Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)
1975-06-01
Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.
Energy Technology Data Exchange (ETDEWEB)
Usami, K; Ogata, K [Niigata Univ. (Japan). School of Medicine
1930-06-16
The authors present the time course of the labeling of RNA and protein moieties of these particles in vivo as well as the pattern of one-dimensional acrylamide gel electrophoresis of their protein moieties labeled with (/sup 35/S)methionine in vivo, which shows that released 60 S particles are newly synthesized ribosomal large subunits or their precursor particles in the nucleoplasm on their way from the nucleolus to the cytoplasm. It appears likely that released 40 S particles contain newly synthesized ribosomal small subunits or their precursors in the nucleoplasm.
Directory of Open Access Journals (Sweden)
Alexander M. Brannan
2015-12-01
Full Text Available Differential Scanning Calorimetry (DSC of intact Escherichia coli (E. coli was used to identify non-lipidic targets of the antimicrobial peptide (AMP MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets.
Placeholder factors in ribosome biogenesis: please, pave my way
Directory of Open Access Journals (Sweden)
Francisco J. Espinar-Marchena
2017-04-01
Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.
International Nuclear Information System (INIS)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo
2006-01-01
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone
Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering
International Nuclear Information System (INIS)
Burkhardt, N.
1997-01-01
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle
Energy Technology Data Exchange (ETDEWEB)
Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)
1976-01-01
An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.
DEFF Research Database (Denmark)
Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka
2012-01-01
additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....
Automated rapid particle investigation using scanning electron microscopy
Wilkins, Jerod Laurence
The chemical composition of fly ash particles has been known to vary significantly depending on a number of factors. Current bulk methods of investigation including X-Ray Fluorescence and X-Ray Diffraction are thought to be inadequate in determining the performance of fly ash in concrete. It is the goal of this research to develop a method of Automated Rapid Particle Investigation that will not look at fly ash as a bulk material but as individual particles. By examining each particle individually scientists and engineers will have the ability to study the variation in chemical composition by comparing the chemistry present in each particle. The method of investigation developed by this research provides a practical technique that will allow the automated chemical analysis of hundreds, or even thousands, of fly ash particles in a matter of minutes upon completion of sample preparation and automated scanning electron microscope (ASEM) scanning. This research does not examine the significance of the chemical compounds discovered; rather, only the investigation methodology is discussed. Further research will be done to examine the importance of the chemistry discovered with this automated rapid particle investigation technique.
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1997-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Energy Technology Data Exchange (ETDEWEB)
Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung
1998-12-31
Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit
Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos
2010-10-01
Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.
3D scanning particle tracking velocimetry
Energy Technology Data Exchange (ETDEWEB)
Hoyer, Klaus; Holzner, Markus; Guala, Michele; Liberzon, Alexander; Kinzelbach, Wolfgang [Swiss Federal Institut of Technology Zurich, Institut fuer Hydromechanik und Wasserwirtschaft, Zuerich (Switzerland); Luethi, Beat [Risoe National Laboratory, Roskilde (Denmark)
2005-11-01
In this article, we present an experimental setup and data processing schemes for 3D scanning particle tracking velocimetry (SPTV), which expands on the classical 3D particle tracking velocimetry (PTV) through changes in the illumination, image acquisition and analysis. 3D PTV is a flexible flow measurement technique based on the processing of stereoscopic images of flow tracer particles. The technique allows obtaining Lagrangian flow information directly from measured 3D trajectories of individual particles. While for a classical PTV the entire region of interest is simultaneously illuminated and recorded, in SPTV the flow field is recorded by sequential tomographic high-speed imaging of the region of interest. The advantage of the presented method is a considerable increase in maximum feasible seeding density. Results are shown for an experiment in homogenous turbulence and compared with PTV. SPTV yielded an average 3,500 tracked particles per time step, which implies a significant enhancement of the spatial resolution for Lagrangian flow measurements. (orig.)
Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad
2013-01-01
Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461
Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.
Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger
2010-07-15
The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Ribosomal trafficking is reduced in Schwann cells following induction of myelination
Directory of Open Access Journals (Sweden)
James M. Love
2015-08-01
Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following
TSI Model 3936 Scanning Mobility Particle Spectrometer Instrument Handbook
Energy Technology Data Exchange (ETDEWEB)
Kuang, C. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2016-02-01
The Model 3936 Scanning Mobility Particle Spectrometer (SMPS) measures the size distribution of aerosols ranging from 10 nm up to 1000 nm. The SMPS uses a bipolar aerosol charger to keep particles within a known charge distribution. Charged particles are classified according to their electrical mobility, using a long-column differential mobility analyzer (DMA). Particle concentration is measured with a condensation particle counter (CPC). The SMPS is well-suited for applications including: nanoparticle research, atmospheric aerosol studies, pollution studies, smog chamber evaluations, engine exhaust and combustion studies, materials synthesis, filter efficiency testing, nucleation/condensation studies, and rapidly changing aerosol systems.
Directory of Open Access Journals (Sweden)
Silar Philippe
2000-11-01
Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.
Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad
2016-01-25
Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.
Imaging of the vertical particle tracks without any depth scanning
International Nuclear Information System (INIS)
Soroko, L.M.
2001-01-01
The principle of a new optical microscope which enables us to get the image of a vertical particle track without any depth scanning is described. This new optical microscope contains a spatial transformer which consists of mirror lamellar elements and which produces a secondary in focus image of the vertical particle track. Properties of such a system are presented. A longitudinal resolution is estimated
International Nuclear Information System (INIS)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi
2016-01-01
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Energy Technology Data Exchange (ETDEWEB)
Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)
2016-04-22
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.
Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead
Energy Technology Data Exchange (ETDEWEB)
Barrow, W; Himmel, M; Squire, P G; Tornabene, T G
1978-01-01
Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.
Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.
Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C
2016-04-01
Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.
Architecture of the E.coli 70S ribosome
DEFF Research Database (Denmark)
Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.
1997-01-01
The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...
Site-specific fluorescent labeling of nascent proteins on the translating ribosome.
Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou
2011-09-28
As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.
Probing Single Nanometer-scale Particles with Scanning Tunneling Microscopy and Spectroscopies
International Nuclear Information System (INIS)
McCarty, G.S.; Love, J.C.; Kushmerick, J.G.; Charles, L.F.; Keating, C.D.; Toleno, B.J.; Lyn, M.E.; Castleman, A.W.; Natan, M.J.; Weiss, P.S.
1999-01-01
Scanning tunneling microscopy can be used to isolate single particles on surfaces for further study. Local optical and electronic properties coupled with topographic information collected by the scanning tunneling microscope (STM) give insight into the intrinsic properties of the species under study. Since each spectroscopic measurement is done on a single particle, each sample is 'monodisperse', regardless of the degree of heterogeneity of the original preparation. We illustrate this with three example systems - a metal cluster of known atomic structure, metal nanoparticles dispersed from colloid suspensions, and metallocarbohedrenes (Met-Cars) deposited with other reaction products. Au and Ag nanoparticles were imaged using a photon emission STM. The threshold voltage, the lowest bias voltage at which photons are produced, was determined for Au nanoparticles. Electronic spectra of small clusters of Ni atoms on MoS 2 were recorded. Preliminary images of Zr-based Met-Car-containing soot were obtained on Au and MoS 2 substrates and partial electronic spectra were recorded of these possible Met-Car particles
Högenauer, G; Ruf, C
1981-01-01
Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Charged particle beam scanning using deformed high gradient insulator
Chen, Yu -Jiuan
2015-10-06
Devices and methods are provided to allow rapid deflection of a charged particle beam. The disclosed devices can, for example, be used as part of a hadron therapy system to allow scanning of a target area within a patient's body. The disclosed charged particle beam deflectors include a dielectric wall accelerator (DWA) with a hollow center and a dielectric wall that is substantially parallel to a z-axis that runs through the hollow center. The dielectric wall includes one or more deformed high gradient insulators (HGIs) that are configured to produce an electric field with an component in a direction perpendicular to the z-axis. A control component is also provided to establish the electric field component in the direction perpendicular to the z-axis and to control deflection of a charged particle beam in the direction perpendicular to the z-axis as the charged particle beam travels through the hollow center of the DWA.
Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation
Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.
2016-01-01
Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435
International Nuclear Information System (INIS)
Kylberg, Karin; Bjoerk, Petra; Fomproix, Nathalie; Ivarsson, Birgitta; Wieslander, Lars; Daneholt, Bertil
2010-01-01
We have studied the nucleocytoplasmic transport of a specific messenger RNP (mRNP) particle, named Balbiani ring (BR) granule, and ribosomal RNP (rRNP) particles in the salivary glands of the dipteran Chironomus tentans. The passage of the RNPs through the nuclear pore complex (NPC) was inhibited with the nucleoporin-binding wheat germ agglutinin, and the effects were examined by electron microscopy. BR mRNPs bound to the nuclear basket increased in number, while BR mRNPs translocating through the central channel decreased, suggesting that the initiation of translocation proper had been inhibited. The rRNPs accumulated heavily in nucleoplasm, while no or very few rRNPs were recorded within nuclear baskets. Thus, the transport of rRNPs had been blocked prior to the entry into the baskets. Remarkably, the rRNPs had been excluded both from baskets and the space in between the baskets. We propose that normally basket fibrils move freely and repel RNPs from the exclusion zone unless the particles have affinity for and bind to nucleoporins within the baskets.
Contrast and decay of cathodoluminescence from phosphor particles in a scanning electron microscope.
den Engelsen, Daniel; Harris, Paul G; Ireland, Terry G; Fern, George R; Silver, Jack
2015-10-01
Cathodoluminescence (CL) studies are reported on phosphors in a field emission scanning electron microscope (FESEM). ZnO: Zn and other luminescent powders manifest a bright ring around the periphery of the particles: this ring enhances the contrast. Additionally, particles resting on top of others are substantially brighter than underlying ones. These phenomena are explained in terms of the combined effects of electrons backscattered out of the particles, together with light absorption by the substrate. The contrast is found to be a function of the particle size and the energy of the primary electrons. Some phosphor materials exhibit a pronounced comet-like structure at high scan rates in a CL-image, because the particle continues to emit light after the electron beam has moved to a position without phosphor material. Image analysis has been used to study the loss of brightness along the tail and hence to determine the decay time of the materials. The effect of phosphor saturation on the determination of decay times by CL-microscopy was also investigated. Copyright © 2015 Elsevier B.V. All rights reserved.
GTPases and the origin of the ribosome
Directory of Open Access Journals (Sweden)
Smith Temple F
2010-05-01
Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes
2014-12-01
During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.
Protein-protein interactions within late pre-40S ribosomes.
Directory of Open Access Journals (Sweden)
Melody G Campbell
2011-01-01
Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
International Nuclear Information System (INIS)
Denslow, N.D.; O'Brien, T.W.
1984-01-01
To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
Guo, H X; Heinämäki, J; Yliruusi, J
1999-09-20
Direct compression of riboflavin sodium phosphate tablets was studied by confocal laser scanning microscopy (CLSM). The technique is non-invasive and generates three-dimensional (3D) images. Tablets of 1% riboflavin sodium phosphate with two grades of microcrystalline cellulose (MCC) were individually compressed at compression forces of 1.0 and 26.8 kN. The behaviour and deformation of drug particles on the upper and lower surfaces of the tablets were studied under compression forces. Even at the lower compression force, distinct recrystallized areas in the riboflavin sodium phosphate particles were observed in both Avicel PH-101 and Avicel PH-102 tablets. At the higher compression force, the recrystallization of riboflavin sodium phosphate was more extensive on the upper surface of the Avicel PH-102 tablet than the Avicel PH-101 tablet. The plastic deformation properties of both MCC grades reduced the fragmentation of riboflavin sodium phosphate particles. When compressed with MCC, riboflavin sodium phosphate behaved as a plastic material. The riboflavin sodium phosphate particles were more tightly bound on the upper surface of the tablet than on the lower surface, and this could also be clearly distinguished by CLSM. Drug deformation could not be visualized by other techniques. Confocal laser scanning microscopy provides valuable information on the internal mechanisms of direct compression of tablets.
Contrast and decay of cathodoluminescence from phosphor particles in a scanning electron microscope
Energy Technology Data Exchange (ETDEWEB)
Engelsen, Daniel den; Harris, Paul G.; Ireland, Terry G., E-mail: terry.ireland@brunel.ac.uk; Fern, George R.; Silver, Jack
2015-10-15
Cathodoluminescence (CL) studies are reported on phosphors in a field emission scanning electron microscope (FESEM). ZnO: Zn and other luminescent powders manifest a bright ring around the periphery of the particles: this ring enhances the contrast. Additionally, particles resting on top of others are substantially brighter than underlying ones. These phenomena are explained in terms of the combined effects of electrons backscattered out of the particles, together with light absorption by the substrate. The contrast is found to be a function of the particle size and the energy of the primary electrons. Some phosphor materials exhibit a pronounced comet-like structure at high scan rates in a CL-image, because the particle continues to emit light after the electron beam has moved to a position without phosphor material. Image analysis has been used to study the loss of brightness along the tail and hence to determine the decay time of the materials. The effect of phosphor saturation on the determination of decay times by CL-microscopy was also investigated. - Highlights: • Contrast enhancement are observed in secondary electron and cathodoluminescent images of phosphor particles sitting on top of others. • Backscattered electrons largely explain the observed contrast enhancement. • After glow effects in CL-micrographs of phosphors enable the determination of decay times. • Phosphor saturation can be used to determine the decay time of individual spectral transitions.
Directory of Open Access Journals (Sweden)
Arin Ngamniyom
2016-02-01
Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.
Protein folding on the ribosome studied using NMR spectroscopy
Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John
2013-01-01
NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462
Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.
1985-01-01
Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
International Nuclear Information System (INIS)
Lee, Yong Suk; Ha, Hyun Kwon; Lee, Yang Seob; Kim, Jae Kyun; Yoon, Seong Eon; Kim, Jung Hoon; Chung, Dong Jin; Auh, Yong Ho
1998-01-01
To qualitatively analysed barium coating status in the intestinal mucosa, we used scanning electron microscopy to observe barium particles coated in the small intestinal mucosa of rabbit, and we attempted to assess the relationship between electron microscopic findings and radiographic densities. Six different combination of barium and methylcellulose suspensions were infused into the resected small intestines of 15 rabbits. Barium powders were mixed with water to make 40% and 70% w/v barium solutions, and also mixed with 0.5% methylcellulose solutions were used as a double contrast agent. After the infusion of barium suspensions, a mammography unit was used to obtain radiographs of the small intestine, and their optical densities were measured by a densitometer. Thereafter, photographs of barium-coated small intestinal mucosa were obtained using a scanning electron microscope (x 8,000), and the number of barium particles in the unit area were measured. To compare the relationship between the electron microscopic findings and optical densities, statistical analysis using Spearman correlation was performed. This study shows that by using scanning electron microscopy, barium particles coated on the small intestinal mucosa can be qualitatively analysed. It also shows that the number of small barium particles measured by scanning electron microscopy is related to optical densities. (author). 14 refs., 2 figs
Advances in 4D treatment planning for scanned particle beam therapy - report of dedicated workshops
Bert, Christoph; Graeff, Christian; Riboldi, Marco; Nill, Simeon; Baroni, Guido; Knopf, Antje-Christin
2014-01-01
We report on recent progress in the field of mobile tumor treatment with scanned particle beams, as discussed in the latest editions of the 4D treatment planning workshop. The workshop series started in 2009, with about 20 people from 4 research institutes involved, all actively working on particle
Dark-field scanning confocal microscope for vertical particle tracks in nuclear emulsion
International Nuclear Information System (INIS)
Astakhov, A.Ya.; Batusov, Yu.A.; Soroko, L.M.; Tereshchenko, S.V.; Tereshchenko, V.V.
1999-01-01
The principle of the DArk-FIeld Scanning CONfocal (DAFISCON) microscope for selective observation of the vertical particle tracks in nuclear emulsion is described. The construction of the DAFISCON microscope, built on the basis of the 2D measurement microscope, is described. The results of the experimental testing of the DAFISCON microscope, accomplished at high density of the vertical particle tracks, are presented. The 2D plot and the 1D plot of the CCD dark-field image are given. The spatial resolution of our microscope can be increased by using the objective with higher aperture
Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad
2017-05-19
During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Directory of Open Access Journals (Sweden)
Bani Kumar Pathak
Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.
Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian
2016-01-01
Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.
Acosta-Sampson, Ligia; Döring, Kristina; Lin, Yuping; Yu, Vivian Y; Bukau, Bernd; Kramer, Günter; Cate, Jamie H D
2017-12-01
Targeting of most integral membrane proteins to the endoplasmic reticulum is controlled by the signal recognition particle, which recognizes a hydrophobic signal sequence near the protein N terminus. Proper folding of these proteins is monitored by the unfolded protein response and involves protein degradation pathways to ensure quality control. Here, we identify a new pathway for quality control of major facilitator superfamily transporters that occurs before the first transmembrane helix, the signal sequence recognized by the signal recognition particle, is made by the ribosome. Increased rates of translation elongation of the N-terminal sequence of these integral membrane proteins can divert the nascent protein chains to the ribosome-associated complex and stress-seventy subfamily B chaperones. We also show that quality control of integral membrane proteins by ribosome-associated complex-stress-seventy subfamily B couples translation rate to the unfolded protein response, which has implications for understanding mechanisms underlying human disease and protein production in biotechnology. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Klein, S A; Moran, J L; Posner, J D; Frakes, D H
2012-01-01
We present a diagnostic platform for measuring three-dimensional three-component (3D3C) velocity fields in microscopic volumes. The imaging system uses high-speed Nipkow spinning disk confocal microscopy. Confocal microscopy provides optical sectioning using pinhole spatial filtering which rejects light originating from out-of-focus objects. The system accomplishes volumetric scanning by rapid translation of the high numerical aperture objective using a piezo objective positioner. The motion of fluorescent microspheres is quantified using 3D3C super resolution particle-imaging velocimetry with instantaneous spatial resolutions of the order of 5 µm or less in all three dimensions. We examine 3D3C flow in a PDMS microchannel with an expanding section at 3D acquisition rates of 30 Hz, and find strong agreement with a computational model. Equations from the PIV and PTV literature adapted for a scanning objective provide estimates of maximum measurable velocity. The technique allows for isosurface visualization of 3D particle motion and robust high spatial resolution velocity measurements without requiring a calibration step or reconstruction algorithms. (paper)
Scanning tomographic particle image velocimetry applied to a turbulent jet
Casey, T. A.
2013-02-21
We introduce a modified tomographic PIV technique using four high-speed video cameras and a scanning pulsed laser-volume. By rapidly illuminating adjacent subvolumes onto separate video frames, we can resolve a larger total volume of velocity vectors, while retaining good spatial resolution. We demonstrate this technique by performing time-resolved measurements of the turbulent structure of a round jet, using up to 9 adjacent volume slices. In essence this technique resolves more velocity planes in the depth direction by maintaining optimal particle image density and limiting the number of ghost particles. The total measurement volumes contain between 1 ×106 and 3 ×106 velocity vectors calculated from up to 1500 reconstructed depthwise image planes, showing time-resolved evolution of the large-scale vortical structures for a turbulent jet of Re up to 10 000.
Directory of Open Access Journals (Sweden)
Harold S Bernhardt
2015-11-01
Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-08
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
DEFF Research Database (Denmark)
Grankowski, N; Gasior, E; Issinger, O G
1993-01-01
Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...
Bai, Zhangpeng; Ji, Yuan; Pi, Yiqun; Yang, Kaixiang; Wang, Li; Zhang, Yinqi; Zhai, Yadi; Yan, Zhengguang; Han, Xiaodong
2018-01-01
Investigating the hygroscopic behavior of haze aerosol particles is essential for understanding their physicochemical properties and their impacts on regional weather and visibility. An environmental scanning electron microscope equipped with a home-made transmission-scattering electron imaging setup and an energy dispersive spectrometer was used for in-situ observations of pure water-soluble (WS) salts and Beijing haze particles. This imaging setup showed obvious advantages for improving the resolution and acquiring internal information of mixed particles in hydrated environments. We measured the deliquescence relative humidity of pure NaCl, NH4NO3, and (NH4)2SO4 by deliquescence-crystallization processes with an accuracy of up to 0.3% RH. The mixed haze particles showed hygroscopic activation like water uptake and morphological changes when they included WS components such as nitrates, sulfates, halides, ammoniums, and alkali metal salts. In addition, the hygroscopic behavior provides complementary information for analyzing possible phases in mixed haze particles.
Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components
International Nuclear Information System (INIS)
Tejedor, F.; Ballesta, J.P.
1986-01-01
Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Scanned beams of high-energy charged particles and features of their collimation
International Nuclear Information System (INIS)
Zor'ko, K.I.; Kudoyarov, M.F.; Matyukov, A.V.; Mukhin, S.A.; Patrova, M.Ya.
2007-01-01
The coordinate distributions of the accelerated charged particle flux density that are simultaneously formed by sinusoidal scanning and collimation are analyzed. Under certain formation conditions, the edge portions of these distributions are shown to take a two-humped shape. The experimental data obtained are in good agreement with the calculation. Recommendations are made about practical use of these beams in view of the above effects [ru
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Differential Stoichiometry among Core Ribosomal Proteins
Directory of Open Access Journals (Sweden)
Nikolai Slavov
2015-11-01
Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.
Control of ribosome formation in rat heart
International Nuclear Information System (INIS)
Russo, L.A.
1987-01-01
Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Ribosomal history reveals origins of modern protein synthesis.
Directory of Open Access Journals (Sweden)
Ajith Harish
Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.
Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli
Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.
1982-06-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.
Directory of Open Access Journals (Sweden)
Julien Burlaud-Gaillard
Full Text Available The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy. CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.
Post-transcriptional regulation of ribosome biogenesis in yeast
Directory of Open Access Journals (Sweden)
Isabelle C. Kos-Braun
2017-05-01
Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.
Ribosomal Antibiotics: Contemporary Challenges
Directory of Open Access Journals (Sweden)
Tamar Auerbach-Nevo
2016-06-01
Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.
Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes
International Nuclear Information System (INIS)
Singh, H.; Bishop, J.
1984-01-01
It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)
Neutron scattering and the 30 S ribosomal subunit of E. coli
International Nuclear Information System (INIS)
Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.
1982-01-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures
International Nuclear Information System (INIS)
Takeuchi, Jo; Masaki, Kazushige; Emoto, Yuji
2009-01-01
The individual particle analyses of suspended particulate matter (SPM: particles less than 10 μm in size) collected on tape filters during April 17-18, 2006, in Kawasaki, Japan, were carried out. The chemical elements present in aerosol particles were investigated by using a scanning electron microscope with an energy-dispersive X-ray spectrometer. The fraction of chemical elements detected in the particles collected on April 18, 2006, except for S, was in good agreement with that in Asian dust particles from the Loess Plateau, China. S was not detected in Asian dust particles but was detected in the particles collected on April 18, 2006. Therefore, it was concluded that the particles collected in April 18, 2006, in Kawasaki were Asian dust particles transported from the Asian continent, and the absorption of SO 2 or the coagulation of sulfate occurred during the transportation of Asian dust particles. (author)
Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.
Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad
2018-04-20
Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
Emerging functions of ribosomal proteins in gene-specific transcription and translation
International Nuclear Information System (INIS)
Lindstroem, Mikael S.
2009-01-01
Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
Knopf, Antje; Bert, Christoph; Heath, Emily; Nill, Simeon; Kraus, Kim; Richter, Daniel; Hug, Eugen; Pedroni, Eros; Safai, Sairos; Albertini, Francesca; Zenklusen, Silvan; Boye, Dirk; Söhn, Matthias; Soukup, Martin; Sobotta, Benjamin; Lomax, Antony
2010-09-01
This article reports on a 4D-treatment planning workshop (4DTPW), held on 7-8 December 2009 at the Paul Scherrer Institut (PSI) in Villigen, Switzerland. The participants were all members of institutions actively involved in particle therapy delivery and research. The purpose of the 4DTPW was to discuss current approaches, challenges, and future research directions in 4D-treatment planning in the context of actively scanned particle radiotherapy. Key aspects were addressed in plenary sessions, in which leaders of the field summarized the state-of-the-art. Each plenary session was followed by an extensive discussion. As a result, this article presents a summary of recommendations for the treatment of mobile targets (intrafractional changes) with actively scanned particles and a list of requirements to elaborate and apply these guidelines clinically.
Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.
Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria
2017-07-06
Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Nakashima, K.; Yoshitsugu, K.; Tokiwa, H.; Fukuoka Environmental Research Center
1983-01-01
The particles formed by diesel combustion, which may contain various mutagenic chemicals like polycyclic aromatic hydrocarbons (PAH), are analyzed in their morphology by scanning electron microscopy; their sulfur content is detected by X-ray microanalysis, and mutagenicity is tested with a Salmonella typhimurium bioassay. The authors find a close correlation between sulfur content and mutagenicity of PAH. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
Sameshima, M; Ito, K; Iwabuchi, M
1972-01-01
In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.
Coquelin, L.; Le Brusquet, L.; Fischer, N.; Gensdarmes, F.; Motzkus, C.; Mace, T.; Fleury, G.
2018-05-01
A scanning mobility particle sizer (SMPS) is a high resolution nanoparticle sizing system that is widely used as the standard method to measure airborne particle size distributions (PSD) in the size range 1 nm–1 μm. This paper addresses the problem to assess the uncertainty associated with PSD when a differential mobility analyzer (DMA) operates under scanning mode. The sources of uncertainty are described and then modeled either through experiments or knowledge extracted from the literature. Special care is brought to model the physics and to account for competing theories. Indeed, it appears that the modeling errors resulting from approximations of the physics can largely affect the final estimate of this indirect measurement, especially for quantities that are not measured during day-to-day experiments. The Monte Carlo method is used to compute the uncertainty associated with PSD. The method is tested against real data sets that are monosize polystyrene latex spheres (PSL) with nominal diameters of 100 nm, 200 nm and 450 nm. The median diameters and associated standard uncertainty of the aerosol particles are estimated as 101.22 nm ± 0.18 nm, 204.39 nm ± 1.71 nm and 443.87 nm ± 1.52 nm with the new approach. Other statistical parameters, such as the mean diameter, the mode and the geometric mean and associated standard uncertainty, are also computed. These results are then compared with the results obtained by SMPS embedded software.
The Phosphorylation of Ribosomal Protein in Lemna minor
Trewavas, A.
1973-01-01
Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405
1960-01-01
Before the invention of wire chambers, particles tracks were analysed on scanning tables like this one. Today, the process is electronic and much faster. Bubble chamber film - currently available - (links can be found below) was used for this analysis of the particle tracks.
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...
On the control of ribosomal protein biosynthesis in Escherichia coli
International Nuclear Information System (INIS)
Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.
1977-01-01
The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene
Soft X-ray scanning transmission X-ray microscopy (STXM) of actinide particles.
Nilsson, Hans J; Tyliszczak, Tolek; Wilson, Richard E; Werme, Lars; Shuh, David K
2005-09-01
A descriptive account is given of our most recent research on the actinide dioxides with the Advanced Light Source Molecular Environmental Science (ALS-MES) Beamline 11.0.2 soft X-ray scanning transmission X-ray microscope (STXM) at the Lawrence Berkeley National Laboratory (LBNL). The ALS-MES STXM permits near-edge X-ray absorption fine structure (NEXAFS) and imaging with 30-nm spatial resolution. The first STXM spectromicroscopy NEXAFS spectra at the actinide 4d5/2 edges of the imaged transuranic particles, NpO2 and PuO2, have been obtained. Radiation damage induced by the STXM was observed in the investigation of a mixed oxidation state particle (Np(V,VI)) and was minimized during collection of the actual spectra at the 4d5/2 edge of the Np(V,VI) solid. A plutonium elemental map was obtained from an irregular PuO2 particle with the dimensions of 650 x 650 nm. The Pu 4d5/2 NEXAFS spectra were collected at several different locations from the PuO2 particle and were identical. A representative oxygen K-edge spectrum from UO2 was collected and resembles the oxygen K-edge from the bulk material. The unique and current performance of the ALS-MES STXM at extremely low energies (ca. 100 eV) that may permit the successful measurement of the actinide 5d edge is documented. Finally, the potential of STXM as a tool for actinide investigations is briefly discussed.
In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis
Essers, P.B.M.
2013-01-01
Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Dao Duc, Khanh; Saleem, Zain H.; Song, Yun S.
2018-01-01
The Totally Asymmetric Exclusion Process (TASEP) is a classical stochastic model for describing the transport of interacting particles, such as ribosomes moving along the messenger ribonucleic acid (mRNA) during translation. Although this model has been widely studied in the past, the extent of collision between particles and the average distance between a particle to its nearest neighbor have not been quantified explicitly. We provide here a theoretical analysis of such quantities via the distribution of isolated particles. In the classical form of the model in which each particle occupies only a single site, we obtain an exact analytic solution using the matrix ansatz. We then employ a refined mean-field approach to extend the analysis to a generalized TASEP with particles of an arbitrary size. Our theoretical study has direct applications in mRNA translation and the interpretation of experimental ribosome profiling data. In particular, our analysis of data from Saccharomyces cerevisiae suggests a potential bias against the detection of nearby ribosomes with a gap distance of less than approximately three codons, which leads to some ambiguity in estimating the initiation rate and protein production flux for a substantial fraction of genes. Despite such ambiguity, however, we demonstrate theoretically that the interference rate associated with collisions can be robustly estimated and show that approximately 1% of the translating ribosomes get obstructed.
Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis
International Nuclear Information System (INIS)
Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.
1990-01-01
Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated
Hypoxic stress-induced changes in ribosomes of maize seedling roots
International Nuclear Information System (INIS)
Bailey-Serres, J.; Freeling, M.
1990-01-01
The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.
Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger
2005-11-01
Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation
Alejo, Jose Luis
In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.
Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator
International Nuclear Information System (INIS)
Chu, Y.S.; Chen, B.; Zhang, F.; Berenguer, F.; Bean, R.; Kewish, C.; Vila-Comamala, J.; Rodenburg, J.; Robinson, I.
2011-01-01
We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens.
Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations
Energy Technology Data Exchange (ETDEWEB)
Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum
1984-12-01
Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.
Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D
2017-01-01
Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.
Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.
Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E
2017-01-01
Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.
International Nuclear Information System (INIS)
Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya
2013-01-01
Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of
Architecture of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad
2014-01-23
Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
gamma. radiation effect on the functional properties of the cotton ribosomes
Energy Technology Data Exchange (ETDEWEB)
Ibragimov, A P; Safarov, Sh
1973-01-01
A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.
Interaction of tRNA with Eukaryotic Ribosome
Directory of Open Access Journals (Sweden)
Dmitri Graifer
2015-03-01
Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.
Macrolide antibiotic interaction and resistance on the bacterial ribosome.
Poehlsgaard, Jacob; Douthwaite, Stephen
2003-02-01
Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
International Nuclear Information System (INIS)
Otaka, E.; Kobata, K.
1978-01-01
The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Kilcoyne, Arthur L; Takahama, S.; Gilardoni, S.; Russell, L.M.; Kilcoyne, A.L.D.
2007-05-16
A scanning transmission X-ray microscope at the Lawrence Berkeley National Laboratory is used to measure organic functional group abundance and morphology of atmospheric aerosols. We present a summary of spectra, sizes, and shapes observed in 595 particles that were collected and analyzed between 2000 and 2006. These particles ranged between 0.1 and 12 mm and represent aerosols found in a large range of geographical areas, altitudes, and times. They include samples from seven different field campaigns: PELTI, ACE-ASIA, DYCOMS II, Princeton, MILAGRO (urban), MILAGRO (C-130), and INTEX-B. At least 14 different classes of organic particles show different types of spectroscopic signatures. Different particle types are found within the same region while the same particle types are also found in different geographical domains. Particles chemically resembling black carbon, humic-like aerosols, pine ultisol, and secondary or processed aerosol have been identified from functional group abundance and comparison of spectra with those published in the literature.
Trapping the ribosome to control gene expression.
Boehringer, Daniel; Ban, Nenad
2007-09-21
Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
International Nuclear Information System (INIS)
Gorelic, L.; Parker, D.
1978-01-01
The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
cDNA, genomic sequence cloning and analysis of the ribosomal ...
African Journals Online (AJOL)
Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Expanding the ribosomal universe.
Dinman, Jonathan D; Kinzy, Terri Goss
2009-12-09
In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome
Directory of Open Access Journals (Sweden)
Jendrik Hentschel
2017-07-01
Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.
The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.
Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad
2017-07-05
The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.
Wang, Hao; Kingsford, Carl; McManus, C Joel
2018-03-15
Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.
Advances in 4D treatment planning for scanned particle beam therapy - report of dedicated workshops.
Bert, Christoph; Graeff, Christian; Riboldi, Marco; Nill, Simeon; Baroni, Guido; Knopf, Antje-Christin
2014-12-01
We report on recent progress in the field of mobile tumor treatment with scanned particle beams, as discussed in the latest editions of the 4D treatment planning workshop. The workshop series started in 2009, with about 20 people from 4 research institutes involved, all actively working on particle therapy delivery and development. The first workshop resulted in a summary of recommendations for the treatment of mobile targets, along with a list of requirements to apply these guidelines clinically. The increased interest in the treatment of mobile tumors led to a continuously growing number of attendees: the 2012 edition counted more than 60 participants from 20 institutions and commercial vendors. The focus of research discussions among workshop participants progressively moved from 4D treatment planning to complete 4D treatments, aiming at effective and safe treatment delivery. Current research perspectives on 4D treatments include all critical aspects of time resolved delivery, such as in-room imaging, motion detection, beam application, and quality assurance techniques. This was motivated by the start of first clinical treatments of hepato cellular tumors with a scanned particle beam, relying on gating or abdominal compression for motion mitigation. Up to date research activities emphasize significant efforts in investigating advanced motion mitigation techniques, with a specific interest in the development of dedicated tools for experimental validation. Potential improvements will be made possible in the near future through 4D optimized treatment plans that require upgrades of the currently established therapy control systems for time resolved delivery. But since also these novel optimization techniques rely on the validity of the 4DCT, research focusing on alternative 4D imaging technique, such as MRI based 4DCT generation will continue.
Expression of ribosomal genes in pea cotyledons at the initial stages of germination
International Nuclear Information System (INIS)
Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.
1986-01-01
The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination
Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?
Directory of Open Access Journals (Sweden)
Ilana C. Agmon
2016-12-01
Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.
Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues
International Nuclear Information System (INIS)
Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.
1990-01-01
The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins
Confocal scanning microscope for nuclear photoemulsion
International Nuclear Information System (INIS)
Batusov, Yu.A.; Kovalev, Yu.S.; Soroko, L.M.
2005-01-01
The application of the confocal scanning microscope to the objects in the nuclear photoemulsion is described. An array of 27 microtomograms of single silver grain is shown. The cross sections of the same particle track of diameter 1 μm, detected by means of the confocal scanning microscope with open and annular apertures, are presented. It was shown that the confocal scanning microscope opens indeed new opportunities for the nuclear photoemulsion technique to get previously inaccessible information for physics of the short-living particles
Cryo-EM structure of the E. coli translating ribosome in complex with SRP and its receptor
Estrozi, Leandro F.; Boehringer, Daniel; Shan, Shu-ou; Ban, Nenad; Schaffitzel, Christiane
2013-01-01
We report the early conformation of the E. coli signal recognition particle (SRP) and its receptor FtsY bound to the translating ribosome by cryo-electron microscopy. FtsY binds to the tetraloop of the SRP RNA whereas the NG-domains of the SRP protein and FtsY interact weakly in this conformation. Our results suggest that optimal positioning of the SRP RNA tetraloop and the Ffh NG-domain leads to FtsY recruitment. PMID:21151118
International Nuclear Information System (INIS)
Soroko, L.M.
2001-01-01
The first test model of the optical microscope which produces the in focus image of the whole vertical particle track without depth scanning is described. The in focus image of the object consisting of the linear array of the point-like elements was obtained. A comparison with primary out of focus image of such an object has been made
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.
Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad
2017-02-15
Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.
Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek
2017-06-29
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.
Miscoding-induced stalling of substrate translocation on the bacterial ribosome.
Alejo, Jose L; Blanchard, Scott C
2017-10-10
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.
Structure based hypothesis of a mitochondrial ribosome rescue mechanism
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2012-05-01
Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.
Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.
Directory of Open Access Journals (Sweden)
Pierre Bonnin
2017-05-01
Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling
Mechanism of recycling of post-termination ribosomal complexes in ...
Indian Academy of Sciences (India)
Madhu
all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Computational resources for ribosome profiling: from database to Web server and software.
Wang, Hongwei; Wang, Yan; Xie, Zhi
2017-08-14
Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number
Directory of Open Access Journals (Sweden)
Katherine I. Farley-Barnes
2018-02-01
Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.
DEFF Research Database (Denmark)
Rosendahl, G; Douthwaite, S
1993-01-01
RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....
Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin
International Nuclear Information System (INIS)
Boehm, H.; Stahl, J.; Bielka, H.
1979-01-01
N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)
Dosimetric consequences of pencil beam width variations in scanned beam particle therapy
International Nuclear Information System (INIS)
Chanrion, M A; Ammazzalorso, F; Wittig, A; Engenhart-Cabillic, R; Jelen, U
2013-01-01
Scanned ion beam delivery enables the highest degree of target dose conformation attainable in external beam radiotherapy. Nominal pencil beam widths (spot sizes) are recorded during treatment planning system commissioning. Due to changes in the beam-line optics, the actual spot sizes may differ from these commissioning values, leading to differences between planned and delivered dose. The purpose of this study was to analyse the dosimetric consequences of spot size variations in particle therapy treatment plans. For 12 patients with skull base tumours and 12 patients with prostate carcinoma, scanned-beam carbon ion and proton treatment plans were prepared and recomputed simulating spot size changes of (1) ±10% to simulate the typical magnitude of fluctuations, (2) ±25% representing the worst-case scenario and (3) ±50% as a part of a risk analysis in case of fault conditions. The primary effect of the spot size variation was a dose deterioration affecting the target edge: loss of target coverage and broadening of the lateral penumbra (increased spot size) or overdosage and contraction of the lateral penumbra (reduced spot size). For changes ⩽25%, the resulting planning target volume mean 95%-isodose line coverage (CI-95%) deterioration was ranging from negligible to moderate. In some cases changes in the dose to adjoining critical structures were observed. (paper)
International Nuclear Information System (INIS)
Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.
1987-01-01
The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation
Ruggero, D; Londei, P
1996-01-01
Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.
International Nuclear Information System (INIS)
Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry
2008-01-01
The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library
Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9
Directory of Open Access Journals (Sweden)
Arava Yoav
2007-08-01
Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.
International Nuclear Information System (INIS)
Toyoda, Masatoshi; Kaibuchi, Kazuki; Nagasono, Mitsuru; Terada, Yasuko; Tanabe, Teruo; Hayakawa, Shinjiro; Kawai, Jun
2004-01-01
We developed a microscope by a combination of synchrotron radiation X-ray fluorescence (SR-XRF) microscope and scanning electron microscope (SEM) with an energy dispersive X-ray spectrometer (EDX). SR-XRF is appropriate to detect trace and micro amount of elements and sensitive to heavy elements in an analyte but it cannot observe the real time image. SEM-EDX can observe the secondary electron image of a single particle in real time and is appropriate to detect lighter elements. This combination microscope can ensure the identification of the XRF spectrum to the SEM image without transferring the sample. For aerosol analysis, it is important to analyze each particle. The present method makes feasible to analyze not only the average elemental composition as the total particles but also elemental composition of each particle, which is dependent on the particle shape and size. The microscope was applied to an individual aerosol particle study. The X-ray spectra were different among the particles, but also different between SR-XRF and SEM-EDX for the same particle, due to the difference in fluorescence yields between X-ray excitation and electron excitation
Proto-ribosome: a theoretical approach based on RNA relics
Demongeot, Jacques
2017-01-01
We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
Senescent changes in the ribosomes of animal cells in vivo and in vitro
Miquel, J.; Johnson, J. E., Jr.
1979-01-01
The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Directory of Open Access Journals (Sweden)
Devika Salim
2017-09-01
Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
Monitoring and Quantifying Particles Emissions around Industrial Sites with Scanning Doppler Lidar
Thobois, L.; Royer, P.; Parmentier, R.; Brooks, M.; Knoepfle, A.; Alexander, J.; Stidwell, P.; Kumar, R.
2018-04-01
Scanning Coherent Doppler Lidars have been used over the last decade for measuring wind for applications in wind energy [1], meteorology [2] and aviation [3]. They allow for accurate measurements of wind speeds up to a distance of 10 km based on the Doppler shift effect of aerosols. The signal reflectivity (CNR or Carrier-to-Noise Ratio) profiles can also be retrieved from the strength of the Lidar signal. In this study, we will present the developments of algorithm for retrieving aerosol optical properties like the relative attenuated backscatter coefficient and the mass concentration of particles. The use of these algorithms during one operational trial in Point Samson, Western Australia to monitor fugitive emissions over a mine will be presented. This project has been initiated by the Australian Department of Environment Regulations to better determine the impact of the Port on the neighboring town. During the trial in Summer, the strong impact of turbulence refractive index on Lidar performances has been observed. Multiple methodologies have been applied to reduce this impact with more or less success. At the end, a dedicated setup and configuration have been established that allow to properly observe the plumes of the mine with the scanning Lidar. The Lidar data has also been coupled to beta attenuation in-situ sensors for retrieving mass concentration maps. A few case of dispersion of plumes will be presented showing the necessity to combine both the wind and aerosol data.
γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system
International Nuclear Information System (INIS)
Suessmuth, R.; Widmann, A.
1979-01-01
γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de
A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death
Directory of Open Access Journals (Sweden)
Bruce R. Levin
2017-02-01
Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
DEFF Research Database (Denmark)
Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne
2011-01-01
Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...
Studies on the catalytic rate constant of ribosomal peptidyltransferase.
Synetos, D; Coutsogeorgopoulos, C
1987-02-20
A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.
Directory of Open Access Journals (Sweden)
Jörg Grunenberg
2016-03-01
Full Text Available We propose several new and promising antibacterial agents for the treatment of serious Gram-positive infections. Our predictions rely on force field simulations, supervised by first principle calculations and available experimental data. Different force fields were tested in order to reproduce linezolid's conformational space in terms of a the isolated and b the ribosomal bound state. In a first step, an all-atom model of the bacterial ribosome consisting of nearly 1600 atoms was constructed and evaluated. The conformational space of 30 different ribosomal/oxazolidinone complexes was scanned by stochastic methods, followed by an evaluation of their enthalpic penalties or rewards and the mechanical strengths of the relevant hydrogen bonds (relaxed force constants; compliance constants. The protocol was able to reproduce the experimentally known enantioselectivity favoring the S-enantiomer. In a second step, the experimentally known MIC values of eight linezolid analogues were used in order to crosscheck the robustness of our model. In a final step, this benchmarking led to the prediction of several new and promising lead compounds. Synthesis and biological evaluation of the new compounds are on the way.
Directory of Open Access Journals (Sweden)
Jeffrey A Hussmann
2015-12-01
Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.
Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros
2014-01-01
Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Further characterization of ribosome binding to thylakoid membranes
International Nuclear Information System (INIS)
Hurewitz, J.; Jagendorf, A.T.
1987-01-01
Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B
1987-08-01
The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.
Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics
Yonath, Ada
An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.
Purification and properties of a ribosomal casein kinase from rabbit reticulocytes
DEFF Research Database (Denmark)
Issinger, O G
1977-01-01
A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...
Simulation and analysis of single-ribosome translation
International Nuclear Information System (INIS)
Tinoco, Ignacio Jr; Wen, Jin-Der
2009-01-01
In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation
International Nuclear Information System (INIS)
Joshi, Manish; Sapra, B. K.; Khan, Arshad; Tripathi, S. N.; Shamjad, P. M.; Gupta, Tarun; Mayya, Y. S.
2012-01-01
Regional studies focusing on the role of atmospheric nanoparticles in climate change have gained impetus in the last decade. Several multi-institutional studies involving measurement of nanoparticles with several kinds of instruments are on the rise. It is important to harmonize these measurements as the instruments may work on different techniques or principles and are developed by different manufacturers. Scanning mobility particle sizers (SMPS) are often used to measure size distribution of nanoparticles in the airborne phase. Two such commercially available instruments namely, GRIMM and TSI-SMPS have been compared for ambient and laboratory generated conditions. A stand-alone condensation particle counter (CPC) of TSI make was used as a reference for particle concentration measurements. The consistency of the results in terms of mean size and geometric standard deviation was seen to be excellent for both the SMPSs, with GRIMM always showing slightly (approximately 10 %) lower mean size. The integrated number concentration from GRIMM-SMPS was seen to be closer to stand-alone reference CPC compared to TSI-SMPS, for an ambient overnight comparison. However, a concentration-dependent response, i.e. the variations between the two instruments increasing with the concentration, was observed and possible reasons for this have been suggested. A separate experiment was performed for studying the modifying effect of diffusion dryer and sheath air dryer on the measured aerosol size spectra. A significant hygroscopic growth was noted when diffusion dryer was attached to one of the SMPS. The introduction of sheath air dryer in GRIMM-SMPS produced a significant shift towards lower mean size. These results have been compared and discussed with the recent inter-comparison results to strengthen and harmonize the measurement protocols.
Joshi, Manish; Sapra, B. K.; Khan, Arshad; Tripathi, S. N.; Shamjad, P. M.; Gupta, Tarun; Mayya, Y. S.
2012-12-01
Regional studies focusing on the role of atmospheric nanoparticles in climate change have gained impetus in the last decade. Several multi-institutional studies involving measurement of nanoparticles with several kinds of instruments are on the rise. It is important to harmonize these measurements as the instruments may work on different techniques or principles and are developed by different manufacturers. Scanning mobility particle sizers (SMPS) are often used to measure size distribution of nanoparticles in the airborne phase. Two such commercially available instruments namely, GRIMM and TSI-SMPS have been compared for ambient and laboratory generated conditions. A stand-alone condensation particle counter (CPC) of TSI make was used as a reference for particle concentration measurements. The consistency of the results in terms of mean size and geometric standard deviation was seen to be excellent for both the SMPSs, with GRIMM always showing slightly (approximately 10 %) lower mean size. The integrated number concentration from GRIMM-SMPS was seen to be closer to stand-alone reference CPC compared to TSI-SMPS, for an ambient overnight comparison. However, a concentration-dependent response, i.e. the variations between the two instruments increasing with the concentration, was observed and possible reasons for this have been suggested. A separate experiment was performed for studying the modifying effect of diffusion dryer and sheath air dryer on the measured aerosol size spectra. A significant hygroscopic growth was noted when diffusion dryer was attached to one of the SMPS. The introduction of sheath air dryer in GRIMM-SMPS produced a significant shift towards lower mean size. These results have been compared and discussed with the recent inter-comparison results to strengthen and harmonize the measurement protocols.
Andreeva, Irena
2018-01-01
During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209
The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.
Rodnina, Marina V; Wintermeyer, Wolfgang
2011-04-01
Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.
Structural basis for precursor protein-directed ribosomal peptide macrocyclization
Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.
2016-01-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417
Structural basis for precursor protein-directed ribosomal peptide macrocyclization.
Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D
2016-11-01
Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.
Chowdhury, Snehaunshu; Boyette, Wesley; Roberts, William L.
2017-01-01
In this study, we demonstrate the use of a scanning mobility particle sizer (SMPS) as an effective tool to measure the probability density functions (PDFs) of soot nanoparticles in turbulent flames. Time-averaged soot PDFs necessary for validating
The complete structure of the large subunit of the mammalian mitochondrial ribosome.
Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad
2014-11-13
Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.
Molecular dynamics simulation of ribosome jam
Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu
2011-01-01
We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We
Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S
2004-12-01
The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.
Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes
Directory of Open Access Journals (Sweden)
Nicholas T. Ingolia
2014-09-01
Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.
Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Galas, D J; Branscomb, E W
1976-08-12
The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.
Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V
2009-01-01
Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins
DEFF Research Database (Denmark)
Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech
2003-01-01
The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The nuclear import of ribosomal proteins is regulated by mTOR
Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.
2014-01-01
Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.
Directory of Open Access Journals (Sweden)
Sayaka Tsuji
2017-07-01
Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.
Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.
Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N
1981-01-01
The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.
Directory of Open Access Journals (Sweden)
Gisela Pöll
Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.
Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques
2017-12-05
Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian
2016-02-01
Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal
High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.
Directory of Open Access Journals (Sweden)
Nerea Irigoyen
2016-02-01
Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.
Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T
2017-02-21
Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.
Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta
2010-06-18
Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.
Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation
Xie, Ping
2014-12-01
We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.
Ribosome evolution: Emergence of peptide synthesis machinery
Indian Academy of Sciences (India)
suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.
Energy Technology Data Exchange (ETDEWEB)
Kolb, V A; Kammer, A A; Spirin, A S
1987-01-01
The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.
Maize rayado fino virus capsid proteins assemble into virus-like particles in Escherichia coli.
Hammond, Rosemarie W; Hammond, John
2010-02-01
Maize rayado fino virus (MRFV; genus Marafivirus; family Tymoviridae) is an isometric plant virus of 30 nm containing two components: empty shells and complete virus particles (encapsidating the 6.3 kb genomic RNA). Both particles are composed of two serologically related, carboxy co-terminal, coat proteins (CP) of apparent molecular mass 21-22 kDa (CP2) and 24-28 kDa (CP1) in a molar ratio of 3:1, respectively; CP1 contains a 37 amino acid amino terminal extension of CP2. In our study, expression of CP1 or CP2 in Escherichia coli resulted in assembly of each capsid protein into virus-like particles (VLPs), appearing in electron microscopy as stain-permeable (CP2) or stain-impermeable particles (CP1). CP1 VLPs encapsidated bacterial 16S ribosomal RNA, but not CP mRNA, while CP2 VLPs encapsidated neither CP mRNA nor 16S ribosomal RNA. Expression of CP1 and CP2 in E. coli using a co-expression vector resulted in the assembly of VLPs which were stain-impermeable and encapsidated CP mRNA. These results suggest that the N-terminal 37 amino acid residues of CP1, although not required for particle formation, may be involved in the assembly of complete virions and that the presence of both CP1 and CP2 in the particle is required for specific encapsidation of MRFV CP mRNA. (c) 2009 Elsevier B.V. All rights reserved.
The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.
Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim
2012-10-01
YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.
Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.
Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad
2012-03-23
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.
Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*
Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad
2012-01-01
The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031
Larkin, J D; Publicover, N G; Sutko, J L
2011-01-01
In photon event distribution sampling, an image formation technique for scanning microscopes, the maximum likelihood position of origin of each detected photon is acquired as a data set rather than binning photons in pixels. Subsequently, an intensity-related probability density function describing the uncertainty associated with the photon position measurement is applied to each position and individual photon intensity distributions are summed to form an image. Compared to pixel-based images, photon event distribution sampling images exhibit increased signal-to-noise and comparable spatial resolution. Photon event distribution sampling is superior to pixel-based image formation in recognizing the presence of structured (non-random) photon distributions at low photon counts and permits use of non-raster scanning patterns. A photon event distribution sampling based method for localizing single particles derived from a multi-variate normal distribution is more precise than statistical (Gaussian) fitting to pixel-based images. Using the multi-variate normal distribution method, non-raster scanning and a typical confocal microscope, localizations with 8 nm precision were achieved at 10 ms sampling rates with acquisition of ~200 photons per frame. Single nanometre precision was obtained with a greater number of photons per frame. In summary, photon event distribution sampling provides an efficient way to form images when low numbers of photons are involved and permits particle tracking with confocal point-scanning microscopes with nanometre precision deep within specimens. © 2010 The Authors Journal of Microscopy © 2010 The Royal Microscopical Society.
Remodeling of ribosomal genes in somatic cells by Xenopus egg extract
Energy Technology Data Exchange (ETDEWEB)
Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)
2011-09-02
Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.
Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism
Directory of Open Access Journals (Sweden)
Deborah Chiabrando
2010-01-01
Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.
Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.
Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc
2006-02-01
Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.
A streamlined ribosome profiling protocol for the characterization of microorganisms
DEFF Research Database (Denmark)
Latif, Haythem; Szubin, Richard; Tan, Justin
2015-01-01
Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...
Is The Ribosome Targeted By Adaptive Mutations
DEFF Research Database (Denmark)
Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh
2015-01-01
Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...
Simulating movement of tRNA through the ribosome during hybrid-state formation.
Whitford, Paul C; Sanbonmatsu, Karissa Y
2013-09-28
Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the
Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.
Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter
2013-07-01
Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.
O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.
2013-01-01
Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...
Molecular mechanism and structure of Trigger Factor bound to the translating ribosome
Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke
2008-01-01
Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
A laser sheet self-calibration method for scanning PIV
Knutsen, Anna N.; Lawson, John M.; Dawson, James R.; Worth, Nicholas A.
2017-10-01
Knowledge of laser sheet position, orientation, and thickness is a fundamental requirement of scanning PIV and other laser-scanning methods. This paper describes the development and evaluation of a new laser sheet self-calibration method for stereoscopic scanning PIV, which allows the measurement of these properties from particle images themselves. The approach is to fit a laser sheet model by treating particles as randomly distributed probes of the laser sheet profile, whose position is obtained via a triangulation procedure enhanced by matching particle images according to their variation in brightness over a scan. Numerical simulations and tests with experimental data were used to quantify the sensitivity of the method to typical experimental error sources and validate its performance in practice. The numerical simulations demonstrate the accurate recovery of the laser sheet parameters over range of different seeding densities and sheet thicknesses. Furthermore, they show that the method is robust to significant image noise and camera misalignment. Tests with experimental data confirm that the laser sheet model can be accurately reconstructed with no impairment to PIV measurement accuracy. The new method is more efficient and robust in comparison with the standard (self-) calibration approach, which requires an involved, separate calibration step that is sensitive to experimental misalignments. The method significantly improves the practicality of making accurate scanning PIV measurements and broadens its potential applicability to scanning systems with significant vibrations.
Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean
2013-09-01
Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)
2016-11-01
Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.
DEFF Research Database (Denmark)
Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk
2005-01-01
We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....
Kage, S; Kudo, K; Kaizoji, A; Ryumoto, J; Ikeda, H; Ikeda, N
2001-07-01
We devised a simple and rapid method for detection of gunshot residue (GSR) particles, using scanning electron microscopy/wavelength dispersive X-ray (SEM/WDX) analysis. Experiments were done on samples containing GSR particles obtained from hands, hair, face, and clothing, using double-sided adhesive coated aluminum stubs (tape-lift method). SEM/WDX analyses for GSR were carried out in three steps: the first step was map analysis for barium (Ba) to search for GSR particles from lead styphnate primed ammunition, or tin (Sn) to search for GSR particles from mercury fulminate primed ammunition. The second step was determination of the location of GSR particles by X-ray imaging of Ba or Sn at a magnification of x 1000-2000 in the SEM, using data of map analysis, and the third step was identification of GSR particles, using WDX spectrometers. Analysis of samples from each primer of a stub took about 3 h. Practical applications were shown for utility of this method.
Institute of Scientific and Technical Information of China (English)
Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao
2017-01-01
As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.
Assembly constraints drive co-evolution among ribosomal constituents.
Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip
2015-06-23
Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center
DEFF Research Database (Denmark)
Long, K. S.; Hansen, L. K.; Jakobsen, L.
2006-01-01
Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...
Production of RNA-protein cross links in γ irradiated E. Coli ribosomes
International Nuclear Information System (INIS)
Ekert, Bernard; Giocanti, Nicole
1976-01-01
γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr
DEFF Research Database (Denmark)
Tchórzewski, M; Boldyreff, B; Issinger, O
2000-01-01
The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....
The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN
Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth
2015-01-01
Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078
The Ulysses fast latitude scans: COSPIN/KET results
Directory of Open Access Journals (Sweden)
B. Heber
2003-06-01
Full Text Available Ulysses, launched in October 1990, began its second out-of-ecliptic orbit in December 1997, and its second fast latitude scan in September 2000. In contrast to the first fast latitude scan in 1994/1995, during the second fast latitude scan solar activity was close to maximum. The solar magnetic field reversed its polarity around July 2000. While the first latitude scan mainly gave a snapshot of the spatial distribution of galactic cosmic rays, the second one is dominated by temporal variations. Solar particle increases are observed at all heliographic latitudes, including events that produce >250 MeV protons and 50 MeV electrons. Using observations from the University of Chicago’s instrument on board IMP8 at Earth, we find that most solar particle events are observed at both high and low latitudes, indicating either acceleration of these particles over a broad latitude range or an efficient latitudinal transport. The latter is supported by "quiet time" variations in the MeV electron background, if interpreted as Jovian electrons. No latitudinal gradient was found for >106 MeV galactic cosmic ray protons, during the solar maximum fast latitude scan. The electron to proton ratio remains constant and has practically the same value as in the previous solar maximum. Both results indicate that drift is of minor importance. It was expected that, with the reversal of the solar magnetic field and in the declining phase of the solar cycle, this ratio should increase. This was, however, not observed, probably because the transition to the new magnetic cycle was not completely terminated within the heliosphere, as indicated by the Ulysses magnetic field and solar wind measurements. We argue that the new A<0-solar magnetic modulation epoch will establish itself once both polar coronal holes have developed.Key words. Interplanetary physics (cosmic rays; energetic particles; interplanetary magnetic fields
International Nuclear Information System (INIS)
Natali, S.
1984-01-01
This chapter reports on the scanning of 1000 holograms taken in HOBC at CERN. Each hologram is triggered by an interaction in the chamber, the primary particles being pions at 340 GeV/c. The aim of the experiment is the study of charm production. The holograms, recorded on 50 mm film with the ''in line'' technique, can be analyzed by shining a parallel expanded laser beam through the film, obtaining immediately above it the real image of the chamber which can then be scanned and measured with a technique half way between emulsions and bubble chambers. The results indicate that holograms can be analyzed as quickly and reliably as in other visual techniques and that to them is open the same order of magnitude of large scale experiments
International Nuclear Information System (INIS)
Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.
1982-01-01
The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)
Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.
Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad
2016-01-14
Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.
Arndt, J; Deboudt, K; Anderson, A; Blondel, A; Eliet, S; Flament, P; Fourmentin, M; Healy, R M; Savary, V; Setyan, A; Wenger, J C
2016-03-01
The chemical composition of single particles deposited on industrial filters located in three different chimneys of an iron-manganese (Fe-Mn) alloy manufacturing plant have been compared using aerosol time-of-flight mass spectrometry (ATOFMS) and scanning electron microscopy-energy dispersive X-ray spectrometry (SEM-EDX). Very similar types of particles were observed using both analytical techniques. Calcium-containing particles dominated in the firing area of the sintering unit, Mn and/or Al-bearing particles were observed at the cooling area of the sintering unit, while Mn-containing particles were dominant at the smelting unit. SEM-EDX analysis of particles collected downstream of the industrial filters showed that the composition of the particles emitted from the chimneys is very similar to those collected on the filters. ATOFMS analysis of ore samples was also performed to identify particulate emissions that could be generated by wind erosion and manual activities. Specific particle types have been identified for each emission source (chimneys and ore piles) and can be used as tracers for source apportionment of ambient PM measured in the vicinity of the industrial site. Copyright © 2015 Elsevier Ltd. All rights reserved.
Tammet, H.
2006-12-01
Measuring of charged nanometer particles in atmospheric air is a routine task in research on atmospheric electricity, where these particles are called the atmospheric ions. An aspiration condenser is the most popular instrument for measuring atmospheric ions. Continuous scanning of a mobility distribution is possible when the aspiration condenser is connected as an arm of a balanced bridge. Transfer function of an aspiration condenser is calculated according to the measurements of geometric dimensions, air flow rate, driving voltage, and electric current. The most complicated phase of the calibration is the estimation of the inlet loss of ions due to the Brownian deposition. The available models of ion deposition on the protective inlet screen and the inlet control electrofilter have the uncertainty of about 20%. To keep the uncertainty of measurements low the adsorption should not exceed a few tens of percent. The online conversion of the mobility distribution to the size distribution and a correct reduction of inlet losses are possible when air temperature and pressure are measured simultaneously with the mobility distribution. Two instruments called the Balanced Scanning Mobility Analyzers (BSMA) were manufactured and tested in routine atmospheric measurements. The concentration of atmospheric ions of the size of about a few nanometers is very low and a high air flow rate is required to collect enough of ion current. The air flow of 52 l/s exceeds the air flow in usual aerosol instruments by 2-3 orders of magnitude. The high flow rate reduces the time of ion passage to 60 ms and the heating of air in an analyzer to 0.2 K, which suppresses a possible transformation of ions inside the instrument. The mobility range of the BSMA of 0.032-3.2 cm 2 V - 1 s - 1 is logarithmically uniformly divided into 16 fractions. The size distribution is presented by 12 fractions in the diameter range of 0.4-7.5 nm. The measurement noise of a fraction concentration is typically
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
Scanning tomographic particle image velocimetry applied to a turbulent jet
Casey, T. A.; Sakakibara, J.; Thoroddsen, Sigurdur T
2013-01-01
planes in the depth direction by maintaining optimal particle image density and limiting the number of ghost particles. The total measurement volumes contain between 1 ×106 and 3 ×106 velocity vectors calculated from up to 1500 reconstructed depthwise
The architecture of mammalian ribosomal protein promoters
Directory of Open Access Journals (Sweden)
Perry Robert P
2005-02-01
Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.
A new version of the RDP (Ribosomal Database Project)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Pakula, Kevin K; Hansen, Lykke H; Vester, Birte
2017-09-01
Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.
Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis
DEFF Research Database (Denmark)
Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.
2009-01-01
In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...
Multifrequency scanning probe microscopy study of nanodiamond agglomerates
Aravind, Vasudeva; Lippold, Stephen; Li, Qian; Strelcov, Evgheny; Okatan, Baris; Legum, Benjamin; Kalinin, Sergei; Clarion University Team; Oak Ridge National Laboratory Team
Due to their rich surface chemistry and excellent mechanical properties and non-toxic nature, nanodiamond particles have found applications such as biomedicine, tribology and lubrication, targeted drug delivery systems, tissue scaffolds and surgical implants. Although single nanodiamond particles have diameters about 4-5nm, they tend to form agglomerates. While these agglomerates can be useful for some purposes, many applications of nanodiamonds require single particle, disaggregated nanodiamonds. This work is oriented towards studying forces and interactions that contribute to agglomeration in nanodiamonds. In this work, using multifrequency scanning probe microscopy techniques, we show that agglomerate sizes can vary between 50-100nm in raw nanodiamonds. Extremeties of particles and Interfaces between agglomerates show dissipative forces with scanning probe microscope tip, indicating agglomerates could act as points of increased adhesion, thus reducing lubricating efficiency when nanodiamonds are used as lubricant additives. This research was conducted at the Center for Nanophase Materials Sciences, which is a DOE Office of Science User Facility.
Pactamycin binding site on archaebacterial and eukaryotic ribosomes
International Nuclear Information System (INIS)
Tejedor, F.; Amils, R.; Ballesta, J.P.G.
1987-01-01
The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics
Ribosome-catalyzed formation of an abnormal peptide analogue
International Nuclear Information System (INIS)
Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.
1986-01-01
The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue
Directory of Open Access Journals (Sweden)
Pascal F Egea
Full Text Available In all organisms the Signal Recognition Particle (SRP, binds to signal sequences of proteins destined for secretion or membrane insertion as they emerge from translating ribosomes. In Archaea and Eucarya, the conserved ribonucleoproteic core is composed of two proteins, the accessory protein SRP19, the essential GTPase SRP54, and an evolutionarily conserved and essential SRP RNA. Through the GTP-dependent interaction between the SRP and its cognate receptor SR, ribosomes harboring nascent polypeptidic chains destined for secretion are dynamically transferred to the protein translocation apparatus at the membrane. We present here high-resolution X-ray structures of SRP54 and SRP19, the two RNA binding components forming the core of the signal recognition particle from the hyper-thermophilic archaeon Pyrococcus furiosus (Pfu. The 2.5 A resolution structure of free Pfu-SRP54 is the first showing the complete domain organization of a GDP bound full-length SRP54 subunit. In its ras-like GTPase domain, GDP is found tightly associated with the protein. The flexible linker that separates the GTPase core from the hydrophobic signal sequence binding M domain, adopts a purely alpha-helical structure and acts as an articulated arm allowing the M domain to explore multiple regions as it scans for signal peptides as they emerge from the ribosomal tunnel. This linker is structurally coupled to the GTPase catalytic site and likely to propagate conformational changes occurring in the M domain through the SRP RNA upon signal sequence binding. Two different 1.8 A resolution crystal structures of free Pfu-SRP19 reveal a compact, rigid and well-folded protein even in absence of its obligate SRP RNA partner. Comparison with other SRP19*SRP RNA structures suggests the rearrangement of a disordered loop upon binding with the RNA through a reciprocal induced-fit mechanism and supports the idea that SRP19 acts as a molecular scaffold and a chaperone, assisting the SRP
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Xie, Ping
2015-10-09
Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.
International Nuclear Information System (INIS)
Pecher, K.; Nealson, K.; Kneedler, E.; Rothe, J.; Meigs, G.; Warwick, T.; Tonner, B.
2000-01-01
The interfaces between solid mineral particles and water play a crucial role in partitioning and chemical transformation of many inorganic as well as organic pollutants in environmental systems. Among environmentally significant minerals, mixed-valent oxides and hydroxides of iron (e.g. magnetite, green rusts) and manganese (hausmanite, birnessite) have been recognized as particularly strong sorbents for metal ions. In addition, minerals containing Fe(II) have recently been proven to be powerful reductants for a wide range of pollutants. Chemical properties of these minerals strongly depend on the distribution and availability of reactive sites and little is known quantitatively about the nature of these sites. We have investigated the bulk distribution of charge states of manganese (Mn (II, III, IV)) and iron (Fe(II, III)) in single particles of natural manganese nodules and synthetic green rusts using Scanning Transmission X-ray SpectroMicroscopy (STXM). Pixel resolved spectra (XANES) extracted from stacks of images taken at different wave lengths across the metal absorption edge were fitted to total electron yield (TEY) spectra of single valent reference compounds. Two dimensional maps of bulk charge state distributions clearly reveal domains of different oxidation states within single particles of Mn-nodules and green rust precipitates. Changes of oxidation states of iron were followed as a result of reductive transformation of an environmental contaminant (CCl 4 ) using green rust as the only reductant
The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer
Directory of Open Access Journals (Sweden)
Shunfei Yan
2017-01-01
Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.
Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.
Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S
2018-03-15
Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.
Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A
2016-07-01
The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model
Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan
2011-01-01
We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli
International Nuclear Information System (INIS)
Gravel, M.; Melancon, P.; Barkier-Gingras, L.
1987-01-01
[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly
DEFF Research Database (Denmark)
Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw
2018-01-01
Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
International Nuclear Information System (INIS)
Arndt, J.; Deboudt, K.; Anderson, A.; Blondel, A.; Eliet, S.; Flament, P.; Fourmentin, M.; Healy, R.M.; Savary, V.; Setyan, A.; Wenger, J.C.
2016-01-01
The chemical composition of single particles deposited on industrial filters located in three different chimneys of an iron-manganese (Fe–Mn) alloy manufacturing plant have been compared using aerosol time-of-flight mass spectrometry (ATOFMS) and scanning electron microscopy–energy dispersive X-ray spectrometry (SEM-EDX). Very similar types of particles were observed using both analytical techniques. Calcium-containing particles dominated in the firing area of the sintering unit, Mn and/or Al-bearing particles were observed at the cooling area of the sintering unit, while Mn-containing particles were dominant at the smelting unit. SEM-EDX analysis of particles collected downstream of the industrial filters showed that the composition of the particles emitted from the chimneys is very similar to those collected on the filters. ATOFMS analysis of ore samples was also performed to identify particulate emissions that could be generated by wind erosion and manual activities. Specific particle types have been identified for each emission source (chimneys and ore piles) and can be used as tracers for source apportionment of ambient PM measured in the vicinity of the industrial site. - Highlights: • Similar composition for emitted particles as those collected on the chimney filters. • Emitted particles dominated by Ca-, Mn and/or Al-containing particles. • Identification of specific particle types emitted by the different process units. - The particles emitted by metallurgy activities are fully described by ATOFMS and SEM-EDX, enabling the identification of specific particle types from the different units of the process.
Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer
2017-02-01
and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that
The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants
Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter
2004-01-01
Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…
Method and apparatus for scanning x-ray tomography
International Nuclear Information System (INIS)
Albert, R.D.
1988-01-01
In a method of producing a tomographic image of a subject that includes the steps of generating X-rays at a moving origin point by directing a charged particle beam to a target surface, deflecting the charged particle beam to travel the origin point through a predetermined raster scan at the surface, detecting variations of X-ray intensity during the course of the raster scan at spaced apart detection points situated at the opposite side of the subject from the origin point, generating a first sequence of data values that is indicative of variations of X-ray intensity at a first of the detection points at successive times during the course of the raster scan and generating at least a second sequence of data values that is indicative of variations of X-ray intensity at a second of the detection points at successive times during the course of the same raster scan, the improvement is described comprising: combining successive individual data values of the first sequence that are generated by X-rays from successive particular locations in the raster scan with at least individual data values of the second sequence that are generated by X-rays from predetermined successive different locations in the same raster scan in order to produce a composite sequence of data values, and producing an image corresponding to at least a portion of the raster scan which depicts variations of the magnitude of successive data values of the composite sequence
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
Defining the bacteroides ribosomal binding site.
Wegmann, Udo; Horn, Nikki; Carding, Simon R
2013-03-01
The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.
Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel
Energy Technology Data Exchange (ETDEWEB)
Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.
2017-08-28
Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.
Emergence of robust growth laws from optimal regulation of ribosome synthesis.
Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence
2014-08-22
Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.
He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J
2009-12-31
We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.
Energy Technology Data Exchange (ETDEWEB)
Asahina, Shunsuke; Suga, Mitsuo; Takahashi, Hideyuki [JEOL Ltd., SM Business Unit, Tokyo (Japan); Young Jeong, Hu [Graduate School of EEWS, WCU/BK21+, KAIST, Daejeon 305-701 (Korea, Republic of); Galeano, Carolina; Schüth, Ferdi [Department of Heterogeneous Catalysis, Max-Planck-Institut für Kohlenforschung, Mülheim (Germany); Terasaki, Osamu, E-mail: terasaki@mmk.su.se, E-mail: terasaki@kaist.ac.kr [Graduate School of EEWS, WCU/BK21+, KAIST, Daejeon 305-701 (Korea, Republic of); Department of Materials and Environmental Chemistry, Berzelii Centre EXSELENT on Porous Materials, Stockholm University, SE-10691 Stockholm (Sweden)
2014-11-01
Nanometal particles show characteristic features in chemical and physical properties depending on their sizes and shapes. For keeping and further enhancing their features, the particles should be protected from coalescence or degradation. One approach is to encapsulate the nanometal particles inside pores with chemically inert or functional materials, such as carbon, polymer, and metal oxides, which contain mesopores to allow permeation of only chemicals not the nanometal particles. Recently developed low-voltage high-resolution scanning electron microscopy was applied to the study of structural, chemical, and electron state of both nanometal particles and encapsulating materials in yolk-shell materials of Au@C, Ru/Pt@C, Au@TiO{sub 2}, and Pt@Polymer. Progresses in the following categories were shown for the yolk-shell materials: (i) resolution of topographic image contrast by secondary electrons, of atomic-number contrast by back-scattered electrons, and of elemental mapping by X-ray energy dispersive spectroscopy; (ii) sample preparation for observing internal structures; and (iii) X-ray spectroscopy such as soft X-ray emission spectroscopy. Transmission electron microscopy was also used for characterization of Au@C.
The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes
Directory of Open Access Journals (Sweden)
Mickey R. Miller
2014-09-01
Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Satsoura, Dmitri; Leber, Brian; Andrews, David W; Fradin, Cécile
2007-04-23
Photobleaching is a fluorophore-damaging process that commonly afflicts single-molecule fluorescence studies. It becomes an especially severe problem in fluorescence fluctuation experiments when studying slowly diffusing particles. One way to circumvent this problem is to use beam scanning to decrease the residence time of the fluorophores in the excitation volume. We report a systematic study of the effects of circular beam scanning on the photobleaching of fluorescent particles as observed in single-photon excitation fluorescence fluctuation experiments. We start by deriving a simple expression relating the average detected fluorescence to the photobleaching cross section of the fluorophores. We then perform numerical calculations of the spatial distribution of fluorescent particles in order to understand under which conditions beam scanning can prevent the formation of a photobleaching hole. To support these predictions, we show experimental results obtained for large unilamellar vesicles containing a small amount of the fluorescent lipophilic tracer DiD. We establish the required scanning radius and frequency range in order to obtain sufficient reduction of the photobleaching effect for that system. From the detected increase in fluorescence upon increase in scanning speed, we estimate the photobleaching cross section of DiD.
Beam-induced motion correction for sub-megadalton cryo-EM particles.
Scheres, Sjors Hw
2014-08-13
In electron cryo-microscopy (cryo-EM), the electron beam that is used for imaging also causes the sample to move. This motion blurs the images and limits the resolution attainable by single-particle analysis. In a previous Research article (Bai et al., 2013) we showed that correcting for this motion by processing movies from fast direct-electron detectors allowed structure determination to near-atomic resolution from 35,000 ribosome particles. In this Research advance article, we show that an improved movie processing algorithm is applicable to a much wider range of specimens. The new algorithm estimates straight movement tracks by considering multiple particles that are close to each other in the field of view, and models the fall-off of high-resolution information content by radiation damage in a dose-dependent manner. Application of the new algorithm to four data sets illustrates its potential for significantly improving cryo-EM structures, even for particles that are smaller than 200 kDa. Copyright © 2014, Scheres.
Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose
2017-07-25
Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.
(Brassicaceae) based on nuclear ribosomal ITS DNA sequences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...
Detailed SEM-EPMA investigation of high specific radioactivity particles (hot particles)
International Nuclear Information System (INIS)
Burin, K.; Tsacheva, Ts.; Mandjoukov, I.; Mandjoukova, B.
1993-01-01
Scanning electron microscope (SEM) images and electron probe microanalysis (EPMA) spectra of a group of hot particles collected in Bulgaria after the Chernobyl accident have been obtained. A technique for hot particle localization is described. The object is irradiated for two days with a β source and the resulting autoradiographs show particles location precisely. High resolution x-ray spectrum of each particle has been obtained using EPMA. The distribution of chemical elements is visualized by colour dot maps representing the regions of interest of the spectrum. It is concluded that apart from reactor fuel the investigated hot particles come from either construction materials or materials used for the covering of the damaged reactor. 7 figs., 2 ref
International Nuclear Information System (INIS)
Oesterberg, R.; Garrett, A.
1977-01-01
The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
Directory of Open Access Journals (Sweden)
Kiran Hasygar
2014-11-01
Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.
Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae
Linskens, Maarten H.K.; Huberman, Joel A.
1988-01-01
Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
Directory of Open Access Journals (Sweden)
Virginie Marcel
Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.
Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics
Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.
2017-12-01
Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
Blancett, Candace D; Fetterer, David P; Koistinen, Keith A; Morazzani, Elaine M; Monninger, Mitchell K; Piper, Ashley E; Kuehl, Kathleen A; Kearney, Brian J; Norris, Sarah L; Rossi, Cynthia A; Glass, Pamela J; Sun, Mei G
2017-10-01
A method for accurate quantitation of virus particles has long been sought, but a perfect method still eludes the scientific community. Electron Microscopy (EM) quantitation is a valuable technique because it provides direct morphology information and counts of all viral particles, whether or not they are infectious. In the past, EM negative stain quantitation methods have been cited as inaccurate, non-reproducible, and with detection limits that were too high to be useful. To improve accuracy and reproducibility, we have developed a method termed Scanning Transmission Electron Microscopy - Virus Quantitation (STEM-VQ), which simplifies sample preparation and uses a high throughput STEM detector in a Scanning Electron Microscope (SEM) coupled with commercially available software. In this paper, we demonstrate STEM-VQ with an alphavirus stock preparation to present the method's accuracy and reproducibility, including a comparison of STEM-VQ to viral plaque assay and the ViroCyt Virus Counter. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Diaz-Pache, F.; Alonso, F.J.; Esbert, R.M. [Departamento de Geologia, Universidad de Oviedo (Spain)
1996-06-01
Solid pollution particles play an important role in the decay of monumental stone. Scanning electron microscopy (SEM) in conjunction with microanalysis (EDX) are a very valuable study tool. In the present paper, particular attention is paid to sample collection and preparation. Examples of particles providing information on the source of decay are submitted. (Author) 9 refs.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.
Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter
2012-12-18
Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
DEFF Research Database (Denmark)
Long, Katherine S.; Vester, Birte
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites
DEFF Research Database (Denmark)
Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie
2017-01-01
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...
Directory of Open Access Journals (Sweden)
Shunsuke Asahina
2014-11-01
Full Text Available Nanometal particles show characteristic features in chemical and physical properties depending on their sizes and shapes. For keeping and further enhancing their features, the particles should be protected from coalescence or degradation. One approach is to encapsulate the nanometal particles inside pores with chemically inert or functional materials, such as carbon, polymer, and metal oxides, which contain mesopores to allow permeation of only chemicals not the nanometal particles. Recently developed low-voltage high-resolution scanning electron microscopy was applied to the study of structural, chemical, and electron state of both nanometal particles and encapsulating materials in york-shell materials of Au@C, Ru/Pt@C, Au@TiO2, and Pt@Polymer. Progresses in the following categories were shown for the york-shell materials: (i resolution of topographic image contrast by secondary electrons, of atomic-number contrast by back-scattered electrons, and of elemental mapping by X-ray energy dispersive spectroscopy; (ii sample preparation for observing internal structures; and (iii X-ray spectroscopy such as soft X-ray emission spectroscopy. Transmission electron microscopy was also used for characterization of Au@C.
Li, Junhua; Zhang, Yang; Yang, Yanjun
2013-03-01
The ribosomal protein L2, a constituent protein of the 50S large ribosomal subunit, can be used as Si-tag using silica particles for the immobilization and purification of recombinant proteins (Ikeda et al. (Protein Expr Purif 71:91-95, 2010); Taniguchi et al. (Biotechnol Bioeng 96:1023-1029, 2007)). We applied a diatomite powder, a sedimentary rock mainly composed with diatoms silica, as an affinity solid phase and small ubiquitin-like modifier (SUMO) technology to release a target protein from the solid phase. The L2 (203-273) was the sufficient region for the adsorption of ribosomal protein L2 on diatomite. We comparatively analyzed the different adsorption properties of the two deleted proteins of L2 (L2 (1-60, 203-273) and L2 (203-273)) on diatomite. The time required to reach adsorption equilibrium of L2 (203-273) fusion protein on diatomite was shorter than that of L2 (1-60, 203-273) fusion protein. The maximum adsorption capacity of L2 (203-273) fusion protein was larger than that of L2 (1-60, 203-273) fusion protein. In order to study whether the L2 (203-273) can function as an affinity purification tag, SUMO was introduced as one specific protease cleavage site between the target protein and the purification tags. The L2 (203-273) and SUMO fusion protein purification method was tested using enhanced green fluorescent protein as a model protein; the result shows that the purification performance of this affinity purification method was good. The strong adsorption characteristic of L2 (203-273) on diatomite also provides a potential protein fusion tag for the immobilization of enzyme.
1975-01-01
In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969
Directory of Open Access Journals (Sweden)
John N Griffin
2015-03-01
Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases
DEFF Research Database (Denmark)
Douthwaite, S; Christensen, A; Garrett, R A
1982-01-01
The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.
Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P
2015-11-10
Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.
Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad
2015-04-17
Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.
Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.
Nikolaitchik, Olga A; Hu, Wei-Shau
2014-04-01
A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1
Molecular dynamics simulation of ribosome jam
Matsumoto, Shigenori
2011-09-01
We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
CaJacob, C.A.; Frey, P.A.; Hainfeld, J.F.; Wall, J.S.; Yang, H.
1985-01-01
Particle masses of the Escherichia coli pyruvate dehydrogenase (PDH) complex and its component enzymes have been measured by scanning transmission electron microscopy (STEM). The particle mass of PDH complex measured by STEM is 5.28 X 10(6) with a standard deviation of 0.40 X 10(6). The masses of the component enzymes are 2.06 X 10(5) for the dimeric pyruvate dehydrogenase (E1), 1.15 X 10(5) for dimeric dihydrolipoyl dehydrogenase (E3), and 2.20 X 10(6) for dihydrolipoyl transacetylase (E2), the 24-subunit core enzyme. STEM measurements on PDH complex incubated with excess E3 or E1 failed to detect any additional binding of E3 but showed that the complex would bind additional E1 under forcing conditions. The additional E1 subunits were bound too weakly to represent binding sites in an isolated or isolable complex. The mass measurements by STEM are consistent with the subunit composition 24:24:12 when interpreted in the light of the flavin content of the complex and assuming 24 subunits in the core enzyme (E2)
A Scanning scheimpflug lidar system developed for urban pollution monitoring
Yang, Yang; Guan, Peng; Mei, Liang
2018-04-01
A scanning Scheimpflug lidar system based on the Scheimpflug principle has been developed by employing a high power multimode 808 nm laser diode and a highly integrated CMOS sensor in Dalian University of Technology, Dalian, Northern China. Atmospheric scanning measurements in urban area were performed for the studies of particle emission sources.
A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel
DEFF Research Database (Denmark)
Long, Katherine S; Porse, Bo T
2003-01-01
, of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....
Directory of Open Access Journals (Sweden)
O’Farrell Heather C
2012-10-01
Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.
Hatakeyama, T; Hatakeyama, T; Kimura, M
1988-11-21
The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.
Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli.
Mustafi, Mainak; Weisshaar, James C
2018-01-16
In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, https://doi.org/10.1093/nar/gkw787) of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid
International Nuclear Information System (INIS)
Takahashi, Noribumi; Takaiwa, Fumio; Fukuei, Keisuke; Sakamaki, Tadashi; Tanifuji, Shigeyuki
1977-01-01
Incorporation studies with 3 H-uridine or 3 H-adenosine showed that germinating pea embryos synthesize all types of poly A(+) RNA, rRNA and 4-5S RNA at the early stage of germination. After the pulse labeling for 30 min, only heterodisperse RNA and 4-5S RNA appeared in the cytoplasm as labeled RNA species. At this time the radioactivity was associated with cytoplasmic structures heavier than 80S and RNP particles of 68-70S, 52-55S, 36-38S and 20-22S which are presumed to be free mRNP particles in plants. When the pulse-labeled embryos were incubated for a further 60 min in an isotope-free medium, the labeled 17S and 25S rRNA emerged in the cytoplasm, together with labeled heterodisperse and 4-5S RNAs. More radioactivity accumulated in the regions of the polysome, 62-65S and 38-42S particles. The results of analysis of RNAs extracted from the whole cytoplasm, polysome or subribosomal fractions indicated that small subunits of newly formed ribosomes appear more rapidly in the cytoplasm than new large subunits, which accumulate for a while as free particles in the cytoplasm than are incorporated into polysomes. The actinomycin treatment which caused preferential inhibition of rRNA synthesis reduced the accumulation of free, newly formed ribosome subunits and partially permitted detection of the presumed mRNP particles in the subribosomal region even after the chase treatment. (auth.)
Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.
Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre
2016-09-01
Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.
International Nuclear Information System (INIS)
Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.
1987-01-01
The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly
Ribosomal RNA: a key to phylogeny
Olsen, G. J.; Woese, C. R.
1993-01-01
As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
DEFF Research Database (Denmark)
Siewers, Verena; San-Bento, Rita; Nielsen, Jens
2010-01-01
Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.
Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H
1975-01-24
The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.
Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes
Energy Technology Data Exchange (ETDEWEB)
deLivron, M.; Robinson, V
2008-01-01
BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.
Influence of synthesis conditions on particle morphology of ...
Indian Academy of Sciences (India)
Wintec
diffraction (XRD), scanning electron microscopy (SEM), and dynamic light scattering (DLS). Cu/ZnO ... Considerable attention has been paid to copper metal nano- particles .... And also energy dispersive scanning (EDS) analyses of sample ...
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Occurrence of particle debris field during focused Ga ion beam milling of glassy carbon
Energy Technology Data Exchange (ETDEWEB)
Hu Qin [Centre for Industrial Photonics, Institute for Manufacturing, Department of Engineering, University of Cambridge, Alan Reece Building, 17 Charles Babbage Road, Cambridge, CB3 0FS (United Kingdom); O' Neill, William, E-mail: wo207@eng.cam.ac.uk [Centre for Industrial Photonics, Institute for Manufacturing, Department of Engineering, University of Cambridge, Alan Reece Building, 17 Charles Babbage Road, Cambridge, CB3 0FS (United Kingdom)
2010-08-01
To explore the machining characteristics of glassy carbon by focused ion beam (FIB), particles induced by FIB milling on glassy carbon have been studied in the current work. Nano-sized particles in the range of tens of nanometers up to 400 nm can often be found around the area subject to FIB milling. Two ion beam scanning modes - slow single scan and fast repetitive scan - have been tested. Fewer particles are found in single patterns milled in fast repetitive scan mode. For a group of test patterns milled in a sequence, it was found that a greater number of particles were deposited around sites machined early in the sequence. In situ EDX analysis of the particles showed that they were composed of C and Ga. The formation of particles is related to the debris generated at the surrounding areas, the low melting point of gallium used as FIB ion source and the high contact angle of gallium on glassy carbon induces de-wetting of Ga and the subsequent formation of Ga particles. Ultrasonic cleaning can remove over 98% of visible particles. The surface roughness (R{sub a}) of FIB milled areas after cleaning is less than 2 nm.
Occurrence of particle debris field during focused Ga ion beam milling of glassy carbon
International Nuclear Information System (INIS)
Hu Qin; O'Neill, William
2010-01-01
To explore the machining characteristics of glassy carbon by focused ion beam (FIB), particles induced by FIB milling on glassy carbon have been studied in the current work. Nano-sized particles in the range of tens of nanometers up to 400 nm can often be found around the area subject to FIB milling. Two ion beam scanning modes - slow single scan and fast repetitive scan - have been tested. Fewer particles are found in single patterns milled in fast repetitive scan mode. For a group of test patterns milled in a sequence, it was found that a greater number of particles were deposited around sites machined early in the sequence. In situ EDX analysis of the particles showed that they were composed of C and Ga. The formation of particles is related to the debris generated at the surrounding areas, the low melting point of gallium used as FIB ion source and the high contact angle of gallium on glassy carbon induces de-wetting of Ga and the subsequent formation of Ga particles. Ultrasonic cleaning can remove over 98% of visible particles. The surface roughness (R a ) of FIB milled areas after cleaning is less than 2 nm.
Quantification of aggregate grain shape characteristics using 3-D laser scanning technology
CSIR Research Space (South Africa)
Mgangira, Martin B
2013-07-01
Full Text Available to identify the differences between individual aggregates. It was possible to quantify differences in particle shape characteristics at the small particle scale. The study has demonstrated the advantages of the innovative 3-D laser scanning technology...
Real-time scanning charged-particle microscope image composition with correction of drift.
Cizmar, Petr; Vladár, András E; Postek, Michael T
2011-04-01
In this article, a new scanning electron microscopy (SEM) image composition technique is described, which can significantly reduce drift related image corruptions. Drift distortion commonly causes blur and distortions in the SEM images. Such corruption ordinarily appears when conventional image-acquisition methods, i.e., "slow scan" and "fast scan," are applied. The damage is often very significant; it may render images unusable for metrology applications, especially where subnanometer accuracy is required. The described correction technique works with a large number of quickly taken frames, which are properly aligned and then composed into a single image. Such image contains much less noise than the individual frames, while the blur and deformation is minimized. This technique also provides useful information about changes of the sample position in time, which may be applied to investigate the drift properties of the instrument without a need of additional equipment.
Uranium-Molybdenum particles produced by electro-erosion
International Nuclear Information System (INIS)
Cabanillas, Edgardo D.; Lopez, Marisol; Pasqualini, Enrique E.; Lombardo, D. J. C.
2003-01-01
We have produced spheroidal U-Mo particles by the electro-erosion method using pure water as dielectric. The particles were characterised by optical metallography, scanning electron microscopy, energy dispersive spectrometry (EDS-EDAX) and X-ray diffraction. Spheroidal UO 2 particles with a peculiar distribution size were obtained with two distribution centred at 10 and 70 μm. The obtained particles have central inclusions of U and Mo compounds. (author)
Ribosome-Inactivating Proteins from Plants: A Historical Overview
Directory of Open Access Journals (Sweden)
Andrea Bolognesi
2016-11-01
Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.
Examination of the Combustion Morphology of Ziconium Carbide Using Scanning Electron Microscopy
Newbold, Brian R.
1997-01-01
Calculation of viscous particle damping of acoustic combustion instability in solid propellant motors requires an understanding of the combustion behavior of added particles and oxides. A simple hydrogen/oxygen flame was used to ignite carefully sieved zirconium carbide particles which were impacted on slides at different levels below the burner. Scanning electron microscopy revealed that zirconium carbide has a complex heterogeneous combustion morphology. Initially, particles are partly v...
Efficient cascaded parameter scan approach for studying top-off safety in storage rings
Directory of Open Access Journals (Sweden)
Yongjun Li
2011-03-01
Full Text Available We introduce a new algorithm, which we call the cascaded parameter scan method, to efficiently carry out the scan over magnet parameters in the safety analysis for top-off injection in synchrotron radiation storage rings. In top-off safety analysis, one must track particles populating phase space through a beam line containing magnets and apertures and clearly demonstrate that, for all possible magnet settings and errors, all particles are lost on scrapers within the properly shielded region. In the usual approach, if one considers m magnets and scans each magnet through n setpoints, then one must carry out n^{m} tracking runs. In the cascaded parameter scan method, the number of tracking runs is reduced to n×m. This reduction of exponential to linear dependence on the number of setpoints n greatly reduces the required computation time and allows one to more densely populate phase space and to increase the number n of setpoints scanned for each magnet.
Vera-Otarola, Jorge; Solis, Loretto; Soto-Rifo, Ricardo; Ricci, Emiliano P; Pino, Karla; Tischler, Nicole D; Ohlmann, Théophile; Darlix, Jean-Luc; López-Lastra, Marcelo
2012-02-01
The small mRNA (SmRNA) of all Bunyaviridae encodes the nucleocapsid (N) protein. In 4 out of 5 genera in the Bunyaviridae, the smRNA encodes an additional nonstructural protein denominated NSs. In this study, we show that Andes hantavirus (ANDV) SmRNA encodes an NSs protein. Data show that the NSs protein is expressed in the context of an ANDV infection. Additionally, our results suggest that translation initiation from the NSs initiation codon is mediated by ribosomal subunits that have bypassed the upstream N protein initiation codon through a leaky scanning mechanism.
Directory of Open Access Journals (Sweden)
Abhishek Ghosh
2014-10-01
Full Text Available The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.
Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...
African Journals Online (AJOL)
The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...
DEFF Research Database (Denmark)
Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni
1999-01-01
We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...
DEFF Research Database (Denmark)
Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni
1999-01-01
We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...
InterProScan Result: FS919781 [KAIKOcDNA[Archive
Lifescience Database Archive (English)
Full Text Available FS919781 FS919781_2_ORF2 11D6928E8BA64F8F SUPERFAMILY SSF55194 Ribosome recycling f...actor, RRF 5.5e-35 T IPR002661 Ribosome recycling factor Biological Process: translation (GO:0006412) ...
Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...
Indian Academy of Sciences (India)
Unknown
mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.
Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra
DEFF Research Database (Denmark)
Thomsen, S.; Hansen, Harald S.; Nyman, U.
1991-01-01
Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...
Catania, Francesco; Lynch, Michael
2010-05-04
In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Directory of Open Access Journals (Sweden)
Yanan Sun
Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.
2016-02-11
unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was
Crossland, Hannah; Timmons, James A; Atherton, Philip J
2017-12-01
Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).
De novo design and engineering of non-ribosomal peptide synthetases
Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.
2018-03-01
Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
International Nuclear Information System (INIS)
Gontard, Lionel C.; Schierholz, Roland; Yu, Shicheng; Cintas, Jesús; Dunin-Borkowski, Rafal E.
2016-01-01
We apply photogrammetry in a scanning electron microscope (SEM) to study the three-dimensional shape and surface texture of a nanoscale LiTi_2(PO_4)_3 particle. We highlight the fact that the technique can be applied non-invasively in any SEM using free software (freeware) and does not require special sample preparation. Three-dimensional information is obtained in the form of a surface mesh, with the texture of the sample stored as a separate two-dimensional image (referred to as a UV Map). The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass, while the UV map can be used to study the surface texture using conventional image processing techniques. We also illustrate the use of 3D printing to visualize the reconstructed model. - Highlights: • 3D shape and surface texture of a nanoscale LiTi_2(PO_4)_3 particle. • The technique can be applied non-invasively in any SEM using freeware software. • The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass. • The UV map can be processed using 2D image processing software.
Energy Technology Data Exchange (ETDEWEB)
Gontard, Lionel C., E-mail: lionelcg@gmail.com [Departamento de Ciencia de los Materiales e Ingeniería Metalúrgica y Química Inorgánica, Universidad de Cádiz, Puerto Real 11510 (Spain); Faico PCT Cartuja. Edif. TI Marie Curie, C/ Leonardo da Vinci 18, 4a Planta, 41092 Sevilla (Spain); Schierholz, Roland; Yu, Shicheng [Institute of Energy and Climate Research, Fundamental Electrochemistry (IEK-9), Forschungszentrum Jülich, D-52425 Jülich (Germany); Cintas, Jesús [Servicio de Microscopía Centro de Investigación, Tecnología e Innovación (CITIUS), Universidad de Sevilla, Av. Reina Mercedes 4b, 41012 Sevilla (Spain); Dunin-Borkowski, Rafal E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Grünberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany)
2016-10-15
We apply photogrammetry in a scanning electron microscope (SEM) to study the three-dimensional shape and surface texture of a nanoscale LiTi{sub 2}(PO{sub 4}){sub 3} particle. We highlight the fact that the technique can be applied non-invasively in any SEM using free software (freeware) and does not require special sample preparation. Three-dimensional information is obtained in the form of a surface mesh, with the texture of the sample stored as a separate two-dimensional image (referred to as a UV Map). The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass, while the UV map can be used to study the surface texture using conventional image processing techniques. We also illustrate the use of 3D printing to visualize the reconstructed model. - Highlights: • 3D shape and surface texture of a nanoscale LiTi{sub 2}(PO{sub 4}){sub 3} particle. • The technique can be applied non-invasively in any SEM using freeware software. • The mesh can be used to measure parameters such as surface area, volume, moment of inertia and center of mass. • The UV map can be processed using 2D image processing software.
Atmospheric scanning electron microscope for correlative microscopy.
Morrison, Ian E G; Dennison, Clare L; Nishiyama, Hidetoshi; Suga, Mitsuo; Sato, Chikara; Yarwood, Andrew; O'Toole, Peter J
2012-01-01
The JEOL ClairScope is the first truly correlative scanning electron and optical microscope. An inverted scanning electron microscope (SEM) column allows electron images of wet samples to be obtained in ambient conditions in a biological culture dish, via a silicon nitride film window in the base. A standard inverted optical microscope positioned above the dish holder can be used to take reflected light and epifluorescence images of the same sample, under atmospheric conditions that permit biochemical modifications. For SEM, the open dish allows successive staining operations to be performed without moving the holder. The standard optical color camera used for fluorescence imaging can be exchanged for a high-sensitivity monochrome camera to detect low-intensity fluorescence signals, and also cathodoluminescence emission from nanophosphor particles. If these particles are applied to the sample at a suitable density, they can greatly assist the task of perfecting the correlation between the optical and electron images. Copyright © 2012 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Timmins, P.A.; Langowski, J.; Brown, R.S.
1988-01-01
The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA
Monosodium titanate particle characterization
International Nuclear Information System (INIS)
Chandler, G.T.; Hobbs, D.T.
1993-01-01
A characterization study was performed on monosodium titanate (MST) particles to determine the effect of high shear forces expected from the In-Tank Precipitation (ITP) process pumps on the particle size distribution. The particles were characterized using particle size analysis and scanning electron microscopy (SEM). No significant changes in particle size distributions were observed between as-received MST and after 2--4 hours of shearing. Both as-received and sheared MST particles contained a large percentage of porosity with pore sizes on the order of 500 to 2,000 Angstroms. Because of the large percentage of porosity, the overall surface area of the MST is dominated by the internal surfaces. The uranium and plutonium species present in the waste solution will have access to both interior and exterior surfaces. Therefore, uranium and plutonium loading should not be a strong function of MST particle size
InterProScan Result: FS787904 [KAIKOcDNA[Archive
Lifescience Database Archive (English)
Full Text Available FS787904 FS787904_5_ORF1 F46B8A7F4DCFA20B SUPERFAMILY SSF55194 Ribosome recycling f...actor, RRF 4.1e-24 T IPR002661 Ribosome recycling factor Biological Process: translation (GO:0006412) ...
RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN
Directory of Open Access Journals (Sweden)
A.A. Alekseeva
2010-01-01
Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130
DEFF Research Database (Denmark)
Richter, W W; Zang, K D; Issinger, O G
1983-01-01
Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...
Efficiency of a concentric matrix track detector surface scanning
International Nuclear Information System (INIS)
Bek-Uzarov, Dj.; Nikezic, D.; Kostic, D.; Krstic, D.; Cuknic, O.
1995-01-01
Heavy particle ionizing radiation track counting on the surface of a solid state round surface detector is made using the microscope and scanning step by step by a round field of vision. The whole solid state detector surface could not be fully or completely covered by round fields of visions. Therefore detector surface could be divided on the two parts, the larger surface, being under fields of vision, really scanned and no scanned missed or omitted surface. The ratio between omitted and scanned surfaces is so called track scanning efficiency. The knowledge of really counted, or scanned surface is a important value for evaluating the real surface track density an exposed solid state track detector. In the paper a matrix of a concentric field of vision made around the first microscope field of vision placed in center of the round disc of the scanned track detector is proposed. In a such scanning matrix the real scanned surface could be easy calculated and by the microscope scanning made as well. By this way scanned surface is very precisely obtained as well. Precise knowledge of scanned and omitted surface allows to obtain more precise scanning efficiency factor as well as real surface track density, the main parameter in solid state track detection measurements. (author)
cDNA, genomic sequence cloning and overexpression of ribosomal ...
African Journals Online (AJOL)
RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...
Abrasion of 6 dentifrices measured by vertical scanning interference microscopy.
Pascaretti-Grizon, Florence; Mabilleau, Guillaume; Chappard, Daniel
2013-01-01
The abrasion of dentifrices is well recognized to eliminate the dental plaque. The aims of this study were to characterize the abrasive powders of 6 dentifrices (3 toothpastes and 3 toothpowders) and to measure the abrasion on a test surface by Vertical Scanning Interference microscopy (VSI). Bright field and polarization microscopy were used to identify the abrasive particles on the crude dentifrices and after prolonged washes. Scanning electron microscopy and microanalysis characterized the shape and nature of the particles. Standardized and polished blocks of poly(methylmethacrylate) were brushed with a commercial electric toothbrush with the dentifrices. VSI quantified the mean roughness (Ra) and illustrated in 3D the abraded areas. Toothpastes induced a limited abrasion. Toothpowders induced a significantly higher roughness linked to the size of the abrasive particles. One powder (Gencix® produced a high abrasion when used with a standard testing weight. However, the powder is based on pumice particles covered by a plant homogenate that readily dissolves in water. When used in the same volume, or after dispersion in water, Ra was markedly reduced. Light and electron microscopy characterize the abrasive particles and VSI is a new tool allowing the analysis of large surface of abraded materials.
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-10-14
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.
The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage
DEFF Research Database (Denmark)
Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A
2014-01-01
Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...
Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi
2017-07-01
Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji
2007-01-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3 1 21 or P3 2 21
International Nuclear Information System (INIS)
Nowotny, V.; Nierhaus, K.H.
1988-01-01
A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains
Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium
Directory of Open Access Journals (Sweden)
Lynch Michael
2010-05-01
Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.
Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George
2014-01-01
Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...
Directory of Open Access Journals (Sweden)
Fucini Paola
2004-04-01
Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r
Production of uranium-molybdenum particles by spark-erosion
International Nuclear Information System (INIS)
Cabanillas, E.D.; Lopez, M.; Pasqualini, E.E.; Cirilo Lombardo, D.J.
2004-01-01
With the spark-erosion method we have produced spheroidal particles of an uranium-molybdenum alloy using pure water as dielectric. The particles were characterized by optical metallography, scanning electron microscopy, energy dispersive spectrometry and X-ray diffraction. Mostly spherical particles of UO 2 with a distinctive size distribution with peaks centered at 70 and 10 μm were obtained. The particles have central inclusions of U and Mo compounds
Production of uranium-molybdenum particles by spark-erosion
Energy Technology Data Exchange (ETDEWEB)
Cabanillas, E.D. E-mail: cabanill@cnea.gov.ar; Lopez, M.; Pasqualini, E.E.; Cirilo Lombardo, D.J
2004-01-01
With the spark-erosion method we have produced spheroidal particles of an uranium-molybdenum alloy using pure water as dielectric. The particles were characterized by optical metallography, scanning electron microscopy, energy dispersive spectrometry and X-ray diffraction. Mostly spherical particles of UO{sub 2} with a distinctive size distribution with peaks centered at 70 and 10 {mu}m were obtained. The particles have central inclusions of U and Mo compounds.
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development
International Nuclear Information System (INIS)
Dessen, E.M.B.; Perondini, A.L.P.
1979-01-01
Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt
Morphological classification of bioaerosols from composting using scanning electron microscopy
International Nuclear Information System (INIS)
Tamer Vestlund, A.; Al-Ashaab, R.; Tyrrel, S.F.; Longhurst, P.J.; Pollard, S.J.T.; Drew, G.H.
2014-01-01
Highlights: • Bioaerosols were captured using the filter method. • Bioaerosols were analysed using scanning electron microscope. • Bioaerosols were classified on the basis of morphology. • Single small cells were found more frequently than aggregates and larger cells. • Smaller cells may disperse further than heavier aggregate structures. - Abstract: This research classifies the physical morphology (form and structure) of bioaerosols emitted from open windrow composting. Aggregation state, shape and size of the particles captured are reported alongside the implications for bioaerosol dispersal after release. Bioaerosol sampling took place at a composting facility using personal air filter samplers. Samples were analysed using scanning electron microscopy. Particles were released mainly as small (<1 μm) single, spherical cells, followed by larger (>1 μm) single cells, with aggregates occurring in smaller proportions. Most aggregates consisted of clusters of 2–3 particles as opposed to chains, and were <10 μm in size. No cells were attached to soil debris or wood particles. These small single cells or small aggregates are more likely to disperse further downwind from source, and cell viability may be reduced due to increased exposure to environmental factors
Morphological classification of bioaerosols from composting using scanning electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Tamer Vestlund, A. [Institute for Energy and Resource Technology, Environmental Science and Technology Department, School of Applied Sciences, Cranfield University, Building 40, Bedfordshire MK43 0AL (United Kingdom); FIRA International Ltd., Maxwell Road, Stevenage, Herts SG1 2EW (United Kingdom); Al-Ashaab, R.; Tyrrel, S.F.; Longhurst, P.J.; Pollard, S.J.T. [Institute for Energy and Resource Technology, Environmental Science and Technology Department, School of Applied Sciences, Cranfield University, Building 40, Bedfordshire MK43 0AL (United Kingdom); Drew, G.H., E-mail: g.h.drew@cranfield.ac.uk [Institute for Energy and Resource Technology, Environmental Science and Technology Department, School of Applied Sciences, Cranfield University, Building 40, Bedfordshire MK43 0AL (United Kingdom)
2014-07-15
Highlights: • Bioaerosols were captured using the filter method. • Bioaerosols were analysed using scanning electron microscope. • Bioaerosols were classified on the basis of morphology. • Single small cells were found more frequently than aggregates and larger cells. • Smaller cells may disperse further than heavier aggregate structures. - Abstract: This research classifies the physical morphology (form and structure) of bioaerosols emitted from open windrow composting. Aggregation state, shape and size of the particles captured are reported alongside the implications for bioaerosol dispersal after release. Bioaerosol sampling took place at a composting facility using personal air filter samplers. Samples were analysed using scanning electron microscopy. Particles were released mainly as small (<1 μm) single, spherical cells, followed by larger (>1 μm) single cells, with aggregates occurring in smaller proportions. Most aggregates consisted of clusters of 2–3 particles as opposed to chains, and were <10 μm in size. No cells were attached to soil debris or wood particles. These small single cells or small aggregates are more likely to disperse further downwind from source, and cell viability may be reduced due to increased exposure to environmental factors.
Chowdhury, Snehaunshu
2017-01-23
In this study, we demonstrate the use of a scanning mobility particle sizer (SMPS) as an effective tool to measure the probability density functions (PDFs) of soot nanoparticles in turbulent flames. Time-averaged soot PDFs necessary for validating existing soot models are reported at intervals of ∆x/D∆x/D = 5 along the centerline of turbulent, non-premixed, C2H4/N2 flames. The jet exit Reynolds numbers of the flames investigated were 10,000 and 20,000. A simplified burner geometry based on a published design was chosen to aid modelers. Soot was sampled directly from the flame using a sampling probe with a 0.5-mm diameter orifice and diluted with N2 by a two-stage dilution process. The overall dilution ratio was not evaluated. An SMPS system was used to analyze soot particle concentrations in the diluted samples. Sampling conditions were optimized over a wide range of dilution ratios to eliminate the effect of agglomeration in the sampling probe. Two differential mobility analyzers (DMAs) with different size ranges were used separately in the SMPS measurements to characterize the entire size range of particles. In both flames, the PDFs were found to be mono-modal in nature near the jet exit. Further downstream, the profiles were flatter with a fall-off at larger particle diameters. The geometric mean of the soot size distributions was less than 10 nm for all cases and increased monotonically with axial distance in both flames.
Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R
2008-02-22
The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.
Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S
2003-09-01
The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier
2017-07-01
Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.
Energy Technology Data Exchange (ETDEWEB)
Simeonov, Y; Penchev, P; Ringbaek, T Printz [University of Applied Sciences, Institute of Medical Physics and Radiation Protection, Giessen (Germany); Brons, S [Heidelberg Ion-Beam Therapy Center (HIT), Heidelberg (Germany); Weber, U [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Zink, K [University of Applied Sciences, Institute of Medical Physics and Radiation Protection, Giessen (Germany); University Hospital Giessen-Marburg, Marburg (Germany)
2016-06-15
Purpose: Active raster scanning in particle therapy results in highly conformal dose distributions. Treatment time, however, is relatively high due to the large number of different iso-energy layers used. By using only one energy and the so called 3D range-modulator irradiation times of a few seconds only can be achieved, thus making delivery of homogeneous dose to moving targets (e.g. lung cancer) more reliable. Methods: A 3D range-modulator consisting of many pins with base area of 2.25 mm2 and different lengths was developed and manufactured with rapid prototyping technique. The form of the 3D range-modulator was optimised for a spherical target volume with 5 cm diameter placed at 25 cm in a water phantom. Monte Carlo simulations using the FLUKA package were carried out to evaluate the modulating effect of the 3D range-modulator and simulate the resulting dose distribution. The fine and complicated contour form of the 3D range-modulator was taken into account by a specially programmed user routine. Additionally FLUKA was extended with the capability of intensity modulated scanning. To verify the simulation results dose measurements were carried out at the Heidelberg Ion Therapy Center (HIT) with a 400.41 MeV 12C beam. Results: The high resolution measurements show that the 3D range-modulator is capable of producing homogeneous 3D conformal dose distributions, simultaneously reducing significantly irradiation time. Measured dose is in very good agreement with the previously conducted FLUKA simulations, where slight differences were traced back to minor manufacturing deviations from the perfect optimised form. Conclusion: Combined with the advantages of very short treatment time the 3D range-modulator could be an alternative to treat small to medium sized tumours (e.g. lung metastasis) with the same conformity as full raster-scanning treatment. Further simulations and measurements of more complex cases will be conducted to investigate the full potential of the 3D
DEFF Research Database (Denmark)
Douthwaite, S; Powers, T; Lee, J Y
1989-01-01
The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
Probing Individual Ice Nucleation Events with Environmental Scanning Electron Microscopy
Wang, Bingbing; China, Swarup; Knopf, Daniel; Gilles, Mary; Laskin, Alexander
2016-04-01
Heterogeneous ice nucleation is one of the processes of critical relevance to a range of topics in the fundamental and the applied science and technologies. Heterogeneous ice nucleation initiated by particles proceeds where microscopic properties of particle surfaces essentially control nucleation mechanisms. Ice nucleation in the atmosphere on particles governs the formation of ice and mixed phase clouds, which in turn influence the Earth's radiative budget and climate. Heterogeneous ice nucleation is still insufficiently understood and poses significant challenges in predictive understanding of climate change. We present a novel microscopy platform allowing observation of individual ice nucleation events at temperature range of 193-273 K and relative humidity relevant for ice formation in the atmospheric clouds. The approach utilizes a home built novel ice nucleation cell interfaced with Environmental Scanning Electron Microscope (IN-ESEM system). The IN-ESEM system is applied for direct observation of individual ice formation events, determining ice nucleation mechanisms, freezing temperatures, and relative humidity onsets. Reported microanalysis of the ice nucleating particles (INP) include elemental composition detected by the energy dispersed analysis of X-rays (EDX), and advanced speciation of the organic content in particles using scanning transmission x-ray microscopy with near edge X-ray absorption fine structure spectroscopy (STXM/NEXAFS). The performance of the IN-ESEM system is validated through a set of experiments with kaolinite particles with known ice nucleation propensity. We demonstrate an application of the IN-ESEM system to identify and characterize individual INP within a complex mixture of ambient particles.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
Energy Technology Data Exchange (ETDEWEB)
Zhong, Y; Sun, X; Lu, W; Jia, X; Wang, J; Shao, Y [The University of Texas Southwestern Medical Ctr., Dallas, TX (United States)
2016-06-15
Purpose: To investigate the feasibility and requirement for intra-fraction on-line multiple scanning particle beam range verifications (BRVs) with in-situ PET imaging, which is beyond the current single-beam BRV with extra factors that will affect the BR measurement accuracy, such as beam diameter, separation between beams, and different image counts at different BRV positions. Methods: We simulated a 110-MeV proton beam with 5-mm diameter irradiating a uniform PMMA phantom by GATE simulation, which generated nuclear interaction-induced positrons. In this preliminary study, we simply duplicated these positrons and placed them next to the initial protons to approximately mimic the two spatially separated positron distributions produced by two beams parallel to each other but with different beam ranges. These positrons were then imaged by a PET (∼2-mm resolution, 10% sensitivity, 320×320×128 mm^3 FOV) with different acquisition times. We calculated the positron activity ranges (ARs) from reconstructed PET images and compared them with the corresponding ARs of original positron distributions. Results: Without further image data processing and correction, the preliminary study show the errors between the measured and original ARs varied from 0.2 mm to 2.3 mm as center-to-center separations and range differences were in the range of 8–12 mm and 2–8 mm respectively, indicating the accuracy of AR measurement strongly depends on the beam separations and range differences. In addition, it is feasible to achieve ≤ 1.0-mm accuracy for both beams with 1-min PET acquisition and 12 mm beam separation. Conclusion: This study shows that the overlap between the positron distributions from multiple scanning beams can significantly impact the accuracy of BRVs of distributed particle beams and need to be further addressed beyond the established method of single-beam BRV, but it also indicates the feasibility to achieve accurate on-line multi-beam BRV with further improved
The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel
DEFF Research Database (Denmark)
Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen
2017-01-01
Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...
Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G
2011-05-01
The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.
Hatakeyama, T; Kimura, M
1988-03-15
Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.
Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M
2004-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.
DEFF Research Database (Denmark)
Poulsen, S M; Karlsson, M; Johansson, L B
2001-01-01
The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....
International Nuclear Information System (INIS)
Medley, S.S.; Andre, R.; Bell, R.E.; Darrow, D.S.; Domier, C.W.; Fredrickson, E.D.; Gorelenkov, N.N.; Kaye, S.M.; LeBlanc, B.P.; Lee, K.C.; Levinton, F.M.; Liu, D.; Luhmann, N.C. Jr.; Menard, J.E.; Park, H.; Stutman, D.; Roquemore, A.L.; Tritz, K.; Yuh, H
2007-01-01
Observations of magneto-hydro-dynamic (MHD) induced redistribution or loss of energetic ions measured using the vertically scanning capability of the Neutral Particle Analyzer diagnostic on the National Spherical Torus Experiment (NSTX) are presented along with TRANSP and ORBIT code analysis of the results. Although redistribution or loss of energetic ions due to bursting fishbone-like and low-frequency (f ∼ 10 kHz) kinktype MHD activity has been reported previously, the primary goal of this work is to study redistribution or loss due to continuous Alfvenic (f ∼ 20-150 kHz) modes, a topic that heretofore has not been investigated in detail for NSTX plasmas. Initial indications are that the former drive energetic ion loss whereas the continuous Alfvenic modes only cause redistribution and the energetic ions remain confined.
Energy Technology Data Exchange (ETDEWEB)
S.S. Medley, R. Andre, R.E. Bell, D.S. Darrow, C.W. Domier, E.D. Fredrickson, N.N. Gorelenkov, S.M. Kaye, B.P. LeBlanc, K.C. Lee, F.M. Levinton, D. Liu, N.C. Luhmann, Jr., J.E. Menard, H. Park, D. Stutman, A.L. Roquemore, K. Tritz, H. Yuh and the NSTX Team
2007-11-15
Observations of magneto-hydro-dynamic (MHD) induced redistribution or loss of energetic ions measured using the vertically scanning capability of the Neutral Particle Analyzer diagnostic on the National Spherical Torus Experiment (NSTX) are presented along with TRANSP and ORBIT code analysis of the results. Although redistribution or loss of energetic ions due to bursting fishbone-like and low-frequency (f ~ 10 kHz) kinktype MHD activity has been reported previously, the primary goal of this work is to study redistribution or loss due to continuous Alfvénic (f ~ 20 – 150 kHz) modes, a topic that heretofore has not been investigated in detail for NSTX plasmas. Initial indications are that the former drive energetic ion loss whereas the continuous Alfvénic modes only cause redistribution and the energetic ions remain confined.
Sequence analysis and over-expression of ribosomal protein S28 ...
African Journals Online (AJOL)
RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...
Alpha particle radiography of small insects
International Nuclear Information System (INIS)
Chingshen Su
1993-01-01
Radiographies of ants, mosquitoes, cockroaches and small bugs have been done with a radioisotope 244 Cm alpha source. Energy of alpha particles was varied by attenuating the 5.81 MeV alpha particles with adjustable air spacings from the source to the sample. The LR-115 was used to register radiographs. The image of the insect registered on the LR-115 was etched out in a 2.5 N NaOH solution at 52 o C for certain minutes, depending on various irradiation conditions for the insects. For larger insects, a scanning device for the alpha particle irradiation has been fabricated to take the radiograph of whole body of the insect, and the scanning period can be selected to give desired irradiation dosage. A CCDTV camera system connected to a microscope interfaced to an IBM/AT computer is used to register the microscopic image of the radiograph and to print it out with a video copy processor. (Author)
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes
International Nuclear Information System (INIS)
Mori, Tomohiko; Fukuda, Mitsuru
1975-01-01
The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)
The functional half-life of an mRNA depends on the ribosome spacing in an early coding region
DEFF Research Database (Denmark)
Pedersen, Margit; Nissen, Søren; Mitarai, Namiko
2011-01-01
Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...
International Nuclear Information System (INIS)
Stahl, J.; Boehm, H.; Voderberg, M.
1981-01-01
Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)
Investigation of Nematode Diversity using Scanning Electron Microscopy and Fluorescent Microscopy
Seacor, Taylor; Howell, Carina
2013-03-01
Nematode worms account for the vast majority of the animals in the biosphere. They are colossally important to global public health as parasites, and to agriculture both as pests and as beneficial inhabitants of healthy soil. Amphid neurons are the anterior chemosensory neurons in nematodes, mediating critical behaviors including chemotaxis and mating. We are examining the cellular morphology and external anatomy of amphid neurons, using fluorescence microscopy and scanning electron microscopy, respectively, of a wide range of soil nematodes isolated in the wild. We use both classical systematics (e.g. diagnostic keys) and molecular markers (e.g. ribosomal RNA) to classify these wild isolates. Our ultimate aim is to build a detailed anatomical database in order to dissect genetic pathways of neuronal development and function across phylogeny and ecology. Research supported by NSF grants 092304, 0806660, 1058829 and Lock Haven University FPDC grants
MATHEMATICAL AND COMPUTATIONAL MODELLING OF RIBOSOMAL MOVEMENT AND PROTEIN SYNTHESIS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
Tobias von der Haar
2012-04-01
Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.
CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY
Directory of Open Access Journals (Sweden)
A.A. Alekseeva
2011-01-01
Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215
Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome
Long, Katherine S.
2012-01-01
Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525
The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel
DEFF Research Database (Denmark)
Wekselman, I.; Zimmerman, E.; Davidovich, C.
2017-01-01
in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...
Ribosomal PCR and DNA sequencing for detection and identification of bacteria
DEFF Research Database (Denmark)
Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen
2014-01-01
-haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...
Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases
DEFF Research Database (Denmark)
Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus
2016-01-01
Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...
Scanning-electron-microscope study of normal-impingement erosion of ductile metals
Brainard, W. A.; Salik, J.
1980-01-01
Scanning electron microscopy was used to characterize the erosion of annealed copper and aluminum surfaces produced by both single- and multiple-particle impacts. Macroscopic 3.2 mm diameter steel balls and microscopic, brittle erodant particles were projected by a gas gun system so as to impact at normal incidence at speeds up to 140 m/sec. During the impacts by the brittle erodant particles, at lower speeds the erosion behavior was similar to that observed for the larger steel balls. At higher velocities, particle fragmentation and the subsequent cutting by the radial wash of debris created a marked change in the erosion mechanism.
Directory of Open Access Journals (Sweden)
Mikhail M. Pooggin
2018-04-01
Full Text Available Viruses have compact genomes and usually translate more than one protein from polycistronic RNAs using leaky scanning, frameshifting, stop codon suppression or reinitiation mechanisms. Viral (pre-genomic RNAs often contain long 5′-leader sequences with short upstream open reading frames (uORFs and secondary structure elements, which control both translation initiation and replication. In plants, viral RNA and DNA are targeted by RNA interference (RNAi generating small RNAs that silence viral gene expression, while viral proteins are recognized by innate immunity and autophagy that restrict viral infection. In this review we focus on plant pararetroviruses of the family Caulimoviridae and describe the mechanisms of uORF- and secondary structure-driven ribosome shunting, leaky scanning and reinitiation after translation of short and long uORFs. We discuss conservation of these mechanisms in different genera of Caulimoviridae, including host genome-integrated endogenous viral elements, as well as in other viral families, and highlight a multipurpose use of the highly-structured leader sequence of plant pararetroviruses in regulation of translation, splicing, packaging, and reverse transcription of pregenomic RNA (pgRNA, and in evasion of RNAi. Furthermore, we illustrate how targeting of several host factors by a pararetroviral effector protein can lead to transactivation of viral polycistronic translation and concomitant suppression of antiviral defenses. Thus, activation of the plant protein kinase target of rapamycin (TOR by the Cauliflower mosaic virus transactivator/viroplasmin (TAV promotes reinitiation of translation after long ORFs on viral pgRNA and blocks antiviral autophagy and innate immunity responses, while interaction of TAV with the plant RNAi machinery interferes with antiviral silencing.
Scanning electron microscopy of coal macerals
Energy Technology Data Exchange (ETDEWEB)
Davis, M.R.; White, A.; Deegan, M.D.
1986-02-01
Individual macerals separated from some United Kingdom coals of Carboniferous age and bituminous rank were examined by scanning electron microscopy. In each case a specific morphology characteristic of the macerals studied could be recognized. Collinite (a member of the vitrinite maceral group) was recognizable in all samples by its angular shape and characteristic fracture patterns, the particles (30-200 ..mu..m) frequently showing striated or laminated surface. Sporinite particles had no well defined shape and were associated with more detrital material than were the other macerals studied. This detritus was shown by conventional light microscopy to be the maceral micrinite. Fusinite was remarkable in having a chunky needle form, with lengths of up to 200 ..mu..m. 8 references.
International Nuclear Information System (INIS)
Chapman, C.P.
1986-01-01
Extracts of sporangiospores of Mucor racemosus contained RNA that readily hybridized with [ 3 H]polyuridylic acid. Prior to germination, this RNA was in a form sedimenting at 31 P-orthophosphate or L-[ 32 S]methionine, absorbance at 280 nm, or hybridization of [ 3 H]polyuridylic acid. mRNP's from the first two fractions were analyzed. A bimodal population of particles was detected in sedimentation velocity and sedimentation equilibrium centrifugation. Particles eluted at low ionic strength demonstrated a sedimentation coefficient distribution of 20S-to-80S. Particles eluted in formamide demonstrated a sedimentation coefficient distribution of 20S-to-60S. Particles eluted at low ionic strength displayed two peaks in CsCl centrifugation, with buoyant densities of 1.37 gm/cc and 1.59 gm/cc. Particles eluted in formamide displayed a single peak with a buoyant density of 1.61 gm/cc. Particles eluted at low ionic strength and centrifuged in metrizamide solution formed two bands having buoyant densities of 1.15 gm/cc and 1.30 gm/cc; formamide-eluted particles banded only at the higher density. Mucor 40S ribosomal subunits banded at 1.56 gm/cc and 1.28 gm/cc in CsCl and metrizamide solution respectively
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W
2006-01-01
The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.
Lin, A; McNally, J; Wool, I G
1983-09-10
The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.
Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli
DEFF Research Database (Denmark)
Aagaard, C; Rosendahl, G; Dam, M
1991-01-01
The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
Gastrointestinal scanning agent
International Nuclear Information System (INIS)
Francis, M.D.
1980-01-01
An easily prepared radiolabeled gastrointestinal scanning agent is described. Technetium-99m has ideal characteristics for imaging the upper and lower GI tract and determining stomach emptying and intestinal transit time when used with an insoluble particulate material. For example, crystalline and amorphous calcium phosphate particles can be effectively labeled in a one-step process using sup(99m)TcO 4 and SnCl 2 . These labeled particles have insignificant mass and when administered orally pass through the GI tract unchanged, without affecting the handling and density of the intestinal contents. Visualization of the esophageal entry into the stomach, the greater and lesser curvatures of the stomach, ejection into the duodenum, and rates of passage through the upper and lower GI tract are obtained. The slurry of sup(99m)TC particulate can be given rectally by enema. Good images of the cecum and the ascending, transverse, and descending colon are obtained. Mucosal folds and the splenic and hepatic flexures are visualized. The resilience of the large intestine is also readily visualized by pneumocolonographic techniques. (author)
Directory of Open Access Journals (Sweden)
Haiwei Cheng
Full Text Available Single chain variable fragments (scFvs against citrinin (CIT were selected from a scFv library constructed from the splenocytes of non-immunized mice by an improved eukaryotic ribosome display technology in this study. Bovine serum albumin (BSA/ CIT-BSA and ovalbumin (OVA/ CIT-OVA were used as the antigens to select specific anti-CIT scFvs. Eukaryotic in situ RT-PCR method was used to recover the selected mRNA after every affinity selection. After six rounds of ribosome display, expression vector pTIG-TRX carrying specific scFv DNAs were constructed and transformed into Escherichia coli BL21 (DE3 for protein expression. Thirteen positive clones were selected out of which three (designated 23, 68 and 109 showed high binding activity and specificity to CIT by indirect ELISA, while no clone showed binding activity with carrier proteins. The three scFvs showed high specificity to CIT and the cross reactivity with other mycotoxins was below 0.01% as determined by indirect competitive ELISA. These specific scFvs offer a potential novel immunoassay method for CIT residues. This study confirmed the effectiveness of the improved eukaryotic ribosome display system and could be used as a reference for the selection of scFvs specific to other small molecules using ribosome display.
Scanning of irradiated silicon detectors using $\\alpha$ particles and low energy protons
Casse, G L; Glaser, M; Kohout, Z; Konícek, J; Lemeilleur, F; Leroy, C; Linhart, V; Mares, J J; Pospísil, S; Roy, P; Sopko, B; Sinor, M; Svejda, J; Vorobel, V; Wilhelm, I
1999-01-01
In a spectroscopic study of non-irradiated and proton-irradiated silicon diodes, the detectors were illuminated from the front side and from the rear side by various alpha particle sources (mainly ThC') and by monoenergetic protons with energies from 1.0 to 2.5~MeV. Their response characteristics have been studied as a function of the incoming particle energy and the applied bias voltage. The charge collection efficiency was determined as a function of fluence
Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies
Directory of Open Access Journals (Sweden)
Kirsten Kehrein
2015-02-01
Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.
International Nuclear Information System (INIS)
Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.
2010-01-01
Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.
Zhu, X Q; Gasser, R B
1998-06-01
In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.
Energy Technology Data Exchange (ETDEWEB)
Barba de la Rosa, A.P.; Paredes-Lopez, O.; Carabez-Trejo, A.; Ordorica-Falomir, C. (Instituto Politecnico Nacional, Irapuato (Mexico). Centro de Investigacion y de Estudios Avanzados)
1989-11-01
High-protein amaranth flour (HPAF) and carbohydrate rich fraction (CRF) were produced from raw flour in a single-step process using a heat-stable alpha-amylase preparation. Protein content of flour increased from 15 to about 30 or 39% at liquefaction temperatures of 70 or 90{sup 0}C, respectively and 30 min hydrolysis time. CRF exhibited 14-22 DE. Enzymatic action at 70{sup 0}C increased endotherm temperature and gelatinization enthalpy of HPAF, in relation to gelatinized flour, as assessed by differential scanning calorimetry (DSC). Hydrolysis at 90{sup 0}C did not affect significantly (P > 0.05) DSC peak temperature. It is suggested that these changes in DSC performance might result from differences in amount and type of low-molecular weight carbohydrates and residual starch. Scanning electron microscopy (SEM) demonstrated that hydrolysis temperature changed substantially the structural appearance of flour particles. HPAF and CRF might find applications as dry milk extender and sweetener, respectively. (orig.).
Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques
2018-04-06
The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.
Structural model of the 50S subunit of E.Coli ribosomes from solution scattering
Energy Technology Data Exchange (ETDEWEB)
Svergun, D.I.; Koch, M.H.J. [Hamburg Outstation (Germany); Pedersen, J.S. [Riso National Laboratory, Roskilde (Denmark); Serdyuk, I.N. [Inst. of Protein Research, Moscow (Russian Federation)
1994-12-31
The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA.
Structural model of the 50S subunit of E.Coli ribosomes from solution scattering
International Nuclear Information System (INIS)
Svergun, D.I.; Koch, M.H.J.; Pedersen, J.S.; Serdyuk, I.N.
1994-01-01
The application of new methods of small-angle scattering data interpretation to a contrast variation study of the 50S ribosomal subunit of Escherichia coli in solution is described. The X-ray data from contrast variation with sucrose are analyzed in terms of the basic scattering curves from the volume inaccessible to sucrose and from the regions inside this volume occupied mainly by RNA and by proteins. From these curves models of the shape of the 50S and its RNA-rich core are evaluated and positioned so that their difference produces a scattering curve which is in good agreement with the scattering from the protein moiety. Basing on this preliminary model, the X-ray and neutron contrast variation data of the 50S subunit in aqueous solutions are interpreted in the frame of the advanced two-phase model described by the shapes of the 50S subunit and its RNA-rich core taking into account density fluctuations inside the RNA and the protein moiety. The shape of the envelope of the 50S subunit and of the RNA-rich core are evaluated with a resolution of about 40A. The shape of the envelope is in good agreement with the models of the 50S subunit obtained from electron microscopy on isolated particles. The shape of the RNA-rich core correlates well with the model of the entire particle determined by the image reconstruction from ordered sheets indicating that the latter model which is based on the subjective contouring of density maps is heavily biased towards the RNA
Directory of Open Access Journals (Sweden)
Andrea Ciammaruconi
2008-01-01
Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.
Measuring Mass-Based Hygroscopicity of Atmospheric Particles through in situ Imaging
Energy Technology Data Exchange (ETDEWEB)
Piens, Dominique` Y.; Kelly, Stephen T.; Harder, Tristan; Petters, Markus D.; O' Brien, Rachel; Wang, Bingbing; Teske, Ken; Dowell, Pat; Laskin, Alexander; Gilles, Mary K.
2016-04-18
Quantifying how atmospheric particles interact with water vapor is critical for understanding the effects of aerosols on climate. We present a novel method to measure the mass-based hygroscopicity of particles while characterizing their elemental and carbon functional group compositions. Since mass-based hygroscopicity is insensitive to particle geometry, it is advantageous for probing the hygroscopic behavior of atmospheric particles, which can have irregular morphologies. Combining scanning electron microscopy with energy dispersive X-ray analysis (SEM/EDX), scanning transmission X-ray microscopy (STXM) analysis, and in situ STXM humidification experiments, this method was validated using laboratory-generated, atmospherically relevant particles. Then, the hygroscopicity and elemental composition of 15 complex atmospheric particles were analyzed by leveraging quantification of C, N, and O from STXM, and complementary elemental quantification from SEM/EDX. We found three types of hygroscopic responses, and correlated high hygroscopicity with Na and Cl content. The mixing state determined for 158 particles broadly agreed with those of the humidified particles, indicating the potential to infer the atmospheric hygroscopic behavior from a selected subset of particles. These methods offer unique quantitative capabilities to characterize and correlate the hygroscopicity and chemistry of individual submicron atmospheric particles.
Structural basis for substrate placement by an archaeal box C/D ribonucleoprotein particle.
Xue, Song; Wang, Ruiying; Yang, Fangping; Terns, Rebecca M; Terns, Michael P; Zhang, Xinxin; Maxwell, E Stuart; Li, Hong
2010-09-24
Box C/D small nucleolar and Cajal body ribonucleoprotein particles (sno/scaRNPs) direct site-specific 2'-O-methylation of ribosomal and spliceosomal RNAs and are critical for gene expression. Here we report crystal structures of an archaeal box C/D RNP containing three core proteins (fibrillarin, Nop56/58, and L7Ae) and a half-mer box C/D guide RNA paired with a substrate RNA. The structure reveals a guide-substrate RNA duplex orientation imposed by a composite protein surface and the conserved GAEK motif of Nop56/58. Molecular modeling supports a dual C/D RNP structure that closely mimics that recently visualized by electron microscopy. The substrate-bound dual RNP model predicts an asymmetric protein distribution between the RNP that binds and methylates the substrate RNA. The predicted asymmetric nature of the holoenzyme is consistent with previous biochemical data on RNP assembly and provides a simple solution for accommodating base-pairing between the C/D guide RNA and large ribosomal and spliceosomal substrate RNAs. Copyright © 2010 Elsevier Inc. All rights reserved.
Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.
Directory of Open Access Journals (Sweden)
Tetsuro Kawano
Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.
Monte Carlo investigation of the low-dose envelope from scanned proton pencil beams
International Nuclear Information System (INIS)
Sawakuchi, Gabriel O; Titt, Uwe; Mirkovic, Dragan; Ciangaru, George; Zhu, X Ronald; Sahoo, Narayan; Gillin, Michael T; Mohan, Radhe
2010-01-01
Scanned proton pencil beams carry a low-dose envelope that extends several centimeters from the individual beam's central axis. Thus, the total delivered dose depends on the size of the target volume and the corresponding number and intensity of beams necessary to cover the target volume uniformly. This dependence must be considered in dose calculation algorithms used by treatment planning systems. In this work, we investigated the sources of particles contributing to the low-dose envelope using the Monte Carlo technique. We used a validated model of our institution's scanning beam line to determine the contributions to the low-dose envelope from secondary particles created in a water phantom and particles scattered in beam line components. Our results suggested that, for high-energy beams, secondary particles produced by nuclear interactions in the water phantom are the major contributors to the low-dose envelope. For low-energy beams, the low-dose envelope is dominated by particles undergoing multiple Coulomb scattering in the beam line components and water phantom. Clearly, in the latter situation, the low-dose envelope depends directly on beam line design features. Finally, we investigated the dosimetric consequences of the low-dose envelope. Our results showed that if not modeled properly the low-dose envelope may cause clinically relevant dose disturbance in the target volume. This work suggested that this low-dose envelope is beam line specific for low-energy beams, should be thoroughly experimentally characterized and validated during commissioning of the treatment planning system, and therefore is of great concern for accurate delivery of proton scanning beam doses.
Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V
2016-09-06
Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas
2017-12-15
Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Synthesis and characterization of mesoporous silica core-shell particles
Directory of Open Access Journals (Sweden)
Milan Nikolić
2010-06-01
Full Text Available Core-shell particles were formed by deposition of primary silica particles synthesized from sodium silicate solution on functionalized silica core particles (having size of ~0.5 µm prepared by hydrolysis and condensation of tetraethylortosilicate. The obtained mesoporous shell has thickness of about 60 nm and consists of primary silica particles with average size of ~21 nm. Scanning electron microscopy and zeta potential measurements showed that continuous silica shell exists around functionalized core particles which was additionally proved by FTIR and TEM results.
Ionasescu, V; Zellweger, H; Burmeister, L
1976-11-01
The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.
Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer
DEFF Research Database (Denmark)
Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck
2009-01-01
Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...
Directory of Open Access Journals (Sweden)
Jennifer L Houmani
Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.
Polkinghorne, Adam; Vaughan, Lloyd
2011-01-01
The stringent stress response is vital for bacterial survival under adverse environmental conditions. Obligate intracellular Chlamydia lack key stringent response proteins, but nevertheless can interrupt the cell cycle and enter stasis or persistence upon amino acid starvation. A possible key protein retained is YhbZ, a homologue of the ObgE guanosine triphosphatase (GTPase) superfamily connecting the stringent stress response to ribosome maturation. Curiously, chlamydial YhbZ lacks the ObgE C-terminal domain thought to be essential for binding the large ribosomal subunit. We expressed recombinant Chlamydia abortus YhbZ and showed it to be a functional GTPase, with similar activity to other Obg GTPase family members. As Chlamydia are resistant to genetic manipulation, we performed heterologous expression and gradient centrifugation experiments in Escherichia coli and found that, despite the missing C-terminal domain, C. abortus YhbZ co-fractionates with the E. coli 50S large ribosomal subunit. In addition, overexpression of chlamydial YhbZ in E. coli leads to growth defects and elongation, as reported for other Obg members. YhbZ did not complement an E. coli obgE temperature-sensitive mutant, indicating the C-terminal acidic domain may have an additional role. This data supports a role for YhbZ linking the chlamydial stress response to ribosome function and cellular growth. Copyright © 2010 Elsevier Ltd. All rights reserved.
RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription
International Nuclear Information System (INIS)
Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia
2016-01-01
The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Milbury Coren A
2010-09-01
Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
International Nuclear Information System (INIS)
Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan
2013-01-01
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit
Llanos, Susana; Serrano, Manuel
2010-10-01
Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.
Lin, Yuan; Li, Yan; Zhu, Ningyu; Han, Yanxing; Jiang, Wei; Wang, Yanchang; Si, Shuyi; Jiang, Jiandong
2014-01-01
Capreomycin is a second-line drug for multiple-drug-resistant tuberculosis (TB). However, with increased use in clinics, the therapeutic efficiency of capreomycin is decreasing. To better understand TB resistance to capreomycin, we have done research to identify the molecular target of capreomycin. Mycobacterium tuberculosis ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors during translation. Hence, the L12-L10 interaction is considered to be essential for ribosomal function and protein synthesis. Here we provide evidence showing that capreomycin inhibits the L12-L10 interaction by using an established L12-L10 interaction assay. Overexpression of L12 and/or L10 in M. smegmatis, a species close to M. tuberculosis, increases the MIC of capreomycin. Moreover, both elongation factor G-dependent GTPase activity and ribosome-mediated protein synthesis are inhibited by capreomycin. When protein synthesis was blocked with thiostrepton, however, the bactericidal activity of capreomycin was restrained. All of these results suggest that capreomycin seems to inhibit TB by interrupting the L12-L10 interaction. This finding might provide novel clues for anti-TB drug discovery.
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence
Directory of Open Access Journals (Sweden)
Ysabel Montoya
2000-08-01
Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.
mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Stevens, A.
1980-01-01
By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed
Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco
2014-12-18
Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alhosna Benjdia
2017-11-01
Full Text Available Ribosomally-synthesized and post-translationally modified peptides (RiPPs are a large and diverse family of natural products. They possess interesting biological properties such as antibiotic or anticancer activities, making them attractive for therapeutic applications. In contrast to polyketides and non-ribosomal peptides, RiPPs derive from ribosomal peptides and are post-translationally modified by diverse enzyme families. Among them, the emerging superfamily of radical SAM enzymes has been shown to play a major role. These enzymes catalyze the formation of a wide range of post-translational modifications some of them having no counterparts in living systems or synthetic chemistry. The investigation of radical SAM enzymes has not only illuminated unprecedented strategies used by living systems to tailor peptides into complex natural products but has also allowed to uncover novel RiPP families. In this review, we summarize the current knowledge on radical SAM enzymes catalyzing RiPP post-translational modifications and discuss their mechanisms and growing importance notably in the context of the human microbiota.
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
Forensic Scanning Electron Microscope
Keeley, R. H.
1983-03-01
The scanning electron microscope equipped with an x-ray spectrometer is a versatile instrument which has many uses in the investigation of crime and preparation of scientific evidence for the courts. Major applications include microscopy and analysis of very small fragments of paint, glass and other materials which may link an individual with a scene of crime, identification of firearms residues and examination of questioned documents. Although simultaneous observation and chemical analysis of the sample is the most important feature of the instrument, other modes of operation such as cathodoluminescence spectrometry, backscattered electron imaging and direct x-ray excitation are also exploited. Marks on two bullets or cartridge cases can be compared directly by sequential scanning with a single beam or electronic linkage of two instruments. Particles of primer residue deposited on the skin and clothing when a gun is fired can be collected on adhesive tape and identified by their morphology and elemental composition. It is also possible to differentiate between the primer residues of different types of ammunition. Bullets may be identified from the small fragments left behind as they pass through the body tissues. In the examination of questioned documents the scanning electron microscope is used to establish the order in which two intersecting ink lines were written and to detect traces of chemical markers added to the security inks on official documents.
Bodzewski, Kentaro Y.; Caylor, Ryan L.; Comstock, Ashley M.; Hadley, Austin T.; Imholt, Felisha M.; Kirwan, Kory D.; Oyama, Kira S.; Wise, Matthew E.
2016-01-01
A differential scanning calorimeter was used to study homogeneous nucleation of ice from micron-sized aqueous ammonium sulfate aerosol particles. It is important to understand the conditions at which these particles nucleate ice because of their connection to cirrus cloud formation. Additionally, the concept of freezing point depression, a topic…
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-09-27
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.
Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo
2016-01-01
Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515
Energy Technology Data Exchange (ETDEWEB)
William R. Wiley Environmental Sciences Laboratory, Pacific Northwest National Laboratory; Gilles, Mary K; Hopkins, Rebecca J.; Desyaterik, Yury; Tivanski, Alexei V.; Zaveri, Rahul A.; Berkowitz, Carl M.; Tyliszczak, Tolek; Gilles, Mary K.; Laskin, Alexander
2008-03-12
Detailed chemical speciation of the dry residue particles from individual cloud droplets and interstitial aerosol collected during the Marine Stratus Experiment (MASE) was performed using a combination of complementary microanalysis techniques. Techniques include computer controlled scanning electron microscopy with energy dispersed analysis of X-rays (CCSEM/EDX), time-of-flight secondary ionization mass spectrometry (TOF-SIMS), and scanning transmission X-ray microscopy with near edge X-ray absorption fine structure spectroscopy (STXM/NEXAFS). Samples were collected at the ground site located in Point Reyes National Seashore, approximately 1 km from the coast. This manuscript focuses on the analysis of individual particles sampled from air masses that originated over the open ocean and then passed through the area of the California current located along the northern California coast. Based on composition, morphology, and chemical bonding information, two externally mixed, distinct classes of sulfur containing particles were identified: chemically modified (aged) sea salt particles and secondary formed sulfate particles. The results indicate substantial heterogeneous replacement of chloride by methanesulfonate (CH3SO3-) and non-sea salt sulfate (nss-SO42-) in sea-salt particles with characteristic ratios of nss-S/Na>0.10 and CH3SO3-/nss-SO42->0.6.
A New Ka-Band Scanning Radar Facility: Polarimetric and Doppler Spectra Measurements of Snow Events
Oue, M.; Kollias, P.; Luke, E. P.; Mead, J.
2017-12-01
Polarimetric radar analyses offer the capability of identification of ice hydrometeor species as well as their spatial distributions. In addition to polarimetric parameter observations, Doppler spectra measurements offer unique insights into ice particle properties according to particle fall velocities. In particular, millimeter-wavelength radar Doppler spectra can reveal supercooled liquid cloud droplets embedded in ice precipitation clouds. A Ka-band scanning polarimetric radar, named KASPR, was installed in an observation facility at Stony Brook University, located 22 km west of the KOKX NEXRAD radar at Upton, NY. The KASPR can measure Doppler spectra and full polarimetric variables, including radar reflectivity, differential reflectivity (ZDR), differential phase (φDP), specific differential phase (KDP), correlation coefficient (ρhv), and linear depolarization ratio (LDR). The facility also includes a micro-rain radar and a microwave radiometer capable of measuring reflectivity profiles and integrated liquid water path, respectively. The instruments collected initial datasets during two snowstorm events and two snow shower events in March 2017. The radar scan strategy was a combination of PPI scans at 4 elevation angles (10, 20, 45, and 60°) and RHI scans in polarimetry mode, and zenith pointing with Doppler spectra collection. During the snowstorm events the radar observed relatively larger ZDR (1-1.5 dB) and enhanced KDP (1-2 ° km-1) at heights corresponding to a plate/dendrite crystal growth regime. The Doppler spectra showed that slower-falling particles ( 1 m s-1). The weakly increased ZDR could be produced by large, faster falling particles such as quasi-spherical aggregates, while the enhanced KDP could be produced by highly-oriented oblate, slowly-falling particles. Below 2 km altitude, measurements of dual wavelength ratio (DWR) based on Ka and S-band reflectivities from the KASPR and NEXRAD radars were available. Larger DWR (>10 dB) suggested
Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction
DEFF Research Database (Denmark)
Recht, M I; Douthwaite, S; Dahlquist, K D
1999-01-01
antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...
Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.
Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V
2007-04-01
During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.
Jaag, Hannah Miriam; Kawchuk, Lawrence; Rohde, Wolfgang; Fischer, Rainer; Emans, Neil; Prüfer, Dirk
2003-01-01
Potato leafroll polerovirus (PLRV) genomic RNA acts as a polycistronic mRNA for the production of proteins P0, P1, and P2 translated from the 5′-proximal half of the genome. Within the P1 coding region we identified a 5-kDa replication-associated protein 1 (Rap1) essential for viral multiplication. An internal ribosome entry site (IRES) with unusual structure and location was identified that regulates Rap1 translation. Core structural elements for internal ribosome entry include a conserved AUG codon and a downstream GGAGAGAGAGG motif with inverted symmetry. Reporter gene expression in potato protoplasts confirmed the internal ribosome entry function. Unlike known IRES motifs, the PLRV IRES is located completely within the coding region of Rap1 at the center of the PLRV genome. PMID:12835413
DEFF Research Database (Denmark)
Issinger, O G; Beier, H
1978-01-01
Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....
On the time-averaging of ultrafine particle number size spectra in vehicular plumes
Directory of Open Access Journals (Sweden)
X. H. Yao
2006-01-01
Full Text Available Ultrafine vehicular particle (<100 nm number size distributions presented in the literature are mostly averages of long scan-time (~30 s or more spectra mainly due to the non-availability of commercial instruments that can measure particle distributions in the <10 nm to 100 nm range faster than 30 s even though individual researchers have built faster (1–2.5 s scanning instruments. With the introduction of the Engine Exhaust Particle Sizer (EEPS in 2004, high time-resolution (1 full 32-channel spectrum per second particle size distribution data become possible and allow atmospheric researchers to study the characteristics of ultrafine vehicular particles in rapidly and perhaps randomly varying high concentration environments such as roadside, on-road and tunnel. In this study, particle size distributions in these environments were found to vary as rapidly as one second frequently. This poses the question on the generality of using averages of long scan-time spectra for dynamic and/or mechanistic studies in rapidly and perhaps randomly varying high concentration environments. One-second EEPS data taken at roadside, on roads and in tunnels by a mobile platform are time-averaged to yield 5, 10, 30 and 120 s distributions to answer this question.
Preparation and Characterization of Pyrotechnics Binder-Coated Nano-Aluminum Composite Particles
Ye, Mingquan; Zhang, Shuting; Liu, Songsong; Han, Aijun; Chen, Xin
2017-07-01
The aim of this article is to protect the activity of nano-aluminum (Al) particles in solid rocket propellants and pyrotechnics. The morphology, structure, active aluminum content, and thermal and catalytic properties of the coated samples were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR), thermogravimetry-differential scanning calorimetry (TG-DSC), and oxidation-reduction titration methods. The results indicated that nano-Al particles could be effectively coated with phenolic resin (PF), fluororubber (Viton B), and shellac through a solvent/nonsolvent method. The energetic composite particles have core-shell structures and the thickness of the coating film is about 5-15 nm. Analysis of the active Al content revealed that Viton B coating had a much better protective effect. The TG-DSC results showed that the energy amount and energy release rate of PF-, Viton B-, and shellac-coated Al particles were larger than those of the raw nano-Al particles. The catalytic effects of coated Al particles on the thermal decomposition of ammonium perchlorate (AP) were better than those of raw nano-Al particles, and the effect of shellac-coated Al particles was significantly better than that of Viton B-coated Al particles.
Czech Academy of Sciences Publication Activity Database
Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.
2017-01-01
Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Avila, Humar A.; Reboredo, Maria M.; Castro, Miriam; Parra, Rodrigo, E-mail: havila@fi.mdp.edu.ar [Instituto de Investigaciones en Ciencia y Tecnologia de Materiales - INTEMA, Consejo Nacional de Investigaciones Cientificas y Tecnicas - CONICET, Universidad Nacional de Mar del Plata - UNMdP, Mar del Plata (Argentina)
2013-11-01
Barium titanate particles (100-300 nm) synthesized by hydrothermal method were dispersed in both polyvinyl alcohol (PVA) and ethylcellulose (EC) solutions. These suspensions were processed by electrospinning. When no particles were added, homogeneous polymeric nanofibers were obtained. Under certain conditions, polymeric suspensions of barium titanate particles were electrospun generating polymeric fibers with BT particles. The effect of a surfactant was also assessed over the formation of nanofibers. The BaTiO{sub 3} particles synthesized by hydrothermal method were characterized by X-Ray diffraction (XRD), field emission-scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM) and Raman spectroscopy. Fibers were characterized by scanning electron microscopy (SEM). (author)
Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae
Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.
2016-01-01
Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Energy Technology Data Exchange (ETDEWEB)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)
2011-07-15
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.
International Nuclear Information System (INIS)
Guo Zhanhu; Park, Sung; Wei Suying; Pereira, Tony; Moldovan, Monica; Karki, Amar B; Young, David P; Hahn, H Thomas
2007-01-01
Flexible high-loading nanoparticle-reinforced polyurethane magnetic nanocomposites fabricated by the surface-initiated polymerization (SIP) method are reported. Extensive field emission scanning electron microscopic (SEM) and atomic force microscopic (AFM) observations revealed a uniform particle distribution within the polymer matrix. X-ray photoelectron spectrometry (XPS) and differential thermal analysis (DTA) revealed a strong chemical bonding between the nanoparticles and the polymer matrix. The elongation of the SIP nanocomposite under tensile test was about four times greater than that of the composite fabricated by a conventional direct mixing fabrication method. The nanocomposite shows particle-loading-dependent magnetic properties, with an increase of coercive force after the magnetic nanoparticles were embedded into the polymer matrix, arising from the increased interparticle distance and the introduced polymer-particle interactions
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Lin, Na; Jia, Zhe; Wang, Zhihui; Zhao, Hui; Ai, Guo; Song, Xiangyun; Bai, Ying; Battaglia, Vincent; Sun, Chengdong; Qiao, Juan; Wu, Kai; Liu, Gao
2017-10-01
The structure degradation of commercial Lithium-ion battery (LIB) graphite anodes with different cycling numbers and charge rates was investigated by focused ion beam (FIB) and scanning electron microscopy (SEM). The cross-section image of graphite anode by FIB milling shows that cracks, resulted in the volume expansion of graphite electrode during long-term cycling, were formed in parallel with the current collector. The crack occurs in the bulk of graphite particles near the lithium insertion surface, which might derive from the stress induced during lithiation and de-lithiation cycles. Subsequently, crack takes place along grain boundaries of the polycrystalline graphite, but only in the direction parallel with the current collector. Furthermore, fast charge graphite electrodes are more prone to form cracks since the tensile strength of graphite is more likely to be surpassed at higher charge rates. Therefore, for LIBs long-term or high charge rate applications, the tensile strength of graphite anode should be taken into account.
Energy Technology Data Exchange (ETDEWEB)
Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)
2013-11-15
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.
Bharill, Shashank; Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskiran; Smilansky, Zeev; Mandecki, Wlodek; Gryczynski, Ignacy; Gryczynski, Zygmunt; Cooperman, Barry S; Goldman, Yale E
2011-01-25
Metal-enhanced fluorescence (MEF) increased total photon emission of Cy3- and Cy5-labeled ribosomal initiation complexes near 50 nm silver particles 4- and 5.5-fold, respectively. Fluorescence intensity fluctuations above shot noise, at 0.1-5 Hz, were greater on silver particles. Overall signal-to-noise ratio was similar or slightly improved near the particles. Proximity to silver particles did not compromise ribosome function, as measured by codon-dependent binding of fluorescent tRNA, dynamics of fluorescence resonance energy transfer between adjacent tRNAs in the ribosome, and tRNA translocation induced by elongation factor G.
Bharill, Shashank; Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskiran; Smilansky, Zeev; Mandecki, Wlodek; Gryczynski, Ignacy; Gryczynski, Zygmunt; Cooperman, Barry S.; Goldman, Yale E.
2011-01-01
Metal enhanced fluorescence (MEF) increased total photon emission of Cy3- and Cy5-labeled ribosomal initiation complexes near 50 nm silver particles 4- and 5.5-fold respectively. Fluorescence intensity fluctuations above shot noise, at 0.1 – 5 Hz, were greater on silver particles. Overall signal to noise ratio was similar or slightly improved near the particles. Proximity to silver particles did not compromise ribosome function, as measured by codon-dependent binding of fluorescent tRNA, dynamics of fluorescence resonance energy transfer between adjacent tRNAs in the ribosome, and tRNA translocation induced by elongation factor G. PMID:21158483
International Nuclear Information System (INIS)
Heidenreich, K.A.; Toledo, S.P.
1989-01-01
As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons
Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun
2017-11-21
A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.
Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong
2016-09-01
Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.
International Nuclear Information System (INIS)
Goto, Akihiko; Kametaka, Masao
1975-01-01
A group of rats weighing about 120 g were killed at the beginning of the experiment and after 10 days on the 20% casein diet (C-0 and C-10 groups), and another group of rats were killed after 1,2 and 10 days on the protein-free diet (PF-1, PF-2 and PF-10 groups). From muscle and the liver of each group ribosomes were prepared, and the protein synthesis activity and the polysome patterns were investigated. The activity of polysome fractionated into each size was also measured. Muscle ribosome activity in PF-1, PF-2 and PF-10 groups decreased to about 60%, 40% and 40% of that in C groups, respectively, and this decrease was due to a fall in activity of prolysome itself rather than disaggregation of polysome. Liver ribosome activity in PF-1, PF-2 and PF-10 groups were reduced to about 95%, 90% and 65% of that in C groups, respectively. These alterations in PF-1 and PF-2 groups seemed to be in part related to changes in polysome pattern, whereas ribosome activity in PF-10 group was reduced without changes in polysome pattern. (auth.)
DEFF Research Database (Denmark)
Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios
2017-01-01
The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....
Directory of Open Access Journals (Sweden)
Mingsheng Yang
2015-03-01
Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.
Energy Technology Data Exchange (ETDEWEB)
Wu, Ying [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); College of Food and Bioengineering, Henan University of Science and Technology, Luoyang 471023, Henan (China); Mao, Yingji [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China); Jin, Shan; Hou, Jinyan; Du, Hua [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Yang, Minglei, E-mail: yml888@mail.ustc.edu.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); Wu, Lifang, E-mail: lfwu@ipp.ac.cn [Key Laboratory of Ion Beam Bioengineering and Bioenergy Forest Research Center of State Forestry Administration, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei 230031, Anhui (China); School of Life Sciences, University of Science and Technology of China, Hefei 230027, Anhui (China)
2015-08-07
Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.
International Nuclear Information System (INIS)
Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang
2015-01-01
Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted
Aging fingerprints in combustion particles
Zelenay, V.; Mooser, R.; Tritscher, T.; Křepelová, A.; Heringa, M. F.; Chirico, R.; Prévôt, A. S. H.; Weingartner, E.; Baltensperger, U.; Dommen, J.; Watts, B.; Raabe, J.; Huthwelker, T.; Ammann, M.
2011-05-01
Soot particles can significantly influence the Earth's climate by absorbing and scattering solar radiation as well as by acting as cloud condensation nuclei. However, despite their environmental (as well as economic and political) importance, the way these properties are affected by atmospheric processing is still a subject of discussion. In this work, soot particles emitted from two different cars, a EURO 2 transporter, a EURO 3 passenger vehicle, and a wood stove were investigated on a single-particle basis. The emitted exhaust, including the particulate and the gas phase, was processed in a smog chamber with artificial solar radiation. Single particle specimens of both unprocessed and aged soot were characterized using x-ray absorption spectroscopy and scanning electron microscopy. Comparison of the spectra from the unprocessed and aged soot particles revealed changes in the carbon functional group content, such as that of carboxylic carbon, which can be ascribed to both the condensation of secondary organic compounds on the soot particles and oxidation of primary soot particles upon photochemical aging. Changes in the morphology and size of the single soot particles were also observed upon aging. Furthermore, we show that the soot particles take up water in humid environments and that their water uptake capacity increases with photochemical aging.
International Nuclear Information System (INIS)
Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj
2008-01-01
The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1
Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.
Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P
2010-08-01
Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.
Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering
International Nuclear Information System (INIS)
Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.
1981-01-01
The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)
International Nuclear Information System (INIS)
Buck, M.; Cooperman, B.S.
1990-01-01
In previous work the authors showed that on photolysis of Escherichia coli ribosomes in the presence of [ 3 H]tetracycline (TC) the major protein labeled is S7, and they presented strong evidence that such labeling takes place from a high-affinity site related to the inhibitory action of TC. In this work they use single protein omission reconstitution (SPORE) experiments to identify those proteins that are important for high-affinity TC binding to the 30S subunit, as measured by both cosedimentation and filter binding assays. With respect to both sedimentation coefficients and relative Phe-tRNA Phe binding, the properties of the SPORE particles they obtain parallel very closely those measured earlier, with the exception of the SPORE particle lacking S13. A total of five proteins, S3, S7, S8, S14, and S19, are shown to be important for TC binding, with the largest effects seen on omission of proteins S7 and S14. Determination of the protein compositions of the corresponding SPORE particles demonstrates that the observed effects are, for the most part, directly attributable to the omission of the given protein rather than reflecting an indirect effect of omitting one protein on the uptake of another. A large body of evidence supports the notion that four of these proteins, S3, S7, S14, and S19, are included, along with 16S rRNA bases 920-1,396, in one of the major domains of the 30S subunit. The results support the conclusion that the structure of this domain is important for the binding of TC and that, within this domain, TC binds directly to S7
YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis
Czech Academy of Sciences Publication Activity Database
Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří
2007-01-01
Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007
WE-FG-BRB-02: Spatial Mapping of the RBE of Scanned Particle Beams
Energy Technology Data Exchange (ETDEWEB)
Grosshans, D. [The University of Texas MD Anderson Cancer Center (United States)
2016-06-15
The physical pattern of energy deposition and the enhanced relative biological effectiveness (RBE) of protons and carbon ions compared to photons offer unique and not fully understood or exploited opportunities to improve the efficacy of radiation therapy. Variations in RBE within a pristine or spread out Bragg peak and between particle types may be exploited to enhance cell killing in target regions without a corresponding increase in damage to normal tissue structures. In addition, the decreased sensitivity of hypoxic tumors to photon-based therapies may be partially overcome through the use of more densely ionizing radiations. These and other differences between particle and photon beams may be used to generate biologically optimized treatments that reduce normal tissue complications. In this symposium, speakers will examine the impact of the RBE of charged particles on measurable biological endpoints, treatment plan optimization, and the prediction or retrospective assessment of treatment outcomes. In particular, an AAPM task group was formed to critically examine the evidence for a spatially-variant RBE in proton therapy. Current knowledge of proton RBE variation with respect to dose, biological endpoint, and physics parameters will be reviewed. Further, the clinical relevance of these variations will be discussed. Recent work focused on improving simulations of radiation physics and biological response in proton and carbon ion therapy will also be presented. Finally, relevant biology research and areas of research needs will be highlighted, including the dependence of RBE on genetic factors including status of DNA repair pathways, the sensitivity of cancer stem-like cells to charged particles, the role of charged particles in hypoxic tumors, and the importance of fractionation effects. In addition to the physical advantages of protons and more massive ions over photons, the future application of biologically optimized treatment plans and their potential to
DEFF Research Database (Denmark)
Foged, Camilla; Brodin, Birger; Frøkjær, Sven
2005-01-01
Current vaccine development includes optimization of antigen delivery to antigen presenting cells, such as dendritic cells (DC). Particulate systems have attracted increasing attention in the development of vaccine delivery systems. In the present study, we investigated DC uptake of model...... fluorescent polystyrene particles with a broad size range and variable surface properties. Localization of particles was investigated using confocal laser scanning microscopy and uptake was quantified by flow cytometry. Immature DC were generated from mononuclear cells isolated from human blood...
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-01-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...
In silico modelling and analysis of ribosome kinetics and aa-tRNA competition
Bošnački, D.; Pronk, T.E.; de Vink, E.P.
2008-01-01
We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the
DEFF Research Database (Denmark)
Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E
2015-01-01
Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...
Relationship between organization and function of ribosomal genes in Drosophila melanogaster
International Nuclear Information System (INIS)
Karpen, G.H.
1987-01-01
In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional
Lung scan alterations in congenital heart disease
Energy Technology Data Exchange (ETDEWEB)
Dietrich, R; Sanchez, J; Munoz, A; Lanaro, A E; Pico, A M
1975-04-01
This report analyzes the patterns in 54 lung scannings of 34 patients with altered pulmonary blood flow due to congenital heart disease. The technique and the results are presented. According to the images obtained, the patients are classified in three groups: Group I--normal distribution with more concentration of particles over the right lung and the bases. Group II--normal scannings found in left to right shunts unless there is pulmonary venous hypertension in which case the apex-base relationship was inverted. Group III--patients with right to left shunts of different types presenting various patterns according to severity, associated anomalies and palliative surgery. The hemodynamics created by cardiac defects and surgical procedures explain these alterations. This method is recommended in view of its advantages and accurate results.
New superconducting cyclotron driven scanning proton therapy systems
International Nuclear Information System (INIS)
Klein, Hans-Udo; Baumgarten, Christian; Geisler, Andreas; Heese, Juergen; Hobl, Achim; Krischel, Detlef; Schillo, Michael; Schmidt, Stefan; Timmer, Jan
2005-01-01
Since one and a half decades ACCEL is investing in development and engineering of state of the art particle-therapy systems. A new medical superconducting 250 MeV proton cyclotron with special focus on the present and future beam requirements of fast scanning treatment systems has been designed. The first new ACCEL medical proton cyclotron is under commissioning at PSI for their PROSCAN proton therapy facility having undergone successful factory tests especially of the closed loop cryomagnetic system. The second cyclotron is part of ACCEL's integrated proton therapy system for Europe's first clinical center, RPTC in Munich. The cyclotron, the energy selection system, the beamline as well as the four gantries and patient positioners have been installed. The scanning system and major parts of the control software have already been tested. We will report on the concept of ACCEL's superconducting cyclotron driven scanning proton therapy systems and the current status of the commissioning work at PSI and RPTC
Zhao, Huayan
2015-08-13
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming
2015-01-01
The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.
The 2009 Nobel Prize in Chemistry: Thomas A. Steitz and the structure of the ribosome.
Zhao, Peter
2011-06-01
Over the past 200 years, there have been countless groundbreaking discoveries in biology and medicine at Yale University. However, one particularly noteworthy discovery with profoundly important and broad consequences happened here in just the past two decades. In 2009, Thomas Steitz, the Sterling Professor of Molecular Biophysics & Biochemistry, was awarded the Nobel Prize in Chemistry for "studies of the structure and function of the ribosome," along with Venkatraman Ramakrishnan of the MRC Laboratory of Molecular Biology and Ada E. Yonath of the Weizmann Institute of Science. This article covers the historical context of Steitz's important discovery, the techniques his laboratory used to study the ribosome, and the impact that this research has had, and will have, on the future of biological and medical research.
Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2016-06-27
Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Energy Technology Data Exchange (ETDEWEB)
Ekert, B; Giocanti, N [Institut du Radium, 91 - Orsay (France)
1977-04-01
Gamma irradiation of E.coli MRE 600 ribosomes in aqueous suspensions led to covalent linkages between the RNA and some ribosomal proteins. The presence of oxygen during the irradiation strongly inhibited this phenomenon. It appears clearly that only a few proteins were able to participate in these cross-linking reactions, which occurred simultaneously in the two sub-units. The radiochemical yield was determined at several concentrations and was relatively low.