WorldWideScience

Sample records for schizont specific gene

  1. Proteomic analysis of the Theileria annulata schizont.

    OpenAIRE

    Witschi Marc; Xia D; Sanderson Sandy; Baumgartner Martin; Wastling Jonathan; Dobbelaere Dirk

    2013-01-01

    The apicomplexan parasite, Theileria annulata, is the causative agent of tropical theileriosis, a devastating lymphoproliferative disease of cattle. The schizont stage transforms bovine leukocytes and provides an intriguing model to study host/pathogen interactions. The genome of T. annulata has been sequenced and transcriptomic data are rapidly accumulating. In contrast, little is known about the proteome of the schizont, the pathogenic, transforming life cycle stage of the parasite. Using o...

  2. Metamorphosis of Ichthyophonus Schizonts Transiting the Gastrointestinal Tract of Experimentally Exposed Rainbow Trout.

    Science.gov (United States)

    Kocan, R M; LaPatra, S E

    2017-12-08

    Other than the initial infectious cell, schizonts are the only stage of the parasite Ichthyophonus sp. that has been identified in the tissues of a living host, and they are known to initiate new infections when ingested by a suitable host. However, after feeding Ichthyophonus-infected tissue to Rainbow Trout Oncorhynchus mykiss, we observed that once infection was initiated, some schizonts proceeded to develop into several other morphologic forms indistinguishable from those previously described from recently deceased hosts, decomposing infected corpses, and in vitro culture. It appeared that not all schizonts participated in the infection process; some initiated infection, as expected, while others passed into the intestines, where they morphed into multiple cell types (e.g., schizonts, some with partially digested or ruptured capsules, ameboid plasmodia, merozoites, hyphenated cells, and empty capsules). Some of these cells were viable when cultured, but none was infectious to naïve Rainbow Trout when administered by gavage. We posit that (1) not all tissue schizonts are programmed to perform the same function or (2) not all respond similarly to their environment. After consumption by a piscivore, those schizonts that do not initiate an infection do not die but rather metamorphose into different cell types as they transit the gastrointestinal tract and are ultimately released back into the aquatic environment through defecation. The fate of these cells after exiting the host is presently unknown, but they likely represent a segment of the Ichthyophonus life cycle. © 2017 American Fisheries Society.

  3. Proteomic analysis of the Theileria annulata schizont

    Science.gov (United States)

    Witschi, M.; Xia, D.; Sanderson, S.; Baumgartner, M.; Wastling, J.M.; Dobbelaere, D.A.E.

    2013-01-01

    The apicomplexan parasite, Theileria annulata, is the causative agent of tropical theileriosis, a devastating lymphoproliferative disease of cattle. The schizont stage transforms bovine leukocytes and provides an intriguing model to study host/pathogen interactions. The genome of T. annulata has been sequenced and transcriptomic data are rapidly accumulating. In contrast, little is known about the proteome of the schizont, the pathogenic, transforming life cycle stage of the parasite. Using one-dimensional (1-D) gel LC-MS/MS, a proteomic analysis of purified T. annulata schizonts was carried out. In whole parasite lysates, 645 proteins were identified. Proteins with transmembrane domains (TMDs) were under-represented and no proteins with more than four TMDs could be detected. To tackle this problem, Triton X-114 treatment was applied, which facilitates the extraction of membrane proteins, followed by 1-D gel LC-MS/MS. This resulted in the identification of an additional 153 proteins. Half of those had one or more TMD and 30 proteins with more than four TMDs were identified. This demonstrates that Triton X-114 treatment can provide a valuable additional tool for the identification of new membrane proteins in proteomic studies. With two exceptions, all proteins involved in glycolysis and the citric acid cycle were identified. For at least 29% of identified proteins, the corresponding transcripts were not present in the existing expressed sequence tag databases. The proteomics data were integrated into the publicly accessible database resource at EuPathDB (www.eupathdb.org) so that mass spectrometry-based protein expression evidence for T. annulata can be queried alongside transcriptional and other genomics data available for these parasites. PMID:23178997

  4. Directional gene expression and antisense transcripts in sexual and asexual stages of Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    López-Barragán María J

    2011-11-01

    Full Text Available Abstract Background It has been shown that nearly a quarter of the initial predicted gene models in the Plasmodium falciparum genome contain errors. Although there have been efforts to obtain complete cDNA sequences to correct the errors, the coverage of cDNA sequences on the predicted genes is still incomplete, and many gene models for those expressed in sexual or mosquito stages have not been validated. Antisense transcripts have widely been reported in P. falciparum; however, the extent and pattern of antisense transcripts in different developmental stages remain largely unknown. Results We have sequenced seven bidirectional libraries from ring, early and late trophozoite, schizont, gametocyte II, gametocyte V, and ookinete, and four strand-specific libraries from late trophozoite, schizont, gametocyte II, and gametocyte V of the 3D7 parasites. Alignment of the cDNA sequences to the 3D7 reference genome revealed stage-specific antisense transcripts and novel intron-exon splicing junctions. Sequencing of strand-specific cDNA libraries suggested that more genes are expressed in one direction in gametocyte than in schizont. Alternatively spliced genes, antisense transcripts, and stage-specific expressed genes were also characterized. Conclusions It is necessary to continue to sequence cDNA from different developmental stages, particularly those of non-erythrocytic stages. The presence of antisense transcripts in some gametocyte and ookinete genes suggests that these antisense RNA may play an important role in gene expression regulation and parasite development. Future gene expression studies should make use of directional cDNA libraries. Antisense transcripts may partly explain the observed discrepancy between levels of mRNA and protein expression.

  5. A quantitative reverse-transcriptase PCR assay for the assessment of drug activities against intracellular Theileria annulata schizonts

    Directory of Open Access Journals (Sweden)

    Isabel Hostettler

    2014-12-01

    Full Text Available Intracellular schizonts of the apicomplexans Theileria annulata and Theileria parva immortalize bovine leucocytes thereby causing fatal immunoproliferative diseases. Buparvaquone, a hydroxynaphthoquinone related to parvaquone, is the only drug available against Theileria. The drug is only effective at the onset of infection and emerging resistance underlines the need for identifying alternative compounds. Current drug assays employ monitoring of proliferation of infected cells, with apoptosis of the infected host cell as a read-out, but it is often unclear whether active compounds directly impair the viability of the parasite or primarily induce host cell death. We here report on the development of a quantitative reverse transcriptase real time PCR method based on two Theileria genes, tasp and tap104, which are both expressed in schizonts. Upon in vitro treatment of T. annulata infected bovine monocytes with buparvaquone, TaSP and Tap104 mRNA expression levels significantly decreased in relation to host cell actin already within 4 h of drug exposure, while significant differences in host cell proliferation were detectable only after 48–72 h. TEM revealed marked alterations of the schizont ultrastructure already after 2 h of buparvaquone treatment, while the host cell remained unaffected. Expression of TaSP and Tap104 proteins showed a marked decrease only after 24 h. Therefore, the analysis of expression levels of mRNA coding for TaSP and Tap104 allows to directly measuring impairment of parasite viability. We subsequently applied this method using a series of compounds affecting different targets in other apicomplexan parasites, and show that monitoring of TaSP- and Tap104 mRNA levels constitutes a suitable tool for anti-theilerial drug development.

  6. Recruitment of EB1, a Master Regulator of Microtubule Dynamics, to the Surface of the Theileria annulata Schizont

    KAUST Repository

    Woods, Kerry L.

    2013-05-09

    The apicomplexan parasite Theileria annulata transforms infected host cells, inducing uncontrolled proliferation and clonal expansion of the parasitized cell population. Shortly after sporozoite entry into the target cell, the surrounding host cell membrane is dissolved and an array of host cell microtubules (MTs) surrounds the parasite, which develops into the transforming schizont. The latter does not egress to invade and transform other cells. Instead, it remains tethered to host cell MTs and, during mitosis and cytokinesis, engages the cell\\'s astral and central spindle MTs to secure its distribution between the two daughter cells. The molecular mechanism by which the schizont recruits and stabilizes host cell MTs is not known. MT minus ends are mostly anchored in the MT organizing center, while the plus ends explore the cellular space, switching constantly between phases of growth and shrinkage (called dynamic instability). Assuming the plus ends of growing MTs provide the first point of contact with the parasite, we focused on the complex protein machinery associated with these structures. We now report how the schizont recruits end-binding protein 1 (EB1), a central component of the MT plus end protein interaction network and key regulator of host cell MT dynamics. Using a range of in vitro experiments, we demonstrate that T. annulata p104, a polymorphic antigen expressed on the schizont surface, functions as a genuine EB1-binding protein and can recruit EB1 in the absence of any other parasite proteins. Binding strictly depends on a consensus SxIP motif located in a highly disordered C-terminal region of p104. We further show that parasite interaction with host cell EB1 is cell cycle regulated. This is the first description of a pathogen-encoded protein to interact with EB1 via a bona-fide SxIP motif. Our findings provide important new insight into the mode of interaction between Theileria and the host cell cytoskeleton. 2013 Woods et al.

  7. Recruitment of EB1, a master regulator of microtubule dynamics, to the surface of the Theileria annulata schizont.

    Directory of Open Access Journals (Sweden)

    Kerry L Woods

    2013-05-01

    Full Text Available The apicomplexan parasite Theileria annulata transforms infected host cells, inducing uncontrolled proliferation and clonal expansion of the parasitized cell population. Shortly after sporozoite entry into the target cell, the surrounding host cell membrane is dissolved and an array of host cell microtubules (MTs surrounds the parasite, which develops into the transforming schizont. The latter does not egress to invade and transform other cells. Instead, it remains tethered to host cell MTs and, during mitosis and cytokinesis, engages the cell's astral and central spindle MTs to secure its distribution between the two daughter cells. The molecular mechanism by which the schizont recruits and stabilizes host cell MTs is not known. MT minus ends are mostly anchored in the MT organizing center, while the plus ends explore the cellular space, switching constantly between phases of growth and shrinkage (called dynamic instability. Assuming the plus ends of growing MTs provide the first point of contact with the parasite, we focused on the complex protein machinery associated with these structures. We now report how the schizont recruits end-binding protein 1 (EB1, a central component of the MT plus end protein interaction network and key regulator of host cell MT dynamics. Using a range of in vitro experiments, we demonstrate that T. annulata p104, a polymorphic antigen expressed on the schizont surface, functions as a genuine EB1-binding protein and can recruit EB1 in the absence of any other parasite proteins. Binding strictly depends on a consensus SxIP motif located in a highly disordered C-terminal region of p104. We further show that parasite interaction with host cell EB1 is cell cycle regulated. This is the first description of a pathogen-encoded protein to interact with EB1 via a bona-fide SxIP motif. Our findings provide important new insight into the mode of interaction between Theileria and the host cell cytoskeleton.

  8. Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana

    Science.gov (United States)

    2011-01-01

    Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species

  9. In silico analysis of Ta9 gene polymorphism in an Iranian Theileria annulata schizont-infected cell line S15 vaccine strain and native isolates

    Directory of Open Access Journals (Sweden)

    Habibi, G.

    2016-07-01

    Full Text Available Bovine theileriosis is a tick-borne disease caused by obligate intracellular parasites related to the genus Theileria. Cellular immune responses protect cattle against pathogens through the activation of immune cells. Nowadays, live, attenuated vaccine of Theileria annulata (T. annulata is being produced in Iran and is recommended for active cattle immunization. Detection of the immunogenic antigens and epitopes recognized by CD8+ T Lymphocytes is vital for the development of recombinant and subunit vaccines. Herein, sequences of the genes encoding Ta9, which is an important antigen recognized by bovine CD8+ T cells specific for T. annulata, in Iranian S15 vaccine strains, several Iranian isolates, as well as reference Ta9 DNA sequences registered in GeneBank were compared through polymerase chain reaction (PCR. The obtained data from DNA sequences were analyzed by using "Nucleotide", "Blast n", "BioEdit" and "IEDB" softwares. The results showed high level of variation in nucleotides and amino acids level. The observed polymorphism in Ta9 gene sequences of Iranian vaccine strains and some isolates from Iran demonstrated that this antigen contains polymorphic sequences and is active along with the specific major histocompatibility complex (MHC of the host. Polymorphic sequences and specific epitopes of Ta9 gene for CD8+ T cell provides an explanation for incomplete protection observed after inoculation of heterologous parasites in vaccinated cattle. These results have important implications for the application of Ta9 antigen for developing novel subunit vaccines.

  10. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  11. Gene specific actions of thyroid hormone receptor subtypes.

    Directory of Open Access Journals (Sweden)

    Jean Z Lin

    Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.

  12. Gene-specific cell labeling using MiMIC transposons.

    Science.gov (United States)

    Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

    2015-04-30

    Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  14. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  15. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  16. Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

    Directory of Open Access Journals (Sweden)

    Benjamin Mayne

    2016-10-01

    Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  17. Exploring the potential relevance of human-specific genes to complex disease

    Directory of Open Access Journals (Sweden)

    Cooper David N

    2011-01-01

    Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.

  18. Tissue-specific functional networks for prioritizing phenotype and disease genes.

    Directory of Open Access Journals (Sweden)

    Yuanfang Guan

    Full Text Available Integrated analyses of functional genomics data have enormous potential for identifying phenotype-associated genes. Tissue-specificity is an important aspect of many genetic diseases, reflecting the potentially different roles of proteins and pathways in diverse cell lineages. Accounting for tissue specificity in global integration of functional genomics data is challenging, as "functionality" and "functional relationships" are often not resolved for specific tissue types. We address this challenge by generating tissue-specific functional networks, which can effectively represent the diversity of protein function for more accurate identification of phenotype-associated genes in the laboratory mouse. Specifically, we created 107 tissue-specific functional relationship networks through integration of genomic data utilizing knowledge of tissue-specific gene expression patterns. Cross-network comparison revealed significantly changed genes enriched for functions related to specific tissue development. We then utilized these tissue-specific networks to predict genes associated with different phenotypes. Our results demonstrate that prediction performance is significantly improved through using the tissue-specific networks as compared to the global functional network. We used a testis-specific functional relationship network to predict genes associated with male fertility and spermatogenesis phenotypes, and experimentally confirmed one top prediction, Mbyl1. We then focused on a less-common genetic disease, ataxia, and identified candidates uniquely predicted by the cerebellum network, which are supported by both literature and experimental evidence. Our systems-level, tissue-specific scheme advances over traditional global integration and analyses and establishes a prototype to address the tissue-specific effects of genetic perturbations, diseases and drugs.

  19. Genome-scale analysis of positional clustering of mouse testis-specific genes

    Directory of Open Access Journals (Sweden)

    Lee Bernett TK

    2005-01-01

    Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.

  20. Mining tissue specificity, gene connectivity and disease association to reveal a set of genes that modify the action of disease causing genes

    Directory of Open Access Journals (Sweden)

    Reverter Antonio

    2008-09-01

    Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing

  1. Discovery of cancer common and specific driver gene sets

    Science.gov (United States)

    2017-01-01

    Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

  2. Effect of Exposure Dose on Ichthyophonus Prevalence and Infection Intensity in Experimentally Infected Rainbow Trout, Oncorhynchus mykiss.

    Science.gov (United States)

    Kocan, Richard; LaPatra, Scott

    2016-02-01

    This study describes the effect of increasing exposure dose on Ichthyophonus prevalence and infection intensity in experimentally infected rainbow trout, Oncorhynchus mykiss. Specific-pathogen free trout were exposed per os to increasing numbers of Ichthyophonus schizonts obtained from naturally infected donor fish, then sampled after 30 and 60 days post-exposure. Both in vitro explant culture and histology revealed that as the number of schizonts per dose increased there was a proportionate increase in the number of infected fish, as well as an increase in the number of infected organs; parasite density in individual infected organs also increased with dose. Explant culture revealed that all fish exposed to the highest dose (≥2,080 schizonts) became infected, while only 67% of those exposed to the intermediate dose (1,040-1,153 schizonts) were Ichthyophonus-positive after 60 days; Ichthyophonus was not detected in fish exposed to the 2 lowest doses (≤280 schizonts). Histologic examination of individual infected organs also revealed increasing infection prevalence and parasite density in response to exposure to increasing numbers of Ichthyophonus schizonts.

  3. Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA.

    Science.gov (United States)

    Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J

    2013-05-01

    FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.

  4. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  5. Description of electrophoretic loci and tissue specific gene ...

    African Journals Online (AJOL)

    Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.

  6. Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.

    Science.gov (United States)

    Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy

    2017-12-01

    Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.

  7. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

    Directory of Open Access Journals (Sweden)

    Clark Taane G

    2010-04-01

    Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes

  8. Evolutionary constraints shape caste-specific gene expression across 15 ant species.

    Science.gov (United States)

    Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki

    2017-05-01

    Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  9. New frontier in regenerative medicine: site-specific gene correction in patient-specific induced pluripotent stem cells.

    Science.gov (United States)

    Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C

    2013-06-01

    Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.

  10. Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

    Science.gov (United States)

    Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

    2016-05-20

    Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  11. Exposure of the Plasmodium falciparum clonally variant STEVOR proteins on the merozoite surface

    Directory of Open Access Journals (Sweden)

    Meri Seppo

    2011-03-01

    Full Text Available Abstract Background Plasmodium falciparum merozoites are free invasive forms that invade host erythrocytes in iterative cycles in the presence of different arms of the immune system. Variant antigens are known to play a role in immune evasion and several gene families coding for variant antigens have been identified in P. falciparum. However, none of them have been reported to be expressed on the surface of merozoites. Methods Flow cytometry, immunofluorescence microscopy, and immunoblotting assays were performed to assess surface exposure, membrane association and stage specific expression of the STEVOR family of variants proteins, respectively. Results Using a polyclonal antibody (anti-PFL2610w with a broad specificity towards different STEVOR variants, the STEVOR proteins were identified on the surface of non-permeabilized/non-fixed merozoites in flow cytometry assays. Anti-PFL2610w antibody showed that several STEVORs were expressed in the trophozoite stage of the parasite but only one variant was integrated into the merozoite membrane. Moreover, this antibody failed to identify STEVORs on the surface of the parent schizont infected erythrocytes (IE although they were readily identified when schizont IE were permeabilized. Conclusions These data suggest for a role for STEVOR in immune evasion by P. falciparum merozoites to allow successful invasion of erythrocytes. Additionally, the expression of STEVORs in the schizont stage may only represent a step in the biogenesis process of the merozoite surface coat.

  12. Identification of the two rotavirus genes determining neutralization specificities

    International Nuclear Information System (INIS)

    Offit, P.A.; Blavat, G.

    1986-01-01

    Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities

  13. Identification of the two rotavirus genes determining neutralization specificities

    Energy Technology Data Exchange (ETDEWEB)

    Offit, P.A.; Blavat, G.

    1986-01-01

    Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.

  14. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  15. Transcriptional Profiling Identifies Location-Specific and Breed-Specific Differentially Expressed Genes in Embryonic Myogenesis in Anas Platyrhynchos.

    Directory of Open Access Journals (Sweden)

    Rong-Ping Zhang

    Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only

  16. Study on Fusion Protein and Its gene in Baculovirus Specificity

    International Nuclear Information System (INIS)

    Nemr, W.A.H.

    2012-01-01

    Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at

  17. A high parasite density environment induces transcriptional changes and cell death in Plasmodium falciparum blood stages.

    Science.gov (United States)

    Chou, Evelyn S; Abidi, Sabia Z; Teye, Marian; Leliwa-Sytek, Aleksandra; Rask, Thomas S; Cobbold, Simon A; Tonkin-Hill, Gerry Q; Subramaniam, Krishanthi S; Sexton, Anna E; Creek, Darren J; Daily, Johanna P; Duffy, Michael F; Day, Karen P

    2018-03-01

    Transient regulation of Plasmodium numbers below the density that induces fever has been observed in chronic malaria infections in humans. This species transcending control cannot be explained by immunity alone. Using an in vitro system we have observed density dependent regulation of malaria population size as a mechanism to possibly explain these in vivo observations. Specifically, Plasmodium falciparum blood stages from a high but not low-density environment exhibited unique phenotypic changes during the late trophozoite (LT) and schizont stages of the intraerythrocytic cycle. These included in order of appearance: failure of schizonts to mature and merozoites to replicate, apoptotic-like morphological changes including shrinking, loss of mitochondrial membrane potential, and blebbing with eventual release of aberrant parasites from infected erythrocytes. This unique death phenotype was triggered in a stage-specific manner by sensing of a high-density culture environment. Conditions of glucose starvation, nutrient depletion, and high lactate could not induce the phenotype. A high-density culture environment induced rapid global changes in the parasite transcriptome including differential expression of genes involved in cell remodeling, clonal antigenic variation, metabolism, and cell death pathways including an apoptosis-associated metacaspase gene. This transcriptional profile was also characterized by concomitant expression of asexual and sexual stage-specific genes. The data show strong evidence to support our hypothesis that density sensing exists in P. falciparum. They indicate that an apoptotic-like mechanism may play a role in P. falciparum density regulation, which, as in yeast, has features quite distinguishable from mammalian apoptosis. Gene expression data are available in the GEO databases under the accession number GSE91188. © 2017 Federation of European Biochemical Societies.

  18. Tissue-specifically regulated site-specific excision of selectable marker genes in bivalent insecticidal, genetically-modified rice.

    Science.gov (United States)

    Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu

    2013-12-01

    Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.

  19. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  20. Sarcocystis jamaicensis n. sp., from Red-Tailed Hawks (Buteo jamaicensis) Definitive Host and IFN-γ Gene Knockout Mice as Experimental Intermediate Host.

    Science.gov (United States)

    Verma, S K; von Dohlen, A Rosypal; Mowery, J D; Scott, D; Rosenthal, B M; Dubey, J P; Lindsay, D S

    2017-10-01

    Here, we report a new species of Sarcocystis with red-tailed hawk (RTH, Buteo jamaicensis) as the natural definitive host and IFN-γ gene knockout (KO) mice as an experimental intermediate host in which sarcocysts form in muscle. Two RTHs submitted to the Carolina Raptor Center, Huntersville, North Carolina, were euthanized because they could not be rehabilitated and released. Fully sporulated 12.5 × 9.9-μm sized sporocysts were found in intestinal scrapings of both hawks. Sporocysts were orally fed to laboratory-reared outbred Swiss Webster mice (SW, Mus musculus) and also to KO mice. The sporocysts were infective for KO mice but not for SW mice. All SW mice remained asymptomatic, and neither schizonts nor sarcocysts were found in any SW mice euthanized on days 54, 77, 103 (n = 2) or 137 post-inoculation (PI). The KO mice developed neurological signs and were necropsied between 52 to 68 days PI. Schizonts/merozoites were found in all KO mice euthanized on days 52, 55 (n = 3), 59, 61 (n = 2), 66, and 68 PI and they were confined to the brain. The predominant lesion was meningoencephalitis characterized by perivascular cuffs, granulomas, and necrosis of the neural tissue. The schizonts/merozoites were located in neural tissue and were apparently extravascular. Brain homogenates from infected KO mice were infective to KO mice by subcutaneous inoculation and when seeded on to CV-1 cells. Microscopic sarcocysts were found in skeletal muscles of 5 of 8 KO mice euthanized between 55-61 days PI. Only a few sarcocysts were detected. Sarcocysts were microscopic, up to 3.5 mm long. When viewed with light microscopy, the sarcocyst wall appeared thin (<1 μm thick) and smooth. By transmission electron microscopy, the sarcocyst wall classified as "type 1j" (new designation). Molecular characterization using 18S rRNA, 28S rRNA, ITS-1, and cox1 genes revealed a close relationship with Sarcocystis microti and Sarcocystis glareoli; both species infect birds as definitive hosts

  1. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Harindra E. Amarasinghe

    2015-07-01

    Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  2. Epigenetic repression of male gametophyte-specific genes in the Arabidopsis sporophyte

    DEFF Research Database (Denmark)

    Hoffmann, Robert D; Palmgren, Michael Broberg

    2013-01-01

    Tissue formation, the identity of cells, and the functions they fulfill, are results of gene regulation. The male gametophyte of plants, pollen, is outstanding in this respect as several hundred genes expressed in pollen are not expressed in the sporophyte. How pollen-specific genes are down......-regulated in the sporophyte has yet to be established. In this study, we have performed a bioinformatics analysis of publicly available genome-wide epigenetics data of several sporophytic tissues. By combining this analysis with DNase I footprinting data, we assessed means by which the repression of pollen-specific genes...

  3. Heritable and lineage-specific gene knockdown in zebrafish embryo.

    Directory of Open Access Journals (Sweden)

    Mei Dong

    Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.

  4. Acute, fatal Sarcocystis calchasi-associated hepatitis in Roller pigeons (Columba livia f. dom.) at Philadelphia Zoo.

    Science.gov (United States)

    Trupkiewicz, J G; Calero-Bernal, R; Verma, S K; Mowery, J; Davison, S; Habecker, P; Georoff, T A; Ialeggio, D M; Dubey, J P

    2016-01-30

    Four Roller pigeons (Columba livia f. dom.) at the Philadelphia Zoo died suddenly. Necropsy examination revealed macroscopic hepatitis. Microscopically, the predominant lesions were in liver, characterized with necrosis and mixed cell inflammatory response. Sarcocystis calchasi-like schizonts and free merozoites were identified in liver. Transmission electron microscopy confirmed that schizonts were in hepatocytes. A few schizonts were in spleen. PCR using S. calchasi-specific primers confirmed the diagnosis. Neither lesions nor protozoa were found in brain and muscles. This is the first report of acute visceral S. calchasi-associated sarcocystosis in naturally infected avian hosts. Published by Elsevier B.V.

  5. A gene regulatory network armature for T-lymphocyte specification

    Energy Technology Data Exchange (ETDEWEB)

    Fung, Elizabeth-sharon [Los Alamos National Laboratory

    2008-01-01

    Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

  6. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Directory of Open Access Journals (Sweden)

    Hettne Kristina M

    2013-01-01

    Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.

  7. A large-scale analysis of tissue-specific pathology and gene expression of human disease genes and complexes

    DEFF Research Database (Denmark)

    Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart

    2008-01-01

    to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...

  8. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  9. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  10. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  11. Sarcocystis neurona schizonts-associated encephalitis, chorioretinitis, and myositis in a two-month-old dog simulating toxoplasmosis, and presence of mature sarcocysts in muscles.

    Science.gov (United States)

    Dubey, J P; Black, S S; Verma, S K; Calero-Bernal, R; Morris, E; Hanson, M A; Cooley, A J

    2014-05-28

    Sarcocystis neurona is an unusual species of the genus Sarcocystis. Opossums (Didelphis virginianus, D. albiventris) are the definitive hosts and several other species, including dogs, cats, marine mammals, and horses are intermediate or aberrant hosts. Sarcocysts are not known to form in aberrant hosts. Sarcocystis neurona causes fatal disease in horses (Equine Protozoal Myeloencephalitis, EPM). There are numerous reports of fatal EPM-like infections in other species, usually with central nervous system signs and associated with the schizont stage of S. neurona. Here, we report fatal disseminated S. neurona infection in a nine-week-old golden retriever dog from Mississippi, USA. Protozoal merozoites were identified in smears of the cerebrospinal fluid. Microscopically, lesions and protozoa were identified in eyes, tongue, heart, liver, intestines, nasal turbinates, skeletal muscle and brain, which reacted intensely with S. neurona polyclonal antibodies. Mature sarcocysts were seen in sections of muscles. These sarcocysts were ultrastructurally similar to those of S. neurona from experimentally infected animals. These data suggest that the dog is another intermediate host for S. neurona. Data suggest that the dog was transplacentally infected. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  13. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  14. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

    2013-01-01

    Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

  15. Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle.

    Science.gov (United States)

    Shock, Jennifer L; Fischer, Kael F; DeRisi, Joseph L

    2007-01-01

    The rate of mRNA decay is an essential element of post-transcriptional regulation in all organisms. Previously, studies in several organisms found that the specific half-life of each mRNA is precisely related to its physiologic role, and plays an important role in determining levels of gene expression. We used a genome-wide approach to characterize mRNA decay in Plasmodium falciparum. We found that, globally, rates of mRNA decay increase dramatically during the asexual intra-erythrocytic developmental cycle. During the ring stage of the cycle, the average mRNA half-life was 9.5 min, but this was extended to an average of 65 min during the late schizont stage of development. Thus, a major determinant of mRNA decay rate appears to be linked to the stage of intra-erythrocytic development. Furthermore, we found specific variations in decay patterns superimposed upon the dominant trend of progressive half-life lengthening. These variations in decay pattern were frequently enriched for genes with specific cellular functions or processes. Elucidation of Plasmodium mRNA decay rates provides a key element for deciphering mechanisms of genetic control in this parasite, by complementing and extending previous mRNA abundance studies. Our results indicate that progressive stage-dependent decreases in mRNA decay rate function are a major determinant of mRNA accumulation during the schizont stage of intra-erythrocytic development. This type of genome-wide change in mRNA decay rate has not been observed in any other organism to date, and indicates that post-transcriptional regulation may be the dominant mechanism of gene regulation in P. falciparum.

  16. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  17. Conservation and sex-specific splicing of the doublesex gene

    Indian Academy of Sciences (India)

    Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...

  18. Freedom of expression: cell-type-specific gene profiling.

    Science.gov (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

    2014-01-01

    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.

  19. Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

    Directory of Open Access Journals (Sweden)

    Vaiman Daniel

    2005-05-01

    Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological

  20. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    Science.gov (United States)

    2013-01-01

    Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the

  1. [Analysis of tissue-specific differentially methylated genes with differential gene expression in non-small cell lung cancer].

    Science.gov (United States)

    Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q

    2014-01-01

    Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.

  2. Towards the identification of flower-specific genes in Citrus spp

    Directory of Open Access Journals (Sweden)

    Marcelo Carnier Dornelas

    2007-01-01

    Full Text Available Citrus sinensis is a perennial woody species, for which genetic approaches to the study of reproductive development are not readily amenable. Here, the usefulness of the CitEST Expressed Sequence Tag (EST database is demonstrated as a reliable new resource for identifying novel genes exclusively related to Citrus reproductive biology. We performed the analysis of an EST dataset of the CitEST Project containing 4,330 flower-derived cDNA sequences. Relying on bioinformatics tools, sequences exclusively present in this flower-derived sequence collection were selected and used for the identification of Citrus putative flower-specific genes. Our analysis revealed several Citrus sequences showing significant similarity to conserved genes known to have flower-specific expression and possessing functions related to flower metabolism and/or reproductive development in diverse plant species. Comparison of the Citrus flower-specific sequences with all available plant peptide sequences unraveled 247 unique transcripts not identified elsewhere within the plant kingdom. Additionally, 49 transcripts, for which no biological function could be attributed by means of sequence comparisons, were found to be conserved among plant species. These results allow further gene expression analysis and possibly novel approaches to the understanding of reproductive development in Citrus.

  3. Analysis of cell-type-specific gene expression during mouse spermatogenesis

    DEFF Research Database (Denmark)

    Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser

    2004-01-01

    In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...

  4. Specific gene mutations induced by heavy ions

    International Nuclear Information System (INIS)

    Freeling, M.; Karoly, C.W.; Cheng, D.S.K.

    1980-01-01

    This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens

  5. Injury, inflammation and the emergence of human specific genes

    Science.gov (United States)

    2016-07-12

    genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate

  6. Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

    NARCIS (Netherlands)

    K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)

    2013-01-01

    textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with

  7. Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.

    Science.gov (United States)

    Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

    2017-06-08

    A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.

  8. Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.

    Directory of Open Access Journals (Sweden)

    Chen Xie

    2012-09-01

    Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.

  9. Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.

    OpenAIRE

    Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M

    1989-01-01

    Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...

  10. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  11. Allele-specific gene expression in a wild nonhuman primate population

    Science.gov (United States)

    Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

    2015-01-01

    Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

  12. Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans.

    Science.gov (United States)

    Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B

    2017-11-24

    Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.

  13. Area-Specific Cell Stimulation via Surface-Mediated Gene Transfer Using Apatite-Based Composite Layers

    Directory of Open Access Journals (Sweden)

    Yushin Yazaki

    2015-04-01

    Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.

  14. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  15. The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

    Science.gov (United States)

    Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

    2012-06-01

    Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

  16. Inference of cancer-specific gene regulatory networks using soft computing rules.

    Science.gov (United States)

    Wang, Xiaosheng; Gotoh, Osamu

    2010-03-24

    Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

  17. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  18. Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

    Science.gov (United States)

    Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

    2016-10-15

    Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author

  19. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  20. Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS

    Directory of Open Access Journals (Sweden)

    Scott Jewell

    2012-08-01

    Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.

  1. Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.

    Directory of Open Access Journals (Sweden)

    Erin C Macaulay

    Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.

  2. Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans

    Directory of Open Access Journals (Sweden)

    Assaf Gottlieb

    2017-11-01

    Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort

  3. Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.

    Science.gov (United States)

    Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua

    2018-04-01

    Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.

  4. A human-specific de novo protein-coding gene associated with human brain functions.

    Directory of Open Access Journals (Sweden)

    Chuan-Yun Li

    2010-03-01

    Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.

  5. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Using a periclinal chimera to unravel layer-specific gene expression in plants.

    Science.gov (United States)

    Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

    2013-09-01

    Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

  7. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  8. Characterization of a novel autophagy-specific gene, ATG29

    International Nuclear Information System (INIS)

    Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori

    2005-01-01

    Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins

  9. Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules

    Directory of Open Access Journals (Sweden)

    Xiaosheng Wang

    2010-03-01

    Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

  10. Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression

    International Nuclear Information System (INIS)

    Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe

    2005-01-01

    We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells

  11. Sorted gene genealogies and species-specific nonsynonymous substitutions point to putative postmating prezygotic isolation genes in Allonemobius crickets

    Directory of Open Access Journals (Sweden)

    Suegene Noh

    2016-02-01

    Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of

  12. Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues

    OpenAIRE

    Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.

    2010-01-01

    MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...

  13. Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

    Science.gov (United States)

    Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

    2018-05-03

    Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

  14. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  15. Generation of a gene cassette for genetically engineered Salmonella Enteritidis in the specific region of the sipC gene

    Directory of Open Access Journals (Sweden)

    M Ghasemi

    2017-05-01

    Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.

  16. Novel Genes Involved in Controlling Specification of Drosophila FMRFamide Neuropeptide Cells.

    Science.gov (United States)

    Bivik, Caroline; Bahrampour, Shahrzad; Ulvklo, Carina; Nilsson, Patrik; Angel, Anna; Fransson, Fredrik; Lundin, Erika; Renhorn, Jakob; Thor, Stefan

    2015-08-01

    The expression of neuropeptides is often extremely restricted in the nervous system, making them powerful markers for addressing cell specification . In the developing Drosophila ventral nerve cord, only six cells, the Ap4 neurons, of some 10,000 neurons, express the neuropeptide FMRFamide (FMRFa). Each Ap4/FMRFa neuron is the last-born cell generated by an identifiable and well-studied progenitor cell, neuroblast 5-6 (NB5-6T). The restricted expression of FMRFa and the wealth of information regarding its gene regulation and Ap4 neuron specification makes FMRFa a valuable readout for addressing many aspects of neural development, i.e., spatial and temporal patterning cues, cell cycle control, cell specification, axon transport, and retrograde signaling. To this end, we have conducted a forward genetic screen utilizing an Ap4-specific FMRFa-eGFP transgenic reporter as our readout. A total of 9781 EMS-mutated chromosomes were screened for perturbations in FMRFa-eGFP expression, and 611 mutants were identified. Seventy-nine of the strongest mutants were mapped down to the affected gene by deficiency mapping or whole-genome sequencing. We isolated novel alleles for previously known FMRFa regulators, confirming the validity of the screen. In addition, we identified novel essential genes, including several with previously undefined functions in neural development. Our identification of genes affecting most major steps required for successful terminal differentiation of Ap4 neurons provides a comprehensive view of the genetic flow controlling the generation of highly unique neuronal cell types in the developing nervous system. Copyright © 2015 by the Genetics Society of America.

  17. Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish

    Directory of Open Access Journals (Sweden)

    Atsuo Kawahara

    2016-05-01

    Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

  18. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays

    Directory of Open Access Journals (Sweden)

    Yuan Xin Goay

    2016-01-01

    Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

  19. Identification of Five Novel Salmonella Typhi-Specific Genes as Markers for Diagnosis of Typhoid Fever Using Single-Gene Target PCR Assays.

    Science.gov (United States)

    Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien

    2016-01-01

    Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.

  20. Comparative analysis of chromatin landscape in regulatory regions of human housekeeping and tissue specific genes

    Directory of Open Access Journals (Sweden)

    Dasgupta Dipayan

    2005-05-01

    Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.

  1. Age-Related Gene Expression in the Frontal Cortex Suggests Synaptic Function Changes in Specific Inhibitory Neuron Subtypes

    Directory of Open Access Journals (Sweden)

    Leon French

    2017-05-01

    Full Text Available Genome-wide expression profiling of the human brain has revealed genes that are differentially expressed across the lifespan. Characterizing these genes adds to our understanding of both normal functions and pathological conditions. Additionally, the specific cell-types that contribute to the motor, sensory and cognitive declines during aging are unclear. Here we test if age-related genes show higher expression in specific neural cell types. Our study leverages data from two sources of murine single-cell expression data and two sources of age-associations from large gene expression studies of postmortem human brain. We used nonparametric gene set analysis to test for age-related enrichment of genes associated with specific cell-types; we also restricted our analyses to specific gene ontology groups. Our analyses focused on a primary pair of single-cell expression data from the mouse visual cortex and age-related human post-mortem gene expression information from the orbitofrontal cortex. Additional pairings that used data from the hippocampus, prefrontal cortex, somatosensory cortex and blood were used to validate and test specificity of our findings. We found robust age-related up-regulation of genes that are highly expressed in oligodendrocytes and astrocytes, while genes highly expressed in layer 2/3 glutamatergic neurons were down-regulated across age. Genes not specific to any neural cell type were also down-regulated, possibly due to the bulk tissue source of the age-related genes. A gene ontology-driven dissection of the cell-type enriched genes highlighted the strong down-regulation of genes involved in synaptic transmission and cell-cell signaling in the Somatostatin (Sst neuron subtype that expresses the cyclin dependent kinase 6 (Cdk6 and in the vasoactive intestinal peptide (Vip neuron subtype expressing myosin binding protein C, slow type (Mybpc1. These findings provide new insights into cell specific susceptibility to normal aging

  2. eap Gene as novel target for specific identification of Staphylococcus aureus.

    Science.gov (United States)

    Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten

    2008-02-01

    The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.

  3. Digital sorting of complex tissues for cell type-specific gene expression profiles.

    Science.gov (United States)

    Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong

    2013-03-07

    Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.

  4. The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene.

    Science.gov (United States)

    Pharo, Elizabeth A; De Leo, Alison A; Renfree, Marilyn B; Thomson, Peter C; Lefèvre, Christophe M; Nicholas, Kevin R

    2012-06-08

    The marsupial early lactation protein (ELP) gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A). Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI) protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI)-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1) and early lactation (Phase 2A). The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI), spleen trypsin inhibitor (STI) and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5) genes. Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.

  5. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  6. General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD

    Directory of Open Access Journals (Sweden)

    Chen Xiaoheng

    2017-01-01

    Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.

  7. Controlling nuclear JAKs and STATs for specific gene activation by IFNγ

    International Nuclear Information System (INIS)

    Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.

    2011-01-01

    Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The

  8. Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells.

    Science.gov (United States)

    Soucie, Erinn L; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J-C; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H

    2016-02-12

    Differentiated macrophages can self-renew in tissues and expand long term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network that controls self-renewal. Single-cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. Copyright © 2016, American Association for the Advancement of Science.

  9. The DAL10 gene from Norway spruce (Picea abies) belongs to a potentially gymnosperm-specific subclass of MADS-box genes and is specifically active in seed cones and pollen cones.

    Science.gov (United States)

    Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter

    2003-01-01

    Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.

  10. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Cell-type-specific gene delivery into neuronal cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Parveen, Zahida; Mukhtar, Muhammad; Rafi, Mohammed; Wenger, David A.; Siddiqui, Khwaja M.; Siler, Catherine A.; Dietzschold, Bernhard; Pomerantz, Roger J.; Schnell, Matthias J.; Dornburg, Ralph

    2003-01-01

    The avian retroviruses reticuloendotheliosis virus strain A (REV-A) and spleen necrosis virus (SNV) are not naturally infectious in human cells. However, REV-A-derived viral vectors efficiently infect human cells when they are pseudotyped with envelope proteins displaying targeting ligands specific for human cell-surface receptors. Here we report that vectors containing the gag region of REV-A and pol of SNV can be pseudotyped with the envelope protein of vesicular stomatitis virus (VSV) and the glycoproteins of different rabies virus (RV) strains. Vectors pseudotyped with the envelope protein of the highly neurotropic RV strain CVS-N2c facilitated cell type-specific gene delivery into mouse and human neurons, but did not infect other human cell types. Moreover, when such vector particles were injected into the brain of newborn mice, only neuronal cells were infected in vivo. Cell-type-specific gene delivery into neurons may present quite specific gene therapy approaches for many degenerative diseases of the brain

  12. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  13. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  14. Specific genetic modifications of domestic animals by gene targeting and animal cloning

    Directory of Open Access Journals (Sweden)

    Zhou Jiangfeng

    2003-11-01

    Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.

  15. Retinal Diseases Caused by Mutations in Genes Not Specifically Associated with the Clinical Diagnosis.

    Directory of Open Access Journals (Sweden)

    Xia Wang

    Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.

  16. Simultaneous inference of phenotype-associated genes and relevant tissues from GWAS data via Bayesian integration of multiple tissue-specific gene networks.

    Science.gov (United States)

    Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung

    2017-12-01

    Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.

  17. Improving sensitivity of linear regression-based cell type-specific differential expression deconvolution with per-gene vs. global significance threshold.

    Science.gov (United States)

    Glass, Edmund R; Dozmorov, Mikhail G

    2016-10-06

    The goal of many human disease-oriented studies is to detect molecular mechanisms different between healthy controls and patients. Yet, commonly used gene expression measurements from blood samples suffer from variability of cell composition. This variability hinders the detection of differentially expressed genes and is often ignored. Combined with cell counts, heterogeneous gene expression may provide deeper insights into the gene expression differences on the cell type-specific level. Published computational methods use linear regression to estimate cell type-specific differential expression, and a global cutoff to judge significance, such as False Discovery Rate (FDR). Yet, they do not consider many artifacts hidden in high-dimensional gene expression data that may negatively affect linear regression. In this paper we quantify the parameter space affecting the performance of linear regression (sensitivity of cell type-specific differential expression detection) on a per-gene basis. We evaluated the effect of sample sizes, cell type-specific proportion variability, and mean squared error on sensitivity of cell type-specific differential expression detection using linear regression. Each parameter affected variability of cell type-specific expression estimates and, subsequently, the sensitivity of differential expression detection. We provide the R package, LRCDE, which performs linear regression-based cell type-specific differential expression (deconvolution) detection on a gene-by-gene basis. Accounting for variability around cell type-specific gene expression estimates, it computes per-gene t-statistics of differential detection, p-values, t-statistic-based sensitivity, group-specific mean squared error, and several gene-specific diagnostic metrics. The sensitivity of linear regression-based cell type-specific differential expression detection differed for each gene as a function of mean squared error, per group sample sizes, and variability of the proportions

  18. A Double Selection Approach to Achieve Specific Expression of Toxin Genes for Ovarian Cancer Gene Therapy

    National Research Council Canada - National Science Library

    Curiel, David T; Siegal, Gene; Wang, Minghui

    2007-01-01

    ...) to achieve efficient and selective gene transfer to target tumor cells. Proposed herein is a strategy to modify one candidate vector, recombinant adenovirus, such that it embodies the requisite properties of efficacy and specificity...

  19. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  20. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  1. Schistosomiasis coinfection in children influences acquired immune response against Plasmodium falciparum malaria antigens.

    Directory of Open Access Journals (Sweden)

    Tamsir O Diallo

    Full Text Available BACKGROUND: Malaria and schistosomiasis coinfection frequently occurs in tropical countries. This study evaluates the influence of Schistosoma haematobium infection on specific antibody responses and cytokine production to recombinant merozoite surface protein-1-19 (MSP1-(19 and schizont extract of Plasmodium falciparum in malaria-infected children. METHODOLOGY: Specific IgG1 to MSP1-(19, as well as IgG1 and IgG3 to schizont extract were significantly increased in coinfected children compared to P. falciparum mono-infected children. Stimulation with MSP1-(19 lead to a specific production of both interleukin-10 (IL-10 and interferon-γ (IFN-γ, whereas the stimulation with schizont extract produced an IL-10 response only in the coinfected group. CONCLUSIONS: Our study suggests that schistosomiasis coinfection favours anti-malarial protective antibody responses, which could be associated with the regulation of IL-10 and IFN-γ production and seems to be antigen-dependent. This study demonstrates the importance of infectious status of the population in the evaluation of acquired immunity against malaria and highlights the consequences of a multiple infection environment during clinical trials of anti-malaria vaccine candidates.

  2. Establishment of Besnoitia darlingi from opossums (Didelphis virginiana) in experimental intermediate and definitive hosts, propagation in cell culture, and description of ultrastructural and genetic characteristics.

    Science.gov (United States)

    Dubey, J P; Lindsay, D S; Rosenthal, B M; Sreekumar, C; Hill, D E; Shen, S K; Kwok, O C H; Rickard, L G; Black, S S; Rashmir-Raven, A

    2002-07-01

    Besnoitia darlingi from naturally infected opossums (Didelphis virginiana) from Mississippi, USA, was propagated experimentally in mice, cats, and cell culture and was characterised according to ultrastructural, genetic, and life-history characteristics. Cats fed tissue cysts from opossums shed oocysts with a prepatent period of nine or 11 days. Oocysts, bradyzoites, or tachyzoites were infective to outbred and interferon-gamma gene knockout mice. Tachyzoites were successfully cultivated and maintained in vitro in bovine monocytes and African green monkey cells and revived after an 18-month storage in liquid nitrogen. Schizonts were seen in the small intestinal lamina propria of cats fed experimentally-infected mouse tissues. These schizonts measured up to 45 x 25 microm and contained many merozoites. A few schizonts were present in mesenteric lymph nodes and livers of cats fed tissue cysts. Ultrastructurally, tachyzoites and bradyzoites of B. darlingi were similar to other species of Besnoitia. A close relationship to B. besnoiti and an even closer relationship to B. jellisoni was indicated for B. darlingi on the basis of the small subunit and ITS-1 portions of nuclear ribosomal DNA.

  3. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  4. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

    Science.gov (United States)

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-01-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

  5. Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation

    DEFF Research Database (Denmark)

    Milani, Lili; Lundmark, Anders; Nordlund, Jessica

    2008-01-01

    To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...

  6. The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene

    Directory of Open Access Journals (Sweden)

    Pharo Elizabeth A

    2012-06-01

    Full Text Available Abstract Background The marsupial early lactation protein (ELP gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A. Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Results Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1 and early lactation (Phase 2A. The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI, spleen trypsin inhibitor (STI and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5 genes. Conclusions Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.

  7. Specific Gene Loci of Clinical Pseudomonas putida Isolates.

    Directory of Open Access Journals (Sweden)

    Lázaro Molina

    Full Text Available Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host's immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria.

  8. Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature.

    Directory of Open Access Journals (Sweden)

    Samantha M Thomas

    2015-05-01

    Full Text Available Renewable in vitro cell cultures, such as lymphoblastoid cell lines (LCLs, have facilitated studies that contributed to our understanding of genetic influence on human traits. However, the degree to which cell lines faithfully maintain differences in donor-specific phenotypes is still debated. We have previously reported that standard cell line maintenance practice results in a loss of donor-specific gene expression signatures in LCLs. An alternative to the LCL model is the induced pluripotent stem cell (iPSC system, which carries the potential to model tissue-specific physiology through the use of differentiation protocols. Still, existing LCL banks represent an important source of starting material for iPSC generation, and it is possible that the disruptions in gene regulation associated with long-term LCL maintenance could persist through the reprogramming process. To address this concern, we studied the effect of reprogramming mature LCL cultures from six unrelated donors to iPSCs on the ensuing gene expression patterns within and between individuals. We show that the reprogramming process results in a recovery of donor-specific gene regulatory signatures, increasing the number of genes with a detectable donor effect by an order of magnitude. The proportion of variation in gene expression statistically attributed to donor increases from 6.9% in LCLs to 24.5% in iPSCs (P < 10-15. Since environmental contributions are unlikely to be a source of individual variation in our system of highly passaged cultured cell lines, our observations suggest that the effect of genotype on gene regulation is more pronounced in iPSCs than in LCLs. Our findings indicate that iPSCs can be a powerful model system for studies of phenotypic variation across individuals in general, and the genetic association with variation in gene regulation in particular. We further conclude that LCLs are an appropriate starting material for iPSC generation.

  9. Molecular Subtyping of Primary Prostate Cancer Reveals Specific and Shared Target Genes of Different ETS Rearrangements

    Directory of Open Access Journals (Sweden)

    Paula Paulo

    2012-07-01

    Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.

  10. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  11. Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

    Science.gov (United States)

    Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

    2009-03-11

    Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene

  12. Kinetics and regional specificity of irinotecan-induced gene expression in the gastrointestinal tract

    International Nuclear Information System (INIS)

    Bowen, Joanne M.; Tsykin, Anna; Stringer, Andrea M.; Logan, Richard M.; Gibson, Rachel J.; Keefe, Dorothy M.K.

    2010-01-01

    Gastrointestinal toxicity remains a significant and dose-limiting complication of cancer treatment. While the pathophysiology is becoming clearer, considerable gaps in the knowledge remain surrounding the timing and site-specific gene changes which occur in response to insult. As such, this study aimed to assess gene expression profiles in a number of regions along the gastrointestinal tract following treatment with the chemotherapy agent, irinotecan, and correlate them with markers of cell death and tissue damage. Data analysis of microarray results found that genes involved in apoptosis, mitogen activated kinase (MAPK) signalling and inflammation were upregulated within 6 h, while genes involved in cell proliferation, wound healing and blood vessel formation were upregulated at later time points up to 72 h. Cell death was significantly increased at 6 and 24 h, and the stomach showed the lowest severity of overt tissue damage. Real time PCR of MAPK signalling pathway genes found that the jejunum and colon had significantly increased expression in a number of genes at 72 h, where as the stomach was unchanged. These results indicate that overall severity of tissue damage may be determined by precisely timed target gene responses specific to each region. Therapeutic targeting of key gene responses at the appropriate time point may prove to be effective for prevention of chemotherapy-induced gastrointestinal damage.

  13. Prediction of disease-related genes based on weighted tissue-specific networks by using DNA methylation.

    Science.gov (United States)

    Li, Min; Zhang, Jiayi; Liu, Qing; Wang, Jianxin; Wu, Fang-Xiang

    2014-01-01

    Predicting disease-related genes is one of the most important tasks in bioinformatics and systems biology. With the advances in high-throughput techniques, a large number of protein-protein interactions are available, which make it possible to identify disease-related genes at the network level. However, network-based identification of disease-related genes is still a challenge as the considerable false-positives are still existed in the current available protein interaction networks (PIN). Considering the fact that the majority of genetic disorders tend to manifest only in a single or a few tissues, we constructed tissue-specific networks (TSN) by integrating PIN and tissue-specific data. We further weighed the constructed tissue-specific network (WTSN) by using DNA methylation as it plays an irreplaceable role in the development of complex diseases. A PageRank-based method was developed to identify disease-related genes from the constructed networks. To validate the effectiveness of the proposed method, we constructed PIN, weighted PIN (WPIN), TSN, WTSN for colon cancer and leukemia, respectively. The experimental results on colon cancer and leukemia show that the combination of tissue-specific data and DNA methylation can help to identify disease-related genes more accurately. Moreover, the PageRank-based method was effective to predict disease-related genes on the case studies of colon cancer and leukemia. Tissue-specific data and DNA methylation are two important factors to the study of human diseases. The same method implemented on the WTSN can achieve better results compared to those being implemented on original PIN, WPIN, or TSN. The PageRank-based method outperforms degree centrality-based method for identifying disease-related genes from WTSN.

  14. Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds

    LENUS (Irish Health Repository)

    McKeown, Peter C

    2011-08-12

    Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was

  15. Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds

    Directory of Open Access Journals (Sweden)

    Wennblom Trevor J

    2011-08-01

    Full Text Available Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination. We identified these MEGs by developing a bioinformatics tool (GenFrag which can directly determine the identities of transcript-derived fragments from (i their size and (ii which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1

  16. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  17. CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.

    Directory of Open Access Journals (Sweden)

    Minyan Li

    Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.

  18. Comparative transcriptional profiling of the axolotl limb identifies a tripartite regeneration-specific gene program.

    Directory of Open Access Journals (Sweden)

    Dunja Knapp

    Full Text Available Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression - early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation.

  19. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Directory of Open Access Journals (Sweden)

    Conforto Tara L

    2012-04-01

    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  20. Maternal diets trigger sex-specific divergent trajectories of gene expression and epigenetic systems in mouse placenta.

    Directory of Open Access Journals (Sweden)

    Anne Gabory

    Full Text Available Males and females responses to gestational overnutrition set the stage for subsequent sex-specific differences in adult onset non communicable diseases. Placenta, as a widely recognized programming agent, contibutes to the underlying processes. According to our previous findings, a high-fat diet during gestation triggers sex-specific epigenetic alterations within CpG and throughout the genome, together with the deregulation of clusters of imprinted genes. We further investigated the impact of diet and sex on placental histology, transcriptomic and epigenetic signatures in mice. Both basal gene expression and response to maternal high-fat diet were sexually dimorphic in whole placentas. Numerous genes showed sexually dimorphic expression, but only 11 genes regardless of the diet. In line with the key role of genes belonging to the sex chromosomes, 3 of these genes were Y-specific and 3 were X-specific. Amongst all the genes that were differentially expressed under a high-fat diet, only 16 genes were consistently affected in both males and females. The differences were not only quantitative but remarkably qualitative. The biological functions and networks of genes dysregulated differed markedly between the sexes. Seven genes of the epigenetic machinery were dysregulated, due to effects of diet, sex or both, including the Y- and X-linked histone demethylase paralogues Kdm5c and Kdm5d, which could mark differently male and female epigenomes. The DNA methyltransferase cofactor Dnmt3l gene expression was affected, reminiscent of our previous observation of changes in global DNA methylation. Overall, this striking sexual dimorphism of programming trajectories impose a considerable revision of the current dietary interventions protocols.

  1. Sex linkage, sex-specific selection, and the role of recombination in the evolution of sexually dimorphic gene expression.

    Science.gov (United States)

    Connallon, Tim; Clark, Andrew G

    2010-12-01

    Sex-biased genes--genes that are differentially expressed within males and females--are nonrandomly distributed across animal genomes, with sex chromosomes and autosomes often carrying markedly different concentrations of male- and female-biased genes. These linkage patterns are often gene- and lineage-dependent, differing between functional genetic categories and between species. Although sex-specific selection is often hypothesized to shape the evolution of sex-linked and autosomal gene content, population genetics theory has yet to account for many of the gene- and lineage-specific idiosyncrasies emerging from the empirical literature. With the goal of improving the connection between evolutionary theory and a rapidly growing body of genome-wide empirical studies, we extend previous population genetics theory of sex-specific selection by developing and analyzing a biologically informed model that incorporates sex linkage, pleiotropy, recombination, and epistasis, factors that are likely to vary between genes and between species. Our results demonstrate that sex-specific selection and sex-specific recombination rates can generate, and are compatible with, the gene- and species-specific linkage patterns reported in the genomics literature. The theory suggests that sexual selection may strongly influence the architectures of animal genomes, as well as the chromosomal distribution of fixed substitutions underlying sexually dimorphic traits. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  2. A clade-specific Arabidopsis gene connects primary metabolism and senescence

    Science.gov (United States)

    Plants have to deal with environmental insults as they cannot move to escape from stressful conditions. To do so, they have evolved novel components that respond to the changing environments. A primary example is Qua Quine Starch (QQS, AT3G30720), an Arabidopsis thaliana-specific (orphan) gene that ...

  3. Population genomic scan for candidate signatures of balancing selection to guide antigen characterization in malaria parasites.

    Science.gov (United States)

    Amambua-Ngwa, Alfred; Tetteh, Kevin K A; Manske, Magnus; Gomez-Escobar, Natalia; Stewart, Lindsay B; Deerhake, M Elizabeth; Cheeseman, Ian H; Newbold, Christopher I; Holder, Anthony A; Knuepfer, Ellen; Janha, Omar; Jallow, Muminatou; Campino, Susana; Macinnis, Bronwyn; Kwiatkowski, Dominic P; Conway, David J

    2012-01-01

    Acquired immunity in vertebrates maintains polymorphisms in endemic pathogens, leading to identifiable signatures of balancing selection. To comprehensively survey for genes under such selection in the human malaria parasite Plasmodium falciparum, we generated paired-end short-read sequences of parasites in clinical isolates from an endemic Gambian population, which were mapped to the 3D7 strain reference genome to yield high-quality genome-wide coding sequence data for 65 isolates. A minority of genes did not map reliably, including the hypervariable var, rifin, and stevor families, but 5,056 genes (90.9% of all in the genome) had >70% sequence coverage with minimum read depth of 5 for at least 50 isolates, of which 2,853 genes contained 3 or more single nucleotide polymorphisms (SNPs) for analysis of polymorphic site frequency spectra. Against an overall background of negatively skewed frequencies, as expected from historical population expansion combined with purifying selection, the outlying minority of genes with signatures indicating exceptionally intermediate frequencies were identified. Comparing genes with different stage-specificity, such signatures were most common in those with peak expression at the merozoite stage that invades erythrocytes. Members of clag, PfMC-2TM, surfin, and msp3-like gene families were highly represented, the strongest signature being in the msp3-like gene PF10_0355. Analysis of msp3-like transcripts in 45 clinical and 11 laboratory adapted isolates grown to merozoite-containing schizont stages revealed surprisingly low expression of PF10_0355. In diverse clonal parasite lines the protein product was expressed in a minority of mature schizonts (<1% in most lines and ∼10% in clone HB3), and eight sub-clones of HB3 cultured separately had an intermediate spectrum of positive frequencies (0.9 to 7.5%), indicating phase variable expression of this polymorphic antigen. This and other identified targets of balancing selection are now

  4. Population genomic scan for candidate signatures of balancing selection to guide antigen characterization in malaria parasites.

    Directory of Open Access Journals (Sweden)

    Alfred Amambua-Ngwa

    Full Text Available Acquired immunity in vertebrates maintains polymorphisms in endemic pathogens, leading to identifiable signatures of balancing selection. To comprehensively survey for genes under such selection in the human malaria parasite Plasmodium falciparum, we generated paired-end short-read sequences of parasites in clinical isolates from an endemic Gambian population, which were mapped to the 3D7 strain reference genome to yield high-quality genome-wide coding sequence data for 65 isolates. A minority of genes did not map reliably, including the hypervariable var, rifin, and stevor families, but 5,056 genes (90.9% of all in the genome had >70% sequence coverage with minimum read depth of 5 for at least 50 isolates, of which 2,853 genes contained 3 or more single nucleotide polymorphisms (SNPs for analysis of polymorphic site frequency spectra. Against an overall background of negatively skewed frequencies, as expected from historical population expansion combined with purifying selection, the outlying minority of genes with signatures indicating exceptionally intermediate frequencies were identified. Comparing genes with different stage-specificity, such signatures were most common in those with peak expression at the merozoite stage that invades erythrocytes. Members of clag, PfMC-2TM, surfin, and msp3-like gene families were highly represented, the strongest signature being in the msp3-like gene PF10_0355. Analysis of msp3-like transcripts in 45 clinical and 11 laboratory adapted isolates grown to merozoite-containing schizont stages revealed surprisingly low expression of PF10_0355. In diverse clonal parasite lines the protein product was expressed in a minority of mature schizonts (<1% in most lines and ∼10% in clone HB3, and eight sub-clones of HB3 cultured separately had an intermediate spectrum of positive frequencies (0.9 to 7.5%, indicating phase variable expression of this polymorphic antigen. This and other identified targets of balancing

  5. Hox genes require homothorax and extradenticle for body wall identity specification but not for appendage identity specification during metamorphosis of Tribolium castaneum.

    Science.gov (United States)

    Smith, Frank W; Jockusch, Elizabeth L

    2014-11-01

    The establishment of segment identity is a key developmental process that allows for divergence along the anteroposterior body axis in arthropods. In Drosophila, the identity of a segment is determined by the complement of Hox genes it expresses. In many contexts, Hox transcription factors require the protein products of extradenticle (exd) and homothorax (hth) as cofactors to perform their identity specification functions. In holometabolous insects, segment identity may be specified twice, during embryogenesis and metamorphosis. To glean insight into the relationship between embryonic and metamorphic segmental identity specification, we have compared these processes in the flour beetle Tribolium castaneum, which develops ventral appendages during embryogenesis that later metamorphose into adult appendages with distinct morphologies. At metamorphosis, comparisons of RNAi phenotypes indicate that Hox genes function jointly with Tc-hth and Tc-exd to specify several region-specific aspects of the adult body wall. On the other hand, Hox genes specify appendage identities along the anteroposterior axis independently of Tc-hth/Tc-exd and Tc-hth/Tc-exd specify proximal vs. distal identity within appendages independently of Hox genes during this stage. During embryogenesis, Tc-hth and Tc-exd play a broad role in the segmentation process and are required for specification of body wall identities in the thorax; however, contrasting with results from other species, we did not obtain homeotic transformations of embryonic appendages in response to Tc-hth or Tc-exd RNAi. In general, the homeotic effects of interference with the function of Hox genes and Tc-hth/Tc-exd during metamorphosis did not match predictions based on embryonic roles of these genes. Comparing metamorphic patterning in T. castaneum to embryonic and post-embryonic development in hemimetabolous insects suggests that holometabolous metamorphosis combines patterning processes of both late embryogenesis and

  6. CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.

    Science.gov (United States)

    Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng

    2017-06-16

    Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    Science.gov (United States)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  8. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  9. Pleiotropic role of growth arrest-specific gene 6 in atherosclerosis

    NARCIS (Netherlands)

    Tjwa, Marc; Moons, Lieve; Lutgens, Esther

    2009-01-01

    Growth arrest-specific gene 6 (Gas6) belongs to the family of vitamin K-dependent coagulation proteins, but in contrast to its other members, has only a limited role in hemostasis. Instead, Gas6 plays a prominent role in conditions of injury, inflammation and repair. Gas6 amplifies the activation of

  10. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  11. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  12. Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.

    Science.gov (United States)

    Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K

    1989-10-01

    Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Knowledge Enrichment Analysis for Human Tissue- Specific Genes Uncover New Biological Insights

    Directory of Open Access Journals (Sweden)

    Gong Xiu-Jun

    2012-06-01

    Full Text Available The expression and regulation of genes in different tissues are fundamental questions to be answered in biology. Knowledge enrichment analysis for tissue specific (TS and housekeeping (HK genes may help identify their roles in biological process or diseases and gain new biological insights.In this paper, we performed the knowledge enrichment analysis for 17,343 genes in 84 human tissues using Gene Set Enrichment Analysis (GSEA and Hypergeometric Analysis (HA against three biological ontologies: Gene Ontology (GO, KEGG pathways and Disease Ontology (DO respectively.The analyses results demonstrated that the functions of most gene groups are consistent with their tissue origins. Meanwhile three interesting new associations for HK genes and the skeletal muscle tissuegenes are found. Firstly, Hypergeometric analysis against KEGG database for HK genes disclosed that three disease terms (Parkinson’s disease, Huntington’s disease, Alzheimer’s disease are intensively enriched.Secondly, Hypergeometric analysis against the KEGG database for Skeletal Muscle tissue genes shows that two cardiac diseases of “Hypertrophic cardiomyopathy (HCM” and “Arrhythmogenic right ventricular cardiomyopathy (ARVC” are heavily enriched, which are also considered as no relationship with skeletal functions.Thirdly, “Prostate cancer” is intensively enriched in Hypergeometric analysis against the disease ontology (DO for the Skeletal Muscle tissue genes, which is a much unexpected phenomenon.

  14. The regulation of cytoskeletal and liver-specific gene expression during liver regeneration and primary hepatocyte culture

    International Nuclear Information System (INIS)

    Robinson, G.S.

    1989-01-01

    The focus of this dissertation is to determine what role(s) the extracellular matrix and expression of certain cytoskeletal genes play in the regulation of hepatocyte growth and the maintenance of a differential state. The expression of several cytoskeletal and liver-specific genes was examined during liver regeneration and in hepatocyte cultures maintained in a hormonally-defined, serum-free medium and plated on two different matrices: rat tail collagen and the EHS matrix. During liver regeneration and in hepatocytes cultured on rat tail collagen, there was a dramatic increase in tubulin mRNA levels coincident with but not linked to DNA synthesis. The message levels for other cytoskeletal genes similarly increased, while a decrease was observed in the mRNA levels of the liver-specific genes, serum albumin and alpha 1 inhibitor III. Hepatocytes cultured on the EHS matrix resulted in the maintenance of low levels of cytoskeletal gene expression and high levels of liver-specific gene expression, similar to that observed in the normal liver. Results from subcellar fractionation and two-dimensional gel electrophoresis of 35 S-labelled proteins paralleled the results seen at the mRNA level. Preliminary work suggests that microtubule organization may play a role in the expression of the liver-specific genes which encode secreted proteins. These studies, which compare hepatocytes cultured on collagen or the EHS matrix gel, reveal that both cell-cell and cell-matrix interactions play a major role in the maintenance of the differential phenotype in hepatocytes

  15. Regulation of Msx genes by a Bmp gradient is essential for neural crest specification.

    Science.gov (United States)

    Tribulo, Celeste; Aybar, Manuel J; Nguyen, Vu H; Mullins, Mary C; Mayor, Roberto

    2003-12-01

    There is evidence in Xenopus and zebrafish embryos that the neural crest/neural folds are specified at the border of the neural plate by a precise threshold concentration of a Bmp gradient. In order to understand the molecular mechanism by which a gradient of Bmp is able to specify the neural crest, we analyzed how the expression of Bmp targets, the Msx genes, is regulated and the role that Msx genes has in neural crest specification. As Msx genes are directly downstream of Bmp, we analyzed Msx gene expression after experimental modification in the level of Bmp activity by grafting a bead soaked with noggin into Xenopus embryos, by expressing in the ectoderm a dominant-negative Bmp4 or Bmp receptor in Xenopus and zebrafish embryos, and also through Bmp pathway component mutants in the zebrafish. All the results show that a reduction in the level of Bmp activity leads to an increase in the expression of Msx genes in the neural plate border. Interestingly, by reaching different levels of Bmp activity in animal cap ectoderm, we show that a specific concentration of Bmp induces msx1 expression to a level similar to that required to induce neural crest. Our results indicate that an intermediate level of Bmp activity specifies the expression of Msx genes in the neural fold region. In addition, we have analyzed the role that msx1 plays on neural crest specification. As msx1 has a role in dorsoventral pattering, we have carried out conditional gain- and loss-of-function experiments using different msx1 constructs fused to a glucocorticoid receptor element to avoid an early effect of this factor. We show that msx1 expression is able to induce all other early neural crest markers tested (snail, slug, foxd3) at the time of neural crest specification. Furthermore, the expression of a dominant negative of Msx genes leads to the inhibition of all the neural crest markers analyzed. It has been previously shown that snail is one of the earliest genes acting in the neural crest

  16. Concordance of gene expression in human protein complexes reveals tissue specificity and pathology

    DEFF Research Database (Denmark)

    Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven

    2013-01-01

    Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among prot...

  17. Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia.

    Science.gov (United States)

    Badea, Liviu; Herlea, Vlad; Dima, Simona Olimpia; Dumitrascu, Traian; Popescu, Irinel

    2008-01-01

    The precise details of pancreatic ductal adenocarcinoma (PDAC) pathogenesis are still insufficiently known, requiring the use of high-throughput methods. However, PDAC is especially difficult to study using microarrays due to its strong desmoplastic reaction, which involves a hyperproliferating stroma that effectively "masks" the contribution of the minoritary neoplastic epithelial cells. Thus it is not clear which of the genes that have been found differentially expressed between normal and whole tumor tissues are due to the tumor epithelia and which simply reflect the differences in cellular composition. To address this problem, laser microdissection studies have been performed, but these have to deal with much smaller tissue sample quantities and therefore have significantly higher experimental noise. In this paper we combine our own large sample whole-tissue study with a previously published smaller sample microdissection study by Grützmann et al. to identify the genes that are specifically overexpressed in PDAC tumor epithelia. The overlap of this list of genes with other microarray studies of pancreatic cancer as well as with the published literature is impressive. Moreover, we find a number of genes whose over-expression appears to be inversely correlated with patient survival: keratin 7, laminin gamma 2, stratifin, platelet phosphofructokinase, annexin A2, MAP4K4 and OACT2 (MBOAT2), which are all specifically upregulated in the neoplastic epithelia, rather than the tumor stroma. We improve on other microarray studies of PDAC by putting together the higher statistical power due to a larger number of samples with information about cell-type specific expression and patient survival.

  18. Using Merkel cell polyomavirus specific TCR gene therapy for treatment of Merkel cellcarcinoma

    DEFF Research Database (Denmark)

    Lyngaa, Rikke Birgitte; Pedersen, Natasja Wulff; Linnemann, C.

    2016-01-01

    T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated with Mer......T cell receptor gene-therapy has entered the clinic and shown potential for successful cancer treatment. However, the clinical evaluation has also highlighted the need for selection of truly cancerspecific targets. Merkel cell carcinoma (MCC) is a highly aggressive skin cancer associated...... with Merkel cell polyomavirus (MCPyV). Due to the clear viral correlation CD8+ T cells specific for viral epitopes could potentially form cancer-specific targets in MCC patients. We have identified MCPyV specific T cells using a high-throughput platform for T-cell enrichment and combinatorial encoding...

  19. Ploidy-dependent changes in the epigenome of symbiotic cells correlate with specific patterns of gene expression

    KAUST Repository

    Nagymihály, Marianna

    2017-04-13

    The formation of symbiotic nodule cells in Medicago truncatula is driven by successive endoreduplication cycles and transcriptional reprogramming in different temporal waves including the activation of more than 600 cysteine-rich NCR genes expressed only in nodules. We show here that the transcriptional waves correlate with growing ploidy levels and have investigated how the epigenome changes during endoreduplication cycles. Differential DNA methylation was found in only a small subset of symbiotic nodule-specific genes, including more than half of the NCR genes, whereas in most genes DNA methylation was unaffected by the ploidy levels and was independent of the genes\\' active or repressed state. On the other hand, expression of nodule-specific genes correlated with ploidy-dependent opening of the chromatin as well as, in a subset of tested genes, with reduced H3K27me3 levels combined with enhanced H3K9ac levels. Our results suggest that endoreduplication-dependent epigenetic changes contribute to transcriptional reprogramming in the differentiation of symbiotic cells.

  20. Tumor-specific apoptotic gene targeting overcomes radiation resistance in esophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Chang, Joe Y.; Zhang Xiaochun; Komaki, Ritsuko; Cheung, Rex; Fang Bingliang

    2006-01-01

    Purpose: To overcome radiation resistance in esophageal adenocarcinoma by tumor-specific apoptotic gene targeting using tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Methods and Materials: Adenoviral vector Ad/TRAIL-F/RGD with a tumor-specific human telomerase reverse transcription promoter was used to transfer TRAIL gene to human esophageal adenocarcinoma and normal human lung fibroblastic cells (NHLF). Activation of apoptosis was analyzed by Western blot, fluorescent activated cell sorting, and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate labeling (TUNEL) assay. A human esophageal adenocarcinoma mouse model was treated with intratumoral injections of Ad/TRAIL-F/RGD plus local radiotherapy. Results: The combination of Ad/TRAIL-F/RGD and radiotherapy increased the cell-killing effect in all esophageal adenocarcinoma cell lines but not in NHLF cells. This combination also significantly reduced clonogenic formation (p < 0.05) and increased sub-G1 deoxyribonucleic acid accumulation in cancer cells (p < 0.05). Activation of apoptosis by Ad/TRAIL-F/RGD plus radiotherapy was demonstrated by activation of caspase-9, caspase-8, and caspase-3 and cleaved poly (adenosine diphosphate-ribose) polymerase in vitro and TUNEL assay in vivo. Combined Ad/TRAIL-F/RGD and radiotherapy dramatically inhibited tumor growth and prolonged mean survival in the esophageal adenocarcinoma model to 31.6 days from 16.7 days for radiotherapy alone and 21.5 days for Ad/TRAIL-F/RGD alone (p < 0.05). Conclusions: The combination of tumor-specific TRAIL gene targeting and radiotherapy enhances the effect of suppressing esophageal adenocarcinoma growth and prolonging survival

  1. Cardiomyocyte-specific deletion of the G protein-coupled estrogen receptor (GPER) leads to left ventricular dysfunction and adverse remodeling: A sex-specific gene profiling analysis.

    Science.gov (United States)

    Wang, Hao; Sun, Xuming; Chou, Jeff; Lin, Marina; Ferrario, Carlos M; Zapata-Sudo, Gisele; Groban, Leanne

    2017-08-01

    Activation of G protein-coupled estrogen receptor (GPER) by its agonist, G1, protects the heart from stressors such as pressure-overload, ischemia, a high-salt diet, estrogen loss, and aging, in various male and female animal models. Due to nonspecific effects of G1, the exact functions of cardiac GPER cannot be concluded from studies using systemic G1 administration. Moreover, global knockdown of GPER affects glucose homeostasis, blood pressure, and many other cardiovascular-related systems, thereby confounding interpretation of its direct cardiac actions. We generated a cardiomyocyte-specific GPER knockout (KO) mouse model to specifically investigate the functions of GPER in cardiomyocytes. Compared to wild type mice, cardiomyocyte-specific GPER KO mice exhibited adverse alterations in cardiac structure and impaired systolic and diastolic function, as measured by echocardiography. Gene deletion effects on left ventricular dimensions were more profound in male KO mice compared to female KO mice. Analysis of DNA microarray data from isolated cardiomyocytes of wild type and KO mice revealed sex-based differences in gene expression profiles affecting multiple transcriptional networks. Gene Set Enrichment Analysis (GSEA) revealed that mitochondrial genes are enriched in GPER KO females, whereas inflammatory response genes are enriched in GPER KO males, compared to their wild type counterparts of the same sex. The cardiomyocyte-specific GPER KO mouse model provides us with a powerful tool to study the functions of GPER in cardiomyocytes. The gene expression profiles of the GPER KO mice provide foundational information for further study of the mechanisms underlying sex-specific cardioprotection by GPER. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Cell-specific prediction and application of drug-induced gene expression profiles.

    Science.gov (United States)

    Hodos, Rachel; Zhang, Ping; Lee, Hao-Chih; Duan, Qiaonan; Wang, Zichen; Clark, Neil R; Ma'ayan, Avi; Wang, Fei; Kidd, Brian; Hu, Jianying; Sontag, David; Dudley, Joel

    2018-01-01

    Gene expression profiling of in vitro drug perturbations is useful for many biomedical discovery applications including drug repurposing and elucidation of drug mechanisms. However, limited data availability across cell types has hindered our capacity to leverage or explore the cell-specificity of these perturbations. While recent efforts have generated a large number of drug perturbation profiles across a variety of human cell types, many gaps remain in this combinatorial drug-cell space. Hence, we asked whether it is possible to fill these gaps by predicting cell-specific drug perturbation profiles using available expression data from related conditions--i.e. from other drugs and cell types. We developed a computational framework that first arranges existing profiles into a three-dimensional array (or tensor) indexed by drugs, genes, and cell types, and then uses either local (nearest-neighbors) or global (tensor completion) information to predict unmeasured profiles. We evaluate prediction accuracy using a variety of metrics, and find that the two methods have complementary performance, each superior in different regions in the drug-cell space. Predictions achieve correlations of 0.68 with true values, and maintain accurate differentially expressed genes (AUC 0.81). Finally, we demonstrate that the predicted profiles add value for making downstream associations with drug targets and therapeutic classes.

  3. Personalized Medicine: Cell and Gene Therapy Based on Patient-Specific iPSC-Derived Retinal Pigment Epithelium Cells.

    Science.gov (United States)

    Li, Yao; Chan, Lawrence; Nguyen, Huy V; Tsang, Stephen H

    2016-01-01

    Interest in generating human induced pluripotent stem (iPS) cells for stem cell modeling of diseases has overtaken that of patient-specific human embryonic stem cells due to the ethical, technical, and political concerns associated with the latter. In ophthalmology, researchers are currently using iPS cells to explore various applications, including: (1) modeling of retinal diseases using patient-specific iPS cells; (2) autologous transplantation of differentiated retinal cells that undergo gene correction at the iPS cell stage via gene editing tools (e.g., CRISPR/Cas9, TALENs and ZFNs); and (3) autologous transplantation of patient-specific iPS-derived retinal cells treated with gene therapy. In this review, we will discuss the uses of patient-specific iPS cells for differentiating into retinal pigment epithelium (RPE) cells, uncovering disease pathophysiology, and developing new treatments such as gene therapy and cell replacement therapy via autologous transplantation.

  4. Proviral HIV-genome-wide and pol-gene specific Zinc Finger Nucleases: Usability for targeted HIV gene therapy

    Directory of Open Access Journals (Sweden)

    Wayengera Misaki

    2011-07-01

    Full Text Available Abstract Background Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively. However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i to assemble and construct zinc finger arrays and nucleases (ZFN with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii to advance a model for pre-clinically testing lentiviral vectors (LV that deliver and transduce either ZFN genotype. Methods and Results First, we computationally generated the consensus sequences of (a 114 dsDNA-binding zinc finger (Zif arrays (ZFAs or ZifHIV-pol and (b two zinc-finger nucleases (ZFNs which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN. Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN. Second, a model for constructing lentiviral vectors (LVs that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively is proposed. Third, two preclinical models for controlled testing of

  5. Proviral HIV-genome-wide and pol-gene specific zinc finger nucleases: usability for targeted HIV gene therapy.

    Science.gov (United States)

    Wayengera, Misaki

    2011-07-22

    Infection with HIV, which culminates in the establishment of a latent proviral reservoir, presents formidable challenges for ultimate cure. Building on the hypothesis that ex-vivo or even in-vivo abolition or disruption of HIV-gene/genome-action by target mutagenesis or excision can irreversibly abrogate HIV's innate fitness to replicate and survive, we previously identified the isoschizomeric bacteria restriction enzymes (REases) AcsI and ApoI as potent cleavers of the HIV-pol gene (11 and 9 times in HIV-1 and 2, respectively). However, both enzymes, along with others found to cleave across the entire HIV-1 genome, slice (SX) at palindromic sequences that are prevalent within the human genome and thereby pose the risk of host genome toxicity. A long-term goal in the field of R-M enzymatic therapeutics has thus been to generate synthetic restriction endonucleases with longer recognition sites limited in specificity to HIV. We aimed (i) to assemble and construct zinc finger arrays and nucleases (ZFN) with either proviral-HIV-pol gene or proviral-HIV-1 whole-genome specificity respectively, and (ii) to advance a model for pre-clinically testing lentiviral vectors (LV) that deliver and transduce either ZFN genotype. First, we computationally generated the consensus sequences of (a) 114 dsDNA-binding zinc finger (Zif) arrays (ZFAs or ZifHIV-pol) and (b) two zinc-finger nucleases (ZFNs) which, unlike the AcsI and ApoI homeodomains, possess specificity to >18 base-pair sequences uniquely present within the HIV-pol gene (ZifHIV-polFN). Another 15 ZFNs targeting >18 bp sequences within the complete HIV-1 proviral genome were constructed (ZifHIV-1FN). Second, a model for constructing lentiviral vectors (LVs) that deliver and transduce a diploid copy of either ZifHIV-polFN or ZifHIV-1FN chimeric genes (termed LV- 2xZifHIV-polFN and LV- 2xZifHIV-1FN, respectively) is proposed. Third, two preclinical models for controlled testing of the safety and efficacy of either of these

  6. Inferring gene dependency network specific to phenotypic alteration based on gene expression data and clinical information of breast cancer.

    Science.gov (United States)

    Zhou, Xionghui; Liu, Juan

    2014-01-01

    Although many methods have been proposed to reconstruct gene regulatory network, most of them, when applied in the sample-based data, can not reveal the gene regulatory relations underlying the phenotypic change (e.g. normal versus cancer). In this paper, we adopt phenotype as a variable when constructing the gene regulatory network, while former researches either neglected it or only used it to select the differentially expressed genes as the inputs to construct the gene regulatory network. To be specific, we integrate phenotype information with gene expression data to identify the gene dependency pairs by using the method of conditional mutual information. A gene dependency pair (A,B) means that the influence of gene A on the phenotype depends on gene B. All identified gene dependency pairs constitute a directed network underlying the phenotype, namely gene dependency network. By this way, we have constructed gene dependency network of breast cancer from gene expression data along with two different phenotype states (metastasis and non-metastasis). Moreover, we have found the network scale free, indicating that its hub genes with high out-degrees may play critical roles in the network. After functional investigation, these hub genes are found to be biologically significant and specially related to breast cancer, which suggests that our gene dependency network is meaningful. The validity has also been justified by literature investigation. From the network, we have selected 43 discriminative hubs as signature to build the classification model for distinguishing the distant metastasis risks of breast cancer patients, and the result outperforms those classification models with published signatures. In conclusion, we have proposed a promising way to construct the gene regulatory network by using sample-based data, which has been shown to be effective and accurate in uncovering the hidden mechanism of the biological process and identifying the gene signature for

  7. Substrate-specific gene expression in Batrachochytrium dendrobatidis, the chytrid pathogen of amphibians.

    Directory of Open Access Journals (Sweden)

    Erica Bree Rosenblum

    Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.

  8. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  9. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  10. Histone modification profiles are predictive for tissue/cell-type specific expression of both protein-coding and microRNA genes

    Directory of Open Access Journals (Sweden)

    Zhang Michael Q

    2011-05-01

    Full Text Available Abstract Background Gene expression is regulated at both the DNA sequence level and through modification of chromatin. However, the effect of chromatin on tissue/cell-type specific gene regulation (TCSR is largely unknown. In this paper, we present a method to elucidate the relationship between histone modification/variation (HMV and TCSR. Results A classifier for differentiating CD4+ T cell-specific genes from housekeeping genes using HMV data was built. We found HMV in both promoter and gene body regions to be predictive of genes which are targets of TCSR. For example, the histone modification types H3K4me3 and H3K27ac were identified as the most predictive for CpG-related promoters, whereas H3K4me3 and H3K79me3 were the most predictive for nonCpG-related promoters. However, genes targeted by TCSR can be predicted using other type of HMVs as well. Such redundancy implies that multiple type of underlying regulatory elements, such as enhancers or intragenic alternative promoters, which can regulate gene expression in a tissue/cell-type specific fashion, may be marked by the HMVs. Finally, we show that the predictive power of HMV for TCSR is not limited to protein-coding genes in CD4+ T cells, as we successfully predicted TCSR targeted genes in muscle cells, as well as microRNA genes with expression specific to CD4+ T cells, by the same classifier which was trained on HMV data of protein-coding genes in CD4+ T cells. Conclusion We have begun to understand the HMV patterns that guide gene expression in both tissue/cell-type specific and ubiquitous manner.

  11. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance.

    Science.gov (United States)

    Morimoto, Shimpei; Yahara, Koji

    2018-03-01

    Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential

  12. Ekstrak Sambiloto (Andrographis paniculata Menurunkan Jumlah Skizon, Mikrogamet, Makrogamet, dan Oosista Eimeria tenella (EXTRACT OF ANDROGRAPHIS PANICULATA DECREASED SCHIZONTS, MICROGAMETES, MACROGAMETES AND OOCYSTS NUMBER OF EIMERIA TENELLA

    Directory of Open Access Journals (Sweden)

    UMI CAHYANINGSIH

    2013-07-01

    Full Text Available The aim of this research was to observe the effect of ethanol extract of Andrographis paniculata givenin grading doses to the schizonts, microgamete, macrogamete, and oocytes counts of Eimeria tenella inchicken caecum. A total of ninety day old broiler chicks were used in the study. At two weeks old the broilerswere divided into six groups. Each group consisted of 15 broilers, the 6 groups were: (i negative control(broilers did not receive any treatment; (ii positive control (each animal were infected with 104 E. tenellaoocytes; (iii medicine control (each animal were infected with 104 E. tenella oocytes and coccidiostat; (ivA1 (each animal were infected with 104 E. tenella oocytes and paniculata extract 90 mg/kg body weight; (vA2 (each animal were infected with 104 E. tenella oocytes and paniculata extract 180 mg/kg body weight;and (vi A3 (each animal were infected with 104 E. tenella oocytes and paniculata extract 360 mg/kg bodyweight. At day 6, 9, 13, 16, and 22 post infection three broilers from each group were sacrificed and theirceca were collected for histopathological examination. The results showed that paniculata extract at dose90 mg/kg body weight and 180 mg/kg body weight was able to decrease the numbers of shizont, microgamete,macrogamete, and oocytes of E. tenella in the chicken caecum.

  13. Genome-wide analysis of the expansin gene superfamily reveals grapevine-specific structural and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Silvia Dal Santo

    Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the

  14. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  15. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    Energy Technology Data Exchange (ETDEWEB)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)

    2016-05-27

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  16. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    International Nuclear Information System (INIS)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen

    2016-01-01

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  17. Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

    Science.gov (United States)

    Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

    2004-01-01

    Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

  18. Incorporation of gene-specific variability improves expression analysis using high-density DNA microarrays

    Directory of Open Access Journals (Sweden)

    Spitznagel Edward

    2003-11-01

    Full Text Available Abstract Background The assessment of data reproducibility is essential for application of microarray technology to exploration of biological pathways and disease states. Technical variability in data analysis largely depends on signal intensity. Within that context, the reproducibility of individual probe sets has not been hitherto addressed. Results We used an extraordinarily large replicate data set derived from human placental trophoblast to analyze probe-specific contribution to variability of gene expression. We found that signal variability, in addition to being signal-intensity dependant, is probe set-specific. Importantly, we developed a novel method to quantify the contribution of this probe set-specific variability. Furthermore, we devised a formula that incorporates a priori-computed, replicate-based information on probe set- and intensity-specific variability in determination of expression changes even without technical replicates. Conclusion The strategy of incorporating probe set-specific variability is superior to analysis based on arbitrary fold-change thresholds. We recommend its incorporation to any computation of gene expression changes using high-density DNA microarrays. A Java application implementing our T-score is available at http://www.sadovsky.wustl.edu/tscore.html.

  19. Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes

    Directory of Open Access Journals (Sweden)

    Benedetta Izzi

    2018-04-01

    Full Text Available Chromosomal interactions connect distant enhancers and promoters on the same chromosome, activating or repressing gene expression. PEAR1 encodes the Platelet-Endothelial Aggregation Receptor 1, a contact receptor involved in platelet function and megakaryocyte and endothelial cell proliferation. PEAR1 expression during megakaryocyte differentiation is controlled by DNA methylation at its first CpG island. We identified a PEAR1 cell-specific methylation sensitive region in endothelial cells and megakaryocytes that showed strong chromosomal interactions with ISGL20L2, RRNAD1, MRLP24, HDGF and PRCC, using available promoter capture Hi-C datasets. These genes are involved in ribosome processing, protein synthesis, cell cycle and cell proliferation. We next studied the methylation and expression profile of these five genes in Human Umbilical Vein Endothelial Cells (HUVECs and megakaryocyte precursors. While cell-specific PEAR1 methylation corresponded to variability in expression for four out of five genes, no methylation change was observed in their promoter regions across cell types. Our data suggest that PEAR1 cell-type specific methylation changes may control long distance interactions with other genes. Further studies are needed to show whether such interaction data might be relevant for the genome-wide association data that showed a role for non-coding PEAR1 variants in the same region and platelet function, platelet count and cardiovascular risk.

  20. Sex-Specificity of Mineralocorticoid Target Gene Expression during Renal Development, and Long-Term Consequences

    Science.gov (United States)

    Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia

    2017-01-01

    Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786

  1. The Drosophila Translational Control Element (TCE is required for high-level transcription of many genes that are specifically expressed in testes.

    Directory of Open Access Journals (Sweden)

    Rebeccah J Katzenberger

    Full Text Available To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE. The TCE functions in the 5' untranslated region of Mst(3CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and

  2. The Drosophila Translational Control Element (TCE) is required for high-level transcription of many genes that are specifically expressed in testes.

    Science.gov (United States)

    Katzenberger, Rebeccah J; Rach, Elizabeth A; Anderson, Ashley K; Ohler, Uwe; Wassarman, David A

    2012-01-01

    To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5' untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the

  3. Bayesian model to detect phenotype-specific genes for copy number data

    Directory of Open Access Journals (Sweden)

    González Juan R

    2012-06-01

    Full Text Available Abstract Background An important question in genetic studies is to determine those genetic variants, in particular CNVs, that are specific to different groups of individuals. This could help in elucidating differences in disease predisposition and response to pharmaceutical treatments. We propose a Bayesian model designed to analyze thousands of copy number variants (CNVs where only few of them are expected to be associated with a specific phenotype. Results The model is illustrated by analyzing three major human groups belonging to HapMap data. We also show how the model can be used to determine specific CNVs related to response to treatment in patients diagnosed with ovarian cancer. The model is also extended to address the problem of how to adjust for confounding covariates (e.g., population stratification. Through a simulation study, we show that the proposed model outperforms other approaches that are typically used to analyze this data when analyzing common copy-number polymorphisms (CNPs or complex CNVs. We have developed an R package, called bayesGen, that implements the model and estimating algorithms. Conclusions Our proposed model is useful to discover specific genetic variants when different subgroups of individuals are analyzed. The model can address studies with or without control group. By integrating all data in a unique model we can obtain a list of genes that are associated with a given phenotype as well as a different list of genes that are shared among the different subtypes of cases.

  4. Acquisition and evolution of plant pathogenesis-associated gene clusters and candidate determinants of tissue-specificity in xanthomonas.

    Directory of Open Access Journals (Sweden)

    Hong Lu

    Full Text Available Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown.To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage.Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small

  5. Sex-specific gonadal and gene expression changes throughout development in fathead minnow

    Science.gov (United States)

    Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...

  6. Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells

    OpenAIRE

    Soucie, E.L.; Weng, Z.; Geirsdottir, L.; Molawi, K.; Maurizio, J.; Fenouil, R.; Mossadegh-Keller, N.; Gimenez, G.; VanHille, L.; Beniazza, M.; Favret, J.; Berruyer, C.; Perrin, P.; Hacohen, N.; Andrau, J.C.

    2016-01-01

    Differentiated macrophages can self-renew in tissues and expand long-term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network controlling self-renewal. Single cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down...

  7. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  8. Lys48 ubiquitination during the intraerythrocytic cycle of the rodent malaria parasite, Plasmodium chabaudi.

    Science.gov (United States)

    González-López, Lorena; Carballar-Lejarazú, Rebeca; Arrevillaga Boni, Gerardo; Cortés-Martínez, Leticia; Cázares-Raga, Febe Elena; Trujillo-Ocampo, Abel; Rodríguez, Mario H; James, Anthony A; Hernández-Hernández, Fidel de la Cruz

    2017-01-01

    Ubiquitination tags proteins for different functions within the cell. One of the most abundant and studied ubiquitin modification is the Lys48 polyubiquitin chain that modifies proteins for their destruction by proteasome. In Plasmodium is proposed that post-translational regulation is fundamental for parasite development during its complex life-cycle; thus, the objective of this work was to analyze the ubiquitination during Plasmodium chabaudi intraerythrocytic stages. Ubiquitinated proteins were detected during intraerythrocytic stages of Plasmodium chabaudi by immunofluorescent microscopy, bidimensional electrophoresis (2-DE) combined with immunoblotting and mass spectrometry. All the studied stages presented protein ubiquitination and Lys48 polyubiquitination with more abundance during the schizont stage. Three ubiquitinated proteins were identified for rings, five for trophozoites and twenty for schizonts. Only proteins detected with a specific anti- Lys48 polyubiquitin antibody were selected for Mass Spectrometry analysis and two of these identified proteins were selected in order to detect the specific amino acid residues where ubiquitin is placed. Ubiquitinated proteins during the ring and trophozoite stages were related with the invasion process and in schizont proteins were related with nucleic acid metabolism, glycolysis and protein biosynthesis. Most of the ubiquitin detection was during the schizont stage and the Lys48 polyubiquitination during this stage was related to proteins that are expected to be abundant during the trophozoite stage. The evidence that these Lys48 polyubiquitinated proteins are tagged for destruction by the proteasome complex suggests that this type of post-translational modification is important in the regulation of protein abundance during the life-cycle and may also contribute to the parasite cell-cycle progression.

  9. Gene expression profiling in autoimmune diseases: chronic inflammation or disease specific patterns?

    DEFF Research Database (Denmark)

    Bovin, Lone Frier; Brynskov, Jørn; Hegedüs, Laszlo

    2007-01-01

    ) patients and healthy individuals were specific for the arthritic process or likewise altered in other chronic inflammatory diseases such as chronic autoimmune thyroiditis (Hashimoto's thyroiditis, HT) and inflammatory bowel disease (IBD). Using qPCR for 18 RA-discriminative genes, there were no significant...

  10. Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

    Science.gov (United States)

    Firnhaber, Christopher; Hammarlund, Marc

    2013-11-01

    Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

  11. Response of cyprid specific genes to natural settlement cues in the barnacle Balanus (=Amphibalanus) amphitrite

    KAUST Repository

    Li, Honglei; Thiyagarajan, Vengatesen; Qian, Pei Yuan

    2010-01-01

    Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.

  12. Response of cyprid specific genes to natural settlement cues in the barnacle Balanus (=Amphibalanus) amphitrite

    KAUST Repository

    Li, Honglei

    2010-06-01

    Quantitative real-time PCR was used to further our understanding of the molecular processes involved in the attachment and metamorphosis of larval barnacles. We report the effects of natural settlement cues (microbial biofilms and conspecific settlement-inducing factor) on the expression profiles of six barnacle cyprid specific (bcs) genes in cyprids of the barnacle Balanus (=Amphibalanus) amphitrite Darwin. Genes bcs-1 to bcs-5 all showed marked decreases in their expression between initial cyprid attachment and the completion of metamorphosis, whereas bcs-6 showed significant up-regulation. Generally, settlement cues exerted no significant effect on the decreasing trend of bcs-1 to bcs-5 expression during attachment and metamorphosis. However, the expression of bcs-6 increased prior to cyprid attachment in response to both settlement cues. This elevated expression of bcs-6 gene indicates the importance and key regulatory role of this specific gene to larval attachment and metamorphosis in this barnacle species. © 2010 Elsevier B.V. All rights reserved.

  13. Genes expressed in specific areas of the human fetal cerebral cortex display distinct patterns of evolution.

    Directory of Open Access Journals (Sweden)

    Nelle Lambert

    2011-03-01

    Full Text Available The developmental mechanisms through which the cerebral cortex increased in size and complexity during primate evolution are essentially unknown. To uncover genetic networks active in the developing cerebral cortex, we combined three-dimensional reconstruction of human fetal brains at midgestation and whole genome expression profiling. This novel approach enabled transcriptional characterization of neurons from accurately defined cortical regions containing presumptive Broca and Wernicke language areas, as well as surrounding associative areas. We identified hundreds of genes displaying differential expression between the two regions, but no significant difference in gene expression between left and right hemispheres. Validation by qRTPCR and in situ hybridization confirmed the robustness of our approach and revealed novel patterns of area- and layer-specific expression throughout the developing cortex. Genes differentially expressed between cortical areas were significantly associated with fast-evolving non-coding sequences harboring human-specific substitutions that could lead to divergence in their repertoires of transcription factor binding sites. Strikingly, while some of these sequences were accelerated in the human lineage only, many others were accelerated in chimpanzee and/or mouse lineages, indicating that genes important for cortical development may be particularly prone to changes in transcriptional regulation across mammals. Genes differentially expressed between cortical regions were also enriched for transcriptional targets of FoxP2, a key gene for the acquisition of language abilities in humans. Our findings point to a subset of genes with a unique combination of cortical areal expression and evolutionary patterns, suggesting that they play important roles in the transcriptional network underlying human-specific neural traits.

  14. Identification of stress responsive genes by studying specific relationships between mRNA and protein abundance

    Directory of Open Access Journals (Sweden)

    Shimpei Morimoto

    2018-03-01

    Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after

  15. Maternal Germline-Specific Genes in the Asian Malaria Mosquito Anopheles stephensi: Characterization and Application for Disease Control

    Science.gov (United States)

    Biedler, James K.; Qi, Yumin; Pledger, David; Macias, Vanessa M.; James, Anthony A.; Tu, Zhijian

    2014-01-01

    Anopheles stephensi is a principal vector of urban malaria on the Indian subcontinent and an emerging model for molecular and genetic studies of mosquito biology. To enhance our understanding of female mosquito reproduction, and to develop new tools for basic research and for genetic strategies to control mosquito-borne infectious diseases, we identified 79 genes that displayed previtellogenic germline-specific expression based on RNA-Seq data generated from 11 life stage–specific and sex-specific samples. Analysis of this gene set provided insights into the biology and evolution of female reproduction. Promoters from two of these candidates, vitellogenin receptor and nanos, were used in independent transgenic cassettes for the expression of artificial microRNAs against suspected mosquito maternal-effect genes, discontinuous actin hexagon and myd88. We show these promoters have early germline-specific expression and demonstrate 73% and 42% knockdown of myd88 and discontinuous actin hexagon mRNA in ovaries 48 hr after blood meal, respectively. Additionally, we demonstrate maternal-specific delivery of mRNA and protein to progeny embryos. We discuss the application of this system of maternal delivery of mRNA/miRNA/protein in research on mosquito reproduction and embryonic development, and for the development of a gene drive system based on maternal-effect dominant embryonic arrest. PMID:25480960

  16. Mammalian transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes and are predicted to act as transcriptional activator hubs.

    Science.gov (United States)

    Joshi, Anagha

    2014-12-30

    Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.

  17. Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI.

    Science.gov (United States)

    Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng

    2017-11-13

    The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly

  18. Kidney-specific Sonoporation-mediated Gene Transfer.

    Science.gov (United States)

    Ishida, Ryo; Kami, Daisuke; Kusaba, Tetsuro; Kirita, Yuhei; Kishida, Tsunao; Mazda, Osam; Adachi, Takaomi; Gojo, Satoshi

    2016-02-01

    Sonoporation can deliver agents to target local organs by systemic administration, while decreasing the associated risk of adverse effects. Sonoporation has been used for a variety of materials and in a variety of organs. Herein, we demonstrated that local sonoporation to the kidney can offer highly efficient transfer of oligonucleotides, which were systemically administrated to the tubular epithelium with high specificity. Ultrasonic wave irradiation to the kidney collapsed the microbubbles and transiently affected the glomerular filtration barrier and increased glomerular permeability. Oligonucleotides were passed through the barrier all at once and were absorbed throughout the tubular epithelium. Tumor necrosis factor alpha (TNFα), which plays a central role in renal ischemia-reperfusion injury, was targeted using small interfering RNA (siRNA) with renal sonoporation in a murine model. The reduction of TNFα expression after single gene transfer significantly inhibited the expression of kidney injury markers, suggesting that systemic administration of siRNA under temporary and local sonoporation could be applicable in the clinical setting of ischemic acute kidney injury.

  19. Biological characterisation of Sarcocystis neurona isolated from a Southern sea otter (Enhydra lutris nereis)

    Science.gov (United States)

    Lindsay, D.S.; Thomas, N.J.; Dubey, J.P.

    2000-01-01

    Sarcocystis neurona was isolated from the brain of a juvenile, male southern sea otter (Enhydra lutris nereis) suffering from CNS disease. Schizonts and merozoites in tissue sections of the otter's brain reacted with anti-S. neurona antiserum immunohistochemically. Development in cell culture was by endopolyogeny and mature schizonts were first observed at 3 days postinoculation. PCR of merozoite DNA using primer pairs JNB33/JNB54 and restriction enzyme digestion of the 1100 bp product with Dra I indicated the organism was S. neurona. Four of four interferon-γ gene knockout mice inoculated with merozoites developed S. neurona-associated encephalitis. Antibodies to S. neurona but not Sarcocystis falcatula, Toxoplasma gondii, or Neospora caninum were present in the serum of inoculated mice. This is the first isolation of S. neurona from the brain of a non-equine host.

  20. Mammalian-specific genomic functions: Newly acquired traits generated by genomic imprinting and LTR retrotransposon-derived genes in mammals.

    Science.gov (United States)

    Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2015-01-01

    Mammals, including human beings, have evolved a unique viviparous reproductive system and a highly developed central nervous system. How did these unique characteristics emerge in mammalian evolution, and what kinds of changes did occur in the mammalian genomes as evolution proceeded? A key conceptual term in approaching these issues is "mammalian-specific genomic functions", a concept covering both mammalian-specific epigenetics and genetics. Genomic imprinting and LTR retrotransposon-derived genes are reviewed as the representative, mammalian-specific genomic functions that are essential not only for the current mammalian developmental system, but also mammalian evolution itself. First, the essential roles of genomic imprinting in mammalian development, especially related to viviparous reproduction via placental function, as well as the emergence of genomic imprinting in mammalian evolution, are discussed. Second, we introduce the novel concept of "mammalian-specific traits generated by mammalian-specific genes from LTR retrotransposons", based on the finding that LTR retrotransposons served as a critical driving force in the mammalian evolution via generating mammalian-specific genes.

  1. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  2. Analysis of eye lens-specific genes in congenital hereditary cataracts and microphthalmia of the miniature schnauzer dog.

    Science.gov (United States)

    Zhang, R L; Samuelson, D A; Zhang, Z G; Reddy, V N; Shastry, B S

    1991-08-01

    The congenital hereditary cataracts and microphthalmia in the miniature schnauzer dog are inherited by an autosomal recessive mode. To understand the genetic basis of these diseases, the authors purified and analyzed leukocyte deoxyribonucleic acid (DNA) from affected and normal animals using a candidate gene approach. Because the genes that encode the lens-specific proteins, specifically, alpha, beta, and gamma crystallins and the membrane protein (MP26), are known to maintain the structure and function of the lens, the authors used complimentary DNA (cDNA) fragments that corresponded to the above genes to search for the mutations at their loci in the affected animals. They found no evidence of the gene deletion and rearrangement in any of the five loci. In addition, the hybridizable sequences of the dog DNA to the specific probes for the human chromosome 4 and 18 loci, which are reported to be involved in the abnormality of the human eye, seem to be unaffected. These data support the notion that the hereditary cataracts and microphthalmia in the dog may be associated with genes other than those reported for several animal systems.

  3. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    Energy Technology Data Exchange (ETDEWEB)

    Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.

  4. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    International Nuclear Information System (INIS)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-01-01

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC

  5. Human apolipoprotein CIII gene expression is regulated by positive and negative cis-acting elements and tissue-specific protein factors

    International Nuclear Information System (INIS)

    Reue, K.; Leff, T.; Breslow, J.L.

    1988-01-01

    Apolipoprotein CIII (apoCIII) is a major protein constituent of triglyceride-rich lipoproteins and is synthesized primarily in the liver. Cis-acting DNA elements required for liver-specific apoCIII gene transcription were identified with transient expression assays in the human hepatoma (HepG2) and epithelial carcinoma (HeLa) cell lines. In liver cells, 821 nucleotides of the human apoCIII gene 5'-flanking sequence were required for maximum levels of gene expression, while the proximal 110 nucleotides alone were sufficient. No expression was observed in similar studies with HeLa cells. The level of expression was modulated by a combination of positive and negative cis-acting sequences, which interact with distinct sets of proteins from liver and HeLa cell nuclear extracts. The proximal positive regulatory region shares homology with similarly located sequences of other genes strongly expressed in the liver, including α 1 -antitrypsin and other apolipoprotein genes. The negative regulatory region is striking homologous to the human β-interferon gene regulatory element. The distal positive region shares homology with some viral enhancers and has properties of a tissue-specific enhancer. The regulation of the apoCIII gene is complex but shares features with other genes, suggesting shuffling of regulatory elements as a common mechanism for cell type-specific gene expression

  6. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  7. The hypoxic proteome is influenced by gene-specific changes in mRNA translation

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.

    2005-01-01

    Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia

  8. Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

    Science.gov (United States)

    Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

    2015-10-01

    FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

  9. Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.

  10. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko

    2015-12-23

    Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression

  11. PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes.

    Science.gov (United States)

    Soto-Feliciano, Yadira M; Bartlebaugh, Jordan M E; Liu, Yunpeng; Sánchez-Rivera, Francisco J; Bhutkar, Arjun; Weintraub, Abraham S; Buenrostro, Jason D; Cheng, Christine S; Regev, Aviv; Jacks, Tyler E; Young, Richard A; Hemann, Michael T

    2017-05-15

    Developmental and lineage plasticity have been observed in numerous malignancies and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the plant homeodomain finger protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B-cell- and T-cell-specific factors. Additionally, Phf6 KO cells show significant down-regulation of genes involved in the development and function of normal B cells, show up-regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. © 2017 Soto-Feliciano et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Specific DNA-binding proteins and DNA sequences involved in steroid hormone regulation of gene expression

    International Nuclear Information System (INIS)

    Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.

    1987-01-01

    Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule

  13. Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

    Science.gov (United States)

    Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

    2017-10-01

    Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The Schizosaccharomyces pombe map1 gene encodes an SRF/MCM1-related protein required for P-cell specific gene expression

    DEFF Research Database (Denmark)

    Nielsen, O; Friis, T; Kjaerulff, S

    1996-01-01

    Cells of Schizosaccharomyces pombe undergo mating and meiosis when starved for a nitrogen source. In this process a P and and M cell first mate to generate a diploid zygote, which subsequently enters meiosis and sporulates. The P mating type is controlled by the mat1-Pc gene at the mating type lo...... cerevisiae MCM1. The Mat1-Pc protein contains a motif characteristic for proteins that interact with MADS-box factors, suggesting that Mat-Pc and Map1 may form a heterodimer that activates the P-specific map3 gene....

  15. Human protein secretory pathway genes are expressed in a tissue-specific pattern to match processing demands of the secretome

    DEFF Research Database (Denmark)

    Feizi, Amir; Gatto, Francesco; Uhlén, Mathias

    2017-01-01

    Protein secretory pathway in eukaryal cells is responsible for delivering functional secretory proteins. The dysfunction of this pathway causes a range of important human diseases from congenital disorders to cancer. Despite the piled-up knowledge on the molecular biology and biochemistry level...... in specific gene families of the secretory pathway. We also inspected the potential functional link between detected extreme genes and the corresponding tissues enriched secretome. As a result, the detected extreme genes showed correlation with the enrichment of the nature and number of specific post......-translational modifications in each tissue's secretome. Our findings conciliate both the housekeeping and tissue-specific nature of the protein secretory pathway, which we attribute to a fine-tuned regulation of defined gene families to support the diversity of secreted proteins and their modifications....

  16. Detecting lineage-specific adaptive evolution of brain-expressed genes in human using rhesus macaque as outgroup

    DEFF Research Database (Denmark)

    Yu, Xiao-Jing; Zheng, Hong-Kun; Wang, Jun

    2006-01-01

    related species as outgroup, it is difficult to identify human-lineage-specific changes, which is critical in delineating the biological uniqueness of humans. In this study, we conducted phylogeny-based analyses of 2633 human brain-expressed genes using rhesus macaque as the outgroup. We identified 47...... candidate genes showing strong evidence of positive selection in the human lineage. Genes with maximal expression in the brain showed a higher evolutionary rate in human than in chimpanzee. We observed that many immune-defense-related genes were under strong positive selection, and this trend was more...

  17. Gene expression signatures of radiation response are specific, durable and accurate in mice and humans.

    Directory of Open Access Journals (Sweden)

    Sarah K Meadows

    2008-04-01

    Full Text Available Previous work has demonstrated the potential for peripheral blood (PB gene expression profiling for the detection of disease or environmental exposures.We have sought to determine the impact of several variables on the PB gene expression profile of an environmental exposure, ionizing radiation, and to determine the specificity of the PB signature of radiation versus other genotoxic stresses. Neither genotype differences nor the time of PB sampling caused any lessening of the accuracy of PB signatures to predict radiation exposure, but sex difference did influence the accuracy of the prediction of radiation exposure at the lowest level (50 cGy. A PB signature of sepsis was also generated and both the PB signature of radiation and the PB signature of sepsis were found to be 100% specific at distinguishing irradiated from septic animals. We also identified human PB signatures of radiation exposure and chemotherapy treatment which distinguished irradiated patients and chemotherapy-treated individuals within a heterogeneous population with accuracies of 90% and 81%, respectively.We conclude that PB gene expression profiles can be identified in mice and humans that are accurate in predicting medical conditions, are specific to each condition and remain highly accurate over time.

  18. Cell-Type-Specific Gene Programs of the Normal Human Nephron Define Kidney Cancer Subtypes.

    Science.gov (United States)

    Lindgren, David; Eriksson, Pontus; Krawczyk, Krzysztof; Nilsson, Helén; Hansson, Jennifer; Veerla, Srinivas; Sjölund, Jonas; Höglund, Mattias; Johansson, Martin E; Axelson, Håkan

    2017-08-08

    Comprehensive transcriptome studies of cancers often rely on corresponding normal tissue samples to serve as a transcriptional reference. In this study, we performed in-depth analyses of normal kidney tissue transcriptomes from the TCGA and demonstrate that the histological variability in cellularity, inherent in the kidney architecture, lead to considerable transcriptional differences between samples. This should be considered when comparing expression profiles of normal and cancerous kidney tissues. We exploited these differences to define renal-cell-specific gene signatures and used these as a framework to analyze renal cell carcinoma (RCC) ontogeny. Chromophobe RCCs express FOXI1-driven genes that define collecting duct intercalated cells, whereas HNF-regulated genes, specific for proximal tubule cells, are an integral part of clear cell and papillary RCC transcriptomes. These networks may be used as a framework for understanding the interplay between genomic changes in RCC subtypes and the lineage-defining regulatory machinery of their non-neoplastic counterparts. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Putative and unique gene sequence utilization for the design of species specific probes as modeled by Lactobacillus plantarum

    Science.gov (United States)

    The concept of utilizing putative and unique gene sequences for the design of species specific probes was tested. The abundance profile of assigned functions within the Lactobacillus plantarum genome was used for the identification of the putative and unique gene sequence, csh. The targeted gene (cs...

  20. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  1. A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals.

    Directory of Open Access Journals (Sweden)

    Nandina Paria

    Full Text Available Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.

  2. A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals.

    Science.gov (United States)

    Paria, Nandina; Raudsepp, Terje; Pearks Wilkerson, Alison J; O'Brien, Patricia C M; Ferguson-Smith, Malcom A; Love, Charles C; Arnold, Carolyn; Rakestraw, Peter; Murphy, William J; Chowdhary, Bhanu P

    2011-01-01

    Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY) contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY gene catalogue was developed for the horse--an odd-toed ungulate. Using direct cDNA selection from horse testis, and sequence analysis of Y-specific BAC clones, 37 horse MSY genes/transcripts were identified. The genes were mapped to the MSY BAC contig map, characterized for copy number, analyzed for transcriptional profiles by RT-PCR, examined for the presence of ORFs, and compared to other mammalian orthologs. We demonstrate that the horse MSY harbors 20 X-degenerate genes with known orthologs in other eutherian species. The remaining 17 genes are acquired or novel and have so far been identified only in the horse or donkey Y chromosomes. Notably, 3 transcripts were found in the heterochromatic part of the Y. We show that despite substantial differences between the sequence, gene content and organization of horse and other mammalian Y chromosomes, the functions of MSY genes are predominantly related to testis and spermatogenesis. Altogether, 10 multicopy genes with testis-specific expression were identified in the horse MSY, and considered likely candidate genes for stallion fertility. The findings establish an important foundation for the study of Y-linked genetic factors governing fertility in stallions, and improve our knowledge about the evolutionary processes that have shaped Y chromosomes in different mammalian lineages.

  3. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.

    Science.gov (United States)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Extensive gene-specific translational reprogramming in a model of B cell differentiation and Abl-dependent transformation.

    Directory of Open Access Journals (Sweden)

    Jamie G Bates

    Full Text Available To what extent might the regulation of translation contribute to differentiation programs, or to the molecular pathogenesis of cancer? Pre-B cells transformed with the viral oncogene v-Abl are suspended in an immortalized, cycling state that mimics leukemias with a BCR-ABL1 translocation, such as Chronic Myelogenous Leukemia (CML and Acute Lymphoblastic Leukemia (ALL. Inhibition of the oncogenic Abl kinase with imatinib reverses transformation, allowing progression to the next stage of B cell development. We employed a genome-wide polysome profiling assay called Gradient Encoding to investigate the extent and potential contribution of translational regulation to transformation and differentiation in v-Abl-transformed pre-B cells. Over half of the significantly translationally regulated genes did not change significantly at the level of mRNA abundance, revealing biology that might have been missed by measuring changes in transcript abundance alone. We found extensive, gene-specific changes in translation affecting genes with known roles in B cell signaling and differentiation, cancerous transformation, and cytoskeletal reorganization potentially affecting adhesion. These results highlight a major role for gene-specific translational regulation in remodeling the gene expression program in differentiation and malignant transformation.

  5. Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

    International Nuclear Information System (INIS)

    Tucker, M.A.

    1988-01-01

    Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

  6. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.

    Science.gov (United States)

    Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A

    2015-08-01

    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. © 2015 Polstein et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Identification of ecotype-specific marker genes for categorization of beer-spoiling Lactobacillus brevis.

    Science.gov (United States)

    Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F

    2015-10-01

    The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Organ-Specific Gene Expression Changes in the Fetal Liver and Placenta in Response to Maternal Folate Depletion

    Directory of Open Access Journals (Sweden)

    Jill A. McKay

    2016-10-01

    Full Text Available Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or “programme”, the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.

  9. Organ-Specific Gene Expression Changes in the Fetal Liver and Placenta in Response to Maternal Folate Depletion.

    Science.gov (United States)

    McKay, Jill A; Xie, Long; Adriaens, Michiel; Evelo, Chris T; Ford, Dianne; Mathers, John C

    2016-10-22

    Growing evidence supports the hypothesis that the in utero environment can have profound implications for fetal development and later life offspring health. Current theory suggests conditions experienced in utero prepare, or "programme", the fetus for its anticipated post-natal environment. The mechanisms responsible for these programming events are poorly understood but are likely to involve gene expression changes. Folate is essential for normal fetal development and inadequate maternal folate supply during pregnancy has long term adverse effects for offspring. We tested the hypothesis that folate depletion during pregnancy alters offspring programming through altered gene expression. Female C57BL/6J mice were fed diets containing 2 mg or 0.4 mg folic acid/kg for 4 weeks before mating and throughout pregnancy. At 17.5 day gestation, genome-wide gene expression was measured in male fetal livers and placentas. In the fetal liver, 989 genes were expressed differentially (555 up-regulated, 434 down-regulated) in response to maternal folate depletion, with 460 genes expressed differentially (250 up-regulated, 255 down-regulated) in the placenta. Only 25 differentially expressed genes were common between organs. Maternal folate intake during pregnancy influences fetal gene expression in a highly organ specific manner which may reflect organ-specific functions.

  10. Cell type-specific suppression of mechanosensitive genes by audible sound stimulation.

    Science.gov (United States)

    Kumeta, Masahiro; Takahashi, Daiji; Takeyasu, Kunio; Yoshimura, Shige H

    2018-01-01

    Audible sound is a ubiquitous environmental factor in nature that transmits oscillatory compressional pressure through the substances. To investigate the property of the sound as a mechanical stimulus for cells, an experimental system was set up using 94.0 dB sound which transmits approximately 10 mPa pressure to the cultured cells. Based on research on mechanotransduction and ultrasound effects on cells, gene responses to the audible sound stimulation were analyzed by varying several sound parameters: frequency, wave form, composition, and exposure time. Real-time quantitative PCR analyses revealed a distinct suppressive effect for several mechanosensitive and ultrasound-sensitive genes that were triggered by sounds. The effect was clearly observed in a wave form- and pressure level-specific manner, rather than the frequency, and persisted for several hours. At least two mechanisms are likely to be involved in this sound response: transcriptional control and RNA degradation. ST2 stromal cells and C2C12 myoblasts exhibited a robust response, whereas NIH3T3 cells were partially and NB2a neuroblastoma cells were completely insensitive, suggesting a cell type-specific response to sound. These findings reveal a cell-level systematic response to audible sound and uncover novel relationships between life and sound.

  11. Alteration of the gene expression profile of T-cell receptor αβ-modified T-cells with diffuse large B-cell lymphoma specificity.

    Science.gov (United States)

    Zha, Xianfeng; Yin, Qingsong; Tan, Huo; Wang, Chunyan; Chen, Shaohua; Yang, Lijian; Li, Bo; Wu, Xiuli; Li, Yangqiu

    2013-05-01

    Antigen-specific, T-cell receptor (TCR)-modified cytotoxic T lymphocytes (CTLs) that target tumors are an attractive strategy for specific adoptive immunotherapy. Little is known about whether there are any alterations in the gene expression profile after TCR gene transduction in T cells. We constructed TCR gene-redirected CTLs with specificity for diffuse large B-cell lymphoma (DLBCL)-associated antigens to elucidate the gene expression profiles of TCR gene-redirected T-cells, and we further analyzed the gene expression profile pattern of these redirected T-cells by Affymetrix microarrays. The resulting data were analyzed using Bioconductor software, a two-fold cut-off expression change was applied together with anti-correlation of the profile ratios to render the microarray analysis set. The fold change of all genes was calculated by comparing the three TCR gene-modified T-cells and a negative control counterpart. The gene pathways were analyzed using Bioconductor and Kyoto Encyclopedia of Genes and Genomes. Identical genes whose fold change was greater than or equal to 2.0 in all three TCR gene-redirected T-cell groups in comparison with the negative control were identified as the differentially expressed genes. The differentially expressed genes were comprised of 33 up-regulated genes and 1 down-regulated gene including JUNB, FOS, TNF, INF-γ, DUSP2, IL-1B, CXCL1, CXCL2, CXCL9, CCL2, CCL4, and CCL8. These genes are mainly involved in the TCR signaling, mitogen-activated protein kinase signaling, and cytokine-cytokine receptor interaction pathways. In conclusion, we characterized the gene expression profile of DLBCL-specific TCR gene-redirected T-cells. The changes corresponded to an up-regulation in the differentiation and proliferation of the T-cells. These data may help to explain some of the characteristics of the redirected T-cells.

  12. Multiple loci with different cancer specificities within the 8q24 gene desert

    DEFF Research Database (Denmark)

    Ghoussaini, M.; Song, H.; Koessler, T.

    2008-01-01

    this gene desert were specifically associated with risks of different cancers. One block was solely associated with risk of breast cancer, three others were associated solely with the risk of prostate cancer, and a fifth was associated with the risk of prostate, colorectal, and ovarian cancer...

  13. Gene-specific correlation of RNA and protein levels in human cells and tissues

    DEFF Research Database (Denmark)

    Edfors, Fredrik; Danielsson, Frida; Hallström, Björn M.

    2016-01-01

    An important issue for molecular biology is to establish whether transcript levels of a given gene can be used as proxies for the corresponding protein levels. Here, we have developed a targeted proteomics approach for a set of human non-secreted proteins based on parallel reaction monitoring...... to measure, at steady-state conditions, absolute protein copy numbers across human tissues and cell lines and compared these levels with the corresponding mRNA levels using transcriptomics. The study shows that the transcript and protein levels do not correlate well unless a gene-specific RNA-to-protein (RTP...

  14. Application of Adoptive T-Cell Therapy Using Tumor Antigen-Specific T-Cell Receptor Gene Transfer for the Treatment of Human Leukemia

    Directory of Open Access Journals (Sweden)

    Toshiki Ochi

    2010-01-01

    Full Text Available The last decade has seen great strides in the field of cancer immunotherapy, especially the treatment of melanoma. Beginning with the identification of cancer antigens, followed by the clinical application of anti-cancer peptide vaccination, it has now been proven that adoptive T-cell therapy (ACT using cancer antigen-specific T cells is the most effective option. Despite the apparent clinical efficacy of ACT, the timely preparation of a sufficient number of cancer antigen-specific T cells for each patient has been recognized as its biggest limitation. Currently, therefore, attention is being focused on ACT with engineered T cells produced using cancer antigen-specific T-cell receptor (TCR gene transfer. With regard to human leukemia, ACT using engineered T cells bearing the leukemia antigen-specific TCR gene still remains in its infancy. However, several reports have provided preclinical data on TCR gene transfer using Wilms' tumor gene product 1 (WT1, and also preclinical and clinical data on TCR gene transfer involving minor histocompatibility antigen, both of which have been suggested to provide additional clinical benefit. In this review, we examine the current status of anti-leukemia ACT with engineered T cells carrying the leukemia antigen-specific TCR gene, and discuss the existing barriers to progress in this area.

  15. Gametogenesis in the Pacific oyster Crassostrea gigas: a microarrays-based analysis identifies sex and stage specific genes.

    Directory of Open Access Journals (Sweden)

    Nolwenn M Dheilly

    Full Text Available BACKGROUND: The Pacific oyster Crassostrea gigas (Mollusca, Lophotrochozoa is an alternative and irregular protandrous hermaphrodite: most individuals mature first as males and then change sex several times. Little is known about genetic and phenotypic basis of sex differentiation in oysters, and little more about the molecular pathways regulating reproduction. We have recently developed and validated a microarray containing 31,918 oligomers (Dheilly et al., 2011 representing the oyster transcriptome. The application of this microarray to the study of mollusk gametogenesis should provide a better understanding of the key factors involved in sex differentiation and the regulation of oyster reproduction. METHODOLOGY/PRINCIPAL FINDINGS: Gene expression was studied in gonads of oysters cultured over a yearly reproductive cycle. Principal component analysis and hierarchical clustering showed a significant divergence in gene expression patterns of males and females coinciding with the start of gonial mitosis. ANOVA analysis of the data revealed 2,482 genes differentially expressed during the course of males and/or females gametogenesis. The expression of 434 genes could be localized in either germ cells or somatic cells of the gonad by comparing the transcriptome of female gonads to the transcriptome of stripped oocytes and somatic tissues. Analysis of the annotated genes revealed conserved molecular mechanisms between mollusks and mammals: genes involved in chromatin condensation, DNA replication and repair, mitosis and meiosis regulation, transcription, translation and apoptosis were expressed in both male and female gonads. Most interestingly, early expressed male-specific genes included bindin and a dpy-30 homolog and female-specific genes included foxL2, nanos homolog 3, a pancreatic lipase related protein, cd63 and vitellogenin. Further functional analyses are now required in order to investigate their role in sex differentiation in oysters

  16. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    Science.gov (United States)

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  17. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.

    Directory of Open Access Journals (Sweden)

    Yuki Mitaka

    Full Text Available The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq, we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.

  18. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  19. Comprehensive survey of carapacial ridge-specific genes in turtle implies co-option of some regulatory genes in carapace evolution.

    Science.gov (United States)

    Kuraku, Shigehiro; Usuda, Ryo; Kuratani, Shigeru

    2005-01-01

    The turtle shell is an evolutionary novelty in which the developmental pattern of the ribs is radically modified. In contrast to those of other amniotes, turtle ribs grow laterally into the dorsal dermis to form a carapace. The lateral margin of carapacial primordium is called the carapacial ridge (CR), and is thought to play an essential role in carapace patterning. To reveal the developmental mechanisms underlying this structure, we systematically screened for genes expressed specifically in the CR of the Chinese soft-shelled turtle, Pelodiscus sinensis, using microbead-based differential cDNA analysis and real-time reverse transcription-polymerase chain reaction. We identified orthologs of Sp5, cellular retinoic acid-binding protein-I (CRABP-I), adenomatous polyposis coli down-regulated 1 (APCDD1), and lymphoid enhancer-binding factor-1 (LEF-1). Although these genes are conserved throughout the major vertebrate lineages, comparison of their expression patterns with those in chicken and mouse indicated that these genes have acquired de novo expression in the CR in the turtle lineage. In association with the expression of LEF-1, the nuclear localization of beta-catenin protein was detected in the CR ectoderm, suggesting that the canonical Wnt signaling triggers carapace development. These findings indicate that the acquisition of the turtle shell did not involve the creation of novel genes, but was based on the co-option of pre-existing genes.

  20. Correlating Gene-specific DNA Methylation Changes with Expression and Transcriptional Activity of Astrocytic KCNJ10 (Kir4.1).

    Science.gov (United States)

    Nwaobi, Sinifunanya E; Olsen, Michelle L

    2015-09-26

    DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.

  1. A dual-specificity isoform of the protein kinase inhibitor PKI produced by alternate gene splicing.

    Science.gov (United States)

    Kumar, Priyadarsini; Walsh, Donal A

    2002-03-15

    We have previously shown that the protein kinase inhibitor beta (PKIbeta) form of the cAMP-dependent protein kinase inhibitor exists in multiple isoforms, some of which are specific inhibitors of the cAMP-dependent protein kinase, whereas others also inhibit the cGMP-dependent enzyme [Kumar, Van Patten and Walsh (1997), J. Biol. Chem. 272, 20011-20020]. We have now demonstrated that the switch from a cAMP-dependent protein kinase (PKA)-specific inhibitor to one with dual specificity arises as a consequence of alternate gene splicing. We have confirmed using bacterially produced pure protein that a single inhibitor species has dual specificity for both PKA and cGMP-dependent protein kinase (PKG), inhibiting each with very high and closely similar inhibitory potencies. The gene splicing converted a protein with 70 amino acids into one of 109 amino acids, and did not change the inhibitory potency to PKA, but changed it from a protein that had no detectable PKG inhibitory activity to one that now inhibited PKG in the nanomolar range.

  2. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    Science.gov (United States)

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  3. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  4. Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa.

    Science.gov (United States)

    Lin, F; Chen, X M

    2007-05-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values

  5. Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3

    International Nuclear Information System (INIS)

    Fan Jun; Akabane, Hiroto; Zheng Xuehai; Zhou Xuan; Zhang Li; Liu Qiang; Zhang Yonglian; Yang Jing; Zhu Guozhang

    2007-01-01

    The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function

  6. Absence of erythrocyte sequestration and lack of multicopy gene family expression in Plasmodium falciparum from a splenectomized malaria patient.

    Directory of Open Access Journals (Sweden)

    Anna Bachmann

    Full Text Available BACKGROUND: To avoid spleen-dependent killing mechanisms parasite-infected erythrocytes (IE of Plasmodium falciparum malaria patients have the capacity to bind to endothelial receptors. This binding also known as sequestration, is mediated by parasite proteins, which are targeted to the erythrocyte surface. Candidate proteins are those encoded by P. falciparum multicopy gene families, such as var, rif, stevor or PfMC-2TM. However, a direct in vivo proof of IE sequestration and expression of multicopy gene families is still lacking. Here, we report on the analysis of IE from a black African immigrant, who received the diagnosis of a malignant lymphoproliferative disorder and subsequently underwent splenectomy. Three weeks after surgery, the patient experienced clinical falciparum malaria with high parasitemia and circulating developmental parasite stages usually sequestered to the vascular endothelium such as late trophozoites, schizonts or immature gametocytes. METHODOLOGY/PRINCIPAL FINDINGS: Initially, when isolated from the patient, the infected erythrocytes were incapable to bind to various endothelial receptors in vitro. Moreover, the parasites failed to express the multicopy gene families var, A-type rif and stevor but expression of B-type rif and PfMC-2TM genes were detected. In the course of in vitro cultivation, the parasites started to express all investigated multicopy gene families and concomitantly developed the ability to adhere to endothelial receptors such as CD36 and ICAM-1, respectively. CONCLUSION/SIGNIFICANCE: This case strongly supports the hypothesis that parasite surface proteins such as PfEMP1, A-type RIFIN or STEVOR are involved in interactions of infected erythrocytes with endothelial receptors mediating sequestration of mature asexual and immature sexual stages of P. falciparum. In contrast, multicopy gene families coding for B-type RIFIN and PfMC-2TM proteins may not be involved in sequestration, as these genes were

  7. A Gene Catalogue of the Euchromatic Male-Specific Region of the Horse Y Chromosome: Comparison with Human and Other Mammals

    OpenAIRE

    Paria, Nandina; Raudsepp, Terje; Pearks Wilkerson, Alison J.; O'Brien, Patricia C. M.; Ferguson-Smith, Malcom A.; Love, Charles C.; Arnold, Carolyn; Rakestraw, Peter; Murphy, William J.; Chowdhary, Bhanu P.

    2011-01-01

    Studies of the Y chromosome in primates, rodents and carnivores provide compelling evidence that the male specific region of Y (MSY) contains functional genes, many of which have specialized roles in spermatogenesis and male-fertility. Little similarity, however, has been found between the gene content and sequence of MSY in different species. This hinders the discovery of species-specific male fertility genes and limits our understanding about MSY evolution in mammals. Here, a detailed MSY g...

  8. Sarcocystis neurona retinochoroiditis in a sea otter (Enhydra lutris kenyoni).

    Science.gov (United States)

    Dubey, J P; Thomas, N J

    2011-12-29

    Sarcocystis neurona is an important cause of fatal disease in sea otters in the USA. Encephalitis is the predominant lesion and parasites are confined to the central nervous system and muscles. Here we report retinochoroiditis in a sea otter (Enhydra lutris kenyoni) found dead on Copalis Beach, WA, USA. Salient lesions were confined to the brain and eye. Multifocal nonsuppurative meningoencephalitis was present in the cerebrum and cerebellum associated with S. neurona schizonts. The retina of one eye had a focus of inflammation that contained numerous S. neurona schizonts and merozoites. The focus extended from the retinal pigment epithelium inward through all layers of the retina, but inflammation was most concentrated at the inner surface of the tapetum and the outer retina. The inner and outer nuclear layers of the retina were disorganized and irregular at the site of inflammation. There was severe congestion and mild hemorrhage in the choroid, and mild hemorrhage into the vitreous body. Immunohistochemistry with S. neurona-specific polyclonal rabbit antibodies stained schizonts and merozoites. To our knowledge this is the first report of S. neurona-associated retinochoroiditis in any naturally infected animal. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Specific gene expression profiles and chromosomal abnormalities are associated with infant disseminated neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kushner Brian

    2009-02-01

    Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.

  10. Gene expression patterns specific to the regenerating limb of the Mexican axolotl

    Directory of Open Access Journals (Sweden)

    James R. Monaghan

    2012-07-01

    Salamander limb regeneration is dependent upon tissue interactions that are local to the amputation site. Communication among limb epidermis, peripheral nerves, and mesenchyme coordinate cell migration, cell proliferation, and tissue patterning to generate a blastema, which will form missing limb structures. An outstanding question is how cross-talk between these tissues gives rise to the regeneration blastema. To identify genes associated with epidermis-nerve-mesenchymal interactions during limb regeneration, we examined histological and transcriptional changes during the first week following injury in the wound epidermis and subjacent cells between three injury types; 1 a flank wound on the side of the animal that will not regenerate a limb, 2 a denervated limb that will not regenerate a limb, and 3 an innervated limb that will regenerate a limb. Early, histological and transcriptional changes were similar between the injury types, presumably because a common wound-healing program is employed across anatomical locations. However, some transcripts were enriched in limbs compared to the flank and are associated with vertebrate limb development. Many of these genes were activated before blastema outgrowth and expressed in specific tissue types including the epidermis, peripheral nerve, and mesenchyme. We also identified a relatively small group of transcripts that were more highly expressed in innervated limbs versus denervated limbs. These transcripts encode for proteins involved in myelination of peripheral nerves, epidermal cell function, and proliferation of mesenchymal cells. Overall, our study identifies limb-specific and nerve-dependent genes that are upstream of regenerative growth, and thus promising candidates for the regulation of blastema formation.

  11. Site-specific selfish genes as tools for the control and genetic engineering of natural populations.

    Science.gov (United States)

    Burt, Austin

    2003-05-07

    Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.

  12. A Chinese Herbal Decoction, Danggui Buxue Tang, Stimulates Proliferation, Differentiation and Gene Expression of Cultured Osteosarcoma Cells: Genomic Approach to Reveal Specific Gene Activation

    Directory of Open Access Journals (Sweden)

    Roy C. Y. Choi

    2011-01-01

    Full Text Available Danggui Buxue Tang (DBT, a Chinese herbal decoction used to treat ailments in women, contains Radix Astragali (Huangqi; RA and Radix Angelicae Sinensis (Danggui; RAS. When DBT was applied onto cultured MG-63 cells, an increase of cell proliferation and differentiation of MG-63 cell were revealed: both of these effects were significantly higher in DBT than RA or RAS extract. To search for the biological markers that are specifically regulated by DBT, DNA microarray was used to reveal the gene expression profiling of DBT in MG-63 cells as compared to that of RA- or RAS-treated cells. Amongst 883 DBT-regulated genes, 403 of them are specifically regulated by DBT treatment, including CCL-2, CCL-7, CCL-8, and galectin-9. The signaling cascade of this DBT-regulated gene expression was also elucidated in cultured MG-63 cells. The current results reveal the potential usage of this herbal decoction in treating osteoporosis and suggest the uniqueness of Chinese herbal decoction that requires a well-defined formulation. The DBT-regulated genes in the culture could serve as biological responsive markers for quality assurance of the herbal preparation.

  13. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  14. Dual-specificity anti-sigma factor reinforces control of cell-type specific gene expression in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Mónica Serrano

    2015-04-01

    Full Text Available Gene expression during spore development in Bacillus subtilis is controlled by cell type-specific RNA polymerase sigma factors. σFand σE control early stages of development in the forespore and the mother cell, respectively. When, at an intermediate stage in development, the mother cell engulfs the forespore, σF is replaced by σG and σE is replaced by σK. The anti-sigma factor CsfB is produced under the control of σF and binds to and inhibits the auto-regulatory σG, but not σF. A position in region 2.1, occupied by an asparagine in σG and by a glutamate in οF, is sufficient for CsfB discrimination of the two sigmas, and allows it to delay the early to late switch in forespore gene expression. We now show that following engulfment completion, csfB is switched on in the mother cell under the control of σK and that CsfB binds to and inhibits σE but not σK, possibly to facilitate the switch from early to late gene expression. We show that a position in region 2.3 occupied by a conserved asparagine in σE and by a conserved glutamate in σK suffices for discrimination by CsfB. We also show that CsfB prevents activation of σG in the mother cell and the premature σG-dependent activation of σK. Thus, CsfB establishes negative feedback loops that curtail the activity of σE and prevent the ectopic activation of σG in the mother cell. The capacity of CsfB to directly block σE activity may also explain how CsfB plays a role as one of the several mechanisms that prevent σE activation in the forespore. Thus the capacity of CsfB to differentiate between the highly similar σF/σG and σE/σK pairs allows it to rinforce the cell-type specificity of these sigma factors and the transition from early to late development in B. subtilis, and possibly in all sporeformers that encode a CsfB orthologue.

  15. Organization and Biology of the Porcine Serum Amyloid A (SAA) Gene Cluster: Isoform Specific Responses to Bacterial Infection

    DEFF Research Database (Denmark)

    Olsen, Helle G; Skovgaard, Kerstin; Nielsen, Ole L

    2013-01-01

    Serum amyloid A (SAA) is a prominent acute phase protein. Although its biological functions are debated, the wide species distribution of highly homologous SAA proteins and their uniform behavior in response to injury or inflammation in itself suggests a significant role for this protein. The pig...... is increasingly being used as a model for the study of inflammatory reactions, yet only little is known about how specific SAA genes are regulated in the pig during acute phase responses and other responses induced by pro-inflammatory host mediators. We designed SAA gene specific primers and quantified the gene...... expression of porcine SAA1, SAA2, SAA3, and SAA4 by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in liver, spleen, and lung tissue from pigs experimentally infected with the Gram-negative swine specific bacterium Actinobacillus pleuropneumoniae, as well as from pigs experimentally...

  16. Selecting Question-Specific Genes to Reduce Incongruence in Phylogenomics: A Case Study of Jawed Vertebrate Backbone Phylogeny.

    Science.gov (United States)

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng

    2015-11-01

    Incongruence between different phylogenomic analyses is the main challenge faced by phylogeneticists in the genomic era. To reduce incongruence, phylogenomic studies normally adopt some data filtering approaches, such as reducing missing data or using slowly evolving genes, to improve the signal quality of data. Here, we assembled a phylogenomic data set of 58 jawed vertebrate taxa and 4682 genes to investigate the backbone phylogeny of jawed vertebrates under both concatenation and coalescent-based frameworks. To evaluate the efficiency of extracting phylogenetic signals among different data filtering methods, we chose six highly intractable internodes within the backbone phylogeny of jawed vertebrates as our test questions. We found that our phylogenomic data set exhibits substantial conflicting signal among genes for these questions. Our analyses showed that non-specific data sets that are generated without bias toward specific questions are not sufficient to produce consistent results when there are several difficult nodes within a phylogeny. Moreover, phylogenetic accuracy based on non-specific data is considerably influenced by the size of data and the choice of tree inference methods. To address such incongruences, we selected genes that resolve a given internode but not the entire phylogeny. Notably, not only can this strategy yield correct relationships for the question, but it also reduces inconsistency associated with data sizes and inference methods. Our study highlights the importance of gene selection in phylogenomic analyses, suggesting that simply using a large amount of data cannot guarantee correct results. Constructing question-specific data sets may be more powerful for resolving problematic nodes. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  18. Regulating expressin of cell and tissue-specific genes by modifying transcription

    Energy Technology Data Exchange (ETDEWEB)

    Beachy, Roger N. [Donald Danforth Plant Science Center, St. Louis, MO (United States); Dai, Shunhong [Donald Danforth Plant Science Center, St. Louis, MO (United States)

    2009-12-15

    Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Our research supported by this program has led to the identification of rice bZIP transcription factors RF2a, RF2b and RLP1 that play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV) through their interactions with the Box II essential cis element located in the promoter. RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants and to improve biofuel feedstock.

  19. Virus-specific DNA sequences present in cells which carry the herpes simplex virus thymidine kinase gene.

    Science.gov (United States)

    Minson, A C; Darby, G K; Wildy, P

    1979-11-01

    Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.

  20. Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

    Science.gov (United States)

    Proudhon, D; Wei, J; Briat, J; Theil, E C

    1996-03-01

    Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

  1. Identification of a novel and unique transcription factor in the intraerythrocytic stage of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available The mechanisms of stage-specific gene regulation in the malaria parasite Plasmodium falciparum are largely unclear, with only a small number of specific regulatory transcription factors (AP2 family having been identified. In particular, the transcription factors that function in the intraerythrocytic stage remain to be elucidated. Previously, as a model case for stage-specific transcription in the P. falciparum intraerythrocytic stage, we analyzed the transcriptional regulation of pf1-cys-prx, a trophozoite/schizont-specific gene, and suggested that some nuclear factors bind specifically to the cis-element of pf1-cys-prx and enhance transcription. In the present study, we purified nuclear factors from parasite nuclear extract by 5 steps of chromatography, and identified a factor termed PREBP. PREBP is not included in the AP2 family, and is a novel protein with four K-homology (KH domains. The KH domain is known to be found in RNA-binding or single-stranded DNA-binding proteins. PREBP is well conserved in Plasmodium species and partially conserved in phylum Apicomplexa. To evaluate the effects of PREBP overexpression, we used a transient overexpression and luciferase assay combined approach. Overexpression of PREBP markedly enhanced luciferase expression under the control of the pf1-cys-prx cis-element. These results provide the first evidence of a novel transcription factor that activates the gene expression in the malaria parasite intraerythrocytic stage. These findings enhance our understanding of the evolution of specific transcription machinery in Plasmodium and other eukaryotes.

  2. Chronic stress induces sex-specific alterations in methylation and expression of corticotropin-releasing factor gene in the rat.

    Directory of Open Access Journals (Sweden)

    Linda Sterrenburg

    Full Text Available BACKGROUND: Although the higher prevalence of depression in women than in men is well known, the neuronal basis of this sex difference is largely elusive. METHODS: Male and female rats were exposed to chronic variable mild stress (CVMS after which immediate early gene products, corticotropin-releasing factor (CRF mRNA and peptide, various epigenetic-associated enzymes and DNA methylation of the Crf gene were determined in the hypothalamic paraventricular nucleus (PVN, oval (BSTov and fusiform (BSTfu parts of the bed nucleus of the stria terminalis, and central amygdala (CeA. RESULTS: CVMS induced site-specific changes in Crf gene methylation in all brain centers studied in female rats and in the male BST and CeA, whereas the histone acetyltransferase, CREB-binding protein was increased in the female BST and the histone-deacetylase-5 decreased in the male CeA. These changes were accompanied by an increased amount of c-Fos in the PVN, BSTfu and CeA in males, and of FosB in the PVN of both sexes and in the male BSTov and BSTfu. In the PVN, CVMS increased CRF mRNA in males and CRF peptide decreased in females. CONCLUSIONS: The data confirm our hypothesis that chronic stress affects gene expression and CRF transcriptional, translational and secretory activities in the PVN, BSTov, BSTfu and CeA, in a brain center-specific and sex-specific manner. Brain region-specific and sex-specific changes in epigenetic activity and neuronal activation may play, too, an important role in the sex specificity of the stress response and the susceptibility to depression.

  3. In vitro sensitivity pattern of chloroquine and artemisinin in Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Supriya Sharma

    2016-01-01

    Full Text Available Artemisinin (ART and its derivatives form the mainstay of antimalarial therapy. Emergence of resistance to them poses a potential threat to future malaria control and elimination on a global level. It is important to know the mechanism of action of drug and development of drug resistance. We put forwards probable correlation between the mode of action of chloroquine (CQ and ART. Modified trophozoite maturation inhibition assay, WHO Mark III assay and molecular marker study for CQ resistance at K76T codon in Plasmodium falciparum CQ-resistant transporter gene were carried out on cultured P. falciparum. On comparing trophozoite and schizont growth for both CQ-sensitive (MRC-2 and CQ-resistant (RKL-9 culture isolates, it was observed that the clearance of trophozoites and schizonts was similar with both drugs. The experiment supports that CQ interferes with heme detoxification pathway in food vacuoles of parasite, and this may be correlated as one of the plausible mechanisms of ART.

  4. Molecular characterization and analysis of a novel protein disulfide isomerase-like protein of Eimeria tenella.

    Directory of Open Access Journals (Sweden)

    Hongyu Han

    Full Text Available Protein disulfide isomerase (PDI and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE according to the expressed sequence tag (EST. The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC. BLAST analysis showed that the EtPDIL protein was 55-59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells

  5. Molecular characterization and analysis of a novel protein disulfide isomerase-like protein of Eimeria tenella.

    Science.gov (United States)

    Han, Hongyu; Dong, Hui; Zhu, Shunhai; Zhao, Qiping; Jiang, Lianlian; Wang, Yange; Li, Liujia; Wu, Youlin; Huang, Bing

    2014-01-01

    Protein disulfide isomerase (PDI) and PDI-like proteins are members of the thioredoxin superfamily. They contain thioredoxin-like domains and catalyze the physiological oxidation, reduction and isomerization of protein disulfide bonds, which are involved in cell function and development in prokaryotes and eukaryotes. In this study, EtPDIL, a novel PDI-like gene of Eimeria tenella, was cloned using rapid amplification of cDNA ends (RACE) according to the expressed sequence tag (EST). The EtPDIL cDNA contained 1129 nucleotides encoding 216 amino acids. The deduced EtPDIL protein belonged to thioredoxin-like superfamily and had a single predicted thioredoxin domain with a non-classical thioredoxin-like motif (SXXC). BLAST analysis showed that the EtPDIL protein was 55-59% identical to PDI-like proteins of other apicomplexan parasites. The transcript and protein levels of EtPDIL at different development stages were investigated by real-time quantitative PCR and western blot. The messenger RNA and protein levels of EtPDIL were higher in sporulated oocysts than in unsporulated oocysts, sporozoites or merozoites. Protein expression was barely detectable in unsporulated oocysts. Western blots showed that rabbit antiserum against recombinant EtPDIL recognized only a native 24 kDa protein from parasites. Immunolocalization with EtPDIL antibody showed that EtPDIL had a disperse distribution in the cytoplasm of whole sporozoites and merozoites. After sporozoites were incubated in complete medium, EtPDIL protein concentrated at the anterior of the sporozoites and appeared on the surface of parasites. Specific staining was more intense and mainly located on the parasite surface after merozoites released from mature schizonts invaded DF-1 cells. After development of parasites in DF-1 cells, staining intensified in trophozoites, immature schizonts and mature schizonts. Antibody inhibition of EtPDIL function reduced the ability of E. tenella to invade DF-1 cells. These results

  6. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity

    Science.gov (United States)

    Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.

    2014-01-01

    The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.

  7. Global Transcriptome Analysis of Primary Cerebrocortical Cells: Identification of Genes Regulated by Triiodothyronine in Specific Cell Types.

    Science.gov (United States)

    Gil-Ibañez, Pilar; García-García, Francisco; Dopazo, Joaquín; Bernal, Juan; Morte, Beatriz

    2017-01-01

    Thyroid hormones, thyroxine, and triiodothyronine (T3) are crucial for cerebral cortex development acting through regulation of gene expression. To define the transcriptional program under T3 regulation, we have performed RNA-Seq of T3-treated and untreated primary mouse cerebrocortical cells. The expression of 1145 genes or 7.7% of expressed genes was changed upon T3 addition, of which 371 responded to T3 in the presence of cycloheximide indicating direct transcriptional regulation. The results were compared with available transcriptomic datasets of defined cellular types. In this way, we could identify targets of T3 within genes enriched in astrocytes and neurons, in specific layers including the subplate, and in specific neurons such as prepronociceptin, cholecystokinin, or cortistatin neurons. The subplate and the prepronociceptin neurons appear as potentially major targets of T3 action. T3 upregulates mostly genes related to cell membrane events, such as G-protein signaling, neurotransmission, and ion transport and downregulates genes involved in nuclear events associated with the M phase of cell cycle, such as chromosome organization and segregation. Remarkably, the transcriptomic changes induced by T3 sustain the transition from fetal to adult patterns of gene expression. The results allow defining in molecular terms the elusive role of thyroid hormones on neocortical development. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Effect of specific enzyme inhibitors on replication, total genome DNA repair and on gene-specific DNA repair after UV irradiation in CHO cells

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.C.; Stevsner, Tinna; Bohr, Vilhelm A. (National Cancer Institute, NIH, Bethesda, MD (USA). Division of Cancer Treatment, Laboratory of Molecular Pharmacology); Mattern, M.R. (Smith Kline Beecham Pharmaceuticals, King of Prussia, PA (USA). Department of Biomolecular Discovery)

    1991-09-01

    The effects were studied of some specific enzyme inhibitors on DNA repair and replication after UV damage in Chinese hamster ovary cells. The DNA repair was studied at the level of the average, overall genome and also in the active dihydrofolate reductase gene. Replication was measured in the overall genome. The inhibitors were tested of DNA poly-merase {alpha} and {delta} (aphidicolin), of poly(ADPr) polymerase (3-aminobenzamide), of ribonucleotide reductase (hydroxyurea), of topo-isomerase I (camptothecin), and of topoisomerase II (merbarone, VP-16). In addition, the effects were tested of the potential topoisomerase I activator, {beta}-lapachone. All of these compounds inhibited genome replication and all topoisomerase inhibitors affected the overall genome repair; {beta}-lapachone stimulated it. None of these compounds had any effect on the gene-specific repair. (author). 36 refs.; 3 figs.; 2 tabs.

  9. Abundance profiling of specific gene groups using precomputed gut metagenomes yields novel biological hypotheses.

    Directory of Open Access Journals (Sweden)

    Konstantin Yarygin

    Full Text Available The gut microbiota is essentially a multifunctional bioreactor within a human being. The exploration of its enormous metabolic potential provides insights into the mechanisms underlying microbial ecology and interactions with the host. The data obtained using "shotgun" metagenomics capture information about the whole spectrum of microbial functions. However, each new study presenting new sequencing data tends to extract only a little of the information concerning the metabolic potential and often omits specific functions. A meta-analysis of the available data with an emphasis on biomedically relevant gene groups can unveil new global trends in the gut microbiota. As a step toward the reuse of metagenomic data, we developed a method for the quantitative profiling of user-defined groups of genes in human gut metagenomes. This method is based on the quick analysis of a gene coverage matrix obtained by pre-mapping the metagenomic reads to a global gut microbial catalogue. The method was applied to profile the abundance of several gene groups related to antibiotic resistance, phages, biosynthesis clusters and carbohydrate degradation in 784 metagenomes from healthy populations worldwide and patients with inflammatory bowel diseases and obesity. We discovered country-wise functional specifics in gut resistome and virome compositions. The most distinct features of the disease microbiota were found for Crohn's disease, followed by ulcerative colitis and obesity. Profiling of the genes belonging to crAssphage showed that its abundance varied across the world populations and was not associated with clinical status. We demonstrated temporal resilience of crAssphage and the influence of the sample preparation protocol on its detected abundance. Our approach offers a convenient method to add value to accumulated "shotgun" metagenomic data by helping researchers state and assess novel biological hypotheses.

  10. Locus-Specific Databases and Recommendations to Strengthen Their Contribution to the Classification of Variants in Cancer Susceptibility Genes

    NARCIS (Netherlands)

    Greenblatt, Marc S.; Brody, Lawrence C.; Foulkes, William D.; Genuardi, Maurizio; Hofstra, Robert M. W.; Olivier, Magali; Plon, Sharon E.; Sijmons, Rolf H.; Sinilnikova, Olga; Spurdle, Amanda B.

    2008-01-01

    Locus-specific databases (LSDBs) are curated collections of sequence variants in genes associated with disease. LSDBs of cancer-related genes often serve as a critical resource to researchers, diagnostic laboratories, clinicians, and others in the cancer genetics community. LSDBs are poised to play

  11. Regulatory regions in the rat lactase-phlorizin hydrolase gene that control cell-specific expression

    NARCIS (Netherlands)

    Verhave, Menno; Krasinski, Stephen D.; Christian, Sara I.; van Schaik, Sandrijn; van den Brink, Gijs R.; Doting, Edwina M. H.; Maas, Saskia M.; Wolthers, Katja C.; Grand, Richard J.; Montgomery, Robert K.

    2004-01-01

    OBJECTIVES: Lactase-phlorizin hydrolase (LPH) is an enterocyte-specific gene whose expression has been well-characterized, not only developmentally but also along the crypt-villus axis and along the length of the small bowel. Previous studies from the authors' laboratory have demonstrated that 2 kb

  12. Parent-of-origin dependent gene-specific knock down in mouse embryos

    International Nuclear Information System (INIS)

    Iqbal, Khursheed; Kues, Wilfried A.; Niemann, Heiner

    2007-01-01

    In mice hemizygous for the Oct4-GFP transgene, the F1 embryos show parent-of-origin dependent expression of the marker gene. F1 embryos with a maternally derived OG2 allele (OG2 mat /-) express GFP in the oocyte and during preimplantation development until the blastocyst stage indicating a maternal and embryonic expression pattern. F1-embryos with a paternally inherited OG2 allele (OG2 pat /-) express GFP from the 4- to 8-cell stage onwards showing only embryonic expression. This allows to study allele specific knock down of GFP expression. RNA interference (RNAi) was highly efficient in embryos with the paternally inherited GFP allele, whereas embryos with the maternally inherited GFP allele showed a delayed and less stringent suppression, indicating that the initial levels of the target transcript and the half life of the protein affect RNAi efficacy. RT-PCR analysis revealed only minimum of GFP mRNA. These results have implications for studies of gene silencing in mammalian embryos

  13. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.).

    Science.gov (United States)

    Kamenetsky, Rina; Faigenboim, Adi; Shemesh Mayer, Einat; Ben Michael, Tomer; Gershberg, Chen; Kimhi, Sagie; Esquira, Itzhak; Rohkin Shalom, Sarit; Eshel, Dani; Rabinowitch, Haim D; Sherman, Amir

    2015-01-22

    Garlic is cultivated and consumed worldwide as a popular condiment and green vegetable with medicinal and neutraceutical properties. Garlic cultivars do not produce seeds, and therefore, this plant has not been the subject of either classical breeding or genetic studies. However, recent achievements in fertility restoration in a number of genotypes have led to flowering and seed production, thus enabling genetic studies and breeding in garlic. A transcriptome catalogue of fertile garlic was produced from multiplexed gene libraries, using RNA collected from various plant organs, including inflorescences and flowers. Over 32 million 250-bp paired-end reads were assembled into an extensive transcriptome of 240,000 contigs. An abundant transcriptome assembled separately from 102,000 highly expressed contigs was annotated and analyzed for gene ontology and metabolic pathways. Organ-specific analysis showed significant variation of gene expression between plant organs, with the highest number of specific reads in inflorescences and flowers. Analysis of the enriched biological processes and molecular functions revealed characteristic patterns for stress response, flower development and photosynthetic activity. Orthologues of key flowering genes were differentially expressed, not only in reproductive tissues, but also in leaves and bulbs, suggesting their role in flower-signal transduction and the bulbing process. More than 100 variants and isoforms of enzymes involved in organosulfur metabolism were differentially expressed and had organ-specific patterns. In addition to plant genes, viral RNA of at least four garlic viruses was detected, mostly in the roots and cloves, whereas only 1-4% of the reads were found in the foliage leaves. The de novo transcriptome of fertile garlic represents a new resource for research and breeding of this important crop, as well as for the development of effective molecular markers for useful traits, including fertility and seed production

  14. Common genetic variations in CCK, leptin, and leptin receptor genes are associated with specific human eating patterns

    NARCIS (Netherlands)

    de Krom, Mariken; van der Schouw, Yvonne T.; Hendriks, Judith; Ophoff, Roel A.; van Gils, Carla H.; Stolk, Ronald P.; Grobbee, Diederick E.; Adan, Roger

    Obesity has a heritable component; however, the heterogeneity of obesity complicates dissection of its genetic background. In this study, we therefore focused on eating patterns as specific traits within obesity. These traits have a heritable component; genes associated with a specific eating

  15. Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo.

    Directory of Open Access Journals (Sweden)

    Raymond L Fields

    Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.

  16. Lactobacillus reuteri-specific immunoregulatory gene rsiR modulates histamine production and immunomodulation by Lactobacillus reuteri.

    Science.gov (United States)

    Hemarajata, P; Gao, C; Pflughoeft, K J; Thomas, C M; Saulnier, D M; Spinler, J K; Versalovic, J

    2013-12-01

    Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes that were highly expressed during the stationary phase of growth, when TNF suppression is most potent. One such gene was found to be a regulator of genes involved in histidine-histamine metabolism by this probiotic species. During the course of these studies, this gene was renamed the Lactobacillus reuteri-specific immunoregulatory (rsiR) gene. The rsiR gene is essential for human TNF suppression by L. reuteri and expression of the histidine decarboxylase (hdc) gene cluster on the L. reuteri chromosome. Inactivation of rsiR resulted in diminished TNF suppression in vitro and reduced anti-inflammatory effects in vivo in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of acute colitis. A L. reuteri strain lacking an intact rsiR gene was unable to suppress colitis and resulted in greater concentrations of serum amyloid A (SAA) in the bloodstream of affected animals. The PhdcAB promoter region targeted by rsiR was defined by reporter gene experiments. These studies support the presence of a regulatory gene, rsiR, which modulates the expression of a gene cluster known to mediate immunoregulation by probiotics at the transcriptional level. These findings may point the way toward new strategies for controlling gene expression in probiotics by dietary interventions or microbiome manipulation.

  17. Identification of specific gene expression profiles in fibroblasts derived from middle ear cholesteatoma.

    Science.gov (United States)

    Yoshikawa, Mamoru; Kojima, Hiromi; Wada, Kota; Tsukidate, Toshiharu; Okada, Naoko; Saito, Hirohisa; Moriyama, Hiroshi

    2006-07-01

    To investigate the role of fibroblasts in the pathogenesis of cholesteatoma. Tissue specimens were obtained from our patients. Middle ear cholesteatoma-derived fibroblasts (MECFs) and postauricular skin-derived fibroblasts (SFs) as controls were then cultured for a few weeks. These fibroblasts were stimulated with interleukin (IL) 1alpha and/or IL-1beta before gene expression assays. We used the human genome U133A probe array (GeneChip) and real-time polymerase chain reaction to examine and compare the gene expression profiles of the MECFs and SFs. Six patients who had undergone tympanoplasty. The IL-1alpha-regulated genes were classified into 4 distinct clusters on the basis of profiles differentially regulated by SF and MECF using a hierarchical clustering analysis. The messenger RNA expressions of LARC (liver and activation-regulated chemokine), GMCSF (granulocyte-macrophage colony-stimulating factor), epiregulin, ICAM1 (intercellular adhesion molecule 1), and TGFA (transforming growth factor alpha) were more strongly up-regulated by IL-1alpha and/or IL-1beta in MECF than in SF, suggesting that these fibroblasts derived from different tissues retained their typical gene expression profiles. Fibroblasts may play a role in hyperkeratosis of middle ear cholesteatoma by releasing molecules involved in inflammation and epidermal growth. These fibroblasts may retain tissue-specific characteristics presumably controlled by epigenetic mechanisms.

  18. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Science.gov (United States)

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

    2010-05-16

    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  19. Haplotype specific alteration of diabetes MHC risk by olfactory receptor gene polymorphism.

    Science.gov (United States)

    Jahromi, Mohamed M

    2012-12-01

    Evidence for genes associated with risk for Type 1 diabetes (T1D) in the extended region of the major histocompatibility complex (MHC) genes is accumulating. The aim of this study was to investigate the association pattern of the extended MHC region with T1D susceptibility to identify effects independent of well established DR/DQ genes. A total of 394 Europid families with T1D were genotyped for the single nucleotide polymorphism (SNP) in the olfactory receptor family 14, subfamily J, member 1 (OR14J1) gene, rs9257691, in the MHC telomeric region. The OR provides "an internal depiction of our external world" through the capture of odorant molecules in the main OR system by several large families of G-protein coupled receptors (GPCR). These receptors transduce and chemosignals into the central nervous system (CNS). This SNP was chosen to identify its association with T1D. Interestingly, OR14J1C allele was significantly associated with T1D that seems to go with DRB1*0401, Χ(2)=10.9, p=0.0003. However, by fixing both genes of DR*0401-DQB1*0302, high risk, the association of T1D with OR14J1C still existed, Χ(2)=7.4, p=0.005. The occurrence of association of the OR14J1C allele with T1D patients with DRB1*401/DQB1*0302 is an independent risk for T1D. As an accumulative report suggests the role of OR in the pathogenesis of diabetic microvascular and other diabetic complications, undoubtedly, this haplotype specific alteration of T1D risk is an independent risk for the disease and can address the promising MHC-linked gene other than DR/DQ. Moreover, there is nothing to hinder for that this might be a signal that identifies the role of OR gene in the pathogenesis of T1D in patients who are prone to diabetic complications. Copyright © 2012. Published by Elsevier B.V.

  20. Lim homeobox genes in the Ctenophore Mnemiopsis leidyi: the evolution of neural cell type specification

    Directory of Open Access Journals (Sweden)

    Simmons David K

    2012-01-01

    Full Text Available Abstract Background Nervous systems are thought to be important to the evolutionary success and diversification of metazoans, yet little is known about the origin of simple nervous systems at the base of the animal tree. Recent data suggest that ctenophores, a group of macroscopic pelagic marine invertebrates, are the most ancient group of animals that possess a definitive nervous system consisting of a distributed nerve net and an apical statocyst. This study reports on details of the evolution of the neural cell type specifying transcription factor family of LIM homeobox containing genes (Lhx, which have highly conserved functions in neural specification in bilaterian animals. Results Using next generation sequencing, the first draft of the genome of the ctenophore Mnemiopsis leidyi has been generated. The Lhx genes in all animals are represented by seven subfamilies (Lhx1/5, Lhx3/4, Lmx, Islet, Lhx2/9, Lhx6/8, and LMO of which four were found to be represented in the ctenophore lineage (Lhx1/5, Lhx3/4, Lmx, and Islet. Interestingly, the ctenophore Lhx gene complement is more similar to the sponge complement (sponges do not possess neurons than to either the cnidarian-bilaterian or placozoan Lhx complements. Using whole mount in situ hybridization, the Lhx gene expression patterns were examined and found to be expressed around the blastopore and in cells that give rise to the apical organ and putative neural sensory cells. Conclusion This research gives us a first look at neural cell type specification in the ctenophore M. leidyi. Within M. leidyi, Lhx genes are expressed in overlapping domains within proposed neural cellular and sensory cell territories. These data suggest that Lhx genes likely played a conserved role in the patterning of sensory cells in the ancestor of sponges and ctenophores, and may provide a link to the expression of Lhx orthologs in sponge larval photoreceptive cells. Lhx genes were later co-opted into patterning more

  1. Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

    Science.gov (United States)

    Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

    2017-10-27

    Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes

  2. A robust approach to identifying tissue-specific gene expression regulatory variants using personalized human induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Je-Hyuk Lee

    2009-11-01

    Full Text Available Normal variation in gene expression due to regulatory polymorphisms is often masked by biological and experimental noise. In addition, some regulatory polymorphisms may become apparent only in specific tissues. We derived human induced pluripotent stem (iPS cells from adult skin primary fibroblasts and attempted to detect tissue-specific cis-regulatory variants using in vitro cell differentiation. We used padlock probes and high-throughput sequencing for digital RNA allelotyping and measured allele-specific gene expression in primary fibroblasts, lymphoblastoid cells, iPS cells, and their differentiated derivatives. We show that allele-specific expression is both cell type and genotype-dependent, but the majority of detectable allele-specific expression loci remains consistent despite large changes in the cell type or the experimental condition following iPS reprogramming, except on the X-chromosome. We show that our approach to mapping cis-regulatory variants reduces in vitro experimental noise and reveals additional tissue-specific variants using skin-derived human iPS cells.

  3. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

    Directory of Open Access Journals (Sweden)

    Chun-Nun Chao

    Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

  4. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.

    Science.gov (United States)

    Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin

    2016-01-01

    Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

  5. Different gene-specific mechanisms determine the 'revised-response' memory transcription patterns of a subset of A. thaliana dehydration stress responding genes.

    Science.gov (United States)

    Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya

    2014-05-01

    Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  7. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  8. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  9. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  10. Collective Dynamics of Specific Gene Ensembles Crucial for Neutrophil Differentiation: The Existence of Genome Vehicles Revealed

    Science.gov (United States)

    Giuliani, Alessandro; Tomita, Masaru

    2010-01-01

    Cell fate decision remarkably generates specific cell differentiation path among the multiple possibilities that can arise through the complex interplay of high-dimensional genome activities. The coordinated action of thousands of genes to switch cell fate decision has indicated the existence of stable attractors guiding the process. However, origins of the intracellular mechanisms that create “cellular attractor” still remain unknown. Here, we examined the collective behavior of genome-wide expressions for neutrophil differentiation through two different stimuli, dimethyl sulfoxide (DMSO) and all-trans-retinoic acid (atRA). To overcome the difficulties of dealing with single gene expression noises, we grouped genes into ensembles and analyzed their expression dynamics in correlation space defined by Pearson correlation and mutual information. The standard deviation of correlation distributions of gene ensembles reduces when the ensemble size is increased following the inverse square root law, for both ensembles chosen randomly from whole genome and ranked according to expression variances across time. Choosing the ensemble size of 200 genes, we show the two probability distributions of correlations of randomly selected genes for atRA and DMSO responses overlapped after 48 hours, defining the neutrophil attractor. Next, tracking the ranked ensembles' trajectories, we noticed that only certain, not all, fall into the attractor in a fractal-like manner. The removal of these genome elements from the whole genomes, for both atRA and DMSO responses, destroys the attractor providing evidence for the existence of specific genome elements (named “genome vehicle”) responsible for the neutrophil attractor. Notably, within the genome vehicles, genes with low or moderate expression changes, which are often considered noisy and insignificant, are essential components for the creation of the neutrophil attractor. Further investigations along with our findings might

  11. atpE gene as a new useful specific molecular target to quantify Mycobacterium in environmental samples

    Science.gov (United States)

    2013-01-01

    Background The environment is the likely source of many pathogenic mycobacterial species but detection of mycobacteria by bacteriological tools is generally difficult and time-consuming. Consequently, several molecular targets based on the sequences of housekeeping genes, non-functional RNA and structural ribosomal RNAs have been proposed for the detection and identification of mycobacteria in clinical or environmental samples. While certain of these targets were proposed as specific for this genus, most are prone to false positive results in complex environmental samples that include related, but distinct, bacterial genera. Nowadays the increased number of sequenced genomes and the availability of software for genomic comparison provide tools to develop novel, mycobacteria-specific targets, and the associated molecular probes and primers. Consequently, we conducted an in silico search for proteins exclusive to Mycobacterium spp. genomes in order to design sensitive and specific molecular targets. Results Among the 3989 predicted proteins from M. tuberculosis H37Rv, only 11 proteins showed 80% to 100% of similarity with Mycobacterium spp. genomes, and less than 50% of similarity with genomes of closely related Corynebacterium, Nocardia and Rhodococcus genera. Based on DNA sequence alignments, we designed primer pairs and a probe that specifically detect the atpE gene of mycobacteria, as verified by quantitative real-time PCR on a collection of mycobacteria and non-mycobacterial species. The real-time PCR method we developed was successfully used to detect mycobacteria in tap water and lake samples. Conclusions The results indicate that this real-time PCR method targeting the atpE gene can serve for highly specific detection and precise quantification of Mycobacterium spp. in environmental samples. PMID:24299240

  12. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

    OpenAIRE

    Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

    2009-01-01

    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

  13. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  14. A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function

    Directory of Open Access Journals (Sweden)

    Jingjing Zhai

    2016-12-01

    Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.

  15. Supplementary Material for: Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori

    2015-01-01

    Abstract Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis

  16. [Genes of insecticidal crystal proteins with dual specificity in Bacillus thuringiensis strains, isolated in the Crimea territory].

    Science.gov (United States)

    Rymar, S Iu; Isakova, I A; Kuznietsova, L M; Kordium, V A

    2006-01-01

    The insecticidal crystal proteins of 15 B. thuringiensis strains, isolated in the Crimea territory that are toxical for some Lepidoptera and Colorado potato beetle larvae were identified by PAGE electrophoresis. Ten strains produced the crystal proteins with high molecular weight (> 120 kD). PCR with use of broad specificity primers and DNA of these B. thuringiensis strains as template demonstrated the specific PCR products (1000 bp). Amplified DNA fragments were cloned and sequenced. The nucleotide sequence analysis revealed that the genomes of ten strains of B. thuringiensis carried Cry1B genes, which are responsible for production of the insecticidal crystal proteins with dual specificity. The influence of the solubilization conditions on the structure and toxicity of Cry1B protein for Colorado potato beetle larvae was shown. The dual toxicity of studied B. thuringiensis strains is explained by the Cry1B genes presence in their genomes. These strains may be used to develop the broad specificity bioinsecticides.

  17. [Parahaemoproteus desseri n. sp.; gametogony and schizogony in the natural host: Psittacula roseata from Thailand, experimental sporogony in Culicoides nubeculosus (author's transl)].

    Science.gov (United States)

    Miltgen, F; Landau, I; Ratanaworabhan, N; Yenbutra, S

    1981-01-01

    The gametogony and the tissue schizogony of Parahaemoproteus desseri are described in the natural host: Psittacula roseata; the schizonts develop in muscle fibres; they are large (up to 900 micrometer) and often sausage shaped with pseudo-septa. Experimental sporogony was studied in laboratory bred Culicoides nubeculosus (Ceratopogonidae). Oocysts are small and give rise to a small number of sporozoites. The morphological characteristics of the schizonts of our Parahaemoproteus are very similar to those of schizonts of Arthrocystis galli and therefore it is possible that the two genera are synonymous.

  18. Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight.

    Science.gov (United States)

    Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi

    2016-01-01

    Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

  19. Cell-Specific Actions of a Human LHX3 Gene Enhancer During Pituitary and Spinal Cord Development

    Science.gov (United States)

    Park, Soyoung; Mullen, Rachel D.

    2013-01-01

    The LIM class of homeodomain protein 3 (LHX3) transcription factor is essential for pituitary gland and nervous system development in mammals. In humans, mutations in the LHX3 gene underlie complex pediatric syndromes featuring deficits in anterior pituitary hormones and defects in the nervous system. The mechanisms that control temporal and spatial expression of the LHX3 gene are poorly understood. The proximal promoters of the human LHX3 gene are insufficient to guide expression in vivo and downstream elements including a conserved enhancer region appear to play a role in tissue-specific expression in the pituitary and nervous system. Here we characterized the activity of this downstream enhancer region in regulating gene expression at the cellular level during development. Human LHX3 enhancer-driven Cre reporter transgenic mice were generated to facilitate studies of enhancer actions. The downstream LHX3 enhancer primarily guides gene transcription in α-glycoprotein subunit -expressing cells secreting the TSHβ, LHβ, or FSHβ hormones and expressing the GATA2 and steroidogenic factor 1 transcription factors. In the developing nervous system, the enhancer serves as a targeting module active in V2a interneurons. These results demonstrate that the downstream LHX3 enhancer is important in specific endocrine and neural cell types but also indicate that additional regulatory elements are likely involved in LHX3 gene expression. Furthermore, these studies revealed significant gonadotrope cell heterogeneity during pituitary development, providing insights into the cellular physiology of this key reproductive regulatory cell. The human LHX3 enhancer-driven Cre reporter transgenic mice also provide a valuable tool for further developmental studies of cell determination and differentiation in the pituitary and nervous system. PMID:24100213

  20. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  1. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available A recently developed strategy of sequencing alternative polyadenylation (APA sites (SAPAS with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here, we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs and differentiated mouse embryonic fibroblast cells (MEFs as controls. As a result, we obtained 99,944 poly(A sites, approximately 40% of which were newly detected in our experiments. These poly(A sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site

  2. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells

    Science.gov (United States)

    Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu

    2015-01-01

    A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and

  3. Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control.

    Science.gov (United States)

    Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T

    1993-12-01

    CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.

  4. Identification of Subtype-Specific Prognostic Genes for Early-Stage Lung Adenocarcinoma and Squamous Cell Carcinoma Patients Using an Embedded Feature Selection Algorithm.

    Directory of Open Access Journals (Sweden)

    Suyan Tian

    Full Text Available The existence of fundamental differences between lung adenocarcinoma (AC and squamous cell carcinoma (SCC in their underlying mechanisms motivated us to postulate that specific genes might exist relevant to prognosis of each histology subtype. To test on this research hypothesis, we previously proposed a simple Cox-regression model based feature selection algorithm and identified successfully some subtype-specific prognostic genes when applying this method to real-world data. In this article, we continue our effort on identification of subtype-specific prognostic genes for AC and SCC, and propose a novel embedded feature selection method by extending Threshold Gradient Descent Regularization (TGDR algorithm and minimizing on a corresponding negative partial likelihood function. Using real-world datasets and simulated ones, we show these two proposed methods have comparable performance whereas the new proposal is superior in terms of model parsimony. Our analysis provides some evidence on the existence of such subtype-specific prognostic genes, more investigation is warranted.

  5. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  6. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  7. Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..

    2000-02-01

    Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.

  8. Tissue specific haemoglobin gene expression suggests adaptation to local marine conditions in North Sea flounder (Platichthys flesus L.)

    DEFF Research Database (Denmark)

    Larsen, P.F.; Eg Nielsen, Einar; Hansen, M.M.

    2013-01-01

    Recent genetic analyses of candidate genes and gene expression in marine fishes have provided evidence of local adaptation in response to environmental differences, despite the lack of strong signals of population structure from conventional neutral genetic markers. In this study expression...... in flounder. In gill tissue a plastic response to salinity treatments was observed with general up-regulation of these genes concomitant with higher salinity. For liver tissue a population specific expression differences was observed with lower expression at simulated non-native compared to native salinities...... in high gene flow marine fishes. © 2013 The Genetics Society of Korea...

  9. Gene expression of a green fluorescent protein homolog as a host-specific biomarker of heat stress within a reef-building coral.

    Science.gov (United States)

    Smith-Keune, C; Dove, S

    2008-01-01

    Recent incidences of mass coral bleaching indicate that major reef building corals are increasingly suffering thermal stress associated with climate-related temperature increases. The development of pulse amplitude modulated (PAM) fluorometry has enabled rapid detection of the onset of thermal stress within coral algal symbionts, but sensitive biomarkers of thermal stress specific to the host coral have been slower to emerge. Differential display reverse transcription polymerase chain reaction (DDRT-PCR) was used to produce fingerprints of gene expression for the reef-building coral Acropora millepora exposed to 33 degrees C. Changes in the expression of 23 out of 399 putative genes occurred within 144 h. Down-regulation of one host-specific gene (AmA1a) occurred within just 6 h. Full-length sequencing revealed the product of this gene to be an all-protein chromatophore (green fluorescent protein [GFP]-homolog). RT-PCR revealed consistent down-regulation of this GFP-homolog for three replicate colonies within 6 h at both 32 degrees C and 33 degrees C but not at lower temperatures. Down-regulation of this host gene preceded significant decreases in the photosynthetic activity of photosystem II (dark-adapted F (v)/F (m)) of algal symbionts as measured by PAM fluorometry. Gene expression of host-specific genes such as GFP-homologs may therefore prove to be highly sensitive indicators for the onset of thermal stress within host coral cells.

  10. Vertebrate host specificity and experimental vectors of Plasmodium (Novyella) kempi sp. n. from the eastern wild turkey in Iowa.

    Science.gov (United States)

    Christensen, B M; Barnes, H J; Rowley, W A

    1983-07-01

    Vertebrate host specificity, experimental laboratory vectors, and a description of Plasmodium (Novyella) kempi sp. n. from eastern wild turkeys (Meleagris gallopavo silvestris Vieillot) in Iowa are presented. Plasmodium kempi is infective for domestic turkeys, bobwhites (Colinus virginianus), chukars (Alectoris graeca), guinea fowl (Numida meleagris), peacocks (Pavo cristatus), and canaries (Serinus canaria), produces a transient infection in mallards (Anas platyrhynchos) and domestic geese (Anser anser), but will not infect ring-necked pheasants (Phasianus colchicus), pigeons (Columba livia), Japanese quail (Coturnix coturnix), leghorn white chickens (Gallus gallus), or starlings (Sturnus vulgaris). Oocysts and (or) sporozoites were recovered from 68% (84/124) and 98% (60/61) of the Culex pipiens pipiens and C. tarsalis examined, respectively. Oocysts developed faster and sporozoites invaded the salivary glands sooner in C. tarsalis (6 days) than in C. p. pipiens (7 days). Culex tarsalis transmitted P. kempi more effectively than C. p. pipiens, although both species were capable of transmitting the parasite by natural feeding. Oocysts developed and sporozoites also were produced in C. restuans, but its ability to transmit the parasite was not determined. Aedes aegypti (Rockefeller strain) and A. triseriatus were refractive to P. kempi. Plasmodium kempi produces trophozoites with large refractile globules and fine cytoplasmic extensions, mature schizonts in the form of a condensed fan containing four to eight nuclei (usually 5), and elongate gametocytes with irregular borders. All stages are confined almost exclusively to mature erythrocytes, with no effect on host cell size or position of host cell nucleus. Plasmodium kempi is most similar morphologically to P. (Novyella) hexamerium and P. (Novyella) vaughani. It differs from P. hexamerium in having large refractile globules in trophozoites and immature schizonts, an inability to infect starlings, an absence of

  11. Specific phosphorylation of histone demethylase KDM3A determines target gene expression in response to heat shock.

    Directory of Open Access Journals (Sweden)

    Mo-bin Cheng

    2014-12-01

    Full Text Available Histone lysine (K residues, which are modified by methyl- and acetyl-transferases, diversely regulate RNA synthesis. Unlike the ubiquitously activating effect of histone K acetylation, the effects of histone K methylation vary with the number of methyl groups added and with the position of these groups in the histone tails. Histone K demethylases (KDMs counteract the activity of methyl-transferases and remove methyl group(s from specific K residues in histones. KDM3A (also known as JHDM2A or JMJD1A is an H3K9me2/1 demethylase. KDM3A performs diverse functions via the regulation of its associated genes, which are involved in spermatogenesis, metabolism, and cell differentiation. However, the mechanism by which the activity of KDM3A is regulated is largely unknown. Here, we demonstrated that mitogen- and stress-activated protein kinase 1 (MSK1 specifically phosphorylates KDM3A at Ser264 (p-KDM3A, which is enriched in the regulatory regions of gene loci in the human genome. p-KDM3A directly interacts with and is recruited by the transcription factor Stat1 to activate p-KDM3A target genes under heat shock conditions. The demethylation of H3K9me2 at the Stat1 binding site specifically depends on the co-expression of p-KDM3A in the heat-shocked cells. In contrast to heat shock, IFN-γ treatment does not phosphorylate KDM3A via MSK1, thereby abrogating its downstream effects. To our knowledge, this is the first evidence that a KDM can be modified via phosphorylation to determine its specific binding to target genes in response to thermal stress.

  12. Comprehensive microarray-based analysis for stage-specific larval camouflage pattern-associated genes in the swallowtail butterfly, Papilio xuthus

    Directory of Open Access Journals (Sweden)

    Futahashi Ryo

    2012-05-01

    Full Text Available Abstract Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern as a young larva, and switches to a green camouflage coloration (cryptic pattern in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes

  13. Multiplex preamplification of specific cDNA targets prior to gene expression analysis by TaqMan Arrays

    Directory of Open Access Journals (Sweden)

    Ribal María

    2008-06-01

    Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.

  14. Phospho switch triggers Brd4 chromatin binding and activator recruitment for gene-specific targeting.

    Science.gov (United States)

    Wu, Shwu-Yuan; Lee, A-Young; Lai, Hsien-Tsung; Zhang, Hong; Chiang, Cheng-Ming

    2013-03-07

    Bromodomain-containing protein 4 (Brd4) is an epigenetic reader and transcriptional regulator recently identified as a cancer therapeutic target for acute myeloid leukemia, multiple myeloma, and Burkitt's lymphoma. Although chromatin targeting is a crucial function of Brd4, there is little understanding of how bromodomains that bind acetylated histones are regulated, nor how the gene-specific activity of Brd4 is determined. Via interaction screen and domain mapping, we identified p53 as a functional partner of Brd4. Interestingly, Brd4 association with p53 is modulated by casein kinase II (CK2)-mediated phosphorylation of a conserved acidic region in Brd4 that selectively contacts either a juxtaposed bromodomain or an adjacent basic region to dictate the ability of Brd4 binding to chromatin and also the recruitment of p53 to regulated promoters. The unmasking of bromodomains and activator recruitment, concurrently triggered by the CK2 phospho switch, provide an intriguing mechanism for gene-specific targeting by a universal epigenetic reader. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Development of Non-Viral, Trophoblast-Specific Gene Delivery for Placental Therapy.

    Directory of Open Access Journals (Sweden)

    Noura Abd Ellah

    Full Text Available Low birth weight is associated with both short term problems and the fetal programming of adult onset diseases, including an increased risk of obesity, diabetes and cardiovascular disease. Placental insufficiency leading to intrauterine growth restriction (IUGR contributes to the prevalence of diseases with developmental origins. Currently there are no therapies for IUGR or placental insufficiency. To address this and move towards development of an in utero therapy, we employ a nanostructure delivery system complexed with the IGF-1 gene to treat the placenta. IGF-1 is a growth factor critical to achieving appropriate placental and fetal growth. Delivery of genes to a model of human trophoblast and mouse placenta was achieved using a diblock copolymer (pHPMA-b-pDMAEMA complexed to hIGF-1 plasmid DNA under the control of trophoblast-specific promoters (Cyp19a or PLAC1. Transfection efficiency of pEGFP-C1-containing nanocarriers in BeWo cells and non-trophoblast cells was visually assessed via fluorescence microscopy. In vivo transfection and functionality was assessed by direct placental-injection into a mouse model of IUGR. Complexes formed using pHPMA-b-pDMAEMA and CYP19a-923 or PLAC1-modified plasmids induce trophoblast-selective transgene expression in vitro, and placental injection of PLAC1-hIGF-1 produces measurable RNA expression and alleviates IUGR in our mouse model, consequently representing innovative building blocks towards human placental gene therapies.

  16. Genetic Approaches to Study Meiosis and Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona; Stuart, David T

    2017-01-01

    The budding yeast Saccharomyces cerevisiae has a long history as a model organism for studies of meiosis and the cell cycle. The popularity of this yeast as a model is in large part due to the variety of genetic and cytological approaches that can be effectively performed with the cells. Cultures of the cells can be induced to synchronously progress through meiosis and sporulation allowing large-scale gene expression and biochemical studies to be performed. Additionally, the spore tetrads resulting from meiosis make it possible to characterize the haploid products of meiosis allowing investigation of meiotic recombination and chromosome segregation. Here we describe genetic methods for analysis progression of S. cerevisiae through meiosis and sporulation with an emphasis on strategies for the genetic analysis of regulators of meiosis-specific genes.

  17. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Science.gov (United States)

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei

    2017-11-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  18. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    Directory of Open Access Journals (Sweden)

    Yushi Yao

    2017-11-01

    Full Text Available Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM, which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  19. Circulating MicroRNAs in Plasma of Hepatitis B e Antigen Positive Children Reveal Liver-Specific Target Genes

    DEFF Research Database (Denmark)

    Winther, Thilde Nordmann; Jacobsen, Kari Stougaard; Mirza, Aashiq Hussain

    2014-01-01

    Background and Aim. Hepatitis B e antigen positive (HBeAg-positive) children are at high risk of severe complications such as hepatocellular carcinoma and cirrhosis. Liver damage is caused by the host immune response to infected hepatocytes, and we hypothesise that specific microRNAs play a role...... in this complex interaction between virus and host. The study aimed to identify microRNAs with aberrant plasma expressions in HBeAg-positive children and with liver-specific target genes. Methods. By revisiting our previous screen of microRNA plasma levels in HBeAg-positive and HBeAg-negative children...... with chronic hepatitis B (CHB) and in healthy controls, candidate microRNAs with aberrant plasma expressions in HBeAg-positive children were identified. MicroRNAs targeting liver-specific genes were selected based on bioinformatics analysis and validated by qRT-PCR using plasma samples from 34 HBe...

  20. Gene-specific DNA methylation association with serum levels of C-reactive protein in African Americans.

    Directory of Open Access Journals (Sweden)

    Yan V Sun

    Full Text Available A more thorough understanding of the differences in DNA methylation (DNAm profiles in populations may hold promise for identifying molecular mechanisms through which genetic and environmental factors jointly contribute to human diseases. Inflammation is a key molecular mechanism underlying several chronic diseases including cardiovascular disease, and it affects DNAm profile on both global and locus-specific levels. To understand the impact of inflammation on the DNAm of the human genome, we investigated DNAm profiles of peripheral blood leukocytes from 966 African American participants in the Genetic Epidemiology Network of Arteriopathy (GENOA study. By testing the association of DNAm sites on CpG islands of over 14,000 genes with C-reactive protein (CRP, an inflammatory biomarker of cardiovascular disease, we identified 257 DNAm sites in 240 genes significantly associated with serum levels of CRP adjusted for age, sex, body mass index and smoking status, and corrected for multiple testing. Of the significantly associated DNAm sites, 80.5% were hypomethylated with higher CRP levels. The most significant Gene Ontology terms enriched in the genes associated with the CRP levels were immune system process, immune response, defense response, response to stimulus, and response to stress, which are all linked to the functions of leukocytes. While the CRP-associated DNAm may be cell-type specific, understanding the DNAm association with CRP in peripheral blood leukocytes of multi-ethnic populations can assist in unveiling the molecular mechanism of how the process of inflammation affects the risks of developing common disease through epigenetic modifications.

  1. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))

    1988-09-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.

  2. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    International Nuclear Information System (INIS)

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.

    1988-01-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression

  3. Characterization of lepidopteran-specific cry1 and cry2 gene harbouring native Bacillus thuringiensis isolates toxic against Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Showkat Ahmad Lone

    2017-09-01

    Full Text Available Bacillus thuringiensis (Bt based biopesticides are feasible alternatives to chemical pesticides. Here, we present the distribution of lepidopteran-specific cry1 and cry2 genes in native B. thuringiensis. Forty four out of 86 colonies were found to harbour crystals by phase contrast microscopy exhibiting a Bt index of 0.51. PCR analysis resulted in the amplification of cry1 in 24 and cry2 in 14 isolates. Twelve of the isolates showed presence of both cry1 and cry2, while 18 isolates did not show presence of either of the genes. Toxicity screening using spore-crystal mixtures against 2nd instar larvae of Helicoverpa armigera revealed that the isolates (50% were either mildly toxic or not toxic (36.36%, and only 13.63% were toxic. The results are interesting, particularly so because the same isolates were previously reported to contain lepidopteran specific vip3A genes also, hence can complement the toxicity of the isolates harbouring vip3A genes.

  4. The use of genetic transformation in the study of ovarian-specific gene expression

    International Nuclear Information System (INIS)

    Manzi, A.; Andone, S.; Rotoli, D.; Capua, M.R.; Gargiulo, G.; Graziani, F.; Malva, C.

    1998-01-01

    We are using genetic and molecular approaches to understand the mechanisms controlling the establishment of the cellular specificity of expression during oogenesis. Female-sterile mutations have been isolated and the molecular analysis is revealing interesting cell-cell interaction systems that work not only during oogenesis but also at other developmental stages. We will review in this paper our most recent studies on genes involved in ovarian development. (author)

  5. XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD

    Directory of Open Access Journals (Sweden)

    Devon Shook

    2017-12-01

    Full Text Available A single-nucleotide polymorphism (SNP of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD. This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.

  6. XKR4 Gene Effects on Cerebellar Development Are Not Specific to ADHD.

    Science.gov (United States)

    Shook, Devon; Brouwer, Rachel; de Zeeuw, Patrick; Oranje, Bob; Durston, Sarah

    2017-01-01

    A single-nucleotide polymorphism (SNP) of the XKR4 gene has been linked to Attention-Deficit/Hyperactivity Disorder (ADHD). This gene is preferentially expressed in cerebellum, a brain structure implicated in this disorder. This study investigated the effects of this SNP on cerebellar development in children with and without ADHD. We collected 279 longitudinal T1-weighted structural images and DNA from 58 children with ADHD and 64 typically developing (TD) children matched for age, IQ, and gender. Groups were divided by the XKR4 rs2939678 SNP into A-allele carriers versus subjects homozygous for the G-allele. Cerebellar lobular volumes were segmented into 35 regions of interest using MAGeTBrain, an automated multi-atlas segmentation pipeline for anatomical MRI, and statistically analyzed using linear mixed models. We found decreased gray matter (GM) volumes in ADHD compared to TD children in bilateral lobules VIIIA, left VIIIB, right VIIB, and vermis VI. Furthermore, we found a linear age by gene interaction in left lobule VIIB where subjects homozygous for the G-allele showed a decrease in volume over time compared to A-allele carriers. We further found quadratic age × gene and age × diagnosis interactions in left lobule IV. Subjects homozygous for the G-allele (the genotype overtransmitted in ADHD) showed more suppressed, almost flat quadratic growth curves compared to A-allele carriers, similar to individuals with ADHD compared to controls. However, there was no interaction between genotype and diagnosis, suggesting that any effects of this SNP on cerebellar development are not specific to the disorder.

  7. Brain region-specific altered expression and association of mitochondria-related genes in autism.

    Science.gov (United States)

    Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Matsuzaki, Hideo; Miyachi, Taishi; Yamada, Satoru; Tsujii, Masatsugu; Tsuchiya, Kenji J; Matsumoto, Kaori; Iwata, Yasuhide; Suzuki, Katsuaki; Ichikawa, Hironobu; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

    2012-11-01

    Mitochondrial dysfunction (MtD) has been observed in approximately five percent of children with autism spectrum disorders (ASD). MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA). Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG), motor cortex (MC) and thalamus (THL)) from autism patients (n=8) and controls (n=10) were obtained from the Autism Tissue Program (Princeton, NJ, USA). Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct) method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2), neurofilament, light polypeptide (NEFL) and solute carrier family 25, member 27 (SLC25A27) showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066) and SLC25A27 (P = 0.046; Z-score 1.990) showed genetic association with autism in Caucasian and Japanese samples, respectively. The expression of DNAJC19, DNM1L, LRPPRC

  8. Brain region-specific altered expression and association of mitochondria-related genes in autism

    Directory of Open Access Journals (Sweden)

    Anitha Ayyappan

    2012-11-01

    Full Text Available Abstract Background Mitochondrial dysfunction (MtD has been observed in approximately five percent of children with autism spectrum disorders (ASD. MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA. Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. Methods For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG, motor cortex (MC and thalamus (THL from autism patients (n=8 and controls (n=10 were obtained from the Autism Tissue Program (Princeton, NJ, USA. Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Results Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2, neurofilament, light polypeptide (NEFL and solute carrier family 25, member 27 (SLC25A27 showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066 and SLC25A27 (P = 0.046; Z-score 1.990 showed genetic association with autism in Caucasian and Japanese samples, respectively. The

  9. Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

    Science.gov (United States)

    Joshee, N; Kisaka, H; Kitagawa, Y

    1998-01-01

    One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

  10. TLR2-dependent inhibition of macrophage responses to IFN-gamma is mediated by distinct, gene-specific mechanisms.

    Directory of Open Access Journals (Sweden)

    Sarah A Benson

    2009-07-01

    Full Text Available Mycobacterium tuberculosis uses multiple mechanisms to avoid elimination by the immune system. We have previously shown that M. tuberculosis can inhibit selected macrophage responses to IFN-gamma through TLR2-dependent and -independent mechanisms. To specifically address the role of TLR2 signaling in mediating this inhibition, we stimulated macrophages with the specific TLR2/1 ligand Pam(3CSK(4 and assayed responses to IFN-gamma. Pam(3CSK(4 stimulation prior to IFN-gamma inhibited transcription of the unrelated IFN-gamma-inducible genes, CIITA and CXCL11. Surface expression of MHC class II and secretion of CXCL11 were greatly reduced as well, indicating that the reduction in transcripts had downstream effects. Inhibition of both genes required new protein synthesis. Using chromatin immunoprecipitation, we found that TLR2 stimulation inhibited IFN-gamma-induced RNA polymerase II binding to the CIITA and CXCL11 promoters. Furthermore, TATA binding protein was unable to bind the TATA box of the CXCL11 promoter, suggesting that assembly of transcriptional machinery was disrupted. However, TLR2 stimulation affected chromatin modifications differently at each of the inhibited promoters. Histone H3 and H4 acetylation was reduced at the CIITA promoter but unaffected at the CXCL11 promoter. In addition, NF-kappaB signaling was required for inhibition of CXCL11 transcription, but not for inhibition of CIITA. Taken together, these results indicate that TLR2-dependent inhibition of IFN-gamma-induced gene expression is mediated by distinct, gene-specific mechanisms that disrupt binding of the transcriptional machinery to the promoters.

  11. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    Science.gov (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  12. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

    2006-03-31

    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  13. Generation of healthy mice from gene-corrected disease-specific induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Guangming Wu

    2011-07-01

    Full Text Available Using the murine model of tyrosinemia type 1 (fumarylacetoacetate hydrolase [FAH] deficiency; FAH⁻/⁻ mice as a paradigm for orphan disorders, such as hereditary metabolic liver diseases, we evaluated fibroblast-derived FAH⁻/⁻-induced pluripotent stem cells (iPS cells as targets for gene correction in combination with the tetraploid embryo complementation method. First, after characterizing the FAH⁻/⁻ iPS cell lines, we aggregated FAH⁻/⁻-iPS cells with tetraploid embryos and obtained entirely FAH⁻/⁻-iPS cell-derived mice that were viable and exhibited the phenotype of the founding FAH⁻/⁻ mice. Then, we transduced FAH cDNA into the FAH⁻/⁻-iPS cells using a third-generation lentiviral vector to generate gene-corrected iPS cells. We could not detect any chromosomal alterations in these cells by high-resolution array CGH analysis, and after their aggregation with tetraploid embryos, we obtained fully iPS cell-derived healthy mice with an astonishing high efficiency for full-term development of up to 63.3%. The gene correction was validated functionally by the long-term survival and expansion of FAH-positive cells of these mice after withdrawal of the rescuing drug NTBC (2-(2-nitro-4-fluoromethylbenzoyl-1,3-cyclohexanedione. Furthermore, our results demonstrate that both a liver-specific promoter (transthyretin, TTR-driven FAH transgene and a strong viral promoter (from spleen focus-forming virus, SFFV-driven FAH transgene rescued the FAH-deficiency phenotypes in the mice derived from the respective gene-corrected iPS cells. In conclusion, our data demonstrate that a lentiviral gene repair strategy does not abrogate the full pluripotent potential of fibroblast-derived iPS cells, and genetic manipulation of iPS cells in combination with tetraploid embryo aggregation provides a practical and rapid approach to evaluate the efficacy of gene correction of human diseases in mouse models.

  14. Impact of child malnutrition on the specific anti-Plasmodium falciparum antibody response

    Directory of Open Access Journals (Sweden)

    Fillol Florie

    2009-06-01

    Full Text Available Abstract Background In sub-Saharan Africa, preschool children represent the population most vulnerable to malaria and malnutrition. It is widely recognized that malnutrition compromises the immune function, resulting in higher risk of infection. However, very few studies have investigated the relationship between malaria, malnutrition and specific immunity. In the present study, the anti-Plasmodium falciparum IgG antibody (Ab response was evaluated in children according to the type of malnutrition. Methods Anthropometric assessment and blood sample collection were carried out during a cross-sectional survey including rural Senegalese preschool children. This cross-sectional survey was conducted in July 2003 at the onset of the rainy season. Malnutrition was defined as stunting (height-for-age P. falciparum whole extracts (schizont antigens was assessed by ELISA in sera of the included children. Results Both the prevalence of anti-malarial immune responders and specific IgG Ab levels were significantly lower in malnourished children than in controls. Depending on the type of malnutrition, wasted children and stunted children presented a lower specific IgG Ab response than their respective controls, but this difference was significant only in stunted children (P = 0.026. This down-regulation of the specific Ab response seemed to be explained by severely stunted children (HAZ ≤ -2.5 compared to their controls (P = 0.03, while no significant difference was observed in mildly stunted children (-2.5 P. falciparum Ab response appeared to be independent of the intensity of infection. Conclusion Child malnutrition, and particularly stunting, may down-regulate the anti-P. falciparum Ab response, both in terms of prevalence of immune responders and specific IgG Ab levels. This study provides further evidence for the influence of malnutrition on the specific anti-malarial immune response and points to the importance of taking into account child

  15. Targeted cytosine deaminase-uracil phosphoribosyl transferase suicide gene therapy induces small cell lung cancer-specific cytotoxicity and tumor growth delay

    DEFF Research Database (Denmark)

    Christensen, Camilla L; Gjetting, Torben; Poulsen, Thomas Tuxen

    2010-01-01

    Small cell lung cancer (SCLC) is a highly malignant cancer for which there is no curable treatment. Novel therapies are therefore in great demand. In the present study we investigated the therapeutic effect of transcriptionally targeted suicide gene therapy for SCLC based on the yeast cytosine...... deaminase (YCD) gene alone or fused with the yeast uracil phosphoribosyl transferase (YUPRT) gene followed by administration of 5-fluorocytosine (5-FC) prodrug. Experimental design: The YCD gene or the YCD-YUPRT gene was placed under regulation of the SCLC-specific promoter insulinoma-associated 1 (INSM1...

  16. Gene co-expression networks in liver and muscle transcriptome reveal sex-specific gene expression in lambs fed with a mix of essential oils

    DEFF Research Database (Denmark)

    Sabino, Marcella; Carmelo, Victor Adriano Okstoft; Mazzoni, Gianluca

    2018-01-01

    the potential of RNA-Sequencing data in order to evaluate the effect of an EO supplementary diet on gene expression in both lamb liver and muscle. Using a treatment and sex interaction model, 13 and 4 differentially expressed genes were identified in liver and muscle respectively. Sex-specific differentially...... on the expression profile of both liver and muscle tissues. We hypothesize that the presence of EOs could have beneficial effects on wellness of male lamb and further analyses are needed to understand the biological mechanisms behind the different effect of EO metabolites based on sex. Using lamb as a model...

  17. Genome-wide identification and tissue-specific expression analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli chickpea).

    Science.gov (United States)

    Sharma, Ranu; Rawat, Vimal; Suresh, C G

    2017-12-01

    The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.

  18. Identification of novel target genes for safer and more specific control of root-knot nematodes from a pan-genome mining.

    Directory of Open Access Journals (Sweden)

    Etienne G J Danchin

    2013-10-01

    Full Text Available Root-knot nematodes are globally the most aggressive and damaging plant-parasitic nematodes. Chemical nematicides have so far constituted the most efficient control measures against these agricultural pests. Because of their toxicity for the environment and danger for human health, these nematicides have now been banned from use. Consequently, new and more specific control means, safe for the environment and human health, are urgently needed to avoid worldwide proliferation of these devastating plant-parasites. Mining the genomes of root-knot nematodes through an evolutionary and comparative genomics approach, we identified and analyzed 15,952 nematode genes conserved in genomes of plant-damaging species but absent from non target genomes of chordates, plants, annelids, insect pollinators and mollusks. Functional annotation of the corresponding proteins revealed a relative abundance of putative transcription factors in this parasite-specific set compared to whole proteomes of root-knot nematodes. This may point to important and specific regulators of genes involved in parasitism. Because these nematodes are known to secrete effector proteins in planta, essential for parasitism, we searched and identified 993 such effector-like proteins absent from non-target species. Aiming at identifying novel targets for the development of future control methods, we biologically tested the effect of inactivation of the corresponding genes through RNA interference. A total of 15 novel effector-like proteins and one putative transcription factor compatible with the design of siRNAs were present as non-redundant genes and had transcriptional support in the model root-knot nematode Meloidogyne incognita. Infestation assays with siRNA-treated M. incognita on tomato plants showed significant and reproducible reduction of the infestation for 12 of the 16 tested genes compared to control nematodes. These 12 novel genes, showing efficient reduction of parasitism when

  19. Utilization of genetic tests: analysis of gene-specific billing in Medicare claims data.

    Science.gov (United States)

    Lynch, Julie A; Berse, Brygida; Dotson, W David; Khoury, Muin J; Coomer, Nicole; Kautter, John

    2017-08-01

    We examined the utilization of precision medicine tests among Medicare beneficiaries through analysis of gene-specific tier 1 and 2 billing codes developed by the American Medical Association in 2012. We conducted a retrospective cross-sectional study. The primary source of data was 2013 Medicare 100% fee-for-service claims. We identified claims billed for each laboratory test, the number of patients tested, expenditures, and the diagnostic codes indicated for testing. We analyzed variations in testing by patient demographics and region of the country. Pharmacogenetic tests were billed most frequently, accounting for 48% of the expenditures for new codes. The most common indications for testing were breast cancer, long-term use of medications, and disorders of lipid metabolism. There was underutilization of guideline-recommended tumor mutation tests (e.g., epidermal growth factor receptor) and substantial overutilization of a test discouraged by guidelines (methylenetetrahydrofolate reductase). Methodology-based tier 2 codes represented 15% of all claims billed with the new codes. The highest rate of testing per beneficiary was in Mississippi and the lowest rate was in Alaska. Gene-specific billing codes significantly improved our ability to conduct population-level research of precision medicine. Analysis of these data in conjunction with clinical records should be conducted to validate findings.Genet Med advance online publication 26 January 2017.

  20. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

    Science.gov (United States)

    Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

    2011-08-01

    The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

  1. Assessing somatic hypermutation in Ramos B cells after overexpression or knockdown of specific genes.

    Science.gov (United States)

    Upton, Dana C; Unniraman, Shyam

    2011-11-01

    B cells start their life with low affinity antibodies generated by V(D)J recombination. However, upon detecting a pathogen, the variable (V) region of an immunoglobulin (Ig) gene is mutated approximately 100,000-fold more than the rest of the genome through somatic hypermutation (SHM), resulting in high affinity antibodies. In addition, class switch recombination (CSR) produces antibodies with different effector functions depending on the kind of immune response that is needed for a particular pathogen. Both CSR and SHM are initiated by activation-induced cytidine deaminase (AID), which deaminates cytosine residues in DNA to produce uracils. These uracils are processed by error-prone forms of repair pathways, eventually leading to mutations and recombination. Our current understanding of the molecular details of SHM and CSR come from a combination of studies in mice, primary cells, cell lines, and cell-free experiments. Mouse models remain the gold standard with genetic knockouts showing critical roles for many repair factors (e.g. Ung, Msh2, Msh6, Exo1, and polymerase η). However, not all genes are amenable for knockout studies. For example, knockouts of several double-strand break repair proteins are embryonically lethal or impair B-cell development. Moreover, sometimes the specific function of a protein in SHM or CSR may be masked by more global defects caused by the knockout. In addition, since experiments in mice can be lengthy, altering expression of individual genes in cell lines has become an increasingly popular first step to identifying and characterizing candidate genes. Ramos - a Burkitt lymphoma cell line that constitutively undergoes SHM - has been a popular cell-line model to study SHM. One advantage of Ramos cells is that they have a built-in convenient semi-quantitative measure of SHM. Wild type cells express IgM and, as they pick up mutations, some of the mutations knock out IgM expression. Therefore, assaying IgM loss by fluorescence

  2. Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

    International Nuclear Information System (INIS)

    Studencki, A.B.; Wallace, R.B.

    1984-01-01

    The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

  3. MO-DE-207B-03: Improved Cancer Classification Using Patient-Specific Biological Pathway Information Via Gene Expression Data

    Energy Technology Data Exchange (ETDEWEB)

    Young, M; Craft, D [Massachusetts General Hospital and Harvard Medical School, Boston, MA (United States)

    2016-06-15

    Purpose: To develop an efficient, pathway-based classification system using network biology statistics to assist in patient-specific response predictions to radiation and drug therapies across multiple cancer types. Methods: We developed PICS (Pathway Informed Classification System), a novel two-step cancer classification algorithm. In PICS, a matrix m of mRNA expression values for a patient cohort is collapsed into a matrix p of biological pathways. The entries of p, which we term pathway scores, are obtained from either principal component analysis (PCA), normal tissue centroid (NTC), or gene expression deviation (GED). The pathway score matrix is clustered using both k-means and hierarchical clustering, and a clustering is judged by how well it groups patients into distinct survival classes. The most effective pathway scoring/clustering combination, per clustering p-value, thus generates various ‘signatures’ for conventional and functional cancer classification. Results: PICS successfully regularized large dimension gene data, separated normal and cancerous tissues, and clustered a large patient cohort spanning six cancer types. Furthermore, PICS clustered patient cohorts into distinct, statistically-significant survival groups. For a suboptimally-debulked ovarian cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00127) showed significant improvement over that of a prior gene expression-classified study (p = .0179). For a pancreatic cancer set, the pathway-classified Kaplan-Meier survival curve (p = .00141) showed significant improvement over that of a prior gene expression-classified study (p = .04). Pathway-based classification confirmed biomarkers for the pyrimidine, WNT-signaling, glycerophosphoglycerol, beta-alanine, and panthothenic acid pathways for ovarian cancer. Despite its robust nature, PICS requires significantly less run time than current pathway scoring methods. Conclusion: This work validates the PICS method to improve

  4. A high-resolution gene expression atlas of epistasis between gene-specific transcription factors exposes potential mechanisms for genetic interactions.

    Science.gov (United States)

    Sameith, Katrin; Amini, Saman; Groot Koerkamp, Marian J A; van Leenen, Dik; Brok, Mariel; Brabers, Nathalie; Lijnzaad, Philip; van Hooff, Sander R; Benschop, Joris J; Lenstra, Tineke L; Apweiler, Eva; van Wageningen, Sake; Snel, Berend; Holstege, Frank C P; Kemmeren, Patrick

    2015-12-23

    Genetic interactions, or non-additive effects between genes, play a crucial role in many cellular processes and disease. Which mechanisms underlie these genetic interactions has hardly been characterized. Understanding the molecular basis of genetic interactions is crucial in deciphering pathway organization and understanding the relationship between genotype, phenotype and disease. To investigate the nature of genetic interactions between gene-specific transcription factors (GSTFs) in Saccharomyces cerevisiae, we systematically analyzed 72 GSTF pairs by gene expression profiling double and single deletion mutants. These pairs were selected through previously published growth-based genetic interactions as well as through similarity in DNA binding properties. The result is a high-resolution atlas of gene expression-based genetic interactions that provides systems-level insight into GSTF epistasis. The atlas confirms known genetic interactions and exposes new ones. Importantly, the data can be used to investigate mechanisms that underlie individual genetic interactions. Two molecular mechanisms are proposed, "buffering by induced dependency" and "alleviation by derepression". These mechanisms indicate how negative genetic interactions can occur between seemingly unrelated parallel pathways and how positive genetic interactions can indirectly expose parallel rather than same-pathway relationships. The focus on GSTFs is important for understanding the transcription regulatory network of yeast as it uncovers details behind many redundancy relationships, some of which are completely new. In addition, the study provides general insight into the complex nature of epistasis and proposes mechanistic models for genetic interactions, the majority of which do not fall into easily recognizable within- or between-pathway relationships.

  5. The life-cycle of Eimeria cernae Levine and Ivens, 1965 in the bank vole, Clethrionomys glareolus.

    Science.gov (United States)

    Lewis, D C; Ball, S J

    1982-12-01

    Eimeria cernae is recorded for the first time in England and the life-cycle is described in experimentally infected bank-voles (Clethrionomys glareolus). The pre-patent period was 6 days and the patent period was 4-6 days. Oocysts were ellipsoidal in shape and measured 20.2 x 15.9 micrometers. Sporocysts, measuring 11.5 micrometers long and 6.8 micrometers wide, possessed a small stieda body and contained a mass of granular sporocyst residuum. The endogenous stages developed in the epithelial cells of the colon and rectum. Three generations of schizonts were found. The 1st-generation schizont seen at 48 h post-infection (p.i.) contained up to 8 merozoites, the 2nd-generation schizont seen at 72 hr p.i. had a mean number of 16 (12-20) merozoites and the 3rd-generation schizont at 96 h p.i. had a mean of 18 (14-21) merozoites. Gamogonic stages were present from 96 to 120 h p.i. in the rectum only.

  6. Dynamic subcellular localization of isoforms of the folate pathway enzyme serine hydroxymethyltransferase (SHMT through the erythrocytic cycle of Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Mitchell Sarah L

    2010-12-01

    Full Text Available Abstract Background The folate pathway enzyme serine hydroxymethyltransferase (SHMT converts serine to glycine and 5,10-methylenetetrahydrofolate and is essential for the acquisition of one-carbon units for subsequent transfer reactions. 5,10-methylenetetrahydrofolate is used by thymidylate synthase to convert dUMP to dTMP for DNA synthesis. In Plasmodium falciparum an enzymatically functional SHMT (PfSHMTc and a related, apparently inactive isoform (PfSHMTm are found, encoded by different genes. Here, patterns of localization of the two isoforms during the parasite erythrocytic cycle are investigated. Methods Polyclonal antibodies were raised to PfSHMTc and PfSHMTm, and, together with specific markers for the mitochondrion and apicoplast, were employed in quantitative confocal fluorescence microscopy of blood-stage parasites. Results As well as the expected cytoplasmic occupancy of PfSHMTc during all stages, localization into the mitochondrion and apicoplast occurred in a stage-specific manner. Although early trophozoites lacked visible organellar PfSHMTc, a significant percentage of parasites showed such fluorescence during the mid-to-late trophozoite and schizont stages. In the case of the mitochondrion, the majority of parasites in these stages at any given time showed no marked PfSHMTc fluorescence, suggesting that its occupancy of this organelle is of limited duration. PfSHMTm showed a distinctly more pronounced mitochondrial location through most of the erythrocytic cycle and GFP-tagging of its N-terminal region confirmed the predicted presence of a mitochondrial signal sequence. Within the apicoplast, a majority of mitotic schizonts showed a marked concentration of PfSHMTc, whose localization in this organelle was less restricted than for the mitochondrion and persisted from the late trophozoite to the post-mitotic stages. PfSHMTm showed a broadly similar distribution across the cycle, but with a distinctive punctate accumulation towards

  7. Specific patterns of gene space organisation revealed in wheat by using the combination of barley and wheat genomic resources

    Directory of Open Access Journals (Sweden)

    Waugh Robbie

    2010-12-01

    Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.

  8. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  9. Evidence for a hierarchical transcriptional circuit in Drosophila male germline involving testis-specific TAF and two gene-specific transcription factors, Mod and Acj6.

    Science.gov (United States)

    Jiang, Mei; Gao, Zhengliang; Wang, Jian; Nurminsky, Dmitry I

    2018-01-01

    To analyze transcription factors involved in gene regulation by testis-specific TAF (tTAF), tTAF-dependent promoters were mapped and analyzed in silico. Core promoters show decreased AT content, paucity of classical promoter motifs, and enrichment with translation control element CAAAATTY. Scanning of putative regulatory regions for known position frequency matrices identified 19 transcription regulators possibly contributing to tTAF-driven gene expression. Decreased male fertility associated with mutation in one of the regulators, Acj6, indicates its involvement in male reproduction. Transcriptome study of testes from male mutants for tTAF, Acj6, and previously characterized tTAF-interacting factor Modulo implies the existence of a regulatory hierarchy of tTAF, Modulo and Acj6, in which Modulo and/or Acj6 regulate one-third of tTAF-dependent genes. © 2017 Federation of European Biochemical Societies.

  10. Loss of lager specific genes and subtelomeric regions define two different Saccharomyces cerevisiae lineages for Saccharomyces pastorianus Group I and II strains.

    Science.gov (United States)

    Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula

    2015-03-01

    Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  11. Overexpression and cosuppression of xylem-related genes in an early xylem differentiation stage-specific manner by the AtTED4 promoter.

    Science.gov (United States)

    Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo

    2018-02-01

    Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Evaluation of endogenous control genes for gene expression studies across multiple tissues and in the specific sets of fat- and muscle-type samples of the pig.

    Science.gov (United States)

    Gu, Y R; Li, M Z; Zhang, K; Chen, L; Jiang, A A; Wang, J Y; Li, X W

    2011-08-01

    To normalize a set of quantitative real-time PCR (q-PCR) data, it is essential to determine an optimal number/set of housekeeping genes, as the abundance of housekeeping genes can vary across tissues or cells during different developmental stages, or even under certain environmental conditions. In this study, of the 20 commonly used endogenous control genes, 13, 18 and 17 genes exhibited credible stability in 56 different tissues, 10 types of adipose tissue and five types of muscle tissue, respectively. Our analysis clearly showed that three optimal housekeeping genes are adequate for an accurate normalization, which correlated well with the theoretical optimal number (r ≥ 0.94). In terms of economical and experimental feasibility, we recommend the use of the three most stable housekeeping genes for calculating the normalization factor. Based on our results, the three most stable housekeeping genes in all analysed samples (TOP2B, HSPCB and YWHAZ) are recommended for accurate normalization of q-PCR data. We also suggest that two different sets of housekeeping genes are appropriate for 10 types of adipose tissue (the HSPCB, ALDOA and GAPDH genes) and five types of muscle tissue (the TOP2B, HSPCB and YWHAZ genes), respectively. Our report will serve as a valuable reference for other studies aimed at measuring tissue-specific mRNA abundance in porcine samples. © 2011 Blackwell Verlag GmbH.

  13. Identification and localization of a soluble antigen, Ag2, of 136 kDa from Plasmodium falciparum in vitro cultures

    DEFF Research Database (Denmark)

    Jakobsen, P H; Grellier, P; Theander, T G

    1991-01-01

    as a duplet with molecular masses of 136 and 120 kDa when tested by immunoblotting. Immunoprecipitation experiments on Triton X-100 extracted antigens from synchronized cultures showed that the antigen was synthesized in the schizont stage. Ag2 was located near the surface of schizonts in the parasitophorous...

  14. Evidence to support horses as natural intermediate hosts for Sarcocystis neurona.

    Science.gov (United States)

    Mullaney, Thomas; Murphy, Alice J; Kiupel, Matti; Bell, Julia A; Rossano, Mary G; Mansfield, Linda S

    2005-10-10

    Opossums (Didelphis spp.) are the definitive host for the protozoan parasite Sarcocystis neurona, the causative agent of equine protozoal myeloencephalitis (EPM). Opossums shed sporocysts in feces that can be ingested by true intermediate hosts (cats, raccoons, skunks, armadillos and sea otters). Horses acquire the parasite by ingestion of feed or water contaminated by opossum feces. However, horses have been classified as aberrant intermediate hosts because the terminal asexual sarcocyst stage that is required for transmission to the definitive host has not been found in their tissues despite extensive efforts to search for them [Dubey, J.P., Lindsay, D.S., Saville, W.J., Reed, S.M., Granstrom, D.E., Speer, C.A., 2001b. A review of Sarcocystis neurona and equine protozoal myeloencephalitis (EPM). Vet. Parasitol. 95, 89-131]. In a 4-month-old filly with neurological disease consistent with EPM, we demonstrate schizonts in the brain and spinal cord and mature sarcocysts in the tongue and skeletal muscle, both with genetic and morphological characteristics of S. neurona. The histological and electron microscopic morphology of the schizonts and sarcocysts were identical to published features of S. neurona [Stanek, J.F., Dubey, J.P., Oglesbee, M.J., Reed, S.M., Lindsay, D.S., Capitini, L.A., Njoku, C.J., Vittitow, K.L., Saville, W.J., 2002. Life cycle of Sarcocystis neurona in its natural intermediate host, the raccoon, Procyon lotor. J. Parasitol. 88, 1151-1158]. DNA from schizonts and sarcocysts from this horse produced Sarcocystis specific 334bp PCR products [Tanhauser, S.M., Yowell, C.A., Cutler, T.J., Greiner, E.C., MacKay, R.J., Dame, J.B., 1999. Multiple DNA markers differentiate Sarcocystis neurona and Sarcocystis falcatula. J. Parasitol. 85, 221-228]. Restriction fragment length polymorphism (RFLP) analysis of these PCR products showed banding patterns characteristic of S. neurona. Sequencing, alignment and comparison of both schizont and sarcocyst DNA

  15. Chicken globin gene transcription is cell lineage specific during the time of the switch

    International Nuclear Information System (INIS)

    Lois, R.; Martinson, H.G.

    1989-01-01

    Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position

  16. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij

    2015-01-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 m.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner....

  17. Acute fatal sarcocystosis hepatitis in an Indo-Pacific bottlenose dolphin (Tursiops aduncus) in Hong Kong.

    Science.gov (United States)

    Calero-Bernal, R; Mauroo, N F; Hui, S W; Kuiken, T; van de Bildt, M W G; de Jong, A W; Osterhaus, A D M E; Sims, L; Gendron-Fitzpatrick, A; Carmena, D; Cerqueira-Cézar, C K; Rosenthal, B M; Dubey, J P

    2017-02-15

    Unlike most species in the genus Sarcocystis, Sarcocystis canis has a broad intermediate host range. Its life cycle is incompletely known and most reports are from the USA. Here we report fatal hepatitis in a 4year old male Indo-Pacific bottlenose dolphin (Tursiops aduncus) from Hong Kong associated with a S. canis-like infection. Diagnosis was made based on clinical presentation, histopathology, transmission electron microscopy (TEM), and molecular characterization. Microscopically, S. canis-like like infection was confined to the liver. Immature and mature schizonts were found in hepatocytes and the parasite was associated with generalized hepatic necrosis. By TEM, schizonts divided by endopolygeny, and merozoites lacked rhoptries. Molecular characterization of parasites present in liver and brain tissues at the cox1 gene showed a high degree of identity (97-98%) and clustered together with Sarcocystis canis, S. lutrae, S. arctica, S. speeri, S. turdusi, and S. rileyi in a phylogenetic study. This is the first report of S. canis-like infection from Asia. Published by Elsevier B.V.

  18. Conservation and Sex-Specific Splicing of the transformer Gene in the Calliphorids Cochliomyia hominivorax, Cochliomyia macellaria and Lucilia sericata

    Science.gov (United States)

    Li, Fang; Vensko, Steven P.; Belikoff, Esther J.; Scott, Maxwell J.

    2013-01-01

    Transformer (TRA) promotes female development in several dipteran species including the Australian sheep blowfly Lucilia cuprina, the Mediterranean fruit fly, housefly and Drosophila melanogaster. tra transcripts are sex-specifically spliced such that only the female form encodes full length functional protein. The presence of six predicted TRA/TRA2 binding sites in the sex-specific female intron of the L. cuprina gene suggested that tra splicing is auto-regulated as in medfly and housefly. With the aim of identifying conserved motifs that may play a role in tra sex-specific splicing, here we have isolated and characterized the tra gene from three additional blowfly species, L. sericata, Cochliomyia hominivorax and C. macellaria. The blowfly adult male and female transcripts differ in the choice of splice donor site in the first intron, with males using a site downstream of the site used in females. The tra genes all contain a single TRA/TRA2 site in the male exon and a cluster of four to five sites in the male intron. However, overall the sex-specific intron sequences are poorly conserved in closely related blowflies. The most conserved regions are around the exon/intron junctions, the 3′ end of the intron and near the cluster of TRA/TRA2 sites. We propose a model for sex specific regulation of tra splicing that incorporates the conserved features identified in this study. In L. sericata embryos, the male tra transcript was first detected at around the time of cellular blastoderm formation. RNAi experiments showed that tra is required for female development in L. sericata and C. macellaria. The isolation of the tra gene from the New World screwworm fly C. hominivorax, a major livestock pest, will facilitate the development of a “male-only” strain for genetic control programs. PMID:23409170

  19. Altered expression of testis-specific genes, piRNAs, and transposons in the silkworm ovary masculinized by a W chromosome mutation

    Science.gov (United States)

    2012-01-01

    Background In the silkworm, Bombyx mori, femaleness is strongly controlled by the female-specific W chromosome. Originally, it was presumed that the W chromosome encodes female-determining gene(s), accordingly called Fem. However, to date, neither Fem nor any protein-coding gene has been identified from the W chromosome. Instead, the W chromosome is occupied with numerous transposon-related sequences. Interestingly, the silkworm W chromosome is a source of female-enriched PIWI-interacting RNAs (piRNAs). piRNAs are small RNAs of 23-30 nucleotides in length, which are required for controlling transposon activity in animal gonads. A recent study has identified a novel mutant silkworm line called KG, whose mutation in the W chromosome causes severe female masculinization. However, the molecular nature of KG line has not been well characterized yet. Results Here we molecularly characterize the KG line. Genomic PCR analyses using currently available W chromosome-specific PCR markers indicated that no large deletion existed in the KG W chromosome. Genetic analyses demonstrated that sib-crosses within the KG line suppressed masculinization. Masculinization reactivated when crossing KG females with wild type males. Importantly, the KG ovaries exhibited a significantly abnormal transcriptome. First, the KG ovaries misexpressed testis-specific genes. Second, a set of female-enriched piRNAs was downregulated in the KG ovaries. Third, several transposons were overexpressed in the KG ovaries. Conclusions Collectively, the mutation in the KG W chromosome causes broadly altered expression of testis-specific genes, piRNAs, and transposons. To our knowledge, this is the first study that describes a W chromosome mutant with such an intriguing phenotype. PMID:22452797

  20. Inhibitory effect of cyanide on wastewater nitrification determined using SOUR and RNA-based gene-specific assays

    Science.gov (United States)

    The effect of CN- (CN-) on nitrification was examined with samples from nitrifying wastewater enrichments using two different approaches: by measuring substrate (ammonia) specific oxygen uptake rates (SOUR), and by using RT-qPCR to quantify the transcripts of functional genes inv...

  1. Phylogeny of Symbiotic Genes and the Symbiotic Properties of Rhizobia Specific to Astragalus glycyphyllos L.

    Science.gov (United States)

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Łotocka, Barbara; Wójcik, Magdalena

    2015-01-01

    The phylogeny of symbiotic genes of Astragalus glycyphyllos L. (liquorice milkvetch) nodule isolates was studied by comparative sequence analysis of nodA, nodC, nodH and nifH loci. In all these genes phylograms, liquorice milkvetch rhizobia (closely related to bacteria of three species, i.e. Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium ciceri) formed one clearly separate cluster suggesting the horizontal transfer of symbiotic genes from a single ancestor to the bacteria being studied. The high sequence similarity of the symbiotic genes of A. glycyphyllos rhizobia (99-100% in the case of nodAC and nifH genes, and 98-99% in the case of nodH one) points to the relatively recent (in evolutionary scale) lateral transfer of these genes. In the nodACH and nifH phylograms, A. glycyphyllos nodule isolates were grouped together with the genus Mesorhizobium species in one monophyletic clade, close to M. ciceri, Mesorhizobium opportunistum and Mesorhizobium australicum symbiovar biserrulae bacteria, which correlates with the close relationship of these rhizobia host plants. Plant tests revealed the narrow host range of A. glycyphyllos rhizobia. They formed effective symbiotic interactions with their native host (A. glycyphyllos) and Amorpha fruticosa but not with 11 other fabacean species. The nodules induced on A. glycyphyllos roots were indeterminate with apical, persistent meristem, an age gradient of nodule tissues and cortical vascular bundles. To reflect the symbiosis-adaptive phenotype of rhizobia, specific for A. glycyphyllos, we propose for these bacteria the new symbiovar "glycyphyllae", based on nodA and nodC genes sequences.

  2. Cloning analysis of HBV-specific CD8 T cell receptor gene in patients with acute hepatitis B

    Directory of Open Access Journals (Sweden)

    Ning DING

    2011-05-01

    Full Text Available Objective To investigate the molecular mechanism of T cell receptor(TCR in CD8 T cell-mediated immune response to HBV in patients with acute hepatitis B(AHB.Methods Peripheral blood mononuclear cells(PBMCs were collected from HLA-A2-positive AHB patients.To determine HBsAg183-191 and HBsAg335-343-specific CD8 T cell frequencies,the PBMCs were stained by fluorescence-labeled anti-CD3,anti-CD8 and pentamers,and analyzed by flow cytometry.PBMCs from 6 patients were stimulated with epitopic peptide HBsAg335-343 in vitro for 3 to 4 weeks.HBV-specific CD8 T cells were isolated by magnetic activated cell sorting followed by flow florescence activated cell sorting.The mRNA of sorted cells was extracted after expanding by IL-2,anti-CD3 and anti-CD8.The full-length gene fragments of variable region of TCR α and β chains were gained by 5’-RACE,and then cloned and sequenced(≥50 clones for single chain of each sample.The gene families of TCR α and β chains were identified and the sequence characters of CDR3 were compared.Results Analysis of more than 600 cloned gene sequences of TCR α and β chains showed that the proliferated HBV-specific CD8 T cells from 6 AHB patients presented a predominant expression in TCR α and chains,with 2-4 α chain families and 1-4 chain families in each case.The α2,α14,α15,β3,β13 and 23 families were detected in more than one case.The chain genes were all 13 for all tested clones in one case.For the same α chain or-chain family,CDR3 sequences tended to be identical in one case but different among cases.Conclusions HBV-specific CD8 T cells with antigenic peptide-induced proliferation present predominance in the usage of TCR α and β chains.This property might be one of the important molecular factors influencing anti-HBV immunity.

  3. Neuronal type-specific gene expression profiling and laser-capture microdissection.

    Science.gov (United States)

    Pietersen, Charmaine Y; Lim, Maribel P; Macey, Laurel; Woo, Tsung-Ung W; Sonntag, Kai C

    2011-01-01

    The human brain is an exceptionally heterogeneous structure. In order to gain insight into the neurobiological basis of neural circuit disturbances in various neurologic or psychiatric diseases, it is often important to define the molecular cascades that are associated with these disturbances in a neuronal type-specific manner. This can be achieved by the use of laser microdissection, in combination with molecular techniques such as gene expression profiling. To identify neurons in human postmortem brain tissue, one can use the inherent properties of the neuron, such as pigmentation and morphology or its structural composition through immunohistochemistry (IHC). Here, we describe the isolation of homogeneous neuronal cells and high-quality RNA from human postmortem brain material using a combination of rapid IHC, Nissl staining, or simple morphology with Laser-Capture Microdissection (LCM) or Laser Microdissection (LMD).

  4. Site-specific protein O-glycosylation modulates proprotein processing - Deciphering specific functions of the large polypeptide GalNAc-transferase gene family

    DEFF Research Database (Denmark)

    Schjoldager, Katrine Ter-Borch Gram; Clausen, Henrik

    2012-01-01

    Posttranslational modifications (PTMs) greatly expand the function and regulation of proteins, and glycosylation is the most abundant and diverse PTM. Of the many different types of protein glycosylation, one is quite unique; GalNAc-type (or mucin-type) O-glycosylation, where biosynthesis...... and considerable redundancy. Recently we have begun to uncover human diseases associated with deficiencies in GalNAc-T genes (GALNTs). Thus deficiencies in individual GALNTs produce cell and protein specific effects and subtle distinct phenotypes such as hyperphosphatemia with hyperostosis (GALNT3...

  5. Preparation of a recombinant adenoviral encoding human NIS gene and its specific expression in cardiomyocytes

    International Nuclear Information System (INIS)

    Wang Lihua; Zhang Miao; Guo Rui; Shi Shuo; Li Biao

    2012-01-01

    Objective: To construct a recombinant adenovirus vector containing the human NIS gene with the myosin light chain-2(MLC-2v) gene as the promoter and evaluate its specific expression and feasibility as a reporter gene in cardiomyocytes. Methods: MLC-2v promoter and NIS were subcloned into an adenovirus shuttle vector, and forwarded by homologous recombination in the bacteria BJ5183 containing AdEasy-1 plasmid. Positive recombinant adenovirus vector was selected, packaged and amplified in the HEK293 cells to obtain recombinant adenovirus Ad-MLC-NIS. Ad-cytomegalovirus (CMV)-NIS with cytomegalovirus as the promoter, Ad-MLC without NIS and Ad-NIS without promoter were constructed as the controls. Cardiomyocytes and non-cardiomyocytes were then infected by the adenovirus. The protein expression was tested by Western blot analysis. The function and features of NIS protein were evaluated by dynamic iodide uptake and NaClO 4 iodine uptake inhibition test in vitro. The viability and proliferation of cardiomyocytes after adenovirus transfection and radioiodine incubation were checked by trypan blue staining. Results: Recombinant NIS adenovirus was successfully constructed. Western blot analysis showed that the NIS protein was highly expressed in cardiomyocytes transfected with Ad-MLC-NIS, and all cells transfected with Ad-CMV-NIS. However, in non-cardiomyocytes transfected with Ad-MLC-NIS, little NIS protein was detected. Dynamic iodine uptake tests showed that the peaks of iodide uptake of the three different cell lines (H9C2, A549, U87 cell) transfected with Ad-MLC-NIS were 5844.0, 833.6 and 846.0 counts · min -1 , respectively. The iodide uptake function of H9C2 was inhibited by NaClO 4 . There was almost no change in cell viability and proliferation when the MOI was 100. Conclusions: Ad-MLC-NIS allows myocardial specific expression of an external gene, and the cardiomyocytes with NIS expression are capable of iodine uptake. Further research of NIS as a reporter gene in

  6. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  7. Combined chromatin and expression analysis reveals specific regulatory mechanisms within cytokine genes in the macrophage early immune response.

    Directory of Open Access Journals (Sweden)

    Maria Jesus Iglesias

    Full Text Available Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS.To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches--gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII, which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF, was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines, was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/-LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40% was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at

  8. Over half of breakpoints in gene pairs involved in cancer-specific recurrent translocations are mapped to human chromosomal fragile sites

    Directory of Open Access Journals (Sweden)

    Pierce Levi CT

    2009-01-01

    Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.

  9. Gene expression profiling, pathway analysis and subtype classification reveal molecular heterogeneity in hepatocellular carcinoma and suggest subtype specific therapeutic targets.

    Science.gov (United States)

    Agarwal, Rahul; Narayan, Jitendra; Bhattacharyya, Amitava; Saraswat, Mayank; Tomar, Anil Kumar

    2017-10-01

    A very low 5-year survival rate among hepatocellular carcinoma (HCC) patients is mainly due to lack of early stage diagnosis, distant metastasis and high risk of postoperative recurrence. Hence ascertaining novel biomarkers for early diagnosis and patient specific therapeutics is crucial and urgent. Here, we have performed a comprehensive analysis of the expression data of 423 HCC patients (373 tumors and 50 controls) downloaded from The Cancer Genome Atlas (TCGA) followed by pathway enrichment by gene ontology annotations, subtype classification and overall survival analysis. The differential gene expression analysis using non-parametric Wilcoxon test revealed a total of 479 up-regulated and 91 down-regulated genes in HCC compared to controls. The list of top differentially expressed genes mainly consists of tumor/cancer associated genes, such as AFP, THBS4, LCN2, GPC3, NUF2, etc. The genes over-expressed in HCC were mainly associated with cell cycle pathways. In total, 59 kinases associated genes were found over-expressed in HCC, including TTK, MELK, BUB1, NEK2, BUB1B, AURKB, PLK1, CDK1, PKMYT1, PBK, etc. Overall four distinct HCC subtypes were predicted using consensus clustering method. Each subtype was unique in terms of gene expression, pathway enrichment and median survival. Conclusively, this study has exposed a number of interesting genes which can be exploited in future as potential markers of HCC, diagnostic as well as prognostic and subtype classification may guide for improved and specific therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Genome sequences of lower Great Lakes Microcystis sp. reveal strain-specific genes that are present and expressed in western Lake Erie blooms.

    Directory of Open Access Journals (Sweden)

    Kevin Anthony Meyer

    Full Text Available Blooms of the potentially toxic cyanobacterium Microcystis are increasing worldwide. In the Laurentian Great Lakes they pose major socioeconomic, ecological, and human health threats, particularly in western Lake Erie. However, the interpretation of "omics" data is constrained by the highly variable genome of Microcystis and the small number of reference genome sequences from strains isolated from the Great Lakes. To address this, we sequenced two Microcystis isolates from Lake Erie (Microcystis aeruginosa LE3 and M. wesenbergii LE013-01 and one from upstream Lake St. Clair (M. cf aeruginosa LSC13-02, and compared these data to the genomes of seventeen Microcystis spp. from across the globe as well as one metagenome and seven metatranscriptomes from a 2014 Lake Erie Microcystis bloom. For the publically available strains analyzed, the core genome is ~1900 genes, representing ~11% of total genes in the pan-genome and ~45% of each strain's genome. The flexible genome content was related to Microcystis subclades defined by phylogenetic analysis of both housekeeping genes and total core genes. To our knowledge this is the first evidence that the flexible genome is linked to the core genome of the Microcystis species complex. The majority of strain-specific genes were present and expressed in bloom communities in Lake Erie. Roughly 8% of these genes from the lower Great Lakes are involved in genome plasticity (rapid gain, loss, or rearrangement of genes and resistance to foreign genetic elements (such as CRISPR-Cas systems. Intriguingly, strain-specific genes from Microcystis cultured from around the world were also present and expressed in the Lake Erie blooms, suggesting that the Microcystis pangenome is truly global. The presence and expression of flexible genes, including strain-specific genes, suggests that strain-level genomic diversity may be important in maintaining Microcystis abundance during bloom events.

  11. Tissue- Specific Expression Analysis of Anthocyanin Biosynthetic Genes in White- and Red-Fleshed Grape Cultivars

    Directory of Open Access Journals (Sweden)

    Sha Xie

    2015-12-01

    Full Text Available Yan73, a teinturier (dyer grape variety in China, is one of the few Vitis vinifera cultivars with red-coloured berry flesh. To examine the tissue-specific expression of genes associated with berry colour in Yan73, we analysed the differential accumulation of anthocyanins in the skin and flesh tissues of two red-skinned grape varieties with either red (Yan73 or white flesh (Muscat Hamburg based on HPLC-MS analysis, as well as the differential expression of 18 anthocyanin biosynthesis genes in both varieties by quantitative RT-PCR. The results revealed that the transcripts of GST, OMT, AM3, CHS3, UFGT, MYBA1, F3′5′H, F3H1 and LDOX were barely detectable in the white flesh of Muscat Hamburg. In particular, GST, OMT, AM3, CHS3 and F3H1 showed approximately 50-fold downregulation in the white flesh of Muscat Hamburg compared to the red flesh of Yan73. A correlation analysis between the accumulation of different types of anthocyanins and gene expression indicated that the cumulative expression of GST, F3′5′H, LDOX and MYBA1 was more closely associated with the acylated anthocyanins and the 3′5′-OH anthocyanins, while OMT and AM3 were more closely associated with the total anthocyanins and methoxylated anthocyanins. Therefore, the transcripts of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 explained most of the variation in the amount and composition of anthocyanins in skin and flesh of Yan73. The data suggest that the specific localization of anthocyanins in the flesh tissue of Yan73 is most likely due to the tissue-specific expression of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 in the flesh.

  12. Expression of nodule-specific genes in alfalfa root nodules blocked at an early stage of development.

    NARCIS (Netherlands)

    Dickstein, R.; Bisseling, T.; Reinhold, V.N.; Ausubel, F.M.

    1988-01-01

    To help dissect the molecular basis of the Rhizobium-legume symbiosis, we used in vitro translation and Northern blot analysis of nodule RNA to examine alfalfa-specific genes (nodulins) expressed in two types of developmentally defective root nodules elicited by Rhizobium meliloti. Fix- nodules were

  13. DNMT1-interacting RNAs block gene specific DNA methylation

    Science.gov (United States)

    Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.

    2013-01-01

    Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992

  14. Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

    Science.gov (United States)

    Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

    2001-12-21

    We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

  15. The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

    Science.gov (United States)

    Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

    2011-01-01

    Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

  16. Cell-cycle-specific interaction of nuclear DNA-binding proteins with a CCAAT sequence from the human thymidine kinase gene

    International Nuclear Information System (INIS)

    Knight, G.B.; Gudas, J.M.; Pardee, A.B.

    1987-01-01

    Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene

  17. Nanoparticle-specific changes in Arabidopsis thaliana gene expression after exposure to ZnO, TiO2, and fullerene soot

    International Nuclear Information System (INIS)

    Landa, Premysl; Vankova, Radomira; Andrlova, Jana; Hodek, Jan; Marsik, Petr; Storchova, Helena; White, Jason C.; Vanek, Tomas

    2012-01-01

    Highlights: ► Exposure to different nanoparticles resulted in specific changes in gene transcription. ► Nano ZnO caused most dramatic changes in Arabidopsis gene expression. ► Nano ZnO was the most toxic and up-regulated most stress-related genes. ► Fullerene soot caused significant gene expression response – mainly stress-related. ► Nano TiO 2 had weak impact on Arabidopsis gene expression indicating minimal toxicity. - Abstract: The effect of exposure to 100 mg/L zinc oxide (nZnO), fullerene soot (FS) or titanium dioxide (nTiO 2 ) nanoparticles on gene expression in Arabidopsis thaliana roots was studied using microarrays. After 7 d, nZnO, FS, or nTiO 2 exposure resulted in 660 up- and 826 down-regulated genes, 232 up- and 189 down-regulated genes, and 80 up- and 74 down-regulated genes, respectively (expression difference > 2-fold; p[t test] 2 exposure, which resulted in up- and down-regulation of genes involved mainly in responses to biotic and abiotic stimuli. The data clearly indicate that the mechanisms of phytotoxicity are highly nanoparticle dependent despite of a limited overlap in gene expression response.

  18. Enhanced combined tumor-specific oncolysis and suicide gene therapy for prostate cancer using M6 promoter.

    Science.gov (United States)

    Ahn, M; Lee, S-J; Li, X; Jiménez, J A; Zhang, Y-P; Bae, K-H; Mohammadi, Y; Kao, C; Gardner, T A

    2009-01-01

    Enzyme pro-drug suicide gene therapy has been hindered by inefficient viral delivery and gene transduction. To further explore the potential of this approach, we have developed AdIU1, a prostate-restricted replicative adenovirus (PRRA) armed with the herpes simplex virus thymidine kinase (HSV-TK). In our previous Ad-OC-TK/ACV phase I clinical trial, we demonstrated safety and proof of principle with a tissue-specific promoter-based TK/pro-drug therapy using a replication-defective adenovirus for the treatment of prostate cancer metastases. In this study, we aimed to inhibit the growth of androgen-independent (AI), PSA/PSMA-positive prostate cancer cells by AdIU1. In vitro the viability of an AI- PSA/PSMA-expressing prostate cancer cell line, CWR22rv, was significantly inhibited by treatment with AdIU1 plus GCV (10 microg ml(-1)), compared with AdIU1 treatment alone and also cytotoxicity was observed following treatment with AdIU1 plus GCV only in PSA/PSMA-positive CWR22rv and C4-2 cells, but not in the PSA/PSMA-negative cell line, DU-145. In vivo assessment of AdIU1 plus GCV treatment revealed a stronger therapeutic effect against CWR22rv tumors in nude mice than treatment with AdIU1 alone, AdE4PSESE1a alone or in combination with GCV. Our results demonstrate the therapeutic potential of specific-oncolysis and suicide gene therapy for AI-PSA/PSMA-positive prostate cancer gene therapy.

  19. Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression

    Directory of Open Access Journals (Sweden)

    Juni eSarkar

    2014-07-01

    Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.

  20. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  1. Sustained expression of a neuron-specific isoform of the Taf1 gene in development stages and aging in mice

    International Nuclear Information System (INIS)

    Jambaldorj, Jamiyansuren; Makino, Satoshi; Munkhbat, Batmunkh; Tamiya, Gen

    2012-01-01

    Highlights: ► We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). ► Taf1 mRNA was expressed in most tissues and cell lines. ► N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. ► Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II–mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.

  2. Transcriptional activation of prostate specific homeobox gene NKX3-1 in subsets of T-cell lymphoblastic leukemia (T-ALL.

    Directory of Open Access Journals (Sweden)

    Stefan Nagel

    Full Text Available Homeobox genes encode transcription factors impacting key developmental processes including embryogenesis, organogenesis, and cell differentiation. Reflecting their tight transcriptional control, homeobox genes are often embedded in large non-coding, cis-regulatory regions, containing tissue specific elements. In T-cell acute lymphoblastic leukemia (T-ALL homeobox genes are frequently deregulated by chromosomal aberrations, notably translocations adding T-cell specific activatory elements. NKX3-1 is a prostate specific homeobox gene activated in T-ALL patients expressing oncogenic TAL1 or displaying immature T-cell characteristics. After investigating regulation of NKX3-1 in primary cells and cell lines, we report its ectopic expression in T-ALL cells independent of chromosomal rearrangements. Using siRNAs and expression profiling, we exploited NKX3-1 positive T-ALL cell lines as tools to investigate aberrant activatory mechanisms. Our data confirmed NKX3-1 activation by TAL1/GATA3/LMO and identified LYL1 as an alternative activator in immature T-ALL cells devoid of GATA3. Moreover, we showed that NKX3-1 is directly activated by early T-cell homeodomain factor MSX2. These activators were regulated by MLL and/or by IL7-, BMP4- and IGF2-signalling. Finally, we demonstrated homeobox gene SIX6 as a direct leukemic target of NKX3-1 in T-ALL. In conclusion, we identified three major mechanisms of NKX3-1 regulation in T-ALL cell lines which are represented by activators TAL1, LYL1 and MSX2, corresponding to particular T-ALL subtypes described in patients. These results may contribute to the understanding of leukemic transcriptional networks underlying disturbed T-cell differentiation in T-ALL.

  3. Sustained expression of a neuron-specific isoform of the Taf1 gene in development stages and aging in mice

    Energy Technology Data Exchange (ETDEWEB)

    Jambaldorj, Jamiyansuren [Department of Pharmacology, Institute of Health Biosciences, Graduate School, The University of Tokushima, Tokushima 770-8503 (Japan); Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan); Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Makino, Satoshi, E-mail: smakino@genetix-h.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Otsu 520-2192 (Japan); Munkhbat, Batmunkh [Central Scientific Research Laboratory, Institute of Medical Sciences, Ulaanbaatar (Mongolia); Tamiya, Gen [Advanced Molecular Epidemiology Research Institute, Yamagata University Faculty of Medicine, Yamagata 990-9585 (Japan)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer We identified the mouse homologue of neuron-specific TAF1 (N-Taf1). Black-Right-Pointing-Pointer Taf1 mRNA was expressed in most tissues and cell lines. Black-Right-Pointing-Pointer N-Taf1 mRNA was expressed in the brain and Neuroblastoma N2a cell lines. Black-Right-Pointing-Pointer Taf1 and N-Taf1 showed different expression profile in development stage and aging. -- Abstract: TATA-box binding protein associated factor 1 (TAF1) protein is the largest and the essential component of the TFIID complex in the pathway of RNA polymerase II-mediated gene transcription, and it regulates transcription of a large number of genes related to cell division. The neuron-specific isoform of the TAF1 gene (N-TAF1), which we reported previously, may have an essential role in neurons through transcriptional regulation of many neuron-specific genes. In the present study, we cloned the full-length cDNA that encodes the mouse homologue of N-TAF1 (N-Taf1) protein. By carrying out of real time RT-PCR, we investigated the expression analysis of the N-Taf1 mRNA in mouse tissues and cell lines. As well as the human N-TAF1, the N-Taf1 showed limited expression in the brain and neuroblastoma, whereas Taf1 expressed elsewhere. Furthermore, in mouse embryo head or mouse brain, mRNA expression of TAF1 changes dramatically during development but N-Taf1 showed sustained expression. Our result suggests that the N-Taf1 gene has an important role in non-dividing neuronal cell rather than in cell division and proliferation during neurogenesis.

  4. A specific endogenous reference for genetically modified common bean (Phaseolus vulgaris L.) DNA quantification by real-time PCR targeting lectin gene.

    Science.gov (United States)

    Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M

    2014-11-01

    The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.

  5. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation-specific genes.

    Science.gov (United States)

    Galperin, Michael Y; Mekhedov, Sergei L; Puigbo, Pere; Smirnov, Sergey; Wolf, Yuri I; Rigden, Daniel J

    2012-11-01

    Three classes of low-G+C Gram-positive bacteria (Firmicutes), Bacilli, Clostridia and Negativicutes, include numerous members that are capable of producing heat-resistant endospores. Spore-forming firmicutes include many environmentally important organisms, such as insect pathogens and cellulose-degrading industrial strains, as well as human pathogens responsible for such diseases as anthrax, botulism, gas gangrene and tetanus. In the best-studied model organism Bacillus subtilis, sporulation involves over 500 genes, many of which are conserved among other bacilli and clostridia. This work aimed to define the genomic requirements for sporulation through an analysis of the presence of sporulation genes in various firmicutes, including those with smaller genomes than B. subtilis. Cultivable spore-formers were found to have genomes larger than 2300 kb and encompass over 2150 protein-coding genes of which 60 are orthologues of genes that are apparently essential for sporulation in B. subtilis. Clostridial spore-formers lack, among others, spoIIB, sda, spoVID and safA genes and have non-orthologous displacements of spoIIQ and spoIVFA, suggesting substantial differences between bacilli and clostridia in the engulfment and spore coat formation steps. Many B. subtilis sporulation genes, particularly those encoding small acid-soluble spore proteins and spore coat proteins, were found only in the family Bacillaceae, or even in a subset of Bacillus spp. Phylogenetic profiles of sporulation genes, compiled in this work, confirm the presence of a common sporulation gene core, but also illuminate the diversity of the sporulation processes within various lineages. These profiles should help further experimental studies of uncharacterized widespread sporulation genes, which would ultimately allow delineation of the minimal set(s) of sporulation-specific genes in Bacilli and Clostridia. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  6. Quantitative analysis of gene-specific DNA damage in human spermatozoa

    International Nuclear Information System (INIS)

    Sawyer, Dennis E.; Mercer, Belinda G.; Wiklendt, Agnieszka M.; Aitken, R. John

    2003-01-01

    Recent studies have suggested that human spermatozoa are highly susceptible to DNA damage induced by oxidative stress. However, a detailed analysis of the precise nature of this damage and the extent to which it affects the mitochondrial and nuclear genomes has not been reported. To induce DNA damage, human spermatozoa were treated in vitro with hydrogen peroxide (H 2 O 2 ; 0-5 mM) or iron (as Fe(II)SO 4 , 0-500 μM). Quantitative PCR (QPCR) was used to measure DNA damage in individual nuclear genes (hprt, β-pol and β-globin) and mitochondrial DNA. Single strand breaks were also assessed by alkaline gel electrophoresis. H 2 O 2 was found to be genotoxic toward spermatozoa at concentrations as high as 1.25 mM, but DNA damage was not detected in these cells with lower concentrations of H 2 O 2 . The mitochondrial genome of human spermatozoa was significantly (P 2 O 2 -induced DNA damage than the nuclear genome. However, both nDNA and mtDNA in human spermatozoa were significantly (P<0.001) more resistant to damage than DNA from a variety of cell lines of germ cell and myoblastoid origin. Interestingly, significant DNA damage was also not detected in human spermatozoa treated with iron. These studies report, for the first time, quantitative measurements of DNA damage in specific genes of male germ cells, and challenge the commonly held belief that human spermatozoa are particularly vulnerable to DNA damage

  7. Global and stage specific patterns of Krüppel-associated-box zinc finger protein gene expression in murine early embryonic cells.

    Directory of Open Access Journals (Sweden)

    Andrea Corsinotti

    Full Text Available Highly coordinated transcription networks orchestrate the self-renewal of pluripotent stem cell and the earliest steps of mammalian development. KRAB-containing zinc finger proteins represent the largest group of transcription factors encoded by the genomes of higher vertebrates including mice and humans. Together with their putatively universal cofactor KAP1, they have been implicated in events as diverse as the silencing of endogenous retroelements, the maintenance of imprinting and the pluripotent self-renewal of embryonic stem cells, although the genomic targets and specific functions of individual members of this gene family remain largely undefined. Here, we first generated a list of Ensembl-annotated KRAB-containing genes encoding the mouse and human genomes. We then defined the transcription levels of these genes in murine early embryonic cells. We found that the majority of KRAB-ZFP genes are expressed in mouse pluripotent stem cells and other early progenitors. However, we also identified distinctively cell- or stage-specific patterns of expression, some of which are pluripotency-restricted. Finally, we determined that individual KRAB-ZFP genes exhibit highly distinctive modes of expression, even when grouped in genomic clusters, and that these cannot be correlated with the presence of prototypic repressive or activating chromatin marks. These results pave the way to delineating the role of specific KRAB-ZFPs in early embryogenesis.

  8. Regulators of Long-Term Memory Revealed by Mushroom Body-Specific Gene Expression Profiling in Drosophila melanogaster.

    Science.gov (United States)

    Widmer, Yves F; Bilican, Adem; Bruggmann, Rémy; Sprecher, Simon G

    2018-06-20

    Memory formation is achieved by genetically tightly controlled molecular pathways that result in a change of synaptic strength and synapse organization. While for short-term memory traces rapidly acting biochemical pathways are in place, the formation of long-lasting memories requires changes in the transcriptional program of a cell. Although many genes involved in learning and memory formation have been identified, little is known about the genetic mechanisms required for changing the transcriptional program during different phases of long-term memory formation. With Drosophila melanogaster as a model system we profiled transcriptomic changes in the mushroom body, a memory center in the fly brain, at distinct time intervals during appetitive olfactory long-term memory formation using the targeted DamID technique. We describe the gene expression profiles during these phases and tested 33 selected candidate genes for deficits in long-term memory formation using RNAi knockdown. We identified 10 genes that enhance or decrease memory when knocked-down in the mushroom body. For vajk-1 and hacd1 , the two strongest hits, we gained further support for their crucial role in appetitive learning and forgetting. These findings show that profiling gene expression changes in specific cell-types harboring memory traces provides a powerful entry point to identify new genes involved in learning and memory. The presented transcriptomic data may further be used as resource to study genes acting at different memory phases. Copyright © 2018, Genetics.

  9. Fear conditioning leads to alteration in specific genes expression in cortical and thalamic neurons that project to the lateral amygdala.

    Science.gov (United States)

    Katz, Ira K; Lamprecht, Raphael

    2015-02-01

    RNA transcription is needed for memory formation. However, the ability to identify genes whose expression is altered by learning is greatly impaired because of methodological difficulties in profiling gene expression in specific neurons involved in memory formation. Here, we report a novel approach to monitor the expression of genes after learning in neurons in specific brain pathways needed for memory formation. In this study, we aimed to monitor gene expression after fear learning. We retrogradely labeled discrete thalamic neurons that project to the lateral amygdala (LA) of rats. The labeled neurons were dissected, using laser microdissection microscopy, after fear conditioning learning or unpaired training. The RNAs from the dissected neurons were subjected to microarray analysis. The levels of selected RNAs detected by the microarray analysis to be altered by fear conditioning were also assessed by nanostring analysis. We observed that the expression of genes involved in the regulation of translation, maturation and degradation of proteins was increased 6 h after fear conditioning compared to unpaired or naïve trained rats. These genes were not expressed 24 h after training or in cortical neurons that project to the LA. The expression of genes involved in transcription regulation and neuronal development was altered after fear conditioning learning in the cortical-LA pathway. The present study provides key information on the identity of genes expressed in discrete thalamic and cortical neurons that project to the LA after fear conditioning. Such an approach could also serve to identify gene products as targets for the development of a new generation of therapeutic agents that could be aimed to functionally identified brain circuits to treat memory-related disorders. © 2014 International Society for Neurochemistry.

  10. Comprehensive search for intra- and inter-specific sequence polymorphisms among coding envelope genes of retroviral origin found in the human genome: genes and pseudogenes

    Directory of Open Access Journals (Sweden)

    Vasilescu Alexandre

    2005-09-01

    Full Text Available Abstract Background The human genome carries a high load of proviral-like sequences, called Human Endogenous Retroviruses (HERVs, which are the genomic traces of ancient infections by active retroviruses. These elements are in most cases defective, but open reading frames can still be found for the retroviral envelope gene, with sixteen such genes identified so far. Several of them are conserved during primate evolution, having possibly been co-opted by their host for a physiological role. Results To characterize further their status, we presently sequenced 12 of these genes from a panel of 91 Caucasian individuals. Genomic analyses reveal strong sequence conservation (only two non synonymous Single Nucleotide Polymorphisms [SNPs] for the two HERV-W and HERV-FRD envelope genes, i.e. for the two genes specifically expressed in the placenta and possibly involved in syncytiotrophoblast formation. We further show – using an ex vivo fusion assay for each allelic form – that none of these SNPs impairs the fusogenic function. The other envelope proteins disclose variable polymorphisms, with the occurrence of a stop codon and/or frameshift for most – but not all – of them. Moreover, the sequence conservation analysis of the orthologous genes that can be found in primates shows that three env genes have been maintained in a fully coding state throughout evolution including envW and envFRD. Conclusion Altogether, the present study strongly suggests that some but not all envelope encoding sequences are bona fide genes. It also provides new tools to elucidate the possible role of endogenous envelope proteins as susceptibility factors in a number of pathologies where HERVs have been suspected to be involved.

  11. Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

    Science.gov (United States)

    Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

    2016-06-21

    To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

  12. TCR Gene Transfer: MAGE-C2/HLA-A2 and MAGE-A3/HLA-DP4 Epitopes as Melanoma-Specific Immune Targets

    Directory of Open Access Journals (Sweden)

    Trudy Straetemans

    2012-01-01

    Full Text Available Adoptive therapy with TCR gene-engineered T cells provides an attractive and feasible treatment option for cancer patients. Further development of TCR gene therapy requires the implementation of T-cell target epitopes that prevent “on-target” reactivity towards healthy tissues and at the same time direct a clinically effective response towards tumor tissues. Candidate epitopes that meet these criteria are MAGE-C2336-344/HLA-A2 (MC2/A2 and MAGE-A3243-258/HLA-DP4 (MA3/DP4. We molecularly characterized TCRαβ genes of an MC2/A2-specific CD8 and MA3/DP4-specific CD4 T-cell clone derived from melanoma patients who responded clinically to MAGE vaccination. We identified MC2/A2 and MA3/DP4-specific TCR-Vα3/Vβ28 and TCR-Vα38/Vβ2 chains and validated these TCRs in vitro upon gene transfer into primary human T cells. The MC2 and MA3 TCR were surface-expressed and mediated CD8 T-cell functions towards melanoma cell lines and CD4 T-cell functions towards dendritic cells, respectively. We intend to start testing these MAGE-specific TCRs in phase I clinical trial.

  13. Misregulation of spermatogenesis genes in Drosophila hybrids is lineage-specific and driven by the combined effects of sterility and fast male regulatory divergence.

    Science.gov (United States)

    Gomes, S; Civetta, A

    2014-09-01

    Hybrid male sterility is a common outcome of crosses between different species. Gene expression studies have found that a number of spermatogenesis genes are differentially expressed in sterile hybrid males, compared with parental species. Late-stage sperm development genes are particularly likely to be misexpressed, with fewer early-stage genes affected. Thus, a link has been posited between misexpression and sterility. A more recent alternative explanation for hybrid gene misexpression has been that it is independent of sterility and driven by divergent evolution of male-specific regulatory elements between species (faster male hypothesis). The faster male hypothesis predicts that misregulation of spermatogenesis genes should be independent of sterility and approximately the same in both hybrids, whereas sterility should only affect gene expression in sterile hybrids. To test the faster male hypothesis vs. the effect of sterility on gene misexpression, we analyse spermatogenesis gene expression in different species pairs of the Drosophila phylogeny, where hybrid male sterility occurs in only one direction of the interspecies cross (i.e. unidirectional sterility). We find significant differences among genes in misexpression with effects that are lineage-specific and caused by sterility or fast male regulatory divergence. © 2014 The Authors. Journal of Evolutionary Biology © 2014 European Society For Evolutionary Biology.

  14. Male Specific Gene Expression in Dioecious Phoenix Dactylifera (Date Palm) Tree at Flowering Stage

    International Nuclear Information System (INIS)

    Al-Ameri, A. A.; Al-Qurainy, F.; Gaafar, A. R. Z.; Khan, S.; Nadeem, M.

    2016-01-01

    Date palm is a long-living and evergreen important tree in the semiarid regions. Its fruit is rich in carbohydrate and fibres. Transcriptional profiling was compared among male and female trees of dioecious date palm at flowering stage. Male specific genes are expressed at flowering stage which was studied using the cDNA-SCoT marker. We developed sequence characterized amplified region (SCAR) markers of size 253 bp from male tree based on cDNA-SCoT fingerprinting. Further, developed SCAR marker was validated on the independently collected samples of both types of trees at flowering stage. The unique and specific band (253 bp) was amplified from male samples only whereas it was absent from female samples. (author)

  15. Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis

    Directory of Open Access Journals (Sweden)

    Jun Ueda

    2017-01-01

    Full Text Available Cellular differentiation is associated with dynamic chromatin remodeling in establishing a cell-type-specific epigenomic landscape. Here, we find that mouse testis-specific and replication-dependent histone H3 variant H3t is essential for very early stages of spermatogenesis. H3t gene deficiency leads to azoospermia because of the loss of haploid germ cells. When differentiating spermatogonia emerge in normal spermatogenesis, H3t appears and replaces the canonical H3 proteins. Structural and biochemical analyses reveal that H3t-containing nucleosomes are more flexible than the canonical nucleosomes. Thus, by incorporating H3t into the genome during spermatogonial differentiation, male germ cells are able to enter meiosis and beyond.

  16. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    Science.gov (United States)

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  17. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith

    2007-12-01

    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  18. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  19. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  20. Age- and stage-dependent variations of muscle-specific gene expression in brown trout Salmo trutta L.

    Science.gov (United States)

    Churova, Maria V; Meshcheryakova, Olga V; Ruchev, Mikhail; Nemova, Nina N

    2017-09-01

    This study was conducted to characterize the features of muscle-specific genes expression during development of brown trout Salmo trutta inhabiting the river Krivoy ruchey (Kola Peninsula, Russia). Gene expression levels of myogenic regulatory factors (MRFs - MyoD1 paralogs (MyoD1a, MyoD1b, MyoD1c), Myf5, myogenin), myostatin paralogs (MSTN-1a, MSTN-1b, MSTN-2a), fast skeletal myosin heavy chain (MyHC) were measured in the white muscles of brown trout parr of ages 0+ (under-yearling), 1+ (yearling) and 2+ (two year old) and smolts of age 2+. Multidirectional changes in MyoD1 and MSTN paralogs expression along with myogenin, Myf 5 and MyHC expression levels in white muscles in parr of trout with age were revealed. The expression of MyoD1c, myogenin, MSTN-2a was the highest in 0+ parr and then decreased. MyoD1a/b expression levels didn't differ between age groups. The simultaneous elevation of MyHC, Myf5, MSTN-1a, and MSTN-1b was found in trout yearlings. In smolts, expression levels of MSTN paralogs, MyHC, Myf5, MyoD1a was lower than in parr. But in contrast, the MyoD1c and myogenin mRNA levels was higher in smolts. The study revealed that there are definite patterns in simultaneous muscle-specific genes expression in age groups of parr and smolts. As MyoD and MSTN paralogs expression changed differently in dependence on age and stage, it was suggested that paralogs of the same gene complementarily control myogenesis during development. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  2. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2012-01-01

    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  3. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  4. The potato-specific apyrase is apoplastically localized and has influence on gene expression, growth, and development.

    Science.gov (United States)

    Riewe, David; Grosman, Lukasz; Fernie, Alisdair R; Wucke, Cornelia; Geigenberger, Peter

    2008-07-01

    Apyrases hydrolyze nucleoside triphosphates and diphosphates and are found in all eukaryotes and a few prokaryotes. Although their enzymatic properties have been well characterized, relatively little is known regarding their subcellular localization and physiological function in plants. In this study, we used reverse genetic and biochemical approaches to investigate the role of potato (Solanum tuberosum)-specific apyrase. Silencing of the apyrase gene family with RNA interference constructs under the control of the constitutive 35S promoter led to a strong decrease in apyrase activity to below 10% of the wild-type level. This decreased activity led to phenotypic changes in the transgenic lines, including a general retardation in growth, an increase in tuber number per plant, and differences in tuber morphology. Silencing of apyrase under the control of a tuber-specific promoter led to similar changes in tuber morphology; however, there were no direct effects of apyrase inhibition on tuber metabolism. DNA microarrays revealed that decreased expression of apyrase leads to increased levels of transcripts coding for cell wall proteins involved in growth and genes involved in energy transfer and starch synthesis. To place these results in context, we determined the subcellular localization of the potato-specific apyrase. Using a combination of approaches, we were able to demonstrate that this enzyme is localized to the apoplast. We describe the evidence that underlies both this fact and that potato-specific apyrase has a crucial role in regulating growth and development.

  5. The Use of Cytochrome b Gene as a Specific Marker of the Rat Meat (Rattus norvegicus on Meat and Meat Products

    Directory of Open Access Journals (Sweden)

    C. Sumantri

    2012-04-01

    Full Text Available Falsification of the origin of livestock meat and its processed with rat meat is a problem that must be overcome to ensure food safety. One way that is often used to detect forgeries by using cytochrome b gene as a marker. The purpose of this study was to create a specific primer derived from cytochrome b sequences in rat (Rattus norvegicus as the DNA marker to detect any contamination of rat meat on fresh livestock meat and its processed meat products. Meatballs were made from beef meat with the addition of rat 1%-25%, and the meatballs were obtained from traditional markets. DNA extraction was conducted from seven species (goat, chicken, cattle, sheep, pig, horse, and rat by using phenol-chloroform. The highest success rate in detecting the presence of rat meat in a mixture of beef meatballs at concentration of 15% was 100%. The specific fragment of cytochrome b gene in R. norvegicus has no similarity with the cytochrome b gene from six other species, so it can be used as molecular markers to detect the presence of rat meat contamination in the processed of meat products. Amplified fragment length for goats, chickens, cattle, sheep, pigs, horses, and rats 157, 227, 274, 331, 398, 439 and 603 bp respectively. The amplification of cytochrome b gene in seven species of animals with different fragment length indicated the specificity of cytochrome b gene sequences among species.

  6. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  7. Receptor-like protein-tyrosine phosphatase alpha specifically inhibits insulin-increased prolactin gene expression

    DEFF Research Database (Denmark)

    Jacob, K K; Sap, J; Stanley, F M

    1998-01-01

    A physiologically relevant response to insulin, stimulation of prolactin promoter activity in GH4 pituitary cells, was used as an assay to study the specificity of protein-tyrosine phosphatase function. Receptor-like protein-tyrosine phosphatase alpha (RPTPalpha) blocks the effect of insulin...... is specific by two criteria. A number of potential RPTPalpha targets were ruled out by finding (a) that they are not affected or (b) that they are not on the pathway to insulin-increased prolactin-CAT activity. The negative effect of RPTPalpha on insulin activation of the prolactin promoter is not due...... to reduced phosphorylation or kinase activity of the insulin receptor or to reduced phosphorylation of insulin receptor substrate-1 or Shc. Inhibitor studies suggest that insulin-increased prolactin gene expression is mediated by a Ras-like GTPase but is not mitogen-activated protein kinase dependent...

  8. Development of unidentified dna-specific hif 1α gene of lizard (hemidactylus platyurus) which plays a role in tissue regeneration process

    Science.gov (United States)

    Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.

    2018-03-01

    Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.

  9. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  10. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease.

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around

  11. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD

  12. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.

    1988-01-01

    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  13. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  14. Identification of a seed coat-specific promoter fragment from the Arabidopsis MUCILAGE-MODIFIED4 gene.

    Science.gov (United States)

    Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W

    2017-09-01

    The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.

  15. Symbiont modulates expression of specific gene categories in Angomonas deanei

    Directory of Open Access Journals (Sweden)

    Luciana Loureiro Penha

    Full Text Available Trypanosomatids are parasites that cause disease in humans, animals, and plants. Most are non-pathogenic and some harbor a symbiotic bacterium. Endosymbiosis is part of the evolutionary process of vital cell functions such as respiration and photosynthesis. Angomonas deanei is an example of a symbiont-containing trypanosomatid. In this paper, we sought to investigate how symbionts influence host cells by characterising and comparing the transcriptomes of the symbiont-containing A. deanei (wild type and the symbiont-free aposymbiotic strains. The comparison revealed that the presence of the symbiont modulates several differentially expressed genes. Empirical analysis of differential gene expression showed that 216 of the 7625 modulated genes were significantly changed. Finally, gene set enrichment analysis revealed that the largest categories of genes that downregulated in the absence of the symbiont were those involved in oxidation-reduction process, ATP hydrolysis coupled proton transport and glycolysis. In contrast, among the upregulated gene categories were those involved in proteolysis, microtubule-based movement, and cellular metabolic process. Our results provide valuable information for dissecting the mechanism of endosymbiosis in A. deanei.

  16. Toward epigenetic and gene regulation models of specific language impairment: looking for links among growth, genes, and impairments

    Directory of Open Access Journals (Sweden)

    Rice Mabel L

    2012-11-01

    Full Text Available Abstract Children with specific language impairment (SLI are thought to have an inherited form of language impairment that spares other developmental domains. SLI shows strong heritability and recent linkage and association studies have replicated results for candidate genes. Regulatory regions of the genes may be involved. Behavioral growth models of language development of children with SLI reveal that the onset of language is delayed, and the growth trajectories of children with SLI parallel those of younger children without SLI. The rate of language acquisition decelerates in the pre-adolescent period, resulting in immature language levels for the children with SLI that persist into adolescence and beyond. Recent genetic and epigenetic discoveries and models relevant to language impairment are reviewed. T cell regulation of onset, acceleration, and deceleration signaling are described as potential conceptual parallels to the growth timing elements of language acquisition and impairment. A growth signaling disruption (GSD hypothesis is proposed for SLI, which posits that faulty timing mechanisms at the cellular level, intrinsic to neurocortical functioning essential for language onset and growth regulation, are at the core of the growth outcomes of SLI. The GSD highlights the need to document and account for growth patterns over childhood and suggests needed directions for future investigation.

  17. Common inversion polymorphism at 17q21.31 affects expression of multiple genes in tissue-specific manner.

    Science.gov (United States)

    de Jong, Simone; Chepelev, Iouri; Janson, Esther; Strengman, Eric; van den Berg, Leonard H; Veldink, Jan H; Ophoff, Roel A

    2012-09-06

    Chromosome 17q21.31 contains a common inversion polymorphism of approximately 900 kb in populations with European ancestry. Two divergent MAPT haplotypes, H1 and H2 are described with distinct linkage disequilibrium patterns across the region reflecting the inversion status at this locus. The MAPT H1 haplotype has been associated with progressive supranuclear palsy, corticobasal degeneration, Parkinson's disease and Alzheimer's disease, while the H2 is linked to recurrent deletion events associated with the 17q21.31 microdeletion syndrome, a disease characterized by developmental delay and learning disability. In this study, we investigate the effect of the inversion on the expression of genes in the 17q21.31 region. We find the expression of several genes in and at the borders of the inversion to be affected; specific either to whole blood or different regions of the human brain. The H1 haplotype was found to be associated with an increased expression of LRRC37A4, PLEKH1M and MAPT. In contrast, a decreased expression of MGC57346, LRRC37A and CRHR1 was associated with H1. Studies thus far have focused on the expression of MAPT in the inversion region. However, our results show that the inversion status affects expression of other genes in the 17q21.31 region as well. Given the link between the inversion status and different neurological diseases, these genes may also be involved in disease pathology, possibly in a tissue-specific manner.

  18. Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

    Science.gov (United States)

    Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

    2014-08-01

    30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

  19. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  20. Site-Specific Gene Editing of Human Hematopoietic Stem Cells for X-Linked Hyper-IgM Syndrome

    Directory of Open Access Journals (Sweden)

    Caroline Y. Kuo

    2018-05-01

    Full Text Available X-linked hyper-immunoglobulin M (hyper-IgM syndrome (XHIM is a primary immunodeficiency due to mutations in CD40 ligand that affect immunoglobulin class-switch recombination and somatic hypermutation. The disease is amenable to gene therapy using retroviral vectors, but dysregulated gene expression results in abnormal lymphoproliferation in mouse models, highlighting the need for alternative strategies. Here, we demonstrate the ability of both the transcription activator-like effector nuclease (TALEN and clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR/Cas9 platforms to efficiently drive integration of a normal copy of the CD40L cDNA delivered by Adeno-Associated Virus. Site-specific insertion of the donor sequence downstream of the endogenous CD40L promoter maintained physiologic expression of CD40L while overriding all reported downstream mutations. High levels of gene modification were achieved in primary human hematopoietic stem cells (HSCs, as well as in cell lines and XHIM-patient-derived T cells. Notably, gene-corrected HSCs engrafted in immunodeficient mice at clinically relevant frequencies. These studies provide the foundation for a permanent curative therapy in XHIM.

  1. Hybrid sterility and evolution in Hawaiian Drosophila: differential gene and allele-specific expression analysis of backcross males.

    Science.gov (United States)

    Brill, E; Kang, L; Michalak, K; Michalak, P; Price, D K

    2016-08-01

    The Hawaiian Drosophila are an iconic example of sequential colonization, adaptive radiation and speciation on islands. Genetic and phenotypic analysis of closely related species pairs that exhibit incomplete reproductive isolation can provide insights into the mechanisms of speciation. Drosophila silvestris from Hawai'i Island and Drosophila planitibia from Maui are two closely related allopatric Hawaiian picture-winged Drosophila that produce sterile F1 males but fertile F1 females, a pattern consistent with Haldane's rule. Backcrossing F1 hybrid females between these two species to parental species gives rise to recombinant males with three distinct sperm phenotypes despite a similar genomic background: motile sperm, no sperm (sterile), and immotile sperm. We found that these three reproductive morphologies of backcross hybrid males produce divergent gene expression profiles in testes, as measured with RNA sequencing. There were a total of 71 genes significantly differentially expressed between backcross males with no sperm compared with those backcross males with motile sperm and immotile sperm, but no significant differential gene expression between backcross males with motile sperm and backcross males with immotile sperm. All of these genes were underexpressed in males with no sperm, including a number of genes with previously known activities in adult testis. An allele-specific expression analysis showed overwhelmingly more cis-divergent than trans-divergent genes, with no significant difference in the ratio of cis- and trans-divergent genes among the sperm phenotypes. Overall, the results indicate that the regulation of gene expression involved in sperm production likely diverged relatively rapidly between these two closely related species.

  2. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  3. Exposure to Hycanthone alters chromatin structure around specific gene functions and specific repeats in Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    David eRoquis

    2014-07-01

    Full Text Available Schistosoma mansoni is a parasitic plathyhelminth responsible for intestinal schistosomiasis (or bilharziasis, a disease affecting 67 million people worldwide and causing an important economic burden. The schistosomicides hycanthone, and its later proxy oxamniquine, were widely used for treatments in endemic areas during the 20th century. Recently, the mechanism of action, as well as the genetic origin of a stably and Mendelian inherited resistance for both drugs was elucidated in two strains. However, several observations suggested early on that alternative mechanisms might exist, by which resistance could be induced for these two drugs in sensitive lines of schistosomes. This induced resistance appeared rapidly, within the first generation, but was metastable (not stably inherited. Epigenetic inheritance could explain such a phenomenon and we therefore re-analyzed the historical data with our current knowledge of epigenetics. In addition, we performed new experiments such as ChIP-seq on hycanthone treated worms. We found distinct chromatin structure changes between sensitive worms and induced resistant worms from the same strain. No specific pathway was discovered, but genes in which chromatin structure modification were observed are mostly associated with transport and catabolism, which makes sense in the context of the elimination of the drug. Specific differences were observed in the repetitive compartment of the genome. We finally describe what types of experiments are needed to understand the complexity of heritability that can be based on genetic and/or epigenetic mechanisms for drug resistance in schistosomes.

  4. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  5. Nuclear factor 1 regulates adipose tissue-specific expression in the mouse GLUT4 gene

    International Nuclear Information System (INIS)

    Miura, Shinji; Tsunoda, Nobuyo; Ikeda, Shinobu; Kai, Yuko; Cooke, David W.; Lane, M. Daniel; Ezaki, Osamu

    2004-01-01

    Previous studies demonstrated that an adipose tissue-specific element(s) (ASE) of the murine GLUT4 gene is located between -551 and -506 in the 5'-flanking sequence and that a high-fat responsive element(s) for down-regulation of the GLUT4 gene is located between bases -701 and -552. A binding site for nuclear factor 1 (NF1), that mediates insulin and cAMP-induced repression of GLUT4 in 3T3-L1 adipocytes is located between bases -700 and -688. To examine the role of NF1 in the regulation of GLUT4 gene expression in white adipose tissues (WAT) in vivo, we created two types of transgenic mice harboring mutated either 5' or 3' half-site of NF1-binding sites in GLUT4 minigene constructs. In both cases, the GLUT4 minigene was not expressed in WAT, while expression was maintained in brown adipose tissue, skeletal muscle, and heart. This was an unexpected finding, since a -551 GLUT4 minigene that did not have the NF1-binding site was expressed in WAT. We propose a model that explains the requirement for both the ASE and the NF1-binding site for expression of GLUT4 in WAT

  6. Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

    Science.gov (United States)

    Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

    2017-07-17

    Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

  7. Sex-specific patterns and deregulation of endocrine pathways in the gene expression profiles of Bangladeshi adults exposed to arsenic contaminated drinking water

    Energy Technology Data Exchange (ETDEWEB)

    Muñoz, Alexandra; Chervona, Yana [New York University School of Medicine, Nelson Institute of Environmental Medicine, Tuxedo, NY (United States); Hall, Megan [Department of Epidemiology, Mailman School of Public Health, Columbia University, New York (United States); Kluz, Thomas [New York University School of Medicine, Nelson Institute of Environmental Medicine, Tuxedo, NY (United States); Gamble, Mary V., E-mail: mvg7@columbia.edu [Department of Environmental Health Sciences, Mailman School of Public Health, Columbia University, New York (United States); Costa, Max, E-mail: Max.Costa@nyumc.org [New York University School of Medicine, Nelson Institute of Environmental Medicine, Tuxedo, NY (United States)

    2015-05-01

    Arsenic contamination of drinking water occurs globally and is associated with numerous diseases including skin, lung and bladder cancers, and cardiovascular disease. Recent research indicates that arsenic may be an endocrine disruptor. This study was conducted to evaluate the nature of gene expression changes among males and females exposed to arsenic contaminated water in Bangladesh at high and low doses. Twenty-nine (55% male) Bangladeshi adults with water arsenic exposure ranging from 50 to 1000 μg/L were selected from the Folic Acid Creatinine Trial. RNA was extracted from peripheral blood mononuclear cells for gene expression profiling using Affymetrix 1.0 ST arrays. Differentially expressed genes were assessed between high and low exposure groups for males and females separately and findings were validated using quantitative real-time PCR. There were 534 and 645 differentially expressed genes (p < 0.05) in the peripheral blood mononuclear cells of males and females, respectively, when high and low water arsenic exposure groups were compared. Only 43 genes overlapped between the two sexes, with 29 changing in opposite directions. Despite the difference in gene sets both males and females exhibited common biological changes including deregulation of 17β-hydroxysteroid dehydrogenase enzymes, deregulation of genes downstream of Sp1 (specificity protein 1) transcription factor, and prediction of estrogen receptor alpha as a key hub in cardiovascular networks. Arsenic-exposed adults exhibit sex-specific gene expression profiles that implicate involvement of the endocrine system. Due to arsenic's possible role as an endocrine disruptor, exposure thresholds for arsenic may require different parameters for males and females. - Highlights: • Males and females exhibit unique gene expression changes in response to arsenic. • Only 23 genes are common among the differentially expressed genes for the sexes. • Male and female gene lists exhibit common

  8. Sex-specific patterns and deregulation of endocrine pathways in the gene expression profiles of Bangladeshi adults exposed to arsenic contaminated drinking water

    International Nuclear Information System (INIS)

    Muñoz, Alexandra; Chervona, Yana; Hall, Megan; Kluz, Thomas; Gamble, Mary V.; Costa, Max

    2015-01-01

    Arsenic contamination of drinking water occurs globally and is associated with numerous diseases including skin, lung and bladder cancers, and cardiovascular disease. Recent research indicates that arsenic may be an endocrine disruptor. This study was conducted to evaluate the nature of gene expression changes among males and females exposed to arsenic contaminated water in Bangladesh at high and low doses. Twenty-nine (55% male) Bangladeshi adults with water arsenic exposure ranging from 50 to 1000 μg/L were selected from the Folic Acid Creatinine Trial. RNA was extracted from peripheral blood mononuclear cells for gene expression profiling using Affymetrix 1.0 ST arrays. Differentially expressed genes were assessed between high and low exposure groups for males and females separately and findings were validated using quantitative real-time PCR. There were 534 and 645 differentially expressed genes (p < 0.05) in the peripheral blood mononuclear cells of males and females, respectively, when high and low water arsenic exposure groups were compared. Only 43 genes overlapped between the two sexes, with 29 changing in opposite directions. Despite the difference in gene sets both males and females exhibited common biological changes including deregulation of 17β-hydroxysteroid dehydrogenase enzymes, deregulation of genes downstream of Sp1 (specificity protein 1) transcription factor, and prediction of estrogen receptor alpha as a key hub in cardiovascular networks. Arsenic-exposed adults exhibit sex-specific gene expression profiles that implicate involvement of the endocrine system. Due to arsenic's possible role as an endocrine disruptor, exposure thresholds for arsenic may require different parameters for males and females. - Highlights: • Males and females exhibit unique gene expression changes in response to arsenic. • Only 23 genes are common among the differentially expressed genes for the sexes. • Male and female gene lists exhibit common

  9. Candidate gene resequencing to identify rare, pedigree-specific variants influencing healthy aging phenotypes in the long life family study

    DEFF Research Database (Denmark)

    Druley, Todd E; Wang, Lihua; Lin, Shiow J

    2016-01-01

    from six pedigrees. OBFC1 (chromosome 10) is involved in telomere maintenance, and falls within a linkage peak recently reported from an analysis of telomere length in LLFS families. Two different algorithms for single gene associations identified three genes with an enrichment of variation......BACKGROUND: The Long Life Family Study (LLFS) is an international study to identify the genetic components of various healthy aging phenotypes. We hypothesized that pedigree-specific rare variants at longevity-associated genes could have a similar functional impact on healthy phenotypes. METHODS......: We performed custom hybridization capture sequencing to identify the functional variants in 464 candidate genes for longevity or the major diseases of aging in 615 pedigrees (4,953 individuals) from the LLFS, using a multiplexed, custom hybridization capture. Variants were analyzed individually...

  10. Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects.

    Science.gov (United States)

    Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le

    2017-06-01

    The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.

  11. Individual Polychlorinated Biphenyl (PCB) Congeners Produce Tissue- and Gene-Specific Effects on Thyroid Hormone Signaling during Development

    Science.gov (United States)

    Giera, Stefanie; Bansal, Ruby; Ortiz-Toro, Theresa M.; Taub, Daniel G.

    2011-01-01

    Polychlorinated biphenyls (PCB) are industrial chemicals linked to developmental deficits that may be caused in part by disrupting thyroid hormone (TH) action by either reducing serum TH or interacting directly with the TH receptor (TR). Individual PCB congeners can activate the TR in vitro when the metabolic enzyme cytochrome P4501A1 (CYP1A1) is induced, suggesting that specific PCB metabolites act as TR agonists. To test this hypothesis in vivo, we compared two combinations of PCB congeners that either activate the TR (PCB 105 and 118) or not (PCB 138 and 153) in the presence or absence of a PCB congener (PCB 126) that induces CYP1A1 in vitro. Aroclor 1254 was used as a positive control, and a group treated with propylthiouracil was included to characterize the effects of low serum TH. We monitored the effects on TH signaling in several peripheral tissues by measuring the mRNA expression of well-known TH-response genes in these tissues. Aroclor 1254 and its component PCB 105/118/126 reduced total T4 to the same extent as that of propylthiouracil but increased the expression of some TH target genes in liver. This effect was strongly correlated with CYP1A1 expression supporting the hypothesis that metabolism is necessary. Effects were gene and tissue specific, indicating that tissue-specific metabolism is an important component of PCB disruption of TH action and that PCB metabolites interact in complex ways with the TR. These are essential mechanisms to consider when evaluating the health risks of contaminant exposures, for both PCB and other polycyclic compounds known to interact with nuclear hormone receptors. PMID:21540284

  12. Gene expression-signature of belinostat in cell lines is specific for histone deacetylase inhibitor treatment, with a corresponding signature in xenografts

    DEFF Research Database (Denmark)

    Monks, A.; Hose, C.D.; Pezzoli, P.

    2009-01-01

    gene modulation were significantly correlated. A belinostat-gene profile was specific for HDACi in three cell lines when compared with equipotent concentrations of four mechanistically different chemotherapeutic agents: 5-fluorouracil, cisplatin, paclitaxel, and thiotepa. Belinostat- and trichostatin...... in a drug-sensitive tumor than a more resistant model. We have demonstrated a gene signature that is selectively regulated by HDACi when compared with other clinical agents allowing us to distinguish HDACi responses from those related to other mechanisms Udgivelsesdato: 2009/9...

  13. Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

    Science.gov (United States)

    Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

    1999-10-01

    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

  14. Assessment of global and gene-specific DNA methylation in rat liver and kidney in response to non-genotoxic carcinogen exposure

    Energy Technology Data Exchange (ETDEWEB)

    Ozden, Sibel, E-mail: stopuz@istanbul.edu.tr [Department of Pharmaceutical Toxicology, Faculty of Pharmacy, Istanbul University, Istanbul (Turkey); Turgut Kara, Neslihan [Department of Molecular Biology and Genetics, Faculty of Science, Istanbul University, Istanbul (Turkey); Sezerman, Osman Ugur [Department of Biostatistics and Medical Informatics, Acibadem University, Istanbul (Turkey); Durasi, İlknur Melis [Biological Sciences and Bioengineering, Faculty of Engineering and Natural Sciences, Sabancı University, Istanbul (Turkey); Chen, Tao [Department of Toxicology, School of Public Health, Soochow University, Suzhou (China); Demirel, Goksun; Alpertunga, Buket [Department of Pharmaceutical Toxicology, Faculty of Pharmacy, Istanbul University, Istanbul (Turkey); Chipman, J. Kevin [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); Mally, Angela [Department of Toxicology, University of Würzburg, Würzburg (Germany)

    2015-12-01

    Altered expression of tumor suppressor genes and oncogenes, which is regulated in part at the level of DNA methylation, is an important event involved in non-genotoxic carcinogenesis. This may serve as a marker for early detection of non-genotoxic carcinogens. Therefore, we evaluated the effects of non-genotoxic hepatocarcinogens, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), hexachlorobenzene (HCB), methapyrilene (MPY) and male rat kidney carcinogens, d-limonene, p-dichlorobenzene (DCB), chloroform and ochratoxin A (OTA) on global and CpG island promoter methylation in their respective target tissues in rats. No significant dose-related effects on global DNA hypomethylation were observed in tissues of rats compared to vehicle controls using LC–MS/MS in response to short-term non-genotoxic carcinogen exposure. Initial experiments investigating gene-specific methylation using methylation-specific PCR and bisulfite sequencing, revealed partial methylation of p16 in the liver of rats treated with HCB and TCDD. However, no treatment related effects on the methylation status of Cx32, e-cadherin, VHL, c-myc, Igfbp2, and p15 were observed. We therefore applied genome-wide DNA methylation analysis using methylated DNA immunoprecipitation combined with microarrays to identify alterations in gene-specific methylation. Under the conditions of our study, some genes were differentially methylated in response to MPY and TCDD, whereas d-limonene, DCB and chloroform did not induce any methylation changes. 90-day OTA treatment revealed enrichment of several categories of genes important in protein kinase activity and mTOR cell signaling process which are related to OTA nephrocarcinogenicity. - Highlights: • Studied non-genotoxic carcinogens caused no change on global DNA hypomethylation. • d-Limonene, DCB and chloroform did not show any genome-wide methylation changes. • Some genes were differentially methylated in response to MPY, TCDD and OTA. • Protein kinase activity

  15. Assessment of global and gene-specific DNA methylation in rat liver and kidney in response to non-genotoxic carcinogen exposure

    International Nuclear Information System (INIS)

    Ozden, Sibel; Turgut Kara, Neslihan; Sezerman, Osman Ugur; Durasi, İlknur Melis; Chen, Tao; Demirel, Goksun; Alpertunga, Buket; Chipman, J. Kevin; Mally, Angela

    2015-01-01

    Altered expression of tumor suppressor genes and oncogenes, which is regulated in part at the level of DNA methylation, is an important event involved in non-genotoxic carcinogenesis. This may serve as a marker for early detection of non-genotoxic carcinogens. Therefore, we evaluated the effects of non-genotoxic hepatocarcinogens, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), hexachlorobenzene (HCB), methapyrilene (MPY) and male rat kidney carcinogens, d-limonene, p-dichlorobenzene (DCB), chloroform and ochratoxin A (OTA) on global and CpG island promoter methylation in their respective target tissues in rats. No significant dose-related effects on global DNA hypomethylation were observed in tissues of rats compared to vehicle controls using LC–MS/MS in response to short-term non-genotoxic carcinogen exposure. Initial experiments investigating gene-specific methylation using methylation-specific PCR and bisulfite sequencing, revealed partial methylation of p16 in the liver of rats treated with HCB and TCDD. However, no treatment related effects on the methylation status of Cx32, e-cadherin, VHL, c-myc, Igfbp2, and p15 were observed. We therefore applied genome-wide DNA methylation analysis using methylated DNA immunoprecipitation combined with microarrays to identify alterations in gene-specific methylation. Under the conditions of our study, some genes were differentially methylated in response to MPY and TCDD, whereas d-limonene, DCB and chloroform did not induce any methylation changes. 90-day OTA treatment revealed enrichment of several categories of genes important in protein kinase activity and mTOR cell signaling process which are related to OTA nephrocarcinogenicity. - Highlights: • Studied non-genotoxic carcinogens caused no change on global DNA hypomethylation. • d-Limonene, DCB and chloroform did not show any genome-wide methylation changes. • Some genes were differentially methylated in response to MPY, TCDD and OTA. • Protein kinase activity

  16. Skeletal muscle gene expression in response to resistance exercise: sex specific regulation

    Directory of Open Access Journals (Sweden)

    Burant Charles F

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms underlying the sex differences in human muscle morphology and function remain to be elucidated. The sex differences in the skeletal muscle transcriptome in both the resting state and following anabolic stimuli, such as resistance exercise (RE, might provide insight to the contributors of sexual dimorphism of muscle phenotypes. We used microarrays to profile the transcriptome of the biceps brachii of young men and women who underwent an acute unilateral RE session following 12 weeks of progressive training. Bilateral muscle biopsies were obtained either at an early (4 h post-exercise or late recovery (24 h post-exercise time point. Muscle transcription profiles were compared in the resting state between men (n = 6 and women (n = 8, and in response to acute RE in trained exercised vs. untrained non-exercised control muscle for each sex and time point separately (4 h post-exercise, n = 3 males, n = 4 females; 24 h post-exercise, n = 3 males, n = 4 females. A logistic regression-based method (LRpath, following Bayesian moderated t-statistic (IMBT, was used to test gene functional groups and biological pathways enriched with differentially expressed genes. Results This investigation identified extensive sex differences present in the muscle transcriptome at baseline and following acute RE. In the resting state, female muscle had a greater transcript abundance of genes involved in fatty acid oxidation and gene transcription/translation processes. After strenuous RE at the same relative intensity, the time course of the transcriptional modulation was sex-dependent. Males experienced prolonged changes while females exhibited a rapid restoration. Most of the biological processes involved in the RE-induced transcriptional regulation were observed in both males and females, but sex specificity was suggested for several signaling pathways including activation of notch signaling and TGF-beta signaling in females

  17. Allele-specific expression in the germline of patients with familial pancreatic cancer: An unbiased approach to cancer gene discovery

    OpenAIRE

    Tan, Aik Choon; Fan, Jian-Bing; Karikari, Collins; Bibikova, Marina; Garcia, Eliza Wickham; Zhou, Lixin; Barker, David; Serre, David; Feldmann, Georg; Hruban, Ralph H.; Klein, Alison P.; Goggins, Michael; Couch, Fergus J.; Hudson, Thomas J.; Winslow, Raimond L.

    2007-01-01

    Physiologic allele-specific expression (ASE) in germline tissues occurs during random X-chromosome inactivation1 and in genomic imprinting,2 wherein the two alleles of a gene in a heterozygous individual are not expressed equally. Recent studies have confirmed the existence of ASE in apparently non-imprinted autosomal genes;3–14 however, the extent of ASE in the human genome is unknown. We explored ASE in lymphoblastoid cell lines of 145 individuals using an oligonucleotide array based assay....

  18. Maternal obesity programs increased leptin gene expression in rat male offspring via epigenetic modifications in a depot-specific manner

    Directory of Open Access Journals (Sweden)

    Simon Lecoutre

    2017-08-01

    Conclusions: Consistent with the DOHaD hypothesis, persistent epigenetic remodeling occurs at regulatory regions especially within intergenic sequences, linked to higher leptin gene expression in adult HF offspring in a depot-specific manner.

  19. Hepatocyte-specific deletion of the keap1 gene activates Nrf2 and confers potent resistance against acute drug toxicity

    International Nuclear Information System (INIS)

    Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki

    2006-01-01

    Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes

  20. Functional interrelationship between TFII-I and E2F transcription factors at specific cell cycle gene loci.

    Science.gov (United States)

    Shen, Yong; Nar, Rukiye; Fan, Alex X; Aryan, Mahmoud; Hossain, Mir A; Gurumurthy, Aishwarya; Wassel, Paul C; Tang, Ming; Lu, Jianrong; Strouboulis, John; Bungert, Jörg

    2018-01-01

    Transcription factor TFII-I is a multifunctional protein implicated in the regulation of cell cycle and stress-response genes. Previous studies have shown that a subset of TFII-I associated genomic sites contained DNA-binding motifs for E2F family transcription factors. We analyzed the co-association of TFII-I and E2Fs in more detail using bioinformatics, chromatin immunoprecipitation, and co-immunoprecipitation experiments. The data show that TFII-I interacts with E2F transcription factors. Furthermore, TFII-I, E2F4, and E2F6 interact with DNA-regulatory elements of several genes implicated in the regulation of the cell cycle, including DNMT1, HDAC1, CDKN1C, and CDC27. Inhibition of TFII-I expression led to a decrease in gene expression and in the association of E2F4 and E2F6 with these gene loci in human erythroleukemia K562 cells. Finally, TFII-I deficiency reduced the proliferation of K562 cells and increased the sensitivity toward doxorubicin toxicity. The results uncover novel interactions between TFII-I and E2Fs and suggest that TFII-I mediates E2F function at specific cell cycle genes. © 2017 Wiley Periodicals, Inc.

  1. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    International Nuclear Information System (INIS)

    Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.

    2010-01-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-γ co-activator-1 (PGC-1α) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  2. Circuit- and Diagnosis-Specific DNA Methylation Changes at γ-Aminobutyric Acid-Related Genes in Postmortem Human Hippocampus in Schizophrenia and Bipolar Disorder.

    Science.gov (United States)

    Ruzicka, W Brad; Subburaju, Sivan; Benes, Francine M

    2015-06-01

    Dysfunction related to γ-aminobutyric acid (GABA)-ergic neurotransmission in the pathophysiology of major psychosis has been well established by the work of multiple groups across several decades, including the widely replicated downregulation of GAD1. Prior gene expression and network analyses within the human hippocampus implicate a broader network of genes, termed the GAD1 regulatory network, in regulation of GAD1 expression. Several genes within this GAD1 regulatory network show diagnosis- and sector-specific expression changes within the circuitry of the hippocampus, influencing abnormal GAD1 expression in schizophrenia and bipolar disorder. To investigate the hypothesis that aberrant DNA methylation contributes to circuit- and diagnosis-specific abnormal expression of GAD1 regulatory network genes in psychotic illness. This epigenetic association study targeting GAD1 regulatory network genes was conducted between July 1, 2012, and June 30, 2014. Postmortem human hippocampus tissue samples were obtained from 8 patients with schizophrenia, 8 patients with bipolar disorder, and 8 healthy control participants matched for age, sex, postmortem interval, and other potential confounds from the Harvard Brain Tissue Resource Center, McLean Hospital, Belmont, Massachusetts. We extracted DNA from laser-microdissected stratum oriens tissue of cornu ammonis 2/3 (CA2/3) and CA1 postmortem human hippocampus, bisulfite modified it, and assessed it with the Infinium HumanMethylation450 BeadChip (Illumina, Inc). The subset of CpG loci associated with GAD1 regulatory network genes was analyzed in R version 3.1.0 software (R Foundation) using the minfi package. Findings were validated using bisulfite pyrosequencing. Methylation levels at 1308 GAD1 regulatory network-associated CpG loci were assessed both as individual sites to identify differentially methylated positions and by sharing information among colocalized probes to identify differentially methylated regions. A total of

  3. MYC through miR-17-92 Suppresses Specific Target Genes to Maintain Survival, Autonomous Proliferation, and a Neoplastic State

    KAUST Repository

    Li, Yulin; Choi, Peter  S.; Casey, Stephanie  C.; Dill, David  L.; Felsher, Dean  W.

    2014-01-01

    The MYC oncogene regulates gene expression through multiple mechanisms, and its overexpression culminates in tumorigenesis. MYC inactivation reverses turmorigenesis through the loss of distinguishing features of cancer, including autonomous proliferation and survival. Here we report that MYC via miR-17-92 maintains a neoplastic state through the suppression of chromatin regulatory genes Sin3b, Hbp1, Suv420h1, and Btg1, as well as the apoptosis regulator Bim. The enforced expression of miR-17-92 prevents MYC suppression from inducing proliferative arrest, senescence, and apoptosis and abrogates sustained tumor regression. Knockdown of the five miR-17-92 target genes blocks senescence and apoptosis while it modestly delays proliferative arrest, thus partially recapitulating miR-17-92 function. We conclude that MYC, via miR-17-92, maintains a neoplastic state by suppressing specific target genes.

  4. MYC through miR-17-92 Suppresses Specific Target Genes to Maintain Survival, Autonomous Proliferation, and a Neoplastic State

    KAUST Repository

    Li, Yulin

    2014-08-01

    The MYC oncogene regulates gene expression through multiple mechanisms, and its overexpression culminates in tumorigenesis. MYC inactivation reverses turmorigenesis through the loss of distinguishing features of cancer, including autonomous proliferation and survival. Here we report that MYC via miR-17-92 maintains a neoplastic state through the suppression of chromatin regulatory genes Sin3b, Hbp1, Suv420h1, and Btg1, as well as the apoptosis regulator Bim. The enforced expression of miR-17-92 prevents MYC suppression from inducing proliferative arrest, senescence, and apoptosis and abrogates sustained tumor regression. Knockdown of the five miR-17-92 target genes blocks senescence and apoptosis while it modestly delays proliferative arrest, thus partially recapitulating miR-17-92 function. We conclude that MYC, via miR-17-92, maintains a neoplastic state by suppressing specific target genes.

  5. Analysis of expression in the Anopheles gambiae developing testes reveals rapidly evolving lineage-specific genes in mosquitoes

    Directory of Open Access Journals (Sweden)

    Krzywinski Jaroslaw

    2009-07-01

    Full Text Available Abstract Background Male mosquitoes do not feed on blood and are not involved in delivery of pathogens to humans. Consequently, they are seldom the subjects of research, which results in a very poor understanding of their biology. To gain insights into male developmental processes we sought to identify genes transcribed exclusively in the reproductive tissues of male Anopheles gambiae pupae. Results Using a cDNA subtraction strategy, five male-specifically or highly male-biased expressed genes were isolated, four of which remain unannotated in the An. gambiae genome. Spatial and temporal expression patterns suggest that each of these genes is involved in the mid-late stages of spermatogenesis. Their sequences are rapidly evolving; however, two genes possess clear homologs in a wide range of taxa and one of these probably acts in a sperm motility control mechanism conserved in many organisms, including humans. The other three genes have no match to sequences from non-mosquito taxa, thus can be regarded as orphans. RNA in situ hybridization demonstrated that one of the orphans is transcribed in spermatids, which suggests its involvement in sperm maturation. Two other orphans have unknown functions. Expression analysis of orthologs of all five genes indicated that male-biased transcription was not conserved in the majority of cases in Aedes and Culex. Conclusion Discovery of testis-expressed orphan genes in mosquitoes opens new prospects for the development of innovative control methods. The orphan encoded proteins may represent unique targets of selective anti-mosquito sterilizing agents that will not affect non-target organisms.

  6. Analysis of expression in the Anopheles gambiae developing testes reveals rapidly evolving lineage-specific genes in mosquitoes.

    Science.gov (United States)

    Krzywinska, Elzbieta; Krzywinski, Jaroslaw

    2009-07-06

    Male mosquitoes do not feed on blood and are not involved in delivery of pathogens to humans. Consequently, they are seldom the subjects of research, which results in a very poor understanding of their biology. To gain insights into male developmental processes we sought to identify genes transcribed exclusively in the reproductive tissues of male Anopheles gambiae pupae. Using a cDNA subtraction strategy, five male-specifically or highly male-biased expressed genes were isolated, four of which remain unannotated in the An. gambiae genome. Spatial and temporal expression patterns suggest that each of these genes is involved in the mid-late stages of spermatogenesis. Their sequences are rapidly evolving; however, two genes possess clear homologs in a wide range of taxa and one of these probably acts in a sperm motility control mechanism conserved in many organisms, including humans. The other three genes have no match to sequences from non-mosquito taxa, thus can be regarded as orphans. RNA in situ hybridization demonstrated that one of the orphans is transcribed in spermatids, which suggests its involvement in sperm maturation. Two other orphans have unknown functions. Expression analysis of orthologs of all five genes indicated that male-biased transcription was not conserved in the majority of cases in Aedes and Culex. Discovery of testis-expressed orphan genes in mosquitoes opens new prospects for the development of innovative control methods. The orphan encoded proteins may represent unique targets of selective anti-mosquito sterilizing agents that will not affect non-target organisms.

  7. Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.)

    Science.gov (United States)

    Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia

    2015-01-01

    Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

  8. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Science.gov (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  9. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

    for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  10. Adoptive Immunotherapy for Hematological Malignancies Using T Cells Gene-Modified to Express Tumor Antigen-Specific Receptors

    Directory of Open Access Journals (Sweden)

    Hiroshi Fujiwara

    2014-12-01

    Full Text Available Accumulating clinical evidence suggests that adoptive T-cell immunotherapy could be a promising option for control of cancer; evident examples include the graft-vs-leukemia effect mediated by donor lymphocyte infusion (DLI and therapeutic infusion of ex vivo-expanded tumor-infiltrating lymphocytes (TIL for melanoma. Currently, along with advances in synthetic immunology, gene-modified T cells retargeted to defined tumor antigens have been introduced as “cellular drugs”. As the functional properties of the adoptive immune response mediated by T lymphocytes are decisively regulated by their T-cell receptors (TCRs, transfer of genes encoding target antigen-specific receptors should enable polyclonal T cells to be uniformly redirected toward cancer cells. Clinically, anticancer adoptive immunotherapy using genetically engineered T cells has an impressive track record. Notable examples include the dramatic benefit of chimeric antigen receptor (CAR gene-modified T cells redirected towards CD19 in patients with B-cell malignancy, and the encouraging results obtained with TCR gene-modified T cells redirected towards NY-ESO-1, a cancer-testis antigen, in patients with advanced melanoma and synovial cell sarcoma. This article overviews the current status of this treatment option, and discusses challenging issues that still restrain the full effectiveness of this strategy, especially in the context of hematological malignancy.

  11. Development of a multiplex assay for genus- and species-specific detection of Phytophthora based on differences in mitochondrial gene order.

    Science.gov (United States)

    Bilodeau, Guillaume J; Martin, Frank N; Coffey, Michael D; Blomquist, Cheryl L

    2014-07-01

    A molecular diagnostic assay for Phytophthora spp. that is specific, sensitive, has both genus- and species-specific detection capabilities multiplexed, and can be used to systematically develop markers for detection of a wide range of species would facilitate research and regulatory efforts. To address this need, a marker system was developed based on the high copy sequences of the mitochondrial DNA utilizing gene orders that were highly conserved in the genus Phytophthora but different in the related genus Pythium and plants to reduce the importance of highly controlled annealing temperatures for specificity. An amplification primer pair designed from conserved regions of the atp9 and nad9 genes produced an amplicon of ≈340 bp specific for the Phytophthora spp. tested. The TaqMan probe for the genus-specific Phytophthora test was designed from a conserved portion of the atp9 gene whereas variable intergenic spacer sequences were used for designing the species-specific TaqMan probes. Specific probes were developed for 13 species and the P. citricola species complex. In silico analysis suggests that species-specific probes could be developed for at least 70 additional described and provisional species; the use of locked nucleic acids in TaqMan probes should expand this list. A second locus spanning three tRNAs (trnM-trnP-trnM) was also evaluated for genus-specific detection capabilities. At 206 bp, it was not as useful for systematic development of a broad range of species-specific probes as the larger 340-bp amplicon. All markers were validated against a test panel that included 87 Phytophthora spp., 14 provisional Phytophthora spp., 29 Pythium spp., 1 Phytopythium sp., and 39 plant species. Species-specific probes were validated further against a range of geographically diverse isolates to ensure uniformity of detection at an intraspecific level, as well as with other species having high levels of sequence similarity to ensure specificity. Both diagnostic

  12. Upregulation of meiosis-specific genes in lymphoma cell lines following genotoxic insult and induction of mitotic catastrophe

    International Nuclear Information System (INIS)

    Kalejs, Martins; Ivanov, Andrey; Plakhins, Gregory; Cragg, Mark S; Emzinsh, Dzintars; Illidge, Timothy M; Erenpreisa, Jekaterina

    2006-01-01

    We have previously reported that p53 mutated radioresistant lymphoma cell lines undergo mitotic catastrophe after irradiation, resulting in metaphase arrest and the generation of endopolyploid cells. A proportion of these endopolyploid cells then undergo a process of de-polyploidisation, stages of which are partially reminiscent of meiotic prophase. Furthermore, expression of meiosis-specific proteins of the cancer/testis antigens group of genes has previously been reported in tumours. We therefore investigated whether expression of meiosis-specific genes was associated with the polyploidy response in our tumour model. Three lymphoma cell lines, Namalwa, WI-L2-NS and TK6, of varying p53 status were exposed to a single 10 Gy dose of gamma radiation and their responses assessed over an extended time course. DNA flow cytometry and mitotic counts were used to assess the kinetics and extent of polyploidisation and mitotic progression. Expression of meiotic genes was analysed using RT-PCR and western blotting. In addition, localisation of the meiotic cohesin REC8 and its relation to centromeres was analysed by immunofluorescence. The principal meiotic regulator MOS was found to be significantly post-transcriptionally up-regulated after irradiation in p53 mutated but not p53 wild-type lymphoma cells. The maximum expression of MOS coincided with the maximal fraction of metaphase arrested cells and was directly proportional to both the extent of the arrest and the number of endopolyploid cells that subsequently emerged. The meiotic cohesin REC8 was also found to be up-regulated after irradiation, linking sister chromatid centromeres in the metaphase-arrested and subsequent giant cells. Finally, RT-PCR revealed expression of the meiosis-prophase genes, DMC1, STAG3, SYCP3 and SYCP1. We conclude that multiple meiotic genes are aberrantly activated during mitotic catastrophe in p53 mutated lymphoma cells after irradiation. Furthermore, we suggest that the coordinated expression

  13. Recruitment of Mediator Complex by Cell Type and Stage-Specific Factors Required for Tissue-Specific TAF Dependent Gene Activation in an Adult Stem Cell Lineage.

    Science.gov (United States)

    Lu, Chenggang; Fuller, Margaret T

    2015-12-01

    Onset of terminal differentiation in adult stem cell lineages is commonly marked by robust activation of new transcriptional programs required to make the appropriate differentiated cell type(s). In the Drosophila male germ line stem cell lineage, the switch from proliferating spermatogonia to spermatocyte is accompanied by one of the most dramatic transcriptional changes in the fly, as over 1000 new transcripts turn on in preparation for meiosis and spermatid differentiation. Here we show that function of the coactivator complex Mediator is required for activation of hundreds of new transcripts in the spermatocyte program. Mediator appears to act in a sequential hierarchy, with the testis activating Complex (tMAC), a cell type specific form of the Mip/dREAM general repressor, required to recruit Mediator subunits to the chromatin, and Mediator function required to recruit the testis TAFs (tTAFs), spermatocyte specific homologs of subunits of TFIID. Mediator, tMAC and the tTAFs co-regulate expression of a major set of spermatid differentiation genes. The Mediator subunit Med22 binds the tMAC component Topi when the two are coexpressed in S2 cells, suggesting direct recruitment. Loss of Med22 function in spermatocytes causes meiosis I maturation arrest male infertility, similar to loss of function of the tMAC subunits or the tTAFs. Our results illuminate how cell type specific versions of the Mip/dREAM complex and the general transcription machinery cooperate to drive selective gene activation during differentiation in stem cell lineages.

  14. Identification of Gene-Specific Polymorphisms and Association with Capsaicin Pathway Metabolites in Capsicum annuum L. Collections

    Science.gov (United States)

    Abburi, Venkata L.; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil

    2014-01-01

    Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1. PMID:24475113

  15. Tissue Specific Promoters in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    A. R. Rama

    2015-01-01

    Full Text Available Colorectal carcinoma is the third most prevalent cancer in the world. In the most advanced stages, the use of chemotherapy induces a poor response and is usually accompanied by other tissue damage. Significant progress based on suicide gene therapy has demonstrated that it may potentiate the classical cytotoxic effects in colorectal cancer. The inconvenience still rests with the targeting and the specificity efficiency. The main target of gene therapy is to achieve an effective vehicle to hand over therapeutic genes safely into specific cells. One possibility is the use of tumor-specific promoters overexpressed in cancers. They could induce a specific expression of therapeutic genes in a given tumor, increasing their localized activity. Several promoters have been assayed into direct suicide genes to cancer cells. This review discusses the current status of specific tumor-promoters and their great potential in colorectal carcinoma treatment.

  16. A new gene in A. rubens: A sea star Ig kappa gene.

    Science.gov (United States)

    Vincent, Nadine; Osteras, Magne; Otten, Patricia; Leclerc, Michel

    2014-12-01

    The sea star Asterias rubens reacts specifically to the antigen:HRP (horse-radish peroxydase) and produces an antibody anti-HRP. We previously identified a candidate Ig kappa gene corresponding to this manuscript. We show now the gene referred to as: "sea star Ig kappa gene in its specificity".

  17. Acute Sleep Loss Induces Tissue-Specific Epigenetic and Transcriptional Alterations to Circadian Clock Genes in Men.

    Science.gov (United States)

    Cedernaes, Jonathan; Osler, Megan E; Voisin, Sarah; Broman, Jan-Erik; Vogel, Heike; Dickson, Suzanne L; Zierath, Juleen R; Schiöth, Helgi B; Benedict, Christian

    2015-09-01

    Shift workers are at increased risk of metabolic morbidities. Clock genes are known to regulate metabolic processes in peripheral tissues, eg, glucose oxidation. This study aimed to investigate how clock genes are affected at the epigenetic and transcriptional level in peripheral human tissues following acute total sleep deprivation (TSD), mimicking shift work with extended wakefulness. In a randomized, two-period, two-condition, crossover clinical study, 15 healthy men underwent two experimental sessions: x sleep (2230-0700 h) and overnight wakefulness. On the subsequent morning, serum cortisol was measured, followed by skeletal muscle and subcutaneous adipose tissue biopsies for DNA methylation and gene expression analyses of core clock genes (BMAL1, CLOCK, CRY1, PER1). Finally, baseline and 2-h post-oral glucose load plasma glucose concentrations were determined. In adipose tissue, acute sleep deprivation vs sleep increased methylation in the promoter of CRY1 (+4%; P = .026) and in two promoter-interacting enhancer regions of PER1 (+15%; P = .036; +9%; P = .026). In skeletal muscle, TSD vs sleep decreased gene expression of BMAL1 (-18%; P = .033) and CRY1 (-22%; P = .047). Concentrations of serum cortisol, which can reset peripheral tissue clocks, were decreased (2449 ± 932 vs 3178 ± 723 nmol/L; P = .039), whereas postprandial plasma glucose concentrations were elevated after TSD (7.77 ± 1.63 vs 6.59 ± 1.32 mmol/L; P = .011). Our findings demonstrate that a single night of wakefulness can alter the epigenetic and transcriptional profile of core circadian clock genes in key metabolic tissues. Tissue-specific clock alterations could explain why shift work may disrupt metabolic integrity as observed herein.

  18. Functional heterogeneity of cancer-associated fibroblasts from human colon tumors shows specific prognostic gene expression signature.

    Science.gov (United States)

    Herrera, Mercedes; Islam, Abul B M M K; Herrera, Alberto; Martín, Paloma; García, Vanesa; Silva, Javier; Garcia, Jose M; Salas, Clara; Casal, Ignacio; de Herreros, Antonio García; Bonilla, Félix; Peña, Cristina

    2013-11-01

    Cancer-associated fibroblasts (CAF) actively participate in reciprocal communication with tumor cells and with other cell types in the microenvironment, contributing to a tumor-permissive neighborhood and promoting tumor progression. The aim of this study is the characterization of how CAFs from primary human colon tumors promote migration of colon cancer cells. Primary CAF cultures from 15 primary human colon tumors were established. Their enrichment in CAFs was evaluated by the expression of various epithelial and myofibroblast specific markers. Coculture assays of primary CAFs with different colon tumor cells were performed to evaluate promigratory CAF-derived effects on cancer cells. Gene expression profiles were developed to further investigate CAF characteristics. Coculture assays showed significant differences in fibroblast-derived paracrine promigratory effects on cancer cells. Moreover, the association between CAFs' promigratory effects on cancer cells and classic fibroblast activation or stemness markers was observed. CAF gene expression profiles were analyzed by microarray to identify deregulated genes in different promigratory CAFs. The gene expression signature, derived from the most protumorogenic CAFs, was identified. Interestingly, this "CAF signature" showed a remarkable prognostic value for the clinical outcome of patients with colon cancer. Moreover, this prognostic value was validated in an independent series of 142 patients with colon cancer, by quantitative real-time PCR (qRT-PCR), with a set of four genes included in the "CAF signature." In summary, these studies show for the first time the heterogeneity of primary CAFs' effect on colon cancer cell migration. A CAF gene expression signature able to classify patients with colon cancer into high- and low-risk groups was identified.

  19. Gene-Specific-Candidate-Driven Study to decipher Genetic Predisposition to Rotavirus Infection

    Directory of Open Access Journals (Sweden)

    Kshitija Rane-Yadav

    2017-10-01

    Full Text Available Recent report of WHO shows 113000 children in India succumb to death due to Rotavirus diarrhea. Lack of knowledge about pathogenesis of virus has led to lack of therapy for severely infected patients. Previous studies have found that, animal rotavirus requires sialyl glycan moieties on cell surface for pathogenesis. Present study states that human rotaviruses also follows same path and this specificity of virus leads to host genetic predisposition for the infection as well as the disease. Two hundred children less than 5 years of age clinically suspected of viral diarrhea were screened for rotavirus infection. EDTA blood was processed for analyzing DNA sequences of various fucosyltransferase genes. Lewis antigens which are secretory form of ABO Histo Blood Group Antigens were correlated with the genotype of patient. Genetics of HBGA secretion, particularly, basis of Leb expression manifested by fucosyltransferase-2 enzyme was studied in healthy individuals and was compared in cases of rotavirus positive and negative diarrhea. Positive clinical isolates with various genotypes were purified from stool samples and gene for VP4 - surface spike protein was sequenced. Using Bioinformatics interphase, three dimensional protein structures were modeled and their functional domains were analyzed. All these modeled proteins were docked with Leb HBGA (Lewis-b Histo Blood Group Antigens using molecular docking software. In present study, to investigate possible association of the rotavirus with host genome, we screened highly suspected genes involved in expression of glycoproteins on enterocytes. This study performed for prevalent Indian strains of rotaviruses provides possible evidence that, VP8 domain of VP4 spike protein utilizes Leb surface antigen for attachment and entry to enterocytes in the intestine. The FUT2 and FUT3 gene has been found to show significant association with the rotavirus infection hence can serve as a biomarker for genetic

  20. Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

    Directory of Open Access Journals (Sweden)

    Sirjana Devi Shrestha

    Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

  1. Cumulus-specific genes are transcriptionally silent following somatic cell nuclear transfer in a mouse model*

    OpenAIRE

    Tong, Guo-qing; Heng, Boon-chin; Ng, Soon-chye

    2007-01-01

    This study investigated whether four cumulus-specific genes: follicular stimulating hormone receptor (FSHr), hyaluronan synthase 2 (Has2), prostaglandin synthase 2 (Ptgs2) and steroidogenic acute regulator protein (Star), were correctly reprogrammed to be transcriptionally silent following somatic cell nuclear transfer (SCNT) in a murine model. Cumulus cells of C57×CBA F1 female mouse were injected into enucleated oocytes, followed by activation in 10 µmol/L strontium chloride for 5 h and sub...

  2. Genes and gene expression: Localization, damage and control -- A multilevel and inter-disciplinary study

    International Nuclear Information System (INIS)

    Ts'o, P.O.P.

    1990-09-01

    All projects are working toward a goal for describing the three dimensional nuclear topography in terms of relative spatial relationships among genes (specific DNA sequence). Methods are now being perfected to detect these genes, quantitatively and spatially, to perturb these genes specifically, and to measure the perturbation in order to assure specificity. We are developing methods to assay, after perturbation of the target DNA within living cells, whether or not only the target sequence are attacked while other sequences remain unharmed. We are now at the stage to do chemical gene modification or masking within living cells in a strictly sequence-specific manner. Soon, we will be able to study the function and the physical location of each gene in living cells with exquisite specificity. 25 refs., 15 figs

  3. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  4. Human-Specific Endogenous Retroviruses

    Directory of Open Access Journals (Sweden)

    Anton Buzdin

    2007-01-01

    Full Text Available This review focuses on a small family of human-specific genomic repetitive elements, presented by 134 members that shaped ~330 kb of the human DNA. Although modest in terms of its copy number, this group appeared to modify the human genome activity by endogenizing ~50 functional copies of viral genes that may have important implications in the immune response, cancer progression, and antiretroviral host defense. A total of 134 potential promoters and enhancers have been added to the human DNA, about 50% of them in the close gene vicinity and 22% in gene introns. For 60 such human-specific promoters, their activity was confirmed by in vivo assays, with the transcriptional level varying ~1000-fold from hardly detectable to as high as ~3% of β-actin transcript level. New polyadenylation signals have been provided to four human RNAs, and a number of potential antisense regulators of known human genes appeared due to human-specific retroviral insertional activity. This information is given here in the context of other major genomic changes underlining differences between human and chimpanzee DNAs. Finally, a comprehensive database, is available for download, of human-specific and polymorphic endogenous retroviruses is presented, which encompasses the data on their genomic localization, primary structure, encoded viral genes, human gene neighborhood, transcriptional activity, and methylation status.

  5. Comparison of CpG island methylator phenotype (CIMP) frequency in colon cancer using different probe- and gene-specific scoring alternatives on recommended multi-gene panels.

    Science.gov (United States)

    Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil

    2014-01-01

    In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; pCIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.

  6. Exogenous Methyl Jasmonate and Salicylic Acid Induce Subspecies-Specific Patterns of Glucosinolate Accumulation and Gene Expression in Brassica oleracea L.

    Science.gov (United States)

    Yi, Go-Eun; Robin, Arif Hasan Khan; Yang, Kiwoung; Park, Jong-In; Hwang, Byung Ho; Nou, Ill-Sup

    2016-10-24

    Glucosinolates have anti-carcinogenic properties. In the recent decades, the genetics of glucosinolate biosynthesis has been widely studied, however, the expression of specific genes involved in glucosinolate biosynthesis under exogenous phytohormone treatment has not been explored at the subspecies level in Brassica oleracea . Such data are vital for strategies aimed at selective exploitation of glucosinolate profiles. This study quantified the expression of 38 glucosinolate biosynthesis-related genes in three B. oleracea subspecies, namely cabbage, broccoli and kale, and catalogued associations between gene expression and increased contents of individual glucosinolates under methyl jasmonate (MeJA) and salicylic acid (SA) treatments. Glucosinolate accumulation and gene expression in response to phytohormone elicitation was subspecies specific. For instance, cabbage leaves showed enhanced accumulation of the aliphatic glucoiberin, progoitrin, sinigrin and indolic neoglucobrassicin under both MeJA and SA treatment. MeJA treatment induced strikingly higher accumulation of glucobrassicin (GBS) in cabbage and kale and of neoglucobrassicin (NGBS) in broccoli compared to controls. Notably higher expression of ST5a (Bol026200), CYP81F1 (Bol028913, Bol028914) and CYP81F4 genes was associated with significantly higher GBS accumulation under MeJA treatment compared to controls in all three subspecies. CYP81F4 genes, trans-activated by MYB34 genes, were expressed at remarkably high levels in all three subspecies under MeJA treatment, which also induced in higher indolic NGBS accumulation in all three subspecies. Remarkably higher expression of MYB28 (Bol036286), ST5b , ST5c , AOP2 , FMOGS-OX5 (Bol031350) and GSL-OH (Bol033373) was associated with much higher contents of aliphatic glucosinolates in kale leaves compared to the other two subspecies. The genes expressed highly could be utilized in strategies to selectively increase glucosinolate compounds in B. oleracea

  7. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    Science.gov (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  8. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  9. Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia.

    Science.gov (United States)

    Ponciano-Gómez, Alberto; Martínez-Tovar, Adolfo; Vela-Ojeda, Jorge; Olarte-Carrillo, Irma; Centeno-Cruz, Federico; Garrido, Efraín

    2017-10-01

    Acute myeloid leukemia is characterized by its high biological and clinical heterogeneity, which represents an important barrier for a precise disease classification and accurate therapy. While epigenetic aberrations play a pivotal role in acute myeloid leukemia pathophysiology, molecular signatures such as change in the DNA methylation patterns and genetic mutations in enzymes needed to the methylation process can also be helpful for classifying acute myeloid leukemia. Our study aims to unveil the relevance of DNMT3A and TET2 genes in global and specific methylation patterns in acute myeloid leukemia. Peripheral blood samples from 110 untreated patients with acute myeloid leukemia and 15 healthy control individuals were collected. Global 5-methylcytosine and 5-hydroxymethylcytosine in genomic DNA from peripheral blood leukocytes were measured by using the MethylFlashTM Quantification kits. DNMT3A and TET2 expression levels were evaluated by real-time quantitative polymerase chain reaction. The R882A hotspot of DNMT3A and exons 6-10 of TET2 were amplified by polymerase chain reaction and sequenced using the Sanger method. Methylation patterns of 16 gene promoters were evaluated by pyrosequencing after treating DNA with sodium bisulfite, and their transcriptional products were measured by real-time quantitative polymerase chain reaction.Here, we demonstrate altered levels of 5-methylcytosine and 5-hydroxymethylcytosine and highly variable transcript levels of DNMT3A and TET2 in peripheral blood leukocytes from acute myeloid leukemia patients. We found a mutation prevalence of 2.7% for DNMT3A and 11.8% for TET2 in the Mexican population with this disease. The average overall survival of acute myeloid leukemia patients with DNMT3A mutations was only 4 months. In addition, we showed that mutations in DNMT3A and TET2 may cause irregular DNA methylation patterns and transcriptional expression levels in 16 genes known to be involved in acute myeloid leukemia pathogenesis

  10. The identification of genes specific to Prevotella intermedia and Prevotella nigrescens using genomic subtractive hybridization.

    Science.gov (United States)

    Masakiyo, Yoshiaki; Yoshida, Akihiro; Shintani, Yasuyuki; Takahashi, Yusuke; Ansai, Toshihiro; Takehara, Tadamichi

    2010-06-01

    Prevotella intermedia and Prevotella nigrescens, which are often isolated from periodontal sites, were once considered two different genotypes of P. intermedia. Although the genomic sequence of P. intermedia was determined recently, little is known about the genetic differences between P. intermedia and P. nigrescens. The subtractive hybridization technique is a powerful method for generating a set of DNA fragments differing between two closely related bacterial strains or species. We used subtractive hybridization to identify the DNA regions specific to P. intermedia ATCC 25611 and P. nigrescens ATCC 25261. Using this method, four P. intermedia ATCC 25611-specific and three P. nigrescens ATCC 25261-specific regions were determined. From the species-specific regions, insertion sequence (IS) elements were isolated for P. intermedia. IS elements play an important role in the pathogenicity of bacteria. For the P. intermedia-specific regions, the genes adenine-specific DNA-methyltransferase and 8-amino-7-oxononanoate synthase were isolated. The P. nigrescens-specific region contained a Flavobacterium psychrophilum SprA homologue, a cell-surface protein involved in gliding motility, Prevotella melaninogenica ATCC 25845 glutathione peroxide, and Porphyromonas gingivalis ATCC 33277 leucyl-tRNA synthetase. The results demonstrate that the subtractive hybridization technique was useful for distinguishing between the two closely related species. Furthermore, this technique will contribute to our understanding of the virulence of these species. 2009 Elsevier Ltd. All rights reserved.

  11. Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

  12. Specific down-regulation of spermatogenesis genes targeted by 22G RNAs in hybrid sterile males associated with an X-Chromosome introgression.

    Science.gov (United States)

    Li, Runsheng; Ren, Xiaoliang; Bi, Yu; Ho, Vincy Wing Sze; Hsieh, Chia-Ling; Young, Amanda; Zhang, Zhihong; Lin, Tingting; Zhao, Yanmei; Miao, Long; Sarkies, Peter; Zhao, Zhongying

    2016-09-01

    Hybrid incompatibility (HI) prevents gene flow between species, thus lying at the heart of speciation genetics. One of the most common HIs is male sterility. Two superficially contradictory observations exist for hybrid male sterility. First, an introgression on the X Chromosome is more likely to produce male sterility than on autosome (so-called large-X theory); second, spermatogenesis genes are enriched on the autosomes but depleted on the X Chromosome (demasculinization of X Chromosome). Analysis of gene expression in Drosophila hybrids suggests a genetic interaction between the X Chromosome and autosomes that is essential for male fertility. However, the prevalence of such an interaction and its underlying mechanism remain largely unknown. Here we examine the interaction in nematode species by contrasting the expression of both coding genes and transposable elements (TEs) between hybrid sterile males and its parental nematode males. We use two lines of hybrid sterile males, each carrying an independent introgression fragment from Caenorhabditis briggsae X Chromosome in an otherwise Caenorhabditis nigoni background, which demonstrate similar defects in spermatogenesis. We observe a similar pattern of down-regulated genes that are specific for spermatogenesis between the two hybrids. Importantly, the down-regulated genes caused by the X Chromosome introgressions show a significant enrichment on the autosomes, supporting an epistatic interaction between the X Chromosome and autosomes. We investigate the underlying mechanism of the interaction by measuring small RNAs and find that a subset of 22G RNAs specifically targeting the down-regulated spermatogenesis genes is significantly up-regulated in hybrids, suggesting that perturbation of small RNA-mediated regulation may contribute to the X-autosome interaction. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

    Directory of Open Access Journals (Sweden)

    Ryan Joseph F

    2011-01-01

    Full Text Available Abstract Background Mutations in the Otopetrin 1 gene (Otop1 in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH subtype 1G (Ush1g, both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF, a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq data in mouse and human embryonic stem (ES cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s of Ush1g and Otop in developmental pathways.

  14. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia

    2017-10-11

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  15. A multiple genome analysis of Mycobacterium tuberculosis reveals specific novel genes and mutations associated with pyrazinamide resistance

    KAUST Repository

    Sheen, Patricia; Requena, David; Gushiken, Eduardo; Gilman, Robert H.; Antiparra, Ricardo; Lucero, Bryan; Lizá rraga, Pilar; Cieza, Basilio; Roncal, Elisa; Grandjean, Louis; Pain, Arnab; McNerney, Ruth; Clark, Taane G.; Moore, David; Zimic, Mirko

    2017-01-01

    Tuberculosis (TB) is a major global health problem and drug resistance compromises the efforts to control this disease. Pyrazinamide (PZA) is an important drug used in both first and second line treatment regimes. However, its complete mechanism of action and resistance remains unclear.We genotyped and sequenced the complete genomes of 68 M. tuberculosis strains isolated from unrelated TB patients in Peru. No clustering pattern of the strains was verified based on spoligotyping. We analyzed the association between PZA resistance with non-synonymous mutations and specific genes. We found mutations in pncA and novel genes significantly associated with PZA resistance in strains without pncA mutations. These included genes related to transportation of metal ions, pH regulation and immune system evasion.These results suggest potential alternate mechanisms of PZA resistance that have not been found in other populations, supporting that the antibacterial activity of PZA may hit multiple targets.

  16. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  17. The dopamine transporter gene may not contribute to susceptibility and the specific personality traits of amphetamine dependence.

    Science.gov (United States)

    Tzeng, Nian-Sheng; Lu, Ru-Band; Yeh, Hui-Wen; Yeh, Yi-Wei; Huang, Chang-Chih; Yen, Che-Hung; Kuo, Shin-Chang; Chen, Chun-Yen; Chang, Hsin-An; Ho, Pei-Shen; Cheng, Serena; Shih, Mei-Chen; Huang, San-Yuan

    2015-04-01

    A substantial amount of evidence suggests that dysfunction of the dopamine transporter may be involved in the pathophysiology of amphetamine dependence (AD). The aim of this study was to examine whether the dopamine transporter gene (DAT1, SLC6A3) is associated with development of AD and whether this gene influences personality traits in patients with AD. Eighteen polymorphisms of the DAT1 gene were analyzed in a case-control study that included 909 Han Chinese men (568 patients with AD and 341 control subjects). The patients fulfilled the DSM-IV-TR criteria for AD. The Tridimensional Personality Questionnaire (TPQ) was used to assess personality traits and to examine the association between these traits and DAT1 gene variants. A weak association was found between the rs27072 polymorphism and development of AD, but these borderline associations were unconfirmed by logistic regression and haplotype analysis. Although harm avoidance and novelty seeking scores were significantly higher in patients than in controls, DAT1 polymorphisms did not influence these scores. This study suggests that high harm avoidance and novelty seeking personality traits may be a risk factor for the development of AD. However, the DAT1 gene may not contribute to AD susceptibility and specific personality traits observed in AD among Han Chinese men. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. Co-expression of the transcription factors CEH-14 and TTX-1 regulates AFD neuron-specific genes gcy-8 and gcy-18 in C. elegans.

    Science.gov (United States)

    Kagoshima, Hiroshi; Kohara, Yuji

    2015-03-15

    A wide variety of cells are generated by the expression of characteristic sets of genes, primarily those regulated by cell-specific transcription. To elucidate the mechanism regulating cell-specific gene expression in a highly specialized cell, AFD thermosensory neuron in Caenorhabditis elegans, we analyzed the promoter sequences of guanylyl cyclase genes, gcy-8 and gcy-18, exclusively expressed in AFD. In this study, we showed that AFD-specific expression of gcy-8 and gcy-18 requires the co-expression of homeodomain proteins, CEH-14/LHX3 and TTX-1/OTX1. We observed that mutation of ttx-1 or ceh-14 caused a reduction in the expression of gcy-8 and gcy-18 and that the expression was completely lost in double mutants. This synergy effect was also observed with other AFD marker genes, such as ntc-1, nlp-21and cng-3. Electrophoretic mobility shift assays revealed direct interaction of CEH-14 and TTX-1 proteins with gcy-8 and gcy-18 promoters in vitro. The binding sites of CEH-14 and TTX-1 proteins were confirmed to be essential for AFD-specific expression of gcy-8 and gcy-18 in vivo. We also demonstrated that forced expression of CEH-14 and TTX-1 in AWB chemosensory neurons induced ectopic expression of gcy-8 and gcy-18 reporters in this neuron. Finally, we showed that the regulation of gcy-8 and gcy-18 expression by ceh-14 and ttx-1 is evolutionally conserved in five Caenorhabditis species. Taken together, ceh-14 and ttx-1 expression determines the fate of AFD as terminal selector genes at the final step of cell specification. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  20. Specific reduction of calcium-binding protein (28-kilodalton calbindin-D) gene expression in aging and neurodegenerative diseases

    International Nuclear Information System (INIS)

    Iacopino, A.M.; Christakos, S.

    1990-01-01

    The present studies establish that there are specific, significant decreases in the neuronal calcium-binding protein (28-kDa calbindin-D) gene expression in aging and in neurodegenerative diseases. The specificity of the changes observed in calbindin mRNA levels was tested by reprobing blots with calmodulin, cyclophilin, and B-actin cDNAs. Gross brain regions of the aging rat exhibited specific, significant decreases in calbindin·mRNA and protein levels in the cerebellum, corpus striatum, and brain-stem region but not in the cerebral cortex or hippocampus. Discrete areas of the aging human brain exhibited significant decreases in calbindin protein and mRNA in the cerebellum, corpus striatum, and nucleus basalis but not in the neocortex, hippocampus, amygdala, locus ceruleus, or nucleus raphe dorsalis. Comparison of diseased human brain tissue with age- and sex-matched controls yielded significant decreases calbindin protein and mRNA in the substantia nigra (Parkinson disease), in the corpus striatum (Huntington disease), in the nucleus basalis (Alzheimer disease), and in the hippocampus and nucleus raphe dorsalis (Parkinson, Huntington, and Alzheimer diseases) but not in the cerebellum, neocortex, amygdala, or locus ceruleus. These findings suggest that decreased calbindin gene expression may lead to a failure of calcium buffering or intraneuronal calcium homeostasis, which contributes to calcium-mediated cytotoxic events during aging and in the pathogenesis of neurodegenerative diseases

  1. Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

    Science.gov (United States)

    Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

    1999-01-01

    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

  2. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  3. A novel CpG island set identifies tissue-specific methylation at developmental gene loci.

    Directory of Open Access Journals (Sweden)

    Robert Illingworth

    2008-01-01

    Full Text Available CpG islands (CGIs are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.

  4. Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

    Science.gov (United States)

    O'Connor, Timothy R.; Bailey, Timothy L.

    2014-01-01

    Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

  5. Constructing disease-specific gene networks using pair-wise relevance metric: Application to colon cancer identifies interleukin 8, desmin and enolase 1 as the central elements

    Directory of Open Access Journals (Sweden)

    Jiang Wei

    2008-08-01

    Full Text Available Abstract Background With the advance of large-scale omics technologies, it is now feasible to reversely engineer the underlying genetic networks that describe the complex interplays of molecular elements that lead to complex diseases. Current networking approaches are mainly focusing on building genetic networks at large without probing the interaction mechanisms specific to a physiological or disease condition. The aim of this study was thus to develop such a novel networking approach based on the relevance concept, which is ideal to reveal integrative effects of multiple genes in the underlying genetic circuit for complex diseases. Results The approach started with identification of multiple disease pathways, called a gene forest, in which the genes extracted from the decision forest constructed by supervised learning of the genome-wide transcriptional profiles for patients and normal samples. Based on the newly identified disease mechanisms, a novel pair-wise relevance metric, adjusted frequency value, was used to define the degree of genetic relationship between two molecular determinants. We applied the proposed method to analyze a publicly available microarray dataset for colon cancer. The results demonstrated that the colon cancer-specific gene network captured the most important genetic interactions in several cellular processes, such as proliferation, apoptosis, differentiation, mitogenesis and immunity, which are known to be pivotal for tumourigenesis. Further analysis of the topological architecture of the network identified three known hub cancer genes [interleukin 8 (IL8 (p ≈ 0, desmin (DES (p = 2.71 × 10-6 and enolase 1 (ENO1 (p = 4.19 × 10-5], while two novel hub genes [RNA binding motif protein 9 (RBM9 (p = 1.50 × 10-4 and ribosomal protein L30 (RPL30 (p = 1.50 × 10-4] may define new central elements in the gene network specific to colon cancer. Gene Ontology (GO based analysis of the colon cancer-specific gene network and

  6. Constructing disease-specific gene networks using pair-wise relevance metric: application to colon cancer identifies interleukin 8, desmin and enolase 1 as the central elements.

    Science.gov (United States)

    Jiang, Wei; Li, Xia; Rao, Shaoqi; Wang, Lihong; Du, Lei; Li, Chuanxing; Wu, Chao; Wang, Hongzhi; Wang, Yadong; Yang, Baofeng

    2008-08-10

    With the advance of large-scale omics technologies, it is now feasible to reversely engineer the underlying genetic networks that describe the complex interplays of molecular elements that lead to complex diseases. Current networking approaches are mainly focusing on building genetic networks at large without probing the interaction mechanisms specific to a physiological or disease condition. The aim of this study was thus to develop such a novel networking approach based on the relevance concept, which is ideal to reveal integrative effects of multiple genes in the underlying genetic circuit for complex diseases. The approach started with identification of multiple disease pathways, called a gene forest, in which the genes extracted from the decision forest constructed by supervised learning of the genome-wide transcriptional profiles for patients and normal samples. Based on the newly identified disease mechanisms, a novel pair-wise relevance metric, adjusted frequency value, was used to define the degree of genetic relationship between two molecular determinants. We applied the proposed method to analyze a publicly available microarray dataset for colon cancer. The results demonstrated that the colon cancer-specific gene network captured the most important genetic interactions in several cellular processes, such as proliferation, apoptosis, differentiation, mitogenesis and immunity, which are known to be pivotal for tumourigenesis. Further analysis of the topological architecture of the network identified three known hub cancer genes [interleukin 8 (IL8) (p approximately 0), desmin (DES) (p = 2.71 x 10(-6)) and enolase 1 (ENO1) (p = 4.19 x 10(-5))], while two novel hub genes [RNA binding motif protein 9 (RBM9) (p = 1.50 x 10(-4)) and ribosomal protein L30 (RPL30) (p = 1.50 x 10(-4))] may define new central elements in the gene network specific to colon cancer. Gene Ontology (GO) based analysis of the colon cancer-specific gene network and the sub-network that

  7. Tissue-specific and pathogen-induced regulation of a Nicotiana plumbaginifolia beta-1,3-glucanase gene.

    Science.gov (United States)

    Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M

    1990-01-01

    The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158

  8. Circuit- and Diagnosis-Specific DNA Methylation Changes at γ-Aminobutyric Acid–Related Genes in Postmortem Human Hippocampus in Schizophrenia and Bipolar Disorder

    Science.gov (United States)

    Ruzicka, W. Brad; Subburaju, Sivan; Benes, Francine M.

    2017-01-01

    IMPORTANCE Dysfunction related to γ-aminobutyric acid (GABA)–ergic neurotransmission in the pathophysiology of major psychosis has been well established by the work of multiple groups across several decades, including the widely replicated downregulation of GAD1. Prior gene expression and network analyses within the human hippocampus implicate a broader network of genes, termed the GAD1 regulatory network, in regulation of GAD1 expression. Several genes within this GAD1 regulatory network show diagnosis- and sector-specific expression changes within the circuitry of the hippocampus, influencing abnormal GAD1 expression in schizophrenia and bipolar disorder. OBJECTIVE To investigate the hypothesis that aberrant DNA methylation contributes to circuit- and diagnosis-specific abnormal expression of GAD1 regulatory network genes in psychotic illness. DESIGN, SETTING, AND PARTICIPANTS This epigenetic association study targeting GAD1 regulatory network genes was conducted between July 1, 2012, and June 30, 2014. Postmortem human hippocampus tissue samples were obtained from 8patients with schizophrenia, 8 patients with bipolar disorder, and 8 healthy control participants matched for age, sex, postmortem interval, and other potential confounds from the Harvard Brain Tissue Resource Center, McLean Hospital, Belmont,Massachusetts. We extracted DNA from laser-microdissected stratum oriens tissue of cornu ammonis 2/3 (CA2/3) and CA1 postmortem human hippocampus, bisulfite modified it, and assessed it with the Infinium HumanMethylation450 BeadChip (Illumina, Inc). The subset of CpG loci associated with GAD1 regulatory network genes was analyzed in R version 3.1.0 software (R Foundation) using the minfi package. Findings were validated using bisulfite pyrosequencing. MAIN OUTCOMES AND MEASURES Methylation levels at 1308 GAD1 regulatory network–associated CpG loci were assessed both as individual sites to identify differentially methylated positions and by sharing

  9. Recruitment of Mediator Complex by Cell Type and Stage-Specific Factors Required for Tissue-Specific TAF Dependent Gene Activation in an Adult Stem Cell Lineage.

    Directory of Open Access Journals (Sweden)

    Chenggang Lu

    2015-12-01

    Full Text Available Onset of terminal differentiation in adult stem cell lineages is commonly marked by robust activation of new transcriptional programs required to make the appropriate differentiated cell type(s. In the Drosophila male germ line stem cell lineage, the switch from proliferating spermatogonia to spermatocyte is accompanied by one of the most dramatic transcriptional changes in the fly, as over 1000 new transcripts turn on in preparation for meiosis and spermatid differentiation. Here we show that function of the coactivator complex Mediator is required for activation of hundreds of new transcripts in the spermatocyte program. Mediator appears to act in a sequential hierarchy, with the testis activating Complex (tMAC, a cell type specific form of the Mip/dREAM general repressor, required to recruit Mediator subunits to the chromatin, and Mediator function required to recruit the testis TAFs (tTAFs, spermatocyte specific homologs of subunits of TFIID. Mediator, tMAC and the tTAFs co-regulate expression of a major set of spermatid differentiation genes. The Mediator subunit Med22 binds the tMAC component Topi when the two are coexpressed in S2 cells, suggesting direct recruitment. Loss of Med22 function in spermatocytes causes meiosis I maturation arrest male infertility, similar to loss of function of the tMAC subunits or the tTAFs. Our results illuminate how cell type specific versions of the Mip/dREAM complex and the general transcription machinery cooperate to drive selective gene activation during differentiation in stem cell lineages.

  10. Macrophage-specific gene functions in Spi1-directed innate immunity

    NARCIS (Netherlands)

    Zakrzewska, Anna; Cui, Chao; Stockhammer, Oliver W.; Benard, Erica L.; Spaink, Herman P.; Meijer, Annemarie H.

    2010-01-01

    The Spi1/Pu.1 transcription factor plays a crucial role in myeloid cell development in vertebrates. Despite extensive studies of Spi1, the controlled gene group remains largely unknown. To identify genes dependent on Spi1, we used a microarray strategy using a knockdown approach in zebrafish embryos

  11. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    Science.gov (United States)

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1-3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent.

  12. Screening of Genes Specifically Expressed in Males of Fenneropenaeus chinensis and Their Potential as Sex Markers

    Directory of Open Access Journals (Sweden)

    Shihao Li

    2013-01-01

    Full Text Available The androgenic gland (AG, playing an important role in sex differentiation of male crustacean, is a target candidate to understand the mechanism of male development and to mine male-specific sex markers. An SSH library (designated as male reproduction-related tissues—SSH library, MRT-SSH library for short was constructed using cDNA from tissues located at the basal part of the 5th pereiopods, including AG and part of spermatophore sac, as tester, and the cDNA from the basal part of the 4th pereiopods of these male shrimp as driver. 402 ESTs from the SSH library were sequenced and assembled into 48 contigs and 104 singlets. Twelve contigs and 14 singlets were identified as known genes. The proteins encoded by the identified genes were categorized, according to their proposed functions, into neuropeptide hormone and hormone transporter, RNA posttranscriptional regulation, translation, cell growth and death, metabolism, genetic information processing, signal transduction/transport, or immunity-related proteins. Eleven highly expressed contigs in the SSH library were selected for validation of the MRT-SSH library and screening sex markers of shrimp. One contig, specifically expressed in male shrimp, had a potential to be developed as a transcriptomic sex marker in shrimp.

  13. Novel polymorphisms within the Dlk1-Dio3 imprinted locus in rat: a putative genetic basis for strain-specific allelic gene expression

    Directory of Open Access Journals (Sweden)

    Laura J Sittig

    2012-12-01

    Full Text Available The imprinted iodothyronine deiodinase-III (Dio3 thyroid hormone metabolizing gene exhibits paternal expression in most fetal tissues, yet exhibits aberrant, maternal expression in the hippocampus in F1 offspring of Sprague Dawley (SD x Brown Norway (BN rats. The maternal hippocampal expression is associated with lower Dio3 mRNA levels specifically in the hippocampus. Here, we tested the hypothesis that genetic polymorphisms between the SD and BN parent strains cause this aberrant allelic Dio3 expression and contribute to behavioral sequelae of higher thyroid hormone levels locally in the hippocampus, including anxiety-related behavior. We mapped and sequenced the Dio3 gene and several previously unmapped regions in the Dlk1-Dio3 locus that could regulate imprinting of the Dio3 gene. In the Dio3 promoter we identified four novel polymorphisms between the BN and SD strains. Next we took advantage of the fact that the Long Evans (LE strain exhibits identical polymorphisms as the SD strain in the region 5’ and including the Dio3 gene. By reciprocally crossing LE and BN strains we tested the relationship among Dio3 promoter region polymorphisms and Dio3 mRNA expression in the hippocampus. Aberrant strain-specific hippocampal Dio3 allelic expression replicated in the LE-BN reciprocal crosses, suggesting that hippocampal-specific imprinting of the Dio3 gene is not the result of a unique genetic or epigenetic characteristic of the SD rat strain, or a unique epistatic interaction between SD and BN. To our knowledge no other studies have reported a genetic x epigenetic interaction of genetic origin in the brain.

  14. Male and female rat bone marrow-derived mesenchymal stem cells are different in terms of the expression of germ cell specific genes.

    Science.gov (United States)

    Ghasemzadeh-Hasankolaei, Mohammad; Eslaminejad, Mohammadreza Baghaban; Batavani, Roozali; Ghasemzadeh-Hasankolaei, Maryam

    2015-06-01

    Recent studies have shown that mesenchymal stem cells (MSCs), under appropriate conditions, can differentiate into cell types including germ cells (GCs). These studies also show that MSCs without any induction express some GC-specific genes innately. Moreover, one report suggests that female MSCs have a greater tendency to differentiate into female instead of male GCs. Therefore, for the first time, this study attempts to assay and determine the differences between the expression levels of some important GC-specific genes (Stra8, Vasa, Dazl, Stella, Piwil2, Oct4, Fragilis, Rnf17 and c-Kit) in male and female bone marrow (BM)-MSCs of rats. BM sampling of the rate was performed by a newly established method. We cultured rat BM samples, then characterized male and female MSCs according to their adhesion onto the culture dish, their differentiation potential into bone, cartilage and fat cells, and phenotype analysis by flow cytometry. The expression of GC-specific genes and their expression levels were evaluated with reverse transcription polymerase chain reaction (RT-PCR) and real-time RT-PCR. Our results showed that Dazl and Rnf17 did not express in the cells. The majority of examined genes, except Piwil2, expressed at almost the same levels in male and female MSCs. Piwil2 had higher expression in male MSCs which was probably related to the more prominent role of Piwil2 in the male GC development process. Male BM-MSCs appeared more prone to differentiate into male rather than female GCs. Additional research should be performed to determine the exact role of different genes in the male and female GC development process.

  15. Nanoparticle-specific changes in Arabidopsis thaliana gene expression after exposure to ZnO, TiO{sub 2}, and fullerene soot

    Energy Technology Data Exchange (ETDEWEB)

    Landa, Premysl [Laboratory of Plant Biotechnologies, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic); Vankova, Radomira [Laboratory of Hormonal Regulations in Plants, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic); Andrlova, Jana [Laboratory of Plant Biotechnologies, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic); Department of Crop Sciences and Agroforestry, Institute of Tropics and Subtropics, Czech University of Life Sciences Prague, 165 21 Prague 6 - Suchdol (Czech Republic); Hodek, Jan [Department of Molecular Biology, Crop Research Institute, v.v.i., 161 06 Praha 6 - Ruzyne (Czech Republic); Marsik, Petr [Laboratory of Plant Biotechnologies, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic); Storchova, Helena [Plant Reproduction Laboratory, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic); White, Jason C. [Department of Analytical Chemistry, Connecticut Agricultural Experiment Station, 123 Huntington Street, New Haven, CT 06512 (United States); Vanek, Tomas, E-mail: vanek@ueb.cas.cz [Laboratory of Plant Biotechnologies, Institute of Experimental Botany AS CR, v.v.i., 165 02 Prague 6 - Lysolaje (Czech Republic)

    2012-11-30

    Highlights: Black-Right-Pointing-Pointer Exposure to different nanoparticles resulted in specific changes in gene transcription. Black-Right-Pointing-Pointer Nano ZnO caused most dramatic changes in Arabidopsis gene expression. Black-Right-Pointing-Pointer Nano ZnO was the most toxic and up-regulated most stress-related genes. Black-Right-Pointing-Pointer Fullerene soot caused significant gene expression response - mainly stress-related. Black-Right-Pointing-Pointer Nano TiO{sub 2} had weak impact on Arabidopsis gene expression indicating minimal toxicity. - Abstract: The effect of exposure to 100 mg/L zinc oxide (nZnO), fullerene soot (FS) or titanium dioxide (nTiO{sub 2}) nanoparticles on gene expression in Arabidopsis thaliana roots was studied using microarrays. After 7 d, nZnO, FS, or nTiO{sub 2} exposure resulted in 660 up- and 826 down-regulated genes, 232 up- and 189 down-regulated genes, and 80 up- and 74 down-regulated genes, respectively (expression difference > 2-fold; p[t test] < 0.05). The genes induced by nZnO and FS include mainly ontology groups annotated as stress responsive, including both abiotic (oxidative, salt, water deprivation) and biotic (wounding and defense to pathogens) stimuli. The down-regulated genes upon nZnO exposure were involved in cell organization and biogenesis, including translation, nucleosome assembly and microtubule based process. FS largely repressed the transcription of genes involved in electron transport and energy pathways. Only mild changes in gene expression were observed upon nTiO{sub 2} exposure, which resulted in up- and down-regulation of genes involved mainly in responses to biotic and abiotic stimuli. The data clearly indicate that the mechanisms of phytotoxicity are highly nanoparticle dependent despite of a limited overlap in gene expression response.

  16. Concentration of acrylamide in a polyacrylamide gel affects VP4 gene coding assignment of group A equine rotavirus strains with P[12] specificity

    Science.gov (United States)

    2010-01-01

    Background It is universally acknowledged that genome segment 4 of group A rotavirus, the major etiologic agent of severe diarrhea in infants and neonatal farm animals, encodes outer capsid neutralization and protective antigen VP4. Results To determine which genome segment of three group A equine rotavirus strains (H-2, FI-14 and FI-23) with P[12] specificity encodes the VP4, we analyzed dsRNAs of strains H-2, FI-14 and FI-23 as well as their reassortants by polyacrylamide gel electrophoresis (PAGE) at varying concentrations of acrylamide. The relative position of the VP4 gene of the three equine P[12] strains varied (either genome segment 3 or 4) depending upon the concentration of acrylamide. The VP4 gene bearing P[3], P[4], P[6], P[7], P[8] or P[18] specificity did not exhibit this phenomenon when the PAGE running conditions were varied. Conclusions The concentration of acrylamide in a PAGE gel affected VP4 gene coding assignment of equine rotavirus strains bearing P[12] specificity. PMID:20573245

  17. Shot-gun proteome and transcriptome mapping of the jujube floral organ and identification of a pollen-specific S-locus F-box gene

    Directory of Open Access Journals (Sweden)

    Ruihong Chen

    2017-07-01

    Full Text Available The flower is a plant reproductive organ that forms part of the fruit produced as the flowering season ends. While the number and identity of proteins expressed in a jujube (Ziziphus jujuba Mill. flower is currently unknown, integrative proteomic and transcriptomic analyses provide a systematic strategy of characterizing the floral biology of plants. We conducted a shotgun proteomic analysis on jujube flowers by using a filter-aided sample preparation tryptic digestion, followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS. In addition, transcriptomics analyses were performed on HiSeq2000 sequencers. In total, 7,853 proteins were identified accounting for nearly 30% of the ‘Junzao’ gene models (27,443. Genes identified in proteome generally showed higher RPKM (reads per kilobase per million mapped reads values than undetected genes. Gene ontology categories showed that ribosomes and intracellular organelles were the most dominant classes and accounted for 17.0% and 14.0% of the proteome mass, respectively. The top-ranking proteins with iBAQ >1010 included non-specific lipid transfer proteins, histones, actin-related proteins, fructose-bisphosphate aldolase, Bet v I type allergens, etc. In addition, we identified one pollen-specificity S-locus F-box-like gene located on the same chromosome as the S-RNase gene. Both of these may activate the behaviour of gametophyte self-incompatibility in jujube. These results reflected the protein profile features of jujube flowers and contributes new information important to the jujube breeding system.

  18. Npas4 regulates excitatory-inhibitory balance within neural circuits through cell-type-specific gene programs.

    Science.gov (United States)

    Spiegel, Ivo; Mardinly, Alan R; Gabel, Harrison W; Bazinet, Jeremy E; Couch, Cameron H; Tzeng, Christopher P; Harmin, David A; Greenberg, Michael E

    2014-05-22

    The nervous system adapts to experience by inducing a transcriptional program that controls important aspects of synaptic plasticity. Although the molecular mechanisms of experience-dependent plasticity are well characterized in excitatory neurons, the mechanisms that regulate this process in inhibitory neurons are only poorly understood. Here, we describe a transcriptional program that is induced by neuronal activity in inhibitory neurons. We find that, while neuronal activity induces expression of early-response transcription factors such as Npas4 in both excitatory and inhibitory neurons, Npas4 activates distinct programs of late-response genes in inhibitory and excitatory neurons. These late-response genes differentially regulate synaptic input to these two types of neurons, promoting inhibition onto excitatory neurons while inducing excitation onto inhibitory neurons. These findings suggest that the functional outcomes of activity-induced transcriptional responses are adapted in a cell-type-specific manner to achieve a circuit-wide homeostatic response. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Gene networks specific for innate immunity define post-traumatic stress disorder.

    Science.gov (United States)

    Breen, M S; Maihofer, A X; Glatt, S J; Tylee, D S; Chandler, S D; Tsuang, M T; Risbrough, V B; Baker, D G; O'Connor, D T; Nievergelt, C M; Woelk, C H

    2015-12-01

    The molecular factors involved in the development of Post-Traumatic Stress Disorder (PTSD) remain poorly understood. Previous transcriptomic studies investigating the mechanisms of PTSD apply targeted approaches to identify individual genes under a cross-sectional framework lack a holistic view of the behaviours and properties of these genes at the system-level. Here we sought to apply an unsupervised gene-network based approach to a prospective experimental design using whole-transcriptome RNA-Seq gene expression from peripheral blood leukocytes of U.S. Marines (N=188), obtained both pre- and post-deployment to conflict zones. We identified discrete groups of co-regulated genes (i.e., co-expression modules) and tested them for association to PTSD. We identified one module at both pre- and post-deployment containing putative causal signatures for PTSD development displaying an over-expression of genes enriched for functions of innate-immune response and interferon signalling (Type-I and Type-II). Importantly, these results were replicated in a second non-overlapping independent dataset of U.S. Marines (N=96), further outlining the role of innate immune and interferon signalling genes within co-expression modules to explain at least part of the causal pathophysiology for PTSD development. A second module, consequential of trauma exposure, contained PTSD resiliency signatures and an over-expression of genes involved in hemostasis and wound responsiveness suggesting that chronic levels of stress impair proper wound healing during/after exposure to the battlefield while highlighting the role of the hemostatic system as a clinical indicator of chronic-based stress. These findings provide novel insights for early preventative measures and advanced PTSD detection, which may lead to interventions that delay or perhaps abrogate the development of PTSD.

  20. Osteoblast-specific transcription factor Osterix increases vitamin D receptor gene expression in osteoblasts.

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    Full Text Available Osterix (Osx is an osteoblast-specific transcription factor required for osteoblast differentiation from mesenchymal stem cells. In Osx knock-out mice, no bone formation occurs. The vitamin D receptor (VDR is a member of the nuclear hormone receptor superfamily that regulates target gene transcription to ensure appropriate control of calcium homeostasis and bone development. Here, we provide several lines of evidence that show that the VDR gene is a target for transcriptional regulation by Osx in osteoblasts. For example, calvaria obtained from Osx-null embryos displayed dramatic reductions in VDR expression compared to wild-type calvaria. Stable overexpression of Osx stimulated VDR expression in C2C12 mesenchymal cells. Inhibition of Osx expression by siRNA led to downregulation of VDR. In contrast, Osx levels remained unchanged in osteoblasts in VDR-null mice. Mechanistic approaches using transient transfection assays showed that Osx directly activated a 1 kb fragment of the VDR promoter in a dose-dependent manner. To define the region of the VDR promoter that was responsive to Osx, a series of VDR promoter deletion mutants were examined and the minimal Osx-responsive region was refined to the proximal 120 bp of the VDR promoter. Additional point mutants were used to identify two GC-rich regions that were responsible for VDR promoter activation by Osx. Chromatin immunoprecipitation assays demonstrated that endogenous Osx was associated with the native VDR promoter in primary osteoblasts in vivo. Cumulatively, these data strongly support a direct regulatory role for Osx in VDR gene expression. They further provide new insight into potential mechanisms and pathways that Osx controls in osteoblasts and during the process of osteoblastic cell differentiation.