WorldWideScience

Sample records for scanning ribosomal particle

  1. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    Science.gov (United States)

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  2. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  3. 3D scanning particle tracking velocimetry

    Energy Technology Data Exchange (ETDEWEB)

    Hoyer, Klaus; Holzner, Markus; Guala, Michele; Liberzon, Alexander; Kinzelbach, Wolfgang [Swiss Federal Institut of Technology Zurich, Institut fuer Hydromechanik und Wasserwirtschaft, Zuerich (Switzerland); Luethi, Beat [Risoe National Laboratory, Roskilde (Denmark)

    2005-11-01

    In this article, we present an experimental setup and data processing schemes for 3D scanning particle tracking velocimetry (SPTV), which expands on the classical 3D particle tracking velocimetry (PTV) through changes in the illumination, image acquisition and analysis. 3D PTV is a flexible flow measurement technique based on the processing of stereoscopic images of flow tracer particles. The technique allows obtaining Lagrangian flow information directly from measured 3D trajectories of individual particles. While for a classical PTV the entire region of interest is simultaneously illuminated and recorded, in SPTV the flow field is recorded by sequential tomographic high-speed imaging of the region of interest. The advantage of the presented method is a considerable increase in maximum feasible seeding density. Results are shown for an experiment in homogenous turbulence and compared with PTV. SPTV yielded an average 3,500 tracked particles per time step, which implies a significant enhancement of the spatial resolution for Lagrangian flow measurements. (orig.)

  4. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  5. Release of newly synthesized nucleoplasmic ribosomal subunits or their precursor particles from isolated nuclei of regenerating rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine

    1930-06-16

    The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.

  6. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    Directory of Open Access Journals (Sweden)

    Alexander M. Brannan

    2015-12-01

    Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.

  7. Imaging of the vertical particle tracks without any depth scanning

    International Nuclear Information System (INIS)

    Soroko, L.M.

    2001-01-01

    The principle of a new optical microscope which enables us to get the image of a vertical particle track without any depth scanning is described. This new optical microscope contains a spatial transformer which consists of mirror lamellar elements and which produces a secondary in focus image of the vertical particle track. Properties of such a system are presented. A longitudinal resolution is estimated

  8. TSI Model 3936 Scanning Mobility Particle Spectrometer Instrument Handbook

    Energy Technology Data Exchange (ETDEWEB)

    Kuang, C. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2016-02-01

    The Model 3936 Scanning Mobility Particle Spectrometer (SMPS) measures the size distribution of aerosols ranging from 10 nm up to 1000 nm. The SMPS uses a bipolar aerosol charger to keep particles within a known charge distribution. Charged particles are classified according to their electrical mobility, using a long-column differential mobility analyzer (DMA). Particle concentration is measured with a condensation particle counter (CPC). The SMPS is well-suited for applications including: nanoparticle research, atmospheric aerosol studies, pollution studies, smog chamber evaluations, engine exhaust and combustion studies, materials synthesis, filter efficiency testing, nucleation/condensation studies, and rapidly changing aerosol systems.

  9. Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

    1976-01-01

    An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

  10. Automated rapid particle investigation using scanning electron microscopy

    Science.gov (United States)

    Wilkins, Jerod Laurence

    The chemical composition of fly ash particles has been known to vary significantly depending on a number of factors. Current bulk methods of investigation including X-Ray Fluorescence and X-Ray Diffraction are thought to be inadequate in determining the performance of fly ash in concrete. It is the goal of this research to develop a method of Automated Rapid Particle Investigation that will not look at fly ash as a bulk material but as individual particles. By examining each particle individually scientists and engineers will have the ability to study the variation in chemical composition by comparing the chemistry present in each particle. The method of investigation developed by this research provides a practical technique that will allow the automated chemical analysis of hundreds, or even thousands, of fly ash particles in a matter of minutes upon completion of sample preparation and automated scanning electron microscope (ASEM) scanning. This research does not examine the significance of the chemical compounds discovered; rather, only the investigation methodology is discussed. Further research will be done to examine the importance of the chemistry discovered with this automated rapid particle investigation technique.

  11. Charged particle beam scanning using deformed high gradient insulator

    Science.gov (United States)

    Chen, Yu -Jiuan

    2015-10-06

    Devices and methods are provided to allow rapid deflection of a charged particle beam. The disclosed devices can, for example, be used as part of a hadron therapy system to allow scanning of a target area within a patient's body. The disclosed charged particle beam deflectors include a dielectric wall accelerator (DWA) with a hollow center and a dielectric wall that is substantially parallel to a z-axis that runs through the hollow center. The dielectric wall includes one or more deformed high gradient insulators (HGIs) that are configured to produce an electric field with an component in a direction perpendicular to the z-axis. A control component is also provided to establish the electric field component in the direction perpendicular to the z-axis and to control deflection of a charged particle beam in the direction perpendicular to the z-axis as the charged particle beam travels through the hollow center of the DWA.

  12. The AAA-ATPase NVL2 is a component of pre-ribosomal particles that interacts with the DExD/H-box RNA helicase DOB1

    International Nuclear Information System (INIS)

    Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo

    2006-01-01

    Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone

  13. Scanning tomographic particle image velocimetry applied to a turbulent jet

    KAUST Repository

    Casey, T. A.

    2013-02-21

    We introduce a modified tomographic PIV technique using four high-speed video cameras and a scanning pulsed laser-volume. By rapidly illuminating adjacent subvolumes onto separate video frames, we can resolve a larger total volume of velocity vectors, while retaining good spatial resolution. We demonstrate this technique by performing time-resolved measurements of the turbulent structure of a round jet, using up to 9 adjacent volume slices. In essence this technique resolves more velocity planes in the depth direction by maintaining optimal particle image density and limiting the number of ghost particles. The total measurement volumes contain between 1 ×106 and 3 ×106 velocity vectors calculated from up to 1500 reconstructed depthwise image planes, showing time-resolved evolution of the large-scale vortical structures for a turbulent jet of Re up to 10 000.

  14. Stenostomum cf. leucops (Platyhelminthes in Thailand: a surface observation using scanning electron microscopy and phylogenetic analysis based on 18S ribosomal DNA sequences

    Directory of Open Access Journals (Sweden)

    Arin Ngamniyom

    2016-02-01

    Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.

  15. Scanning tomographic particle image velocimetry applied to a turbulent jet

    KAUST Repository

    Casey, T. A.; Sakakibara, J.; Thoroddsen, Sigurdur T

    2013-01-01

    planes in the depth direction by maintaining optimal particle image density and limiting the number of ghost particles. The total measurement volumes contain between 1 ×106 and 3 ×106 velocity vectors calculated from up to 1500 reconstructed depthwise

  16. Advances in 4D treatment planning for scanned particle beam therapy - report of dedicated workshops

    NARCIS (Netherlands)

    Bert, Christoph; Graeff, Christian; Riboldi, Marco; Nill, Simeon; Baroni, Guido; Knopf, Antje-Christin

    2014-01-01

    We report on recent progress in the field of mobile tumor treatment with scanned particle beams, as discussed in the latest editions of the 4D treatment planning workshop. The workshop series started in 2009, with about 20 people from 4 research institutes involved, all actively working on particle

  17. Exclusion of mRNPs and ribosomal particles from a thin zone beneath the nuclear envelope revealed upon inhibition of transport

    International Nuclear Information System (INIS)

    Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil

    2010-01-01

    We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.

  18. Contrast and decay of cathodoluminescence from phosphor particles in a scanning electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Engelsen, Daniel den; Harris, Paul G.; Ireland, Terry G., E-mail: terry.ireland@brunel.ac.uk; Fern, George R.; Silver, Jack

    2015-10-15

    Cathodoluminescence (CL) studies are reported on phosphors in a field emission scanning electron microscope (FESEM). ZnO: Zn and other luminescent powders manifest a bright ring around the periphery of the particles: this ring enhances the contrast. Additionally, particles resting on top of others are substantially brighter than underlying ones. These phenomena are explained in terms of the combined effects of electrons backscattered out of the particles, together with light absorption by the substrate. The contrast is found to be a function of the particle size and the energy of the primary electrons. Some phosphor materials exhibit a pronounced comet-like structure at high scan rates in a CL-image, because the particle continues to emit light after the electron beam has moved to a position without phosphor material. Image analysis has been used to study the loss of brightness along the tail and hence to determine the decay time of the materials. The effect of phosphor saturation on the determination of decay times by CL-microscopy was also investigated. - Highlights: • Contrast enhancement are observed in secondary electron and cathodoluminescent images of phosphor particles sitting on top of others. • Backscattered electrons largely explain the observed contrast enhancement. • After glow effects in CL-micrographs of phosphors enable the determination of decay times. • Phosphor saturation can be used to determine the decay time of individual spectral transitions.

  19. Contrast and decay of cathodoluminescence from phosphor particles in a scanning electron microscope.

    Science.gov (United States)

    den Engelsen, Daniel; Harris, Paul G; Ireland, Terry G; Fern, George R; Silver, Jack

    2015-10-01

    Cathodoluminescence (CL) studies are reported on phosphors in a field emission scanning electron microscope (FESEM). ZnO: Zn and other luminescent powders manifest a bright ring around the periphery of the particles: this ring enhances the contrast. Additionally, particles resting on top of others are substantially brighter than underlying ones. These phenomena are explained in terms of the combined effects of electrons backscattered out of the particles, together with light absorption by the substrate. The contrast is found to be a function of the particle size and the energy of the primary electrons. Some phosphor materials exhibit a pronounced comet-like structure at high scan rates in a CL-image, because the particle continues to emit light after the electron beam has moved to a position without phosphor material. Image analysis has been used to study the loss of brightness along the tail and hence to determine the decay time of the materials. The effect of phosphor saturation on the determination of decay times by CL-microscopy was also investigated. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Dark-field scanning confocal microscope for vertical particle tracks in nuclear emulsion

    International Nuclear Information System (INIS)

    Astakhov, A.Ya.; Batusov, Yu.A.; Soroko, L.M.; Tereshchenko, S.V.; Tereshchenko, V.V.

    1999-01-01

    The principle of the DArk-FIeld Scanning CONfocal (DAFISCON) microscope for selective observation of the vertical particle tracks in nuclear emulsion is described. The construction of the DAFISCON microscope, built on the basis of the 2D measurement microscope, is described. The results of the experimental testing of the DAFISCON microscope, accomplished at high density of the vertical particle tracks, are presented. The 2D plot and the 1D plot of the CCD dark-field image are given. The spatial resolution of our microscope can be increased by using the objective with higher aperture

  1. Scanned beams of high-energy charged particles and features of their collimation

    International Nuclear Information System (INIS)

    Zor'ko, K.I.; Kudoyarov, M.F.; Matyukov, A.V.; Mukhin, S.A.; Patrova, M.Ya.

    2007-01-01

    The coordinate distributions of the accelerated charged particle flux density that are simultaneously formed by sinusoidal scanning and collimation are analyzed. Under certain formation conditions, the edge portions of these distributions are shown to take a two-humped shape. The experimental data obtained are in good agreement with the calculation. Recommendations are made about practical use of these beams in view of the above effects [ru

  2. Characterization of particle deformation during compression measured by confocal laser scanning microscopy.

    Science.gov (United States)

    Guo, H X; Heinämäki, J; Yliruusi, J

    1999-09-20

    Direct compression of riboflavin sodium phosphate tablets was studied by confocal laser scanning microscopy (CLSM). The technique is non-invasive and generates three-dimensional (3D) images. Tablets of 1% riboflavin sodium phosphate with two grades of microcrystalline cellulose (MCC) were individually compressed at compression forces of 1.0 and 26.8 kN. The behaviour and deformation of drug particles on the upper and lower surfaces of the tablets were studied under compression forces. Even at the lower compression force, distinct recrystallized areas in the riboflavin sodium phosphate particles were observed in both Avicel PH-101 and Avicel PH-102 tablets. At the higher compression force, the recrystallization of riboflavin sodium phosphate was more extensive on the upper surface of the Avicel PH-102 tablet than the Avicel PH-101 tablet. The plastic deformation properties of both MCC grades reduced the fragmentation of riboflavin sodium phosphate particles. When compressed with MCC, riboflavin sodium phosphate behaved as a plastic material. The riboflavin sodium phosphate particles were more tightly bound on the upper surface of the tablet than on the lower surface, and this could also be clearly distinguished by CLSM. Drug deformation could not be visualized by other techniques. Confocal laser scanning microscopy provides valuable information on the internal mechanisms of direct compression of tablets.

  3. The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning.

    Science.gov (United States)

    Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos

    2010-10-01

    Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.

  4. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  5. Hygroscopic analysis of individual Beijing haze aerosol particles by environmental scanning electron microscopy

    Science.gov (United States)

    Bai, Zhangpeng; Ji, Yuan; Pi, Yiqun; Yang, Kaixiang; Wang, Li; Zhang, Yinqi; Zhai, Yadi; Yan, Zhengguang; Han, Xiaodong

    2018-01-01

    Investigating the hygroscopic behavior of haze aerosol particles is essential for understanding their physicochemical properties and their impacts on regional weather and visibility. An environmental scanning electron microscope equipped with a home-made transmission-scattering electron imaging setup and an energy dispersive spectrometer was used for in-situ observations of pure water-soluble (WS) salts and Beijing haze particles. This imaging setup showed obvious advantages for improving the resolution and acquiring internal information of mixed particles in hydrated environments. We measured the deliquescence relative humidity of pure NaCl, NH4NO3, and (NH4)2SO4 by deliquescence-crystallization processes with an accuracy of up to 0.3% RH. The mixed haze particles showed hygroscopic activation like water uptake and morphological changes when they included WS components such as nitrates, sulfates, halides, ammoniums, and alkali metal salts. In addition, the hygroscopic behavior provides complementary information for analyzing possible phases in mixed haze particles.

  6. Probing Single Nanometer-scale Particles with Scanning Tunneling Microscopy and Spectroscopies

    International Nuclear Information System (INIS)

    McCarty, G.S.; Love, J.C.; Kushmerick, J.G.; Charles, L.F.; Keating, C.D.; Toleno, B.J.; Lyn, M.E.; Castleman, A.W.; Natan, M.J.; Weiss, P.S.

    1999-01-01

    Scanning tunneling microscopy can be used to isolate single particles on surfaces for further study. Local optical and electronic properties coupled with topographic information collected by the scanning tunneling microscope (STM) give insight into the intrinsic properties of the species under study. Since each spectroscopic measurement is done on a single particle, each sample is 'monodisperse', regardless of the degree of heterogeneity of the original preparation. We illustrate this with three example systems - a metal cluster of known atomic structure, metal nanoparticles dispersed from colloid suspensions, and metallocarbohedrenes (Met-Cars) deposited with other reaction products. Au and Ag nanoparticles were imaged using a photon emission STM. The threshold voltage, the lowest bias voltage at which photons are produced, was determined for Au nanoparticles. Electronic spectra of small clusters of Ni atoms on MoS 2 were recorded. Preliminary images of Zr-based Met-Car-containing soot were obtained on Au and MoS 2 substrates and partial electronic spectra were recorded of these possible Met-Car particles

  7. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chu, Y.S.; Chen, B.; Zhang, F.; Berenguer, F.; Bean, R.; Kewish, C.; Vila-Comamala, J.; Rodenburg, J.; Robinson, I.

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens.

  8. The case study on elemental analyses of Asian dust particles by using an analytical scanning electron microscope

    International Nuclear Information System (INIS)

    Takeuchi, Jo; Masaki, Kazushige; Emoto, Yuji

    2009-01-01

    The individual particle analyses of suspended particulate matter (SPM: particles less than 10 μm in size) collected on tape filters during April 17-18, 2006, in Kawasaki, Japan, were carried out. The chemical elements present in aerosol particles were investigated by using a scanning electron microscope with an energy-dispersive X-ray spectrometer. The fraction of chemical elements detected in the particles collected on April 18, 2006, except for S, was in good agreement with that in Asian dust particles from the Loess Plateau, China. S was not detected in Asian dust particles but was detected in the particles collected on April 18, 2006. Therefore, it was concluded that the particles collected in April 18, 2006, in Kawasaki were Asian dust particles transported from the Asian continent, and the absorption of SO 2 or the coagulation of sulfate occurred during the transportation of Asian dust particles. (author)

  9. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  10. Three-dimensional three-component particle velocimetry for microscale flows using volumetric scanning

    International Nuclear Information System (INIS)

    Klein, S A; Moran, J L; Posner, J D; Frakes, D H

    2012-01-01

    We present a diagnostic platform for measuring three-dimensional three-component (3D3C) velocity fields in microscopic volumes. The imaging system uses high-speed Nipkow spinning disk confocal microscopy. Confocal microscopy provides optical sectioning using pinhole spatial filtering which rejects light originating from out-of-focus objects. The system accomplishes volumetric scanning by rapid translation of the high numerical aperture objective using a piezo objective positioner. The motion of fluorescent microspheres is quantified using 3D3C super resolution particle-imaging velocimetry with instantaneous spatial resolutions of the order of 5 µm or less in all three dimensions. We examine 3D3C flow in a PDMS microchannel with an expanding section at 3D acquisition rates of 30 Hz, and find strong agreement with a computational model. Equations from the PIV and PTV literature adapted for a scanning objective provide estimates of maximum measurable velocity. The technique allows for isosurface visualization of 3D particle motion and robust high spatial resolution velocity measurements without requiring a calibration step or reconstruction algorithms. (paper)

  11. Advances in 4D treatment planning for scanned particle beam therapy - report of dedicated workshops.

    Science.gov (United States)

    Bert, Christoph; Graeff, Christian; Riboldi, Marco; Nill, Simeon; Baroni, Guido; Knopf, Antje-Christin

    2014-12-01

    We report on recent progress in the field of mobile tumor treatment with scanned particle beams, as discussed in the latest editions of the 4D treatment planning workshop. The workshop series started in 2009, with about 20 people from 4 research institutes involved, all actively working on particle therapy delivery and development. The first workshop resulted in a summary of recommendations for the treatment of mobile targets, along with a list of requirements to apply these guidelines clinically. The increased interest in the treatment of mobile tumors led to a continuously growing number of attendees: the 2012 edition counted more than 60 participants from 20 institutions and commercial vendors. The focus of research discussions among workshop participants progressively moved from 4D treatment planning to complete 4D treatments, aiming at effective and safe treatment delivery. Current research perspectives on 4D treatments include all critical aspects of time resolved delivery, such as in-room imaging, motion detection, beam application, and quality assurance techniques. This was motivated by the start of first clinical treatments of hepato cellular tumors with a scanned particle beam, relying on gating or abdominal compression for motion mitigation. Up to date research activities emphasize significant efforts in investigating advanced motion mitigation techniques, with a specific interest in the development of dedicated tools for experimental validation. Potential improvements will be made possible in the near future through 4D optimized treatment plans that require upgrades of the currently established therapy control systems for time resolved delivery. But since also these novel optimization techniques rely on the validity of the 4DCT, research focusing on alternative 4D imaging technique, such as MRI based 4DCT generation will continue.

  12. Soft X-ray scanning transmission X-ray microscopy (STXM) of actinide particles.

    Science.gov (United States)

    Nilsson, Hans J; Tyliszczak, Tolek; Wilson, Richard E; Werme, Lars; Shuh, David K

    2005-09-01

    A descriptive account is given of our most recent research on the actinide dioxides with the Advanced Light Source Molecular Environmental Science (ALS-MES) Beamline 11.0.2 soft X-ray scanning transmission X-ray microscope (STXM) at the Lawrence Berkeley National Laboratory (LBNL). The ALS-MES STXM permits near-edge X-ray absorption fine structure (NEXAFS) and imaging with 30-nm spatial resolution. The first STXM spectromicroscopy NEXAFS spectra at the actinide 4d5/2 edges of the imaged transuranic particles, NpO2 and PuO2, have been obtained. Radiation damage induced by the STXM was observed in the investigation of a mixed oxidation state particle (Np(V,VI)) and was minimized during collection of the actual spectra at the 4d5/2 edge of the Np(V,VI) solid. A plutonium elemental map was obtained from an irregular PuO2 particle with the dimensions of 650 x 650 nm. The Pu 4d5/2 NEXAFS spectra were collected at several different locations from the PuO2 particle and were identical. A representative oxygen K-edge spectrum from UO2 was collected and resembles the oxygen K-edge from the bulk material. The unique and current performance of the ALS-MES STXM at extremely low energies (ca. 100 eV) that may permit the successful measurement of the actinide 5d edge is documented. Finally, the potential of STXM as a tool for actinide investigations is briefly discussed.

  13. Monitoring and Quantifying Particles Emissions around Industrial Sites with Scanning Doppler Lidar

    Science.gov (United States)

    Thobois, L.; Royer, P.; Parmentier, R.; Brooks, M.; Knoepfle, A.; Alexander, J.; Stidwell, P.; Kumar, R.

    2018-04-01

    Scanning Coherent Doppler Lidars have been used over the last decade for measuring wind for applications in wind energy [1], meteorology [2] and aviation [3]. They allow for accurate measurements of wind speeds up to a distance of 10 km based on the Doppler shift effect of aerosols. The signal reflectivity (CNR or Carrier-to-Noise Ratio) profiles can also be retrieved from the strength of the Lidar signal. In this study, we will present the developments of algorithm for retrieving aerosol optical properties like the relative attenuated backscatter coefficient and the mass concentration of particles. The use of these algorithms during one operational trial in Point Samson, Western Australia to monitor fugitive emissions over a mine will be presented. This project has been initiated by the Australian Department of Environment Regulations to better determine the impact of the Port on the neighboring town. During the trial in Summer, the strong impact of turbulence refractive index on Lidar performances has been observed. Multiple methodologies have been applied to reduce this impact with more or less success. At the end, a dedicated setup and configuration have been established that allow to properly observe the plumes of the mine with the scanning Lidar. The Lidar data has also been coupled to beta attenuation in-situ sensors for retrieving mass concentration maps. A few case of dispersion of plumes will be presented showing the necessity to combine both the wind and aerosol data.

  14. Dosimetric consequences of pencil beam width variations in scanned beam particle therapy

    International Nuclear Information System (INIS)

    Chanrion, M A; Ammazzalorso, F; Wittig, A; Engenhart-Cabillic, R; Jelen, U

    2013-01-01

    Scanned ion beam delivery enables the highest degree of target dose conformation attainable in external beam radiotherapy. Nominal pencil beam widths (spot sizes) are recorded during treatment planning system commissioning. Due to changes in the beam-line optics, the actual spot sizes may differ from these commissioning values, leading to differences between planned and delivered dose. The purpose of this study was to analyse the dosimetric consequences of spot size variations in particle therapy treatment plans. For 12 patients with skull base tumours and 12 patients with prostate carcinoma, scanned-beam carbon ion and proton treatment plans were prepared and recomputed simulating spot size changes of (1) ±10% to simulate the typical magnitude of fluctuations, (2) ±25% representing the worst-case scenario and (3) ±50% as a part of a risk analysis in case of fault conditions. The primary effect of the spot size variation was a dose deterioration affecting the target edge: loss of target coverage and broadening of the lateral penumbra (increased spot size) or overdosage and contraction of the lateral penumbra (reduced spot size). For changes ⩽25%, the resulting planning target volume mean 95%-isodose line coverage (CI-95%) deterioration was ranging from negligible to moderate. In some cases changes in the dose to adjoining critical structures were observed. (paper)

  15. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  16. Harmonisation of nanoparticle concentration measurements using GRIMM and TSI scanning mobility particle sizers

    International Nuclear Information System (INIS)

    Joshi, Manish; Sapra, B. K.; Khan, Arshad; Tripathi, S. N.; Shamjad, P. M.; Gupta, Tarun; Mayya, Y. S.

    2012-01-01

    Regional studies focusing on the role of atmospheric nanoparticles in climate change have gained impetus in the last decade. Several multi-institutional studies involving measurement of nanoparticles with several kinds of instruments are on the rise. It is important to harmonize these measurements as the instruments may work on different techniques or principles and are developed by different manufacturers. Scanning mobility particle sizers (SMPS) are often used to measure size distribution of nanoparticles in the airborne phase. Two such commercially available instruments namely, GRIMM and TSI-SMPS have been compared for ambient and laboratory generated conditions. A stand-alone condensation particle counter (CPC) of TSI make was used as a reference for particle concentration measurements. The consistency of the results in terms of mean size and geometric standard deviation was seen to be excellent for both the SMPSs, with GRIMM always showing slightly (approximately 10 %) lower mean size. The integrated number concentration from GRIMM-SMPS was seen to be closer to stand-alone reference CPC compared to TSI-SMPS, for an ambient overnight comparison. However, a concentration-dependent response, i.e. the variations between the two instruments increasing with the concentration, was observed and possible reasons for this have been suggested. A separate experiment was performed for studying the modifying effect of diffusion dryer and sheath air dryer on the measured aerosol size spectra. A significant hygroscopic growth was noted when diffusion dryer was attached to one of the SMPS. The introduction of sheath air dryer in GRIMM-SMPS produced a significant shift towards lower mean size. These results have been compared and discussed with the recent inter-comparison results to strengthen and harmonize the measurement protocols.

  17. Harmonisation of nanoparticle concentration measurements using GRIMM and TSI scanning mobility particle sizers

    Science.gov (United States)

    Joshi, Manish; Sapra, B. K.; Khan, Arshad; Tripathi, S. N.; Shamjad, P. M.; Gupta, Tarun; Mayya, Y. S.

    2012-12-01

    Regional studies focusing on the role of atmospheric nanoparticles in climate change have gained impetus in the last decade. Several multi-institutional studies involving measurement of nanoparticles with several kinds of instruments are on the rise. It is important to harmonize these measurements as the instruments may work on different techniques or principles and are developed by different manufacturers. Scanning mobility particle sizers (SMPS) are often used to measure size distribution of nanoparticles in the airborne phase. Two such commercially available instruments namely, GRIMM and TSI-SMPS have been compared for ambient and laboratory generated conditions. A stand-alone condensation particle counter (CPC) of TSI make was used as a reference for particle concentration measurements. The consistency of the results in terms of mean size and geometric standard deviation was seen to be excellent for both the SMPSs, with GRIMM always showing slightly (approximately 10 %) lower mean size. The integrated number concentration from GRIMM-SMPS was seen to be closer to stand-alone reference CPC compared to TSI-SMPS, for an ambient overnight comparison. However, a concentration-dependent response, i.e. the variations between the two instruments increasing with the concentration, was observed and possible reasons for this have been suggested. A separate experiment was performed for studying the modifying effect of diffusion dryer and sheath air dryer on the measured aerosol size spectra. A significant hygroscopic growth was noted when diffusion dryer was attached to one of the SMPS. The introduction of sheath air dryer in GRIMM-SMPS produced a significant shift towards lower mean size. These results have been compared and discussed with the recent inter-comparison results to strengthen and harmonize the measurement protocols.

  18. Correlative scanning-transmission electron microscopy reveals that a chimeric flavivirus is released as individual particles in secretory vesicles.

    Directory of Open Access Journals (Sweden)

    Julien Burlaud-Gaillard

    Full Text Available The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy. CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.

  19. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  20. Scanning electron-microscopic and X-ray-microanalytic observation of diesel-emission particles associated with mutagenicity

    International Nuclear Information System (INIS)

    Nakashima, K.; Yoshitsugu, K.; Tokiwa, H.; Fukuoka Environmental Research Center

    1983-01-01

    The particles formed by diesel combustion, which may contain various mutagenic chemicals like polycyclic aromatic hydrocarbons (PAH), are analyzed in their morphology by scanning electron microscopy; their sulfur content is detected by X-ray microanalysis, and mutagenicity is tested with a Salmonella typhimurium bioassay. The authors find a close correlation between sulfur content and mutagenicity of PAH. (Auth.)

  1. First test model of the optical microscope which images the whole vertical particle tracks without any depth scanning

    International Nuclear Information System (INIS)

    Soroko, L.M.

    2001-01-01

    The first test model of the optical microscope which produces the in focus image of the whole vertical particle track without depth scanning is described. The in focus image of the object consisting of the linear array of the point-like elements was obtained. A comparison with primary out of focus image of such an object has been made

  2. Qualitative analysis of barium particles coated in small intestinal mucosa of rabbit by using scanning electron microscopy

    International Nuclear Information System (INIS)

    Lee, Yong Suk; Ha, Hyun Kwon; Lee, Yang Seob; Kim, Jae Kyun; Yoon, Seong Eon; Kim, Jung Hoon; Chung, Dong Jin; Auh, Yong Ho

    1998-01-01

    To qualitatively analysed barium coating status in the intestinal mucosa, we used scanning electron microscopy to observe barium particles coated in the small intestinal mucosa of rabbit, and we attempted to assess the relationship between electron microscopic findings and radiographic densities. Six different combination of barium and methylcellulose suspensions were infused into the resected small intestines of 15 rabbits. Barium powders were mixed with water to make 40% and 70% w/v barium solutions, and also mixed with 0.5% methylcellulose solutions were used as a double contrast agent. After the infusion of barium suspensions, a mammography unit was used to obtain radiographs of the small intestine, and their optical densities were measured by a densitometer. Thereafter, photographs of barium-coated small intestinal mucosa were obtained using a scanning electron microscope (x 8,000), and the number of barium particles in the unit area were measured. To compare the relationship between the electron microscopic findings and optical densities, statistical analysis using Spearman correlation was performed. This study shows that by using scanning electron microscopy, barium particles coated on the small intestinal mucosa can be qualitatively analysed. It also shows that the number of small barium particles measured by scanning electron microscopy is related to optical densities. (author). 14 refs., 2 figs

  3. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  4. The Particle inside a Ring: A Two-Dimensional Quantum Problem Visualized by Scanning Tunneling Microscopy

    Science.gov (United States)

    Ellison, Mark D.

    2008-01-01

    The one-dimensional particle-in-a-box model used to introduce quantum mechanics to students suffers from a tenuous connection to a real physical system. This article presents a two-dimensional model, the particle confined within a ring, that directly corresponds to observations of surface electrons in a metal trapped inside a circular barrier.…

  5. Classification of Multiple Types of Organic Carbon Composition in Atmospheric Particles by Scanning Transmission X-Ray Microscopy Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kilcoyne, Arthur L; Takahama, S.; Gilardoni, S.; Russell, L.M.; Kilcoyne, A.L.D.

    2007-05-16

    A scanning transmission X-ray microscope at the Lawrence Berkeley National Laboratory is used to measure organic functional group abundance and morphology of atmospheric aerosols. We present a summary of spectra, sizes, and shapes observed in 595 particles that were collected and analyzed between 2000 and 2006. These particles ranged between 0.1 and 12 mm and represent aerosols found in a large range of geographical areas, altitudes, and times. They include samples from seven different field campaigns: PELTI, ACE-ASIA, DYCOMS II, Princeton, MILAGRO (urban), MILAGRO (C-130), and INTEX-B. At least 14 different classes of organic particles show different types of spectroscopic signatures. Different particle types are found within the same region while the same particle types are also found in different geographical domains. Particles chemically resembling black carbon, humic-like aerosols, pine ultisol, and secondary or processed aerosol have been identified from functional group abundance and comparison of spectra with those published in the literature.

  6. Scanning of irradiated silicon detectors using $\\alpha$ particles and low energy protons

    CERN Document Server

    Casse, G L; Glaser, M; Kohout, Z; Konícek, J; Lemeilleur, F; Leroy, C; Linhart, V; Mares, J J; Pospísil, S; Roy, P; Sopko, B; Sinor, M; Svejda, J; Vorobel, V; Wilhelm, I

    1999-01-01

    In a spectroscopic study of non-irradiated and proton-irradiated silicon diodes, the detectors were illuminated from the front side and from the rear side by various alpha particle sources (mainly ThC') and by monoenergetic protons with energies from 1.0 to 2.5~MeV. Their response characteristics have been studied as a function of the incoming particle energy and the applied bias voltage. The charge collection efficiency was determined as a function of fluence

  7. Real-time scanning charged-particle microscope image composition with correction of drift.

    Science.gov (United States)

    Cizmar, Petr; Vladár, András E; Postek, Michael T

    2011-04-01

    In this article, a new scanning electron microscopy (SEM) image composition technique is described, which can significantly reduce drift related image corruptions. Drift distortion commonly causes blur and distortions in the SEM images. Such corruption ordinarily appears when conventional image-acquisition methods, i.e., "slow scan" and "fast scan," are applied. The damage is often very significant; it may render images unusable for metrology applications, especially where subnanometer accuracy is required. The described correction technique works with a large number of quickly taken frames, which are properly aligned and then composed into a single image. Such image contains much less noise than the individual frames, while the blur and deformation is minimized. This technique also provides useful information about changes of the sample position in time, which may be applied to investigate the drift properties of the instrument without a need of additional equipment.

  8. Integral charged particle nuclear data bibliography: Literature scanned from April 11, 1987 through November 10, 1988

    International Nuclear Information System (INIS)

    Holden, N.E.; Ramavataram, S.

    1988-12-01

    This publication is the annual supplement to the first edition published in 1984. The primary goal of this publication has been to satisfy the need expressed by the Nuclear Reaction Data Center Network for a concise and comprehensive bibliography of integral charged-particle cross section data. The reader is referred to a partial list of other bibliographies relevant to charged-particle-induced reaction data and to ''A Source List of Nuclear Data Bibliographies, Compilations, and Evaluations'' for a more comprehensive list. Since this publication is not cumulative, earlier versions are also shown in this paper. This publication makes use of a modification to the database of the Nuclear Structure References (NSR) file. This modification allows the retrieval of integral charged particle nuclear data entries from the NSR file. In recent years, the presentation of various sections was changed, as a result of users' suggestions. The authors continue to welcome users' comments. 190 refs., 3 tabs

  9. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  10. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  11. Continuous scanning of the mobility and size distribution of charged clusters and nanometer particles in atmospheric air and the Balanced Scanning Mobility Analyzer BSMA

    Science.gov (United States)

    Tammet, H.

    2006-12-01

    Measuring of charged nanometer particles in atmospheric air is a routine task in research on atmospheric electricity, where these particles are called the atmospheric ions. An aspiration condenser is the most popular instrument for measuring atmospheric ions. Continuous scanning of a mobility distribution is possible when the aspiration condenser is connected as an arm of a balanced bridge. Transfer function of an aspiration condenser is calculated according to the measurements of geometric dimensions, air flow rate, driving voltage, and electric current. The most complicated phase of the calibration is the estimation of the inlet loss of ions due to the Brownian deposition. The available models of ion deposition on the protective inlet screen and the inlet control electrofilter have the uncertainty of about 20%. To keep the uncertainty of measurements low the adsorption should not exceed a few tens of percent. The online conversion of the mobility distribution to the size distribution and a correct reduction of inlet losses are possible when air temperature and pressure are measured simultaneously with the mobility distribution. Two instruments called the Balanced Scanning Mobility Analyzers (BSMA) were manufactured and tested in routine atmospheric measurements. The concentration of atmospheric ions of the size of about a few nanometers is very low and a high air flow rate is required to collect enough of ion current. The air flow of 52 l/s exceeds the air flow in usual aerosol instruments by 2-3 orders of magnitude. The high flow rate reduces the time of ion passage to 60 ms and the heating of air in an analyzer to 0.2 K, which suppresses a possible transformation of ions inside the instrument. The mobility range of the BSMA of 0.032-3.2 cm 2 V - 1 s - 1 is logarithmically uniformly divided into 16 fractions. The size distribution is presented by 12 fractions in the diameter range of 0.4-7.5 nm. The measurement noise of a fraction concentration is typically

  12. Time-averaged probability density functions of soot nanoparticles along the centerline of a piloted turbulent diffusion flame using a scanning mobility particle sizer

    KAUST Repository

    Chowdhury, Snehaunshu; Boyette, Wesley; Roberts, William L.

    2017-01-01

    In this study, we demonstrate the use of a scanning mobility particle sizer (SMPS) as an effective tool to measure the probability density functions (PDFs) of soot nanoparticles in turbulent flames. Time-averaged soot PDFs necessary for validating

  13. Uncertainty propagation using the Monte Carlo method in the measurement of airborne particle size distribution with a scanning mobility particle sizer

    Science.gov (United States)

    Coquelin, L.; Le Brusquet, L.; Fischer, N.; Gensdarmes, F.; Motzkus, C.; Mace, T.; Fleury, G.

    2018-05-01

    A scanning mobility particle sizer (SMPS) is a high resolution nanoparticle sizing system that is widely used as the standard method to measure airborne particle size distributions (PSD) in the size range 1 nm–1 μm. This paper addresses the problem to assess the uncertainty associated with PSD when a differential mobility analyzer (DMA) operates under scanning mode. The sources of uncertainty are described and then modeled either through experiments or knowledge extracted from the literature. Special care is brought to model the physics and to account for competing theories. Indeed, it appears that the modeling errors resulting from approximations of the physics can largely affect the final estimate of this indirect measurement, especially for quantities that are not measured during day-to-day experiments. The Monte Carlo method is used to compute the uncertainty associated with PSD. The method is tested against real data sets that are monosize polystyrene latex spheres (PSL) with nominal diameters of 100 nm, 200 nm and 450 nm. The median diameters and associated standard uncertainty of the aerosol particles are estimated as 101.22 nm  ±  0.18 nm, 204.39 nm  ±  1.71 nm and 443.87 nm  ±  1.52 nm with the new approach. Other statistical parameters, such as the mean diameter, the mode and the geometric mean and associated standard uncertainty, are also computed. These results are then compared with the results obtained by SMPS embedded software.

  14. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  15. WE-FG-BRB-02: Spatial Mapping of the RBE of Scanned Particle Beams

    Energy Technology Data Exchange (ETDEWEB)

    Grosshans, D. [The University of Texas MD Anderson Cancer Center (United States)

    2016-06-15

    The physical pattern of energy deposition and the enhanced relative biological effectiveness (RBE) of protons and carbon ions compared to photons offer unique and not fully understood or exploited opportunities to improve the efficacy of radiation therapy. Variations in RBE within a pristine or spread out Bragg peak and between particle types may be exploited to enhance cell killing in target regions without a corresponding increase in damage to normal tissue structures. In addition, the decreased sensitivity of hypoxic tumors to photon-based therapies may be partially overcome through the use of more densely ionizing radiations. These and other differences between particle and photon beams may be used to generate biologically optimized treatments that reduce normal tissue complications. In this symposium, speakers will examine the impact of the RBE of charged particles on measurable biological endpoints, treatment plan optimization, and the prediction or retrospective assessment of treatment outcomes. In particular, an AAPM task group was formed to critically examine the evidence for a spatially-variant RBE in proton therapy. Current knowledge of proton RBE variation with respect to dose, biological endpoint, and physics parameters will be reviewed. Further, the clinical relevance of these variations will be discussed. Recent work focused on improving simulations of radiation physics and biological response in proton and carbon ion therapy will also be presented. Finally, relevant biology research and areas of research needs will be highlighted, including the dependence of RBE on genetic factors including status of DNA repair pathways, the sensitivity of cancer stem-like cells to charged particles, the role of charged particles in hypoxic tumors, and the importance of fractionation effects. In addition to the physical advantages of protons and more massive ions over photons, the future application of biologically optimized treatment plans and their potential to

  16. Charge state mapping of mixed valent iron and manganese mineral particles using Scanning Transmission X-ray Microscopy (STXM)

    International Nuclear Information System (INIS)

    Pecher, K.; Nealson, K.; Kneedler, E.; Rothe, J.; Meigs, G.; Warwick, T.; Tonner, B.

    2000-01-01

    The interfaces between solid mineral particles and water play a crucial role in partitioning and chemical transformation of many inorganic as well as organic pollutants in environmental systems. Among environmentally significant minerals, mixed-valent oxides and hydroxides of iron (e.g. magnetite, green rusts) and manganese (hausmanite, birnessite) have been recognized as particularly strong sorbents for metal ions. In addition, minerals containing Fe(II) have recently been proven to be powerful reductants for a wide range of pollutants. Chemical properties of these minerals strongly depend on the distribution and availability of reactive sites and little is known quantitatively about the nature of these sites. We have investigated the bulk distribution of charge states of manganese (Mn (II, III, IV)) and iron (Fe(II, III)) in single particles of natural manganese nodules and synthetic green rusts using Scanning Transmission X-ray SpectroMicroscopy (STXM). Pixel resolved spectra (XANES) extracted from stacks of images taken at different wave lengths across the metal absorption edge were fitted to total electron yield (TEY) spectra of single valent reference compounds. Two dimensional maps of bulk charge state distributions clearly reveal domains of different oxidation states within single particles of Mn-nodules and green rust precipitates. Changes of oxidation states of iron were followed as a result of reductive transformation of an environmental contaminant (CCl 4 ) using green rust as the only reductant

  17. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  18. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  19. Photogrammetry of the three-dimensional shape and texture of a nanoscale particle using scanning electron microscopy and free software

    International Nuclear Information System (INIS)

    Gontard, Lionel C.; Schierholz, Roland; Yu, Shicheng; Cintas, Jesús; Dunin-Borkowski, Rafal E.

    2016-01-01

    We apply photogrammetry in a scanning electron microscope (SEM) to study the three-dimensional shape and surface texture of a nanoscale LiTi_2(PO_4)_3 particle. We highlight the fact that the technique can be applied non-invasively in any SEM using free software (freeware) and does not require special sample preparation. Three-dimensional information is obtained in the form of a surface mesh, with the texture of the sample stored as a separate two-dimensional image (referred to as a UV Map). The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass, while the UV map can be used to study the surface texture using conventional image processing techniques. We also illustrate the use of 3D printing to visualize the reconstructed model. - Highlights: • 3D shape and surface texture of a nanoscale LiTi_2(PO_4)_3 particle. • The technique can be applied non-invasively in any SEM using freeware software. • The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass. • The UV map can be processed using 2D image processing software.

  20. Photogrammetry of the three-dimensional shape and texture of a nanoscale particle using scanning electron microscopy and free software

    Energy Technology Data Exchange (ETDEWEB)

    Gontard, Lionel C., E-mail: lionelcg@gmail.com [Departamento de Ciencia de los Materiales e Ingeniería Metalúrgica y Química Inorgánica, Universidad de Cádiz, Puerto Real 11510 (Spain); Faico PCT Cartuja. Edif. TI Marie Curie, C/ Leonardo da Vinci 18, 4a Planta, 41092 Sevilla (Spain); Schierholz, Roland; Yu, Shicheng [Institute of Energy and Climate Research, Fundamental Electrochemistry (IEK-9), Forschungszentrum Jülich, D-52425 Jülich (Germany); Cintas, Jesús [Servicio de Microscopía Centro de Investigación, Tecnología e Innovación (CITIUS), Universidad de Sevilla, Av. Reina Mercedes 4b, 41012 Sevilla (Spain); Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany)

    2016-10-15

    We apply photogrammetry in a scanning electron microscope (SEM) to study the three-dimensional shape and surface texture of a nanoscale LiTi{sub 2}(PO{sub 4}){sub 3} particle. We highlight the fact that the technique can be applied non-invasively in any SEM using free software (freeware) and does not require special sample preparation. Three-dimensional information is obtained in the form of a surface mesh, with the texture of the sample stored as a separate two-dimensional image (referred to as a UV Map). The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass, while the UV map can be used to study the surface texture using conventional image processing techniques. We also illustrate the use of 3D printing to visualize the reconstructed model. - Highlights: • 3D shape and surface texture of a nanoscale LiTi{sub 2}(PO{sub 4}){sub 3} particle. • The technique can be applied non-invasively in any SEM using freeware software. • The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass. • The UV map can be processed using 2D image processing software.

  1. Escherichia coli pyruvate dehydrogenase complex: particle masses of the complex and component enzymes measured by scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    CaJacob, C.A.; Frey, P.A.; Hainfeld, J.F.; Wall, J.S.; Yang, H.

    1985-01-01

    Particle masses of the Escherichia coli pyruvate dehydrogenase (PDH) complex and its component enzymes have been measured by scanning transmission electron microscopy (STEM). The particle mass of PDH complex measured by STEM is 5.28 X 10(6) with a standard deviation of 0.40 X 10(6). The masses of the component enzymes are 2.06 X 10(5) for the dimeric pyruvate dehydrogenase (E1), 1.15 X 10(5) for dimeric dihydrolipoyl dehydrogenase (E3), and 2.20 X 10(6) for dihydrolipoyl transacetylase (E2), the 24-subunit core enzyme. STEM measurements on PDH complex incubated with excess E3 or E1 failed to detect any additional binding of E3 but showed that the complex would bind additional E1 under forcing conditions. The additional E1 subunits were bound too weakly to represent binding sites in an isolated or isolable complex. The mass measurements by STEM are consistent with the subunit composition 24:24:12 when interpreted in the light of the flavin content of the complex and assuming 24 subunits in the core enzyme (E2)

  2. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  3. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  4. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  5. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  6. Scanning table

    CERN Multimedia

    1960-01-01

    Before the invention of wire chambers, particles tracks were analysed on scanning tables like this one. Today, the process is electronic and much faster. Bubble chamber film - currently available - (links can be found below) was used for this analysis of the particle tracks.

  7. SU-F-T-184: 3D Range-Modulator for Scanned Particle Therapy: Development, Monte Carlo Simulations and Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Simeonov, Y; Penchev, P; Ringbaek, T Printz [University of Applied Sciences, Institute of Medical Physics and Radiation Protection, Giessen (Germany); Brons, S [Heidelberg Ion-Beam Therapy Center (HIT), Heidelberg (Germany); Weber, U [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Zink, K [University of Applied Sciences, Institute of Medical Physics and Radiation Protection, Giessen (Germany); University Hospital Giessen-Marburg, Marburg (Germany)

    2016-06-15

    Purpose: Active raster scanning in particle therapy results in highly conformal dose distributions. Treatment time, however, is relatively high due to the large number of different iso-energy layers used. By using only one energy and the so called 3D range-modulator irradiation times of a few seconds only can be achieved, thus making delivery of homogeneous dose to moving targets (e.g. lung cancer) more reliable. Methods: A 3D range-modulator consisting of many pins with base area of 2.25 mm2 and different lengths was developed and manufactured with rapid prototyping technique. The form of the 3D range-modulator was optimised for a spherical target volume with 5 cm diameter placed at 25 cm in a water phantom. Monte Carlo simulations using the FLUKA package were carried out to evaluate the modulating effect of the 3D range-modulator and simulate the resulting dose distribution. The fine and complicated contour form of the 3D range-modulator was taken into account by a specially programmed user routine. Additionally FLUKA was extended with the capability of intensity modulated scanning. To verify the simulation results dose measurements were carried out at the Heidelberg Ion Therapy Center (HIT) with a 400.41 MeV 12C beam. Results: The high resolution measurements show that the 3D range-modulator is capable of producing homogeneous 3D conformal dose distributions, simultaneously reducing significantly irradiation time. Measured dose is in very good agreement with the previously conducted FLUKA simulations, where slight differences were traced back to minor manufacturing deviations from the perfect optimised form. Conclusion: Combined with the advantages of very short treatment time the 3D range-modulator could be an alternative to treat small to medium sized tumours (e.g. lung metastasis) with the same conformity as full raster-scanning treatment. Further simulations and measurements of more complex cases will be conducted to investigate the full potential of the 3D

  8. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  9. Special report: workshop on 4D-treatment planning in actively scanned particle therapy--recommendations, technical challenges, and future research directions.

    Science.gov (United States)

    Knopf, Antje; Bert, Christoph; Heath, Emily; Nill, Simeon; Kraus, Kim; Richter, Daniel; Hug, Eugen; Pedroni, Eros; Safai, Sairos; Albertini, Francesca; Zenklusen, Silvan; Boye, Dirk; Söhn, Matthias; Soukup, Martin; Sobotta, Benjamin; Lomax, Antony

    2010-09-01

    This article reports on a 4D-treatment planning workshop (4DTPW), held on 7-8 December 2009 at the Paul Scherrer Institut (PSI) in Villigen, Switzerland. The participants were all members of institutions actively involved in particle therapy delivery and research. The purpose of the 4DTPW was to discuss current approaches, challenges, and future research directions in 4D-treatment planning in the context of actively scanned particle radiotherapy. Key aspects were addressed in plenary sessions, in which leaders of the field summarized the state-of-the-art. Each plenary session was followed by an extensive discussion. As a result, this article presents a summary of recommendations for the treatment of mobile targets (intrafractional changes) with actively scanned particles and a list of requirements to elaborate and apply these guidelines clinically.

  10. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  11. X-ray analysis of a single aerosol particle with combination of scanning electron microscope and synchrotron radiation X-ray microscope

    International Nuclear Information System (INIS)

    Toyoda, Masatoshi; Kaibuchi, Kazuki; Nagasono, Mitsuru; Terada, Yasuko; Tanabe, Teruo; Hayakawa, Shinjiro; Kawai, Jun

    2004-01-01

    We developed a microscope by a combination of synchrotron radiation X-ray fluorescence (SR-XRF) microscope and scanning electron microscope (SEM) with an energy dispersive X-ray spectrometer (EDX). SR-XRF is appropriate to detect trace and micro amount of elements and sensitive to heavy elements in an analyte but it cannot observe the real time image. SEM-EDX can observe the secondary electron image of a single particle in real time and is appropriate to detect lighter elements. This combination microscope can ensure the identification of the XRF spectrum to the SEM image without transferring the sample. For aerosol analysis, it is important to analyze each particle. The present method makes feasible to analyze not only the average elemental composition as the total particles but also elemental composition of each particle, which is dependent on the particle shape and size. The microscope was applied to an individual aerosol particle study. The X-ray spectra were different among the particles, but also different between SR-XRF and SEM-EDX for the same particle, due to the difference in fluorescence yields between X-ray excitation and electron excitation

  12. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  13. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  14. Photon event distribution sampling: an image formation technique for scanning microscopes that permits tracking of sub-diffraction particles with high spatial and temporal resolutions.

    Science.gov (United States)

    Larkin, J D; Publicover, N G; Sutko, J L

    2011-01-01

    In photon event distribution sampling, an image formation technique for scanning microscopes, the maximum likelihood position of origin of each detected photon is acquired as a data set rather than binning photons in pixels. Subsequently, an intensity-related probability density function describing the uncertainty associated with the photon position measurement is applied to each position and individual photon intensity distributions are summed to form an image. Compared to pixel-based images, photon event distribution sampling images exhibit increased signal-to-noise and comparable spatial resolution. Photon event distribution sampling is superior to pixel-based image formation in recognizing the presence of structured (non-random) photon distributions at low photon counts and permits use of non-raster scanning patterns. A photon event distribution sampling based method for localizing single particles derived from a multi-variate normal distribution is more precise than statistical (Gaussian) fitting to pixel-based images. Using the multi-variate normal distribution method, non-raster scanning and a typical confocal microscope, localizations with 8 nm precision were achieved at 10 ms sampling rates with acquisition of ~200 photons per frame. Single nanometre precision was obtained with a greater number of photons per frame. In summary, photon event distribution sampling provides an efficient way to form images when low numbers of photons are involved and permits particle tracking with confocal point-scanning microscopes with nanometre precision deep within specimens. © 2010 The Authors Journal of Microscopy © 2010 The Royal Microscopical Society.

  15. A simple method for detection of gunshot residue particles from hands, hair, face, and clothing using scanning electron microscopy/wavelength dispersive X-ray (SEM/WDX).

    Science.gov (United States)

    Kage, S; Kudo, K; Kaizoji, A; Ryumoto, J; Ikeda, H; Ikeda, N

    2001-07-01

    We devised a simple and rapid method for detection of gunshot residue (GSR) particles, using scanning electron microscopy/wavelength dispersive X-ray (SEM/WDX) analysis. Experiments were done on samples containing GSR particles obtained from hands, hair, face, and clothing, using double-sided adhesive coated aluminum stubs (tape-lift method). SEM/WDX analyses for GSR were carried out in three steps: the first step was map analysis for barium (Ba) to search for GSR particles from lead styphnate primed ammunition, or tin (Sn) to search for GSR particles from mercury fulminate primed ammunition. The second step was determination of the location of GSR particles by X-ray imaging of Ba or Sn at a magnification of x 1000-2000 in the SEM, using data of map analysis, and the third step was identification of GSR particles, using WDX spectrometers. Analysis of samples from each primer of a stub took about 3 h. Practical applications were shown for utility of this method.

  16. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  17. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  18. The application of scanning electron microscopy to the determination of elemental and isotopic composition in individual actinide particles

    International Nuclear Information System (INIS)

    Vatter, I.; Cattle, G.; Tushingham, J.

    2000-01-01

    Techniques for the determination of both elemental and isotopic composition of actinides within single particles are required by the IAEA in support of their environmental safeguards programme. SEM and SIMS are valuable techniques for the measurement of elemental and isotopic composition, respectively, on the particle scale. The potential for effective combination of SEM and SIMS has been investigated at Harwell Laboratory. In trials, copper finder grids have been successfully used to enable re-identification of particles between SEM and SIMS instruments. Use of the grids enables rapid relocation of particles pre-selected by SEM for SIMS measurement. The work has highlighted a possible matrix effect in plutonium measurement that results in variable sensitivity dependent on the presence of other elements (including uranium). This effect would limit the use of SIMS to obtain elemental ratios, and highlights the requirement to use both SEM and SIMS to gain full and accurate information. The possible use of autoradiography as an adjunct to SEM has been investigated. In principle, autoradiography could be used to identify higher enrichments of uranium and enable pre-selection of particles for SIMS measurement. During trials, practical problems have been encountered which have demonstrated this particular approach to be unsuitable. (author)

  19. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  20. Impact of Membrane-Induced Particle Immobilization on Seeded Growth Monitored by In Situ Liquid Scanning Transmission Electron Microscopy.

    Science.gov (United States)

    Weiner, Rebecca G; Chen, Dennis P; Unocic, Raymond R; Skrabalak, Sara E

    2016-05-01

    In situ liquid cell scanning transmission electron microscopy probes seeded growth in real time. The growth of Pd on Au nanocubes is monitored as a model system to compare growth within a liquid cell and traditional colloidal synthesis. Different growth patterns are observed due to seed immobilization and the highly reducing environment within the liquid cell. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  3. Time-averaged probability density functions of soot nanoparticles along the centerline of a piloted turbulent diffusion flame using a scanning mobility particle sizer

    KAUST Repository

    Chowdhury, Snehaunshu

    2017-01-23

    In this study, we demonstrate the use of a scanning mobility particle sizer (SMPS) as an effective tool to measure the probability density functions (PDFs) of soot nanoparticles in turbulent flames. Time-averaged soot PDFs necessary for validating existing soot models are reported at intervals of ∆x/D∆x/D = 5 along the centerline of turbulent, non-premixed, C2H4/N2 flames. The jet exit Reynolds numbers of the flames investigated were 10,000 and 20,000. A simplified burner geometry based on a published design was chosen to aid modelers. Soot was sampled directly from the flame using a sampling probe with a 0.5-mm diameter orifice and diluted with N2 by a two-stage dilution process. The overall dilution ratio was not evaluated. An SMPS system was used to analyze soot particle concentrations in the diluted samples. Sampling conditions were optimized over a wide range of dilution ratios to eliminate the effect of agglomeration in the sampling probe. Two differential mobility analyzers (DMAs) with different size ranges were used separately in the SMPS measurements to characterize the entire size range of particles. In both flames, the PDFs were found to be mono-modal in nature near the jet exit. Further downstream, the profiles were flatter with a fall-off at larger particle diameters. The geometric mean of the soot size distributions was less than 10 nm for all cases and increased monotonically with axial distance in both flames.

  4. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  5. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  6. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  7. Scanning electron microscopy applied to the study of solid pollution particles deposited on monumental stone; La microscopia electronica de barrido aplicada al estudio de particulas solidas de contaminacion depositadas sobre la piedra momumental

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Pache, F.; Alonso, F.J.; Esbert, R.M. [Departamento de Geologia, Universidad de Oviedo (Spain)

    1996-06-01

    Solid pollution particles play an important role in the decay of monumental stone. Scanning electron microscopy (SEM) in conjunction with microanalysis (EDX) are a very valuable study tool. In the present paper, particular attention is paid to sample collection and preparation. Examples of particles providing information on the source of decay are submitted. (Author) 9 refs.

  8. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  9. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  10. Final Report on Small Particle Speciation for Forensics Analysis by Soft X-ray Scanning Transmission X-ray Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Pacold, J. I. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Altman, A. B. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Univ. of California, Berkeley, CA (United States); Donald, S B [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dai, Z. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Davisson, M. L. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Holliday, K S [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Knight, K. B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kristo, M. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Minasian, S. G. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Nelson, A J [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tyliszczak, T [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Booth, C. H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Shuh, D. K. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-09-30

    Materials of interest for nuclear forensic science are often highly heterogeneous, containing complex mixtures of actinide compounds in a wide variety of matrices. Scanning transmission X-ray microscopy (STXM) is ideally suited to study such materials, as it can be used to chemically image specimens by acquiring X-ray absorption near-edge spectroscopy (XANES) data with 25 nm spatial resolution. In particular, STXM in the soft X-ray synchrotron radiation regime (approximately 120 – 2000 eV) can collect spectroscopic information from the actinides and light elements in a single experiment. Thus, STXM combines the chemical sensitivity of X-ray absorption spectroscopy with high spatial resolution in a single non-destructive characterization method. This report describes the application of STXM to a broad range of nuclear materials. Where possible, the spectroscopic images obtained by STXM are compared with information derived from other analytical methods, and used to make inferences about the process history of each material. STXM measurements can yield information including the morphology of a sample, “elemental maps” showing the spatial distribution of major chemical constituents, and XANES spectra from localized regions of a sample, which may show spatial variations in chemical composition.

  11. Scanning and transmission electron microscopy study of the microstructural changes occurring in aluminium matrix composites reinforced with SiC particles during casting and welding: interface reactions

    Science.gov (United States)

    Urena; Gomez De Salazar JM; Gil; Escalera; Baldonedo

    1999-11-01

    Processing of aluminium matrix composites (AMCs), especially those constituted by a reactive system such as Al-SiC, presents great difficulties which limit their potential applications. The interface reactivity between SiC and molten Al generates an aluminium carbide which degrades the composite properties. Scanning and transmission electron microscopes equipped with energy-dispersive X-ray spectroscopes are essential tools for determining the structure and chemistry of the Al-SiC interfaces in AMCs and changes occurring during casting and arc welding. In the present work, an aluminium-copper alloy (AA2014) reinforced with three different percentages of SiC particles was subjected to controlled remelting tests, at temperatures in the range 750-900 degrees C for 10 and 30 min. Arc welding tests using a tungsten intert gas with power inputs in the range 850-2000 W were also carried out. The results of these studies showed that during remelting there is preferential SiC particle consumption with formation of Al4C3 by interface reaction between the solid SiC particle and the molten aluminium matrix. The formation of Al4C3 by the same mechanism has also been detected in molten pools of arc welded composites. However, in this case there was formation of an almost continuous layer of Al4C3, which protects the particle against further consumption, and formation of aciculate aluminium carbide on the top weld. Both are formed by fusion and dissolution of the SiC in molten aluminium followed by reaction and precipitation of the Al4C3 during cooling.

  12. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  13. Neutral Particle Analyzer Vertically Scanning Measurements of MHD-induced Energetic Ion Redistribution or Loss in the National Spherical Torus Experiment

    Energy Technology Data Exchange (ETDEWEB)

    S.S. Medley, R. Andre, R.E. Bell, D.S. Darrow, C.W. Domier, E.D. Fredrickson, N.N. Gorelenkov, S.M. Kaye, B.P. LeBlanc, K.C. Lee, F.M. Levinton, D. Liu, N.C. Luhmann, Jr., J.E. Menard, H. Park, D. Stutman, A.L. Roquemore, K. Tritz, H. Yuh and the NSTX Team

    2007-11-15

    Observations of magneto-hydro-dynamic (MHD) induced redistribution or loss of energetic ions measured using the vertically scanning capability of the Neutral Particle Analyzer diagnostic on the National Spherical Torus Experiment (NSTX) are presented along with TRANSP and ORBIT code analysis of the results. Although redistribution or loss of energetic ions due to bursting fishbone-like and low-frequency (f ~ 10 kHz) kinktype MHD activity has been reported previously, the primary goal of this work is to study redistribution or loss due to continuous Alfvénic (f ~ 20 – 150 kHz) modes, a topic that heretofore has not been investigated in detail for NSTX plasmas. Initial indications are that the former drive energetic ion loss whereas the continuous Alfvénic modes only cause redistribution and the energetic ions remain confined.

  14. Neutral Particle Analyzer Vertically Scanning Measurements of MHD-induced Energetic Ion Redistribution or Loss in the National Spherical Torus Experiment

    International Nuclear Information System (INIS)

    Medley, S.S.; Andre, R.; Bell, R.E.; Darrow, D.S.; Domier, C.W.; Fredrickson, E.D.; Gorelenkov, N.N.; Kaye, S.M.; LeBlanc, B.P.; Lee, K.C.; Levinton, F.M.; Liu, D.; Luhmann, N.C. Jr.; Menard, J.E.; Park, H.; Stutman, D.; Roquemore, A.L.; Tritz, K.; Yuh, H

    2007-01-01

    Observations of magneto-hydro-dynamic (MHD) induced redistribution or loss of energetic ions measured using the vertically scanning capability of the Neutral Particle Analyzer diagnostic on the National Spherical Torus Experiment (NSTX) are presented along with TRANSP and ORBIT code analysis of the results. Although redistribution or loss of energetic ions due to bursting fishbone-like and low-frequency (f ∼ 10 kHz) kinktype MHD activity has been reported previously, the primary goal of this work is to study redistribution or loss due to continuous Alfvenic (f ∼ 20-150 kHz) modes, a topic that heretofore has not been investigated in detail for NSTX plasmas. Initial indications are that the former drive energetic ion loss whereas the continuous Alfvenic modes only cause redistribution and the energetic ions remain confined.

  15. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. SU-C-207A-06: On-Line Beam Range Verification with Multiple Scanning Particle Beams: Initial Feasibility Study with Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Zhong, Y; Sun, X; Lu, W; Jia, X; Wang, J; Shao, Y [The University of Texas Southwestern Medical Ctr., Dallas, TX (United States)

    2016-06-15

    Purpose: To investigate the feasibility and requirement for intra-fraction on-line multiple scanning particle beam range verifications (BRVs) with in-situ PET imaging, which is beyond the current single-beam BRV with extra factors that will affect the BR measurement accuracy, such as beam diameter, separation between beams, and different image counts at different BRV positions. Methods: We simulated a 110-MeV proton beam with 5-mm diameter irradiating a uniform PMMA phantom by GATE simulation, which generated nuclear interaction-induced positrons. In this preliminary study, we simply duplicated these positrons and placed them next to the initial protons to approximately mimic the two spatially separated positron distributions produced by two beams parallel to each other but with different beam ranges. These positrons were then imaged by a PET (∼2-mm resolution, 10% sensitivity, 320×320×128 mm^3 FOV) with different acquisition times. We calculated the positron activity ranges (ARs) from reconstructed PET images and compared them with the corresponding ARs of original positron distributions. Results: Without further image data processing and correction, the preliminary study show the errors between the measured and original ARs varied from 0.2 mm to 2.3 mm as center-to-center separations and range differences were in the range of 8–12 mm and 2–8 mm respectively, indicating the accuracy of AR measurement strongly depends on the beam separations and range differences. In addition, it is feasible to achieve ≤ 1.0-mm accuracy for both beams with 1-min PET acquisition and 12 mm beam separation. Conclusion: This study shows that the overlap between the positron distributions from multiple scanning beams can significantly impact the accuracy of BRVs of distributed particle beams and need to be further addressed beyond the established method of single-beam BRV, but it also indicates the feasibility to achieve accurate on-line multi-beam BRV with further improved

  17. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  18. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  19. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  20. Scanning holograms

    International Nuclear Information System (INIS)

    Natali, S.

    1984-01-01

    This chapter reports on the scanning of 1000 holograms taken in HOBC at CERN. Each hologram is triggered by an interaction in the chamber, the primary particles being pions at 340 GeV/c. The aim of the experiment is the study of charm production. The holograms, recorded on 50 mm film with the ''in line'' technique, can be analyzed by shining a parallel expanded laser beam through the film, obtaining immediately above it the real image of the chamber which can then be scanned and measured with a technique half way between emulsions and bubble chambers. The results indicate that holograms can be analyzed as quickly and reliably as in other visual techniques and that to them is open the same order of magnitude of large scale experiments

  1. Multispecies Biofilms Transform Selenium Oxyanions into Elemental Selenium Particles: Studies Using Combined Synchrotron X-ray Fluorescence Imaging and Scanning Transmission X-ray Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Soo In; George, Graham N.; Lawrence, John R.; Kaminskyj, Susan G. W.; Dynes, James J.; Lai, Barry; Pickering, Ingrid J.

    2016-10-04

    Selenium (Se) is an element of growing environmental concern, because low aqueous concentrations can lead to biomagnification through the aquatic food web. Biofilms, naturally occurring microbial consortia, play numerous important roles in the environment, especially in biogeochemical cycling of toxic elements in aquatic systems. The complexity of naturally forming multispecies biofilms presents challenges for characterization because conventional microscopic techniques require chemical and physical modifications of the sample. Here, multispecies biofilms biotransforming selenium oxyanions were characterized using X-ray fluorescence imaging (XFI) and scanning transmission X-ray microscopy (STXM). These complementary synchrotron techniques required minimal sample preparation and were applied correlatively to the same biofilm areas. Sub-micrometer XFI showed distributions of Se and endogenous metals, while Se K-edge X-ray absorption spectroscopy indicated the presence of elemental Se (Se0). Nanoscale carbon K-edge STXM revealed the distributions of microbial cells, extracellular polymeric substances (EPS), and lipids using the protein, saccharide, and lipid signatures, respectively, together with highly localized Se0 using the Se LIII edge. Transmission electron microscopy showed the electron-dense particle diameter to be 50–700 nm, suggesting Se0 nanoparticles. The intimate association of Se0 particles with protein and polysaccharide biofilm components has implications for the bioavailability of selenium in the environment.

  2. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  3. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  4. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  5. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  7. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  8. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  9. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  10. Understanding the crack formation of graphite particles in cycled commercial lithium-ion batteries by focused ion beam - scanning electron microscopy

    Science.gov (United States)

    Lin, Na; Jia, Zhe; Wang, Zhihui; Zhao, Hui; Ai, Guo; Song, Xiangyun; Bai, Ying; Battaglia, Vincent; Sun, Chengdong; Qiao, Juan; Wu, Kai; Liu, Gao

    2017-10-01

    The structure degradation of commercial Lithium-ion battery (LIB) graphite anodes with different cycling numbers and charge rates was investigated by focused ion beam (FIB) and scanning electron microscopy (SEM). The cross-section image of graphite anode by FIB milling shows that cracks, resulted in the volume expansion of graphite electrode during long-term cycling, were formed in parallel with the current collector. The crack occurs in the bulk of graphite particles near the lithium insertion surface, which might derive from the stress induced during lithiation and de-lithiation cycles. Subsequently, crack takes place along grain boundaries of the polycrystalline graphite, but only in the direction parallel with the current collector. Furthermore, fast charge graphite electrodes are more prone to form cracks since the tensile strength of graphite is more likely to be surpassed at higher charge rates. Therefore, for LIBs long-term or high charge rate applications, the tensile strength of graphite anode should be taken into account.

  11. Scanning electron microscopy-energy dispersive X-ray spectrometry (SEM-EDX) and aerosol time-of-flight mass spectrometry (ATOFMS) single particle analysis of metallurgy plant emissions

    International Nuclear Information System (INIS)

    Arndt, J.; Deboudt, K.; Anderson, A.; Blondel, A.; Eliet, S.; Flament, P.; Fourmentin, M.; Healy, R.M.; Savary, V.; Setyan, A.; Wenger, J.C.

    2016-01-01

    The chemical composition of single particles deposited on industrial filters located in three different chimneys of an iron-manganese (Fe–Mn) alloy manufacturing plant have been compared using aerosol time-of-flight mass spectrometry (ATOFMS) and scanning electron microscopy–energy dispersive X-ray spectrometry (SEM-EDX). Very similar types of particles were observed using both analytical techniques. Calcium-containing particles dominated in the firing area of the sintering unit, Mn and/or Al-bearing particles were observed at the cooling area of the sintering unit, while Mn-containing particles were dominant at the smelting unit. SEM-EDX analysis of particles collected downstream of the industrial filters showed that the composition of the particles emitted from the chimneys is very similar to those collected on the filters. ATOFMS analysis of ore samples was also performed to identify particulate emissions that could be generated by wind erosion and manual activities. Specific particle types have been identified for each emission source (chimneys and ore piles) and can be used as tracers for source apportionment of ambient PM measured in the vicinity of the industrial site. - Highlights: • Similar composition for emitted particles as those collected on the chimney filters. • Emitted particles dominated by Ca-, Mn and/or Al-containing particles. • Identification of specific particle types emitted by the different process units. - The particles emitted by metallurgy activities are fully described by ATOFMS and SEM-EDX, enabling the identification of specific particle types from the different units of the process.

  12. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  13. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  14. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  15. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  16. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  17. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  18. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  19. Direct writing of micro/nano-scale patterns by means of particle lens arrays scanned by a focused diode pumped Nd:YVO4 laser

    Science.gov (United States)

    Pena, Ana; Wang, Zengbo; Whitehead, David; Li, Lin

    2010-11-01

    A practical approach to a well-known technique of laser micro/nano-patterning by optical near fields is presented. It is based on surface patterning by scanning a Gaussian laser beam through a self-assembled monolayer of silica micro-spheres on a single-crystalline silicon (Si) substrate. So far, the outcome of this kind of near-field patterning has been related to the simultaneous, parallel surface-structuring of large areas either by top hat or Gaussian laser intensity distributions. We attempt to explore the possibility of using the same technique in order to produce single, direct writing of features. This could be of advantage for applications in which only some areas need to be patterned (i.e. local area selective patterning) or single lines are required (e.g. a particular micro/nano-fluidic channel). A diode pumped Nd:YVO4 laser system (wavelength of 532 nm, pulse duration of 8 ns, repetition rate of 30 kHz) with a computer-controlled 3 axis galvanometer beam scanner was employed to write user-defined patterns through the particle lens array on the Si substrate. After laser irradiation, the obtained patterns which are in the micro-scale were composed of sub-micro/micro-holes or bumps. The micro-pattern resolution depends on the dimension of both the micro-sphere’s diameter and the beam’s spot size. The developed technique could potentially be employed to fabricate photonic crystal structures mimicking nature’s butterfly wings and anti-reflective “moth eye” arrays for photovoltaic cells.

  20. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  1. Nuclear Scans

    Science.gov (United States)

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  2. Scanning electron microscopy-energy dispersive X-ray spectrometry (SEM-EDX) and aerosol time-of-flight mass spectrometry (ATOFMS) single particle analysis of metallurgy plant emissions.

    Science.gov (United States)

    Arndt, J; Deboudt, K; Anderson, A; Blondel, A; Eliet, S; Flament, P; Fourmentin, M; Healy, R M; Savary, V; Setyan, A; Wenger, J C

    2016-03-01

    The chemical composition of single particles deposited on industrial filters located in three different chimneys of an iron-manganese (Fe-Mn) alloy manufacturing plant have been compared using aerosol time-of-flight mass spectrometry (ATOFMS) and scanning electron microscopy-energy dispersive X-ray spectrometry (SEM-EDX). Very similar types of particles were observed using both analytical techniques. Calcium-containing particles dominated in the firing area of the sintering unit, Mn and/or Al-bearing particles were observed at the cooling area of the sintering unit, while Mn-containing particles were dominant at the smelting unit. SEM-EDX analysis of particles collected downstream of the industrial filters showed that the composition of the particles emitted from the chimneys is very similar to those collected on the filters. ATOFMS analysis of ore samples was also performed to identify particulate emissions that could be generated by wind erosion and manual activities. Specific particle types have been identified for each emission source (chimneys and ore piles) and can be used as tracers for source apportionment of ambient PM measured in the vicinity of the industrial site. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  4. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  5. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  6. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  7. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  8. Renal scan

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003790.htm Renal scan To use the sharing features on this ... anaphylaxis . Alternative Names Renogram; Kidney scan Images Kidney anatomy Kidney - blood and urine flow References Chernecky CC, ...

  9. CT Scan

    Science.gov (United States)

    ... disease, lung nodules and liver masses Monitor the effectiveness of certain treatments, such as cancer treatment Detect ... scan done in a hospital or an outpatient facility. CT scans are painless and, with newer machines, ...

  10. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

    Science.gov (United States)

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

  11. Direct observation and analysis of york-shell materials using low-voltage high-resolution scanning electron microscopy: Nanometal-particles encapsulated in metal-oxide, carbon, and polymer

    Directory of Open Access Journals (Sweden)

    Shunsuke Asahina

    2014-11-01

    Full Text Available Nanometal particles show characteristic features in chemical and physical properties depending on their sizes and shapes. For keeping and further enhancing their features, the particles should be protected from coalescence or degradation. One approach is to encapsulate the nanometal particles inside pores with chemically inert or functional materials, such as carbon, polymer, and metal oxides, which contain mesopores to allow permeation of only chemicals not the nanometal particles. Recently developed low-voltage high-resolution scanning electron microscopy was applied to the study of structural, chemical, and electron state of both nanometal particles and encapsulating materials in york-shell materials of Au@C, Ru/Pt@C, Au@TiO2, and Pt@Polymer. Progresses in the following categories were shown for the york-shell materials: (i resolution of topographic image contrast by secondary electrons, of atomic-number contrast by back-scattered electrons, and of elemental mapping by X-ray energy dispersive spectroscopy; (ii sample preparation for observing internal structures; and (iii X-ray spectroscopy such as soft X-ray emission spectroscopy. Transmission electron microscopy was also used for characterization of Au@C.

  12. Direct observation and analysis of yolk-shell materials using low-voltage high-resolution scanning electron microscopy: Nanometal-particles encapsulated in metal-oxide, carbon, and polymer

    Energy Technology Data Exchange (ETDEWEB)

    Asahina, Shunsuke; Suga, Mitsuo; Takahashi, Hideyuki [JEOL Ltd., SM Business Unit, Tokyo (Japan); Young Jeong, Hu [Graduate School of EEWS, WCU/BK21+, KAIST, Daejeon 305-701 (Korea, Republic of); Galeano, Carolina; Schüth, Ferdi [Department of Heterogeneous Catalysis, Max-Planck-Institut für Kohlenforschung, Mülheim (Germany); Terasaki, Osamu, E-mail: terasaki@mmk.su.se, E-mail: terasaki@kaist.ac.kr [Graduate School of EEWS, WCU/BK21+, KAIST, Daejeon 305-701 (Korea, Republic of); Department of Materials and Environmental Chemistry, Berzelii Centre EXSELENT on Porous Materials, Stockholm University, SE-10691 Stockholm (Sweden)

    2014-11-01

    Nanometal particles show characteristic features in chemical and physical properties depending on their sizes and shapes. For keeping and further enhancing their features, the particles should be protected from coalescence or degradation. One approach is to encapsulate the nanometal particles inside pores with chemically inert or functional materials, such as carbon, polymer, and metal oxides, which contain mesopores to allow permeation of only chemicals not the nanometal particles. Recently developed low-voltage high-resolution scanning electron microscopy was applied to the study of structural, chemical, and electron state of both nanometal particles and encapsulating materials in yolk-shell materials of Au@C, Ru/Pt@C, Au@TiO{sub 2}, and Pt@Polymer. Progresses in the following categories were shown for the yolk-shell materials: (i) resolution of topographic image contrast by secondary electrons, of atomic-number contrast by back-scattered electrons, and of elemental mapping by X-ray energy dispersive spectroscopy; (ii) sample preparation for observing internal structures; and (iii) X-ray spectroscopy such as soft X-ray emission spectroscopy. Transmission electron microscopy was also used for characterization of Au@C.

  13. Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

    Science.gov (United States)

    Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

    2003-08-01

    Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

  14. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

    Science.gov (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

    1982-06-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  15. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

    1982-01-01

    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  16. Pixelized measurement of {sup 99m}Tc-HDP micro particles formed in gamma correction phantom pinhole scan: A reference study

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Joo Young; Yoon, Do Kyun; Chung, Yong An [Catholic University of Korea, College of Medicine, Seoul (Korea, Republic of); Cheon, Gi Jeong; Lee, Yun Sang; Ha, Seunggyun [Radiopharmaceutical Science Laboratory, Dept. of Nuclear MedicineSeoul National University, College of Medicine, Seoul (Korea, Republic of); Bahk, Yong Whee [Dept. of Nuclear Medicine, Sung Ae General Hospital, Seoul (Korea, Republic of)

    2016-09-15

    Currently, traumatic bone diseases are diagnosed by assessing the micro {sup 99m}Tc-hydroxymethylene diphosphonate (HDP) uptake in injured trabeculae with ongoing osteoneogenesis demonstrated by gamma correction pinhole scan (GCPS). However, the mathematic size quantification of micro-uptake is not yet available. We designed and performed this phantom-based study to set up an in-vitro model of the mathematical calculation of micro-uptake by the pixelized measurement. The micro {sup 99m}Tc-HDP deposits used in this study were spontaneously formed both in a large standard flood and small house-made dish phantoms. The processing was as follows: first, phantoms were flooded with distilled water and {sup 99m}Tc-HDP was therein injected to induce micro {sup 99m}Tc-HDP deposition; second, the deposits were scanned using parallel-hole and pinhole collimator to generally survey {sup 99m}Tc-HDP deposition pattern; and third, the scans underwent gamma correction (GC) to discern individual deposits for size measurement. In original naïve scans, tracer distribution was simply nebulous in appearance and, hence, could not be measured. Impressively, however, GCPS could discern individual micro deposits so that they were calculated by pixelized measurement. Phantoms naturally formed micro {sup 99m}Tc-HDP deposits that are analogous to {sup 99m}Tc-HDP uptake on in-vivo bone scan. The smallest one we measured was 0.414 mm. Flooded phantoms and therein injected {sup 99m}Tc-HDP form nebulous micro {sup 99m}Tc-HDP deposits that are rendered discernible by GCPB and precisely calculable using pixelized measurement. This method can be used for precise quantitative and qualitative diagnosis of bone and joint diseases at the trabecular level.

  17. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  18. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  19. Special report : Workshop on 4D-treatment planning in actively scanned particle therapy-Recommendations, technical challenges, and future research directions

    NARCIS (Netherlands)

    Knopf, Antje; Bert, Christoph; Heath, Emily; Nill, Simeon; Kraus, Kim; Richter, Daniel; Hug, Eugen B.; Pedroni, Eros; Safai, Sairos; Albertini, Francesca; Zenklusen, Silvan; Boye, Dirk; Söhn, Matthias; Soukup, Martin; Sobotta, Benjamin; Lomax, Antony

    This article reports on a 4D-treatment planning workshop (4DTPW), held on 7-8 December 2009 at the Paul Scherrer Institut (PSI) in Villigen, Switzerland. The participants were all members of institutions actively involved in particle therapy delivery and research. The purpose of the 4DTPW was to

  20. An in situ cell to study phase transitions in individual aerosol particles on a substrate using scanning transmission x-ray microspectroscopy

    International Nuclear Information System (INIS)

    Huthwelker, T.; Zelenay, V.; Birrer, M.; Krepelova, A.; Raabe, J.; Ammann, M.; Tzvetkov, G.; Vernooij, M. G. C.

    2010-01-01

    A new in situ cell to study phase transitions and chemical processes on individual aerosol particles in the x-ray transmission microscope at the PolLux beamline of the Swiss light source has been built. The cell is machined from stainless steel and aluminum components and is designed to be used in the standard mount of the microscope without need of complicated rearrangements of the microscope. The cell consists of two parts, a back part which contains connections for the gas supply, heating, cooling devices, and temperature measurement. The second part is a removable clip, which hosts the sample. This clip can be easily exchanged and brought into a sampling unit for aerosol particles. Currently, the cell can be operated at temperatures ranging from -40 to +50 deg. C. The function of the cell is demonstrated using two systems of submicron size: inorganic sodium bromide aerosols and soot originating from a diesel passenger car. For the sodium bromide we demonstrate how phase transitions can be studied in these systems and that O1s spectra from aqueous sodium bromide solution can be taken from submicron sized particles. For the case of soot, we demonstrate that the uptake of water onto individual soot particles can be studied.

  1. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  2. Cooperative scans

    NARCIS (Netherlands)

    M. Zukowski (Marcin); P.A. Boncz (Peter); M.L. Kersten (Martin)

    2004-01-01

    textabstractData mining, information retrieval and other application areas exhibit a query load with multiple concurrent queries touching a large fraction of a relation. This leads to individual query plans based on a table scan or large index scan. The implementation of this access path in most

  3. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  4. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  5. Radionuclide scanning

    International Nuclear Information System (INIS)

    Shapiro, B.

    1986-01-01

    Radionuclide scanning is the production of images of normal and diseased tissues and organs by means of the gamma-ray emissions from radiopharmaceutical agents having specific distributions in the body. The gamma rays are detected at the body surface by a variety of instruments that convert the invisible rays into visible patterns representing the distribution of the radionuclide in the body. The patterns, or images, obtained can be interpreted to provide or to aid diagnoses, to follow the course of disease, and to monitor the management of various illnesses. Scanning is a sensitive technique, but its specificity may be low when interpreted alone. To be used most successfully, radionuclide scanning must be interpreted in conjunction with other techniques, such as bone radiographs with bone scans, chest radiographs with lung scans, and ultrasonic studies with thyroid scans. Interpretation is also enhanced by providing pertinent clinical information because the distribution of radiopharmaceutical agents can be altered by drugs and by various procedures besides physiologic and pathologic conditions. Discussion of the patient with the radionuclide scanning specialist prior to the study and review of the results with that specialist after the study are beneficial

  6. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  7. Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

    Science.gov (United States)

    Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

    2017-01-01

    Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

  8. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  9. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  10. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  11. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  12. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  13. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  14. Intra-event correlations and the statistical moments of the identified particle multiplicity distributions in the RHIC beam energy scan data collected by STAR

    Science.gov (United States)

    Llope, W. J.; STAR Collaboration

    2013-10-01

    Specific products of the statistical moments of the multiplicity distributions of identified particles can be directly compared to susceptibility ratios obtained from lattice QCD calculations. They may also diverge for nuclear systems formed close to a possible QCD critical point due to the phenomenon of critical opalescence. Of particular interest are the moments products for net-protons, net-kaons, and net-charge, as these are considered proxies for conserved quantum numbers. The moments products have been measured by the STAR experiment for Au+Au collisions at seven beam energies ranging from 7.7 to 200 GeV. In this presentation, the experimental results are compared to data-based calculations in which the intra-event correlations of the numbers of positive and negative particles are broken by construction. The importance of intra-event correlations to the moments products values for net-protons, net-kaons, and net-charge can thus be evaluated. Work supported by the U.S. Dept of Energy under grant DE-PS02-09ER09.

  15. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  16. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  17. Determination of physical and dynamic properties of suspended particles in water column with ultrasonic scanning in between the water surface and stable sediment layer.

    Science.gov (United States)

    Acar, Dursun; Alpar, Bedri; Ozeren, Sinan; Cagatay, Namık; Sari, Erol; Vardar, Denizhan; Eris, Kadir

    2015-04-01

    The behavior of seafloor sediment with its water column should be known against any occurrences of anoxic or oxic conditions. The most important ones of these conditions are possible leakage of natural gas or escape of liquids from sediment. On the basis of combined solid/liquid flow dynamics in sedimentation, such kind of events can change, even in an effective manner, the dynamic movements of molecules and their cumulative mass of particules, i.e. the suspended materials. The deployment of suitable sediment traps or ultrasonic transducers somewhere in the water column are not easy attempts in order to obtain useful information about the state of suspended materials during sedimentation. These are usually bulky instruments; therefore they may behave like an anti-move suppresser on the particles moving in the float direction, in oxic and anoxic manner. These instruments, on the other hand, may cover the effects of diffusive flow or bubble formed gas and fluid escape from the sediment surface into the water column. Ultrasonic scanners, however, are able to make observations in a remote manner, without affecting such artificial events. Our field trials were successfully completed at the historical estuary called Halic of Marmara sea . The physical properties; such as the velocity of particles, their travel directions, their dimensions and the ability to observe anti-compositor crushes of shock waves of the bubbles are only a few of these observations in natural ambience. The most important problem solved about water pressure during 3 atmosphere . The sensor has been tested successfully few times. We used the ''High voltage electric isolator oil filling'' to the inside of the scanner for pressure equalization between outer side and inner body of probe at a depth of (20 meters) beneath the sea surface . The transmitted signals by the planar crystal of the transducer become weaker under the pressure of overlying water column in depths. Our efforts are now focused on the

  18. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  19. Application of particle-induced X-ray emission, backscattering spectrometry and scanning electron microscopy in the evaluation of orthodontic materials

    International Nuclear Information System (INIS)

    Gihwala, D.; Mars, J.A.; Pineda-Vargas, C.

    2013-01-01

    The focus of this investigation was on orthodontic materials used in the manufacture of dental brackets. The properties of these dental materials are subjected to various physical parameters such as elongation, yield strength and elasticity that justify their application. In turn, these parameters depend on the quantitative elemental concentration distribution (QECD) in the materials used in the manufacture. For compositional analysis, proton-induced X-ray emission (PIXE), backscatter spectrometry (BS) and scanning electron microscopy (SEM) were applied. QECD analysis was performed to correlate the physical parameters with the composition and to quantify imperfections in the materials. PIXE and BS analyses were performed simultaneously with a 3 MeV proton beam while electrons accelerated at 25 keV were used for the SEM analysis. From the QECDs it was observed that: (1) the major elements Cr, Fe and Ni were homogeneously distributed in the orthodontic plate; (2) the distribution of Mo and O correlated with one another; (3) there was a spread of Cr around regions of high C concentration; and, (4) areas of high concentrations of Mo and O corresponded to a decrease in C concentrations. Elemental concentration correlations are shown to indicate the similarities and differences in the ease of formation of phases, based on the tangent of linearity. (author)

  20. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  1. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  2. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  3. Scan Statistics

    CERN Document Server

    Glaz, Joseph

    2009-01-01

    Suitable for graduate students and researchers in applied probability and statistics, as well as for scientists in biology, computer science, pharmaceutical science and medicine, this title brings together a collection of chapters illustrating the depth and diversity of theory, methods and applications in the area of scan statistics.

  4. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  5. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  6. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  7. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  8. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  9. Bone scans

    International Nuclear Information System (INIS)

    Hetherington, V.J.

    1989-01-01

    Oftentimes, in managing podiatric complaints, clinical and conventional radiographic techniques are insufficient in determining a patient's problem. This is especially true in the early stages of bone infection. Bone scanning or imaging can provide additional information in the diagnosis of the disorder. However, bone scans are not specific and must be correlated with clinical, radiographic, and laboratory evaluation. In other words, bone scanning does not provide the diagnosis but is an important bit of information aiding in the process of diagnosis. The more useful radionuclides in skeletal imaging are technetium phosphate complexes and gallium citrate. These compounds are administered intravenously and are detected at specific time intervals postinjection by a rectilinear scanner with minification is used and the entire skeleton can be imaged from head to toe. Minification allows visualization of the entire skeleton in a single image. A gamma camera can concentrate on an isolated area. However, it requires multiple views to complete the whole skeletal image. Recent advances have allowed computer augmentation of the data received from radionucleotide imaging. The purpose of this chapter is to present the current radionuclides clinically useful in podiatric patients

  10. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  11. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  12. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  13. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  14. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  15. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    Science.gov (United States)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-08

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  16. Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor

    Science.gov (United States)

    Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane

    2013-01-01

    We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  18. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  19. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  20. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  1. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  2. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  3. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  4. Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

    Science.gov (United States)

    Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

    1995-01-01

    Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

  5. Forensic Scanning Electron Microscope

    Science.gov (United States)

    Keeley, R. H.

    1983-03-01

    The scanning electron microscope equipped with an x-ray spectrometer is a versatile instrument which has many uses in the investigation of crime and preparation of scientific evidence for the courts. Major applications include microscopy and analysis of very small fragments of paint, glass and other materials which may link an individual with a scene of crime, identification of firearms residues and examination of questioned documents. Although simultaneous observation and chemical analysis of the sample is the most important feature of the instrument, other modes of operation such as cathodoluminescence spectrometry, backscattered electron imaging and direct x-ray excitation are also exploited. Marks on two bullets or cartridge cases can be compared directly by sequential scanning with a single beam or electronic linkage of two instruments. Particles of primer residue deposited on the skin and clothing when a gun is fired can be collected on adhesive tape and identified by their morphology and elemental composition. It is also possible to differentiate between the primer residues of different types of ammunition. Bullets may be identified from the small fragments left behind as they pass through the body tissues. In the examination of questioned documents the scanning electron microscope is used to establish the order in which two intersecting ink lines were written and to detect traces of chemical markers added to the security inks on official documents.

  6. Head CT scan

    Science.gov (United States)

    ... scan - orbits; CT scan - sinuses; Computed tomography - cranial; CAT scan - brain ... head size in children Changes in thinking or behavior Fainting Headache, when you have certain other signs ...

  7. Role for ribosome-associated complex and stress-seventy subfamily B (RAC-Ssb) in integral membrane protein translation.

    Science.gov (United States)

    Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D

    2017-12-01

    Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  9. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  11. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  12. A comprehensive physicochemical, thermal, and spectroscopic characterization of zinc (II) chloride using X-ray diffraction, particle size distribution, differential scanning calorimetry, thermogravimetric analysis/differential thermogravimetric analysis, ultraviolet-visible, and Fourier transform-infrared spectroscopy.

    Science.gov (United States)

    Trivedi, Mahendra Kumar; Sethi, Kalyan Kumar; Panda, Parthasarathi; Jana, Snehasis

    2017-01-01

    Zinc chloride is an important inorganic compound used as a source of zinc and has other numerous industrial applications. Unfortunately, it lacks reliable and accurate physicochemical, thermal, and spectral characterization information altogether. Hence, the authors tried to explore in-depth characterization of zinc chloride using the modern analytical technique. The analysis of zinc chloride was performed using powder X-ray diffraction (PXRD), particle size distribution, differential scanning calorimetry (DSC), thermogravimetric analysis/differential thermogravimetric analysis (TGA/DTG), ultraviolet-visible spectroscopy (UV-vis), and Fourier transform-infrared (FT-IR) analytical techniques. The PXRD patterns showed well-defined, narrow, sharp, and the significant peaks. The crystallite size was found in the range of 14.70-55.40 nm and showed average crystallite size of 41.34 nm. The average particle size was found to be of 1.123 ( d 10 ), 3.025 ( d 50 ), and 6.712 ( d 90 ) μm and average surface area of 2.71 m 2 /g. The span and relative span values were 5.849 μm and 1.93, respectively. The DSC thermogram showed a small endothermic inflation at 308.10°C with the latent heat (ΔH) of fusion 28.52 J/g. An exothermic reaction was observed at 449.32°C with the ΔH of decomposition 66.10 J/g. The TGA revealed two steps of the thermal degradation and lost 8.207 and 89.72% of weight in the first and second step of degradation, respectively. Similarly, the DTG analysis disclosed T max at 508.21°C. The UV-vis spectrum showed absorbance maxima at 197.60 nm (λ max ), and FT-IR spectrum showed a peak at 511/cm might be due to the Zn-Cl stretching. These in-depth, comprehensive data would be very much useful in all stages of nutraceuticals/pharmaceuticals formulation research and development and other industrial applications.

  13. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  14. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  15. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  17. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  18. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  19. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  20. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  1. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  2. Confocal scanning microscope for nuclear photoemulsion

    International Nuclear Information System (INIS)

    Batusov, Yu.A.; Kovalev, Yu.S.; Soroko, L.M.

    2005-01-01

    The application of the confocal scanning microscope to the objects in the nuclear photoemulsion is described. An array of 27 microtomograms of single silver grain is shown. The cross sections of the same particle track of diameter 1 μm, detected by means of the confocal scanning microscope with open and annular apertures, are presented. It was shown that the confocal scanning microscope opens indeed new opportunities for the nuclear photoemulsion technique to get previously inaccessible information for physics of the short-living particles

  3. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  4. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  5. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  6. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  7. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  8. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  9. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  10. Gastrointestinal scanning agent

    International Nuclear Information System (INIS)

    Francis, M.D.

    1980-01-01

    An easily prepared radiolabeled gastrointestinal scanning agent is described. Technetium-99m has ideal characteristics for imaging the upper and lower GI tract and determining stomach emptying and intestinal transit time when used with an insoluble particulate material. For example, crystalline and amorphous calcium phosphate particles can be effectively labeled in a one-step process using sup(99m)TcO 4 and SnCl 2 . These labeled particles have insignificant mass and when administered orally pass through the GI tract unchanged, without affecting the handling and density of the intestinal contents. Visualization of the esophageal entry into the stomach, the greater and lesser curvatures of the stomach, ejection into the duodenum, and rates of passage through the upper and lower GI tract are obtained. The slurry of sup(99m)TC particulate can be given rectally by enema. Good images of the cecum and the ascending, transverse, and descending colon are obtained. Mucosal folds and the splenic and hepatic flexures are visualized. The resilience of the large intestine is also readily visualized by pneumocolonographic techniques. (author)

  11. Brain PET scan

    Science.gov (United States)

    ... results on a PET scan. Blood sugar or insulin levels may affect the test results in people with diabetes . PET scans may be done along with a CT scan. This combination scan is called a PET/CT. Alternative Names Brain positron emission tomography; PET scan - brain References Chernecky ...

  12. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  13. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  14. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  15. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  16. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  17. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  18. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  19. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  20. Application of the methods of scanning electron microscopy and X-ray microanalysis for 'hot particles' detection in the human lungs formed as a result of the Chernobyl accident

    International Nuclear Information System (INIS)

    Reva, Yu.P.; Portyanko, N.M.; Ivanov, A.S.; Chuchalin, A.G.

    1993-01-01

    The up-to-date approaches to 'hot particles' studying were applied in this investigation. A complex of morphological and physical-chemical methods make it possible to detect and identify the 'hot particles' in the autopsy material of the lungs from 2 males at the age 27 and 25, who participated in the liquidation of Chernobyl katastrophe consequences in 1986. The elemental and isotope content of these particles was the same as that of the 'hot particles' detected in the zone of the katstrophe. The results obtained make it possible to suppose that the 'hot particles' have been inhaled and existed for a long time in the human bodies. On the basis of these data we suppose that the 'hot particle' are the cause of respiratory and other systems disorders

  1. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  2. Heart PET scan

    Science.gov (United States)

    ... nuclear medicine scan; Heart positron emission tomography; Myocardial PET scan ... A PET scan requires a small amount of radioactive material (tracer). This tracer is given through a vein (IV), ...

  3. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  4. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  5. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  6. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  7. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  8. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Monosodium titanate particle characterization

    International Nuclear Information System (INIS)

    Chandler, G.T.; Hobbs, D.T.

    1993-01-01

    A characterization study was performed on monosodium titanate (MST) particles to determine the effect of high shear forces expected from the In-Tank Precipitation (ITP) process pumps on the particle size distribution. The particles were characterized using particle size analysis and scanning electron microscopy (SEM). No significant changes in particle size distributions were observed between as-received MST and after 2--4 hours of shearing. Both as-received and sheared MST particles contained a large percentage of porosity with pore sizes on the order of 500 to 2,000 Angstroms. Because of the large percentage of porosity, the overall surface area of the MST is dominated by the internal surfaces. The uranium and plutonium species present in the waste solution will have access to both interior and exterior surfaces. Therefore, uranium and plutonium loading should not be a strong function of MST particle size

  10. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  11. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  12. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  13. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  14. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  15. Particle Pollution

    Science.gov (United States)

    ... Your Health Particle Pollution Public Health Issues Particle Pollution Recommend on Facebook Tweet Share Compartir Particle pollution — ... see them in the air. Where does particle pollution come from? Particle pollution can come from two ...

  16. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  18. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  19. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  20. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  1. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Radiopharmaceutical scanning agents

    International Nuclear Information System (INIS)

    1976-01-01

    This invention is directed to dispersions useful in preparing radiopharmaceutical scanning agents, to technetium labelled dispersions, to methods for preparing such dispersions and to their use as scanning agents

  3. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... Scan and Uptake Thyroid scan and uptake uses small amounts of radioactive materials called radiotracers, a special ... is a branch of medical imaging that uses small amounts of radioactive material to diagnose and determine ...

  4. Nuclear Heart Scan

    Science.gov (United States)

    ... Home / Nuclear Heart Scan Nuclear Heart Scan Also known as Nuclear Stress Test , ... Learn More Connect With Us Contact Us Directly Policies Privacy Policy Freedom of Information Act (FOIA) Accessibility ...

  5. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... of page What will I experience during and after the procedure? Most thyroid scan and thyroid uptake ... you otherwise, you may resume your normal activities after your nuclear medicine scan. If any special instructions ...

  6. RBC nuclear scan

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003835.htm RBC nuclear scan To use the sharing features on this page, please enable JavaScript. An RBC nuclear scan uses small amounts of radioactive material to ...

  7. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  8. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  10. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  11. Scanning gamma camera

    International Nuclear Information System (INIS)

    Engdahl, L.W.; Batter, J.F. Jr.; Stout, K.J.

    1977-01-01

    A scanning system for a gamma camera providing for the overlapping of adjacent scan paths is described. A collimator mask having tapered edges provides for a graduated reduction in intensity of radiation received by a detector thereof, the reduction in intensity being graduated in a direction normal to the scanning path to provide a blending of images of adjacent scan paths. 31 claims, 15 figures

  12. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  13. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  14. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  15. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  16. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  17. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  18. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  19. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  20. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  1. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  2. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  3. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  4. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  5. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  6. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  7. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  8. Lung PET scan

    Science.gov (United States)

    ... Chest PET scan; Lung positron emission tomography; PET - chest; PET - lung; PET - tumor imaging; ... Grainger & Allison's Diagnostic Radiology: A Textbook of Medical Imaging . 6th ed. Philadelphia, ...

  9. Scanning of bone metastases

    International Nuclear Information System (INIS)

    Robillard, J.

    1977-01-01

    The Centers against cancer of Caen, Angers, Montpellier, Strasbourg and 'the Curie Foundation' have confronted their experience in detection of bone metastases by total body scanning. From the investigation by this procedure, of 1,467 patients with cancer, it results: the confrontation between radio and scanning shows a rate of false positive and false negative identical to the literature ones; the countage scanning allows to reduce the number of false positive; scanning allows to direct bone biopsy and to improve efficiency of histological examination [fr

  10. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  11. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  12. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  13. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  14. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  15. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  16. Effective in silico prediction of new oxazolidinone antibiotics: force field simulations of the antibiotic–ribosome complex supervised by experiment and electronic structure methods

    Directory of Open Access Journals (Sweden)

    Jörg Grunenberg

    2016-03-01

    Full Text Available We propose several new and promising antibacterial agents for the treatment of serious Gram-positive infections. Our predictions rely on force field simulations, supervised by first principle calculations and available experimental data. Different force fields were tested in order to reproduce linezolid's conformational space in terms of a the isolated and b the ribosomal bound state. In a first step, an all-atom model of the bacterial ribosome consisting of nearly 1600 atoms was constructed and evaluated. The conformational space of 30 different ribosomal/oxazolidinone complexes was scanned by stochastic methods, followed by an evaluation of their enthalpic penalties or rewards and the mechanical strengths of the relevant hydrogen bonds (relaxed force constants; compliance constants. The protocol was able to reproduce the experimentally known enantioselectivity favoring the S-enantiomer. In a second step, the experimentally known MIC values of eight linezolid analogues were used in order to crosscheck the robustness of our model. In a final step, this benchmarking led to the prediction of several new and promising lead compounds. Synthesis and biological evaluation of the new compounds are on the way.

  17. Ribosome Shunting, Polycistronic Translation, and Evasion of Antiviral Defenses in Plant Pararetroviruses and Beyond

    Directory of Open Access Journals (Sweden)

    Mikhail M. Pooggin

    2018-04-01

    Full Text Available Viruses have compact genomes and usually translate more than one protein from polycistronic RNAs using leaky scanning, frameshifting, stop codon suppression or reinitiation mechanisms. Viral (pre-genomic RNAs often contain long 5′-leader sequences with short upstream open reading frames (uORFs and secondary structure elements, which control both translation initiation and replication. In plants, viral RNA and DNA are targeted by RNA interference (RNAi generating small RNAs that silence viral gene expression, while viral proteins are recognized by innate immunity and autophagy that restrict viral infection. In this review we focus on plant pararetroviruses of the family Caulimoviridae and describe the mechanisms of uORF- and secondary structure-driven ribosome shunting, leaky scanning and reinitiation after translation of short and long uORFs. We discuss conservation of these mechanisms in different genera of Caulimoviridae, including host genome-integrated endogenous viral elements, as well as in other viral families, and highlight a multipurpose use of the highly-structured leader sequence of plant pararetroviruses in regulation of translation, splicing, packaging, and reverse transcription of pregenomic RNA (pgRNA, and in evasion of RNAi. Furthermore, we illustrate how targeting of several host factors by a pararetroviral effector protein can lead to transactivation of viral polycistronic translation and concomitant suppression of antiviral defenses. Thus, activation of the plant protein kinase target of rapamycin (TOR by the Cauliflower mosaic virus transactivator/viroplasmin (TAV promotes reinitiation of translation after long ORFs on viral pgRNA and blocks antiviral autophagy and innate immunity responses, while interaction of TAV with the plant RNAi machinery interferes with antiviral silencing.

  18. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  19. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  20. Model PET Scan Activity

    Science.gov (United States)

    Strunk, Amber; Gazdovich, Jennifer; Redouté, Oriane; Reverte, Juan Manuel; Shelley, Samantha; Todorova, Vesela

    2018-05-01

    This paper provides a brief introduction to antimatter and how it, along with other modern physics topics, is utilized in positron emission tomography (PET) scans. It further describes a hands-on activity for students to help them gain an understanding of how PET scans assist in detecting cancer. Modern physics topics provide an exciting way to introduce students to current applications of physics.

  1. Scanning laser Doppler vibrometry

    DEFF Research Database (Denmark)

    Brøns, Marie; Thomsen, Jon Juel

    With a Scanning Laser Doppler Vibrometer (SLDV) a vibrating surface is automatically scanned over predefined grid points, and data processed for displaying vibration properties like mode shapes, natural frequencies, damping ratios, and operational deflection shapes. Our SLDV – a PSV-500H from...

  2. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available Toggle navigation Test/Treatment Patient Type Screening/Wellness Disease/Condition Safety En Español More Info Images/Videos About Us News Physician Resources Professions Site Index A-Z Thyroid Scan and Uptake Thyroid scan and uptake uses ...

  3. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  4. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  5. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  6. Transverse section scanning mechanism

    International Nuclear Information System (INIS)

    Doherty, E.J.

    1978-01-01

    Apparatus is described for scanning a transverse, radionuclide scan-field using an array of focussed collimators. The collimators are movable tangentially on rails, driven by a single motor via a coupled screw. The collimators are also movable in a radial direction on rails driven by a step motor via coupled screws and bevel gears. Adjacent bevel gears rotate in opposite directions so adjacent collimators move in radially opposite directions. In use, the focal point of each collimator scans at least half of the scan-field, e.g. a human head located in the central aperture, and the electrical outputs of detectors associated with each collimator are used to determine the distribution of radioactive emission intensity at a number of points in the scan-field. (author)

  7. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  8. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  9. LIDAR COMBINED SCANNING UNIT

    Directory of Open Access Journals (Sweden)

    V. V. Elizarov

    2016-11-01

    Full Text Available Subject of Research. The results of lidar combined scanning unit development for locating leaks of hydrocarbons are presented The unit enables to perform high-speed scanning of the investigated space in wide and narrow angle fields. Method. Scanning in a wide angular field is produced by one-line scanning path by means of the movable aluminum mirror with a frequency of 20Hz and amplitude of 20 degrees of swing. Narrowband scanning is performed along a spiral path by the deflector. The deflection of the beam is done by rotation of the optical wedges forming part of the deflector at an angle of ±50. The control function of the scanning node is performed by a specialized software product written in C# programming language. Main Results. This scanning unit allows scanning the investigated area at a distance of 50-100 m with spatial resolution at the level of 3 cm. The positioning accuracy of the laser beam in space is 15'. The developed scanning unit gives the possibility to browse the entire investigated area for the time not more than 1 ms at a rotation frequency of each wedge from 50 to 200 Hz. The problem of unambiguous definition of the beam geographical coordinates in space is solved at the software level according to the rotation angles of the mirrors and optical wedges. Lidar system coordinates are determined by means of GPS. Practical Relevance. Development results open the possibility for increasing the spatial resolution of scanning systems of a wide range of lidars and can provide high positioning accuracy of the laser beam in space.

  10. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  11. Laser Scanning in Forests

    Directory of Open Access Journals (Sweden)

    Håkan Olsson

    2012-09-01

    Full Text Available The introduction of Airborne Laser Scanning (ALS to forests has been revolutionary during the last decade. This development was facilitated by combining earlier ranging lidar discoveries [1–5], with experience obtained from full-waveform ranging radar [6,7] to new airborne laser scanning systems which had components such as a GNSS receiver (Global Navigation Satellite System, IMU (Inertial Measurement Unit and a scanning mechanism. Since the first commercial ALS in 1994, new ALS-based forest inventory approaches have been reported feasible for operational activities [8–12]. ALS is currently operationally applied for stand level forest inventories, for example, in Nordic countries. In Finland alone, the adoption of ALS for forest data collection has led to an annual savings of around 20 M€/year, and the work is mainly done by companies instead of governmental organizations. In spite of the long implementation times and there being a limited tradition of making changes in the forest sector, laser scanning was commercially and operationally applied after about only one decade of research. When analyzing high-ranked journal papers from ISI Web of Science, the topic of laser scanning of forests has been the driving force for the whole laser scanning research society over the last decade. Thus, the topic “laser scanning in forests” has provided a significant industrial, societal and scientific impact. [...

  12. Bone scan in pediatrics

    International Nuclear Information System (INIS)

    Gordon, I.; Peters, A.M.

    1987-01-01

    In 1984, a survey carried out in 21 countries in Europe showed that bone scintigraphy comprised 16% of all paediatric radioisotope scans. Although the value of bone scans in paediatrics is potentially great, their quality varies greatly, and poor-quality images are giving this valuable technique a bad reputation. The handling of children requires a sensitive staff and the provision of a few simple inexpensive items of distraction. Attempting simply to scan a child between two adult patients in a busy general department is a recipe for an unhappy, uncooperative child with the probable result of poor images. The intravenous injection of isotope should be given adjacent to the gamma camera room, unless dynamic scans are required, so that the child does not associate the camera with the injection. This injection is best carried out by someone competent in paediatric venipunture; the entire procedure should be explained to the child and parent, who should remain with child throughout. It is naive to think that silence makes for a cooperative child. The sensitivity of bone-seeking radioisotope tracers and the marked improvement in gamma camera resolution has allowed the bone scanning to become an integrated technique in the assessment of children suspected of suffering from pathological bone conditions. The tracer most commonly used for routine bone scanning is 99m Tc diphosphonate (MDP); other isotopes used include 99m Tc colloid for bone marrow scans and 67 Ga citrate and 111 In white blood cells ( 111 In WBC) for investigation of inflammatory/infective lesions

  13. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    Energy Technology Data Exchange (ETDEWEB)

    Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)

    1994-12-31

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.

  14. Structural model of the 50S subunit of E.Coli ribosomes from solution scattering

    International Nuclear Information System (INIS)

    Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.

    1994-01-01

    The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA

  15. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  16. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  17. A Scanning scheimpflug lidar system developed for urban pollution monitoring

    Science.gov (United States)

    Yang, Yang; Guan, Peng; Mei, Liang

    2018-04-01

    A scanning Scheimpflug lidar system based on the Scheimpflug principle has been developed by employing a high power multimode 808 nm laser diode and a highly integrated CMOS sensor in Dalian University of Technology, Dalian, Northern China. Atmospheric scanning measurements in urban area were performed for the studies of particle emission sources.

  18. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  19. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  20. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  1. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... for a thyroid scan is 30 minutes or less. Thyroid Uptake You will be given radioactive iodine ( ... for each thyroid uptake is five minutes or less. top of page What will I experience during ...

  2. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... evaluate changes in the gland following medication use, surgery, radiotherapy or chemotherapy top of page How should ... such as an x-ray or CT scan, surgeries or treatments using iodinated contrast material within the ...

  3. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... abnormal was found, and should not be a cause of concern for you. If you had an ... abnormal was found, and should not be a cause of concern for you. Actual scanning time for ...

  4. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    Details are given of a tomographic scanning apparatus, with particular reference to a multiplexer slip ring means for receiving output from the detectors and enabling interfeed to the image reconstruction station. (U.K.)

  5. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    Details are presented of a tomographic scanning apparatus, its rotational assembly, and the control and circuit elements, with particular reference to the amplifier and multiplexing circuits enabling detector signal calibration. (U.K.)

  6. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    This patent specification relates to a tomographic scanning apparatus using a fan beam and digital output signal, and particularly to the design of the gas-pressurized ionization detection system. (U.K.)

  7. Pediatric CT Scans

    Science.gov (United States)

    The Radiation Epidemiology Branch and collaborators have initiated a retrospective cohort study to evaluate the relationship between radiation exposure from CT scans conducted during childhood and adolescence and the subsequent development of cancer.

  8. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... which are encased in metal and plastic and most often shaped like a box, attached to a ... will I experience during and after the procedure? Most thyroid scan and thyroid uptake procedures are painless. ...

  9. Heart CT scan

    Science.gov (United States)

    ... make to decrease the risk of heart disease. Risks Risks of CT scans include: Being exposed to ... urac.org). URAC's accreditation program is an independent audit to verify that A.D.A.M. follows ...

  10. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... eat for several hours before your exam because eating can affect the accuracy of the uptake measurement. ... often unattainable using other imaging procedures. For many diseases, nuclear medicine scans yield the most useful information ...

  11. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... A thyroid scan is a type of nuclear medicine imaging. The radioactive iodine uptake test (RAIU) is ... thyroid function, but does not involve imaging. Nuclear medicine is a branch of medical imaging that uses ...

  12. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... that help physicians diagnose and evaluate medical conditions. These imaging scans use radioactive materials called radiopharmaceuticals or ... or had thyroid cancer. A physician may perform these imaging tests to: determine if the gland is ...

  13. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... Because nuclear medicine procedures are able to pinpoint molecular activity within the body, they offer the potential ... or imaging device that produces pictures and provides molecular information. The thyroid scan and thyroid uptake provide ...

  14. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... Actual scanning time for each thyroid uptake is five minutes or less. top of page What will ... diagnostic procedures have been used for more than five decades, and there are no known long-term ...

  15. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... top of page Additional Information and Resources RTAnswers.org Radiation Therapy for Head and Neck Cancer top ... Scan and Uptake Sponsored by Please note RadiologyInfo.org is not a medical facility. Please contact your ...

  16. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... often unattainable using other imaging procedures. For many diseases, nuclear medicine scans yield the most useful information needed to make a diagnosis or to determine appropriate treatment, if any. Nuclear medicine is less expensive and ...

  17. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... the gamma camera and single-photon emission-computed tomography (SPECT). The gamma camera, also called a scintillation ... high as with other imaging techniques, such as CT or MRI. However, nuclear medicine scans are more ...

  18. Scanning Auger Electron Microscope

    Data.gov (United States)

    Federal Laboratory Consortium — A JEOL model 7830F field emission source, scanning Auger microscope.Specifications / Capabilities:Ultra-high vacuum (UHV), electron gun range from 0.1 kV to 25 kV,...

  19. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... as an overactive thyroid gland, a condition called hyperthyroidism , cancer or other growths assess the nature of ... an x-ray or CT scan, surgeries or treatments using iodinated contrast material within the last two ...

  20. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... painless. However, during the thyroid scan, you may feel uncomfortable when lying completely still with your head ... When the radiotracer is given intravenously, you will feel a slight pin prick when the needle is ...

  1. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... energy. top of page What are some common uses of the procedure? The thyroid scan is used ... community, you can search the ACR-accredited facilities database . This website does not provide cost information. The ...

  2. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... scan and thyroid uptake provide information about the structure and function of the thyroid. The thyroid is ... computer, create pictures offering details on both the structure and function of organs and tissues in your ...

  3. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... found, and should not be a cause of concern for you. If you had an intravenous line ... found, and should not be a cause of concern for you. Actual scanning time for each thyroid ...

  4. Body CT (CAT Scan)

    Science.gov (United States)

    ... a CT scan can be reformatted in multiple planes, and can even generate three-dimensional images. These ... other medical conditions and whether you have a history of heart disease, asthma, diabetes, kidney disease or ...

  5. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... the gland following medication use, surgery, radiotherapy or chemotherapy top of page How should I prepare? You ... You will receive specific instructions based on the type of scan you are undergoing. top of page ...

  6. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... Uptake? A thyroid scan is a type of nuclear medicine imaging. The radioactive iodine uptake test (RAIU) ... of thyroid function, but does not involve imaging. Nuclear medicine is a branch of medical imaging that ...

  7. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    This patent specification describes a tomographic scanning apparatus, with particular reference to the adjustable fan beam and its collimator system, together with the facility for taking a conventional x-radiograph without moving the patient. (U.K.)

  8. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... exam of any medications you are taking, including vitamins and herbal supplements. You should also inform them ... of scan you are undergoing. top of page What does the equipment look like? The special camera ...

  9. The Scanning Optical Microscope.

    Science.gov (United States)

    Sheppard, C. J. R.

    1978-01-01

    Describes the principle of the scanning optical microscope and explains its advantages over the conventional microscope in the improvement of resolution and contrast, as well as the possibility of producing a picture from optical harmonies generated within the specimen.

  10. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... the gland following medication use, surgery, radiotherapy or chemotherapy top of page How should I prepare? You ... but is often performed on hospitalized patients as well. Thyroid Scan You will be positioned on an ...

  11. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  12. Rare particles

    International Nuclear Information System (INIS)

    Kutschera, W.

    1984-01-01

    The use of Accelerator Mass Spectrometry (AMS) to search for hypothetical particles and known particles of rare processes is discussed. The hypothetical particles considered include fractionally charged particles, anomalously heavy isotopes, and superheavy elements. The known particles produced in rare processes discussed include doubly-charged negative ions, counting neutrino-produced atoms in detectors for solar neutrino detection, and the spontaneous emission of 14 C from 223 Ra. 35 references

  13. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  14. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  15. Quantification of aggregate grain shape characteristics using 3-D laser scanning technology

    CSIR Research Space (South Africa)

    Mgangira, Martin B

    2013-07-01

    Full Text Available to identify the differences between individual aggregates. It was possible to quantify differences in particle shape characteristics at the small particle scale. The study has demonstrated the advantages of the innovative 3-D laser scanning technology...

  16. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  17. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  18. Efficiency of a concentric matrix track detector surface scanning

    International Nuclear Information System (INIS)

    Bek-Uzarov, Dj.; Nikezic, D.; Kostic, D.; Krstic, D.; Cuknic, O.

    1995-01-01

    Heavy particle ionizing radiation track counting on the surface of a solid state round surface detector is made using the microscope and scanning step by step by a round field of vision. The whole solid state detector surface could not be fully or completely covered by round fields of visions. Therefore detector surface could be divided on the two parts, the larger surface, being under fields of vision, really scanned and no scanned missed or omitted surface. The ratio between omitted and scanned surfaces is so called track scanning efficiency. The knowledge of really counted, or scanned surface is a important value for evaluating the real surface track density an exposed solid state track detector. In the paper a matrix of a concentric field of vision made around the first microscope field of vision placed in center of the round disc of the scanned track detector is proposed. In a such scanning matrix the real scanned surface could be easy calculated and by the microscope scanning made as well. By this way scanned surface is very precisely obtained as well. Precise knowledge of scanned and omitted surface allows to obtain more precise scanning efficiency factor as well as real surface track density, the main parameter in solid state track detection measurements. (author)

  19. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  20. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  1. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    Science.gov (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  2. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  3. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  4. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  5. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  6. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  7. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  8. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  10. Influence of synthesis conditions on particle morphology of ...

    Indian Academy of Sciences (India)

    Wintec

    diffraction (XRD), scanning electron microscopy (SEM), and dynamic light scattering (DLS). Cu/ZnO ... Considerable attention has been paid to copper metal nano- particles .... And also energy dispersive scanning (EDS) analyses of sample ...

  11. Preoperative bone scans

    International Nuclear Information System (INIS)

    Charkes, N.D.; Malmud, L.S.; Caswell, T.; Goldman, L.; Hall, J.; Lauby, V.; Lightfoot, W.; Maier, W.; Rosemond, G.

    1975-01-01

    Strontium nitrate Sr-87m bone scans were made preoperatively in a group of women with suspected breast cancer, 35 of whom subsequently underwent radical mastectomy. In 3 of the 35 (9 percent), the scans were abnormal despite the absence of clinical or roentgenographic evidence of metastatic disease. All three patients had extensive axillary lymph node involvement by tumor, and went on to have additional bone metastases, from which one died. Roentgenograms failed to detect the metastases in all three. Occult bone metastases account in part for the failure of radical mastectomy to cure some patients with breast cancer. It is recommended that all candidates for radical mastectomy have a preoperative bone scan. (U.S.)

  12. Frequency scanning microstrip antennas

    DEFF Research Database (Denmark)

    Danielsen, Magnus; Jørgensen, Rolf

    1979-01-01

    The principles of using radiating microstrip resonators as elements in a frequency scanning antenna array are described. The resonators are cascade-coupled. This gives a scan of the main lobe due to the phase-shift in the resonator in addition to that created by the transmission line phase......-shift. Experimental results inX-band, in good agreement with the theory, show that it is possible to scan the main lobe an angle ofpm30degby a variation of the frequencypm300MHz, and where the 3 dB beamwidth is less than10deg. The directivity was 14.7 dB, while the gain was 8.1 dB. The efficiency might be improved...

  13. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    Science.gov (United States)

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  14. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  15. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  16. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  17. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  18. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    Abele, M.

    1983-01-01

    A computerized tomographic scanning apparatus suitable for diagnosis and for improving target identification in stereotactic neurosurgery is described. It consists of a base, a source of penetrating energy, a detector which produces scanning signals and detector positioning means. A frame with top and bottom arms secures the detector and source to the top and bottom arms respectively. A drive mechanism rotates the frame about an axis along which the frame may also be moved. Finally, the detector may be moved relative to the bottom arm in a direction contrary to the rotation of the frame. (U.K.)

  19. Scanning the phenomenological MSSM

    CERN Document Server

    Wuerzinger, Jonas

    2017-01-01

    A framework to perform scans in the 19-dimensional phenomenological MSSM is developed and used to re-evaluate the ATLAS experiments' sensitivity to R-parity-conserving supersymmetry with LHC Run 2 data ($\\sqrt{s}=13$ TeV), using results from 14 separate ATLAS searches. We perform a $\\tilde{t}_1$ dedicated scan, only considering models with $m_{\\tilde{t}_1}<1$ TeV, while allowing both a neutralino ($\\tilde{\\chi}_1^0$) and a sneutrino ($\\tilde{\

  20. Calibration of scanning Lidar

    DEFF Research Database (Denmark)

    Gómez Arranz, Paula; Courtney, Michael

    This report describes the tests carried out on a scanning lidar at the DTU Test Station for large wind turbines, Høvsøre. The tests were divided in two parts. In the first part, the purpose was to obtain wind speed calibrations at two heights against two cup anemometers mounted on a mast. Additio......This report describes the tests carried out on a scanning lidar at the DTU Test Station for large wind turbines, Høvsøre. The tests were divided in two parts. In the first part, the purpose was to obtain wind speed calibrations at two heights against two cup anemometers mounted on a mast...

  1. Adaptive Optical Scanning Holography

    Science.gov (United States)

    Tsang, P. W. M.; Poon, Ting-Chung; Liu, J.-P.

    2016-01-01

    Optical Scanning Holography (OSH) is a powerful technique that employs a single-pixel sensor and a row-by-row scanning mechanism to capture the hologram of a wide-view, three-dimensional object. However, the time required to acquire a hologram with OSH is rather lengthy. In this paper, we propose an enhanced framework, which is referred to as Adaptive OSH (AOSH), to shorten the holographic recording process. We have demonstrated that the AOSH method is capable of decreasing the acquisition time by up to an order of magnitude, while preserving the content of the hologram favorably. PMID:26916866

  2. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  3. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  4. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  5. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  6. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  7. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  8. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  9. Particle detection

    International Nuclear Information System (INIS)

    Charpak, G.

    2000-01-01

    In this article G.Charpak presents the principles on which particle detection is based. Particle accelerators are becoming more and more powerful and require new detectors able to track the right particle in a huge flux of particles. The gigantic size of detectors in high energy physics is often due to the necessity of getting a long enough trajectory in a magnetic field in order to deduce from the curvature an accurate account of impulses in the reaction. (A.C.)

  10. Strange particles

    International Nuclear Information System (INIS)

    Chinowsky, W.

    1989-01-01

    Work done in the mid 1950s at Brookhaven National Laboratory on strange particles is described. Experiments were done on the Cosmotron. The author describes his own and others' work on neutral kaons, lambda and theta particles and points out the theoretical gap between predictions and experimental findings. By the end of the decade, the theory of strange particles was better understood. (UK)

  11. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... process that regulates the rate at which the body converts food to energy. top of page What are some common uses of the procedure? The thyroid scan is used to determine the size, shape and position of the thyroid gland. The ...

  12. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available Toggle navigation Test/Treatment Patient Type Screening/Wellness Disease/Condition Safety En Español More Info Images/Videos About Us News Physician Resources Professions Site Index A-Z Thyroid Scan and Uptake ...

  13. Dialogue scanning measuring systems

    International Nuclear Information System (INIS)

    Borodyuk, V.P.; Shkundenkov, V.N.

    1985-01-01

    The main developments of scanning measuring systems intended for mass precision processsing of films in nuclear physics problems and in related fields are reviewed. A special attention is paid to the problem of creation of dialogue systems which permit to simlify the development of control computer software

  14. Scanning electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Cox, B. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada)

    1970-05-15

    The JSM-11 scanning electron microscope at CRNL has been used extensively for topographical studies of oxidized metals, fracture surfaces, entomological and biological specimens. A non-dispersive X-ray attachment permits the microanalysis of the surface features. Techniques for the production of electron channeling patterns have been developed. (author)

  15. Scanning tunneling microscopy

    International Nuclear Information System (INIS)

    Binnig, G.; Rohrer, H.

    1983-01-01

    Based on vacuum tunneling, a novel type of microscope, the scanning tunneling microscope (STM) was developed. It has an unprecedented resolution in real space on an atomic scale. The authors review the important technical features, illustrate the power of the STM for surface topographies and discuss its potential in other areas of science and technology. (Auth.)

  16. Bone scan in rheumatology

    International Nuclear Information System (INIS)

    Morales G, R.; Cano P, R.; Mendoza P, R.

    1993-01-01

    In this chapter a revision is made concerning different uses of bone scan in rheumatic diseases. These include reflex sympathetic dystrophy, osteomyelitis, spondyloarthropaties, metabolic bone diseases, avascular bone necrosis and bone injuries due to sports. There is as well some comments concerning pediatric pathology and orthopedics. (authors). 19 refs., 9 figs

  17. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... information. The thyroid scan and thyroid uptake provide information about the structure and function of the thyroid. The thyroid is a gland in the neck that controls metabolism , a chemical process that regulates the rate at which the body ...

  18. Tomographic scanning apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    Details are given of a tomographic scanning apparatus, with particular reference to the means of adjusting the apparent gain of the signal processing means for receiving output signals from the detectors, to compensate for drift in the gain characteristics, including means for passing a reference signal. (U.K.)

  19. Stabilized radiographic scanning agent

    International Nuclear Information System (INIS)

    Fawzi, M.B.

    1979-01-01

    A stable composition useful in preparation of technetium-99m-based radiographic scanning agents has been developed. The composition contains a stabilizing amount of gentisate stabilizer selected from gentisic acid and its soluble pharmaceutically-acceptable salts and esthers. (E.G.)

  20. Scanning electron microscope

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The principle underlying the design of the scanning electron microscope (SEM), the design and functioning of SEM are described. Its applications in the areas of microcircuitry and materials science are outlined. The development of SEM in India is reviewed. (M.G.B.)

  1. Radiographic scanning agent

    International Nuclear Information System (INIS)

    Tofe, A.J.

    1976-01-01

    A stable radiographic scanning agent on a sup(99m)Tc basis has been developed. The substance contains a pertechnetate reduction agent, tin(II)-chloride, chromium(II)-chloride, or iron(II)-sulphate, as well as an organospecific carrier and ascorbic acid or a pharmacologically admissible salt or ester of ascorbic acid. (VJ) [de

  2. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... you: have had any tests, such as an x-ray or CT scan, surgeries or treatments using iodinated ... page How does the procedure work? With ordinary x-ray examinations, an image is made by passing x- ...

  3. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... for a thyroid scan is 30 minutes or less. Thyroid Uptake You will be given radioactive iodine (I-123 or I-131) in liquid or capsule form to swallow. The thyroid uptake will begin several hours to 24 hours later. Often, two separate uptake ...

  4. Thyroid Scan and Uptake

    Medline Plus

    Full Text Available ... an x-ray or CT scan, surgeries or treatments using iodinated contrast material within the last two months. are taking medications or ingesting other substances that contain iodine , including kelp, seaweed, cough syrups, multivitamins or heart medications. have any ...

  5. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  6. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  7. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  8. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  9. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  10. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  11. Scanning probe microscopy

    International Nuclear Information System (INIS)

    Mainsbridge, B.

    1994-01-01

    In late 1959, Richard Feynman observed that manoeuvring atoms was something that could be done in principle but has not been done, 'because we are too big'. In 1982, the scanning tunnelling microscope (STM) was invented and is now a central tool for the construction of nanoscale devices in what was known as molecular engineering, and now, nanotechnology. The principles of the microscope are outlined and references are made to other scanning devices which have evolved from the original invention. The method of employment of the STM as a machine tool is described and references are made to current speculations on applications of the instrument in nanotechnology. A short bibliography on this topic is included. 27 refs., 7 figs

  12. Scanning probe microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Mainsbridge, B [Murdoch Univ., WA (Australia). School of Mathematical and Physical Sciences

    1994-12-31

    In late 1959, Richard Feynman observed that manoeuvring atoms was something that could be done in principle but has not been done, `because we are too big`. In 1982, the scanning tunnelling microscope (STM) was invented and is now a central tool for the construction of nanoscale devices in what was known as molecular engineering, and now, nanotechnology. The principles of the microscope are outlined and references are made to other scanning devices which have evolved from the original invention. The method of employment of the STM as a machine tool is described and references are made to current speculations on applications of the instrument in nanotechnology. A short bibliography on this topic is included. 27 refs., 7 figs.

  13. 67Ga lung scan

    International Nuclear Information System (INIS)

    Niden, A.H.; Mishkin, F.S.; Khurana, M.M.L.; Pick, R.

    1977-01-01

    Twenty-three patients with clinical signs of pulmonary embolic disease and lung infiltrates were studied to determine the value of gallium citrate 67 Ga lung scan in differentiating embolic from inflammatory lung disease. In 11 patients without angiographically proved embolism, only seven had corresponding ventilation-perfusion defects compatible with inflammatory disease. In seven of these 11 patients, the 67 Ga concentration indicated inflammatory disease. In the 12 patients with angiographically proved embolic disease, six had corresponding ventilation-perfusion defects compatible with inflammatory disease. None had an accumulation of 67 Ga in the area of pulmonary infiltrate. Thus, ventilation-perfusion lung scans are of limited value when lung infiltrates are present. In contrast, the accumulation of 67 Ga in the lung indicates an inflammatory process. Gallium imaging can help select those patients with lung infiltrates who need angiography

  14. Horizon Scanning for Pharmaceuticals

    DEFF Research Database (Denmark)

    Lepage-Nefkens, Isabelle; Douw, Karla; Mantjes, GertJan

    for a joint horizon scanning system (HSS).  We propose to create a central “horizon scanning unit” to perform the joint HS activities (a newly established unit, an existing HS unit, or a third party commissioned and financed by the collaborating countries). The unit will be responsible for the identification...... and filtration of new and emerging pharmaceutical products. It will maintain and update the HS database, organise company pipeline meetings, and disseminate the HSS’s outputs.  The HS unit works closely together with the designated national HS experts in each collaborating country. The national HS experts...... will collect country-specific information, liaise between the central HS unit and country-specific clinical and other experts, coordinate the national prioritization process (to select products for early assessment), and communicate the output of the HSS to national decision makers.  The outputs of the joint...

  15. Multichannel scanning spectrophotometer

    International Nuclear Information System (INIS)

    Lagutin, A.F.

    1979-01-01

    A spectrophotometer designed in the Crimea astrophysical observatory is described. The spectrophotometer is intended for the installation at the telescope to measure energy distribution in the star spectra in the 3100-8550 A range. The device is made according to the scheme with a fixed diffraction lattice. The choice of the optical kinematic scheme is explained. The main design elements are shown. Some singularities of the scanning drive kinematics are considered. The device performance is given

  16. Scanning drop sensor

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Jian; Xiang, Chengxiang; Gregoire, John

    2017-05-09

    Electrochemical experiments are performed on a collection of samples by suspending a drop of electrolyte solution between an electrochemical experiment probe and one of the samples that serves as a test sample. During the electrochemical experiment, the electrolyte solution is added to the drop and an output solution is removed from the drop. The probe and collection of samples can be moved relative to one another so the probe can be scanned across the samples.

  17. Scanning drop sensor

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Shinde, Aniketa A.; Guevarra, Dan W.; Jones, Ryan J.; Marcin, Martin R.; Mitrovic, Slobodan

    2017-05-09

    Electrochemical or electrochemical and photochemical experiments are performed on a collection of samples by suspending a drop of electrolyte solution between an electrochemical experiment probe and one of the samples that serves as a test sample. During the electrochemical experiment, the electrolyte solution is added to the drop and an output solution is removed from the drop. The probe and collection of samples can be moved relative to one another so the probe can be scanned across the samples.

  18. IMEF gamma scanning system

    Energy Technology Data Exchange (ETDEWEB)

    Baek, Sang Yeol; Park, Dae Kyu; Ahn, Sang Bok; Ju, Yong Sun; Jeon, Yong Bum

    1997-06-01

    The gamma scanning system which is installed in IMEF is the equipment obtaining the gamma ray spectrum from irradiated fuels. This equipment could afford the useful data relating spent fuels like as burn-up measurements. We describe the specifications of the equipment and its accessories, and also described its operation procedure so that an operator can use this report as the operation procedure. (author). 1 tab., 11 figs., 11 refs.

  19. IMEF gamma scanning system

    International Nuclear Information System (INIS)

    Baek, Sang Yeol; Park, Dae Kyu; Ahn, Sang Bok; Ju, Yong Sun; Jeon, Yong Bum.

    1997-06-01

    The gamma scanning system which is installed in IMEF is the equipment obtaining the gamma ray spectrum from irradiated fuels. This equipment could afford the useful data relating spent fuels like as burn-up measurements. We describe the specifications of the equipment and its accessories, and also described its operation procedure so that an operator can use this report as the operation procedure. (author). 1 tab., 11 figs., 11 refs

  20. Scanning unit for collectrons

    International Nuclear Information System (INIS)

    Plaige, Yves.

    1976-01-01

    This invention concerns a measurement scanning assembly for collectron type detectors. It is used in measuring the neutron flux in nuclear reactors. As the number of these detectors in a reactor can be very great, they are not usually all connected permanently to the measuring facility but rather in turn by means of a scanning device which carries out, as it were, multiplexing between all the collectrons and the input of a single measuring system. The object of the invention is a scanning assembly which is of relative simplicity through an original organisation. Specifically, according to this organisation, the collectrons outputs are grouped together in bunches, each of these bunches being processed by a multiplexing sub-assembly belonging to a first stage, the different outputs of these multiplexing subassemblies of this first stage being grouped together yet again in bunches processed by multiplexors forming a new stage and so forth. Further, this structure is specially adapted for use with collectrons by utilising a current amplifier at each multiplexing level so that from one end to the other of the multiplexing system, the commutations are carried out on currents and not on voltages [fr

  1. Particle therapy

    Energy Technology Data Exchange (ETDEWEB)

    Raju, M.R.

    1993-09-01

    Particle therapy has a long history. The experimentation with particles for their therapeutic application got started soon after they were produced in the laboratory. Physicists played a major role in proposing the potential applications in radiotherapy as well as in the development of particle therapy. A brief review of the current status of particle radiotherapy with some historical perspective is presented and specific contributions made by physicists will be pointed out wherever appropriate. The rationale of using particles in cancer treatment is to reduce the treatment volume to the target volume by using precise dose distributions in three dimensions by using particles such as protons and to improve the differential effects on tumors compared to normal tissues by using high-LET radiations such as neutrons. Pions and heavy ions combine the above two characteristics.

  2. Particle therapy

    International Nuclear Information System (INIS)

    Raju, M.R.

    1993-01-01

    Particle therapy has a long history. The experimentation with particles for their therapeutic application got started soon after they were produced in the laboratory. Physicists played a major role in proposing the potential applications in radiotherapy as well as in the development of particle therapy. A brief review of the current status of particle radiotherapy with some historical perspective is presented and specific contributions made by physicists will be pointed out wherever appropriate. The rationale of using particles in cancer treatment is to reduce the treatment volume to the target volume by using precise dose distributions in three dimensions by using particles such as protons and to improve the differential effects on tumors compared to normal tissues by using high-LET radiations such as neutrons. Pions and heavy ions combine the above two characteristics

  3. Particle cosmology

    CERN Multimedia

    CERN. Geneva

    2007-01-01

    The understanding of the Universe at the largest and smallest scales traditionally has been the subject of cosmology and particle physics, respectively. Studying the evolution of the Universe connects today's large scales with the tiny scales in the very early Universe and provides the link between the physics of particles and of the cosmos. This series of five lectures aims at a modern and critical presentation of the basic ideas, methods, models and observations in today's particle cosmology.

  4. Particle physics

    International Nuclear Information System (INIS)

    Kamal, Anwar

    2014-01-01

    Provides step-by-step derivations. Contains numerous tables and diagrams. Supports learning and teaching with numerous worked examples, questions and problems with answers. Sketches also the historical development of the subject. This textbook teaches particle physics very didactically. It supports learning and teaching with numerous worked examples, questions and problems with answers. Numerous tables and diagrams lead to a better understanding of the explanations. The content of the book covers all important topics of particle physics: Elementary particles are classified from the point of view of the four fundamental interactions. The nomenclature used in particle physics is explained. The discoveries and properties of known elementary particles and resonances are given. The particles considered are positrons, muon, pions, anti-protons, strange particles, neutrino and hadrons. The conservation laws governing the interactions of elementary particles are given. The concepts of parity, spin, charge conjugation, time reversal and gauge invariance are explained. The quark theory is introduced to explain the hadron structure and strong interactions. The solar neutrino problem is considered. Weak interactions are classified into various types, and the selection rules are stated. Non-conservation of parity and the universality of the weak interactions are discussed. Neutral and charged currents, discovery of W and Z bosons and the early universe form important topics of the electroweak interactions. The principles of high energy accelerators including colliders are elaborately explained. Additionally, in the book detectors used in nuclear and particle physics are described. This book is on the upper undergraduate level.

  5. Magnetic particles

    Science.gov (United States)

    Chang, Manchium (Inventor); Colvin, Michael S. (Inventor)

    1989-01-01

    Magnetic polymer particles are formed by swelling porous, polymer particles and impregnating the particles with an aqueous solution of precursor magnetic metal salt such as an equimolar mixture of ferrous chloride and ferric chloride. On addition of a basic reagent such as dilute sodium hydroxide, the metal salts are converted to crystals of magnetite which are uniformly contained througout the pores of the polymer particle. The magnetite content can be increased and neutral buoyancy achieved by repetition of the impregnaton and neutralization steps to adjust the magnetite content to a desired level.

  6. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  7. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  8. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  9. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  10. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  12. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  13. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  14. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  15. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  16. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  17. Automatic Ultrasound Scanning

    DEFF Research Database (Denmark)

    Moshavegh, Ramin

    on the user adjustments on the scanner interface to optimize the scan settings. This explains the huge interest in the subject of this PhD project entitled “AUTOMATIC ULTRASOUND SCANNING”. The key goals of the project have been to develop automated techniques to minimize the unnecessary settings...... on the scanners, and to improve the computer-aided diagnosis (CAD) in ultrasound by introducing new quantitative measures. Thus, four major issues concerning automation of the medical ultrasound are addressed in this PhD project. They touch upon gain adjustments in ultrasound, automatic synthetic aperture image...

  18. Radiographic scanning agent

    International Nuclear Information System (INIS)

    Bevan, J.A.

    1983-01-01

    This invention relates to radiodiagnostic agents and more particularly to a composition and method for preparing a highly effective technetium-99m-based bone scanning agent. One deficiency of x-ray examination is the inability of that technique to detect skeletal metastases in their incipient stages. It has been discovered that the methanehydroxydiphosphonate bone mineral-seeking agent is unique in that it provides the dual benefits of sharp radiographic imaging and excellent lesion detection when used with technetium-99m. This agent can also be used with technetium-99m for detecting soft tissue calcification in the manner of the inorganic phosphate radiodiagnostic agents

  19. Spinal CT scan, 1

    International Nuclear Information System (INIS)

    Nakagawa, Hiroshi

    1982-01-01

    Methods of CT of the cervical and thoracic spines were explained, and normal CT pictures of them were described. Spinal CT was evaluated in comparison with other methods in various spinal diseases. Plain CT revealed stenosis due to spondylosis or ossification of posterior longitudinal ligament and hernia of intervertebral disc. CT took an important role in the diagnosis of spinal cord tumors with calcification and destruction of the bone. CT scan in combination with other methods was also useful for the diagnosis of spinal injuries, congenital anomalies and infections. (Ueda, J.)

  20. Scanning Color Laser Microscope

    Science.gov (United States)

    Awamura, D.; Ode, T.; Yonezawa, M.

    1988-01-01

    A confocal color laser microscope which utilizes a three color laser light source (Red: He-Ne, Green: Ar, Blue: Ar) has been developed and is finding useful applications in the semiconductor field. The color laser microscope, when compared to a conventional microscope, offers superior color separation, higher resolution, and sharper contrast. Recently some new functions including a Focus Scan Memory, a Surface Profile Measurement System, a Critical Dimension Measurement system (CD) and an Optical Beam Induced Current Function (OBIC) have been developed for the color laser microscope. This paper will discuss these new features.

  1. Scanning apparatus and method

    International Nuclear Information System (INIS)

    Brunnett, C.J.

    1980-01-01

    A novel method is described for processing the analogue signals from the photomultiplier tubes in a tomographic X-ray scanner. The system produces a series of pulses whose instantaneous frequency depends on the detected intensity of the X-radiation. A timer unit is used to determine the segment scan intervals and also to deduce the average radiation intensity detected during this interval. The overall system is claimed to possess the advantageous properties of low time delay, wide bandwidth and relative low cost. (U.K.)

  2. Structures of SRP54 and SRP19, the two proteins that organize the ribonucleic core of the signal recognition particle from Pyrococcus furiosus.

    Directory of Open Access Journals (Sweden)

    Pascal F Egea

    Full Text Available In all organisms the Signal Recognition Particle (SRP, binds to signal sequences of proteins destined for secretion or membrane insertion as they emerge from translating ribosomes. In Archaea and Eucarya, the conserved ribonucleoproteic core is composed of two proteins, the accessory protein SRP19, the essential GTPase SRP54, and an evolutionarily conserved and essential SRP RNA. Through the GTP-dependent interaction between the SRP and its cognate receptor SR, ribosomes harboring nascent polypeptidic chains destined for secretion are dynamically transferred to the protein translocation apparatus at the membrane. We present here high-resolution X-ray structures of SRP54 and SRP19, the two RNA binding components forming the core of the signal recognition particle from the hyper-thermophilic archaeon Pyrococcus furiosus (Pfu. The 2.5 A resolution structure of free Pfu-SRP54 is the first showing the complete domain organization of a GDP bound full-length SRP54 subunit. In its ras-like GTPase domain, GDP is found tightly associated with the protein. The flexible linker that separates the GTPase core from the hydrophobic signal sequence binding M domain, adopts a purely alpha-helical structure and acts as an articulated arm allowing the M domain to explore multiple regions as it scans for signal peptides as they emerge from the ribosomal tunnel. This linker is structurally coupled to the GTPase catalytic site and likely to propagate conformational changes occurring in the M domain through the SRP RNA upon signal sequence binding. Two different 1.8 A resolution crystal structures of free Pfu-SRP19 reveal a compact, rigid and well-folded protein even in absence of its obligate SRP RNA partner. Comparison with other SRP19*SRP RNA structures suggests the rearrangement of a disordered loop upon binding with the RNA through a reciprocal induced-fit mechanism and supports the idea that SRP19 acts as a molecular scaffold and a chaperone, assisting the SRP

  3. Characterization of the diatomite binding domain in the ribosomal protein L2 from E. coli and functions as an affinity tag.

    Science.gov (United States)

    Li, Junhua; Zhang, Yang; Yang, Yanjun

    2013-03-01

    The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.

  4. Particle accelerator

    International Nuclear Information System (INIS)

    Ress, R.I.

    1976-01-01

    Charged particles are entrained in a predetermined direction, independent of their polarity, in a circular orbit by a magnetic field rotating at high speed about an axis in a closed cylindrical or toroidal vessel. The field may be generated by a cylindrical laser structure, whose beam is polygonally reflected from the walls of an excited cavity centered on the axis, or by high-frequency energization of a set of electromagnets perpendicular to the axis. In the latter case, a separate magnetostatic axial field limits the orbital radius of the particles. These rotating and stationary magnetic fields may be generated centrally or by individual magnets peripherally spaced along its circular orbit. Chemical or nuclear reactions can be induced by collisions between the orbiting particles and an injected reactant, or by diverting high-speed particles from one doughnut into the path of counterrotating particles in an adjoining doughnut

  5. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  6. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  7. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  8. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  9. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  10. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  11. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  12. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  13. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. NEW SCANNING DEVICE FOR SCANNING TUNNELING MICROSCOPE APPLICATIONS

    NARCIS (Netherlands)

    SAWATZKY, GA; Koops, Karl Richard

    A small, single piezo XYZ translator has been developed. The device has been used as a scanner for a scanning tunneling microscope and has been tested successfully in air and in UHV. Its simple design results in a rigid and compact scanning unit which permits high scanning rates.

  15. Ultrafast scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Botkin, D.A. [California Univ., Berkeley, CA (United States). Dept. of Physics]|[Lawrence Berkeley Lab., CA (United States)

    1995-09-01

    I have developed an ultrafast scanning tunneling microscope (USTM) based on uniting stroboscopic methods of ultrafast optics and scanned probe microscopy to obtain nanometer spatial resolution and sub-picosecond temporal resolution. USTM increases the achievable time resolution of a STM by more than 6 orders of magnitude; this should enable exploration of mesoscopic and nanometer size systems on time scales corresponding to the period or decay of fundamental excitations. USTM consists of a photoconductive switch with subpicosecond response time in series with the tip of a STM. An optical pulse from a modelocked laser activates the switch to create a gate for the tunneling current, while a second laser pulse on the sample initiates a dynamic process which affects the tunneling current. By sending a large sequence of identical pulse pairs and measuring the average tunnel current as a function of the relative time delay between the pulses in each pair, one can map the time evolution of the surface process. USTM was used to measure the broadband response of the STM`s atomic size tunnel barrier in frequencies from tens to hundreds of GHz. The USTM signal amplitude decays linearly with the tunnel junction conductance, so the spatial resolution of the time-resolved signal is comparable to that of a conventional STM. Geometrical capacitance of the junction does not appear to play an important role in the measurement, but a capacitive effect intimately related to tunneling contributes to the measured signals and may limit the ultimate resolution of the USTM.

  16. Single protein omission reconstitution studies of tetracycline binding to the 30S subunit of Escherichia coli ribosomes

    International Nuclear Information System (INIS)

    Buck, M.; Cooperman, B.S.

    1990-01-01

    In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7

  17. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  18. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  19. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  1. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  2. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  3. A laser sheet self-calibration method for scanning PIV

    Science.gov (United States)

    Knutsen, Anna N.; Lawson, John M.; Dawson, James R.; Worth, Nicholas A.

    2017-10-01

    Knowledge of laser sheet position, orientation, and thickness is a fundamental requirement of scanning PIV and other laser-scanning methods. This paper describes the development and evaluation of a new laser sheet self-calibration method for stereoscopic scanning PIV, which allows the measurement of these properties from particle images themselves. The approach is to fit a laser sheet model by treating particles as randomly distributed probes of the laser sheet profile, whose position is obtained via a triangulation procedure enhanced by matching particle images according to their variation in brightness over a scan. Numerical simulations and tests with experimental data were used to quantify the sensitivity of the method to typical experimental error sources and validate its performance in practice. The numerical simulations demonstrate the accurate recovery of the laser sheet parameters over range of different seeding densities and sheet thicknesses. Furthermore, they show that the method is robust to significant image noise and camera misalignment. Tests with experimental data confirm that the laser sheet model can be accurately reconstructed with no impairment to PIV measurement accuracy. The new method is more efficient and robust in comparison with the standard (self-) calibration approach, which requires an involved, separate calibration step that is sensitive to experimental misalignments. The method significantly improves the practicality of making accurate scanning PIV measurements and broadens its potential applicability to scanning systems with significant vibrations.

  4. Multifrequency scanning probe microscopy study of nanodiamond agglomerates

    Science.gov (United States)

    Aravind, Vasudeva; Lippold, Stephen; Li, Qian; Strelcov, Evgheny; Okatan, Baris; Legum, Benjamin; Kalinin, Sergei; Clarion University Team; Oak Ridge National Laboratory Team

    Due to their rich surface chemistry and excellent mechanical properties and non-toxic nature, nanodiamond particles have found applications such as biomedicine, tribology and lubrication, targeted drug delivery systems, tissue scaffolds and surgical implants. Although single nanodiamond particles have diameters about 4-5nm, they tend to form agglomerates. While these agglomerates can be useful for some purposes, many applications of nanodiamonds require single particle, disaggregated nanodiamonds. This work is oriented towards studying forces and interactions that contribute to agglomeration in nanodiamonds. In this work, using multifrequency scanning probe microscopy techniques, we show that agglomerate sizes can vary between 50-100nm in raw nanodiamonds. Extremeties of particles and Interfaces between agglomerates show dissipative forces with scanning probe microscope tip, indicating agglomerates could act as points of increased adhesion, thus reducing lubricating efficiency when nanodiamonds are used as lubricant additives. This research was conducted at the Center for Nanophase Materials Sciences, which is a DOE Office of Science User Facility.

  5. Lung scan alterations in congenital heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Dietrich, R; Sanchez, J; Munoz, A; Lanaro, A E; Pico, A M

    1975-04-01

    This report analyzes the patterns in 54 lung scannings of 34 patients with altered pulmonary blood flow due to congenital heart disease. The technique and the results are presented. According to the images obtained, the patients are classified in three groups: Group I--normal distribution with more concentration of particles over the right lung and the bases. Group II--normal scannings found in left to right shunts unless there is pulmonary venous hypertension in which case the apex-base relationship was inverted. Group III--patients with right to left shunts of different types presenting various patterns according to severity, associated anomalies and palliative surgery. The hemodynamics created by cardiac defects and surgical procedures explain these alterations. This method is recommended in view of its advantages and accurate results.

  6. Automatic scanning of NTA film neutron dosimeters

    CERN Document Server

    Müller, R

    1999-01-01

    At the European Laboratory for Particle Physics CERN, personal neutron monitoring for over 4000 collaborators is performed with Kodak NTA film, one of the few suitable dosemeters in the stray radiation environment of a high energy accelerator. After development, films are scanned with a projection microscope. To overcome this lengthy and strenuous procedure an automated analysis system for the dosemeters has been developed. General purpose image recognition software, tailored to the specific needs with a macro language, analyses the digitised microscope image. This paper reports on the successful automatic scanning of NTA films irradiated with neutrons from a /sup 238/Pu-Be source (E approximately=4 MeV), as well as on the extension of the method to neutrons of higher energies. The question of detection limits is discussed in the light of an application of the method in routine personal neutron monitoring. (9 refs).

  7. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  8. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  9. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  12. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  13. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  14. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  15. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Aging fingerprints in combustion particles

    Science.gov (United States)

    Zelenay, V.; Mooser, R.; Tritscher, T.; Křepelová, A.; Heringa, M. F.; Chirico, R.; Prévôt, A. S. H.; Weingartner, E.; Baltensperger, U.; Dommen, J.; Watts, B.; Raabe, J.; Huthwelker, T.; Ammann, M.

    2011-05-01

    Soot particles can significantly influence the Earth's climate by absorbing and scattering solar radiation as well as by acting as cloud condensation nuclei. However, despite their environmental (as well as economic and political) importance, the way these properties are affected by atmospheric processing is still a subject of discussion. In this work, soot particles emitted from two different cars, a EURO 2 transporter, a EURO 3 passenger vehicle, and a wood stove were investigated on a single-particle basis. The emitted exhaust, including the particulate and the gas phase, was processed in a smog chamber with artificial solar radiation. Single particle specimens of both unprocessed and aged soot were characterized using x-ray absorption spectroscopy and scanning electron microscopy. Comparison of the spectra from the unprocessed and aged soot particles revealed changes in the carbon functional group content, such as that of carboxylic carbon, which can be ascribed to both the condensation of secondary organic compounds on the soot particles and oxidation of primary soot particles upon photochemical aging. Changes in the morphology and size of the single soot particles were also observed upon aging. Furthermore, we show that the soot particles take up water in humid environments and that their water uptake capacity increases with photochemical aging.

  17. Scanning device for a spectrometer

    International Nuclear Information System (INIS)

    Ignat'ev, V.M.

    1982-01-01

    The invention belongs to scanning devices and is intended for spectrum scanning in spectral devices. The purpose of the invention is broadening of spectral scanning range. The device construction ensures the spectrum scanning range determined from revolution fractions to several revolutions of the monochromator drum head, any number of the drum head revolutions determined by integral number with addition of the drum revolution fractions with high degree of accuracy being possible

  18. Factors influencing bone scan quality

    International Nuclear Information System (INIS)

    Adams, F.G.; Shirley, A.W.

    1983-01-01

    A reliable subjective method of assessing bone scan quality is described. A large number of variables which theoretically could influence scan quality were submitted to regression and factor analysis. Obesity, age, sex and abnormality of scan were found to be significant but weak variables. (orig.)

  19. CT scans in encephalitis

    International Nuclear Information System (INIS)

    Imanishi, Masami; Morimoto, Tetsuya; Iida, Noriyuki; Hisanaga, Manabu; Kinugawa, Kazuhiko

    1980-01-01

    Generally, CT scans reveal a decrease in the volume of the ventricular system, sylvian fissures and cortical sulci in the acute stage of encephalitis, and softening of the cerebral lobes with dilatation of the lateral ventricles and subarachnoidian dilated spaces in the chronic stage. We encountered three cases of encephalitis: mumps (case 1), herpes simplex (case 2), and syphilis (case 3). In case 1, brain edema was seen in the acute stage and brain atrophy in the chronic stage. In case 2, necrosis of the temporal pole, which is pathognomonic in herpes simplex encephalitis, was recognized. And in case 3, multiple lesions whose CT appearance was enhanced by contrast materials were found scattered over the whole brain. These lesions were diagnosed as inflammatory granuloma by histological examination. (author)

  20. Scanning device for scintigraphy

    International Nuclear Information System (INIS)

    Casale, R.

    1975-01-01

    A device is described for the scintigraphic scanning according to a horizontal plane, comprising: (a) A support provided with two guides horizontally and longitudinally located, one of which is located in the upper part of the support, while the second guide is located in the lower part of the support; (b) A carriage, movable with respect to the support along the two guides, provided in its upper part, projecting above the support, with rolling means suitable to support and to cause to slide along its axis a support rod for the first detector, horizontally and transversely located, said carriage being further provided in its lower part with a recess with possible rolling means suitable to support and to cause to slide along its axis a second support rod for the second detector, said second rod being located parallel to the first rod and below it; (c) One or two support rods for the detectors, the first of said rods being supported above the support in a sliding way along its axis, by the rolling means located in the upper part of the carriage, and the second rod if present is supported slidingly along its axis by the possible rolling means contained in the suitable recess which is provided in the lower part of the carriage, and (d) A vertical shaft supported by said carriage on which is mounted a toothed wheel for each rod, each toothed wheel engaging a positive drive belt or the like, which is connected to each said rod so that rotation of the shaft determines the simultaneous displacement of the two rods along their axes; and single motor means for driving said shaft during a scanning operation. (U.S.)

  1. Scanning the periphery.

    Science.gov (United States)

    Day, George S; Schoemaker, Paul J H

    2005-11-01

    Companies often face new rivals, technologies, regulations, and other environmental changes that seem to come out of left field. How can they see these changes sooner and capitalize on them? Such changes often begin as weak signals on what the authors call the periphery, or the blurry zone at the edge of an organization's vision. As with human peripheral vision, these signals are difficult to see and interpret but can be vital to success or survival. Unfortunately, most companies lack a systematic method for determining where on the periphery they should be looking, how to interpret the weak signals they see, and how to allocate limited scanning resources. This article provides such a method-a question-based framework for helping companies scan the periphery more efficiently and effectively. The framework divides questions into three categories: learning from the past (What have been our past blind spots? What instructive analogies do other industries offer? Who in the industry is skilled at picking up weak signals and acting on them?); evaluating the present (What important signals are we rationalizing away? What are our mavericks, outliers, complainers, and defectors telling us? What are our peripheral customers and competitors really thinking?); and envisioning the future (What future surprises could really hurt or help us? What emerging technologies could change the game? Is there an unthinkable scenario that might disrupt our business?). Answering these questions is a good first step toward anticipating problems or opportunities that may appear on the business horizon. The article concludes with a self-test that companies can use to assess their need and capability for peripheral vision.

  2. Scanning electron microscopy of coal macerals

    Energy Technology Data Exchange (ETDEWEB)

    Davis, M.R.; White, A.; Deegan, M.D.

    1986-02-01

    Individual macerals separated from some United Kingdom coals of Carboniferous age and bituminous rank were examined by scanning electron microscopy. In each case a specific morphology characteristic of the macerals studied could be recognized. Collinite (a member of the vitrinite maceral group) was recognizable in all samples by its angular shape and characteristic fracture patterns, the particles (30-200 ..mu..m) frequently showing striated or laminated surface. Sporinite particles had no well defined shape and were associated with more detrital material than were the other macerals studied. This detritus was shown by conventional light microscopy to be the maceral micrinite. Fusinite was remarkable in having a chunky needle form, with lengths of up to 200 ..mu..m. 8 references.

  3. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  4. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  5. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  6. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  7. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  8. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  9. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  10. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  11. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  12. Particle detectors

    CERN Document Server

    Hilke, Hans Jürgen

    1992-01-01

    We shall discuss the principles of the main techniques applied to particle detection (including front-end electronics), the construction and performance of some of the devices presently in operation and a few ideas on future developments.

  13. Method and apparatus for scanning x-ray tomography

    International Nuclear Information System (INIS)

    Albert, R.D.

    1988-01-01

    In a method of producing a tomographic image of a subject that includes the steps of generating X-rays at a moving origin point by directing a charged particle beam to a target surface, deflecting the charged particle beam to travel the origin point through a predetermined raster scan at the surface, detecting variations of X-ray intensity during the course of the raster scan at spaced apart detection points situated at the opposite side of the subject from the origin point, generating a first sequence of data values that is indicative of variations of X-ray intensity at a first of the detection points at successive times during the course of the raster scan and generating at least a second sequence of data values that is indicative of variations of X-ray intensity at a second of the detection points at successive times during the course of the same raster scan, the improvement is described comprising: combining successive individual data values of the first sequence that are generated by X-rays from successive particular locations in the raster scan with at least individual data values of the second sequence that are generated by X-rays from predetermined successive different locations in the same raster scan in order to produce a composite sequence of data values, and producing an image corresponding to at least a portion of the raster scan which depicts variations of the magnitude of successive data values of the composite sequence

  14. Auroral particles

    International Nuclear Information System (INIS)

    Evans, D.S.

    1987-01-01

    The problems concerning the aurora posed prior to the war are now either solved in principle or were restated in a more fundamental form. The pre-war hypothesis concerning the nature of the auroral particles and their energies was fully confirmed, with the exception that helium and oxygen ions were identified as participating in the auroral particle precipitation in addition to the protons. The nature of the near-Earth energization processes affecting auroral particles was clarified. Charged particle trajectories in various electric field geometries were modeled. The physical problems have now moved from determining the nature and geometry of the electric fields, which accelerate charged particles near the Earth, to accounting for the existence of these electric fields as a natural consequence of the solar wind's interaction with Earth. Ultimately the reward in continuing the work in auroral and magnetospheric particle dynamics will be a deeper understanding of the subtleties of classical electricity and magnetism as applied to situations not blessed with well-defined and invariant geometries

  15. Elementary particles and particle interactions

    International Nuclear Information System (INIS)

    Bethge, K.; Schroeder, U.E.

    1986-01-01

    This book is a textbook for an introductory course of elementary particle physics. After a general introduction the symmetry principles governing the interactions of elementary particles are discussed. Then the phenomenology of the electroweak and strong interactions are described together with a short introduction to the Weinberg-Salam theory respectively to quantum chromodynamics. Finally a short outlook is given to grand unification with special regards to SU(5) and cosmology in the framework of the current understanding of the fundamental principles of nature. In the appendix is a table of particle properties and physical constants. (HSI) [de

  16. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  18. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  19. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  20. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  1. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  2. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  3. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  4. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  5. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  6. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  7. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  8. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  9. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  10. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  11. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  12. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  13. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  14. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  15. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  16. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  17. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  18. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  19. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  20. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...