the ladder operators in the deformed form and obtain explicit expression of the deformed superpotential in terms of mass distribution and its derivative. We also prove that these deformed operators lead to minimum uncertainty relations. Further, we illustrate our algorithm with two examples, in which the coherent states given for the second example are new.

  3. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  4. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  5. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  6. Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System

    OpenAIRE

    Fengjiao Wu; Junling Ding; Zhengzhong Wang

    2016-01-01

    The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the d...

  7. The great war correspondent: Francis McCullagh, 1874–1956

    OpenAIRE

    Horgan, John

    2009-01-01

    Trotsky of Russia knows Francis McCullagh. So does President Calles of Mexico. Peter, the King of Serbia, was McCullagh’s friend. The headhunters of the upper Amazon list Francis McCullagh as one of their principal deities. The warring tribes of Morocco call him blood brother. A room is always ready for him in the imperial palace of Siam. The latchstrings of hundreds of Siberian peasant huts are out in anticipation of his coming.

  8. The Visual Shock of Francis Bacon: An essay in neuroesthetics

    Directory of Open Access Journals (Sweden)

    Semir eZeki

    2013-12-01

    Full Text Available In this paper we discuss the work of Francis Bacon in the context of his declared aim of giving a visual shock. We explore what this means in terms of brain activity and what insights into the brain’s visual perceptive system his work gives. We do so especially with reference to the representation of faces and bodies in the human visual brain. We discuss the evidence that shows that both these categories of stimuli have a very privileged status in visual perception, compared to the perception of other stimuli, including man-made artifacts such as houses, chairs and cars. We show that viewing face and house stimuli that depart significantly from a normal representation of faces and bodies entails a significant difference in the pattern of brain activation. We argue that Bacon succeeded in delivering his visual shock because he subverted the normal neural representation of faces and bodies, without at the same time subverting the representation of man-made artifacts.

  9. Civil history and poetry, certainty and truth in Francis Bacon

    Directory of Open Access Journals (Sweden)

    Silvia Manzo

    2015-02-01

    Full Text Available This article aims at studying key components of Francis Bacon’s theory of history and of his work as practitioner of civil history, particularly in regard to truth and certainty in historical narratives. It compares Bacon’s theories of history and poetry, and the way in which he conceives their relation to certainty, truth and fiction. It analyzes mainly two sorts of writings. On the one hand, it investigates the programmatic texts where Bacon’s views of history and poetry are developed. On the other hand, it examines the finished and unfinished civil histories written by Bacon as historian. In addition, the article evaluates Bacon’s stances against the background of Renaissance and early modern English historiography. It concludes that although history and poetry constitute separate branches in Bacon’s classification of learning, they share important elements, in keeping with the view of poetry maintained by his contemporary Philip Sidney. Thus, Bacon included fictional patterns in his historical narrative and distinguished certainties from conjectures in a particular way. This attitude towards civil history shows a strong contrast to Bacon’s methodology for natural histories, which, in order to reach certainty, staunchly recommends to exclude any fictional narrative in reporting the facts of nature.

  10. The medical philosophy of Francis Bacon (1561-1626).

    Science.gov (United States)

    Boss, J

    1978-01-01

    Francis Bacon's view of man is dualistic but, although he takes note of mental faculties, he makes the relation between mind and body, rather than the substance of mind, the basis for enquiry into mental processes and, more particularly, for the medically relevant study of mind. (He uses "mind" and "soul" as equivalent terms.) The healing of the body requires study of the body, and the ineffectiveness of physicians is due to their failure in this respect rather than to the body's complexity. To learn about the body requires clinical observation and recording, together with the comparison of bodies, experiments on living animals and attention to pathological changes. The aims of medicine should include not only the restoration of health but also the relief of suffering and they are not to be limited by putting aside a disease as incurable. To learn from treatment it must be fixed in its ordering with controlled and limited variation. Bacon has no separation of medicine from natural science; his philosophy of medicine is his general philosophy of the advancement of knowledge, but limited to a particular field of application. If medicine is separated from natural philosophy it is changed wholly or greatly into empiricism.

  11. Computation of Cavitating Flow in a Francis Hydroturbine

    Science.gov (United States)

    Leonard, Daniel; Lindau, Jay

    2013-11-01

    In an effort to improve cavitation characteristics at off-design conditions, a steady, periodic, multiphase, RANS CFD study of an actual Francis hydroturbine was conducted and compared to experimental results. It is well-known that operating hydroturbines at off-design conditions usually results in the formation of large-scale vaporous cavities. These cavities, and their subsequent collapse, reduce efficiency and cause damage and wear to surfaces. The conventional hydro community has expressed interest in increasing their turbine's operating ranges, improving their efficiencies, and reducing damage and wear to critical turbine components. In this work, mixing planes were used to couple rotating and stationary stages of the turbine which have non-multiple periodicity, and provide a coupled solution for the stay vanes, wicket gates, runner blades, and draft tube. The mixture approach is used to simulate the multiphase flow dynamics, and cavitation models were employed to govern the mass transfer between liquid and gas phases. The solution is compared with experimental results across a range of cavitation numbers which display all the major cavitation features in the machine. Unsteady computations are necessary to capture inherently unsteady cavitation phenomena, such as the precessing vortex rope, and the shedding of bubbles from the wicket gates and their subsequent impingement upon the leading edge of the runner blades. To display these features, preliminary unsteady simulations of the full machine are also presented.

  12. Intertwining relations and Darboux transformations for Schroedinger equations in (n+1) dimensions

    International Nuclear Information System (INIS)

    Schulze-Halberg, Axel

    2010-01-01

    We evaluate the intertwining relation for Schroedinger equations in (n+1) dimensions. The conditions for the existence of a Darboux transformation are analyzed and compared to their (1+1) dimensional counterparts. A complete solution of the conditions is given for (2+1) dimensions, and a Darboux transformation is constructed.

  13. On the equivalence between particular types of Navier-Stokes and non-linear Schroedinger equations

    International Nuclear Information System (INIS)

    Dietrich, K.; Vautherin, D.

    1985-01-01

    We derive a Schroedinger equation equivalent to the Navier-Stokes equation in the special case of constant kinematic viscosities. This equation contains a non-linear term similar to that proposed by Kostin for a quantum description of friction [fr

  14. Exact solutions for the quintic nonlinear Schroedinger equation with time and space modulated nonlinearities and potentials

    International Nuclear Information System (INIS)

    Belmonte-Beitia, Juan; Calvo, Gabriel F.

    2009-01-01

    In this Letter, by means of similarity transformations, we construct explicit solutions to the quintic nonlinear Schroedinger equation with potentials and nonlinearities depending both on time and on the spatial coordinates. We present the general approach and use it to study some examples and find nontrivial explicit solutions such as periodic (breathers), quasiperiodic and bright and dark soliton solutions

  15. The exact solutions of the Schroedinger equation with the Morse potential via Laplace transforms

    International Nuclear Information System (INIS)

    Chen Gang

    2004-01-01

    In this Letter, we reduce the second-order differential equation about the one-dimensional Schroedinger equation with the Morse potential reduced to the first-order differential equation in terms of Laplace transforms and then obtain the exact bound state solutions

  16. Local and non-local Schroedinger cat states in cavity QED

    International Nuclear Information System (INIS)

    Haroche, S.

    2005-01-01

    Full text: I will review recent experiments performed on mesoscopic state superpositions of field states in cavity QED. Proposals to extend these studies to Schroedinger cat states delocalized in two cavities will be discussed. New versions of Bell's inequality tests will probe the non-local behavior of these cats and study their sensitivity to decoherence. (author)

  17. Random Schroedinger operators and the theory of disordered systems: some rigorous results

    International Nuclear Information System (INIS)

    Kunz, H.; Souillard, B.

    1981-01-01

    The authors report results on a class of finite difference Schroedinger operators with stochastic potentials. The Hamiltonian is then H(V)=-Δ+V; where Δ is the discretized Laplacian and the potential V acts as a multiplication operator. The potential V is random. (Auth.)

  18. Accurate high-lying eigenvalues of Schroedinger and Sturm-Liouville problems

    International Nuclear Information System (INIS)

    Vanden Berghe, G.; Van Daele, M.; De Meyer, H.

    1994-01-01

    A modified difference and a Numerov-like scheme have been introduced in a shooting algorithm for the determination of the (higher-lying) eigenvalues of Schroedinger equations and Sturm-Liouville problems. Some numerical experiments are introduced. Time measurements have been performed. The proposed algorithms are compared with other previously introduced shooting schemes. The structure of the eigenvalue error is discussed. ((orig.))

  19. Inverse scattering transform for the time dependent Schroedinger equation with applications to the KPI equation

    Energy Technology Data Exchange (ETDEWEB)

    Xin, Zhou [Wisconsin Univ., Madison (USA). Dept. of Mathematics

    1990-03-01

    For the direct-inverse scattering transform of the time dependent Schroedinger equation, rigorous results are obtained based on an operator-triangular-factorization approach. By viewing the equation as a first order operator equation, similar results as for the first order n x n matrix system are obtained. The nonlocal Riemann-Hilbert problem for inverse scattering is shown to have solution. (orig.).

  20. Two simple ansaetze for obtaining exact solutions of high dispersive nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Palacios, Sergio L.

    2004-01-01

    We propose two simple ansaetze that allow us to obtain different analytical solutions of the high dispersive cubic and cubic-quintic nonlinear Schroedinger equations. Among these solutions we can find solitary wave and periodic wave solutions representing the propagation of different waveforms in nonlinear media

  1. New Exact Travelling Wave and Periodic Solutions of Discrete Nonlinear Schroedinger Equation

    International Nuclear Information System (INIS)

    Yang Qin; Dai Chaoqing; Zhang Jiefang

    2005-01-01

    Some new exact travelling wave and period solutions of discrete nonlinear Schroedinger equation are found by using a hyperbolic tangent function approach, which was usually presented to find exact travelling wave solutions of certain nonlinear partial differential models. Now we can further extend the new algorithm to other nonlinear differential-different models.

  2. On the spectral theory and dispersive estimates for a discrete Schroedinger equation in one dimension

    International Nuclear Information System (INIS)

    Pelinovsky, D. E.; Stefanov, A.

    2008-01-01

    Based on the recent work [Komech et al., 'Dispersive estimates for 1D discrete Schroedinger and Klein-Gordon equations', Appl. Anal. 85, 1487 (2006)] for compact potentials, we develop the spectral theory for the one-dimensional discrete Schroedinger operator, Hφ=(-Δ+V)φ=-(φ n+1 +φ n-1 -2φ n )+V n φ n . We show that under appropriate decay conditions on the general potential (and a nonresonance condition at the spectral edges), the spectrum of H consists of finitely many eigenvalues of finite multiplicities and the essential (absolutely continuous) spectrum, while the resolvent satisfies the limiting absorption principle and the Puiseux expansions near the edges. These properties imply the dispersive estimates parallel e itH P a.c. (H) parallel l σ 2 →l -σ 2 -3/2 for any fixed σ>(5/2) and any t>0, where P a.c. (H) denotes the spectral projection to the absolutely continuous spectrum of H. In addition, based on the scattering theory for the discrete Jost solutions and the previous results by Stefanov and Kevrekidis [''Asymptotic behaviour of small solutions for the discrete nonlinear Schroedinger and Klein-Gordon equations,'' Nonlinearity 18, 1841 (2005)], we find new dispersive estimates parallel e itH P a.c. (H) parallel l 1 →l ∞ -1/3 , which are sharp for the discrete Schroedinger operators even for V=0

  3. Bounds on resolvents of dilated Schroedinger operators with non trapping potentials

    International Nuclear Information System (INIS)

    Duclos, P.; Klein, M.

    1985-06-01

    We provide bounds on resolvents of dilated Schroedinger operators via an exterior scaling. It is done under a non trapping condition on the potential which has a clear interpretation in classical mechanics. These bounds are a powerful tool to prove absence of resonances due to the tail of the potential in the shape resonance problem

  4. Remark on the solution of the Schroedinger equation for anharmonic oscillators via the Feynman path integral

    International Nuclear Information System (INIS)

    Rezende, J.

    1983-01-01

    We give a simple proof of Feynman's formula for the Green's function of the n-dimensional harmonic oscillator valid for every time t with Im t<=0. As a consequence the Schroedinger equation for the anharmonic oscillator is integrated and expressed by the Feynman path integral on Hilbert space. (orig.)

  5. Interrelation of alternative sets of Lax-pairs for a generalized nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Iino, Kazuhiro; Ichikawa, Yoshihiko; Wadati, Miki.

    1982-05-01

    Examination of the inverse scattering transformation schemes for a generalized nonlinear Schroedinger equation reveals the fact that the algorithm of Chen-Lee-Liu gives rise to the Lax-pairs for the squared eigenfunctions of the Wadati-Konno-Ichikawa scheme, which has been formulated as superposition of the Ablowitz-Kaup-Newell-Segur scheme and the Kaup-Newell scheme. (author)

  6. Inverse scattering transform for the time dependent Schroedinger equation with applications to the KPI equation

    International Nuclear Information System (INIS)

    Zhou Xin

    1990-01-01

    For the direct-inverse scattering transform of the time dependent Schroedinger equation, rigorous results are obtained based on an operator-triangular-factorization approach. By viewing the equation as a first order operator equation, similar results as for the first order n x n matrix system are obtained. The nonlocal Riemann-Hilbert problem for inverse scattering is shown to have solution. (orig.)

  7. Linear and nonlinear analogues of the Schroedinger equation in the contextual approach in quantum mechanics

    International Nuclear Information System (INIS)

    Khrennikov, A.Yu.

    2005-01-01

    One derived the general evolutionary differential equation within the Hilbert space describing dynamics of the wave function. The derived contextual model is more comprehensive in contrast to a quantum one. The contextual equation may be a nonlinear one. Paper presents the conditions ensuring linearity of the evolution and derivation of the Schroedinger equation [ru

  8. Filamentary structures of the cosmic web and the nonlinear Schroedinger type equation

    International Nuclear Information System (INIS)

    Tigrak, E; Weygaert, R van de; Jones, B J T

    2011-01-01

    We show that the filamentary type structures of the cosmic web can be modeled as solitonic waves by solving the reaction diffusion system which is the hydrodynamical analogous of the nonlinear Schroedinger type equation. We find the analytical solution of this system by applying the Hirota direct method which produces the dissipative soliton solutions to formulate the dynamical evolution of the nonlinear structure formation.

  9. Continuous-time random walk as a guide to fractional Schroedinger equation

    International Nuclear Information System (INIS)

    Lenzi, E. K.; Ribeiro, H. V.; Mukai, H.; Mendes, R. S.

    2010-01-01

    We argue that the continuous-time random walk approach may be a useful guide to extend the Schroedinger equation in order to incorporate nonlocal effects, avoiding the inconsistencies raised by Jeng et al. [J. Math. Phys. 51, 062102 (2010)]. As an application, we work out a free particle in a half space, obtaining the time dependent solution by considering an arbitrary initial condition.

  10. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  11. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  12. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Turbulence modeling for Francis turbine water passages simulation

    International Nuclear Information System (INIS)

    Maruzewski, P; Munch, C; Mombelli, H P; Avellan, F; Hayashi, H; Yamaishi, K; Hashii, T; Sugow, Y

    2010-01-01

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-ε model, or the standard k-ε model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  15. Turbulence modeling for Francis turbine water passages simulation

    Energy Technology Data Exchange (ETDEWEB)

    Maruzewski, P; Munch, C; Mombelli, H P; Avellan, F [Ecole polytechnique federale de Lausanne, Laboratory of Hydraulic Machines Avenue de Cour 33 bis, CH-1007 Lausanne (Switzerland); Hayashi, H; Yamaishi, K; Hashii, T; Sugow, Y, E-mail: pierre.maruzewski@epfl.c [Nippon KOEI Power Systems, 1-22 Doukyu, Aza, Morijyuku, Sukagawa, Fukushima Pref. 962-8508 (Japan)

    2010-08-15

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-{epsilon} model, or the standard k-{epsilon} model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  16. Turbulence modeling for Francis turbine water passages simulation

    Science.gov (United States)

    Maruzewski, P.; Hayashi, H.; Munch, C.; Yamaishi, K.; Hashii, T.; Mombelli, H. P.; Sugow, Y.; Avellan, F.

    2010-08-01

    The applications of Computational Fluid Dynamics, CFD, to hydraulic machines life require the ability to handle turbulent flows and to take into account the effects of turbulence on the mean flow. Nowadays, Direct Numerical Simulation, DNS, is still not a good candidate for hydraulic machines simulations due to an expensive computational time consuming. Large Eddy Simulation, LES, even, is of the same category of DNS, could be an alternative whereby only the small scale turbulent fluctuations are modeled and the larger scale fluctuations are computed directly. Nevertheless, the Reynolds-Averaged Navier-Stokes, RANS, model have become the widespread standard base for numerous hydraulic machine design procedures. However, for many applications involving wall-bounded flows and attached boundary layers, various hybrid combinations of LES and RANS are being considered, such as Detached Eddy Simulation, DES, whereby the RANS approximation is kept in the regions where the boundary layers are attached to the solid walls. Furthermore, the accuracy of CFD simulations is highly dependent on the grid quality, in terms of grid uniformity in complex configurations. Moreover any successful structured and unstructured CFD codes have to offer a wide range to the variety of classic RANS model to hybrid complex model. The aim of this study is to compare the behavior of turbulent simulations for both structured and unstructured grids topology with two different CFD codes which used the same Francis turbine. Hence, the study is intended to outline the encountered discrepancy for predicting the wake of turbine blades by using either the standard k-epsilon model, or the standard k-epsilon model or the SST shear stress model in a steady CFD simulation. Finally, comparisons are made with experimental data from the EPFL Laboratory for Hydraulic Machines reduced scale model measurements.

  17. On the quantum inverse problem for a new type of nonlinear Schroedinger equation for Alfven waves in plasma

    International Nuclear Information System (INIS)

    Sen, S.; Roy Chowdhury, A.

    1989-06-01

    The nonlinear Alfven waves are governed by the Vector Derivative nonlinear Schroedinger (VDNLS) equation, which for parallel or quasi parallel propagation reduces to the Derivative Nonlinear Schroedinger (DNLS) equation for the circularly polarized waves. We have formulated the Quantum Inverse problem for a new type of Nonlinear Schroedinger Equation which has many properties similar to the usual NLS problem but the structure of classical and quantum R matrix are distinctly different. The commutation rules of the scattering data are obtained and the Algebraic Bethe Ansatz is formulated to derive the eigenvalue equation for the energy of the excited states. 10 refs

  18. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  19. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  20. Sigmund Freud and the Crick-Koch hypothesis. A footnote to the history of consciousness studies.

    Science.gov (United States)

    Smith, D L

    1999-06-01

    The author describes Crick and Koch's recently developed theory of the neurophysiological basis of consciousness as synchronised neural oscillations. The thesis that neural oscillations provide the neurophysiological basis for consciousness was anticipated by Sigmund Freud in his 1895 'Project for a scientific psychology'. Freud attempted to solve his neuropsychological 'problem of quality' by means of the hypothesis that information concerning conscious sensory qualities is transmitted through the mental apparatus by means of neural 'periods'. Freud believed that information carried by neural oscillations would proliferate across 'contact-barriers' (synapses) without inhibition. Freud's theory thus appears to imply that synchronised neural oscillations are an important component of the neurophysiological basis of consciousness. It is possible that Freud's thesis was developed in response to the experimental research of the American neuroscientist M. M. Garver.

  1. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  2. Erwin Schroedinger: Collected papers V. 4. General scientific and popular papers

    International Nuclear Information System (INIS)

    Schroedinger, E.

    1984-01-01

    The present volume contains all of Schroedinger's papers, which did not fit naturally into his earlier volumes. It certainly does not contain only popular writings and is perhaps more so than the other volumes a testimony of the spiritual breadth of its author. Schroedinger occupied himself very extensively with the physiological optics. His papers reach from survey articles, where an enormous experimental material is being sifted, to theoretical explorations. A leitmotiv in Schroedinger's thinking, which never left him in peace, was the duality of particle and wave. He looked upon the wave-picture as the one more to the point and in this connection expressed various fruitful thoughts as e.g. that the state of macroscopic bodies would not be eigenstates of the number of particles. He objected against provisional formulations and thus controverted against quantum jumps, which suggest a discontinuous time-development. Schroedinger rejected the radical positivism, which tolerates only directly observable quantities in a theory and he did not look upon the Copenhagen interpretation as the complete solution to the problem. The collection of 59 papers is a goldmine for all pedagogues. Numerous popularizations of Schroedinger's spheres of interest, which go widely beyond his field of exploration prove how simple and clear a topic can be presented. Let it be astronomy or biology, theory of knowledge or Greek mythology, he always discovered the heart of the questions and illustrated it with simple means. He never pretends learning and deepness of thoughts by cryptical remarks and by vague or contradictory formulations. All writings show his way of thinking, which cannot be restricted by authority and objects to any claim of eternal validity. For instance, he analyses various epoche-making arguements of Galileo and finds that his plausible explanation of the tides is wrong. His conceptions on consciousness, free will and human soul are documented in some essays too

  3. Many particle systems with inverse square potential, Riccatti equation and completely integrable systems connected with Schroedinger operator

    International Nuclear Information System (INIS)

    Chudnovsky, David; Chudnovsky, G.V.

    1978-01-01

    The relations between many particle problem with inverse square potential on the line and meromorphic eigenfunctions of Schroedinger operator are presented. This gives new type of Backlund transformations for many particle problem [fr

  4. Five-Item Francis Scale of Attitude toward Christianity: Construct and Nomological Validity and Internal Consistency among Colombian College Students

    Science.gov (United States)

    Ceballos, Guillermo A.; Suescun, Jesus D.; Oviedo, Heidi C.; Herazo, Edwin; Campo-Arias, Adalberto

    2015-01-01

    The Spanish version of the five-item Francis scale of attitude toward Christianity is a refinement of the short version of the Francis scale of attitude toward Christianity. The scale is a good measurement for intrinsic religiosity. It has been applied previously among Colombian adolescent students. The internal consistency and construct and…

  5. 75 FR 80730 - Francis Slakey on Behalf of the American Physical Society; Receipt of Petition for Rulemaking

    Science.gov (United States)

    2010-12-23

    ... [Docket No. PRM-70-9; NRC-2010-0372] Francis Slakey on Behalf of the American Physical Society; Receipt of... the NRC by Francis Slakey on behalf of the American Physical Society (APS). The petition was docketed... that over the next few years, the NRC would be reviewing license applications for new technologies, and...

  6. A discovery of quite exceptional importance. Schroedinger's correspondence on wave mechanics and on the cat paradoxon

    International Nuclear Information System (INIS)

    Meyenn, Karl von

    2011-01-01

    After Schroedinger has in the beginning of 1926 published his wave mechanics, he has by this opened many new physical views and perspectives, which have decidingly influenced the further development of quantum theory. Also today the Schroedinger equations forms the foundation of the whole microphysics and their far reaching applications. Therefore it is both for the scientist and for the interested layman very attractive to be informed by first hand about the more direct conditions and the problems of their origin. Letters of famous scientists and researchers have also in the past attracted the interest of the public, and many a scientist has been excited to the study by the lecture of such primary sources. The selection of about 300 letters presented here illuminates especially the origin of wave mechanics and their still controverse interpretation. An extensive introduction, comments, remarks, illustrations, and lists establish the physical and historical relations.

  7. Symbolic computation and solitons of the nonlinear Schroedinger equation in inhomogeneous optical fiber media

    International Nuclear Information System (INIS)

    Li Biao; Chen Yong

    2007-01-01

    In this paper, the inhomogeneous nonlinear Schroedinger equation with the loss/gain and the frequency chirping is investigated. With the help of symbolic computation, three families of exact analytical solutions are presented by employing the extended projective Riccati equation method. From our results, many previous known results of nonlinear Schroedinger equation obtained by some authors can be recovered by means of some suitable selections of the arbitrary functions and arbitrary constants. Of optical and physical interests, soliton propagation and soliton interaction are discussed and simulated by computer, which include snake-soliton propagation and snake-solitons interaction, boomerang-like soliton propagation and boomerang-like solitons interaction, dispersion managed (DM) bright (dark) soliton propagation and DM solitons interaction

  8. Solution of Schroedinger equation for particle moving in two-well potential

    International Nuclear Information System (INIS)

    Ivanova, O.I.; Sabirov, R.Kh.

    2000-01-01

    The solution of the Schroedinger equation for the particle, moving in the two-well potential is given on the basis of a single variational method. This potential constitutes the sum of the harmonic potential and the Gaussian addition. The analytical expression for the wave function of the particle basic state is obtained. The dependence of the obtained solutions on the potential barrier height and width is studied. It is shown that the better separation of the potential barrier provides for higher accuracy of the calculations. The values of the two-well potential, whereby good agreement between the calculations and exact numerical solution of the Schroedinger equation may be expected, are presented [ru

  9. An algebraic formulation of quantum electrodynamics. [Fermi method, Schroedinger representation, Weylalgebra

    Energy Technology Data Exchange (ETDEWEB)

    Gaffney, J M

    1975-01-01

    A reappraisal of electromagnetic field theories is made and an account is given of the radiation gauge, Gupta-Bleuler and Fermi methods of quantitising the electromagnetic fields. The Weyl algebra of the vector potential is constructed and the Fermi method is then related to a certain representation of the algebra. The representation is specified by a generating functional for a state on the algebra. The Weyl algebra of the physical field is then constructed as a factor algebra. The Schroedinger representation of the algebra is then studied and it was found that the Fermi method is just a generalization of this representation to an infinite number of degrees of freedom. The Schroedinger representation of Fermi method is constructed.

  10. A q-Schroedinger algebra, its lowest weight representations and generalized q-deformed heat equations

    International Nuclear Information System (INIS)

    Dobrev, V.K.; Doebner, H.D.; Mrugalla, C.

    1995-12-01

    We give a q-deformation S-perpendicular q of the centrally extended Schroedinger algebra. We construct the lowest weight representations of S-perpendicular q , starting from the Verma modules over S-perpendicular q , finding their singular vectors and factoring the Verma submodules built on the singular vectors. We also give a vector-field realization of S-perpendicular q which provides polynomial realization of the lowest weight representations and an infinite hierarchy of q-difference equations which may be called generalized q-deformed heat equations. We also apply our methods to the on-shell q-Schroedinger algebra proposed by Floreanini and Vinet. (author). 12 refs

  11. The general Klein-Gordon-Schroedinger system: modulational instability and exact solutions

    International Nuclear Information System (INIS)

    Tang Xiaoyan; Ding Wei

    2008-01-01

    The general Klein-Gordon-Schroedinger (gKGS) system is studied where the cubic auto-interactions are introduced in both the nonlinear Schroedinger and the nonlinear Klein-Gordon fields. We first investigate the modulational instability (MI) of the system, and thus derive the general dispersion relation between the frequency and wavenumber of the modulating perturbations, which demonstrates many possibilities for the MI regions. Using the travelling wave reduction, the gKGS system is greatly simplified. Via a simple function expansion method, we obtain some exact travelling wave solutions. Under some special parameter values, some representative wave structures are graphically displayed including the kink, anti-kink, bright, dark, grey and periodic solitons

  12. Optical soliton solutions for two coupled nonlinear Schroedinger systems via Darboux transformation

    International Nuclear Information System (INIS)

    Zhang Haiqiang; Li Juan; Xu Tao; Zhang Yaxing; Hu Wei; Tian Bo

    2007-01-01

    In nonlinear optical fibers, the vector solitons can be governed by the systems of coupled nonlinear Schroedinger from polarized optical waves in an isotropic medium. Based on the Ablowitz-Kaup-Newell-Segur technology, the Darboux transformation method is successfully applied to two coupled nonlinear Schroedinger systems. With the help of symbolic computation, the bright vector one- and two-soliton solutions including one-peak and two-peak solitons are further constructed via the iterative algorithm of Darboux transformation. Through the figures for several sample solutions, the stable propagation and elastic collisions for these kinds of bright vector solitons are discussed and the possible applications are pointed out in optical communications and relevant optical experiments.In addition, the conserved quantities of such two systems, i.e., the energy, momentum and Hamiltonian, are also presented

  13. Discrete coupled derivative nonlinear Schroedinger equations and their quasi-periodic solutions

    International Nuclear Information System (INIS)

    Geng Xianguo; Su Ting

    2007-01-01

    A hierarchy of nonlinear differential-difference equations associated with a discrete isospectral problem is proposed, in which a typical differential-difference equation is a discrete coupled derivative nonlinear Schroedinger equation. With the help of the nonlinearization of the Lax pairs, the hierarchy of nonlinear differential-difference equations is decomposed into a new integrable symplectic map and a class of finite-dimensional integrable Hamiltonian systems. Based on the theory of algebraic curve, the Abel-Jacobi coordinates are introduced to straighten out the corresponding flows, from which quasi-periodic solutions for these differential-difference equations are obtained resorting to the Riemann-theta functions. Moreover, a (2+1)-dimensional discrete coupled derivative nonlinear Schroedinger equation is proposed and its quasi-periodic solutions are derived

  14. Form-preserving Transformations for the Time-dependent Schroedinger Equation in (n + 1) Dimensions

    International Nuclear Information System (INIS)

    Schulze-Halberg, Axel

    2006-01-01

    We define a form-preserving transformation (also called point canonical transformation) for the time-dependent Schroedinger equation (TDSE) in (n+1) dimensions. The form-preserving transformation is shown to be invertible and to preserve L 2 -normalizability. We give a class of time-dependent TDSEs that can be mapped onto stationary Schroedinger equations by our form-preserving transformation. As an example, we generate a solvable, time-dependent potential of Coulombic ring-shaped type together with the corresponding exact solution of the TDSE in (3+1) dimensions. We further consider TDSEs with position-dependent (effective) masses and show that there is no form-preserving transformation between them and the conventional TDSEs, if the spatial dimension of the system is higher than one

  15. Continuous analog of Newton's method for determination of quasistationary solutions of the Schroedinger equation

    International Nuclear Information System (INIS)

    Ponomarev, L.I.; Puzynin, I.V.; Puzynina, T.P.

    1975-01-01

    The paper is a part of further development of investigations in which a numerical solution method of the Schroedinger equation for the case of a discrete spectrum has been developed and applied. The suggested algorithm (CAMEN scheme) is generalized and applied to quasistationary solutions of the Schroedinger equation system. Some specific features of the CAMEN scheme realization (such as establishing boundary conditions are observed while calculating quasistationary levels of hydrogen mesic molecules. The calculations have been carried out for energies and wave functions of quasistationary states of hydrogen mesic molecules. The choice of the initial approximation, the accuracy of calculations and characteristics of the convergence of the method have been investigated. The CAMEN algorithm has been realized in the form of the FORTRAN program packet. The CAMEN scheme can be also used for solving scatering problems

  16. Bell's theorem and quantum realism. Reassessment in light of the Schroedinger paradox

    International Nuclear Information System (INIS)

    Shakur, Asif M.; Hemmick, Douglas L.

    2012-01-01

    Quantum theory presents a strange picture of the world, offering no real account of physical properties apart from observation. Neils Bohr felt that this reflected a core truth of nature: ''There is no quantum world. There is only an abstract mathematical description.'' Among the most significant developments since Bohr's day has been the theorem of John S. Bell. It is important to consider whether Bell's analysis supports such a denial of microrealism. In this book, we evaluate the situation in terms of an early work of Erwin Schroedinger. Doing so, we see how Bell's theorem is conceptually related to the Conway and Kochen Free Will theorem and also to all the major anti-realism efforts. It is easy to show that none of these analyses imply the impossibility of objective realism. We find that Schroedinger's work leads to the derivation of a new series of theoretical proofs and potential experiments, each involving ''entanglement,'' the link between particles in some quantum systems. (orig.)

  17. Quantum Gelfand-Levitan equations for nonlinear Schroedinger model of spin-1/2 particles

    International Nuclear Information System (INIS)

    Pu, F.; Zhao, B.

    1984-01-01

    The quantum Gelfand-Levitan equations for the nonlinear Schroedinger model of spin-(1/2) particles are obtained. Two Izergin-Korepin relations are used in the derivation. A new type commutation relation of L operators is introduced to get the commutation relations which are needed for the study of S matrices and Green's functions. As examples, the four-point Green's functions and the two-body S matrices are given

  18. Breather type solutions of the vector nonlinear Schroedinger equation with quasi-constant boundary conditions

    International Nuclear Information System (INIS)

    Makhan'kov, V.G.; Slavov, S.I.

    1989-01-01

    Vector nonlinear Schroedinger equations (VS3) is investigated under quasi-constant boundary conditions. New two-soliton solutions are obtained with such non-trivial dynamics that they may be called the breather solutions. A version of the basic Novikov-Dubrovin-Krichever algebro-geometrical approach is applied to obtain breather like solutions existing for all types of internal symmetry is specified are formulated in terms of the soliton velocity expressed via the parameters of the problem. 4 refs

  19. Exact solutions of fractional Schroedinger-like equation with a nonlocal term

    International Nuclear Information System (INIS)

    Jiang Xiaoyun; Xu Mingyu; Qi Haitao

    2011-01-01

    We study the time-space fractional Schroedinger equation with a nonlocal potential. By the method of Fourier transform and Laplace transform, the Green function, and hence the wave function, is expressed in terms of H-functions. Graphical analysis demonstrates that the influence of both the space-fractal parameter α and the nonlocal parameter ν on the fractional quantum system is strong. Indeed, the nonlocal potential may act similar to a fractional spatial derivative as well as fractional time derivative.

  20. SOq(N) covariant differential calculus on quantum space and quantum deformation of Schroedinger equation

    International Nuclear Information System (INIS)

    Carow-Watamura, U.; Schlieker, M.; Watamura, S.

    1991-01-01

    We construct a differential calculus on the N-dimensional non-commutative Euclidean space, i.e., the space on which the quantum group SO q (N) is acting. The differential calculus is required to be manifestly covariant under SO q (N) transformations. Using this calculus, we consider the Schroedinger equation corresponding to the harmonic oscillator in the limit of q→1. The solution of it is given by q-deformed functions. (orig.)

  1. One-dimensional Schroedinger operators with interactions singular on a discrete set

    International Nuclear Information System (INIS)

    Gesztesy, F.; Kirsch, W.

    We study the self-adjointness of Schroedinger operators -d 2 /dx 2 +V(x) on an arbitrary interval, (a,b) with V(x) locally integrable on (a,b)inverse slantX where X is a discrete set. The treatment of quantum mechanical systems describing point interactions or periodic (possibly strongly singular) potentials is thereby included and explicit examples are presented. (orig.)

  2. On a minimization of the eigenvalues of Schroedinger operator relatively domains

    International Nuclear Information System (INIS)

    Gasymov, Yu.S.; Niftiev, A.A.

    2001-01-01

    Minimization of the eigenvalues plays an important role in the operators spectral theory. The problem on the minimization of the eigenvalues of the Schroedinger operator by areas is considered in this work. The algorithm, analogous to the conditional gradient method, is proposed for the numerical solution of this problem in the common case. The result is generalized for the case of the positively determined completely continuous operator [ru

  3. On the discrete spectrum of non-self-adjoint Schroedinger differential equation with an operator coefficient

    International Nuclear Information System (INIS)

    Bayramoglu, Mehmet; Tasci, Fatih; Zeynalov, Djafar

    2004-01-01

    We study the discrete part of spectrum of a singular non-self-adjoint second-order differential equation on a semiaxis with an operator coefficient. Its boundedness is proved. The result is applied to the Schroedinger boundary value problem -Δu+q(x)u=λ 2 u, u vertical bar ∂D =0, with a complex potential q(x) in an angular domain

  4. An evaluation of diverse methods of obtaining effective Schroedinger interaction potentials for elastic scattering

    International Nuclear Information System (INIS)

    Amos, K.; Allen, L.J.; Steward, C.; Hodgson, P.E.; Sofianos, S.A.

    1995-01-01

    Direct solution of the Schroedinger equation and inversion methods of analysis of elastic scattering data are considered to evaluate the information that they can provide about the physical interaction between colliding nuclear particles. It was found that both optical model and inversion methods based upon inverse scattering theories are subject to ambiguities. Therefore, it is essential that elastic scattering data analyses are consistent with microscopic calculations of the potential. 25 refs

  5. An evaluation of diverse methods of obtaining effective Schroedinger interaction potentials for elastic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Amos, K.; Allen, L.J.; Steward, C. [Melbourne Univ., Parkville, VIC (Australia). School of Physics; Hodgson, P.E. [Oxford Univ. (United Kingdom). Dept. of Physics; Sofianos, S.A. [University of South Africa (UNISA), Pretoria (South Africa). Dept. of Physics

    1995-10-01

    Direct solution of the Schroedinger equation and inversion methods of analysis of elastic scattering data are considered to evaluate the information that they can provide about the physical interaction between colliding nuclear particles. It was found that both optical model and inversion methods based upon inverse scattering theories are subject to ambiguities. Therefore, it is essential that elastic scattering data analyses are consistent with microscopic calculations of the potential. 25 refs.

  6. Regularity of the Rotation Number for the One-Dimensional Time-Continuous Schroedinger Equation

    Energy Technology Data Exchange (ETDEWEB)

    Amor, Sana Hadj, E-mail: sana_hadjamor@yahoo.fr [Ecole Nationale d' Ingenieurs de Monastir (Tunisia)

    2012-12-15

    Starting from results already obtained for quasi-periodic co-cycles in SL(2, R), we show that the rotation number of the one-dimensional time-continuous Schroedinger equation with Diophantine frequencies and a small analytic potential has the behavior of a 1/2-Hoelder function. We give also a sub-exponential estimate of the length of the gaps which depends on its label given by the gap-labeling theorem.

  7. On exact solitary wave solutions of the nonlinear Schroedinger equation with a source

    International Nuclear Information System (INIS)

    Raju, T Solomon; Kumar, C Nagaraja; Panigrahi, Prasanta K

    2005-01-01

    We use a fractional transformation to connect the travelling wave solutions of the nonlinear Schroedinger equation (NLSE), phase locked with a source, to the elliptic equations satisfying, f-Prime ± af ± λf 3 = 0. The solutions are necessarily of rational form, containing both trigonometric and hyperbolic types as special cases. Bright and dark solitons, as well as singular solitons, are obtained in a suitable range of parameter values. (letter to the editor)

  8. Quasiseparation of variables in the Schroedinger equation with a magnetic field

    International Nuclear Information System (INIS)

    Charest, F.; Hudon, C.; Winternitz, P.

    2007-01-01

    We consider a two-dimensional integrable Hamiltonian system with a vector and scalar potential in quantum mechanics. Contrary to the case of a pure scalar potential, the existence of a second order integral of motion does not guarantee the separation of variables in the Schroedinger equation. We introduce the concept of 'quasiseparation of variables' and show that in many cases it allows us to reduce the calculation of the energy spectrum and wave functions to linear algebra

  9. Asymptotic iteration method solutions to the d-dimensional Schroedinger equation with position-dependent mass

    International Nuclear Information System (INIS)

    Yasuk, F.; Tekin, S.; Boztosun, I.

    2010-01-01

    In this study, the exact solutions of the d-dimensional Schroedinger equation with a position-dependent mass m(r)=1/(1+ζ 2 r 2 ) is presented for a free particle, V(r)=0, by using the method of point canonical transformations. The energy eigenvalues and corresponding wavefunctions for the effective potential which is to be a generalized Poeschl-Teller potential are obtained within the framework of the asymptotic iteration method.

  10. Oscillatory integrals on Hilbert spaces and Schroedinger equation with magnetic fields

    International Nuclear Information System (INIS)

    Albeverio, S.; Brzezniak, Z.

    1994-01-01

    We extend the theory of oscillatory integrals on Hilbert spaces (the mathematical version of ''Feynman path integrals'') to cover more general integrable functions, preserving the property of the integrals to have converging finite dimensional approximations. We give an application to the representation of solutions of the time dependent Schroedinger equation with a scalar and a magnetic potential by oscillatory integrals on Hilbert spaces. A relation with Ramer's functional in the corresponding probabilistic setting is found. (orig.)

  11. Nonstationary quantum mechanics. 4. Nonadiabatic properties of the Schroedinger equation in adiabatic processes

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, N S [Low Temperature Department of the Institute of Solid State Physics of the Bulgarian Academy of Sciences, Sofia

    1981-04-01

    It is shown that the nonstationary Schroedinger equation does not satisfy a well-known adiabatical principle in thermodynamics. A ''renormalization procedure'' based on the possible existence of a time-irreversible basic evolution equation is proposed with the help of which one comes to agreement in a variety of specific cases of an adiabatic inclusion of a perturbing potential. The ideology of the present article rests essentially on the ideology of the preceding articles, in particular article I.

  12. Nonstationary quantum mechanics. IV. Nonadiabatic properties of the Schroedinger equation in adiabatic processes

    Energy Technology Data Exchange (ETDEWEB)

    Todorov, N S

    1981-04-01

    It is shown that the nonstationary Schroedinger equation does not satisfy a well-known adiabatical principle in thermodynamics. A ''renormalization procedure'' based on the possible existence of a time-irreversible basic evolution equation is proposed with the help of which one comes to agreement in a variety of specific cases of an adiabatic inclusion of a perturbing potential. The ideology of the present article IV rests essentially on the ideology of the preceding articles, in particular article I.

  13. The harmonic oscillator and the position dependent mass Schroedinger equation: isospectral partners and factorization operators

    International Nuclear Information System (INIS)

    Morales, J.; Ovando, G.; Pena, J. J.

    2010-01-01

    One of the most important scientific contributions of Professor Marcos Moshinsky has been his study on the harmonic oscillator in quantum theory vis a vis the standard Schroedinger equation with constant mass [1]. However, a simple description of the motion of a particle interacting with an external environment such as happen in compositionally graded alloys consist of replacing the mass by the so-called effective mass that is in general variable and dependent on position. Therefore, honoring in memoriam Marcos Moshinsky, in this work we consider the position-dependent mass Schrodinger equations (PDMSE) for the harmonic oscillator potential model as former potential as well as with equi-spaced spectrum solutions, i.e. harmonic oscillator isospectral partners. To that purpose, the point canonical transformation method to convert a general second order differential equation (DE), of Sturm-Liouville type, into a Schroedinger-like standard equation is applied to the PDMSE. In that case, the former potential associated to the PDMSE and the potential involved in the Schroedinger-like standard equation are related through a Riccati-type relationship that includes the equivalent of the Witten superpotential to determine the exactly solvable positions-dependent mass distribution (PDMD)m(x). Even though the proposed approach is exemplified with the harmonic oscillator potential, the procedure is general and can be straightforwardly applied to other DEs.

  14. The discretized Schroedinger equation and simple models for semiconductor quantum wells

    International Nuclear Information System (INIS)

    Boykin, Timothy B; Klimeck, Gerhard

    2004-01-01

    The discretized Schroedinger equation is one of the most commonly employed methods for solving one-dimensional quantum mechanics problems on the computer, yet many of its characteristics remain poorly understood. The differences with the continuous Schroedinger equation are generally viewed as shortcomings of the discrete model and are typically described in purely mathematical terms. This is unfortunate since the discretized equation is more productively viewed from the perspective of solid-state physics, which naturally links the discrete model to realistic semiconductor quantum wells and nanoelectronic devices. While the relationship between the discrete model and a one-dimensional tight-binding model has been known for some time, the fact that the discrete Schroedinger equation admits analytic solutions for quantum wells has gone unnoted. Here we present a solution to this new analytically solvable problem. We show that the differences between the discrete and continuous models are due to their fundamentally different bandstructures, and present evidence for our belief that the discrete model is the more physically reasonable one

  15. An inverse boundary value problem for the Schroedinger operator with vector potentials in two dimensions

    International Nuclear Information System (INIS)

    Ziqi Sun

    1993-01-01

    During the past few years a considerable interest has been focused on the inverse boundary value problem for the Schroedinger operator with a scalar (electric) potential. The popularity gained by this subject seems to be due to its connection with the inverse scattering problem at fixed energy, the inverse conductivity problem and other important inverse problems. This paper deals with an inverse boundary value problem for the Schroedinger operator with vector (electric and magnetic) potentials. As in the case of the scalar potential, results of this study would have immediate consequences in the inverse scattering problem for magnetic field at fixed energy. On the other hand, inverse boundary value problems for elliptic operators are of independent interest. The study is partly devoted to the understanding of the inverse boundary value problem for a class of general elliptic operator of second order. Note that a self-adjoint elliptic operator of second order with Δ as its principal symbol can always be written as a Schroedinger operator with vector potentials

  16. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  17. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  18. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  19. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  20. Francis Bacon's New Science: Rhetoric and the Transformative Power of Print.

    Science.gov (United States)

    Heckel, David

    The process of projecting textual models onto the phenomenal world began with the invention of writing and accelerated through the manuscript culture of classical antiquity and the Middle Ages into the age of print. In Francis Bacon's work, the book (a metaphor for the phenomenal world) adapted to the demands of the printed text and reflects the…

  1. The Culture of Science and the Rhetoric of Scientism: From Francis Bacon to the Darwin Fish

    Science.gov (United States)

    Lessl, Thomas M.

    2007-01-01

    The culture of modern science continues to establish its public identity by appealing to values and historical conceptions that reflect its appropriation of various religious ideals during its formative period, most especially in the rhetoric of Francis Bacon. These elements have persisted because they continue to achieve similar goals, but the…

  2. Internal consistency of a Spanish translation of the Francis Scale of Attitude Toward Christianity Short Form.

    Science.gov (United States)

    Campo-Arias, Adalberto; Oviedo, Heidi Celina; Díaz, Carmen Elena; Cogollo, Zuleima

    2006-12-01

    This study evaluated the internal consistency of a Spanish version of the short form of the Francis Scale of Attitude Toward Christianity based on responses of 405 Colombian adolescent students ages 13 to 17 years. This translated short-form version of the scale had an internal consistency of .80. This estimate indicates suitable internal consistency reliability for research use in this population.

  3. "Ajaloo lõpp" on lähedal / Francis Fukuyama ; interv. Adam Piore

    Index Scriptorium Estoniae

    Fukuyama, Francis

    2003-01-01

    Ajakirjas Newsweek ilmunud intervjuus vastab filosoof Francis Fukuyama küsimustele 2004. aasta kõige olulisemate probleemide, EL-i, Cancunis toimunud Maailma Kaubandusorganisatsiooni kõneluste, ajaloo lõppu jõudmise, Pakistani presidendile tehtud atentaadi kohta

  4. Power Swing Generated in Francis Turbines by Part Load and Overload Instabilities

    Directory of Open Access Journals (Sweden)

    David Valentín

    2017-12-01

    Full Text Available Hydropower plays a key role in the actual energy market due to its fast response and regulation capacity. In that way, hydraulic turbines are increasingly demanded to work at off-design conditions, where complex flow patterns and cavitation appear, especially in Francis turbines. The draft tube cavitation surge is a hydraulic phenomenon that appears in Francis turbines below and above its Best Efficiency Point (BEP. It is a low frequency phenomenon consisting of a vortex rope in the runner outlet and draft tube, which can become unstable when its frequency coincides with a natural frequency of the hydraulic circuit. At this situation, the output power can significantly swing, endangering the electrical grid stability. This study is focused on the detection of these instabilities in Francis turbines and their relationship with the output power swings. To do so, extensive experimental tests for different operating conditions have been carried out in a large prototype Francis turbine (444 MW of rated power within the frame of the European Project Hyperbole (FP7-ENERGY-2013-1. Several sensors have been installed in the hydraulic circuit (pressure sensors in the draft tube, spiral casing, and penstock, in the rotating and static structures (vibration sensors, proximity probes, and strain gauges in the runner and in the shaft, as well as in the electrical side (output power, intensity, and voltage. Moreover, a numerical Finite Element Method (FEM has been also used to relate the hydraulic excitation with the output power swing.

  5. Francis Farley presenting his novel "Catalysed Fusion" in the CERN Library

    CERN Multimedia

    Farley, Irina

    2013-01-01

    "Catalysed Fusion" is described by its author Francis Farley, 92, as a "true-to-life fantasy woven around particle physics" set in 1980s Geneva – "the city where nations meet and particles collide". Farley presented the book in the program "Literature in Focus" on Tuesday 16th April 2013.

  6. Hydraulic Turbines: The Francis Turbine. Technical Terminology Bulletin. Terminotech, Vol. 2, No. 2.

    Science.gov (United States)

    General Electric Co. of Canada, Ltd., Montreal, Quebec.

    This issue of a bulletin of technological terminology is devoted to the Francis turbine. A brief narrative on the subject is presented in both French and English. An English-French dictionary of terms comprises the bulk of the document. An explanatory illustration is appended. (JB)

  7. Saint Francis Xavier on Jesuit School Stages of the Bohemian Province

    Czech Academy of Sciences Publication Activity Database

    Bobková, Kateřina; Jacková, Magdaléna

    2015-01-01

    Roč. 25, č. 2 (2015), s. 135-155 ISSN 0515-3190 R&D Projects: GA ČR GPP406/12/P823 Institutional support: RVO:68378068 ; RVO:67985963 Keywords : St. Francis Xavier * Jesuit saints * Jesuit theatre * neolatin drama * school theatre * Avancini, Nicolaus * Engel, Arnoldus Subject RIV: AJ - Letters, Mass-media, Audiovision; AB - History (HIU-Y)

  8. Inventing Citizens, Imagining Gender Justice: The Suffrage Rhetoric of Virginia and Francis Minor

    Science.gov (United States)

    Ray, Angela G.; Richards, Cindy Koenig

    2007-01-01

    From the late 1860s through the mid-1870s, woman suffrage activists developed an ingenious legal argument, claiming that the U.S. Constitution already enfranchised women citizens. The argument, first articulated by St. Louis activists Virginia and Francis Minor, precipitated rhetorical performances by movement activists on public platforms and in…

  9. Glade/woodland restoration in the St. Francis Mountain Bird Conservation Area

    Science.gov (United States)

    David A. Hasenbeck

    2007-01-01

    The Missouri Department of Conservation (MDC), the Missouri Department of Natural Resources, the U.S. Forest Service, and American Bird Conservancy, share goals to restore and manage high quality glade, savanna, and woodland habitats within the Saint Francis Bird Conservation Area. The partnership endeavors to maintain and enhance an ecosystem with native glade and...

  10. Validez y confiabilidad de la escala breve de Francis para actitud ante el cristianismo

    Directory of Open Access Journals (Sweden)

    Zuleima Cogollo

    2012-04-01

    Resultados. La escala Francis-5 mostró una estructura unidimensional, con un valor propio de 3,681 que dio cuenta del 73,6% de la varianza. Las mujeres puntuaron significativamente mayor que los varones, 18,5 (DE=2,7 vs. 17,9 (DE=3,3 (t = 4,3; p

  11. 78 FR 59913 - Revision of the Land Management Plan for the Francis Marion National Forest

    Science.gov (United States)

    2013-09-30

    ... telecommunication devices for the deaf (TDD) may call the Federal Information Relay Service (FIRS) at 1-800- 877... planning process can also be found on the Francis Marion National Forest Web site at www.fs.usda.gov/goto/scnfs/fmplan . SUPPLEMENTARY INFORMATION: Pursuant to the 2012 Forest Planning Rule (36 CFR Part 219...

  12. Hydrologic and water quality monitoring on Turkey Creek watershed, Francis Marion National Forest, SC

    Science.gov (United States)

    D.M. Amatya; T.J. Callahan; A. Radecki-Pawlik; P. Drewes; C. Trettin; W.F. Hansen

    2008-01-01

    The re-initiation of a 7,260 ha forested watershed study on Turkey Creek, a 3rd order stream, within the Francis Marion National forest in South Carolina, completes the development of a multi-scale hydrology and ecosystem monitoring framework in the Atlantic Coastal Plain. Hydrology and water quality monitoring began on the Santee Experimental...

  13. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  14. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick

  16. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  17. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  18. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  19. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  20. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  1. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  2. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  3. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  4. The Internal Consistency Reliability of the Katz-Francis Scale of Attitude toward Judaism among Australian Jews

    Directory of Open Access Journals (Sweden)

    Patrick Lumbroso

    2016-09-01

    Full Text Available The Katz-Francis Scale of Attitude toward Judaism was developed initially to extend among the Hebrew-speaking Jewish community in Israel a growing body of international research concerned to map the correlates, antecedents and consequences of individual differences in attitude toward religion as assessed by the Francis Scale of Attitude toward Christianity. The present paper explored the internal consistency reliability and construct validity of the English translation of the Katz-Francis Scale of Attitude toward Judaism among 101 Australian Jews. On the basis of these data, this instrument is commended for application in further research.

  5. On norm resolvent convergence of Schroedinger operators with δ'-like potentials

    International Nuclear Information System (INIS)

    Golovaty, Yu D; Hryniv, R O

    2010-01-01

    For a function V:R→R that is integrable and compactly supported, we prove the norm resolvent convergence, as ε → 0, of a family S ε of one-dimensional Schroedinger operators on the line of the form S ε :=-d 2 /dx 2 + 1/ε 2 V(x/ε). If the potential V satisfies the conditions ∫ R V(ξ)dξ=0, ∫ R ξV(ξ)dξ=-1, then the functions ε -2 V(x/ε) converge in the sense of distributions as ε → 0 to δ'(x), and the limit S 0 of S ε might be considered as a 'physically motivated' interpretation of the one-dimensional Schroedinger operator with a potential δ'. In 1985, Seba claimed that the limit operator S 0 is the direct sum of the free Schroedinger operators on positive and negative semi-axes subject to the Dirichlet condition at x = 0, which suggested that in dimension 1 there is no non-trivial Hamiltonian with the potential δ'. In this paper, we show that in fact S 0 essentially depends on V: although the above results are true generically, in the exceptional (or 'resonant') case, the limit S 0 is non-trivial and is determined by the properties of an auxiliary Sturm-Liouville spectral problem associated with V. We then set V(ξ) = αΨ(ξ) with a fixed Ψ and show that there exists a countable set of resonances {α k } ∞ k=-∞ for which a partial transmission of the wave package occurs for S 0 .

  6. Quasi-classical derivation of the Dirac and one-particle Schroedinger equations

    International Nuclear Information System (INIS)

    Wignall, J.W.G.

    1990-08-01

    The quasi-classical approach, in which particles are regarded as extended periodic excitations of a classical nonlinear field, is for the first time applied quantitatively in the quantum domain. It is shown that the twofold intrinsic 'spin' degree of freedom possessed by an electron can be interpreted in a purely classical way, and that the Lorentz covariant incorporation of this degree of freedom requires that the spacetime evolution of an electron excitation in a prescribed external field be given by the Dirac equation and hence, in the nonrelativistic limit, by the Pauli or Schroedinger one-particle equations. 17 refs

  7. Genus two finite gap solutions to the vector nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Woodcock, Thomas; Warren, Oliver H; Elgin, John N

    2007-01-01

    A recently published article presents a technique used to derive explicit formulae for odd genus solutions to the vector nonlinear Schroedinger equation. In another article solutions of genus two are derived using a different approach which assumes a separable ansatz. In this communication, the extension of the first technique to the even genus case is discussed, and this extension is carried out explicitly for genus two. Furthermore, a birational mapping is found between the spectral curves that arise in the two approaches. (fast track communication)

  8. Chirped self-similar solutions of a generalized nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Fei Jin-Xi [Lishui Univ., Zhejiang (China). College of Mathematics and Physics; Zheng Chun-Long [Shaoguan Univ., Guangdong (China). School of Physics and Electromechanical Engineering; Shanghai Univ. (China). Shanghai Inst. of Applied Mathematics and Mechanics

    2011-01-15

    An improved homogeneous balance principle and an F-expansion technique are used to construct exact chirped self-similar solutions to the generalized nonlinear Schroedinger equation with distributed dispersion, nonlinearity, and gain coefficients. Such solutions exist under certain conditions and impose constraints on the functions describing dispersion, nonlinearity, and distributed gain function. The results show that the chirp function is related only to the dispersion coefficient, however, it affects all of the system parameters, which influence the form of the wave amplitude. As few characteristic examples and some simple chirped self-similar waves are presented. (orig.)

  9. Minimal gravitational coupling in the Newtonian theory and the covariant Schroedinger equation

    International Nuclear Information System (INIS)

    Duval, C.; Kuenzle, H.P.

    1983-02-01

    The role of the Bargmann group (11-dimensional extended Galilei group) in non relativistic gravitation theory is investigated. The generalized Newtonian gravitation theory (Newton-Cartan theory) achieves the status of a gauge theory about as much as General Relativity and couples minimally to a complex scalar field leading to a fourdimensionally covariant Schroedinger equation. Matter current and stress-energy tensor follow correctly from the Lagrangian. This theory on curved Newtonian space-time is also shown to be a limit of the Einstein-Klein-Gordon theory

  10. Dynamical theory of neutron diffraction. [One-body Schroedinger equation, review

    Energy Technology Data Exchange (ETDEWEB)

    Sears, V F [Atomic Energy of Canada Ltd., Chalk River, Ontario. Chalk River Nuclear Labs.

    1978-10-01

    We present a review of the dynamical theory of neutron diffraction by macroscopic bodies which provides the theoretical basis for the study of neutron optics. We consider both the theory of dispersion, in which it is shown that the coherent wave in the medium satisfies a macroscopic one-body Schroedinger equation, and the theory of reflection, refraction, and diffraction in which the above equation is solved for a number of special cases of interest. The theory is illustrated with the help of experimental results obtained over the past 10 years by a number of new techniques such as neutron gravity refractometry. Pendelloesung interference, and neutron interferometry.

  11. Quantum scattering via the discretisation of Schroedinger's equation

    Energy Technology Data Exchange (ETDEWEB)

    Alexopoulos, A. [Electronic Warfare and Radar Division, Defence Science and Technology Organisation (DSTO), PO Box 1500, Edinburgh 5111 (Australia)]. E-mail: aris.alexopoulos@dsto.defence.gov.au

    2007-03-19

    We obtain the scattering matrix for particles that encounter a quantum potential by discretising Schroedinger's time independent differential equation without the need to resort to the manipulation of the eigenfunctions directly. The singularities that arise in some solutions by other methods are handled with ease including the effects of resonances while convergence is excellent in all limits with only a small number of orders required to give accurate results. Our method compares the tunnelling probability with that of the WKB theory, exact numerical solutions and the modified Airy function method.

  12. Path space measures for Dirac and Schroedinger equations: Nonstandard analytical approach

    International Nuclear Information System (INIS)

    Nakamura, T.

    1997-01-01

    A nonstandard path space *-measure is constructed to justify the path integral formula for the Dirac equation in two-dimensional space endash time. A standard measure as well as a standard path integral is obtained from it. We also show that, even for the Schroedinger equation, for which there is no standard measure appropriate for a path integral, there exists a nonstandard measure to define a *-path integral whose standard part agrees with the ordinary path integral as defined by a limit from time-slice approximant. copyright 1997 American Institute of Physics

  13. Arbitrary l-wave solutions of the Schroedinger equation for the screen Coulomb potential

    International Nuclear Information System (INIS)

    Dong, Shishan; Sun, Guohua; Dong, Shihai

    2013-01-01

    Using improved approximate schemes for centrifugal term and the singular factor 1/r appearing in potential itself, we solve the Schroedinger equation with the screen Coulomb potential for arbitrary angular momentum state l. The bound state energy levels are obtained. A closed form of normalization constant of the wave functions is also found. The numerical results show that our results are in good agreement with those obtained by other methods. The key issue is how to treat two singular points in this quantum system. (author)

  14. Solution of Schroedinger Equation for Two-Dimensional Complex Quartic Potentials

    International Nuclear Information System (INIS)

    Singh, Ram Mehar; Chand, Fakir; Mishra, S. C.

    2009-01-01

    We investigate the quasi-exact solutions of the Schroedinger wave equation for two-dimensional non-hermitian complex Hamiltonian systems within the frame work of an extended complex phase space characterized by x = x 1 + ip 3 , y = x 2 + ip 4 , p x = p 1 + ix 3 , p y = p 2 + ix 4 . Explicit expressions of the energy eigenvalues and the eigenfunctions for ground and first excited states for a complex quartic potential are obtained. Eigenvalue spectra of some variants of the complex quartic potential, including PT-symmetric one, are also worked out. (general)

  15. Transfer matrix in 1D Schroedinger problems with constant and position-dependent mass

    International Nuclear Information System (INIS)

    Perez-Alvarez, R.; Rodriguez-Coppola, H.

    1987-10-01

    We consider the transfer matrix method for obtaining properties of standard wells and barriers in one-dimensional Schroedinger problems with constant and position-dependent mass. We report the formulae for the energy levels of a well and the transmission coefficient of a barrier. We demonstrate the continuity between virtual bound states and bound states in a well of position-dependent mass and the relation between the zero energy gap states of a periodic potential problem with the corresponding energies of the non-periodic ones with transmission coefficient equal to one. The calculations were carried out for a wide class of potential profiles. (author). 30 refs, 2 figs

  16. Auxiliary fields as a tool for computing analytical solutions of the Schroedinger equation

    International Nuclear Information System (INIS)

    Silvestre-Brac, Bernard; Semay, Claude; Buisseret, Fabien

    2008-01-01

    We propose a new method to obtain approximate solutions for the Schroedinger equation with an arbitrary potential that possesses bound states. This method, relying on the auxiliary field technique, allows to find in many cases, analytical solutions. It offers a convenient way to study the qualitative features of the energy spectrum of bound states in any potential. In particular, we illustrate our method by solving the case of central potentials with power-law form and with logarithmic form. For these types of potentials, we propose very accurate analytical energy formulae which greatly improves the corresponding formulae that can be found in the literature

  17. Auxiliary fields as a tool for computing analytical solutions of the Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Silvestre-Brac, Bernard [LPSC Universite Joseph Fourier, Grenoble 1, CNRS/IN2P3, Institut Polytechnique de Grenoble, Avenue des Martyrs 53, F-38026 Grenoble-Cedex (France); Semay, Claude; Buisseret, Fabien [Groupe de Physique Nucleaire Theorique, Universite de Mons-Hainaut, Academie universitaire Wallonie-Bruxelles, Place du Parc 20, B-7000 Mons (Belgium)], E-mail: silvestre@lpsc.in2p3.fr, E-mail: claude.semay@umh.ac.be, E-mail: fabien.buisseret@umh.ac.be

    2008-07-11

    We propose a new method to obtain approximate solutions for the Schroedinger equation with an arbitrary potential that possesses bound states. This method, relying on the auxiliary field technique, allows to find in many cases, analytical solutions. It offers a convenient way to study the qualitative features of the energy spectrum of bound states in any potential. In particular, we illustrate our method by solving the case of central potentials with power-law form and with logarithmic form. For these types of potentials, we propose very accurate analytical energy formulae which greatly improves the corresponding formulae that can be found in the literature.

  18. Toward an AdS/cold atoms correspondence: A geometric realization of the Schroedinger symmetry

    International Nuclear Information System (INIS)

    Son, D. T.

    2008-01-01

    We discuss a realization of the nonrelativistic conformal group (the Schroedinger group) as the symmetry of a spacetime. We write down a toy model in which this geometry is a solution to field equations. We discuss various issues related to nonrelativistic holography. In particular, we argue that free fermions and fermions at unitarity correspond to the same bulk theory with different choices for the near-boundary asymptotics corresponding to the source and the expectation value of one operator. We describe an extended version of nonrelativistic general coordinate invariance which is realized holographically.

  19. Exact solution of the Schroedinger equation with the spin-boson Hamiltonian

    International Nuclear Information System (INIS)

    Gardas, Bartlomiej

    2011-01-01

    We address the problem of obtaining the exact reduced dynamics of the spin-half (qubit) immersed within the bosonic bath (environment). An exact solution of the Schroedinger equation with the paradigmatic spin-boson Hamiltonian is obtained. We believe that this result is a major step ahead and may ultimately contribute to the complete resolution of the problem in question. We also construct the constant of motion for the spin-boson system. In contrast to the standard techniques available within the framework of the open quantum systems theory, our analysis is based on the theory of block operator matrices.

  20. Two-dimensional differential transform method for solving linear and non-linear Schroedinger equations

    International Nuclear Information System (INIS)

    Ravi Kanth, A.S.V.; Aruna, K.

    2009-01-01

    In this paper, we propose a reliable algorithm to develop exact and approximate solutions for the linear and nonlinear Schroedinger equations. The approach rest mainly on two-dimensional differential transform method which is one of the approximate methods. The method can easily be applied to many linear and nonlinear problems and is capable of reducing the size of computational work. Exact solutions can also be achieved by the known forms of the series solutions. Several illustrative examples are given to demonstrate the effectiveness of the present method.

  1. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Non-preturbative tuning

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, J. Gonzalez [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Renner, D.B. [Jefferson Lab, Newport News, VA (United States); Shindler, A. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik

    2012-08-23

    The use of chirally rotated boundary conditions provides a formulation of the Schroedinger functional that is compatible with automatic O(a) improvement of Wilson fermions up to O(a) boundary contributions. The elimination of bulk O(a) effects requires the non-perturbative tuning of the critical mass and one additional boundary counterterm. We present the results of such a tuning in a quenched setup for several values of the renormalized gauge coupling, from perturbative to nonperturbative regimes, and for a range of lattice spacings. We also check that the correct boundary conditions and symmetries are restored in the continuum limit. (orig.)

  2. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Non-preturbative tuning

    International Nuclear Information System (INIS)

    Lopez, J. Gonzalez; Jansen, K.; Renner, D.B.; Shindler, A.

    2012-01-01

    The use of chirally rotated boundary conditions provides a formulation of the Schroedinger functional that is compatible with automatic O(a) improvement of Wilson fermions up to O(a) boundary contributions. The elimination of bulk O(a) effects requires the non-perturbative tuning of the critical mass and one additional boundary counterterm. We present the results of such a tuning in a quenched setup for several values of the renormalized gauge coupling, from perturbative to nonperturbative regimes, and for a range of lattice spacings. We also check that the correct boundary conditions and symmetries are restored in the continuum limit. (orig.)

  3. Chaotic properties between the nonintegrable discrete nonlinear Schroedinger equation and a nonintegrable discrete Heisenberg model

    International Nuclear Information System (INIS)

    Ding Qing

    2007-01-01

    We prove that the integrable-nonintegrable discrete nonlinear Schroedinger equation (AL-DNLS) introduced by Cai, Bishop and Gronbech-Jensen (Phys. Rev. Lett. 72 591(1994)) is the discrete gauge equivalent to an integrable-nonintegrable discrete Heisenberg model from the geometric point of view. Then we study whether the transmission and bifurcation properties of the AL-DNLS equation are preserved under the action of discrete gauge transformations. Our results reveal that the transmission property of the AL-DNLS equation is completely preserved and the bifurcation property is conditionally preserved to those of the integrable-nonintegrable discrete Heisenberg model

  4. Minimal gravitational coupling in the Newtonian theory and the covariant Schroedinger equation

    International Nuclear Information System (INIS)

    Duval, C.; Kuenzle, H.P.

    1984-01-01

    The role of the Bargmann group (11-dimensional extended Galilei group) in nonrelativistic gravitation theory is investigated. The generalized Newtonian gravitation theory (Newton-Cartan theory) achieves the status of a gauge theory about as much as general relativity and couples minimally to a complex scalar field leading to a four-dimensionally covariant Schroedinger equation. Matter current and stress-energy tensor follow correctly from the Lagrangian. This theory on curved Newtonian space-time is also shown to be a limit of the Einstein-Klein-Gordon theory. (author)

  5. On form factors of the conjugated field in the non-linear Schroedinger model

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.K.

    2011-05-15

    Izergin-Korepin's lattice discretization of the non-linear Schroedinger model along with Oota's inverse problem provides one with determinant representations for the form factors of the lattice discretized conjugated field operator. We prove that these form factors converge, in the zero lattice spacing limit, to those of the conjugated field operator in the continuous model. We also compute the large-volume asymptotic behavior of such form factors in the continuous model. These are in particular characterized by Fredholm determinants of operators acting on closed contours. We provide a way of defining these Fredholm determinants in the case of generic paramaters. (orig.)

  6. Basic properties of the current-current correlation measure for random Schroedinger operators

    International Nuclear Information System (INIS)

    Hislop, Peter D.; Lenoble, Olivier

    2006-01-01

    The current-current correlation measure plays a crucial role in the theory of conductivity for disordered systems. We prove a Pastur-Shubin-type formula for the current-current correlation measure expressing it as a thermodynamic limit for random Schroedinger operators on the lattice and the continuum. We prove that the limit is independent of the self-adjoint boundary conditions and independent of a large family of expanding regions. We relate this finite-volume definition to the definition obtained by using the infinite-volume operators and the trace-per-unit volume

  7. Supersymmetric Solution of the Schroedinger Equation for Woods-Saxon Potential by Using the Pekeris Approximation

    International Nuclear Information System (INIS)

    Feizi, H.; Rajabi, A.A.; Shojaei, M.R.

    2011-01-01

    In this work, the three dimensional Woods-Saxon potential is studied within the context of Supersymmetry Quantum Mechanics. We have applied the SUSY method by using the Pekeris approximation to the centrifugal potential l ≠ 0 states. By application of this method, it is possible to solve the Schroedinger equation for this potential. We obtain exactly bound state spectrum and wave function of Woods-Saxon potential for nonzero angular momentum. Hamiltonian hierarchy method and the shape invariance property are used in the calculations. (authors)

  8. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Applications

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, J. Gonzalez [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik; Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Renner, D.B. [Jefferson Lab, Newport News, VA (United States); Shindler, A. [Humboldt-Universitaet, Berlin (Germany). Inst. fuer Physik

    2012-08-24

    In a previous paper (J. G. Lopez et al.,2012) we have discussed the non-perturbative tuning of the chirally rotated Schroedinger functional ({chi}SF). This tuning is required to eliminate bulk O(a) cutoff effects in physical correlation functions. Using our tuning results obtained in this paper we perform scaling and universality tests analyzing the residual O(a) cutoff effects of several step-scaling functions and we compute renormalization factors at the matching scale. As an example of possible application of the {chi}SF we compute the renormalized strange quark mass using large volume data obtained from Wilson twisted mass fermions at maximal twist. (orig.)

  9. A quenched study of the Schroedinger functional with chirally rotated boundary conditions. Applications

    International Nuclear Information System (INIS)

    Lopez, J. Gonzalez; Jansen, K.; Renner, D.B.; Shindler, A.

    2012-01-01

    In a previous paper (J. G. Lopez et al.,2012) we have discussed the non-perturbative tuning of the chirally rotated Schroedinger functional (χSF). This tuning is required to eliminate bulk O(a) cutoff effects in physical correlation functions. Using our tuning results obtained in this paper we perform scaling and universality tests analyzing the residual O(a) cutoff effects of several step-scaling functions and we compute renormalization factors at the matching scale. As an example of possible application of the χSF we compute the renormalized strange quark mass using large volume data obtained from Wilson twisted mass fermions at maximal twist. (orig.)

  10. Solitary wave solutions as a signature of the instability in the discrete nonlinear Schroedinger equation

    Energy Technology Data Exchange (ETDEWEB)

    Arevalo, Edward, E-mail: arevalo@temf.tu-darmstadt.d [Technische Universitaet Darmstadt, Institut fuer Theorie elektromagnetischer Felder, TEMF, Schlossgartenstr. 8, D-64289 Darmstadt (Germany)

    2009-09-21

    The effect of instability on the propagation of solitary waves along one-dimensional discrete nonlinear Schroedinger equation with cubic nonlinearity is revisited. A self-contained quasicontinuum approximation is developed to derive closed-form expressions for small-amplitude solitary waves. The notion that the existence of nonlinear solitary waves in discrete systems is a signature of the modulation instability is used. With the help of this notion we conjecture that instability effects on moving solitons can be qualitative estimated from the analytical solutions. Results from numerical simulations are presented to support this conjecture.

  11. From nonlinear Schroedinger hierarchy to some (2+1)-dimensional nonlinear pseudodifferential equations

    International Nuclear Information System (INIS)

    Yang Xiao; Du Dianlou

    2010-01-01

    The Poisson structure on C N xR N is introduced to give the Hamiltonian system associated with a spectral problem which yields the nonlinear Schroedinger (NLS) hierarchy. The Hamiltonian system is proven to be Liouville integrable. Some (2+1)-dimensional equations including NLS equation, Kadomtesev-Petviashvili I (KPI) equation, coupled KPI equation, and modified Kadomtesev-Petviashvili (mKP) equation, are decomposed into Hamilton flows via the NLS hierarchy. The algebraic curve, Abel-Jacobi coordinates, and Riemann-Jacobi inversion are used to obtain the algebrogeometric solutions of these equations.

  12. A Greenian approach to the solution of the Schroedinger equation for periodic lattice potentials

    International Nuclear Information System (INIS)

    Minelli, T.A.

    1976-01-01

    A modified structural Green's function (MSGF), exploiting all the information contained in the previously solved Schroedinger equation for the electron interacting with a single lattice site, has been introduced and used in order to obtain, from a Dyson-type equation, a kernel whose poles and residues give the E-vs.-k relation and, respectively, the Bloch functions. Such a formulation suggests an alternative technique for the approximate solution of the KKR equations. The MSGF formalism has been also used in order to determine the structure constants of a one-dimensional lattice in a general representation

  13. Internal consistency of a five-item form of the Francis Scale of Attitude Toward Christianity among adolescent students.

    Science.gov (United States)

    Campo-Arias, Adalberto; Oviedo, Heidi Celina; Cogollo, Zuleima

    2009-04-01

    The short form of the Francis Scale of Attitude Toward Christianity (L. J. Francis, 1992) is a 7-item Likert-type scale that shows high homogeneity among adolescents. The psychometric performance of a shorter version of this scale has not been explored. The authors aimed to determine the internal consistency of a 5-item form of the Francis Scale of Attitude Toward Christianity among 405 students from a school in Cartagena, Colombia. The authors computed the Cronbach's alpha coefficient for the 5 items with a greater corrected item-total punctuation correlation. The version without Items 2 and 7 showed internal consistency of .87. The 5-item version of the Francis Scale of Attitude Toward Christianity exhibited higher internal consistency than did the 7-item version. Future researchers should corroborate this finding.

  14. Effects of draft tube on the hydraulic performance of a Francis turbine

    International Nuclear Information System (INIS)

    Jeon, J H; Byeon, S S; Kim, Y J

    2013-01-01

    The draft tube is an important component of a Francis turbine which influences the hydraulic performance. It is located just under the runner and allowed to decelerate the flow velocity exiting the runner, thereby converting the excess of kinetic energy into static pressure. In this study, we have numerically investigated the hydraulic performance of a Francis turbine on the 15MW hydropower generation with various design parameters (three types of draft tube, thickness of guide vane) through a three-dimensional numerical method with the SST turbulent model. The vortex rope characteristics of the draft tube were confirmed. The results of the vortex flow fields and flow characteristics were graphically depicted with different design parameters and operating conditions

  15. Robust Finite-Time Terminal Sliding Mode Control for a Francis Hydroturbine Governing System

    Directory of Open Access Journals (Sweden)

    Fengjiao Wu

    2016-01-01

    Full Text Available The robust finite-time control for a Francis hydroturbine governing system is investigated in this paper. Firstly, the mathematical model of a Francis hydroturbine governing system is presented and the nonlinear vibration characteristics are analyzed. Then, on the basis of finite-time control theory and terminal sliding mode scheme, a new robust finite-time terminal sliding mode control method is proposed for nonlinear vibration control of the hydroturbine governing system. Furthermore, the designed controller has good robustness which could resist external random disturbances. Numerical simulations are employed to verify the effectiveness and superiority of the designed finite-time sliding mode control scheme. The approach proposed in this paper is simple and also provides a reference for relevant hydropower systems.

  16. Experimental investigations of the unsteady flow in a Francis turbine draft tube cone

    International Nuclear Information System (INIS)

    Baya, A; Muntean, S; Campian, V C; Cuzmos, A; Diaconescu, M; Balan, G

    2010-01-01

    Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.

  17. Experimental investigations of the unsteady flow in a Francis turbine draft tube cone

    Energy Technology Data Exchange (ETDEWEB)

    Baya, A [Department of Hydraulic Machinery, ' Politehnica' University of Timisoara Bv. Mihai Viteazu 1, RO-300222, Timisoara (Romania); Muntean, S [Centre of Advanced Research in Engineering Sciences, Romanian Academy - Timisoara Branch Bv. Mihai Viteazu 24, RO-300223, Timisoara (Romania); Campian, V C; Cuzmos, A [Research Center in Hydraulics, Automation and Heat Transfer, ' Eftimie Murgu' University of Resita P-ta. Traian Vuia 1-4, RO-320085, Resita (Romania); Diaconescu, M; Balan, G, E-mail: abaya@mh.mec.upt.r [Ramnicu Valcea Subsidiary, S.C. Hidroelectrica S.A. Str. Decebal 11, RO-240255, Ramnicu Valcea (Romania)

    2010-08-15

    Operating Francis turbines at partial discharge is often hindered by the development of the helical vortex (so-called vortex rope) downstream the runner, in the draft tube cone. The unsteady pressure field induced by precessing vortex rope leads to pressure fluctuations. The paper presents the experimental investigations of the unsteady pressure field generated by precessing vortex rope and its associated pressure fluctuations into a draft tube of the Francis turbine operating at partial discharge. In situ measurements are performed in order to evaluate the pressure fluctuations and vortex rope frequency at partial load operation. Three pressure taps are installed on the cone wall of the draft tube in order to record the unsteady pressure. As a result, the Fourier spectra are obtained in order to evaluate the amplitude of pressure fluctuations and vortex rope frequency. Moreover, the wall pressure recovery along to the draft tube cone is acquired. Finally, conclusions are drawn in order to present the vortex rope effects.

  18. A new hierarchy of generalized derivative nonlinear Schroedinger equations, its bi-Hamiltonian structure and finite-dimensional involutive system

    International Nuclear Information System (INIS)

    Yan, Z.; Zhang, H.

    2001-01-01

    In this paper, an isospectral problem and one associated with a new hierarchy of nonlinear evolution equations are presented. As a reduction, a representative system of new generalized derivative nonlinear Schroedinger equations in the hierarchy is given. It is shown that the hierarchy possesses bi-Hamiltonian structures by using the trace identity method and is Liouville integrable. The spectral problem is non linearized as a finite-dimensional completely integrable Hamiltonian system under a constraint between the potentials and spectral functions. Finally, the involutive solutions of the hierarchy of equations are obtained. In particular, the involutive solutions of the system of new generalized derivative nonlinear Schroedinger equations are developed

  19. Semi-classical propagation of wavepackets for the phase space Schroedinger equation: interpretation in terms of the Feichtinger algebra

    International Nuclear Information System (INIS)

    Gosson, Maurice A de

    2008-01-01

    The nearby orbit method is a powerful tool for constructing semi-classical solutions of Schroedinger's equation when the initial datum is a coherent state. In this paper, we first extend this method to arbitrary squeezed states and thereafter apply our results to the Schroedinger equation in phase space. This adaptation requires the phase-space Weyl calculus developed in previous work of ours. We also study the regularity of the semi-classical solutions from the point of view of the Feichtinger algebra familiar from the theory of modulation spaces

  20. Quaternionic factorization of the Schroedinger operator and its applications to some first-order systems of mathematical physics

    International Nuclear Information System (INIS)

    Kravchenko, Viktor G; Kravchenko, Vladislav V

    2003-01-01

    We show that an ample class of physically meaningful partial differential systems of first order such as the Dirac equation with different one-component potentials, static Maxwell's system and the system describing the force-free magnetic fields are equivalent to a single quaternionic equation which in its turn reduces in general to a Schroedinger equation with quaternionic potential, and in some situations this last can be diagonalized. The rich variety of methods developed for different problems corresponding to the Schroedinger equation can be applied to the systems considered in the present work

  1. Quaternionic factorization of the Schroedinger operator and its applications to some first-order systems of mathematical physics

    Energy Technology Data Exchange (ETDEWEB)

    Kravchenko, Viktor G [Faculdade de Ciencias y Tecnologia, Universidade do Algarve, Campus de Gambelas, 8000 Faro (Portugal); Kravchenko, Vladislav V [Depto de Telecomunicaciones, SEPI ESIME Zacatenco, Instituto Politecnico Nacional, Av. IPN S/N, Edif. 1 CP 07738, DF (Mexico)

    2003-11-07

    We show that an ample class of physically meaningful partial differential systems of first order such as the Dirac equation with different one-component potentials, static Maxwell's system and the system describing the force-free magnetic fields are equivalent to a single quaternionic equation which in its turn reduces in general to a Schroedinger equation with quaternionic potential, and in some situations this last can be diagonalized. The rich variety of methods developed for different problems corresponding to the Schroedinger equation can be applied to the systems considered in the present work.

  2. Generalized hyperbolic functions to find soliton-like solutions for a system of coupled nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Yomba, Emmanuel

    2008-01-01

    With the aid of symbolic computation, we demonstrate that the known method which is based on the new generalized hyperbolic functions and the new kinds of generalized hyperbolic function transformations, generates classes of exact solutions to a system of coupled nonlinear Schroedinger equations. This system includes the modified Hubbard model and the system of coupled nonlinear Schroedinger derived by Lazarides and Tsironis. Four types of solutions for this system are given explicitly, namely: new bright-bright, new dark-dark, new bright-dark and new dark-bright solitons

  3. Contribution to the establishment and resolution of the Schroedinger equation in a Riemannian manifold with constant curvature

    International Nuclear Information System (INIS)

    Rasolofoson, N.G.

    2014-01-01

    The properties of a physical system may vary significantly due to the presence of matter or energy. This change can be defined by the deformation of the space which is described as the variation of its curvature. In order to describe this law of physics, we have used differential geometry and studied especially a Schroedinger equation which describes a system evolving with time on a Riemannian manifold of constant curvature. Therefore, we have established and solved the Schroedinger equation using appropriate mathematics tools. As perspective, the study of string theory may be considered. [fr

  4. Psychometric properties of the Francis Scale of Attitude Towards Christianity among Portuguese university students.

    Science.gov (United States)

    Ferreira, Ana Veríssimo; Neto, Félix

    2002-12-01

    To facilitate use of the adult form of the Francis Scale of Attitude Towards Christianity in cross-cultural studies, the psychometric characteristics of the translated scale were examined among 323 university students in Portugal (130 men and 193 women). Their ages ranged from 18 to 31 years. Analysis supported the unidimensionality, internal consistency, and construct validity of this scale in this sample of Portuguese university students.

  5. The Norwegian translation of the Francis Scale of Attitude toward Christianity.

    Science.gov (United States)

    Francis, Leslie J; Enger, Trond

    2002-12-01

    This paper reviews the development of the Francis Scale of Attitude toward Christianity and then examines the psychometric properties of the Norwegian translation of this instrument among a sample of 479 young people between the ages of 11 and 18 years attending secondary school. The data support the reliability of this instrument and commend it for further validation studies and for wider general use among young people in Norway.

  6. Assessing clergy work-related psychological health : reliability and validity of the Francis Burnout Inventory

    OpenAIRE

    Francis, Leslie J.; Laycock, Patrick; Crea, Giuseppe

    2017-01-01

    Drawing on the classic model of balanced affect, the Francis Burnout Inventory (FBI) conceptualised good work-related psychological health among clergy in terms of negative affect being balanced by positive affect. In the FBI negative affect is assessed by the Scale of Emotional Exhaustion in Ministry (SEEM) and positive affect is assessed by the Satisfaction in Ministry Scale (SIMS). In support of the idea of balanced affect, previous work had shown a significant interaction between the effe...

  7. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  8. The calculation of fluid-structure interaction and fatigue analysis for Francis turbine runner

    International Nuclear Information System (INIS)

    Wang, X F; Li, H L; Zhu, F W

    2012-01-01

    Francis turbine, as a widely used hydro turbine, is especially suited for the hydropower station with high hydraulic head and higher hydraulic head. For such turbine generator units all around the world, the crack streaks usually come out after a long time use and the resulted accidents may cause huge losses. Hence, it is meaningful to refine the design assuring the stability and safety of the Francis turbine. In this paper, the stiffness and strength as well as the fatigue life of the Francis turbine are studied. Concerning on the turbine of one certain hydropower station, the flow field inside the turbine are first simulated and the pressure distribution around the blades are derived. Meanwhile, the stress distributions of the blades are also obtained. Based on these, the fatigue analyses are applied on the turbine. According to the results of fatigue analyses, some optimal designs on the turbine are verified. The results show that with the optimal designs, the hydraulic performances of the turbine do not change too much while the maximum stress on the turbine decrease and the fatigue life increase as well.

  9. Hydroacoustic simulation of rotor-stator interaction in resonance conditions in Francis pump-turbine

    International Nuclear Information System (INIS)

    Nicolet, C; Ruchonnet, N; Alligne, S; Avellan, F; Koutnik, J

    2010-01-01

    Combined effect of rotating pressure field related to runner blade and wakes of wicket gates leads to rotor stator interactions, RSI, in Francis pump-turbines. These interactions induce pressures waves propagating in the entire hydraulic machine. Superposition of those pressure waves may result in standing wave in the spiral casing and rotating diametrical mode in the guide vanes and can cause strong pressure fluctuations and vibrations. This paper presents the modeling, simulation and analysis of Rotor-Stator Interaction of a scale model of a Francis pump-turbine and related test rig using a one-dimensional approach. The hydroacoustic modeling of the Francis pump-turbine takes into account the spiral casing, the 20 guide vanes, the 9 rotating runner vanes. The connection between stationary and rotating parts is ensured by a valve network driven according to the unsteady flow distribution between guide vanes and runner vanes. Time domain simulations are performed for 2 different runner rotational speeds in turbine mode. The simulation results are analyzed in frequency domain and highlights hydroacoustic resonance between RSI excitations and the spiral case. Rotating diametrical mode in the vaneless gap and standing wave in the spiral case are identified. The influence of the resonance on phase and amplitude of pressure fluctuations obtained for both the spiral case and the vaneless gap is analyzed. The mode shape and frequencies are confirmed using eigenvalues analysis.

  10. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  11. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  12. Automated lattice perturbation theory in the Schroedinger functional. Implementation and applications in HQET

    International Nuclear Information System (INIS)

    Hesse, Dirk

    2012-01-01

    The author developed the pastor software package for automated lattice perturbation theory calculations in the Schroedinger functional scheme. The pastor code consists of two building blocks, dealing with the generation of Feynman rules and Feynman diagrams respectively. Accepting a rather generic class of lattice gauge and fermion actions, passed to the code in a symbolic form as input, a low level part of pastor will generate Feynman rules to an arbitrary order in the bare coupling with a trivial or an Abelian background field. The second, high level part of pastor is a code generator whose output relies on the vertex generator. It writes programs that evaluate Feynman diagrams for a class of Schroedinger functional observables up to one loop order automatically, the relevant O(a) improvement terms are taken into account. We will describe the algorithms used for implementation of both parts of the code in detail, and provide cross checks with perturbative and non-perturbative data to demonstrate the correctness of our code. We demonstrate the usefulness of the pastor package through various applications taken from the matching process of heavy quark effective theory with quantum chromodynamics. We have e.g. completed a one loop analysis for new candidates for matching observables timely and with rather small effort, highlighting two advantages of an automated software setup. The results that were obtained so far will be useful as a guideline for further non-perturbative studies.

  13. Finite-time quantum-to-classical transition for a Schroedinger-cat state

    International Nuclear Information System (INIS)

    Paavola, Janika; Hall, Michael J. W.; Paris, Matteo G. A.; Maniscalco, Sabrina

    2011-01-01

    The transition from quantum to classical, in the case of a quantum harmonic oscillator, is typically identified with the transition from a quantum superposition of macroscopically distinguishable states, such as the Schroedinger-cat state, into the corresponding statistical mixture. This transition is commonly characterized by the asymptotic loss of the interference term in the Wigner representation of the cat state. In this paper we show that the quantum-to-classical transition has different dynamical features depending on the measure for nonclassicality used. Measures based on an operatorial definition have well-defined physical meaning and allow a deeper understanding of the quantum-to-classical transition. Our analysis shows that, for most nonclassicality measures, the Schroedinger-cat state becomes classical after a finite time. Moreover, our results challenge the prevailing idea that more macroscopic states are more susceptible to decoherence in the sense that the transition from quantum to classical occurs faster. Since nonclassicality is a prerequisite for entanglement generation our results also bridge the gap between decoherence, which is lost only asymptotically, and entanglement, which may show a ''sudden death''. In fact, whereas the loss of coherences still remains asymptotic, we emphasize that the transition from quantum to classical can indeed occur at a finite time.

  14. Automated lattice perturbation theory in the Schroedinger functional. Implementation and applications in HQET

    Energy Technology Data Exchange (ETDEWEB)

    Hesse, Dirk

    2012-07-13

    The author developed the pastor software package for automated lattice perturbation theory calculations in the Schroedinger functional scheme. The pastor code consists of two building blocks, dealing with the generation of Feynman rules and Feynman diagrams respectively. Accepting a rather generic class of lattice gauge and fermion actions, passed to the code in a symbolic form as input, a low level part of pastor will generate Feynman rules to an arbitrary order in the bare coupling with a trivial or an Abelian background field. The second, high level part of pastor is a code generator whose output relies on the vertex generator. It writes programs that evaluate Feynman diagrams for a class of Schroedinger functional observables up to one loop order automatically, the relevant O(a) improvement terms are taken into account. We will describe the algorithms used for implementation of both parts of the code in detail, and provide cross checks with perturbative and non-perturbative data to demonstrate the correctness of our code. We demonstrate the usefulness of the pastor package through various applications taken from the matching process of heavy quark effective theory with quantum chromodynamics. We have e.g. completed a one loop analysis for new candidates for matching observables timely and with rather small effort, highlighting two advantages of an automated software setup. The results that were obtained so far will be useful as a guideline for further non-perturbative studies.

  15. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. Self-Similar Solutions of Variable-Coefficient Cubic-Quintic Nonlinear Schroedinger Equation with an External Potential

    International Nuclear Information System (INIS)

    Wu Hongyu; Fei Jinxi; Zheng Chunlong

    2010-01-01

    An improved homogeneous balance principle and an F-expansion technique are used to construct exact self-similar solutions to the cubic-quintic nonlinear Schroedinger equation. Such solutions exist under certain conditions, and impose constraints on the functions describing dispersion, nonlinearity, and the external potential. Some simple self-similar waves are presented. (general)

  17. Time-dependent Schroedinger equations with effective mass in (2 + 1) dimensions: intertwining relations and Darboux operators

    International Nuclear Information System (INIS)

    Cobian, Hector; Schulze-Halberg, Axel

    2011-01-01

    We construct Darboux transformations for time-dependent Schroedinger equations with position-dependent mass in (2 + 1) dimensions. Several examples illustrate our results, which complement and generalize former findings for the constant mass case in two spatial variables (Schulze-Halberg 2010 J. Math. Phys. 51 033521).

  18. The density of states for almost periodic Schroedinger operators and the frequency module: a counter-example

    International Nuclear Information System (INIS)

    Bellissard, J.

    1981-07-01

    We exhibit an example of a one-dimensional discrete Schroedinger operator with an almost periodic potential for which the steps of the density of states do not belong to the frequency module. This example is suggested by the K-theory

  19. A perturbation expansion for the nonlinear Schroedinger equation with application to the influence of nonlinear Landau damping

    International Nuclear Information System (INIS)

    Weiland, J.; Ichikawa, Y.H.; Wilhelmsson, H.

    1977-12-01

    The Bogoliubov-Mitropolsky perturbation method has been applied to the study of a perturbation on soliton solutions to the nonlinear Schroedinger equation. The results are compared to those of Karpman and Maslov using the inverse scattering method and to those by Ott and Sudan on the KdV equation. (auth.)

  20. Studies of particles statistics in one and two dimensions, based on the quantization methods of Heisenberg, Schroedinger and Feynman

    International Nuclear Information System (INIS)

    Myrheim, J.

    1993-06-01

    The thesis deals with the application of different methods to the quantization problem for system of identical particles in one and two dimensions. The standard method is the analytic quantization method due to Schroedinger, which leads to the concept of fractional statistics in one and two dimensions. Two-dimensional particles with fractional statistics are well known by the name of anyons. Two alternative quantization methods are shown by the author, the algebraic method of Heisenberg and the Feynman path integral method. The Feynman method is closely related to the Schroedinger method, whereas the Heisenberg and Schroedinger methods may give different results. The relation between the Heisenberg and Schroedinger methods is discussed. The Heisenberg method is applied to the equations of motion of vortices in superfluid helium, which have the form of Hamiltonian equations for a one-dimensional system. The same method is also discussed more generally for systems of identical particles in one and two dimensions. An application of the Feynman method to the problem of computing the equation of state for a gas of anyons is presented. 104 refs., 4 figs

  1. The essential spectrum of Schroedinger operators with asymptotically constant magnetic fields on the Poincare upper-half plane

    International Nuclear Information System (INIS)

    Inahama, Yuzuru; Shirai, Shin-ichi

    2003-01-01

    We study the essential spectrum of the magnetic Schroedinger operators on the Poincare upper-half plane and establish a hyperbolic analog of Iwatsuka's result [J. Math. Kyoto Univ. 23(3), 475-480 (1983)] on the stability of the essential spectrum under perturbations from constant magnetic fields

  2. Schroedinger centenary

    International Nuclear Information System (INIS)

    Olive, D.

    1987-01-01

    The centenary of the birth of polymath Erwin Schrodinger was marked by a suitably multidisciplinary conference in April at London's Imperial College, reflecting the impact of the man's work on physics, chemistry, molecular biology and the history and philosophy of science

  3. Schroedinger centenary

    Energy Technology Data Exchange (ETDEWEB)

    Olive, D.

    1987-07-15

    The centenary of the birth of polymath Erwin Schrodinger was marked by a suitably multidisciplinary conference in April at London's Imperial College, reflecting the impact of the man's work on physics, chemistry, molecular biology and the history and philosophy of science.

  4. High-fidelity in vivo replication of DNA base shape mimics without Watson–Crick hydrogen bonds

    Science.gov (United States)

    Delaney, James C.; Henderson, Paul T.; Helquist, Sandra A.; Morales, Juan C.; Essigmann, John M.; Kool, Eric T.

    2003-01-01

    We report studies testing the importance of Watson–Crick hydrogen bonding, base-pair geometry, and steric effects during DNA replication in living bacterial cells. Nonpolar DNA base shape mimics of thymine and adenine (abbreviated F and Q, respectively) were introduced into Escherichia coli by insertion into a phage genome followed by transfection of the vector into bacteria. Genetic assays showed that these two base mimics were bypassed with moderate to high efficiency in the cells and with very high efficiency under damage-response (SOS induction) conditions. Under both sets of conditions, the T-shape mimic (F) encoded genetic information in the bacteria as if it were thymine, directing incorporation of adenine opposite it with high fidelity. Similarly, the A mimic (Q) directed incorporation of thymine opposite itself with high fidelity. The data establish that Watson–Crick hydrogen bonding is not necessary for high-fidelity replication of a base pair in vivo. The results suggest that recognition of DNA base shape alone serves as the most powerful determinant of fidelity during transfer of genetic information in a living organism. PMID:12676985

  5. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  6. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Continuity and completeness in physical theory: Schroedinger`s return to the wave interpretation of quantum mechanics in the 1950`s

    Energy Technology Data Exchange (ETDEWEB)

    D`Agostino, S. [Rome Univ. (Italy)

    1992-12-31

    In the 50s, Schroedinger proposed a new conception of a continuous theory of Quantum Mechanics, which remarkably modified his 1926 ideas on ondulatory mechanics. The lack of individuality of the atomic particles presented in the new statistics, and in Heisenberg`s Indeterminacy Relations, was by him considered as an aspect of a more general crisis in the anthology itself of classical atomism. Unlike his 1926 ideas, he proposed now to represent the wave equation in an n-dimensional space and he considered second-quantization technique as the proper mathematical tool for his new physical conception. Although he accepted that space-time discontinuities and casual gaps may appear here and there on the observational level (e.g. in the Indeterminacy Relations), he was convinced that they could be made compatible with a continuous pure theory, provided one accepted a suitable conception of the theory`s epistemiological status. For him, only a continuous theory satisfied the conditions for a complete theory. On these matters, he thought he was somehow orthodox to the ideas of Hertz and Boltzmann, which were also reflected in the teaching of Exner. (author). 69 refs.

  8. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  9. Dos obras del escultor neoclásico inglés John Francis (1780- 1861 en una colección particular española

    Directory of Open Access Journals (Sweden)

    Quintanilla Martínez, Emilio

    2012-09-01

    Full Text Available Two previously unknown works by the British neoclassical sculptor John Francis dating from the second quarter of the 19th century, representing the 1st Duke of Sutherland and, most likely, the sculptor Sir John Francis, have been located in a Spanish private collection.

    Dos obras, hasta ahora inéditas, del escultor neoclásico inglés John Francis del segundo cuarto del siglo XIX, y que representan al primer duque de Sutherland y seguramente al escultor Sir John Francis, en colección privada española.

  10. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  11. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  12. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The backward phase flow and FBI-transform-based Eulerian Gaussian beams for the Schroedinger equation

    International Nuclear Information System (INIS)

    Leung Shingyu; Qian Jianliang

    2010-01-01

    We propose the backward phase flow method to implement the Fourier-Bros-Iagolnitzer (FBI)-transform-based Eulerian Gaussian beam method for solving the Schroedinger equation in the semi-classical regime. The idea of Eulerian Gaussian beams has been first proposed in . In this paper we aim at two crucial computational issues of the Eulerian Gaussian beam method: how to carry out long-time beam propagation and how to compute beam ingredients rapidly in phase space. By virtue of the FBI transform, we address the first issue by introducing the reinitialization strategy into the Eulerian Gaussian beam framework. Essentially we reinitialize beam propagation by applying the FBI transform to wavefields at intermediate time steps when the beams become too wide. To address the second issue, inspired by the original phase flow method, we propose the backward phase flow method which allows us to compute beam ingredients rapidly. Numerical examples demonstrate the efficiency and accuracy of the proposed algorithms.

  14. Qualitative analysis and traveling wave solutions for the perturbed nonlinear Schroedinger's equation with Kerr law nonlinearity

    International Nuclear Information System (INIS)

    Zhang Zaiyun; Liu Zhenhai; Miao Xiujin; Chen Yuezhong

    2011-01-01

    In this Letter, we investigate the perturbed nonlinear Schroedinger's equation (NLSE) with Kerr law nonlinearity. All explicit expressions of the bounded traveling wave solutions for the equation are obtained by using the bifurcation method and qualitative theory of dynamical systems. These solutions contain bell-shaped solitary wave solutions, kink-shaped solitary wave solutions and Jacobi elliptic function periodic solutions. Moreover, we point out the region which these periodic wave solutions lie in. We present the relation between the bounded traveling wave solution and the energy level h. We find that these periodic wave solutions tend to the corresponding solitary wave solutions as h increases or decreases. Finally, for some special selections of the energy level h, it is shown that the exact periodic solutions evolute into solitary wave solution.

  15. AKNS hierarchy, Darboux transformation and conservation laws of the 1D nonautonomous nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Zhao Dun; Zhang Yujuan; Lou Weiwei; Luo Honggang

    2011-01-01

    By constructing nonisospectral Ablowitz-Kaup-Newell-Segur (AKNS) hierarchy, we investigate the nonautonomous nonlinear Schroedinger (NLS) equations which have been used to describe the Feshbach resonance management in matter-wave solitons in Bose-Einstein condensate and the dispersion and nonlinearity managements for optical solitons. It is found that these equations are some special cases of a new integrable model of nonlocal nonautonomous NLS equations. Based on the Lax pairs, the Darboux transformation and conservation laws are explored. It is shown that the local external potentials would break down the classical infinite number of conservation laws. The result indicates that the integrability of the nonautonomous NLS systems may be nontrivial in comparison to the conventional concept of integrability in the canonical case.

  16. Stability of plane wave solutions of the two-space-dimensional nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Martin, D.U.; Yuen, H.C.; Saffman, P.G.

    1980-01-01

    The stability of plane, periodic solutions of the two-dimensional nonlinear Schroedinger equation to infinitesimal, two-dimensional perturbation has been calculated and verified numerically. For standing wave disturbances, instability is found for both odd and even modes; as the period of the unperturbed solution increases, the instability associated with the odd modes remains but that associated with the even mode disappears, which is consistent with the results of Zakharov and Rubenchik, Saffman and Yuen and Ablowitz and Segur on the stability of solitons. In addition, we have identified travelling wave instabilities for the even mode perturbations which are absent in the long-wave limit. Extrapolation to the case of an unperturbed solution with infinite period suggests that these instabilities may also be present for the soliton. In other words, the soliton is unstable to odd, standing-wave perturbations, and very likely also to even, travelling-wave perturbations. (orig.)

  17. The number of bound states for a discrete Schroedinger operator on ZN, N≥1, lattices

    International Nuclear Information System (INIS)

    Karachalios, N I

    2008-01-01

    We consider the discrete Schroedinger operator -Δ d +U in Z N , N≥1 in the case of a potential with negative part in an appropriate l σ -space (decays with an appropriate rate). We present a discrete analog of the method of Li and Yau (1983 Commun. Math. Phys. 88 309-18), proving an explicit upper estimate on the number of bound states N d (0)={j:μ j ≤0}, which is independent of the dimension of the lattice. This is a major difference with the continuous counterpart estimate, which is not valid when N = 1, 2. As a consequence, a dimension-independent smallness criterion for the existence of bound states is derived in contrast to the continuous case as well as to the discrete case of vanishing potential. A short comment is made on possible applications of the results to the study of the dynamics of some particular spatially discrete nonlinear systems

  18. Schroedinger equation from 0 (h/2π) to o(h/2πinfinity)

    International Nuclear Information System (INIS)

    Voros, A.

    1985-08-01

    The Balian and Bloch idea, that the semiclassical treatment of the Schroedinger equation can be carried out exactly to all orders, o(h/2πinfinity), has been explicitly confirmed upon the time-independent equation with a polynomial potential V(q) in one degree of freedom. The global analytic structure of certain functions, which encode the full eigenvalue distribution, has indeed been computed in great detail with the complex WKB method, yielding a structure called a resurgence algebra. In the special case V(q) = q 2 sub(M), this leads to sum rules for the eigenvalues, which have been verified numerically. Inasmuch as the leading order 0(h/2π) of the WKB expansion amounts to the stationary phase evaluation of the Feynman path integral, it is a yet unsolved challenge to reproduce our results by an exact analysis of this path integral using a generalized saddle-point treatment

  19. Universal Critical Power for Nonlinear Schroedinger Equations with a Symmetric Double Well Potential

    International Nuclear Information System (INIS)

    Sacchetti, Andrea

    2009-01-01

    Here we consider stationary states for nonlinear Schroedinger equations in any spatial dimension n with symmetric double well potentials. These states may bifurcate as the strength of the nonlinear term increases and we observe two different pictures depending on the value of the nonlinearity power: a supercritical pitchfork bifurcation, and a subcritical pitchfork bifurcation with two asymmetric branches occurring as the result of saddle-node bifurcations. We show that in the semiclassical limit, or for a large barrier between the two wells, the first kind of bifurcation always occurs when the nonlinearity power is less than a critical value; in contrast, when the nonlinearity power is larger than such a critical value then we always observe the second scenario. The remarkable fact is that such a critical value is a universal constant in the sense that it does not depend on the shape of the double well potential and on the dimension n.

  20. Antibound states for a class of one-dimensional Schroedinger Operators

    Energy Technology Data Exchange (ETDEWEB)

    Angeletti, A [Camerino Univ. (Italy). Ist. di Matematica

    1980-11-01

    Let delta(x) be the Dirac's delta, q(x) element of L/sup 1/(R) L/sup 2/(R) be a real valued function, and lambda, ..mu.. element of R; we will consider the following class of one-dimensional formal Schroedinger operators on L/sup 2/(R) H(lambda,..mu..) = - (d/sup 2//dx/sup 2/) + lambdadelta(x) + ..mu..q(x). It is known that to the formal operator H(lambda, ..mu..) may be associated a selfadjoint operator H(lambda, ..mu..) on L/sup 2/(R). If q is of finite range, for lambda < 0 and /..mu../ is small enough, we prove that H(lambda,..mu..) has an antibound state; that is the resolvent of H(lambda,..mu..) has a pole on the negative real axis on the second Riemann sheet.

  1. Stability analysis of embedded solitons in the generalized third-order nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Pelinovsky, Dmitry E.; Yang Jianke

    2005-01-01

    We study the generalized third-order nonlinear Schroedinger (NLS) equation which admits a one-parameter family of single-hump embedded solitons. Analyzing the spectrum of the linearization operator near the embedded soliton, we show that there exists a resonance pole in the left half-plane of the spectral parameter, which explains linear stability, rather than nonlinear semistability, of embedded solitons. Using exponentially weighted spaces, we approximate the resonance pole both analytically and numerically. We confirm in a near-integrable asymptotic limit that the resonance pole gives precisely the linear decay rate of parameters of the embedded soliton. Using conserved quantities, we qualitatively characterize the stable dynamics of embedded solitons

  2. Structure and properties of Hughston's stochastic extension of the Schroedinger equation

    International Nuclear Information System (INIS)

    Adler, Stephen L.; Horwitz, Lawrence P.

    2000-01-01

    Hughston has recently proposed a stochastic extension of the Schroedinger equation, expressed as a stochastic differential equation on projective Hilbert space. We derive new projective Hilbert space identities, which we use to give a general proof that Hughston's equation leads to state vector collapse to energy eigenstates, with collapse probabilities given by the quantum mechanical probabilities computed from the initial state. We discuss the relation of Hughston's equation to earlier work on norm-preserving stochastic equations, and show that Hughston's equation can be written as a manifestly unitary stochastic evolution equation for the pure state density matrix. We discuss the behavior of systems constructed as direct products of independent subsystems, and briefly address the question of whether an energy-based approach, such as Hughston's, suffices to give an objective interpretation of the measurement process in quantum mechanics. (c) 2000 American Institute of Physics

  3. Discreteness of the spectrum of some operator sheaves associated with a periodic Schroedinger equation

    International Nuclear Information System (INIS)

    Dyakin, V.V.; Petrukhnovskii, S.I.

    1988-01-01

    Three-dimensional periodic Schroedinger operators with potentials that are square integrable on the unit cell (single-electron model of a crystal) are considered. A description is given of the class of rational curves that do not have more than a finite number of common points with any isoenergy surface (in particular, the Fermi surface) of an arbitrary operator of the considered form. A consequence of a theorem proved in the paper is the absence on the isoenergy surfaces of elements of planes, cones, and cylinders with straight generators, and all possible paraboloids and hyperboloids. Another interesting consequence is the following assertion: The topological dimension of an isoenergy manifold does not exceed two, which justifies the use of the word surface. The results generalize the assertion of Thomas's theorem on the absence on isoenergy surfaces of straight edges

  4. Algebraic Bethe ansatz for a quantum integrable derivative nonlinear Schroedinger model

    International Nuclear Information System (INIS)

    Basu-Mallick, B.; Bhattacharyya, Tanaya

    2002-01-01

    We find that the quantum monodromy matrix associated with a derivative nonlinear Schroedinger (DNLS) model exhibits U(2) or U(1,1) symmetry depending on the sign of the related coupling constant. By using a variant of quantum inverse scattering method which is directly applicable to field theoretical models, we derive all possible commutation relations among the operator valued elements of such monodromy matrix. Thus, we obtain the commutation relation between creation and annihilation operators of quasi-particles associated with DNLS model and find out the S-matrix for two-body scattering. We also observe that, for some special values of the coupling constant, there exists an upper bound on the number of quasi-particles which can form a soliton state for the quantum DNLS model

  5. Some simple conditions of bound states of Schroedinger operators in dimension d >= 3

    International Nuclear Information System (INIS)

    Exner, P.

    1984-01-01

    A necessary condition for existence of bound states below a given energy of a Schroedinger operator H=-Δ+V on L 2 (Rsup(d)), d>=3, together with a lower bound to the ground-state energy of H are derived using the Sobolev inequalities. It generalizes some recent results to the dimensions d>3 and to the potentials that are not necessarily rapidly decreasing. Comparison to other known necessary conditions is given. The examples of the d-dimensional hydrogen-like atom and the d-dimensional harmonic oscillator are discussed. In both of them the bound to the ground-state energy becomes remarkably tight for large values of d

  6. Generalized Euler transformation for summing strongly divergent Rayleigh-Schroedinger perturbation series: the Zeeman effect

    International Nuclear Information System (INIS)

    Silverman, J.N.

    1983-01-01

    A generalized Euler transformation (GET) is introduced which provides a powerful alternative method of accurately summing strongly divergent Rayleigh-Schroedinger (RS) perturbation series when other summability methods fail or are difficult to apply. The GET is simple to implement and, unlike a number of other summation procedures, requires no a priori knowledge of the analytic properties of the function underlying the RS series. Application of the GET to the difficult problem of the RS weak-field ground-state eigenvalue series of the hydrogen atom in a magnetic field (quadratic Zeeman effect) yields sums of good accuracy over a very wide range of field strengths up to the most intense fields of 10 14 G. The GET results are compared with those obtained by other summing methods

  7. Conservation laws derived by the Neutral-Action Method. A simple application to the Schroedinger equation

    International Nuclear Information System (INIS)

    Nordbrock, U.; Kienzler, R.

    2007-01-01

    Conservation laws are a recognized tool in physical and engineering sciences. The classical procedure to construct conservation laws is to apply Noether's Theorem. It requires the existence of a Lagrange-function for the system under consideration. Two unknown sets of functions have to be found. A broader class of such laws is obtainable, if Noether's Theorem is used together with the Bessel-Hagen extension, raising the number of sets of unknown functions to three. By using the recently developed Neutral-Action Method, the same conservation laws can be obtained by calculating only one unknown set of functions. Moreover the Neutral Action Method can also be applied in the absence of a Lagrangian, since only the governing differential equations are required for this procedure. In the paper, an application of this method to the Schroedinger equation is presented. (authors)

  8. Fractional analysis for nonlinear electrical transmission line and nonlinear Schroedinger equations with incomplete sub-equation

    Science.gov (United States)

    Fendzi-Donfack, Emmanuel; Nguenang, Jean Pierre; Nana, Laurent

    2018-02-01

    We use the fractional complex transform with the modified Riemann-Liouville derivative operator to establish the exact and generalized solutions of two fractional partial differential equations. We determine the solutions of fractional nonlinear electrical transmission lines (NETL) and the perturbed nonlinear Schroedinger (NLS) equation with the Kerr law nonlinearity term. The solutions are obtained for the parameters in the range (0<α≤1) of the derivative operator and we found the traditional solutions for the limiting case of α =1. We show that according to the modified Riemann-Liouville derivative, the solutions found can describe physical systems with memory effect, transient effects in electrical systems and nonlinear transmission lines, and other systems such as optical fiber.

  9. Collapse instability of solitons in the nonpolynomial Schroedinger equation with dipole-dipole interactions

    International Nuclear Information System (INIS)

    Gligoric, G; Hadzievski, Lj; Maluckov, A; Malomed, B A

    2009-01-01

    A model of the Bose-Einstein condensate (BEC) of dipolar atoms, confined in a combination of a cigar-shaped trap and optical lattice acting in the axial direction, is studied in the framework of the one-dimensional (1D) nonpolynomial Schroedinger equation (NPSE) with additional terms describing long-range dipole-dipole (DD) interactions. The NPSE makes it possible to describe the collapse of localized modes, which was experimentally observed in the self-attractive BEC confined in tight traps, in the framework of the 1D description. We study the influence of the DD interactions on the dynamics of bright solitons, especially concerning their collapse-induced instability. Both attractive and repulsive contact and DD interactions are considered. The results are summarized in the form of stability/collapse diagrams in a respective parametric space. In particular, it is shown that the attractive DD interactions may prevent the collapse instability in the condensate with attractive contact interactions.

  10. Gauge invariance of the Rayleigh--Schroedinger time-independent perturbation theory

    International Nuclear Information System (INIS)

    Yang, K.H.

    1977-08-01

    It is shown that the Rayleigh-Schroedinger time-independent perturbation theory is gauge invariant when the operator concerned is the particle's instantaneous energy operator H/sub B/ = (1/2m)[vector p - (e/c) vector A] 2 + eV 0 . More explicitly, it is shown that the energy perturbation corrections of each individual order of every state is gauge invariant. When the vector potential is curlless, the energy corrections of all orders are shown to vanish identically regardless of the explicit form of the vector potential. The relation between causality and gauge invariance is investigated. It is shown that gauge invariance guarantees conformity with causality and violation of gauge invariance implies violation of causality

  11. Soliton on a cnoidal wave background in the coupled nonlinear Schroedinger equation

    International Nuclear Information System (INIS)

    Shin, H J

    2004-01-01

    An application of the Darboux transformation on a cnoidal wave background in the coupled nonlinear Schroedinger equation gives a new solution which describes a soliton moving on a cnoidal wave. This is a generalized version of the previously known soliton solutions of dark-bright pair. Here a dark soliton resides on a cnoidal wave instead of on a constant background. It also exhibits a new type of soliton solution in a self-focusing medium, which describes a breakup of a generalized dark-bright pair into another generalized dark-bright pair and an 'oscillating' soliton. We calculate the shift of the crest of the cnoidal wave along a soliton and the moving direction of the soliton on a cnoidal wave

  12. Antibound states for a class of one-dimensional Schroedinger Operators

    International Nuclear Information System (INIS)

    Angeletti, A.

    1980-01-01

    Let delta(x) be the Dirac's delta, q(x) element of L 1 (R) L 2 (R) be a real valued function, and lambda, μ element of R; we will consider the following class of one-dimensional formal Schroedinger operators on L 2 (R) H(lambda,μ) = - (d 2 /dx 2 ) + lambdadelta(x) + μq(x). It is known that to the formal operator H(lambda, μ) may be associated a selfadjoint operator H(lambda, μ) on L 2 (R). If q is of finite range, for lambda < 0 and /μ/ is small enough, we prove that H(lambda,μ) has an antibound state; that is the resolvent of H(lambda,μ) has a pole on the negative real axis on the second Riemann sheet. (orig.)

  13. Degenerate RS perturbation theory. [Rayleigh-Schroedinger energies and wave functions

    Science.gov (United States)

    Hirschfelder, J. O.; Certain, P. R.

    1974-01-01

    A concise, systematic procedure is given for determining the Rayleigh-Schroedinger energies and wave functions of degenerate states to arbitrarily high orders even when the degeneracies of the various states are resolved in arbitrary orders. The procedure is expressed in terms of an iterative cycle in which the energy through the (2n + 1)-th order is expressed in terms of the partially determined wave function through the n-th order. Both a direct and an operator derivation are given. The two approaches are equivalent and can be transcribed into each other. The direct approach deals with the wave functions (without the use of formal operators) and has the advantage that it resembles the usual treatment of nondegenerate perturbations and maintains close contact with the basic physics. In the operator approach, the wave functions are expressed in terms of infinite-order operators which are determined by the successive resolution of the space of the zeroth-order functions.

  14. Computation of a long-time evolution in a Schroedinger system

    International Nuclear Information System (INIS)

    Girard, R.; Kroeger, H.; Labelle, P.; Bajzer, Z.

    1988-01-01

    We compare different techniques for the computation of a long-time evolution and the S matrix in a Schroedinger system. As an application we consider a two-nucleon system interacting via the Yamaguchi potential. We suggest computation of the time evolution for a very short time using Pade approximants, the long-time evolution being obtained by iterative squaring. Within the technique of strong approximation of Moller wave operators (SAM) we compare our calculation with computation of the time evolution in the eigenrepresentation of the Hamiltonian and with the standard Lippmann-Schwinger solution for the S matrix. We find numerical agreement between these alternative methods for time-evolution computation up to half the number of digits of internal machine precision, and fairly rapid convergence of both techniques towards the Lippmann-Schwinger solution

  15. A Song in the Dark. Francis of Assisi’s Canticle of Brother Sun

    Directory of Open Access Journals (Sweden)

    Speelman Willem Marie

    2016-10-01

    Full Text Available The Canticle of the Creatures or Canticle of Brother Sun is based on a particular way of perceiving reality. Francis, who had turned away from ‘the world’, discovered a different way of looking at it. This is a divine way of perceiving, in which the senses do not grasp reality, but accept it as it communicates itself. This way of perceiving is only possible if one does not attempt to master the environment, but allows one’s senses to be weak. It is significant, therefore, that this song of praise was born at a moment of the utmost despair and weakness. The song’s content is in line with this weak perception: it is not about Francis who praises God and (or for His creatures, but rather it is a testimony that the creatures-the elements-are already praising God, and a prayer that He should let Himself be praised by the creatures. Also in line with this weak perception is the fact that the creatures are praised just as they communicate themselves to Francis: as bodies. The theology of this song is that the creatures through their bodies resonate (strengthen, and colour the blessings that come from God, thereby making His blessing present here on earth. Francis’ role is to give a voice and a language to the heavenly praises as they resound in his environment. The transformative power of this song is that we, whether consciously or not, do the same thing when we participate in this song.

  16. The Schroedinger-Newton equation as model of self-gravitating quantum systems

    International Nuclear Information System (INIS)

    Grossardt, Andre

    2013-01-01

    The Schroedinger-Newton equation (SN equation) describes a quantummechanical one-particle-system with gravitational self-interaction and might play a role answering the question if gravity must be quantised. As non-relativistic limit of semi-classical gravity, it provides testable predictions of the effects that classical gravity has on genuinely quantum mechanical systems in the mass regime between a few thousand proton masses and the Planck mass, which is experimentally unexplored. In this thesis I subsume the mathematical properties of the SN equation and justify it as a physical model. I will give a short outline of the controversial debate around semi-classical gravity as a fundamental theory, along with the idea of the SN equation as a model of quantum state reduction. Subsequently, I will respond to frequent objections against nonlinear Schrodinger equations. I will show how the SN equation can be obtained from Einstein's General Relativity coupled to either a KleinGordon or a Dirac equation, in the same sense as the linear Schroedinger equation can be derived in flat Minkowski space-time. The equation is, to this effect, a non-relativistic approximation of the semi-classical Einstein equations. Additionally, I will discuss, first by means of analytic estimations and later numerically, in which parameter range effects of gravitational selfinteraction - e.g. in molecular-interferometry experiments - should be expected. Besides the one-particle SN equation I will provide justification for a modified equation describing the centre-of-mass wave-function of a many-particle system. Furthermore, for this modified equation, I will examine, numerically, the consequences for experiments. Although one arrives at the conclusion that no effects of the SN equation can be expected for masses up to six or seven orders of magnitude above those considered in contemporary molecular interferometry experiments, tests of the equation, for example in satellite experiments, seem

  17. Francis Bacon's Valerius Terminus and the Voyage to the "Great Instauration".

    Science.gov (United States)

    Serjeantson, Richard

    2017-01-01

    Francis Bacon's earliest surviving natural philosophical treatise (composed circa 1603) bears the title Valerius Terminus of the Interpretation of Nature. This study, resting on fresh attention to the surviving authorial manuscript, has three goals. It begins by identifying a lost precursor work apparently entitled "Of Active Knowledge." It then examines the significance of the pseudonyms Bacon chose to introduce his ideas, considering especially his invocation of Erasmus's emblem, the Roman deity Terminus. Finally, it shows how the Valerius Terminus's global vision of contemporary knowledge ultimately helped shape the iconography of Bacon's published Instauratio magna.

  18. The Rule of Three for Prizes in Science and the Bold Triptychs of Francis Bacon.

    Science.gov (United States)

    Goldstein, Joseph L

    2016-09-22

    For many scientific awards, such as Nobels and Laskers, the maximum number of recipients is three. This Rule of Three forces selection committees to make difficult decisions that increase the likelihood of singling out those individuals who open a new field and continue to lead it. The Rule of Three is reminiscent of art's three-panel triptych, a form that the modern master Francis Bacon used to distill complex stories in a bold way. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Stability of the Spanish version of the five-item Francis Scale of Attitude toward Christianity.

    Science.gov (United States)

    Miranda-Tapia, Giskar Alonso; Cogollo, Zuleima; Herazo, Edwin; Campo-Arias, Adalberto

    2010-12-01

    The aim of this study was to establish test-retest reliability of a Spanish version of the Francis Scale of Attitude toward Christianity (Campo-Arias, Oviedo, & Cogollo, 2009) among adolescent students in Cartagena, Colombia. A group of ninth grade students from two public schools in Colombia (N = 157) completed the five-item scale. Cronbach's alphas were .74 and .76 in the first and second administrations, respectively. Both Pearson's rho and intra-class correlation coefficient were .69. A Spanish translation of the 5-item scale had consistent stability over four weeks.

  20. Influence of the rotor-stator interaction on the dynamic stresses of Francis runners

    International Nuclear Information System (INIS)

    Guillaume, R; Scolaro, D; Deniau, J L; Colombet, C

    2012-01-01

    Thanks to advances in computing capabilities and Computational Fluid Dynamics (CFD) techniques, it is now possible to calculate realistic unsteady pressure fields in Francis turbines. This paper will explain methods to calculate the structural loads and the dynamic behaviour in order to optimize the turbine design and maximize its reliability and lifetime. Depending on the operating conditions of a Francis turbine, different hydraulic phenomena may impact the mechanical behaviour of the structure. According to their nature, these highly variable phenomena should be treated differently and specifically in order to estimate the potential risks arising on submerged structures, in particular the runner. The operating condition studied thereafter is the point at maximum power with the maximum head. Under this condition, the runner is excited by only one dynamic phenomenon named the Rotor-Stator Interaction (RSI). The origin of the phenomenon is located on the radial gap of the turbine and is the source of pressure fluctuations. A fluid-structure analysis is performed to observe the influence of that dynamic pressure field on the runner behaviour. The first part of the paper deals with the unsteady fluid computation. The RSI phenomenon is totally unsteady so the fluid simulation must take into account the entire machine and its rotation movement, in order to obtain a dynamic pressure field. In the second part of the paper, a method suitable for the RSI study is developed. It is known that the fluctuating pressure in this gap can be described as a sum of spatial components. By evaluating these components in the CFD results and on the scale model, it is possible to assess the relevance of the numerical results on the whole runner. After this step, the numerical pressure field can be used as the dynamic load of the structure. The final part of the paper presentsthe mechanical finite element calculations. A modal analysis of the runner in water and a harmonic analysis of its

  1. Francis Bacon's natural history and the Senecan natural histories of early modern Europe.

    Science.gov (United States)

    Jalobeanu, Dana

    2012-01-01

    At various stages in his career, Francis Bacon claimed to have reformed and changed traditional natural history in such a way that his new "natural and experimental history" was unlike any of its ancient or humanist predecessors. Surprisingly, such claims have gone largely unquestioned in Baconian scholarship. Contextual readings of Bacon's natural history have compared it, so far, only with Plinian or humanist natural history. This paper investigates a different form of natural history, very popular among Bacon's contemporaries, but yet unexplored by contemporary students of Bacon's works. I have provisionally called this form of natural history'Senecan' natural history, partly because it took shape in the Neo-Stoic revival of the sixteenth-century, partly because it originates in a particular cosmographical reading of Seneca's Naturales quaestiones. I discuss in this paper two examples of Senecan natural history: the encyclopedic and cosmographical projects of Pierre de la Primaudaye (1546-1619) and Samuel Purchas (1577-1626). I highlight a number of similarities between these two projects and Francis Bacon's natural history, and argue that Senecan natural history forms an important aspect in the historical and philosophical background that needs to be taken into consideration if we want to understand the extent to which Bacon's project to reform natural history can be said to be new.

  2. Prediction of Francis Turbine Prototype Part Load Pressure and Output Power Fluctuations with Hydroelectric Model

    Science.gov (United States)

    Alligné, S.; Nicolet, C.; Béguin, A.; Landry, C.; Gomes, J.; Avellan, F.

    2017-04-01

    The prediction of pressure and output power fluctuations amplitudes on Francis turbine prototype is a challenge for hydro-equipment industry since it is subjected to guarantees to ensure smooth and reliable operation of the hydro units. The European FP7 research project Hyperbole aims to setup a methodology to transpose the pressure fluctuations induced by the cavitation vortex rope from the reduced scale model to the prototype generating units. A Francis turbine unit of 444MW with a specific speed value of ν = 0.29, is considered as case study. A SIMSEN model of the power station including electrical system, controllers, rotating train and hydraulic system with transposed draft tube excitation sources is setup. Based on this model, a frequency analysis of the hydroelectric system is performed for all technologies to analyse potential interactions between hydraulic excitation sources and electrical components. Three technologies have been compared: the classical fixed speed configuration with Synchronous Machine (SM) and the two variable speed technologies which are Doubly Fed Induction Machine (DFIM) and Full Size Frequency Converter (FSFC).

  3. Prediction Method for the Complete Characteristic Curves of a Francis Pump-Turbine

    Directory of Open Access Journals (Sweden)

    Wei Huang

    2018-02-01

    Full Text Available Complete characteristic curves of a pump-turbine are essential for simulating the hydraulic transients and designing pumped storage power plants but are often unavailable in the preliminary design stage. To solve this issue, a prediction method for the complete characteristics of a Francis pump-turbine was proposed. First, based on Euler equations and the velocity triangles at the runners, a mathematical model describing the complete characteristics of a Francis pump-turbine was derived. According to multiple sets of measured complete characteristic curves, explicit expressions for the characteristic parameters of characteristic operating point sets (COPs, as functions of a specific speed and guide vane opening, were then developed to determine the undetermined coefficients in the mathematical model. Ultimately, by combining the mathematical model with the regression analysis of COPs, the complete characteristic curves for an arbitrary specific speed were predicted. Moreover, a case study shows that the predicted characteristic curves are in good agreement with the measured data. The results obtained by 1D numerical simulation of the hydraulic transient process using the predicted characteristics deviate little from the measured characteristics. This method is effective and sufficient for a priori simulations before obtaining the measured characteristics and provides important support for the preliminary design of pumped storage power plants.

  4. Dynamic stresses in a Francis model turbine at deep part load

    Science.gov (United States)

    Weber, Wilhelm; von Locquenghien, Florian; Conrad, Philipp; Koutnik, Jiri

    2017-04-01

    A comparison between numerically obtained dynamic stresses in a Francis model turbine at deep part load with experimental ones is presented. Due to the change in the electrical power mix to more content of new renewable energy sources, Francis turbines are forced to operate at deep part load in order to compensate stochastic nature of wind and solar power and to ensure grid stability. For the extension of the operating range towards deep part load improved understanding of the harsh flow conditions and their impact on material fatigue of hydraulic components is required in order to ensure long life time of the power unit. In this paper pressure loads on a model turbine runner from unsteady two-phase computational fluid dynamics simulation at deep part load are used for calculation of mechanical stresses by finite element analysis. Therewith, stress distribution over time is determined. Since only few runner rotations are simulated due to enormous numerical cost, more effort has to be spent to evaluation procedure in order to obtain objective results. By comparing the numerical results with measured strains accuracy of the whole simulation procedure is verified.

  5. A highly efficient Francis turbine designed for energy recovery in cooling towers

    Directory of Open Access Journals (Sweden)

    Daqing Zhou

    2015-03-01

    Full Text Available In China, cooling water entering cooling towers still retains surplus pressure between 39,240 and 147,150 Pa. In order to utilize this wasted energy, it is suggested that the surplus water energy can be harnessed to drive a type of hydroturbine installed in the inner platform of cooling tower and make the fan rotate via its coupled shafts. However, conventional hydroturbines are not suited for this job because of their low efficiency or unmatched rotating speed with that of the fan under the operating conditions of cooling towers. In this article, according to the requirements of turbine work environment in cooling towers, a new type of hydroturbine, Francis turbine with ultra-low specific speed (ns  = 50 m.kW, was designed to replace the fan motor in a cooling tower. Primarily, the shape, position, and number of runner blades were designed and optimized through theoretical analyses and computational fluid dynamics simulations. Additionally, metal elliptical volute and single-row ring guide vanes were applied to scale down the structural dimensions. Finally, the optimal scheme of the new Francis turbine was proven to have a high efficiency of 88% and good operation stability through testing of a physical model and can achieve the goal of harvesting renewable energy in the cooling tower.

  6. Research on Francis Turbine Modeling for Large Disturbance Hydropower Station Transient Process Simulation

    Directory of Open Access Journals (Sweden)

    Guangtao Zhang

    2015-01-01

    Full Text Available In the field of hydropower station transient process simulation (HSTPS, characteristic graph-based iterative hydroturbine model (CGIHM has been widely used when large disturbance hydroturbine modeling is involved. However, by this model, iteration should be used to calculate speed and pressure, and slow convergence or no convergence problems may be encountered for some reasons like special characteristic graph profile, inappropriate iterative algorithm, or inappropriate interpolation algorithm, and so forth. Also, other conventional large disturbance hydroturbine models are of some disadvantages and difficult to be used widely in HSTPS. Therefore, to obtain an accurate simulation result, a simple method for hydroturbine modeling is proposed. By this method, both the initial operating point and the transfer coefficients of linear hydroturbine model keep changing during simulation. Hence, it can reflect the nonlinearity of the hydroturbine and be used for Francis turbine simulation under large disturbance condition. To validate the proposed method, both large disturbance and small disturbance simulations of a single hydrounit supplying a resistive, isolated load were conducted. It was shown that the simulation result is consistent with that of field test. Consequently, the proposed method is an attractive option for HSTPS involving Francis turbine modeling under large disturbance condition.

  7. Velocity and pressure measurements in guide vane clearance gap of a low specific speed Francis turbine

    Science.gov (United States)

    Thapa, B. S.; Dahlhaug, O. G.; Thapa, B.

    2016-11-01

    In Francis turbine, a small clearance gap between the guide vanes and the cover plates is usually required to pivot guide vanes as a part of governing system. Deflection of cover plates and erosion of mating surfaces causes this gap to increase from its design value. The clearance gap induces the secondary flow in the distributor system. This effects the main flow at the runner inlet, which causes losses in efficiency and instability. A guide vane cascade of a low specific speed Francis turbine has been developed for experimental investigations. The test setup is able to produce similar velocity distributions at the runner inlet as that of a reference prototype turbine. The setup is designed for particle image velocimetry (PIV) measurements from the position of stay vane outlet to the position of runner inlet. In this study, velocity and pressure measurements are conducted with 2 mm clearance gap on one side of guide vane. Leakage flow is observed and measured together with pressure measurements. It is concluded that the leakage flow behaves as a jet and mixes with the main flow in cross-wise direction and forms a vortex filament. This causes non-uniform inlet flow conditions at runner blades.

  8. On the performance of a high head Francis turbine at design and off-design conditions

    International Nuclear Information System (INIS)

    Aakti, B; Amstutz, O; Casartelli, E; Romanelli, G; Mangani, L

    2015-01-01

    In the present paper, fully 360 degrees transient and steady-state simulations of a Francis turbine were performed at three operating conditions, namely at part load (PL), best efficiency point (BEP), and high load (HL), using different numerical approaches for the pressure-velocity coupling. The simulation domain includes the spiral casing with stay and guide vanes, the runner and the draft tube. The main target of the investigations is the numerical prediction of the overall performance of the high head Francis turbine model as well as local and integral quantities of the complete machine in different operating conditions. All results were compared with experimental data published by the workshop organization. All CFD simulations were performed at model scale with a new in-house, 3D, unstructured, object-oriented finite volume code within the framework of the open source OpenFOAM library. The novel fully coupled pressure-based solver is designed to solve the incompressible RANS- Equations and is capable of handling multiple references of frame (MRF). The obtained results show that the overall performance is well captured by the simulations. Regarding the local flow distributions within the inlet section of the draft-tube, the axial velocity is better estimated than the circumferential component

  9. Study on stress characteristics of Francis hydraulic turbine runner based on two-way FSI

    International Nuclear Information System (INIS)

    Zhu, W R; Xiao, R F; Yang, W; Wang, F J; Liu, J

    2012-01-01

    In recent years, cracking phenomenon occurs in many large-sized turbines both nationally and internationally, which has threatened the stable operation of hydraulic turbines. Consequently, Stress characteristics calculation and analysis of a Francis hydraulic turbine runner by application of fluid-structure interaction (FSI) technology become significantly important. In order to introduce two-way coupling technology to hydraulic machinery, two-way FSI technology is applied in this article to calculate and analyze stress characteristics. Through coordinate system transformation, the continuity equations and Navier-Stokes equations in the Cartesian coordinates system are firstly transformed to ALE coordinates system. The fluid field control equations are then constructed and discrete equations can be obtained by using flow-condition-based interpolation (FBIC-C). The structure static mechanics equations used are established in rotation coordinate system, and modeled with the finite method. Two-way coupling is computed by using iteration method. The fluid equations and structure equations are iterated until coupling coefficients converge. According to structure result, the maximum stress, displacement as well as its location can be found. As a result, the most easily wear position can be discovered which provides valuable basis for optimized design and stable operation of Francis hydraulic turbines. After comparing the results with that of one-way coupling, it is discovered that displacements is the key factors which affects the results of one-way and two-way coupling.

  10. Temporal stability of the Francis Scale of Attitude toward Christianity short-form: test-retest data over one week.

    Science.gov (United States)

    Lewis, Christopher Alan; Cruise, Sharon Mary; McGuckin, Conor

    2005-04-01

    This study evaluated the test-retest reliability of the Francis Scale of Attitude toward Christianity short-form. 39 Northern Irish undergraduate students completed the measure on two occasions separated by one week. Stability across the two administrations was high, r = .92, and there was no significant change between Time 1(M = 25.2, SD = 5.4) and Time 2 (M = 25.7, SD = 6.2). These data support the short-term test-retest reliability of the Francis Scale of Attitude toward Christianity short-form.

  11. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  12. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  13. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  14. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  15. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  16. Canonical quantization of non-abelian gauge theory in the Schroedinger picture: applications to monopoles and instantons

    International Nuclear Information System (INIS)

    Wadia, S.R.

    1979-01-01

    A detailed formulation of the quantum theory of non-abelian gauge fields is presented in the Schroedinger picture. It is applied to the semiclassical quantization of the t'Hoft-Polyakov monopole, with special attention paid to the treatment of boundary conditions and local and global gauge symmetry. The perturbation expansion is then discussed with the aid of standard collective co-ordinates. In the Prasad-Sommerfield limit, all the eigenfunctions of the fluctuation equation are presented, the ground-state wave function is constructed in terms of gauge and translation invariant co-ordinates, and its total angular momentum is computed to be zero. Aspects of instanton phenomena are then examined in the Schroedinger picture; the role of euclidean time is elucidated. The precise relation between boundary conditions, choice of gauge, and the corresponding picture of the semiclassical vacuum is demonstrated

  17. Impulsive moving mirror model and the stability of Schroedinger equation with impulse effect in a Banach space

    International Nuclear Information System (INIS)

    Kostadinov, S.I.; Petrov, G.

    1992-01-01

    From a special class of systems has been used a Schroedinger equation with impulse effect in Minkowski space field theory with time dependent boundary conditions, i.e. those of moving mirrors. The field theoretical approach for studying the properties of the vacuum starts from an analysis of the behaviour of local field quantities in Minkowski space with uniformly moving mirrors. For the impulsive moving mirror model is the real process of interaction between the quantum field and the external mirror a subject to disturbances in its evolution acting in time very short compared with the entire duration of the process. So the stability of the solution of the Schroedinger evolution equation for the process in the stability of the vacuum of Casimir. 8 refs

  18. Inverse spectral results for Schroedinger operators on the unit interval with partial information given on the potentials

    International Nuclear Information System (INIS)

    Amour, L.; Raoux, T.; Faupin, J.

    2009-01-01

    We pursue the analysis of the Schroedinger operator on the unit interval in inverse spectral theory initiated in the work of Amour and Raoux [''Inverse spectral results for Schroedinger operators on the unit interval with potentials in Lp spaces,'' Inverse Probl. 23, 2367 (2007)]. While the potentials in the work of Amour and Raoux belong to L 1 with their difference in L p (1≤p k,1 spaces having their difference in W k,p , where 1≤p≤+∞, k(set-membership sign)(0,1,2). It is proved that two potentials in W k,1 ([0,1]) being equal on [a,1] are also equal on [0,1] if their difference belongs to W k,p ([0,a]) and if the number of their common eigenvalues is sufficiently high. Naturally, this number decreases as the parameter a decreases and as the parameters k and p increase

  19. Piecewise linear emulator of the nonlinear Schroedinger equation and the resulting analytic solutions for Bose-Einstein condensates

    International Nuclear Information System (INIS)

    Theodorakis, Stavros

    2003-01-01

    We emulate the cubic term Ψ 3 in the nonlinear Schroedinger equation by a piecewise linear term, thus reducing the problem to a set of uncoupled linear inhomogeneous differential equations. The resulting analytic expressions constitute an excellent approximation to the exact solutions, as is explicitly shown in the case of the kink, the vortex, and a δ function trap. Such a piecewise linear emulation can be used for any differential equation where the only nonlinearity is a Ψ 3 one. In particular, it can be used for the nonlinear Schroedinger equation in the presence of harmonic traps, giving analytic Bose-Einstein condensate solutions that reproduce very accurately the numerically calculated ones in one, two, and three dimensions

  20. A comparative analysis of Painleve, Lax pair, and similarity transformation methods in obtaining the integrability conditions of nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Al Khawaja, U.

    2010-01-01

    We derive the integrability conditions of nonautonomous nonlinear Schroedinger equations using the Lax pair and similarity transformation methods. We present a comparative analysis of these integrability conditions with those of the Painleve method. We show that while the Painleve integrability conditions restrict the dispersion, nonlinearity, and dissipation/gain coefficients to be space independent and the external potential to be only a quadratic function of position, the Lax Pair and the similarity transformation methods allow for space-dependent coefficients and an external potential that is not restricted to the quadratic form. The integrability conditions of the Painleve method are retrieved as a special case of our general integrability conditions. We also derive the integrability conditions of nonautonomous nonlinear Schroedinger equations for two- and three-spacial dimensions.