WorldWideScience

Sample records for scaffold hopping combining

  1. Ligand scaffold hopping combining 3D maximal substructure search and molecular similarity

    Directory of Open Access Journals (Sweden)

    Petitjean Michel

    2009-08-01

    Full Text Available Abstract Background Virtual screening methods are now well established as effective to identify hit and lead candidates and are fully integrated in most drug discovery programs. Ligand-based approaches make use of physico-chemical, structural and energetics properties of known active compounds to search large chemical libraries for related and novel chemotypes. While 2D-similarity search tools are known to be fast and efficient, the use of 3D-similarity search methods can be very valuable to many research projects as integration of "3D knowledge" can facilitate the identification of not only related molecules but also of chemicals possessing distant scaffolds as compared to the query and therefore be more inclined to scaffolds hopping. To date, very few methods performing this task are easily available to the scientific community. Results We introduce a new approach (LigCSRre to the 3D ligand similarity search of drug candidates. It combines a 3D maximum common substructure search algorithm independent on atom order with a tunable description of atomic compatibilities to prune the search and increase its physico-chemical relevance. We show, on 47 experimentally validated active compounds across five protein targets having different specificities, that for single compound search, the approach is able to recover on average 52% of the co-actives in the top 1% of the ranked list which is better than gold standards of the field. Moreover, the combination of several runs on a single protein target using different query active compounds shows a remarkable improvement in enrichment. Such Results demonstrate LigCSRre as a valuable tool for ligand-based screening. Conclusion LigCSRre constitutes a new efficient and generic approach to the 3D similarity screening of small compounds, whose flexible design opens the door to many enhancements. The program is freely available to the academics for non-profit research at: http://bioserv.rpbs.univ-paris-diderot.fr/LigCSRre.html.

  2. Agrochemical lead optimization by scaffold hopping.

    Science.gov (United States)

    Lamberth, Clemens

    2018-02-01

    Scaffold hopping, the exchange of a specific portion of a potential active ingredient with another substructure with the aim of finding isofunctional molecular structures with significantly different molecular backbones, often offers the chance in lead discovery or optimization to mitigate problems related to toxicity, intellectual property, and insufficient potency or stability. Scaffold hopping tools such as isosteric ring replacement including 1,3 nitrogen shift and cyclic imine-amide isosterism, but also ring opening and ring closure approaches, functional group isosterism, reversion of functional groups, chain shortening, chain lengthening, and scaffolds delivered by natural products, have become a permanent fixture of the innovation and optimization process in crop protection research. Their appropriate use will be explained through examples of success stories in the field of agrochemistry. Analogies to, but also differences from, the main categories of scaffold hopping in medicinal drug discovery are discussed. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. Classification of Scaffold-Hopping Approaches

    Science.gov (United States)

    2011-11-01

    11 years of industrial experience, he switched to Biotechnology HPC Software Applica- tions Institute in Frederick, MD in 2010. He is cur- rently a... aspirin and ibuprofen [39]. Although COX-1 and COX-2 only share 60% sequence homology, the protein backbones, especially the ligand-binding sites...scaffolds with significant different chemotypes from the queries they were derived from [111,112]. Concluding remarks The pharmaceutical industry is facing

  4. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

    2007-01-01

    scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...... ligands of three different protein targets relevant for drug discovery using a rational approach based on statistical experimental design. Five out of eight and seven out of eight thrombin scaffolds and all seven HIV protease scaffolds were recovered within the top 10 and 31 out of 31 neuraminidase...

  5. SHOP: receptor-based scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Liljefors, Tommy; Sørensen, Morten D

    2009-01-01

    A new field-derived 3D method for receptor-based scaffold hopping, implemented in the software SHOP, is presented. Information from a protein-ligand complex is utilized to substitute a fragment of the ligand with another fragment from a database of synthetically accessible scaffolds. A GRID......-based interaction profile of the receptor and geometrical descriptions of a ligand scaffold are used to obtain new scaffolds with different structural features and are able to replace the original scaffold in the protein-ligand complex. An enrichment study was successfully performed verifying the ability of SHOP...... to find known active CDK2 scaffolds in a database. Additionally, SHOP was used for suggesting new inhibitors of p38 MAP kinase. Four p38 complexes were used to perform six scaffold searches. Several new scaffolds were suggested, and the resulting compounds were successfully docked into the query proteins....

  6. Improved Intelligent Underlay-Overlay Combined with Frequency Hopping in GSM

    DEFF Research Database (Denmark)

    Wigard, Jeroen; Nielsen, Thomas Toftegaard; Mogensen, Preben Elgaard

    1997-01-01

    IUO (intelligent underlay-overlay) in a combination with random frequency hopping in GSM is analysed. Several improvements to the original IUO concept analysed in Nielsen et al. (1997) are introduced. With the improved IUO concept it is possible to load a network configuration consisting of 4...

  7. Scaffold-hopping from xanthines to tricyclic guanines: A case study of dipeptidyl peptidase 4 (DPP4) inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Pissarnitski, Dmitri A.; Zhao, Zhiqiang; Cole, David; Wu, Wen-Lian; Domalski, Martin; Clader, John W.; Scapin, Giovanna; Voigt, Johannes; Soriano, Aileen; Kelly, Theresa; Powles, Mary Ann; Yao, Zuliang; Burnett, Duane A. (Merck)

    2016-11-01

    Molecular modeling of unbound tricyclic guanine scaffolds indicated that they can serve as effective bioisosteric replacements of xanthines. This notion was further confirmed by a combination of X-ray crystallography and SAR studies, indicating that tricyclic guanine DPP4 inhibitors mimic the binding mode of xanthine inhibitors, exemplified by linagliptin. Realization of the bioisosteric relationship between these scaffolds potentially will lead to a wider application of cyclic guanines as xanthine replacements in drug discovery programs for a variety of biological targets. Newly designed DPP4 inhibitors achieved sub-nanomolar potency range and demonstrated oral activity in vivo in mouse glucose tolerance test.

  8. Scaffold hopping, synthesis and structure-activity relationships of 5,6-diaryl-pyrazine-2-amide derivatives: a novel series of CB1 receptor antagonists.

    Science.gov (United States)

    Boström, Jonas; Berggren, Kristina; Elebring, Thomas; Greasley, Peter J; Wilstermann, Michael

    2007-06-15

    A scaffold hopping approach has been exploited to design a novel class of cannabinoid (CB1) receptor antagonists for the treatment of obesity. On the basis of shape-complementarity and synthetic feasibility the central fragment, a methylpyrazole, in Rimonabant was replaced by a pyrazine. The synthesis and CB1 antagonistic activities of a new series of 5,6-diaryl-pyrazine-2-amide derivatives are described. Several compounds showed antagonist potency below 10nM for the CB1 receptor.

  9. Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential NNRTIs.

    Science.gov (United States)

    Babkov, Denis A; Valuev-Elliston, Vladimir T; Paramonova, Maria P; Ozerov, Alexander A; Ivanov, Alexander V; Chizhov, Alexander O; Khandazhinskaya, Anastasia L; Kochetkov, Sergey N; Balzarini, Jan; Daelemans, Dirk; Pannecouque, Christophe; Seley-Radtke, Katherine L; Novikov, Mikhail S

    2015-03-01

    In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Hydroxytriazole derivatives as potent and selective aldo-keto reductase 1C3 (AKR1C3) inhibitors discovered by bioisosteric scaffold hopping approach.

    Science.gov (United States)

    Pippione, Agnese C; Giraudo, Alessandro; Bonanni, Davide; Carnovale, Irene M; Marini, Elisabetta; Cena, Clara; Costale, Annalisa; Zonari, Daniele; Pors, Klaus; Sadiq, Maria; Boschi, Donatella; Oliaro-Bosso, Simonetta; Lolli, Marco L

    2017-10-20

    The aldo-keto reductase 1C3 isoform (AKR1C3) plays a vital role in the biosynthesis of androgens, making this enzyme an attractive target for castration-resistant prostate cancer therapy. Although AKR1C3 is a promising drug target, no AKR1C3-targeted agent has to date been approved for clinical use. Flufenamic acid, a non-steroidal anti-inflammatory drug, is known to potently inhibit AKR1C3 in a non-selective manner as COX off-target effects are also observed. To diminish off-target effects, we have applied a scaffold hopping strategy replacing the benzoic acid moiety of flufenamic acid with an acidic hydroxyazolecarbonylic scaffold. In particular, differently N-substituted hydroxylated triazoles were designed to simultaneously interact with both subpockets 1 and 2 in the active site of AKR1C3, larger for AKR1C3 than other AKR1Cs isoforms. Through computational design and iterative rounds of synthesis and biological evaluation, novel compounds are reported, sharing high selectivity (up to 230-fold) for AKR1C3 over 1C2 isoform and minimal COX1 and COX2 off-target inhibition. A docking study of compound 8, the most interesting compound of the series, suggested that its methoxybenzyl substitution has the ability to fit inside subpocket 2, being involved in π-π staking interaction with Trp227 (partial overlapping) and in a T-shape π-π staking with Trp86. This compound was also shown to diminish testosterone production in the AKR1C3-expressing 22RV1 prostate cancer cell line while synergistic effect was observed when 8 was administered in combination with abiraterone or enzalutamide. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Identification of Leishmania donovani Topoisomerase 1 inhibitors via intuitive scaffold hopping and bioisosteric modification of known Top 1 inhibitors

    Science.gov (United States)

    Mamidala, Rajinikanth; Majumdar, Papiya; Jha, Kunal Kumar; Bathula, Chandramohan; Agarwal, Rahul; Chary, M. Thirumala; Mazumdar, H. K.; Munshi, Parthapratim; Sen, Subhabrata

    2016-05-01

    A library of arylidenefuropyridinediones was discovered as potent inhibitors of Leishmania donovani Topoisomerase 1 (LdTop1) where the active molecules displayed considerable inhibition with single digit micromolar EC50 values. This molecular library was designed via intuitive scaffold hopping and bioisosteric modification of known topoisomerase 1 inhibitors such as camptothecin, edotecarin and etc. The design was rationalized by molecular docking analysis of the compound prototype with human topoisomerase 1 (HTop1) and Leishmania donovani topoisomerase 1(LdTop1). The most active compound 4 displayed no cytotoxicity against normal mammalian COS7 cell line (~100 fold less inhibition at the EC50). Similar to camptothecin, 4 interacted with free LdTop1 as observed in the preincubation DNA relaxation inhibition experiment. It also displayed anti-protozoal activity against Leishmania donovani promastigote. Crystal structure investigation of 4 and its molecular modelling with LdTop1 revealed putative binding sites in the enzyme that could be harnessed to generate molecules with better potency.

  12. Combined Technologies for Microfabricating Elastomeric Cardiac Tissue Engineering Scaffolds

    Science.gov (United States)

    Guillemette, Maxime D.; Park, Hyoungshin; Hsiao, James C.; Jain, Saloni R.; Larson, Benjamin L.; Langer, Robert; Freed, Lisa E.

    2012-01-01

    Polymer scaffolds that direct elongation and orientation of cultured cells can enable tissue engineered muscle to act as a mechanically functional unit. We combined micromolding and microablation technologies to create muscle tissue engineering scaffolds from the biodegradable elastomer poly(glycerol sebacate). These scaffolds exhibited well defined surface patterns and pores and robust elastomeric tensile mechanical properties. Cultured C2C12 muscle cells penetrated the pores to form spatially controlled engineered tissues. Scanning electron and confocal microscopy revealed muscle cell orientation in a preferential direction, parallel to micromolded gratings and long axes of microablated anisotropic pores, with significant individual and interactive effects of gratings and pore design. PMID:20718054

  13. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  14. Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-07-18

    This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation and to reduce the processing complexity. On the other hand, the transmitter and the receiver use antenna arrays to improve the overall diversity gain. However, this gain is achieved at the expense of increased processing complexity and power consumption. To this end, some combining schemes aiming at reducing the processing complexity and decreasing the number of active receive channels are investigated. Through the analysis, new formulas for the end-to-end signal-to-noise ratio (SNR) statistics in slowly varying and frequency flat Rayleigh fading channels are derived, which are then used to present some performance measures. Numerical and simulation results are presented to clarify the trade-off between the achieved diversity gain and the receive processing complexity. © 2011 IEEE.

  15. HOP: Achieving Efficient Anonymity in MANETs by Combining HIP, OLSR, and Pseudonyms

    Directory of Open Access Journals (Sweden)

    Campos Javier

    2011-01-01

    Full Text Available Offering secure and anonymous communications in mobile ad hoc networking environments is essential to achieve confidence and privacy, thus promoting widespread adoption of this kind of networks. In addition, some minimum performance levels must be achieved for any solution to be practical and become widely adopted. In this paper, we propose and implement HOP, a novel solution based on cryptographic Host Identity Protocol (HIP that offers security and user-level anonymity in MANET environments while maintaining good performance levels. In particular, we introduce enhancements to the authentication process to achieve Host Identity Tag (HIT relationship anonymity, along with source/destination HIT anonymity when combined with multihoming. Afterward we detail how we integrate our improved version of HIP with the OLSR routing protocol to achieve efficient support for pseudonyms. We implemented our proposal in an experimental testbed, and the results obtained show that performance levels achieved are quite good, and that the integration with OLSR is achieved with a low overhead.

  16. Hyphenated 3D-QSAR statistical model-scaffold hopping analysis for the identification of potentially potent and selective sigma-2 receptor ligands.

    Science.gov (United States)

    Floresta, Giuseppe; Rescifina, Antonio; Marrazzo, Agostino; Dichiara, Maria; Pistarà, Venerando; Pittalà, Valeria; Prezzavento, Orazio; Amata, Emanuele

    2017-10-20

    A 3D quantitative structure-activity relationship (3D-QSAR) model for predicting the σ2 receptor affinity has been constructed with the aim of providing a useful tool for the identification, design, and optimization of novel σ2 receptor ligands. The model has been built using a set of 500 selective σ2 receptor ligands recovered from the sigma-2 receptor selective ligand database (S2RSLDB) and developed with the software Forge. The present model showed high statistical quality as confirmed by its robust predictive potential and satisfactory descriptive capability. The drawn up 3D map allows for a prompt visual comprehension of the electrostatic, hydrophobic, and shaping features underlying σ2 receptor ligands interaction. A theoretic approach for the generation of new lead compounds with optimized σ2 receptor affinity has been performed by means of scaffold hopping analysis. Obtained results further confirmed the validity of our model being some of the identified moieties have already been successfully employed in the development of potent σ2 receptor ligands. For the first time is herein reported a 3D-QSAR model which includes a number of chemically diverse σ2 receptor ligands and well accounts for the individual ligands affinities. These features will ensure prospectively advantageous applications to speed up the identification of new potent and selective σ2 receptor ligands. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Metacognitive Scaffolding during Collaborative Learning: A Promising Combination

    Science.gov (United States)

    Molenaar, Inge; Sleegers, Peter; van Boxtel, Carla

    2014-01-01

    This article explores the effect of computerized scaffolding with different scaffolds (structuring vs. problematizing) on intra-group metacognitive interaction. In this study, we investigate 4 types of intra-group social metacognitive activities; namely ignored, accepted, shared and co-constructed metacognitive activities in 18 triads (6 control…

  18. Scaffold hopping for identification of novel D(2) antagonist based on 3D pharmacophore modelling of illoperidone analogs.

    Science.gov (United States)

    Dash, Radha Charan; Bhosale, Sharad H; Shelke, Suhas M; Suryawanshi, Mugdha R; Kanhed, Ashish M; Mahadik, Kakasaheb R

    2012-05-01

    The dopamine D(2) receptor is involved in the etiology of a number of disorders, such as Parkinson's disease, Huntington's Chorea, tardive dyskinesia and schizophrenia. Antagonism of D(2) receptors is implicated in the treatment of various psychiatric disorders. In order to understand essential structural features required for D(2) antagonism, this research article elaborates on the generation of a four-point 3D pharmacophore model which was extracted from a series of 45 novel 3-[[(aryloxy)alkyl]piperidinyl]-1,2-benzisoxazole derivatives. The best pharmacophore model generated consisted of four PRRR features: a positively charged group (P), and three aromatic rings (R). Based on the model generated, a statistically valid 3D-QSAR with good predictability (Q(2) = 0.756) was derived. For the validation of the pharmacophore hypothesis, active compounds were docked against the 3D structure of the D(2) receptor which was constructed through homology modeling. Further, the derived pharmacophore was used as a query to search the Zinc 'clean drug-like' database. Hits retrieved were passed progressively through filters, such as fitness score, predicted activity and docking scores. The resulting hits present new scaffolds with a strong potential for D(2) antagonist.

  19. Development of a human dihydroorotate dehydrogenase (hDHODH pharma-similarity index approach with scaffold-hopping strategy for the design of novel potential inhibitors.

    Directory of Open Access Journals (Sweden)

    Kuei-Chung Shih

    Full Text Available Human dihydroorotate dehydrogenase (hDHODH is a class-2 dihydroorotate dehydrogenase. Because it is extensively used by proliferating cells, its inhibition in autoimmune and inflammatory diseases, cancers, and multiple sclerosis is of substantial clinical importance. In this study, we had two aims. The first was to develop an hDHODH pharma-similarity index approach (PhSIA using integrated molecular dynamics calculations, pharmacophore hypothesis, and comparative molecular similarity index analysis (CoMSIA contour information techniques. The approach, for the discovery and design of novel inhibitors, was based on 25 diverse known hDHODH inhibitors. Three statistical methods were used to verify the performance of hDHODH PhSIA. Fischer's cross-validation test provided a 98% confidence level and the goodness of hit (GH test score was 0.61. The q(2, r(2, and predictive r(2 values were 0.55, 0.97, and 0.92, respectively, for a partial least squares validation method. In our approach, each diverse inhibitor structure could easily be aligned with contour information, and common substructures were unnecessary. For our second aim, we used the proposed approach to design 13 novel hDHODH inhibitors using a scaffold-hopping strategy. Chemical features of the approach were divided into two groups, and the Vitas-M Laboratory fragment was used to create de novo inhibitors. This approach provides a useful tool for the discovery and design of potential inhibitors of hDHODH, and does not require docking analysis; thus, our method can assist medicinal chemists in their efforts to identify novel inhibitors.

  20. Development of a human dihydroorotate dehydrogenase (hDHODH) pharma-similarity index approach with scaffold-hopping strategy for the design of novel potential inhibitors.

    Science.gov (United States)

    Shih, Kuei-Chung; Lee, Chi-Ching; Tsai, Chi-Neu; Lin, Yu-Shan; Tang, Chuan-Yi

    2014-01-01

    Human dihydroorotate dehydrogenase (hDHODH) is a class-2 dihydroorotate dehydrogenase. Because it is extensively used by proliferating cells, its inhibition in autoimmune and inflammatory diseases, cancers, and multiple sclerosis is of substantial clinical importance. In this study, we had two aims. The first was to develop an hDHODH pharma-similarity index approach (PhSIA) using integrated molecular dynamics calculations, pharmacophore hypothesis, and comparative molecular similarity index analysis (CoMSIA) contour information techniques. The approach, for the discovery and design of novel inhibitors, was based on 25 diverse known hDHODH inhibitors. Three statistical methods were used to verify the performance of hDHODH PhSIA. Fischer's cross-validation test provided a 98% confidence level and the goodness of hit (GH) test score was 0.61. The q(2), r(2), and predictive r(2) values were 0.55, 0.97, and 0.92, respectively, for a partial least squares validation method. In our approach, each diverse inhibitor structure could easily be aligned with contour information, and common substructures were unnecessary. For our second aim, we used the proposed approach to design 13 novel hDHODH inhibitors using a scaffold-hopping strategy. Chemical features of the approach were divided into two groups, and the Vitas-M Laboratory fragment was used to create de novo inhibitors. This approach provides a useful tool for the discovery and design of potential inhibitors of hDHODH, and does not require docking analysis; thus, our method can assist medicinal chemists in their efforts to identify novel inhibitors.

  1. Hopping Robot with Wheels

    Science.gov (United States)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  2. Human amniotic epithelial cells combined with silk fibroin scaffold in the repair of spinal cord injury

    Directory of Open Access Journals (Sweden)

    Ting-gang Wang

    2016-01-01

    Full Text Available Treatment and functional reconstruction after central nervous system injury is a major medical and social challenge. An increasing number of researchers are attempting to use neural stem cells combined with artificial scaffold materials, such as fibroin, for nerve repair. However, such approaches are challenged by ethical and practical issues. Amniotic tissue, a clinical waste product, is abundant, and amniotic epithelial cells are pluripotent, have low immunogenicity, and are not the subject of ethical debate. We hypothesized that amniotic epithelial cells combined with silk fibroin scaffolds would be conducive to the repair of spinal cord injury. To test this, we isolated and cultured amniotic epithelial cells, and constructed complexes of these cells and silk fibroin scaffolds. Implantation of the cell-scaffold complex into a rat model of spinal cord injury resulted in a smaller glial scar in the damaged cord tissue than in model rats that received a blank scaffold, or amniotic epithelial cells alone. In addition to a milder local immunological reaction, the rats showed less inflammatory cell infiltration at the transplant site, milder host-versus-graft reaction, and a marked improvement in motor function. These findings confirm that the transplantation of amniotic epithelial cells combined with silk fibroin scaffold can promote the repair of spinal cord injury. Silk fibroin scaffold can provide a good nerve regeneration microenvironment for amniotic epithelial cells.

  3. Mechanisms of hop inhibition: hop ionophores.

    Science.gov (United States)

    Behr, Jürgen; Vogel, Rudi F

    2009-07-22

    In this work, the mechanism of hop inhibition toward (beer spoiling) bacteria is revised. The mode of action of iso-alpha-acids was investigated via bilayer lipid membrane (BLM) measurements and growth challenges of hop-sensitive and -resistant Lactobacillus brevis strains in the presence of uncouplers of class I and II or a H(+)/Mn(2+) exchanger. The antibacterial action of iso-alpha-acids as proton ionophores could be confirmed by the BLM measurements; however, the reported ionophore properties, as electroneutral H(+)/Mn(2+) exchangers, could not be verified. Potentiometric measurements indicated the manganese-dependent enhancement of transmembrane charge permeation. The origin of high membrane potentials in the presence of manganese, as well as the strongly elevated membrane conductivity with concomitant increase in effectiveness of an uncoupler, suggest a different origin of charge transfer under these conditions. The mode of antibacterial action of hop ionophores can be described as proton ionophores of class I/II, which are capable transporting protons within a wide range of pH due to their inherent complexity of chemical composition. However, growth challenges in the presence of both types of ionophore classes in combination with the measured unusual high BLM potentials in the presence of manganese and at low pH indicate an additional mechanism of inhibition by hop compounds. The latter may be due to the nature/properties of hop compounds, which are known to be highly reactive substances. As a consequence, hop resistance of bacteria can be described as multiple resistance to a heterogeneous mixture of compounds comprising different known and yet unknown charge transport mechanisms, which were dependent on several factors, for example, compound concentrations, cation composition, and pH value. Thus, only specialists such as some L. brevis strains, which can cope with unusually low intracellular manganese levels, can survive hop stress. Accordingly, cross

  4. Tailorable Surface Morphology of 3D Scaffolds by Combining Additive Manufacturing with Thermally Induced Phase Separation.

    Science.gov (United States)

    Di Luca, Andrea; de Wijn, Joost R; van Blitterswijk, Clemens A; Camarero-Espinosa, Sandra; Moroni, Lorenzo

    2017-08-01

    The functionalization of biomaterials substrates used for cell culture is gearing towards an increasing control over cell activity. Although a number of biomaterials have been successfully modified by different strategies to display tailored physical and chemical surface properties, it is still challenging to step from 2D substrates to 3D scaffolds with instructive surface properties for cell culture and tissue regeneration. In this study, additive manufacturing and thermally induced phase separation are combined to create 3D scaffolds with tunable surface morphology from polymer gels. Surface features vary depending on the gel concentration, the exchanging temperature, and the nonsolvent used. When preosteoblasts (MC-3T3 cells) are cultured on these scaffolds, a significant increase in alkaline phosphatase activity is measured for submicron surface topography, suggesting a potential role on early cell differentiation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Calcium Phosphate Scaffolds Combined with Bone Morphogenetic Proteins or Mesenchymal Stem Cells in Bone Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Han Sun

    2015-01-01

    Full Text Available Objective: The purpose of this study was to review the current status of calcium phosphate (CaP scaffolds combined with bone morphogenetic proteins (BMPs or mesenchymal stem cells (MSCs in the field of bone tissue engineering (BTE. Date Sources: Data cited in this review were obtained primarily from PubMed and Medline in publications from 1979 to 2014, with highly regarded older publications also included. The terms BTE, CaP, BMPs, and MSC were used for the literature search. Study Selection: Reviews focused on relevant aspects and original articles reporting in vitro and/or in vivo results concerning the efficiency of CaP/BMPs or CaP/MSCs composites were retrieved, reviewed, analyzed, and summarized. Results: An ideal BTE product contains three elements: Scaffold, growth factors, and stem cells. CaP-based scaffolds are popular because of their outstanding biocompatibility, bioactivity, and osteoconductivity. However, they lack stiffness and osteoinductivity. To solve this problem, composite scaffolds of CaP with BMPs have been developed. New bone formation by CaP/BMP composites can reach levels similar to those of autografts. CaP scaffolds are compatible with MSCs and CaP/MSC composites exhibit excellent osteogenesis and stiffness. In addition, a CaP/MSC/BMP scaffold can repair bone defects more effectively than an autograft. Conclusions: Novel BTE products possess remarkable osteoconduction and osteoinduction capacities, and exhibit balanced degradation with osteogenesis. Further work should yield safe, viable, and efficient materials for the repair of bone lesions.

  6. The potential of chitosan combined with chicken shank collagen as scaffold on bone defect regeneration process in Rattus norvegicus

    Directory of Open Access Journals (Sweden)

    Fitria Rahmitasari

    2016-12-01

    Full Text Available Background: In the field of dentistry, alveolar bone damage can be caused by periodontal disease, traumatic injury due to tooth extraction, cyst enucleation, and tumor surgery. One of the ways to regenerate the bone defect is using graft scaffold. Thus, combination of chitosan and collagen can stimulate osteogenesis. Purpose: The aim of this study was to examine the potential of chitosan combined with chicken shank collagen on bone defect regeneration process. Method: Twelve Rattus norvegicus were prepared as animal models in this research. A bone defect was intentionally created at both of the right and left femoral bones of the models. Next, 24 samples were divided into four groups, namely Group 1 using chitosan – collagen scaffold (50:50, Group 2 using chitosan collagen-scaffold (80:20, Group 3 using chitosan scaffold only, and Control Group using 3% CMC-Na. On 14th day, those animals were sacrificed, and histopathological anatomy examination was conducted to observe osteoclast cells. In addition, immunohistochemistry examination was also performed to observe RANKL expressions. Result: There was a significant difference in RANKL expressions among the groups, except between Group 3 using chitosan scaffold only and control group (p value > 0.05. The highest expression of RANKL was found in Group 1 with chitosan – collagen scaffold (50:50, followed by Group 2 with chitosan-collagen scaffold (80:20. Moreover, there was also a significant difference in osteoclast generation, except between Group 1 using chitosan – collagen scaffold (50:50 and Group 2 using chitosan-collagen scaffold (80:20, p value 0.05. Less osteoclast was found in the groups using chitosan – collagen scaffold (Group 1 and Group 2. Conclusion: Combination of chitosan and chicken shank collagen scaffold can improve regeneration process of bone defect in Rattus novergicus animals through increasing of RANKL expressions, and decreasing of osteoclast.

  7. Electrospun PLLA nanofiber scaffolds and their use in combination with BMP-2 for reconstruction of bone defects.

    Directory of Open Access Journals (Sweden)

    Markus D Schofer

    Full Text Available Adequate migration and differentiation of mesenchymal stem cells is essential for regeneration of large bone defects. To achieve this, modern graft materials are becoming increasingly important. Among them, electrospun nanofiber scaffolds are a promising approach, because of their high physical porosity and potential to mimic the extracellular matrix (ECM.The objective of the present study was to examine the impact of electrospun PLLA nanofiber scaffolds on bone formation in vivo, using a critical size rat calvarial defect model. In addition we analyzed whether direct incorporation of bone morphogenetic protein 2 (BMP-2 into nanofibers could enhance the osteoinductivity of the scaffolds. Two critical size calvarial defects (5 mm were created in the parietal bones of adult male Sprague-Dawley rats. Defects were either (1 left unfilled, or treated with (2 bovine spongiosa, (3 PLLA scaffolds alone or (4 PLLA/BMP-2 scaffolds. Cranial CT-scans were taken at fixed intervals in vivo. Specimens obtained after euthanasia were processed for histology, histomorphometry and immunostaining (Osteocalcin, BMP-2 and Smad5.PLLA scaffolds were well colonized with cells after implantation, but only showed marginal ossification. PLLA/BMP-2 scaffolds showed much better bone regeneration and several ossification foci were observed throughout the defect. PLLA/BMP-2 scaffolds also stimulated significantly faster bone regeneration during the first eight weeks compared to bovine spongiosa. However, no significant differences between these two scaffolds could be observed after twelve weeks. Expression of osteogenic marker proteins in PLLA/BMP-2 scaffolds continuously increased throughout the observation period. After twelve weeks osteocalcin, BMP-2 and Smad5 were all significantly higher in the PLLA/BMP-2 group than in all other groups.Electrospun PLLA nanofibers facilitate colonization of bone defects, while their use in combination with BMP-2 also increases bone

  8. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

    Energy Technology Data Exchange (ETDEWEB)

    Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Trifol, Jon; Szabo, Peter [Danish Polymer Centre, Department of Chemical and Biochemical Engineering, Søltofts Plads, Building 229, DK-2800 Kgs. Lyngby (Denmark); Dufva, Marin; Emnéus, Jenny [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Wolff, Anders, E-mail: anders.wolff@nanotech.dtu.dk [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark)

    2016-04-01

    Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

  9. Liquid Phase Sintered Ceramic Bone Scaffolds by Combined Laser and Furnace

    Directory of Open Access Journals (Sweden)

    Pei Feng

    2014-08-01

    Full Text Available Fabrication of mechanically competent bioactive scaffolds is a great challenge in bone tissue engineering. In this paper, β-tricalcium phosphate (β-TCP scaffolds were successfully fabricated by selective laser sintering combined with furnace sintering. Bioglass 45S5 was introduced in the process as liquid phase in order to improve the mechanical and biological properties. The results showed that sintering of β-TCP with the bioglass revealed some features of liquid phase sintering. The optimum amount of 45S5 was 5 wt %. At this point, the scaffolds were densified without defects. The fracture toughness, compressive strength and stiffness were 1.67 MPam1/2, 21.32 MPa and 264.32 MPa, respectively. Bone like apatite layer was formed and the stimulation for apatite formation was increased with increase in 45S5 content after soaking in simulated body fluid, which indicated that 45S5 could improve the bioactivity. Furthermore, MG-63 cells adhered and spread well, and proliferated with increase in the culture time.

  10. Liquid phase sintered ceramic bone scaffolds by combined laser and furnace.

    Science.gov (United States)

    Feng, Pei; Deng, Youwen; Duan, Songlin; Gao, Chengde; Shuai, Cijun; Peng, Shuping

    2014-08-21

    Fabrication of mechanically competent bioactive scaffolds is a great challenge in bone tissue engineering. In this paper, β-tricalcium phosphate (β-TCP) scaffolds were successfully fabricated by selective laser sintering combined with furnace sintering. Bioglass 45S5 was introduced in the process as liquid phase in order to improve the mechanical and biological properties. The results showed that sintering of β-TCP with the bioglass revealed some features of liquid phase sintering. The optimum amount of 45S5 was 5 wt %. At this point, the scaffolds were densified without defects. The fracture toughness, compressive strength and stiffness were 1.67 MPam1/2, 21.32 MPa and 264.32 MPa, respectively. Bone like apatite layer was formed and the stimulation for apatite formation was increased with increase in 45S5 content after soaking in simulated body fluid, which indicated that 45S5 could improve the bioactivity. Furthermore, MG-63 cells adhered and spread well, and proliferated with increase in the culture time.

  11. Selenium-Substituted Hydroxyapatite/Biodegradable Polymer/Pamidronate Combined Scaffold for the Therapy of Bone Tumour

    Directory of Open Access Journals (Sweden)

    Ewa Oledzka

    2015-09-01

    Full Text Available The present study evaluated a new concept of combined scaffolds as a promising bone replacement material for patients with a bone tumour or bone metastasis. The scaffolds were composed of hydroxyapatite doped with selenium ions and a biodegradable polymer (linear or branched, and contained an active substance—bisphosphonate. For this purpose, a series of biodegradable polyesters were synthesized through a ring-opening polymerization of ε-caprolactone or d,l-lactide in the presence of 2-hydroxyethyl methacrylate (HEMA or hyperbranched 2,2-bis(hydroxymethylpropionic acid polyester-16-hydroxyl (bis-MPA initiators, substances often used in the synthesis of medical materials. The polymers were obtained with a high yield and a number-average molecular weight up to 45,300 (g/mol. The combined scaffolds were then manufactured by a direct compression of pre-synthesized hydroxyapatite doped with selenite or selenate ions, obtained polymer and pamidronate as a model drug. It was found that the kinetic release of the drug from the scaffolds tested in vitro under physiological conditions is strongly dependent on the physicochemical properties and average molecular weight of the polymers. Furthermore, there was good correlation with the hydrolytic biodegradation results of the scaffolds fabricated without drug. The preliminary findings suggest that the fabricated combined scaffolds could be effectively used for the sustained delivery of bioactive molecules at bone defect sites.

  12. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

    DEFF Research Database (Denmark)

    Mohanty, Soumyaranjan; Kuldeep, Kuldeep; Heiskanen, Arto

    2016-01-01

    to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random...... pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing...

  13. Composite scaffolds for osteochondral repair obtained by combination of additive manufacturing, leaching processes and hMSC-CM functionalization.

    Science.gov (United States)

    Díaz Lantada, Andrés; Alarcón Iniesta, Hernán; García-Ruíz, Josefa Predestinación

    2016-02-01

    Articular repair is a relevant and challenging area for the emerging fields of tissue engineering and biofabrication. The need of significant gradients of properties, for the promotion of osteochondral repair, has led to the development of several families of composite biomaterials and scaffolds, using different effective approaches, although a perfect solution has not yet been found. In this study we present the design, modeling, rapid manufacturing and in vitro testing of a composite scaffold aimed at osteochondral repair. The presented composite scaffold stands out for having a functional gradient of density and stiffness in the bony phase, obtained in titanium by means of computer-aided design combined with additive manufacture using selective laser sintering. The chondral phase is obtained by sugar leaching, using a PDMS matrix and sugar as porogen, and is joined to the bony phase during the polymerization of PDMS, therefore avoiding the use of supporting adhesives or additional intermediate layers. The mechanical performance of the construct is biomimetic and the stiffness values of the bony and chondral phases can be tuned to the desired applications, by means of controlled modifications of different parameters. A human mesenchymal stem cell (h-MSC) conditioned medium (CM) is used for improving scaffold response. Cell culture results provide relevant information regarding the viability of the composite scaffolds used. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Fabrication and Evaluation of Electrospun, 3D-Bioplotted, and Combination of Electrospun/3D-Bioplotted Scaffolds for Tissue Engineering Applications

    Directory of Open Access Journals (Sweden)

    Liliana F. Mellor

    2017-01-01

    Full Text Available Electrospun scaffolds provide a dense framework of nanofibers with pore sizes and fiber diameters that closely resemble the architecture of native extracellular matrix. However, it generates limited three-dimensional structures of relevant physiological thicknesses. 3D printing allows digitally controlled fabrication of three-dimensional single/multimaterial constructs with precisely ordered fiber and pore architecture in a single build. However, this approach generally lacks the ability to achieve submicron resolution features to mimic native tissue. The goal of this study was to fabricate and evaluate 3D printed, electrospun, and combination of 3D printed/electrospun scaffolds to mimic the native architecture of heterogeneous tissue. We assessed their ability to support viability and proliferation of human adipose derived stem cells (hASC. Cells had increased proliferation and high viability over 21 days on all scaffolds. We further tested implantation of stacked-electrospun scaffold versus combined electrospun/3D scaffold on a cadaveric pig knee model and found that stacked-electrospun scaffold easily delaminated during implantation while the combined scaffold was easier to implant. Our approach combining these two commonly used scaffold fabrication technologies allows for the creation of a scaffold with more close resemblance to heterogeneous tissue architecture, holding great potential for tissue engineering and regenerative medicine applications of osteochondral tissue and other heterogeneous tissues.

  15. Porous alumina scaffold produced by sol-gel combined polymeric sponge method

    Science.gov (United States)

    Hasmaliza, M.; Fazliah, M. N.; Shafinaz, R. J.

    2012-09-01

    Sol gel is a novel method used to produce high purity alumina with nanometric scale. In this study, three-dimensional porous alumina scaffold was produced using sol-gel polymeric sponge method. Briefly, sol gel alumina was prepared by evaporation and polymeric sponge cut to designated sizes were immersed in the sol gel followed by sintering at 1250 and 1550°C. In order to study the cell interaction, the porous alumina scaffold was sterilized using autoclave prior to Human Mesenchymal Stem Cells (HMSCs) seeding on the scaffold and the cell proliferation was assessed by alamarBlue® assay. SEM results showed that during the 21 day period, HMSCs were able to attach on the scaffold surface and the interconnecting pores while maintaining its proliferation. These findings suggested the potential use of the porous alumina produced as a scaffold for implantation procedure.

  16. Collagen scaffolds combined with collagen-binding ciliary neurotrophic factor facilitate facial nerve repair in mini-pigs.

    Science.gov (United States)

    Lu, Chao; Meng, Danqing; Cao, Jiani; Xiao, Zhifeng; Cui, Yi; Fan, Jingya; Cui, Xiaolong; Chen, Bing; Yao, Yao; Zhang, Zhen; Ma, Jinling; Pan, Juli; Dai, Jianwu

    2015-05-01

    The preclinical studies using animal models play a very important role in the evaluation of facial nerve regeneration. Good models need to recapitulate the distance and time for axons to regenerate in humans. Compared with the most used rodent animals, the structure of facial nerve in mini-pigs shares more similarities with humans in microanatomy. To evaluate the feasibility of repairing facial nerve defects by collagen scaffolds combined with ciliary neurotrophic factor (CNTF), 10-mm-long gaps were made in the buccal branch of mini-pigs' facial nerve. Three months after surgery, electrophysiological assessment and histological examination were performed to evaluate facial nerve regeneration. Immunohistochemistry and transmission electron microscope observation showed that collagen scaffolds with collagen binding (CBD)-CNTF could promote better axon regeneration, Schwann cell migration, and remyelination at the site of implant device than using scaffolds alone. Electrophysiological assessment also showed higher recovery rate in the CNTF group. In summary, combination of collagen scaffolds and CBD-CNTF showed promising effects on facial nerve regeneration in mini-pig models. © 2014 Wiley Periodicals, Inc.

  17. Combination of Root Surface Modification with BMP-2 and Collagen Hydrogel Scaffold Implantation for Periodontal Healing in Beagle Dogs.

    Science.gov (United States)

    Kato, Akihito; Miyaji, Hirofumi; Ishizuka, Ryosuke; Tokunaga, Keisuke; Inoue, Kana; Kosen, Yuta; Yokoyama, Hiroyuki; Sugaya, Tsutomu; Tanaka, Saori; Sakagami, Ryuji; Kawanami, Masamitsu

    2015-01-01

    Objective : Biomodification of the root surface plays a major role in periodontal wound healing. Root surface modification with bone morphogenetic protein (BMP) stimulates bone and cementum-like tissue formation; however, severe ankylosis is simultaneously observed. Bio-safe collagen hydrogel scaffolds may therefore be useful for supplying periodontal ligament cells and preventing ankylosis. We examined the effects of BMP modification in conjunction with collagen hydrogel scaffold implantation on periodontal wound healing in dogs. The collagen hydrogel scaffold was composed of type I collagen sponge and collagen hydrogel. One-wall infrabony defects (5 mm in depth, 3 mm in width) were surgically created in six beagle dogs. In the BMP/Col group, BMP-2 was applied to the root surface (loading dose; 1 µg/µl), and the defects were filled with collagen hydrogel scaffold. In the BMP or Col group, BMP-2 coating or scaffold implantation was performed. Histometric parameters were evaluated at 4 weeks after surgery. Single use of BMP stimulated formation of alveolar bone and ankylosis. In contrast, the BMP/Col group frequently enhanced reconstruction of periodontal attachment including cementum-like tissue, periodontal ligament and alveolar bone. The amount of new periodontal ligament in the BMP/Col group was significantly greater when compared to all other groups. In addition, ankylosis was rarely observed in the BMP/Col group. The combination method using root surface modification with BMP and collagen hydrogel scaffold implantation facilitated the reestablishment of periodontal attachment. BMP-related ankylosis was suppressed by implantation of collagen hydrogel.

  18. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  19. Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Zhang, Jieyuan; Liu, Xiaolin; Li, Haiyan; Chen, Chunyuan; Hu, Bin; Niu, Xin; Li, Qing; Zhao, Bizeng; Xie, Zongping; Wang, Yang

    2016-09-20

    Recently, accumulating evidence has shown that exosomes, the naturally secreted nanocarriers of cells, can exert therapeutic effects in various disease models in the absence of parent cells. However, application of exosomes in bone defect repair and regeneration has been rarely reported, and little is known regarding their underlying mechanisms. Exosomes derived from human-induced pluripotent stem cell-derived mesenchymal stem cells (hiPS-MSC-Exos) were combined with tricalcium phosphate (β-TCP) to repair critical-sized calvarial bone defects, and the efficacy was assessed by histological examination. We evaluated the in vitro effects of hiPSC-MSC-Exos on the proliferation, migration, and osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) by cell-counting, scratch assays, and qRT-PCR, respectively. Gene expression profiling and bioinformatics analyses were also used to identify the underlying mechanisms in the repair. We found that the exosome/β-TCP combination scaffolds could enhance osteogenesis as compared to pure β-TCP scaffolds. In vitro assays showed that the exosomes could release from β-TCP and could be internalized by hBMSCs. In addition, the internalization of exosomes into hBMSCs could profoundly enhance the proliferation, migration, and osteogenic differentiation of hBMSCs. Furthermore, gene expression profiling and bioinformatics analyses demonstrated that exosome/β-TCP combination scaffolds significantly altered the expression of a network of genes involved in the PI3K/Akt signaling pathway. Functional studies further confirmed that the PI3K/Akt signaling pathway was the critical mediator during the exosome-induced osteogenic responses of hBMSCs. We propose that the exosomes can enhance the osteoinductivity of β-TCP through activating the PI3K/Akt signaling pathway of hBMSCs, which means that the exosome/β-TCP combination scaffolds possess better osteogenesis activity than pure β-TCP scaffolds. These

  20. Three-dimensional polycaprolactone-hydroxyapatite scaffolds combined with bone marrow cells for cartilage tissue engineering.

    Science.gov (United States)

    Wei, Bo; Yao, Qingqiang; Guo, Yang; Mao, Fengyong; Liu, Shuai; Xu, Yan; Wang, Liming

    2015-08-01

    The goal of this study was to investigate the chondrogenic potential of three-dimensional polycaprolactone-hydroxyapatite (PCL-HA) scaffolds loaded with bone marrow cells in vitro and the effect of PCL-HA scaffolds on osteochondral repair in vivo. Here, bone marrow was added to the prepared PCL-HA scaffolds and cultured in chondrogenic medium for 10 weeks. Osteochondral defects were created in the trochlear groove of 29 knees in 17 New Zealand white rabbits, which were then divided into four groups that underwent: implantation of PCL-HA scaffolds (left knee, n = 17; Group 1), microfracture (right knee, n = 6; Group 2), autologous osteochondral transplantation (right knee, n = 6; Group 3), and no treatment (right knee, n = 5; Control). Extracellular matrix produced by bone marrow cells covered the surface and filled the pores of PCL-HA scaffolds after 10 weeks in culture. Moreover, many cell-laden cartilage lacunae were observed, and cartilage matrix was concentrated in the PCL-HA scaffolds. After a 12-week repair period, Group 1 showed excellent vertical and lateral integration with host bone, but incomplete cartilage regeneration and matrix accumulation. An uneven surface of regenerated cartilage and reduced distribution of cartilage matrix were observed in Group 2. In addition, abnormal bone growth and unstable integration between repaired and host tissues were detected. For Group 3, the integration between transplanted and host cartilage was interrupted. Our findings indicate that the PCL-HA scaffolds loaded with bone marrow cells improved chondrogenesis in vitro and implantation of PCL-HA scaffolds for osteochondral repairenhanced integration with host bone. However, cartilage regeneration remained unsatisfactory. The addition of trophic factors or the use of precultured cell-PCL-HA constructs for accelerated osteochondral repair requires further investigation. © The Author(s) 2015.

  1. Tooth root regeneration using dental follicle cell sheets in combination with a dentin matrix - based scaffold.

    Science.gov (United States)

    Yang, Bo; Chen, Gang; Li, Jie; Zou, Qing; Xie, Dan; Chen, Yali; Wang, Hang; Zheng, Xiaohui; Long, Jie; Tang, Wei; Guo, Weihua; Tian, Weidong

    2012-03-01

    Stem cell mediated tissue engineering has been acknowledged as a prospective strategy for repairing and replacing damaged and lost tissues. However, the low survival rate of implanted stem cells proves to be a major challenge in the management of transplantation failures. While previous studies have indicated the effectiveness of tissue engineered cell sheets in improving the survival rate of implanted cells, we have recently demonstrated the use of treated dentin matrix (TDM) as a biological scaffold and dental follicle cells (DFCs) as the seeding cells for dentinogenesis and tooth root construction. This study proposes a strategy utilizing TDM with human dental follicle cell sheets (DFCSs) for root regeneration. The biological characteristics and changes of human DFCSs under the effect of TDM were studied with scanning electron microscopy, transmission electron microscopy, immunofluorescence microscopy, immunohistochemistry and quantitative real-time PCR. DFCSs combined with TDM were implanted subcutaneously into the dorsum of mice. Histological examination of the harvested grafts revealed a whirlpool-like alignment of the DFCs in multiple layers that were positive for COLI, integrinβ1, fibronectin and alkaline phosphatase (ALP), suggestive of the formation of a rich extracellular matrix. DFCSs, under the effect of TDM, highly expressed DMP-1 and bone sialoprotein (BSP), indicating their potential for odontogenesis and osteogenesis. Importantly, in vivo, TDM could induce and support DFCSs to develop new dentin-pulp like tissues and cementum-periodontal complexes that were positive for markers such as DSP, nestin and VIII factors, COLI and cementum attachment protein (CAP), implying successful root regeneration. Therefore, DFCSs combined with TDM may prove to be a better strategy for the construction of tooth root, and is a prospective approach that could be utilized for the treatment of root or tooth defect or loss in future. Copyright © 2011 Elsevier Ltd. All

  2. Cytocompatibility and biologic characteristics of synthetic scaffold materials of rabbit acellular vascular matrix combining with human-like collagen I.

    Science.gov (United States)

    Liu, Xuqian; Wang, Jie; Dong, Fusheng; Song, Peng; Tian, Songbo; Li, Hexiang; Hou, Yali

    2017-10-01

    Scaffold material provides a three-dimensional growing environment for seed cells in the research field of tissue engineering. In the present study, rabbit arterial blood vessel cells were chemically removed with trypsin and Triton X-100 to prepare rabbit acellular vascular matrix scaffold material. Observation by He&Masson staining revealed that no cellular components or nuclei existed in the vascular intima and media after decellularization. Human-like collagen I was combined with acellular vascular matrix by freeze-drying to prepare an acellular vascular matrix-0.25% human-like collagen I scaffold to compensate for the extracellular matrix loss during the decellularization process. We next performed a series of experiments to test the water absorbing quality, biomechanics, pressure resistance, cytotoxicity, and ultra-micro structure of the acellular vascular matrix composite material and natural rabbit artery and found that the acellular vascular matrix-0.25% human-like collagen I material behaved similarly to natural rabbit artery. In conclusion, the acellular vascular matrix-0.25% human-like collagen I composite material provides a new approach and lays the foundation for novel scaffold material research into tissue engineering of blood vessels.

  3. A combination of biphasic calcium phosphate scaffold with hyaluronic acid-gelatin hydrogel as a new tool for bone regeneration.

    Science.gov (United States)

    Nguyen, Thuy Ba Linh; Lee, Byong-Taek

    2014-07-01

    A novel bone substitute was fabricated to enhance bone healing by combining ceramic and polymer materials. In this study, Hyaluronic acid (HyA)-Gelatin (Gel) hydrogel was loaded into a biphasic calcium phosphate (BCP) ceramic, and the resulting scaffold, with unique micro- and macroporous orientation, was evaluated for bone regeneration applications. The fabricated scaffold showed high interconnected porosity, with an average compressive strength of 2.8±0.15 MPa, which is usually recommended for cancellous bone substitution. In vitro cytocompatibility studies were conducted using bone marrow mesenchymal stem cells. The HyA-Gel-loaded BCP scaffold resulted in a significant increase in cell proliferation at 3 (p<0.05) and 7 days (p<0.001) and high alkaline phosphatase activities at 14 and 21 days. Furthermore, the in vivo studies showed that the implanted HyA-Gel-loaded BCP scaffold begins to degrade within 3 months after implantation. Histological sections also confirmed a rapid new bone formation and a high rate of collagen mineralization. A bone matrix formation was confirmed by positive immunohistochemistry staining of osteopontin, osteocalcin, and collagen type I. In vivo expression of extracellular matrix proteins demonstrated that this novel bone substitute holds great promise for use in stimulating new bone regeneration.

  4. The application of graphene oxidized combining with decellularized scaffold to repair of sciatic nerve injury in rats

    Directory of Open Access Journals (Sweden)

    Qiaoling Wang

    2017-05-01

    Full Text Available This paper combined the decellularized scaffold of sciatic nerve of rats with graphene oxidized (GO, studied and facilitated the regeneration of sciatic nerve of rats, and provided the basis for the clinical application of nanomaterials. GO was prepared through improving Hammer’s Method. Fourier Infrared Spectrum was used to scan and detect the functional groups in GO of sample by using the pellet method, the microcosmic morphological appearance of GO was observed by using the scanning electron microscope. The GO/decellularized scaffold were prepared and operation bridging of injured sciatic nerve was conducted by using the oscillation mixing method. BL-420F Biofunctional Experiment System was used to detect nerve action potential and the maximum tension value of muscles, and the fiber structure of nerve was observed under H-7650 Transmission Electron Microscope (TEM. Scanning electron microscope observed that GO presented a folded and curly single-layer sheet structure. It was soluble in water through ultrasound, brownish, the Fourier Transform Infrared Spectrometer detected the absorption peaks of carbonyl, hydroxy and carboxy, proving that the surface of GO material had many functional groups containing oxygen. Decellularized scaffold combining with GO was applied to repair injury of sciatic nerve, the nerve action potential, maximum tension value of muscle, wet weight value of gastrocnemius, thickness of gastrocnemius, thickness of myelin sheath and diameter of axon of the decellularized scaffold combining with GO group were obviously higher than the decellularized scaffold group and the self-rotating group, approaching to the normal value. All the data were represented by means ± standard deviation (x¯±s and processed by adopting SPSS 11.0 software. Comparisons among groups were analyzed by variance, and the comparison of two means was detected by student t. The detection level adopted α = 0.05, when P < 0.05, it could be

  5. Bioactive cell-derived matrices combined with polymer mesh scaffold for osteogenesis and bone healing.

    Science.gov (United States)

    Kim, In Gul; Hwang, Mintai P; Du, Ping; Ko, Jaehoon; Ha, Chul-won; Do, Sun Hee; Park, Kwideok

    2015-05-01

    Successful bone tissue engineering generally requires an osteoconductive scaffold that consists of extracellular matrix (ECM) to mimic the natural environment. In this study, we developed a PLGA/PLA-based mesh scaffold coated with cell-derived extracellular matrix (CDM) for the delivery of bone morphogenic protein (BMP-2), and assessed the capacity of this system to provide an osteogenic microenvironment. Decellularized ECM from human lung fibroblasts (hFDM) was coated onto the surface of the polymer mesh scaffolds, upon which heparin was then conjugated onto hFDM via EDC chemistry. BMP-2 was subsequently immobilized onto the mesh scaffolds via heparin, and released at a controlled rate. Human placenta-derived mesenchymal stem cells (hPMSCs) were cultured in such scaffolds and subjected to osteogenic differentiation for 28 days in vitro. The results showed that alkaline phosphatase (ALP) activity, mineralization, and osteogenic marker expression were significantly improved with hPMSCs cultured in the hFDM-coated mesh scaffolds compared to the control and fibronectin-coated ones. In addition, a mouse ectopic and rat calvarial bone defect model was used to examine the feasibility of current platform to induce osteogenesis as well as bone regeneration. All hFDM-coated mesh groups exhibited a significant increase of newly formed bone and in particular, hFDM-coated mesh scaffold loaded with a high dose of BMP-2 exhibited a nearly complete bone defect healing as confirmed via micro-CT and histological observation. This work proposes a great potency of using hFDM (biophysical) coupled with BMP-2 (biochemical) as a promising osteogenic microenvironment for bone tissue engineering applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  7. Electrospun cellulose acetate phthalate nanofibrous scaffolds fabricated using novel solvent combinations biocompatible for primary chondrocytes and neurons.

    Science.gov (United States)

    Shrestha, Rupendra; Palat, Asha; Punnoose, Alan M; Joshi, Shailesh; Ponraju, D; Paul, Solomon F D

    2016-12-01

    Electrospun nanofibres have been shown to exhibit extracellular matrix (ECM)-like characteristics required for tissue engineering in terms of porosity, flexibility, fibre organization and strength. This study focuses on developing novel cellulose acetate phthalate (CAP) scaffolds by electrospinning for establishing 3-D chondrocyte and neuronal cultures. Five solvent combinations were employed in fabricating the fibres, namely, acetone/ethanol (9:1), dimethylformamide/tetrahydrofuran/acetone (3:3:4), tetrahydrofuran/acetone (1:1), tetrahydrofuran/ethanol (1:1) and chloroform/methanol (1:1). The electrospun fibres were characterized by scanning electron microscopy (SEM) analysis and confirmed to be within the nanometre range. Based on the morphology of the fibers from SEM results, two solvent combinations such as acetone/ethanol and dimethylformamide/tetrahydrofuran/acetone were selected for stabilization as CAP exhibits a pH dependent solubility. Fourier-Transform Infrared (FTIR) analysis revealed the hydrolysis of CAP which was overcome by EDC [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide] and EDC/NHS (N-hydroxysuccinimide) cross-linking resulting in its stability (pH of 7.2) for three months. MTT [3-(4, 5-dimethylthiazol-2-yl)-1, 5-diphenyltetrazolium bromide] assay performed using L6 myoblast confirmed the biocompatibility of the scaffolds. 3-D primary chondrocyte and neuronal cultures were established on the scaffolds and maintained for a period of 10 days. H&E staining and SEM analysis showed the attachment of the chondrocytes and neurons on CAP scaffolds prepared using dimethylformamide/tetrahydrofuran/acetone and acetone/ethanol respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Combining mechanical foaming and thermally induced phase separation to generate chitosan scaffolds for soft tissue engineering.

    Science.gov (United States)

    Biswas, D P; Tran, P A; Tallon, C; O'Connor, A J

    2017-02-01

    In this paper, a novel foaming methodology consisting of turbulent mixing and thermally induced phase separation (TIPS) was used to generate scaffolds for tissue engineering. Air bubbles were mechanically introduced into a chitosan solution which forms the continuous polymer/liquid phase in the foam created. The air bubbles entrained in the foam act as a template for the macroporous architecture of the final scaffolds. Wet foams were crosslinked via glutaraldehyde and frozen at -20 °C to induce TIPS in order to limit film drainage, bubble coalescence and Ostwald ripening. The effects of production parameters, including mixing speed, surfactant concentration and chitosan concentration, on foaming are explored. Using this method, hydrogel scaffolds were successfully produced with up to 80% porosity, average pore sizes of 120 μm and readily tuneable compressive modulus in the range of 2.6 to 25 kPa relevant to soft tissue engineering applications. These scaffolds supported 3T3 fibroblast cell proliferation and penetration and therefore show significant potential for application in soft tissue engineering.

  9. Biodegradable porous sheet-like scaffolds for soft-tissue engineering using a combined particulate leaching of salt particles and magnetic sugar particles.

    Science.gov (United States)

    Hu, Chengzhi; Tercero, Carlos; Ikeda, Seiichi; Nakajima, Masahiro; Tajima, Hirotaka; Shen, Yajing; Fukuda, Toshio; Arai, Fumihito

    2013-07-01

    Scaffolds serving as artificial extracellular matrixes (ECMs) play a pivotal role in the process of tissue regeneration by providing optimal cellular environments for penetration, ingrowth, and vascularization. Stacks of sheet-like scaffold can be engineered to become artificial ECMs, suggesting a great potential for achieving complex 3-D tissue regeneration to support cell survival and growth. In this study, we proposed and investigated a combined particulate leaching of magnetic sugar particles (MSPs) and salt particles for the development of a sheet-like scaffold. MSPs were fabricated by encapsulating NdFeB particles inside sugar spheres and were controlled using magnetic fields as a porogen to control pore size, pore structure and pore density while fabricating the scaffold. We studied the influence of the strength of the magnetic fields in controlling the coating thickness of the unmagnetized MSPs during the fabrication of the sheet-like scaffolds. The experimental relationship between magnetic flux density and the thickness of the MSP layer was illustrated. Furthermore, we investigated the infiltration capacity of different concentrations of poly(L-lactide-co-ɛ-caprolactone) (PLCL) as a scaffold material on MSP clusters. Following polymer casting and removal of the sugar template, spherical pores were generated inside the scaffolds. Cultivation of NIH/3T3 fibroblasts on the fabricated scaffold proves that the proposed method can be applied in the cell sheet fabrication. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  11. Improved preparation of acellular nerve scaffold and application of PKH26 fluorescent labeling combined with in vivo fluorescent imaging system in nerve tissue engineering.

    Science.gov (United States)

    Zhao, Bin; Sun, Xiaolei; Li, Xiulan; Yang, Qiang; Li, Yanjun; Zhang, Yang; Li, Bing; Ma, Xinlong

    2013-11-27

    Acellular nerve scaffold has been widely used for peripheral nerve defect treatment. However, the structure of traditional acellular nerve scaffold is dense; the interval porosity and void diameter are too small to meet the requirement of cell seeding, which limits the application. This study was designed to prepare a novel acellular nerve scaffold by the technique of hypotonic buffer combined with freeze-drying, and use PKH26 fluorescent labeling combined with in vivo fluorescent imaging system to evaluate the biological behavior of tissue-engineered nerve in vitro and in vivo. According to light and electron microscopy, the scaffold, which microarchitecture was similar to the fibrous framework of rabbit sciatic nerves, was cell-free and rich in laminin, collagen I and collagen III. In vitro experiment showed that the novel acellular nerve scaffold could provide a 3-D environment to support the attachment, proliferation and migration of adipose-derived stem cells (ADSCs). ADSCs labeled with fluorescent dye PKH26 were then seeded on scaffolds and implanted subcutaneously into nude mice. After 4 weeks, nerve-like tissue rounded by vessels formed. Cells in the tissue seemed to confirm that they originated from the labeled ADSCs, as confirmed by in vivo fluorescent imaging. In conclusion, the prepared novel acellular nerve scaffold can be used as a new kind of nerve scaffold material, which is more conducible for seeding cells; And PKH26 fluorescent labeling and in vivo fluorescent imaging can be useful for cell tracking and analyzing cell-scaffold constructs in vivo. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Specific and sensitive detection of Plasmodium falciparum lactate dehydrogenase by DNA-scaffolded silver nanoclusters combined with an aptamer.

    Science.gov (United States)

    Wang, Wei-Xian; Cheung, Yee-Wai; Dirkzwager, Roderick M; Wong, Wai-Chung; Tanner, Julian A; Li, Hong-Wei; Wu, Yuqing

    2017-02-27

    Innovative nanomaterials offer significant potential for diagnosis of severe diseases of the developing world such as malaria. Small sized silver nanoclusters have shown promise for diagnostics due to their intense fluorescence emission and photo-stabilities. Here, double-stranded DNA-scaffolded silver nanoclusters (AgNCs-dsDNA) were prepared to detect the established malaria biomarker, Plasmodium falciparum lactate dehydrogenase (PfLDH). Significant luminescence enhancement over a wide concentration range of PfLDH was demonstrated. In addition, a low limit of detection at 0.20 nM (7.4 pg μL-1) was achieved for PfLDH in buffer solution, sensitive enough for practical use correlating with the clinical level of PfLDH in plasma from malaria-infected patients. Unique specificity was observed towards Plasmodium falciparum over Plasmodium vivax and human lactate dehydrogenase, as well as other non-specific proteins, by combining the use of AgNCs-dsDNA with a DNA aptamer against PfLDH. Moreover, the intrinsic mechanism was revealed in detail for the two-step luminescence response. The combination of DNA-scaffolded silver nanoclusters coupled to a selective single-stranded DNA aptamer allows for a highly specific and sensitive detection of PfLDH with significant promise for malaria diagnosis in future.

  13. Simulating Muscle-Reflex Dynamics in a Simple Hopping Robot

    Science.gov (United States)

    Seyfarth, Andre; Kalveram, Karl Theodor; Geyer, Hartmut

    In legged systems, springy legs facilitate gaits with subsequent contact and flight phases. Here, we test whether electrical motors can generate leg behaviors suitable for stable hopping. We built a vertically operating sledge actuated by a motor-driven leg. The motor torque simulates either a linear leg spring or a muscle-reflex system. For stable hopping significant energy supply was required after midstance. This was achieved by enhancing leg stiffness or by continuously applying positive force feedback to the simulated muscle. The muscle properties combined with positive force feedback result in spring-like behavior which enables stable hopping with adjustable hopping height.

  14. Combined Effect of a Microporous Layer and Type I Collagen Coating on a Biphasic Calcium Phosphate Scaffold for Bone Tissue Engineering.

    Science.gov (United States)

    Lee, Mun-Hwan; You, Changkook; Kim, Kyo-Han

    2015-03-16

    In this study, type I collagen was coated onto unmodified and modified microporous biphasic calcium phosphate (BCP) scaffolds. Surface characterization using a scanning electron microscope (SEM) and a surface goniometer confirmed the modification of the BCP coating. The quantity of the collagen coating was investigated using Sirius Red staining, and quantitative assessment of the collagen coating showed no significant differences between the two groups. MG63 cells were used to evaluate cell proliferation and ALP activity on the modified BCP scaffolds. The modified microporous surfaces showed low contact angles and large surface areas, which enhanced cell spreading and proliferation. Coating of the BCP scaffolds with type I collagen led to enhanced cell-material interactions and improved MG63 functions, such as spreading, proliferation, and differentiation. The micropore/collagen-coated scaffold showed the highest rate of cell response. These results indicate that a combination of micropores and collagen enhances cellular function on bioengineered bone allograft tissue.

  15. Combined effects of scaffold stiffening and mechanical preconditioning cycles on construct biomechanics, gene expression, and tendon repair biomechanics.

    Science.gov (United States)

    Nirmalanandhan, Victor Sanjit; Juncosa-Melvin, Natalia; Shearn, Jason T; Boivin, Gregory P; Galloway, Marc T; Gooch, Cynthia; Bradica, Gino; Butler, David L

    2009-08-01

    Our group has previously reported that in vitro mechanical stimulation of tissue-engineered tendon constructs significantly increases both construct stiffness and the biomechanical properties of the repair tissue after surgery. When optimized using response surface methodology, our results indicate that a mechanical stimulus with three components (2.4% strain, 3000 cycles/day, and one cycle repetition) produced the highest in vitro linear stiffness. Such positive correlations between construct and repair stiffness after surgery suggest that enhancing structural stiffness before surgery could not only accelerate repair stiffness but also prevent premature failures in culture due to poor mechanical integrity. In this study, we examined the combined effects of scaffold crosslinking and subsequent mechanical stimulation on construct mechanics and biology. Autologous tissue-engineered constructs were created by seeding mesenchymal stem cells (MSCs) from 15 New Zealand white rabbits on type I collagen sponges that had undergone additional dehydrothermal crosslinking (termed ADHT in this manuscript). Both constructs from each rabbit were mechanically stimulated for 8h/day for 12 consecutive days with half receiving 100 cycles/day and the other half receiving 3000 cycles/day. These paired MSC-collagen autologous constructs were then implanted in bilateral full-thickness, full-length defects in the central third of rabbit patellar tendons. Increasing the number of in vitro cycles/day delivered to the ADHT constructs in culture produced no differences in stiffness or gene expression and no changes in biomechanical properties or histology 12 weeks after surgery. Compared to MSC-based repairs from a previous study that received no additional treatment in culture, ADHT crosslinking of the scaffolds actually lowered the 12-week repair stiffness. Thus, while ADHT crosslinking may initially stiffen a construct in culture, this specific treatment also appears to mask any benefits

  16. Scaffolds combined with stem cells and growth factors in healing of pseudotumoral lesions of bone.

    Science.gov (United States)

    De Biase, P; Campanacci, D A; Beltrami, G; Scoccianti, G; Ciampalini, L; Pecchioli, O; Capanna, R

    2011-01-01

    Reconstructions of large lesions or defects often require a bone graft or a bone substitute to promote healing. In common practice the reconstruction of a bone defect is dependent on the site and size of the lesion: in long bones intercalary defects may be managed with Ilizarov technique of bone transport and distraction osteogenesis or the use of a free or pedicled vascularized bone graft, or with Masquelet technique. For cavitary defects the available surgical options include autograft, allograft or xenograft or the use of synthetic scaffolds to promote bone regeneration. In order to promote a faster bone healing tissue engineering proposed the application of enriched graft to fill bone defects. The employment of enriched bone graft has been our choice in the last years to fill contained defects following curettage of a pseudotumoral lesion of bone. We report our clinical experience in terms of safety and success of these procedures at a long-term follow up.

  17. Design and Fabrication of Complex Scaffolds for Bone Defect Healing: Combined 3D Plotting of a Calcium Phosphate Cement and a Growth Factor-Loaded Hydrogel.

    Science.gov (United States)

    Ahlfeld, Tilman; Akkineni, Ashwini Rahul; Förster, Yvonne; Köhler, Tino; Knaack, Sven; Gelinsky, Michael; Lode, Anja

    2017-01-01

    Additive manufacturing enables the fabrication of scaffolds with defined architecture. Versatile printing technologies such as extrusion-based 3D plotting allow in addition the incorporation of biological components increasing the capability to restore functional tissues. We have recently described the fabrication of calcium phosphate cement (CPC) scaffolds by 3D plotting of an oil-based CPC paste under mild conditions. In the present study, we have developed a strategy for growth factor loading based on multichannel plotting: a biphasic scaffold design was realised combining CPC with VEGF-laden, highly concentrated hydrogel strands. As hydrogel component, alginate and an alginate-gellan gum blend were evaluated; the blend exhibited a more favourable VEGF release profile and was chosen for biphasic scaffold fabrication. After plotting, two-step post-processing was performed for both, hydrogel crosslinking and CPC setting, which was shown to be compatible with both materials. Finally, a scaffold was designed and fabricated which can be applied for testing in a rat critical size femur defect. Optimization of CPC plotting enabled the fabrication of highly resolved structures with strand diameters of only 200 µm. Micro-computed tomography revealed a precise strand arrangement and an interconnected pore space within the biphasic scaffold even in swollen state of the hydrogel strands.

  18. Light-emitting diode effects on combined decellularization of tracheae. A novel approach to obtain biological scaffolds.

    Science.gov (United States)

    Evaristo, Thaiane Cristine; CruzAlves, Flávia Cilene Maciel da; Moroz, Andrei; Mion, Woner; Acorci-Valério, Michele Janegitz; Felisbino, Sérgio Luis; Rossi-Ferreira, Rosana; Ruiz Júnior, Raul Lopes; Deffune, Elenice

    2014-08-01

    To obtain a decellularized tracheal scaffold associating traditional approaches with the novel light-emitting diode (LED) proposal. This study was performed with New Zealand adult rabbits weighing 3.0 - 4.0 kg. Different protocols (22) were used combining physical (agitation and LED irradiation), chemical (SDS and Triton X-100 detergents), and enzymatic methods (DNase and RNase). Generally, the cells surrounding soft tissues were successfully removed, but none protocol removed cells from the tracheal cartilage. However, longer protocols were more effective. The cost-benefits relation of the enzymatic processes was not favorable. It was possible to find out that the cartilaginous tissue submitted to the irradiation with LED 630nm and 475 nm showed an increased number of gaps without cells, but several cells were observed to be still present. The light-emitting diode is a promising tool for decellularization of soft tissues.

  19. Bioactive Copper-Doped Glass Scaffolds Can Stimulate Endothelial Cells in Co-Culture in Combination with Mesenchymal Stem Cells

    Science.gov (United States)

    Rath, Subha N.; Brandl, Andreas; Hiller, Daniel; Hoppe, Alexander; Gbureck, Uwe; Horch, Raymund E.; Boccaccini, Aldo R.; Kneser, Ulrich

    2014-01-01

    Bioactive glass (BG) scaffolds are being investigated for bone tissue engineering applications because of their osteoconductive and angiogenic nature. However, to increase the in vivo performance of the scaffold, including enhancing the angiogenetic growth into the scaffolds, some researchers use different modifications of the scaffold including addition of inorganic ionic components to the basic BG composition. In this study, we investigated the in vitro biocompatibility and bioactivity of Cu2+-doped BG derived scaffolds in either BMSC (bone-marrow derived mesenchymal stem cells)-only culture or co-culture of BMSC and human dermal microvascular endothelial cells (HDMEC). In BMSC-only culture, cells were seeded either directly on the scaffolds (3D or direct culture) or were exposed to ionic dissolution products of the BG scaffolds, kept in permeable cell culture inserts (2D or indirect culture). Though we did not observe any direct osteoinduction of BMSCs by alkaline phosphatase (ALP) assay or by PCR, there was increased vascular endothelial growth factor (VEGF) expression, observed by PCR and ELISA assays. Additionally, the scaffolds showed no toxicity to BMSCs and there were healthy live cells found throughout the scaffold. To analyze further the reasons behind the increased VEGF expression and to exploit the benefits of the finding, we used the indirect method with HDMECs in culture plastic and Cu2+-doped BG scaffolds with or without BMSCs in cell culture inserts. There was clear observation of increased endothelial markers by both FACS analysis and acetylated LDL (acLDL) uptake assay. Only in presence of Cu2+-doped BG scaffolds with BMSCs, a high VEGF secretion was demonstrated by ELISA; and typical tubular structures were observed in culture plastics. We conclude that Cu2+-doped BG scaffolds release Cu2+, which in turn act on BMSCs to secrete VEGF. This result is of significance for the application of BG scaffolds in bone tissue engineering approaches. PMID

  20. Bioactive copper-doped glass scaffolds can stimulate endothelial cells in co-culture in combination with mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Subha N Rath

    Full Text Available Bioactive glass (BG scaffolds are being investigated for bone tissue engineering applications because of their osteoconductive and angiogenic nature. However, to increase the in vivo performance of the scaffold, including enhancing the angiogenetic growth into the scaffolds, some researchers use different modifications of the scaffold including addition of inorganic ionic components to the basic BG composition. In this study, we investigated the in vitro biocompatibility and bioactivity of Cu2+-doped BG derived scaffolds in either BMSC (bone-marrow derived mesenchymal stem cells-only culture or co-culture of BMSC and human dermal microvascular endothelial cells (HDMEC. In BMSC-only culture, cells were seeded either directly on the scaffolds (3D or direct culture or were exposed to ionic dissolution products of the BG scaffolds, kept in permeable cell culture inserts (2D or indirect culture. Though we did not observe any direct osteoinduction of BMSCs by alkaline phosphatase (ALP assay or by PCR, there was increased vascular endothelial growth factor (VEGF expression, observed by PCR and ELISA assays. Additionally, the scaffolds showed no toxicity to BMSCs and there were healthy live cells found throughout the scaffold. To analyze further the reasons behind the increased VEGF expression and to exploit the benefits of the finding, we used the indirect method with HDMECs in culture plastic and Cu2+-doped BG scaffolds with or without BMSCs in cell culture inserts. There was clear observation of increased endothelial markers by both FACS analysis and acetylated LDL (acLDL uptake assay. Only in presence of Cu2+-doped BG scaffolds with BMSCs, a high VEGF secretion was demonstrated by ELISA; and typical tubular structures were observed in culture plastics. We conclude that Cu2+-doped BG scaffolds release Cu2+, which in turn act on BMSCs to secrete VEGF. This result is of significance for the application of BG scaffolds in bone tissue engineering

  1. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  2. The application of wrapping ureter by a pedicled gastrocolic omentum flap combined with an artificial external scaffold to prevent stoma stenosis in rabbit after ureterocutaneostomy.

    Science.gov (United States)

    Zhang, Shigeng; Gao, Fei; Xue, Chong; Zhang, Nan; Gao, Feng; Li, Shaojiang; Wen, Jiaming

    2017-02-01

    To evaluate the feasibility and possibility of wrapping ureter by a pedicled gastrocolic omentum flap combined with an artificial ureter external scaffold to prevent stoma stenosis in rabbit after ureterocutaneostomy. Forty male New Zealand rabbits were involved in this study. For application of ureterocutaneostomy, the right ureter was wrapped by a pedicled gastrocolic omentum flap and combined with application of an artificial external scaffold, which served as experimental side. Traditional ureterocutaneostomy was applied in left ureter (control side). All rabbits were killed after 1 month, and the kidney, ureter and abdominal segment ureter were collected to study the morphological and pathological changes by using HE staining, Masson staining, immunohistochemistry staining and microvessel density (MVD) study. HE staining showed that renal medullary tubular dilatation, large number of collagen deposition, renal glomerular and renal tubular atrophy. Glomerular vascular leaves and interstitial fibrosis were detected in the kidney of control side. However, these abnormities in the kidney of experimental side were significantly alleviated compared to control side. The hydronephrosis and ureterectasia in the experimental side were dramatically attenuated compared to control side. Fibrosis in ureter around stoma and stoma stenosis were prevented by wrapping ureter by a pedicled gastrocolic omentum flap combined with an artificial external scaffold. In this study, we have demonstrated that wrapping ureter by a pedicled gastrocolic omentum flap combined with an artificial external scaffold is capable of preventing stoma stenosis in rabbit after ureterocutaneostomy, which provided a new method and theoretical basis for clinical application in the future.

  3. [CYTOCOMPATIBILITY AND PREPARATION OF BONE TISSUE ENGINEERING SCAFFOLD BY COMBINING LOW TEMPERATURE THREE DIMENSIONAL PRINTING AND VACUUM FREEZE-DRYING TECHNIQUES].

    Science.gov (United States)

    Li, Dong; Zhang, Zhenhui; Zheng, Chengcheng; Zhao, Bin; Sun, Kai; Nian, Zhenghao; Zhang, Xizheng; Li, Ruixin; Li, Hui

    2016-03-01

    To study the preparation and cytocompatibility of bone tissue engineering scaffolds by combining low temperature three dimensional (3D) printing and vacuum freeze-drying techniques. Collagen (COL) and silk fibroin (SF) were manufactured from fresh bovine tendon and silkworm silk. SolidWorks2014 was adopted to design bone tissue engineering scaffold models with the size of 9 mm x 9 mm x 3 mm and pore diameter of 500 μm. According to the behavior of composite materials that low temperature 3D printing equipment required, COL, SF, and nano-hydroxyapatite (nHA) at a ratio of 9 : 3 : 2 and low temperature 3D printing in combination with vacuum freeze-drying techniques were accepted to build COL/SF/nHA composite scaffolds. Gross observation and scanning electron microscope (SEM) were applied to observe the morphology and surface structures of composite scaffolds. Meanwhile, compression displacement, compression stress, and elasticity modulus were measured by mechanics machine to analyze mechanical properties of composite scaffolds. The growth and proliferation of MC3T3-E1 cells were evaluated using SEM, inverted microscope, and MTT assay after cultured for 1, 7, 14, and 21 days on the composite scaffolds. The RT-PCR and Western blot techniques were adopted to detect the gene and protein expressions of COL I, alkaline phosphatase (ALP), and osteocalcin (OCN) in MC3T3-E1 cells after 21 days. COL/SF/nHA composite scaffolds were successfully prepared by low temperature 3D printing technology and vacuum freeze-drying techniques; the SEM results showed that the bionic bone scaffolds were 3D polyporous structures with macropores and micropores. The mechanical performance showed that the elasticity modulus was (344.783 07 ± 40.728 55) kPa; compression displacement was (0.958 41 ± 0.000 84) mm; and compression stress was (0.062 15 ± 0.007 15) MPa. The results of inverted microscope, SEM, and MTT method showed that a large number of cells adhered to the surface with full

  4. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  5. Fabrication of BCP/Silica Scaffolds with Dual-Pore by Combining Fused Deposition Modeling and the Particle Leaching Method

    Energy Technology Data Exchange (ETDEWEB)

    Sa, Min-Woo; Kim, Jong Young [Andong National Univ., Andong (Korea, Republic of)

    2016-10-15

    In recent years, traditional scaffold fabrication techniques such as gas foaming, salt leaching, sponge replica, and freeze casting in tissue engineering have significantly limited sufficient mechanical property and cell interaction effect due to only random pores. Fused deposition modeling is the most apposite technology for fabricating the 3D scaffolds using the polymeric materials in tissue engineering application. In this study, 3D slurry mould was fabricated with a blended biphasic calcium phosphate (BCP)/Silica/Alginic acid sodium salt slurry in PCL mould and heated for two hours at 100 .deg. C to harden the blended slurry. 3D dual-pore BCP/Silica scaffold, composed of macro pores interconnected with micro pores, was successfully fabricated by sintering at furnace of 1100 .deg. C. Surface morphology and 3D shape of dual-pore BCP/Silica scaffold from scanning electron microscopy were observed. Also, the mechanical properties of 3D BCP/Silica scaffold, according to blending ratio of alginic acid sodium salt, were evaluated through compression test.

  6. Repair of calvarial bone defects in mice using electrospun polystyrene scaffolds combined with β-TCP or gold nanoparticles.

    Science.gov (United States)

    Terranova, Lisa; Dragusin, Diana Maria; Mallet, Romain; Vasile, Eugeniu; Stancu, Izabela-Cristina; Behets, Catherine; Chappard, Daniel

    2017-02-01

    Non-biodegradable porous polystyrene (PS) scaffolds, composed of microfibers, have been prepared by electrospinning for the reconstruction of large bone defects. PS microfibers were prepared by incorporating β-TCP grains inside the polymer or grafting gold nanoparticles surface functionalized with mercaptosuccinic acid. Cytocompatibility of the three types of scaffolds (PS, β-TCP-PS and Au-PS) was studied by seeding human mesenchymal stem cells. Biocompatibility was evaluated by implanting β-TCP-PS and Au-PS scaffolds into a critical size (4mm) calvarial defect in mice. Calvaria were taken 6, 9, and 12 weeks after implantation; newly formed bone and cellular response was analyzed by microcomputed tomography (microCT) and histology. β-TCP-PS scaffolds showed a significantly higher cell proliferation in vitro than on PS or Au-PS alone; clearly, the presence of β-TCP grains improved cytocompatibility. Biocompatibility study in the mouse calvaria model showed that β-TCP-PS scaffolds were significantly associated with more newly-formed bone than Au-PS. Bone developed by osteoconduction from the defect margins to the center. A dense fibrous connective tissue containing blood vessels was identified histologically in both types of scaffolds. There was no inflammatory foci nor giant cell in these areas. AuNPs aggregates were identified histologically in the fibrosis and also incorporated in the newly-formed bone matrix. Although the different types of PS microfibers appeared cytocompatible during the in vitro experiment, they appeared biotolerated in vivo since they induced a fibrotic reaction associated with newly formed bone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    into a functionally coordinate unit. A genetic scaffolding accounts for the inherited invariance of pattern formation during the embryo’s growth. At higher level, cells behave as agents endowed with the capacity to interpret any scaffolding variation as signs. The full hierarchy of a multi-level scaffolding...

  8. Low Power Multi-Hop Networking Analysis in Intelligent Environments

    Directory of Open Access Journals (Sweden)

    Josu Etxaniz

    2017-05-01

    Full Text Available Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links and scatternets (multi-hop networks. As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  9. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  10. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  11. Treatment of a Coronary Bifurcation Lesion Using One Dedicated Sirolimus Eluting Bifurcation Stent in Combination with a Bioresorbable Vascular Scaffold: A Novel Option for Coronary Bifurcation Approach

    Directory of Open Access Journals (Sweden)

    Javier Benezet

    2016-01-01

    Full Text Available We present a complex bifurcation lesion treated with a new two-stent strategy combining a dedicated sirolimus eluting bifurcation stent, BiOSS Lim, with a bioresorbable vascular scaffold (BVS. The advantages of this strategy compared with the conventional two-stent approach are as follows: the dedicated stent protects the carina from being damaged, the large cell at the middle zone of the BiOSS Lim gives possibility to enter easily into the side branch (SB with any standard size conventional device, and, finally, the additional use of BVS in the SB could have a long-term benefit in terms of restenosis.

  12. Hopping in a Molecular Wire

    Directory of Open Access Journals (Sweden)

    R. Marco

    2004-12-01

    Full Text Available We utilize the Hubbard model approach in analyzing the effect of the hopping parameter in the transport properties of a two-atom molecular device (Kostyrko & Bulka, 2003. The system consists of a molecule with two identical atoms connecting two metal electrodes. In this model, two important and realistic energy parameters are considered which affects the transport properties. The first is the kinetic energy required to “hop” from one atomic site to the next. We call this parameter the hopping term denoted by t, in arbitrary units of energy. The next is an on-site Coulombic repulsion, U, between two electrons on the same atomic site.

  13. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  14. Investigation of mechanism of bone regeneration in a porous biodegradable calcium phosphate (CaP) scaffold by a combination of a multi-scale agent-based model and experimental optimization/validation

    Science.gov (United States)

    Zhang, Le; Qiao, Minna; Gao, Hongjie; Hu, Bin; Tan, Hua; Zhou, Xiaobo; Li, Chang Ming

    2016-08-01

    Herein, we have developed a novel approach to investigate the mechanism of bone regeneration in a porous biodegradable calcium phosphate (CaP) scaffold by a combination of a multi-scale agent-based model, experimental optimization of key parameters and experimental data validation of the predictive power of the model. The advantages of this study are that the impact of mechanical stimulation on bone regeneration in a porous biodegradable CaP scaffold is considered, experimental design is used to investigate the optimal combination of growth factors loaded on the porous biodegradable CaP scaffold to promote bone regeneration and the training, testing and analysis of the model are carried out by using experimental data, a data-mining algorithm and related sensitivity analysis. The results reveal that mechanical stimulation has a great impact on bone regeneration in a porous biodegradable CaP scaffold and the optimal combination of growth factors that are encapsulated in nanospheres and loaded into porous biodegradable CaP scaffolds layer-by-layer can effectively promote bone regeneration. Furthermore, the model is robust and able to predict the development of bone regeneration under specified conditions.

  15. Combining microCT-based characterization with empirical modelling as a robust screening approach for the design of optimized CaP-containing scaffolds for progenitor cell-mediated bone formation.

    Science.gov (United States)

    Kerckhofs, G; Chai, Y C; Luyten, F P; Geris, L

    2016-04-15

    Biomaterials are a key ingredient to the success of bone tissue engineering (TE), which focuses on the healing of bone defects by combining scaffolds with cells and/or growth factors. Due to the widely variable material characteristics and patient-specificities, however, current bone TE strategies still suffer from low repeatability and lack of robustness, which hamper clinical translation. Hence, optimal TE construct (i.e. cells and scaffold) characteristics are still under debate. This study aimed to reduce the material-specific variability for cell-based construct design, avoiding trial-and-error, by combining microCT characterization and empirical modelling as an innovative and robust screening approach. Via microCT characterization we have built a quantitative construct library of morphological and compositional properties of six CE approved CaP-based scaffolds (CopiOs®, BioOss™, Integra Mozaik™, chronOS Vivify, MBCP™ and ReproBone™), and of their bone forming capacity and in vivo scaffold degradation when combined with human periosteal derived cells (hPDCs). The empirical model, based on the construct library, allowed identification of the construct characteristics driving optimized bone formation, i.e. (a) the percentage of β-TCP and dibasic calcium phosphate, (b) the concavity of the CaP structure, (c) the average CaP structure thickness and (d) the seeded cell amount (taking into account the seeding efficiency). Additionally, the model allowed to quantitatively predict the bone forming response of different hPDC-CaP scaffold combinations, thus providing input for a more robust design of optimized constructs and avoiding trial-and error. This could improve and facilitate clinical translation. Biomaterials that support regenerative processes are a key ingredient for successful bone tissue engineering (TE). However, the optimal scaffold structure is still under debate. In this study, we have provided a useful innovative approach for robust screening

  16. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  17. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  18. Headspace solid-phase microextraction combined with mass spectrometry as a powerful analytical tool for profiling the terpenoid metabolomic pattern of hop-essential oil derived from Saaz variety.

    Science.gov (United States)

    Gonçalves, João; Figueira, José; Rodrigues, Fátima; Câmara, José S

    2012-09-01

    Hop (Humulus lupulus L., Cannabaceae family) is prized for its essential oil contents, used in beer production and, more recently, in biological and pharmacological applications. In this work, a method involving headspace solid-phase microextraction and gas chromatography-mass spectrometry was developed and optimized to establish the terpenoid (monoterpenes and sesquiterpenes) metabolomic pattern of hop-essential oil derived from Saaz variety as a mean to explore this matrix as a powerful biological source for newer, more selective, biodegradable and naturally produced antimicrobial and antioxidant compounds. Different parameters affecting terpenoid metabolites extraction by headspace solid-phase microextraction were considered and optimized: type of fiber coatings, extraction temperature, extraction time, ionic strength, and sample agitation. In the optimized method, analytes were extracted for 30 min at 40°C in the sample headspace with a 50/30 μm divinylbenzene/carboxen/polydimethylsiloxane coating fiber. The methodology allowed the identification of a total of 27 terpenoid metabolites, representing 92.5% of the total Saaz hop-essential oil volatile terpenoid composition. The headspace composition was dominated by monoterpenes (56.1%, 13 compounds), sesquiterpenes (34.9%, 10), oxygenated monoterpenes (1.41%, 3), and hemiterpenes (0.04%, 1) some of which can probably contribute to the hop of Saaz variety aroma. Mass spectrometry analysis revealed that the main metabolites are the monoterpene β-myrcene (53.0 ± 1.1% of the total volatile fraction), and the cyclic sesquiterpenes, α-humulene (16.6 ± 0.8%), and β-caryophyllene (14.7 ± 0.4%), which together represent about 80% of the total volatile fraction from the hop-essential oil. These findings suggest that this matrix can be explored as a powerful biosource of terpenoid metabolites. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Scaffolded biology.

    Science.gov (United States)

    Minelli, Alessandro

    2016-09-01

    Descriptions and interpretations of the natural world are dominated by dichotomies such as organism vs. environment, nature vs. nurture, genetic vs. epigenetic, but in the last couple of decades strong dissatisfaction with those partitions has been repeatedly voiced and a number of alternative perspectives have been suggested, from perspectives such as Dawkins' extended phenotype, Turner's extended organism, Oyama's Developmental Systems Theory and Odling-Smee's niche construction theory. Last in time is the description of biological phenomena in terms of hybrids between an organism (scaffolded system) and a living or non-living scaffold, forming unit systems to study processes such as reproduction and development. As scaffold, eventually, we can define any resource used by the biological system, especially in development and reproduction, without incorporating it as happens in the case of resources fueling metabolism. Addressing biological systems as functionally scaffolded systems may help pointing to functional relationships that can impart temporal marking to the developmental process and thus explain its irreversibility; revisiting the boundary between development and metabolism and also regeneration phenomena, by suggesting a conceptual framework within which to investigate phenomena of regular hypermorphic regeneration such as characteristic of deer antlers; fixing a periodization of development in terms of the times at which a scaffolding relationship begins or is terminated; and promoting plant galls to legitimate study objects of developmental biology.

  20. Solution structure and DNA-binding properties of the winged helix domain of the meiotic recombination HOP2 protein.

    Science.gov (United States)

    Moktan, Hem; Guiraldelli, Michel F; Eyster, Craig A; Zhao, Weixing; Lee, Chih-Ying; Mather, Timothy; Camerini-Otero, R Daniel; Sung, Patrick; Zhou, Donghua H; Pezza, Roberto J

    2014-05-23

    The HOP2 protein is required for efficient double-strand break repair which ensures the proper synapsis of homologous chromosomes and normal meiotic progression. We previously showed that in vitro HOP2 shows two distinctive activities: when it is incorporated into a HOP2-MND1 heterodimer, it stimulates DMC1 and RAD51 recombination activities, and the purified HOP2 alone is proficient in promoting strand invasion. The structural and biochemical basis of HOP2 action in recombination are poorly understood; therefore, they are the focus of this work. Herein, we present the solution structure of the amino-terminal portion of mouse HOP2, which contains a typical winged helix DNA-binding domain. Together with NMR spectral changes in the presence of double-stranded DNA, protein docking on DNA, and mutation analysis to identify the amino acids involved in DNA coordination, our results on the three-dimensional structure of HOP2 provide key information on the fundamental structural and biochemical requirements directing the interaction of HOP2 with DNA. These results, in combination with mutational experiments showing the role of a coiled-coil structural feature involved in HOP2 self-association, allow us to explain important aspects of the function of HOP2 in recombination. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  2. Determination of volatile compounds in different hop varieties by headspace-trap GC/MS--in comparison with conventional hop essential oil analysis.

    Science.gov (United States)

    Aberl, Anita; Coelhan, Mehmet

    2012-03-21

    A headspace (HS)-trap method in combination with gas chromatography (GC)-mass spectrometry (MS) was developed for the determination of volatile constituents in hops. The highly sensitive HS-trap system reduces the detection limit by using up to four trap enrichment cycles. Seventy hop samples of different varieties and cultivation regions, from the 2008 harvest, were examined using the HS-trap-GC-MS method and the established "European Brewery Convention" (EBC) method for hop essential oil analysis. Twenty-one different volatiles were quantified for each hop sample. For all compounds, except caryophyllene oxide, a strong correlation was found between the results of the HS-trap method and the EBC method. Experiments have revealed that the EBC method using steam distillation is not appropriate for thermolabile compounds, such as caryophyllene oxide, due to decomposition during boiling. The HS-trap method is fast and sensitive, requires small sample amounts and minimal sample preparation, and is easy to apply.

  3. Repairing rabbit radial defects by combining bone marrow stroma stem cells with bone scaffold material comprising a core-cladding structure.

    Science.gov (United States)

    Wu, H; Liu, G H; Wu, Q; Yu, B

    2015-10-05

    We prepared a bone scaffold material comprising a PLGA/β-TCP core and a Type I collagen cladding, and recombined it with bone marrow stroma stem cells (BMSCs) to evaluate its potential for use in bone tissue engineering by in vivo and in vitro experiments. PLGA/β-TCP without a cladding was used for comparison. The adherence rate of the BMSCs to the scaffold was determined by cell counting. Cell proliferation rate was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method. The osteogenic capability was evaluated by alkaline phosphatase activity. The scaffold materials were recombined with the BMSCs and implanted into a large segmental rabbit radial defect model to evaluate defect repair. Osteogenesis was assessed in the scaffold materials by histological and double immunofluorescence labeling, etc. The adherence number, proliferation number, and alkaline phosphatase expression of the cells on the bone scaffold material with core-cladding structure were significantly higher than the corresponding values in the PLGA/β-TCP composite scaffold material (P structure completely degraded at the bone defect site and bone formation was completed. The rabbit large sentimental radial defect was successfully repaired. The degradation and osteogenesis rates matched well. The bone scaffold with core-cladding structure exhibited better osteogenic activity and capacity to repair a large segmental bone defect compared to the PLGA/β-TCP composite scaffold. The bone scaffold with core-cladding structure has excellent physical properties and biocompatibility. It is an ideal scaffold material for bone tissue engineering.

  4. Fundamentals of beer and hop chemistry

    OpenAIRE

    De Keukeleire, Denis

    2000-01-01

    Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is pla...

  5. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  6. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  7. In Vivo Evaluation of 3D-Printed Polycaprolactone Scaffold Implantation Combined with β-TCP Powder for Alveolar Bone Augmentation in a Beagle Defect Model

    Directory of Open Access Journals (Sweden)

    Su A. Park

    2018-02-01

    Full Text Available Insufficient bone volume is one of the major challenges encountered by dentists after dental implant placement. This study aimed to evaluate the efficacy of a customized three-dimensional polycaprolactone (3D PCL scaffold implant fabricated with a 3D bio-printing system to facilitate rapid alveolar bone regeneration. Saddle-type bone defects were surgically created on the healed site after extracting premolars from the mandibles of four beagle dogs. The defects were radiologically examined using computed tomography for designing a customized 3D PCL scaffold block to fit the defect site. After fabricating 3D PCL scaffolds using rapid prototyping, the scaffolds were implanted into the alveolar bone defects along with β-tricalcium phosphate powder. In vivo analysis showed that the PCL blocks maintained the physical space and bone conductivity around the defects. In addition, no inflammatory infiltrates were observed around the scaffolds. However, new bone formation occurred adjacent to the scaffolds, rather than directly in contact with them. More new bone was observed around PCL blocks with 400/1200 lattices than around blocks with 400/400 lattices, but the difference was not significant. These results indicated the potential of 3D-printed porous PCL scaffolds to promote alveolar bone regeneration for defect healing in dentistry.

  8. Free energy basin-hopping

    Science.gov (United States)

    Sutherland-Cash, K. H.; Wales, D. J.; Chakrabarti, D.

    2015-04-01

    A global optimisation scheme is presented using basin-hopping with the acceptance criterion based on approximate free energy for the corresponding local minima of the potential energy. The method is illustrated for atomic and colloidal clusters and peptides to examine how the predicted global free energy minimum changes with temperature. Using estimates for the local free energies based on harmonic vibrational densities of states provides a computationally effective framework for predicting trends in structure at finite temperature. The resulting scheme represents a powerful tool for exploration of energy landscapes throughout molecular science.

  9. Semiotic scaffolding

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2015-01-01

    implies that genes do not control the life of organisms, they merely scaffold it. The nature-nurture dynamics is thus far more complex and open than is often claimed. Contrary to physically based interactions, semiotic interactions do not depend on any direct causal connection between the sign vehicle......Life processes at all levels (from the genetic to the behavioral) are coordinated by semiotic interactions between cells, tissues, membranes, organs, or individuals and tuned through evolution to stabilize important functions. A stabilizing dynamics based on a system of semiotic scaffoldings...... (the representamen) and the effect. Semiotic interaction patterns therefore provide fast and versatile mechanisms for adaptations, mechanisms that depend on communication and “learning” rather than on genetic preformation. Seen as a stabilizing agency supporting the emergence of higher-order structure...

  10. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  11. Hops

    Science.gov (United States)

    ... by mouth for medicinal uses. Special precautions & warnings: Pregnancy and breast-feeding: There is not enough reliable ... that are changed by the liver include theophylline, omeprazole, clozapine, progesterone, lansoprazole, flutamide, oxaliplatin, erlotinib, and caffeine. ...

  12. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  13. Biomechanical differences between incline and plane hopping.

    Science.gov (United States)

    Kannas, Theodoros M; Kellis, Eleftherios; Amiridis, Ioannis G

    2011-12-01

    Kannas, TM, Kellis, E, and Amiridis, IG. Biomechanical differences between incline and plane hopping. J Strength Cond Res 25(12): 3334-3341, 2011-The need for the generation of higher joint power output during performance of dynamic activities led us to investigate the force-length relationship of the plantar flexors during consecutive stretch-shortening cycles of hopping. The hypothesis of this study was that hopping (consecutive jumps with the knee as straight as possible) on an inclined (15°) surface might lead to a better jumping performance compared with hopping on a plane surface (0°). Twelve active men performed 3 sets of 10 consecutive hops on both an incline and plane surface. Ground reaction forces; ankle and knee joint kinematics; electromyographic (EMG) activity from the medial gastrocnemius (MG), soleus (Sol) and tibialis anterior (TA); and architectural data from the MG were recorded. The results showed that participants jumped significantly higher (p plane surface (27.52 ± 4.97 cm). No differences in temporal characteristics between the 2 types of jumps were observed. Incline hopping induced significantly greater ankle dorsiflexion and knee extension at takeoff compared with plane hopping (p propulsion phase were significantly higher during incline compared with that during plane hopping (p plane surface.

  14. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  15. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  16. Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

    Science.gov (United States)

    Reglitz, Klaas; Steinhaus, Martin

    2017-03-22

    A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-(13C)methyl-4-sulfanyl(1,3,5-13C3)pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

  17. Protein sliding and hopping kinetics on DNA

    CERN Document Server

    DeSantis, Michael C; Wang, Y M

    2010-01-01

    Using Monte-Carlo simulations, we deconvolved the sliding and hopping kinetics of GFP-LacI proteins on elongated DNA from their experimentally observed seconds-long diffusion trajectories. Our simulations suggest the following results: (1) in each diffusion trajectory, a protein makes on average hundreds of alternating slides and hops with a mean sliding time of several tens of ms; (2) sliding dominates the root mean square displacement of fast diffusion trajectories, whereas hopping dominates slow ones; (3) flow and variations in salt concentration have limited effects on hopping kinetics, while in vivo DNA configuration is not expected to influence sliding kinetics; furthermore, (4) the rate of occurrence for hops longer than 200 nm agrees with experimental data for EcoRV proteins.

  18. Small polaron hopping transport along DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Simserides, C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Laboratory for Non-Invasive Brain Imaging, Brenneckestrasse 6, D-39118 Magdeburg (Germany); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, GR-15784 Zografos, Athens (Greece)

    2005-05-04

    We present a small polaron hopping model for interpreting the strong temperature (T) dependence of the electrical conductivity, {sigma}, observed at high (h) temperatures along DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. Percolation-theoretical considerations lead to analytical expressions for the high temperature multiphonon-assisted small polaron hopping conductivity, the hopping distance and their temperature dependence. The experimental data for lambda phage DNA ({lambda}-DNA) and poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behaviour (ln{sigma}{sup h}{proportional_to}T{sup -2/3}). Moreover, our model leads to realistic values of the maximum hopping distances, supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbours of the DNA molecular 'wire'. The low temperature case is also investigated.

  19. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Cooperative MIMO technology in multiple hops wireless sensor networks

    Science.gov (United States)

    Yuan, Lina; Chen, Huajun; Gong, Jing

    2017-03-01

    The limited lifetime is one of the important factors restricted wireless sensor networks (WSNs), when possible, wireless nodes often operate with small batteries, while battery replacement is a very difficult and expensive. So the nodes must work long hours in the case of no battery replacement. Therefore, in WSNs, minimizing energy consumption is an important design consideration, at the same time, the transmission strategies of energy efficiency must be used for data forwarding. This paper, using cooperative multiple input multiple output(MIMO) technology combined with multiple hops technology, has put forward a new transmission model, i.e., the MIMO-MISO(multi-input multi-output)/MIMO-MIMO model. Simulation results demonstrate the proposed MIMO-MISO/MIMO-MIMO to minimize energy consumption of each node every node for multi-hop WSNs, to save a great deal of energy for a larger transmission distance, which makes the life of the entire network be extended.

  1. Nerve Conduction Through Dendrites via Proton Hopping.

    Science.gov (United States)

    Kier, Lemont B

    2017-01-01

    In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Mixed quantum-classical equilibrium: Surface hopping.

    Science.gov (United States)

    Schmidt, J R; Parandekar, Priya V; Tully, John C

    2008-07-28

    We re-examine the analysis of the equilibrium limits of the fewest switches surface hopping algorithm for mixed quantum-classical dynamics. In contrast with previously reported results, we show that surface hopping does not, in general, exactly yield Boltzmann equilibrium, but that in practice the observed deviations are quite small. We also demonstrate that surface hopping does approach the exact equilibrium distribution in both the limits of small adiabatic splitting and/or strong nonadiabatic coupling. We verify these analytical results with numerical simulations for a simple two-level quantum system connected to a bath of classical particles.

  3. Steerable Hopping Six-Legged Robot

    Science.gov (United States)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that

  4. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  5. Collision-based mechanics of bipedal hopping

    National Research Council Canada - National Science Library

    Gutmann, Anne K; Lee, David V; McGowan, Craig P

    2013-01-01

    .... Previous studies have found that large bipedal hoppers can elastically store and return a large fraction of the energy required to hop, whereas small bipedal hoppers can only elastically store...

  6. Recombinant protein scaffolds for tissue engineering.

    Science.gov (United States)

    Werkmeister, Jerome A; Ramshaw, John A M

    2012-02-01

    New biological materials for tissue engineering are now being developed using common genetic engineering capabilities to clone and express a variety of genetic elements that allow cost-effective purification and scaffold fabrication from these recombinant proteins, peptides or from chimeric combinations of these. The field is limitless as long as the gene sequences are known. The utility is dependent on the ease, product yield and adaptability of these protein products to the biomedical field. The development of recombinant proteins as scaffolds, while still an emerging technology with respect to commercial products, is scientifically superior to current use of natural materials or synthetic polymer scaffolds, in terms of designing specific structures with desired degrees of biological complexities and motifs. In the field of tissue engineering, next generation scaffolds will be the key to directing appropriate tissue regeneration. The initial period of biodegradable synthetic scaffolds that provided shape and mechanical integrity, but no biological information, is phasing out. The era of protein scaffolds offers distinct advantages, particularly with the combination of powerful tools of molecular biology. These include, for example, the production of human proteins of uniform quality that are free of infectious agents and the ability to make suitable quantities of proteins that are found in low quantity or are hard to isolate from tissue. For the particular needs of tissue engineering scaffolds, fibrous proteins like collagens, elastin, silks and combinations of these offer further advantages of natural well-defined structural scaffolds as well as endless possibilities of controlling functionality by genetic manipulation.

  7. Cell–scaffold interaction within engineered tissue

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Haiping; Liu, Yuanyuan, E-mail: Yuanyuan_liu@shu.edu.cn; Jiang, Zhenglong; Chen, Weihua; Yu, Yongzhe; Hu, Qingxi

    2014-05-01

    The structure of a tissue engineering scaffold plays an important role in modulating tissue growth. A novel gelatin–chitosan (Gel–Cs) scaffold with a unique structure produced by three-dimensional printing (3DP) technology combining with vacuum freeze-drying has been developed for tissue-engineering applications. The scaffold composed of overall construction, micro-pore, surface morphology, and effective mechanical property. Such a structure meets the essential design criteria of an ideal engineered scaffold. The favorable cell–matrix interaction supports the active biocompatibility of the structure. The structure is capable of supporting cell attachment and proliferation. Cells seeded into this structure tend to maintain phenotypic shape and secreted large amounts of extracellular matrix (ECM) and the cell growth decreased the mechanical properties of scaffold. This novel biodegradable scaffold has potential applications for tissue engineering based upon its unique structure, which acts to support cell growth. - Highlights: • The scaffold is not only for providing a surface for cell residence but also for determining cell phenotype and retaining structural integrity. • The mechanical property of scaffold can be affected by activities of cell. • The scaffold provides a microenvironment for cell attachment, growth, and migration.

  8. Integration of intrinsic muscle properties, feed-forward and feedback signals for generating and stabilizing hopping.

    Science.gov (United States)

    Haeufle, D F B; Grimmer, S; Kalveram, K-T; Seyfarth, A

    2012-07-07

    It was hypothesized that a tight integration of feed-forward and feedback-driven muscle activation with the characteristic intrinsic muscle properties is a key feature of locomotion in challenging environments. In this simulation study it was investigated whether a combination of feed-forward and feedback signals improves hopping stability compared with those simulations with one individual type of activation. In a reduced one-dimensional hopping model with a Hill-type muscle (one contractile element, neither serial nor parallel elastic elements), the level of detail of the muscle's force-length-velocity relation and the type of activation generation (feed-forward, feedback and combination of both) were varied to test their influence on periodic hopping. The stability of the hopping patterns was evaluated by return map analysis. It was found that the combination of feed-forward and proprioceptive feedback improved hopping stability. Furthermore, the nonlinear Hill-type representation of intrinsic muscle properties led to a faster reduction of perturbations than a linear approximation, independent of the type of activation. The results emphasize the ability of organisms to exploit the stabilizing properties of intrinsic muscle characteristics.

  9. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  10. Solid-phase microextraction of hop volatiles. Potential use for determination and verification of hop varieties.

    Science.gov (United States)

    Kovacevic, M; Kac, M

    2001-05-18

    The composition of hop essential oil is an important tool for evaluation of hop quality. As each hop variety has a typical essential oil pattern (fingerprint), hop oil analyses can be used to distinguish between hop varieties. The headspace solid-phase microextraction (SPME) method as described in this contribution is a simple sample preparation technique and represents an alternative procedure for essential oil fingerprint determination. Different SPME parameters (extraction temperature, extraction time and sample mass) were studied and the results were compared with those obtained by the routine distillation method. It is shown that SPME results can be used for determination and verification of varieties grown in Slovenia by means of principal components analysis.

  11. The Osteogenic Potential of Human Non-differentiated and Pre-differentiated Mesenchymal Stem Cells Combined with an Osteoconductive Scaffold – Early Stage Healing

    Directory of Open Access Journals (Sweden)

    Luboš Tuček

    2017-06-01

    Full Text Available Despite the huge research into stem cells and their regenerative properties for bone healing, there are still unanswered questions including the recipient’s respond to the presence of the stem cells, the fate of stem cells inside the bone defect and the possible advantage in utilizing pre-differentiated cells. To address these problems, we used human multipotent mesenchymal stromal/stem cells (MSCs, GMP Grade, in a rat model of bone formation. In a “bioreactor concept” approach seven Wistar rats were implanted with 0.2 g of synthetic bone scaffold seeded with 2 × 106 MSCs, seven Wistar rats were implanted with 0.2 g of synthetic bone scaffold seeded with 1 × 106 predifferentiated osteoblasts and 1 × 106 pre-differentiated endothelial cells and 14 Wistar rats were implanted with 0.2 g of synthetic bone scaffold without seeded cells into an intramuscular pocket on the left side of their back. The right side of each rat was used as a control, and 0.2 g of synthetic bone scaffold was implanted into the intramuscular pocket alone. To see the early stage healing the samples were harvested 14 days after the implantation, MSCs were detected by positive DAPI and MTCO2 staining in 43% of all the samples implanted with MSCs, and no inflammation signs were present in any implanted animal. New vessels could be found in both groups implanted with MSCs, but not in the control group of animals. However, hematoxylin-eosin staining could not detect newly created bone within the implant in any of the groups. These results were in line with COLL1 staining, where we could detect positive staining only in three cases, all of which were implanted with un-differentiated MSCs. According to our findings, there were no benefits of using the pre-differentiated of MSC.

  12. The Osteogenic Potential of Human Nondifferentiated and Pre-differentiated Mesenchymal Stem Cells Combined with an Osteoconductive Scaffold - Early Stage Healing.

    Science.gov (United States)

    Tuček, Luboš; Kočí, Zuzana; Kárová, Kristýna; Doležalová, Helena; Suchánek, Jakub

    Despite the huge research into stem cells and their regenerative properties for bone healing, there are still unanswered questions including the recipient's respond to the presence of the stem cells, the fate of stem cells inside the bone defect and the possible advantage in utilizing pre-differentiated cells. To address these problems, we used human multipotent mesenchymal stromal/stem cells (MSCs), GMP Grade, in a rat model of bone formation. In a "bioreactor concept" approach seven Wistar rats were implanted with 0.2 g of synthetic bone scaffold seeded with 2 × 106 MSCs, seven Wistar rats were implanted with 0.2 g of synthetic bone scaffold seeded with 1 × 106 predifferentiated osteoblasts and 1 × 106 pre-differentiated endothelial cells and 14 Wistar rats were implanted with 0.2 g of synthetic bone scaffold without seeded cells into an intramuscular pocket on the left side of their back. The right side of each rat was used as a control, and 0.2 g of synthetic bone scaffold was implanted into the intramuscular pocket alone. To see the early stage healing the samples were harvested 14 days after the implantation, MSCs were detected by positive DAPI and MTCO2 staining in 43% of all the samples implanted with MSCs, and no inflammation signs were present in any implanted animal. New vessels could be found in both groups implanted with MSCs, but not in the control group of animals. However, hematoxylin-eosin staining could not detect newly created bone within the implant in any of the groups. These results were in line with COLL1 staining, where we could detect positive staining only in three cases, all of which were implanted with un-differentiated MSCs. According to our findings, there were no benefits of using the pre-differentiated of MSC.

  13. Scaffolder - software for manual genome scaffolding

    Directory of Open Access Journals (Sweden)

    Barton Michael D

    2012-05-01

    Full Text Available Abstract Background The assembly of next-generation short-read sequencing data can result in a fragmented non-contiguous set of genomic sequences. Therefore a common step in a genome project is to join neighbouring sequence regions together and fill gaps. This scaffolding step is non-trivial and requires manually editing large blocks of nucleotide sequence. Joining these sequences together also hides the source of each region in the final genome sequence. Taken together these considerations may make reproducing or editing an existing genome scaffold difficult. Methods The software outlined here, “Scaffolder,” is implemented in the Ruby programming language and can be installed via the RubyGems software management system. Genome scaffolds are defined using YAML - a data format which is both human and machine-readable. Command line binaries and extensive documentation are available. Results This software allows a genome build to be defined in terms of the constituent sequences using a relatively simple syntax. This syntax further allows unknown regions to be specified and additional sequence to be used to fill known gaps in the scaffold. Defining the genome construction in a file makes the scaffolding process reproducible and easier to edit compared with large FASTA nucleotide sequences. Conclusions Scaffolder is easy-to-use genome scaffolding software which promotes reproducibility and continuous development in a genome project. Scaffolder can be found at http://next.gs.

  14. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  15. Protein structure prediction using basin-hopping

    Science.gov (United States)

    Prentiss, Michael C.; Wales, David J.; Wolynes, Peter G.

    2008-06-01

    Associative memory Hamiltonian structure prediction potentials are not overly rugged, thereby suggesting their landscapes are like those of actual proteins. In the present contribution we show how basin-hopping global optimization can identify low-lying minima for the corresponding mildly frustrated energy landscapes. For small systems the basin-hopping algorithm succeeds in locating both lower minima and conformations closer to the experimental structure than does molecular dynamics with simulated annealing. For large systems the efficiency of basin-hopping decreases for our initial implementation, where the steps consist of random perturbations to the Cartesian coordinates. We implemented umbrella sampling using basin-hopping to further confirm when the global minima are reached. We have also improved the energy surface by employing bioinformatic techniques for reducing the roughness or variance of the energy surface. Finally, the basin-hopping calculations have guided improvements in the excluded volume of the Hamiltonian, producing better structures. These results suggest a novel and transferable optimization scheme for future energy function development.

  16. Determinants of Job Hopping Experience among Private and Public ...

    African Journals Online (AJOL)

    The results revealed that perceive organizational justice; job stress and job hopping significantly jointly predict employees' turnover intention. Additionally, job stress, job hopping and distributive justice which is one of the dimensions of organizational independently significantly predict employees' turnover intention.

  17. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  18. Bounds on the hop domination number of a tree

    Indian Academy of Sciences (India)

    A hop dominating set of a graph is a set of vertices of if for every vertex of () \\ D, there exists u ∈ D such that (, ) = 2. The hop domination number of a graph , denoted by ℎ(), is the minimum cardinality of a hop dominating set of . We prove that for every tree of order with leaves and support ...

  19. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  20. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  1. 21 CFR 172.560 - Modified hop extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Modified hop extract. 172.560 Section 172.560 Food... Flavoring Agents and Related Substances § 172.560 Modified hop extract. The food additive modified hop extract may be safely used in beer in accordance with the following prescribed conditions: (a) The food...

  2. Formation of proteoglycan and collagen-rich scaffold-free stiff cartilaginous tissue using two-step culture methods with combinations of growth factors.

    Science.gov (United States)

    Miyazaki, Tatsuya; Miyauchi, Satoshi; Matsuzaka, Satoshi; Yamagishi, Chie; Kobayashi, Kohei

    2010-05-01

    Tissue-engineered cartilage may be expected to serve as an alternative to autologous chondrocyte transplantation treatment. Several methods for producing cartilaginous tissue have been reported. In this study, we describe the production of scaffold-free stiff cartilaginous tissue of pig and human, using allogeneic serum and growth factors. The tissue was formed in a mold using chondrocytes recovered from alginate bead culture and maintained in a medium with transforming growth factor-beta and several other additives. In the case of porcine tissue, the tear strength of the tissue and the contents of proteoglycan (PG) and collagen per unit of DNA increased dose-dependently with transforming growth factor-beta. The length of culture was significantly and positively correlated with thickness, tear strength, and PG and collagen contents. Tear strength showed positive high correlations with both PG and collagen contents. A positive correlation was also seen between PG content and collagen content. Similar results were obtained with human cartilaginous tissue formed from chondrocytes expanded in monolayer culture. Further, an in vivo pilot study using pig articular cartilage defect model demonstrated that the cartilaginous tissue was well integrated with surrounding tissue at 13 weeks after the implantation. In conclusion, we successfully produced implantable scaffold-free stiff cartilaginous tissue, which characterized high PG and collagen contents.

  3. Interaction-induced hopping phase in driven-dissipative coupled photonic microcavities

    CERN Document Server

    Rodriguez, S R K; Sagnes, I; Gratiet, L Le; Galopin, E; Lemaitre, A; Bloch, J

    2016-01-01

    Bosons hopping across sites and interacting on-site are the essence of the Bose-Hubbard model (BHM). Inspired by the success of BHM simulators with atoms in optical lattices, proposals for implementing the BHM with photons in coupled nonlinear cavities have emerged. Two coupled semiconductor microcavities constitute a model system where the hopping, interaction, and decay of exciton polaritons --- mixed light-matter quasiparticles --- can be engineered in combination with site-selective coherent driving to implement the driven-dissipative two-site optical BHM. Here we explore the interplay of interference and nonlinearity in this system, in a regime where three distinct density profiles can be observed under identical driving conditions. We demonstrate how the phase acquired by polaritons hopping between cavities can be controlled through effective polariton-polariton interactions. Our results open new perspectives for synthesizing density-dependent gauge fields for polaritons in two-dimensional multicavity s...

  4. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  5. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  6. Bridge Hopping on Conducting Polymers in Solution

    OpenAIRE

    Hone, Daniel W.; Orland, Henri

    2000-01-01

    Configurational fluctuations of conducting polymers in solution can bring into proximity monomers which are distant from each other along the backbone. Electrons can hop between these monomers across the "bridges" so formed. We show how this can lead to (i) a collapse transition for metallic polymers, and (ii) to the observed dramatic efficiency of acceptor molecules for quenching fluorescence in semiconducting polymers.

  7. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  8. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  9. Tietoista liikettä : Hip hop -kulttuurin merkitys katutanssin opettamisessa

    OpenAIRE

    Pikkarainen, Sara

    2015-01-01

    Tutkimuksen lähtökohtana oli saada lisää tietoa siitä, kuinka keskeiseksi hip hop -kulttuurin ym-märtäminen koetaan osana tanssinopettajan ammattitaitoa. Tutkimuskysymykseni ovat: Miksi hip hop -kulttuurin ymmärtäminen on merkityksellistä tanssinopetuksen näkökulmasta? Miten hip hop -kulttuuri ilmenee katutanssinopetuksessa tanssikouluympäristössä? Jotta tutkimuskysymyksiin voidaan vastata, täytyy ymmärtää miten hip hop -kulttuuri on vaikuttanut hip hop -tanssin kehittymiseen ja miten hip...

  10. Surface-enrichment with hydroxyapatite nanoparticles in stereolithography-fabricated composite polymer scaffolds promotes bone repair

    NARCIS (Netherlands)

    Guillaume, O.; Geven, M. A.; Sprecher, C. M.; Stadelmann, V. A.; Grijpma, D. W.; Tang, T.T.; Qin, L.; Lai, Y.; Alini, M.; de Bruijn, J. D.; Yuan, H.; Richards, R.G.; Eglin, D.

    2017-01-01

    Fabrication of composite scaffolds using stereolithography (SLA) for bone tissue engineering has shown great promises. However, in order to trigger effective bone formation and implant integration, exogenous growth factors are commonly combined to scaffold materials. In this study, we fabricated

  11. Complex bifurcation lesions: Randomized comparison of a fully bioresorbable modified t stenting strategy versus bifurcation reconstruction with a dedicated self-expanding stent in combination with bioresorbable scaffolds, an OCT study: Rationale and design of the COBRA II trial.

    Science.gov (United States)

    Bennett, J; Adriaenssens, T; Desmet, W; Dubois, C

    2016-11-15

    There is an ongoing controversy regarding the efficacy and safety of different percutaneous stenting techniques for coronary bifurcation lesions needing >1 stent. The promise of safe vessel restoration with bioresorbable scaffolds (BRS) may not be transferable to complex double BRS bifurcation techniques, and permanent metallic scaffolding of the bifurcation core may be needed. We identified modified-T stenting as the most promising fully bioresorbable 2-stent strategy in a preclinical setting. The objective of this study is to assess acute performance and compare long-term vessel healing with this strategy, versus an approach combining BRS with a dedicated metallic drug-eluting bifurcation stent. In a single center, 60 consecutive patients with true and complex coronary bifurcation lesions will be randomly assigned to treatment with the dedicated self-expanding Axxess™ biolimus-eluting bifurcation stent in the proximal main vessel and additional Absorb™ everolimus-eluting BRS in the branches versus a modified T technique using Absorb™ only. Angiography and optical coherence tomography (OCT) will be performed immediately after implantation and at 30 months, and clinical follow-up is foreseen up to 5 years after implantation. The primary endpoint is the change in minimal luminal area assessed with OCT from baseline to 30 months in pre-specified bifurcation segments. To date the use of Absorb™ BRS in complex coronary bifurcations has not been evaluated in a randomized clinical trial setting. The COBRA II study will examine the role and safety of a double BRS strategy in coronary bifurcations, alone or in combination with a metallic dedicated bifurcation device. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Bridging defects in chronic spinal cord injury using peripheral nerve grafts combined with a chitosan-laminin scaffold and enhancing regeneration through them by co-transplantation with bone-marrow-derived mesenchymal stem cells: case series of 14 patients.

    Science.gov (United States)

    Amr, Sherif M; Gouda, Ashraf; Koptan, Wael T; Galal, Ahmad A; Abdel-Fattah, Dina Sabry; Rashed, Laila A; Atta, Hazem M; Abdel-Aziz, Mohammad T

    2014-01-01

    To investigate the effect of bridging defects in chronic spinal cord injury using peripheral nerve grafts combined with a chitosan-laminin scaffold and enhancing regeneration through them by co-transplantation with bone-marrow-derived mesenchymal stem cells. In 14 patients with chronic paraplegia caused by spinal cord injury, cord defects were grafted and stem cells injected into the whole construct and contained using a chitosan-laminin paste. Patients were evaluated using the International Standards for Classification of Spinal Cord Injuries. Chitosan disintegration leading to post-operative seroma formation was a complication. Motor level improved four levels in 2 cases and two levels in 12 cases. Sensory-level improved six levels in two cases, five levels in five cases, four levels in three cases, and three levels in four cases. A four-level neurological improvement was recorded in 2 cases and a two-level neurological improvement occurred in 12 cases. The American Spinal Impairment Association (ASIA) impairment scale improved from A to C in 12 cases and from A to B in 2 cases. Although motor power improvement was recorded in the abdominal muscles (2 grades), hip flexors (3 grades), hip adductors (3 grades), knee extensors (2-3 grades), ankle dorsiflexors (1-2 grades), long toe extensors (1-2 grades), and plantar flexors (0-2 grades), this improvement was too low to enable them to stand erect and hold their knees extended while walking unaided. Mesenchymal stem cell-derived neural stem cell-like cell transplantation enhances recovery in chronic spinal cord injuries with defects bridged by sural nerve grafts combined with a chitosan-laminin scaffold.

  13. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  14. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  15. Gender specific strategies in demanding hopping conditions.

    Science.gov (United States)

    Demirbüken, Ilkşan; Yurdalan, Saadet Ufuk; Savelberg, Hans; Meijer, Kenneth

    2009-01-01

    Difference in leg stiffness between females and males is considered to be a cause of higher rates of Anterior Cruciate Ligament injury in female athletes. Females are believed to have lower stiffness and as a consequence different recruitment strategies to adapt functional tasks. The aim of the current study was to evaluate how leg stiffness is tuned to demanding conditions. 22 healthy subjects (11 Male-11 Female; age: 20-43 years) participated in this study. Subjects performed two-legged hopping tasks (at their preferred rate, as fast as possible and with added mass of 10% bodyweight) on a force platform. Leg stiffness was calculated for each condition as the ratio between peak ground reaction force and vertical displacement of center of mass. In the preferred and added mass conditions males showed substantially higher leg stiffness than females (p= 0.006 and p = 0.002, respectively). When hopping as fast as possible the gender bias in leg stiffness disappeared (p = 0.880). Added mass had no significant effect on change in leg stiffness. Results have shown that females increased their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks (i.e.fastest hopping).The relationship between observed gender differences in leg stiffness and increased Anterior Cruciate Ligament injury rate in females requires further study. Key pointsLeg stiffness is an adaptable property of neuro musculoskeletal system to different functional loading conditions.Females can increase their leg stiffness more than males indicating they have no gender limiting capacity to reach objectives of higher demanding tasks as fastest hopping.

  16. Deodorant effects of a supercritical hops extract: antibacterial activity against Corynebacterium xerosis and Staphylococcus epidermidis and efficacy testing of a hops/zinc ricinoleate stick in humans through the sensory evaluation of axillary deodorancy.

    Science.gov (United States)

    Dumas, Elizabeth R; Michaud, Amy E; Bergeron, Chantal; Lafrance, Jennifer L; Mortillo, Susan; Gafner, Stefan

    2009-09-01

    There is little scientific evidence to support the efficacy of natural deodorants and therefore, such products may be perceived as inefficacious. The evaluation of the in vitro antibacterial activity of a hop extract and the evaluation of the odor-reducing capacity of a hops/zinc ricinoleate-containing product by a sensory evaluation panel is employed to verify deodorant performance. The goal of this study was to evaluate the in vitro antibacterial activity of a hop extract against Corynebacterium xerosis and Staphylococcus epidermidis and to verify in vivo deodorant performance of a hops/zinc ricinoleate-containing product. The hops extract was evaluated on a culture of an armpit swab from six volunteers. Furthermore, the extract was submitted to a zone of inhibition test and an agar-dilution assay against two major odor-causing bacteria. The clinical evaluation of the finished product was carried out according to a standard method for substantiating deodorant efficacy using trained odor judges for the assessment of axillary malodor (ASTM method E 1207-87 Standard Practice for the Sensory Evaluation of Axillary Deodorancy). The supercritical hops extract showed good antibacterial activities in all three tests. Minimum inhibitory concentration values of 6.25 and 25 mug/mL against C. xerosis and S. aureus, respectively, were obtained in the agar-dilution assay. In the clinical underarm odor-reduction evaluation, the mean malodor score dropped from 6.28 (+/-0.70) to 1.80 (+/-0.71) after 8 h of application. There was still a noticeable effect at both 12 and 24 h after the application, with a score of 1.82 (+/-0.74) and 2.24 (+/-0.77), respectively. The hops extract has good in vitro antibacterial properties and, in combination with zinc ricinoleate in an appropriate base, delivers in vivo odor reduction. The clinical efficacy is likely due to a combination of the base ingredients and the antibacterial actives.

  17. The dynamics of scaffolding

    NARCIS (Netherlands)

    Van Geert, P. L. C.; Steenbeek, H.W.

    2005-01-01

    In this article we have reinterpreted a relatively standard definition of scaffolding in the context of dynamic systems theory. Our main point is that scaffolding cannot be understood outside the context of a dynamic approach of learning and (formal or informal) teaching. We provide a dynamic

  18. Scaffolding students’ assignments

    DEFF Research Database (Denmark)

    Slot, Marie Falkesgaard

    2013-01-01

    This article discusses scaffolding in typical student assignments in mother tongue learning materials in upper secondary education in Denmark and the United Kingdom. It has been determined that assignments do not have sufficient scaffolding end features to help pupils understand concepts and build...

  19. Transplantation of adipose-derived stem cells combined with collagen scaffolds restores ovarian function in a rat model of premature ovarian insufficiency.

    Science.gov (United States)

    Su, Jing; Ding, Lijun; Cheng, Jie; Yang, Jun; Li, Xin'an; Yan, Guijun; Sun, Haixiang; Dai, Jianwu; Hu, Yali

    2016-05-01

    Does the transplantation of adipose-derived stem cells (ADSCs) on soluble collagen scaffolds (collagen/ADSCs) have better therapeutic effect than transplantation of ADSCs alone, to treat premature ovarian insufficiency (POI) in a rat model induced by Tripterygium Glycosides (TG)? The transplantation of collagen/ADSCs increased the short-term retention of ADSCs in ovaries and contributed to long-term restoration of ovarian function, as well as the fertility of rats with TG-induced ovarian damage. About 50% of young women in China, who have been treated with TG, have subsequently developed ovarian insufficiency. Rats exhibit similar symptoms to these patients when given an equivalent dose of TG. Transplantation of ADSCs improves ovarian function impaired by chemotherapy in rodent models. After the administration of TG, 54 POI model rats were randomly assigned to 4 groups: phosphate buffered saline (PBS) ( ITALIC! n = 14), collagen ( ITALIC! n = 11), ADSCs ( ITALIC! n = 16) and collagen/ADSCs ( ITALIC! n = 13). Seventeen normal rats were assigned as control group. The retention of ADSCs in ovaries was confirmed immediately or at 3, 7, 14 and 28 days after transplantation ( ITALIC! n = 9). Four weeks after transplantation, ovarian function was evaluated from estrous cycle, estradiol level, the follicle number, granulosa cell proliferation and a fertility test. To establish the POI model, rats were administered 60 mg TG/kg/day intragastrically for 50 days. The estrous cycles were assessed by vaginal smear. The concentration of plasma estradiol in diestrus stage was measured using a radioimmunoassay kit. Disordered estrous cycles and low serum estradiol levels indicated the successful establishment of the POI model. Four types of suspensions (PBS, collagen, ADSCs and collagen/ADSCs) were transplanted directly into the core of the ovaries. The short-term retention of ADSCs in ovaries was evaluated by small-animal positron emission tomography images immediately after

  20. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  1. Nonregenerative Dual-Hop Cooperative Links with Selection Diversity

    Directory of Open Access Journals (Sweden)

    Karagiannidis George K

    2006-01-01

    Full Text Available The end-to-end performance of dual-hop cooperative diversity systems equipped with nonregenerative relays and a selection combining receiver at the destination terminal over independent and nonidentical Nakagami- fading channels is studied. Closed-form expressions for the cumulative distribution function and the probability density function of the end-to-end signal-to-noise ratio ( are presented, while analytical formulae are derived for the moments and the moment generating function. Using these statistical results, closed-form expressions for the outage probability are presented for both channel state information and fixed gain relays. Furthermore, for the case of fixed gain relay, the average end-to-end , the amount of fading, and the average bit error rate can be numerically evaluated. The proposed mathematical analysis is complemented by numerical examples, including the effects on the overall performance of the s unbalancing as well as the fading severity.

  2. Bioactive Nano-fibrous Scaffold for Vascularized Craniofacial Bone Regeneration

    DEFF Research Database (Denmark)

    Prabha, Rahul Damodaran; Kraft, David Christian Evar; Harkness, Linda

    2017-01-01

    and biocompatibility properties of the new scaffold material. Our results indicate PVA-PCL-HAB scaffolds support attachment and growth of stromal stem cells; (human bone marrow skeletal (mesenchymal) stem cells (hMSC) and dental pulp stem cells (DPSC)). In addition, the scaffold supported in vitro osteogenic...... the limitation of cell penetration of electrospun scaffolds and improve on its osteoconductive nature, in this study, we fabricated a novel electrospun composite scaffold of polyvinyl alcohol (PVA) - poly (ε) caprolactone (PCL) - Bioceramic (HAB), namely, PVA-PCL-HAB. The scaffold prepared by dual...... electrospinning of PVA and PCL with HAB overcomes reduced cell attachment associated with hydrophobic poly (ε) caprolactone (PCL) by combination with a hydrophilic polyvinyl alcohol (PVA) and the bioceramic (HAB) can contribute to enhance osteo-conductivity. We characterized the physicochemical...

  3. Porous Biodegradable Metals for Hard Tissue Scaffolds: A Review

    Directory of Open Access Journals (Sweden)

    A. H. Yusop

    2012-01-01

    Full Text Available Scaffolds have been utilized in tissue regeneration to facilitate the formation and maturation of new tissues or organs where a balance between temporary mechanical support and mass transport (degradation and cell growth is ideally achieved. Polymers have been widely chosen as tissue scaffolding material having a good combination of biodegradability, biocompatibility, and porous structure. Metals that can degrade in physiological environment, namely, biodegradable metals, are proposed as potential materials for hard tissue scaffolding where biodegradable polymers are often considered as having poor mechanical properties. Biodegradable metal scaffolds have showed interesting mechanical property that was close to that of human bone with tailored degradation behaviour. The current promising fabrication technique for making scaffolds, such as computation-aided solid free-form method, can be easily applied to metals. With further optimization in topologically ordered porosity design exploiting material property and fabrication technique, porous biodegradable metals could be the potential materials for making hard tissue scaffolds.

  4. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  5. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  6. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  7. Impedance Spectroscopic Characterisation of Porosity in 3D Cell Culture Scaffolds with Different Channel Networks

    DEFF Research Database (Denmark)

    Canali, Chiara; Mohanty, Soumyaranjan; Heiskanen, Arto

    2015-01-01

    We present the application of electrochemical impedance spectroscopy (EIS) as a method for discriminating between different polydimethylsiloxane (PDMS) scaffolds for three-dimensional (3D) cell cultures. The validity of EIS characterisation for scaffolds having different degree of porosity...... serve as means of single-frequency measurements for fast scaffold characterization combined with in vitro monitoring of 3D cell cultures....

  8. Bioactive electrospun scaffolds delivering growth factors and genes for tissue engineering applications

    NARCIS (Netherlands)

    Ji, W.; Sun, Y.; Yang, F.; Beucken, J.J.J.P van den; Fan, M.; Chen, Z.; Jansen, J.A.

    2011-01-01

    A biomaterial scaffold is one of the key factors for successful tissue engineering. In recent years, an increasing tendency has been observed toward the combination of scaffolds and biomolecules, e.g. growth factors and therapeutic genes, to achieve bioactive scaffolds, which not only provide

  9. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  10. Pipefest hip hop -festivaalin markkinointiviestintä

    OpenAIRE

    Kallio, Timo

    2010-01-01

    Opinnäytetyöni aiheena oli Pipefest hip hop -festivaalien markkinointiviestinnän toteuttaminen. Olin ollut kävijänä tapahtumassa vuodesta 2003 lähtien, ja aloitettuani opinnot digitaalisen äänen ja kaupallisen musiikin suuntautumisvaihtoehdon linjalla, kiinnostuin tapahtuma- ja festivaalijärjestämisestä. Tutustuin tapahtumaa järjestävään tahoon ja aloin työstää Pipefestin markkinointiviestintää. Opintoihini kuuluneella tapahtumatuotannon kurssilla sain paljon oppia tapahtumatuotannosta t...

  11. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-02-13

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

  12. Maser Source-Finding Methods in HOPS

    Science.gov (United States)

    Walsh, A. J.; Purcell, C.; Longmore, S.; Jordan, C. H.; Lowe, V.

    2012-12-01

    The H2O Southern Galactic Plane Survey (HOPS) has observed 100 deg2 of the Galactic plane, using the Mopra radio telescope to search for emission from multiple spectral lines in the 12-mm band (19.5-27.5GHz). Perhaps the most important of these spectral lines is the 22.2-GHz water-maser transition. We describe the methods used to identify water-maser candidates and subsequent confirmation of the sources. Our methods involve a simple determination of likely candidates by searching peak emission maps, utilising the intrinsic nature of water-maser emission, spatially unresolved and spectrally narrow-lined. We estimate completeness limits and compare our method with results from the DUCHAMP source finder. We find that the two methods perform similarly. We conclude that the similarity in performance is due to the intrinsic limitation of the noise characteristics of the data. The advantages of our method are that it is slightly more efficient in eliminating spurious detections and is simple to implement. The disadvantage is that it is a manual method of finding sources and so is not practical on datasets much larger than HOPS, or for datasets with extended emission that needs to be characterised. We outline a two-stage method for the most efficient means of finding masers, using DUCHAMP.

  13. Potential African Substitutes for Hops in Tropical Beer Brewing ...

    African Journals Online (AJOL)

    Proximate analysis showed that these vegetables had protein and crude fibre values comparable to those of commercial hops. Fat content values were however much higher than those for hops with Grongonema latifolium having the highest values of 19.10%. Garcinia cola with a total resin value of 8.24% and an essential ...

  14. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  15. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  16. Factors of Intensification in the Hops Cluster of Chuvashia

    Science.gov (United States)

    Zakharov, Anatoly I.; Evgrafov, Oleg V.; Zakharov, Dmitry A.; Ivanova, Elena V.; Tolstova, Marija L.; Tsaregorodtsev, Evgeny I.

    2016-01-01

    The complex analysis of development of hop-growing for 1971-2015 is carried out. In the conditions of the field experiment made in the Chuvash Republic hop-growing intensification elements--technology of its cultivation, mechanization are fulfilled. Based on researches it is established that the main internal allowance of increase in efficiency of…

  17. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  18. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  19. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  20. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  1. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  2. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  3. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  4. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  5. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  6. Use of hop extract as antifungal ingredient for bread making and selection of autochthonous resistant starters for sourdough fermentation.

    Science.gov (United States)

    Nionelli, Luana; Pontonio, Erica; Gobbetti, Marco; Rizzello, Carlo Giuseppe

    2018-02-02

    Aiming at meeting the consumers' demand in terms of bio-preservation, the potential of the combination of the lactic acid bacteria fermentation and the addition of hop extract as natural preservative in breadmaking, was exploited. The antifungal properties of a hop (Humulus lupulus) extract were investigated, showing a significant inhibition of the hyphal growth of Aspergillus parasiticus, Penicillium carneum, Penicillium polonicum, Penicillium paneum, Penicillium chermesinum, Aspergillus niger, Penicillium roqueforti. Lactic acid bacteria belonging to species of Enterococcus feacium, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus helveticus, Lactobacillus curvatus, Pediococcus pentosaceus, and Pediococcus acidilactici were isolated from hop and subjected to selection based on kinetics of growth and acidification. The sourdough (hS) enriched with hop extract (hE), started with three selected strains, had phenols concentration and antioxidant activity higher than those obtained in the same condition but without the hE. Hop-sourdough used in breadmaking delayed the fungal growth (14 days), giving a bread characterized by free aminoacids concentration, antioxidant and phytase activities higher than bread started only with baker's yeast, with or without the addition of hE. Specific volume and cell-total area of the bread containing hE improved, and its sensory profile was characterized by typical sourdough attributes, and a moderate bitter/herbaceous perception.

  7. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  8. Enhancing Network Quality using Baseband Frequency Hopping, Downlink Power Control and DTX in a Live GSM Network

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wagard, Jeroen; Skjærris, Søren

    1998-01-01

    Baseband frequency hopping in the combination with downlink power control and discontinuous transmission has been investigated as a quality improving feature in a live GSM network. Using the dropped call rate and the frame erasure rate to measure the network quality, the use of frequency hopping...... to the statistical inaccuracy with discontinuous transmission in GSM and maybe due to poor performance of the mobile stations, was encountered. The current status is therefore to reject the use of downlink discontinuous transmission until more information about the performance of the mobile stations is found...

  9. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  10. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  11. Resource Allocation in a Frequency Hopping PCS1900/GSM/DCS1800 Type of Network

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wigard, Jeroen; Michaelsen, Per-Henrik

    1999-01-01

    Resource allocation in a frequency hopping network is even more problematic than in a traditional network. The combined effect from all serving frequencies has to be considered directly in the allocation process. An algorithm doing this for a PCS1900/GSM/DCS1800 type of network is presented...

  12. [Strategies to choose scaffold materials for tissue engineering].

    Science.gov (United States)

    Gao, Qingdong; Zhu, Xulong; Xiang, Junxi; Lü, Yi; Li, Jianhui

    2016-02-01

    mixed with sustained-release nano-microsphere containing growth factors. What's more, the stent internal surface coated with glue/collagen matrix mixing layer containing bFGF and EGF so could supplying the early release of the two cytokines. Finally, combining the poly(L-lactic acid)/poly(ε-caprolactone) biliary stent with the induced cells was the last step for preparing tissue-engineered bile duct. This literature reviewed a variety of the existing tissue engineering scaffold materials and briefly introduced the impact factors on the characteristics of tissue engineering scaffold materials such as preparation procedure, surface modification of scaffold, and so on. We explored the choosing strategy of desired tissue engineering scaffold materials.

  13. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  14. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  15. Job-hopping and New Firm Survival

    DEFF Research Database (Denmark)

    Failla, Virgilio

    for this theory, little is known about the characteristics of this so called `balanced´ skills set. Do entrepreneurial outcomes of individuals presenting a highly varied work experiences differ from entrepreneurs with a less varied career' In particular, how do the characteristics of the entrepreneurs´ job...... is the right experience that enhances the new ventures´ performances. Fallick, Fleischman and Reibtzer (1996) argue that frequent job-hopping facilitates the rapid reallocation of resources toward firms with the best innovations. This could be the result of the fact that especially high quality individuals who...... employed in the start-up they founded. This initial evidence suggests that successful jack-of-all trades are people who do not wander across industries, but those who accumulate a variety of experiences by occupying different roles in the parent organization....

  16. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  17. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  18. New therapy of skin repair combining adipose-derived mesenchymal stem cells with sodium carboxymethylcellulose scaffold in a pre-clinical rat model.

    Directory of Open Access Journals (Sweden)

    Cristiano Rodrigues

    Full Text Available Lesions with great loss of skin and extensive burns are usually treated with heterologous skin grafts, which may lead rejection. Cell therapy with mesenchymal stem cells is arising as a new proposal to accelerate the healing process. We tested a new therapy consisting of sodium carboxymethylcellulose (CMC as a biomaterial, in combination with adipose-derived stem cells (ADSCs, to treat skin lesions in an in vivo rat model. This biomaterial did not affect membrane viability and induced a small and transient genotoxicity, only at the highest concentration tested (40 mg/mL. In a rat wound model, CMC at 10 mg/mL associated with ADSCs increased the rate of cell proliferation of the granulation tissue and epithelium thickness when compared to untreated lesions (Sham, but did not increase collagen fibers nor alter the overall speed of wound closure. Taken together, the results show that the CMC is capable to allow the growth of ADSCs and is safe for this biological application up to the concentration of 20 mg/mL. These findings suggest that CMC is a promising biomaterial to be used in cell therapy.

  19. New Therapy of Skin Repair Combining Adipose-Derived Mesenchymal Stem Cells with Sodium Carboxymethylcellulose Scaffold in a Pre-Clinical Rat Model

    Science.gov (United States)

    Rodrigues, Cristiano; de Assis, Adriano M.; Moura, Dinara J.; Halmenschlager, Graziele; Saffi, Jenifer; Xavier, Léder Leal; da Cruz Fernandes, Marilda; Wink, Márcia Rosângela

    2014-01-01

    Lesions with great loss of skin and extensive burns are usually treated with heterologous skin grafts, which may lead rejection. Cell therapy with mesenchymal stem cells is arising as a new proposal to accelerate the healing process. We tested a new therapy consisting of sodium carboxymethylcellulose (CMC) as a biomaterial, in combination with adipose-derived stem cells (ADSCs), to treat skin lesions in an in vivo rat model. This biomaterial did not affect membrane viability and induced a small and transient genotoxicity, only at the highest concentration tested (40 mg/mL). In a rat wound model, CMC at 10 mg/mL associated with ADSCs increased the rate of cell proliferation of the granulation tissue and epithelium thickness when compared to untreated lesions (Sham), but did not increase collagen fibers nor alter the overall speed of wound closure. Taken together, the results show that the CMC is capable to allow the growth of ADSCs and is safe for this biological application up to the concentration of 20 mg/mL. These findings suggest that CMC is a promising biomaterial to be used in cell therapy. PMID:24788779

  20. Holstein polarons and triplet bipolarons with NNN hopping

    Science.gov (United States)

    Chakraborty, Monodeep; Taraphder, A.; Berciu, Mona

    2017-05-01

    We study the ground state of 1D Holstein single polaron with next nearest neighbour electron hopping (NNN), employing a variational approximation based on exact diagonalization. Our investigation reveals that, depending upon the sign and magnitude of the NNN hopping integral with respect to nearest neighbour hopping, the polaron band minima may occur at non-zero kGS. We compare the present scenario with the SSH polarons, where a similar feature is also observed, albeit, due to very different mechanism. Our initial investigation of triplet bipolarons, in presence of an attractive extended Hubbard interactions, further substantiates the differences between the present model and the SSH model.

  1. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  2. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  3. Macromolecular multi-chromophoric scaffolding

    NARCIS (Netherlands)

    Schwartz, E.; Schwartz, Erik; Le Gac, Stephane; le Gac, Severine; Cornelissen, Jeroen Johannes Lambertus Maria; Nolte, Roeland J.M.; Rowan, Alan E.

    2010-01-01

    This critical review describes recent efforts in the field of chromophoric scaffolding. The advances in this research area, with an emphasis on rigid scaffolds, for example, synthetic polymers, carbon nanotubes (CNTs), nucleic acids, and viruses, are presented (166 references).

  4. Biomimetic Scaffolds for Osteogenesis

    Science.gov (United States)

    Yuan, Nance; Rezzadeh, Kameron S.; Lee, Justine C.

    2015-01-01

    Skeletal regenerative medicine emerged as a field of investigation to address large osseous deficiencies secondary to congenital, traumatic, and post-oncologic conditions. Although autologous bone grafts have been the gold standard for reconstruction of skeletal defects, donor site morbidity remains a significant limitation. To address these limitations, contemporary bone tissue engineering research aims to target delivery of osteogenic cells and growth factors in a defined three dimensional space using scaffolding material. Using bone as a template, biomimetic strategies in scaffold engineering unite organic and inorganic components in an optimal configuration to both support osteoinduction as well as osteoconduction. This article reviews the various structural and functional considerations behind the development of effective biomimetic scaffolds for osteogenesis and highlights strategies for enhancing osteogenesis. PMID:26413557

  5. Semiotic Scaffolding in Mathematics

    DEFF Research Database (Denmark)

    Johansen, Mikkel Willum; Misfeldt, Morten

    2015-01-01

    This paper investigates the notion of semiotic scaffolding in relation to mathematics by considering its influence on mathematical activities, and on the evolution of mathematics as a research field. We will do this by analyzing the role different representational forms play in mathematical...... cognition, and more broadly on mathematical activities. In the main part of the paper, we will present and analyze three different cases. For the first case, we investigate the semiotic scaffolding involved in pencil and paper multiplication. For the second case, we investigate how the development of new...... in both mathematical cognition and in the development of mathematics itself, but mathematical cognition cannot itself be reduced to the use of semiotic scaffolding....

  6. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  7. Possible functional scaffolds for periodontal regeneration

    Directory of Open Access Journals (Sweden)

    Hidetoshi Shimauchi

    2013-11-01

    Full Text Available Periodontal diseases are the most prevalent infectious diseases with the irreversible loss of tooth supporting apparatus. To reestablish the stable health of periodontal tissues after healing, the concept of regenerative surgical procedures has been developed over the past three decades, including various grafting materials, guided tissue regeneration (GTR, and the use of enamel matrix derivatives (EMD in a clinical setting. More recently, tissue engineering strategies have also been applied and developed for periodontal regeneration: (1 stem cell therapies; (2 recombinant human growth factor therapies; (3 combined use of cell and growth factors with matrix-based scaffolds. However, the complete and predictable reconstruction of healthy periodontal tissues still remains a challenging field. To overcome therapeutic limitations and develop stem cell-based strategies, it is necessary to optimize cell–scaffold combinations by understanding the cellular events during periodontal wound healing and regeneration. We reviewed: (1 the current status and strategies for periodontal regeneration; (2 a possible biomaterial design for the scaffold used in periodontal tissue engineering; (3 a possible interaction between scaffold materials and periodontal tissue cells.

  8. Field dependence of hopping mobility: Lattice models against spatial disorder

    Science.gov (United States)

    Oelerich, J. O.; Nenashev, A. V.; Dvurechenskii, A. V.; Gebhard, F.; Baranovskii, S. D.

    2017-11-01

    The theoretical description of the effect of the electric field F on the hopping mobility μ belongs to the not-yet-resolved problems related to charge transport in disordered materials. An often proposed solution is to simulate hopping transport via sites placed on regular grids and to fit the results by phenomenological equations. This approach currently dominates the theoretical research of hopping transport in organic disordered semiconductors. We show that the dependence μ (F ) in the case of regular grids can drastically differ from that in systems with spatial disorder. While μ increases with F on lattices, it can decrease in random systems with the same material parameters. Moreover, the material parameters responsible for the dependence μ (F ) on lattices differ from those responsible for μ (F ) in spatially disordered systems, which makes lattice models inappropriate for studying the field dependence of the hopping mobility.

  9. Two-Hop Secure Communication Using an Untrusted Relay

    National Research Council Canada - National Science Library

    He, Xiang; Yener, Aylin

    2009-01-01

    .... Yet, the information it relays needs to be kept secret from it. In this two-hop communication scenario, where the use of the untrusted relay node is essential, we find that a positive secrecy rate is achievable...

  10. Hip Hop Dance Experience Linked to Sociocognitive Ability

    National Research Council Canada - National Science Library

    Justin W Bonny; Jenna C Lindberg; Marc C Pacampara

    2017-01-01

    .... In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability...

  11. Hopping trajectory optimization for surface exploration on small bodies

    Science.gov (United States)

    Liu, Yanjie; Zhu, Shengying; Cui, Pingyuan; Yu, Zhengshi; Zong, Hua

    2017-07-01

    Surface exploration is an important way to improve the understanding of small bodies. Considering the irregular and weak gravity field near a small body, the movement of the surface explorer is generally achieved by hopping. In this paper, a guidance algorithm method based on convex optimization approach for pinpoint hopping movement on a small body is developed in order to improve the stability and accuracy of surface exploration. We formulate a fuel-optimal control problem for the single pinpoint hopping and convert it into a second-order cone programming (SOCP) problem which can be solved effectively by primal-dual-interior points method. A multi-hopping scenario is also proposed for the long-distance transfer. To certificate the performance of the proposed guidance algorithm, a full set of simulations are conducted and the effectiveness are analyzed.

  12. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    Pospíšil, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  13. Bone tissue engineering scaffolding: computer-aided scaffolding techniques.

    Science.gov (United States)

    Thavornyutikarn, Boonlom; Chantarapanich, Nattapon; Sitthiseripratip, Kriskrai; Thouas, George A; Chen, Qizhi

    Tissue engineering is essentially a technique for imitating nature. Natural tissues consist of three components: cells, signalling systems (e.g. growth factors) and extracellular matrix (ECM). The ECM forms a scaffold for its cells. Hence, the engineered tissue construct is an artificial scaffold populated with living cells and signalling molecules. A huge effort has been invested in bone tissue engineering, in which a highly porous scaffold plays a critical role in guiding bone and vascular tissue growth and regeneration in three dimensions. In the last two decades, numerous scaffolding techniques have been developed to fabricate highly interconnective, porous scaffolds for bone tissue engineering applications. This review provides an update on the progress of foaming technology of biomaterials, with a special attention being focused on computer-aided manufacturing (Andrade et al. 2002) techniques. This article starts with a brief introduction of tissue engineering (Bone tissue engineering and scaffolds) and scaffolding materials (Biomaterials used in bone tissue engineering). After a brief reviews on conventional scaffolding techniques (Conventional scaffolding techniques), a number of CAM techniques are reviewed in great detail. For each technique, the structure and mechanical integrity of fabricated scaffolds are discussed in detail. Finally, the advantaged and disadvantage of these techniques are compared (Comparison of scaffolding techniques) and summarised (Summary).

  14. HapHop-Physio: a computer game to support cognitive therapies in children.

    Science.gov (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch(®) platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  15. Fabrication and characterization of novel nano-biocomposite scaffold of chitosan–gelatin–alginate–hydroxyapatite for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Chhavi, E-mail: chhavisharma19@gmail.com [Department of Polymer and Process Engineering, Indian Institute of Technology Roorkee, Roorkee (India); Dinda, Amit Kumar, E-mail: amit_dinda@yahoo.com [Department of Molecular Medicine and Biology, Jaslok Hospital and Research Centre, Mumbai 400 026 (India); Potdar, Pravin D., E-mail: ppotdar@jaslokhospital.net [Department of Pathology, All India Institute of Medical Sciences, New Delhi 110029 (India); Chou, Chia-Fu, E-mail: cfchou@phys.sinica.edu.tw [Institute of Physics, Academia Sinica, Taipei 11529, Taiwan (China); Mishra, Narayan Chandra, E-mail: mishrawise@gmail.com [Department of Polymer and Process Engineering, Indian Institute of Technology Roorkee, Roorkee (India)

    2016-07-01

    A novel nano-biocomposite scaffold was fabricated in bead form by applying simple foaming method, using a combination of natural polymers–chitosan, gelatin, alginate and a bioceramic–nano-hydroxyapatite (nHAp). This approach of combining nHAp with natural polymers to fabricate the composite scaffold, can provide good mechanical strength and biological property mimicking natural bone. Environmental scanning electron microscopy (ESEM) images of the nano-biocomposite scaffold revealed the presence of interconnected pores, mostly spread over the whole surface of the scaffold. The nHAp particulates have covered the surface of the composite matrix and made the surface of the scaffold rougher. The scaffold has a porosity of 82% with a mean pore size of 112 ± 19.0 μm. Swelling and degradation studies of the scaffold showed that the scaffold possesses excellent properties of hydrophilicity and biodegradability. Short term mechanical testing of the scaffold does not reveal any rupturing after agitation under physiological conditions, which is an indicative of good mechanical stability of the scaffold. In vitro cell culture studies by seeding osteoblast cells over the composite scaffold showed good cell viability, proliferation rate, adhesion and maintenance of osteoblastic phenotype as indicated by MTT assay, ESEM of cell–scaffold construct, histological staining and gene expression studies, respectively. Thus, it could be stated that the nano-biocomposite scaffold of chitosan–gelatin–alginate–nHAp has the paramount importance for applications in bone tissue-engineering in future regenerative therapies. - Highlights: • nHAp–chitosan–gelatin–alginate composite scaffold was successfully fabricated. • Foaming method, without surfactant, was applied successfully for fabricating the scaffold. • nHAp provided mechanical stability and nanotopographic features to scaffold matrix. • This scaffold shows good biocompatibility and proliferation with

  16. Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states.

    Science.gov (United States)

    Humeniuk, Alexander; Mitrić, Roland

    2016-06-21

    A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully's fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronic wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.

  17. Scaffolding Reading Comprehension Skills

    Science.gov (United States)

    Salem, Ashraf Atta Mohamed Safein

    2017-01-01

    The current study investigates whether English language teachers use scaffolding strategies for developing their students' reading comprehension skills or just for assessing their comprehension. It also tries to demonstrate whether teachers are aware of these strategies or they use them as a matter of habit. A questionnaire as well as structured…

  18. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  19. Nano/macro porous bioactive glass scaffold

    Science.gov (United States)

    Wang, Shaojie

    Bioactive glass (BG) and ceramics have been widely studied and developed as implants to replace hard tissues of the musculo-skeletal system, such as bones and teeth. Recently, instead of using bulk materials, which usually do not degrade rapidly enough and may remain in the human body for a long time, the idea of bioscaffold for tissue regeneration has generated much interest. An ideal bioscaffold is a porous material that would not only provide a three-dimensional structure for the regeneration of natural tissue, but also degrade gradually and, eventually be replaced by the natural tissue completely. Among various material choices the nano-macro dual porous BG appears as the most promising candidate for bioscaffold applications. Here macropores facilitate tissue growth while nanopores control degradation and enhance cell response. The surface area, which controls the degradation of scaffold can also be tuned by changing the nanopore size. However, fabrication of such 3D structure with desirable nano and macro pores has remained challenging. In this dissertation, sol-gel process combined with spinodal decomposition or polymer sponge replication method has been developed to fabricate the nano-macro porous BG scaffolds. Macropores up to 100microm are created by freezing polymer induced spinodal structure through sol-gel transition, while larger macropores (>200um) of predetermined size are obtained by the polymer sponge replication technique. The size of nanopores, which are inherent to the sol-gel method of glass fabrication, has been tailored using several approaches: Before gel point, small nanopores are generated using acid catalyst that leads to weakly-branched polymer-like network. On the other hand, larger nanopores are created with the base-catalyzed gel with highly-branched cluster-like structure. After the gel point, the nanostructure can be further modified by manipulating the sintering temperature and/or the ammonia concentration used in the solvent

  20. Hip Hop Syllabus: AME/MUS 303 Hip Hop: Art, Culture, and Politics

    Directory of Open Access Journals (Sweden)

    Sarah Hentges

    2013-10-01

    Full Text Available This syllabus represents a course taught online through the University of Maine at Augusta in the fall of 2011 (and every otheryear thereafter. Critical pedagogy can be a challenge in any classroom, and the challenges in an online classroom are compounded. However, the subject matter and approach of Hip Hop can be a powerful tool in teaching students critical thinking skills as well in laying a foundation for interdisciplinary and intersectional theory; here these elements are represented through curriculum—the themes, texts, contexts,approaches, structure, and assignments.

  1. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  2. Assimilation and Hip-Hop : Interethnic Relations and the Americanization of New Immigrants in Hip-Hop Culture

    OpenAIRE

    Aahlin, Audun Kjus

    2013-01-01

    The conflict thesis and the segmented assimilation theory account for two of the most significant trends in American immigration and ethnicity studies. Both of these major theoretical styles are utterly pessimistic towards interethnic relations in the United States and assimilation into African American urban culture. I have asked in this thesis if the experiences and the history of hip-hop culture can counterbalance these negative interpretations of interethnic relations. Hip-hop culture has...

  3. Design, construction and mechanical testing of digital 3D anatomical data-based PCL-HA bone tissue engineering scaffold.

    Science.gov (United States)

    Yao, Qingqiang; Wei, Bo; Guo, Yang; Jin, Chengzhe; Du, Xiaotao; Yan, Chao; Yan, Junwei; Hu, Wenhao; Xu, Yan; Zhou, Zhi; Wang, Yijin; Wang, Liming

    2015-01-01

    The study aims to investigate the techniques of design and construction of CT 3D reconstructional data-based polycaprolactone (PCL)-hydroxyapatite (HA) scaffold. Femoral and lumbar spinal specimens of eight male New Zealand white rabbits were performed CT and laser scanning data-based 3D printing scaffold processing using PCL-HA powder. Each group was performed eight scaffolds. The CAD-based 3D printed porous cylindrical stents were 16 piece × 3 groups, including the orthogonal scaffold, the Pozi-hole scaffold and the triangular hole scaffold. The gross forms, fiber scaffold diameters and porosities of the scaffolds were measured, and the mechanical testing was performed towards eight pieces of the three kinds of cylindrical scaffolds, respectively. The loading force, deformation, maximum-affordable pressure and deformation value were recorded. The pore-connection rate of each scaffold was 100 % within each group, there was no significant difference in the gross parameters and micro-structural parameters of each scaffold when compared with the design values (P > 0.05). There was no significant difference in the loading force, deformation and deformation value under the maximum-affordable pressure of the three different cylinder scaffolds when the load was above 320 N. The combination of CT and CAD reverse technology could accomplish the design and manufacturing of complex bone tissue engineering scaffolds, with no significant difference in the impacts of the microstructures towards the physical properties of different porous scaffolds under large load.

  4. Acellular organ scaffolds for tumor tissue engineering

    Science.gov (United States)

    Guller, Anna; Trusova, Inna; Petersen, Elena; Shekhter, Anatoly; Kurkov, Alexander; Qian, Yi; Zvyagin, Andrei

    2015-12-01

    Rationale: Tissue engineering (TE) is an emerging alternative approach to create models of human malignant tumors for experimental oncology, personalized medicine and drug discovery studies. Being the bottom-up strategy, TE provides an opportunity to control and explore the role of every component of the model system, including cellular populations, supportive scaffolds and signalling molecules. Objectives: As an initial step to create a new ex vivo TE model of cancer, we optimized protocols to obtain organ-specific acellular matrices and evaluated their potential as TE scaffolds for culture of normal and tumor cells. Methods and results: Effective decellularization of animals' kidneys, ureter, lungs, heart, and liver has been achieved by detergent-based processing. The obtained scaffolds demonstrated biocompatibility and growthsupporting potential in combination with normal (Vero, MDCK) and tumor cell lines (C26, B16). Acellular scaffolds and TE constructs have been characterized and compared with morphological methods. Conclusions: The proposed methodology allows creation of sustainable 3D tumor TE constructs to explore the role of organ-specific cell-matrix interaction in tumorigenesis.

  5. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage

    Directory of Open Access Journals (Sweden)

    Ziola Barry

    2009-09-01

    Full Text Available Abstract Background Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol. Use of antimicrobial compounds (e.g., hop-compounds, Penicillin by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Results Lactic acid bacteria susceptibility test broth medium (LSM used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Conclusion Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  6. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  7. Scaffolding Student Participation in Mathematical Practices

    Science.gov (United States)

    Moschkovich, Judit N.

    2015-01-01

    The concept of scaffolding can be used to describe various types of adult guidance, in multiple settings, across different time scales. This article clarifies what we mean by scaffolding, considering several questions specifically for scaffolding in mathematics: What theoretical assumptions are framing scaffolding? What is being scaffolded? At…

  8. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...

  9. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  10. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  11. A biomimetic three-dimensional woven composite scaffold for functional tissue engineering of cartilage

    Science.gov (United States)

    Moutos, Franklin T.; Freed, Lisa E.; Guilak, Farshid

    2007-02-01

    Tissue engineering seeks to repair or regenerate tissues through combinations of implanted cells, biomaterial scaffolds and biologically active molecules. The rapid restoration of tissue biomechanical function remains an important challenge, emphasizing the need to replicate structural and mechanical properties using novel scaffold designs. Here we present a microscale 3D weaving technique to generate anisotropic 3D woven structures as the basis for novel composite scaffolds that are consolidated with a chondrocyte-hydrogel mixture into cartilage tissue constructs. Composite scaffolds show mechanical properties of the same order of magnitude as values for native articular cartilage, as measured by compressive, tensile and shear testing. Moreover, our findings showed that porous composite scaffolds could be engineered with initial properties that reproduce the anisotropy, viscoelasticity and tension-compression nonlinearity of native articular cartilage. Such scaffolds uniquely combine the potential for load-bearing immediately after implantation in vivo with biological support for cell-based tissue regeneration without requiring cultivation in vitro.

  12. Quantification of fluid shear stress in bone tissue engineering scaffolds with spherical and cubical pore architectures.

    Science.gov (United States)

    Zhao, Feihu; Vaughan, Ted J; McNamara, Laoise M

    2016-06-01

    Recent studies have shown that mechanical stimulation, in the form of fluid perfusion and mechanical compression, can enhance osteogenic differentiation of mesenchymal stem cells and bone cells within tissue engineering scaffolds in vitro. The precise nature of mechanical stimulation within tissue engineering scaffolds is not only dictated by the exogenously applied loading regime, but also depends on the geometric features of the scaffold, in particular architecture, pore size and porosity. However, the precise contribution of each geometric feature towards the resulting mechanical stimulation within a scaffold is difficult to characterise due to the wide range of interacting parameters. In this study, we have applied a fluid-structure interaction model to investigate the role of scaffold geometry (architecture, pore size and porosity) on pore wall shear stress (WSS) under a range of different loading scenarios: fluid perfusion, mechanical compression and a combination of perfusion and compression. It is found that scaffold geometry (spherical and cubical pores), in particular the pore size, has a significant influence on the stimulation within scaffolds. Furthermore, we observed an amplified WSS within scaffolds under a combination of fluid perfusion and mechanical compression, which exceeded that caused by individual fluid perfusion or mechanical compression approximately threefold. By conducting this comprehensive parametric variation study, an expression was generated to allow the design and optimisation of 3D TE scaffolds and inform experimental loading regimes so that a desired level of mechanical stimulation, in terms of WSS is generated within the scaffold.

  13. Virtual topological optimisation of scaffolds for rapid prototyping.

    Science.gov (United States)

    Almeida, Henrique de Amorim; Bártolo, Paulo Jorge da Silva

    2010-09-01

    Advanced additive techniques are now being developed to fabricate scaffolds with controlled architecture for tissue engineering. These techniques combine computer-aided design (CAD) with computer-aided manufacturing (CAM) tools to produce three-dimensional structures layer by layer in a multitude of materials. Actual prediction of the effective mechanical properties of scaffolds produced by additive technologies, is very important for tissue engineering applications. A novel computer based technique for scaffold design is topological optimisation. Topological optimisation is a form of "shape" optimisation, usually referred to as "layout" optimisation. The goal of topological optimisation is to find the best use of material for a body that is subjected to either a single load or a multiple load distribution. This paper proposes a topological optimisation scheme in order to obtain the ideal topological architectures of scaffolds, maximising its mechanical behaviour. 2010 IPEM. Published by Elsevier Ltd. All rights reserved.

  14. Chitosan/bioactive glass nanoparticles scaffolds with shape memory properties.

    Science.gov (United States)

    Correia, Cristina O; Leite, Álvaro J; Mano, João F

    2015-06-05

    We propose a combination of chitosan (CHT) with bioactive glass nanoparticles (BG-NPs) in order to produce CHT/BG-NPs scaffolds that combine the shape memory properties of chitosan and the biomineralization ability of BG-NPs for applications in bone regeneration. The addition of BG-NPs prepared by a sol-gel route to the CHT polymeric matrix improved the bioactivity of the nanocomposite scaffold, as seen by the precipitation of bone-like apatite layer upon immersion in simulated body fluid (SBF). Shape memory tests were carried out while the samples were immersed in varying compositions of water/ethanol mixtures. Dehydration with ethanol enables to fix a temporary shape of a deformed scaffold that recovers the initial geometry upon water uptake. The scaffolds present good shape memory properties characterized by a recovery ratio of 87.5% for CHT and 89.9% for CHT/BG-NPs and a fixity ratio of 97.2% for CHT and 98.2% for CHT/BG-NPs (for 30% compressive deformation). The applicability of such structures was demonstrated by a good geometrical accommodation of a previously compressed scaffold in a bone defect. The results indicate that the developed CHT/BG-NPs nanocomposite scaffolds have potential for being applied in bone tissue engineering. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Discrimination of different hop varieties using headspace gas chromatographic data

    Directory of Open Access Journals (Sweden)

    Jorge Katia

    2003-01-01

    Full Text Available Methods for characterization of hop varieties include analyses of bitter acids and essential oils, followed by comparison of the chemical composition, particularly chromatographic profiles. In the present work discrimination of different hop varieties was carried out based on their essential oil volatile composition, assessed by headspace gas chromatography, with subsequent statistical treatment of the data. Differences and similarities were determined in samples from USA, New Zealand and Europe, using correlation and cluster analysis. Aroma hops presented low levels of myrcene while bitter samples showed high levels of beta-caryophyllene, aloaromadendrene and also the sum of the marker ratios, independently of being in the form of pellets or extracts. Highly correlated samples with no significant differences have good possibility to substitute each other in the beer manufacture.

  16. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  17. Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

    Directory of Open Access Journals (Sweden)

    Atieh Hajirahimkhan

    Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

  18. Improving bone marrow stromal cell attachment on chitosan/hydroxyapatite scaffolds by an immobilized RGD peptide

    Energy Technology Data Exchange (ETDEWEB)

    Qu Zhiwei; Yan Jinglong; Zhuang Jinpeng [Fourth Department of Orthopedics, First Hospital Affiliated to Harbin Medical University, Harbin 150081 (China); Li Baoqiang [Institutes for Advanced Ceramics, Harbin Institute of Technology, Harbin 150001 (China); Huang Yanming, E-mail: quzhiwei2@163.co [First Department of Orthopedics, Heilongjiang Prevention and Treatment of Infectious Diseases Hospital, Harbin 150500 (China)

    2010-12-15

    Ample cell adhesion to scaffolds is essential for effective bone tissue engineering. Chitosan/hydroxyapatite (CS/HA) scaffolds with channel-shaped and spherically shaped pore morphologies were prepared via in situ compositing hybridization in combination with lyophilization. The sizes of channel-shaped and spherically shaped pores of the CS/HA scaffolds were 150-650 {mu}m and 3-15 {mu}m, respectively. The RGD peptide (Arg-Gly-Asp) was bound to the surface of CS/HA scaffolds via physical adsorption. More than 63% of RGD present in a PBS solution spontaneously adsorbed onto CS/HA scaffolds. High numbers of viable bone marrow stromal cells (BMSCs) were observed by confocal and fluorescence microscopy for cells cultured on CS/HA scaffolds with and without RGD for 3 days. BMSCs on CS/HA scaffolds with RGD (RGD-CS/HA) were incubated for 4 h under standard culture conditions, and the degree of cell adhesion was calculated. Cell adhesion to RGD-CS/HA scaffolds with different RGD concentrations was 71.6% and 80.7%, respectively. This was 30.9% and 47.5% higher than adhesion to the CS/HA scaffold without RGD, respectively. BMSCs cultured on the scaffolds for 14 days with osteogenic supplements expressed 103% higher alkaline phosphatase on the RGD-CS/HA scaffold (0.001 97 {+-} 0.000 31 U/L/ng), than on the unmodified scaffold (0.000 97 {+-} 0.000 25 U/L/ng) (p < 0.01), indicating that a RGD peptide significantly promotes osteogenic differentiation of BMSCs on CS/HA scaffolds. The results of this study indicate that RGD-CS/HA scaffolds promote initial cell adhesion, spread and differentiation toward an osteogenic phenotype.

  19. Bone augmentation using a highly porous PLGA/β-TCP scaffold containing fibroblast growth factor-2.

    Science.gov (United States)

    Yoshida, T; Miyaji, H; Otani, K; Inoue, K; Nakane, K; Nishimura, H; Ibara, A; Shimada, A; Ogawa, K; Nishida, E; Sugaya, T; Sun, L; Fugetsu, B; Kawanami, M

    2015-04-01

    Beta-tricalcium phosphate (β-TCP), a bio-absorbable ceramic, facilitates bone conductivity. We constructed a highly porous three-dimensional scaffold, using β-TCP, for bone tissue engineering and coated it with co-poly lactic acid/glycolic acid (PLGA) to improve the mechanical strength and biological performance. The aim of this study was to examine the effect of implantation of the PLGA/β-TCP scaffold loaded with fibroblast growth factor-2 (FGF-2) on bone augmentation. The β-TCP scaffold was fabricated by the replica method using polyurethane foam, then coated with PLGA. The PLGA/β-TCP scaffold was characterized by scanning electron miscroscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction, compressive testing, cell culture and a subcutaneous implant test. Subsequently, a bone-forming test was performed using 52 rats. The β-TCP scaffold, PLGA-coated scaffold, and β-TCP and PLGA-coated scaffolds loaded with FGF-2, were implanted into rat cranial bone. Histological observations were made at 10 and 35 d postsurgery. SEM and TEM observations showed a thin PLGA layer on the β-TCP particles after coating. High porosity (> 90%) of the scaffold was exhibited after PLGA coating, and the compressive strength of the PLGA/β-TCP scaffold was six-fold greater than that of the noncoated scaffold. Good biocompatibility of the PLGA/β-TCP scaffold was found in the culture and implant tests. Histological samples obtained following implantation of PLGA/β-TCP scaffold loaded with FGF-2 showed significant bone augmentation. The PLGA coating improved the mechanical strength of β-TCP scaffolds while maintaining high porosity and tissue compatibility. PLGA/β-TCP scaffolds, in combination with FGF-2, are bioeffective for bone augmentation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Lattice Gauge Quantum Simulation via State-Dependent Hopping

    DEFF Research Database (Denmark)

    Salami Dehkharghani, Amin

    2017-01-01

    We develop a quantum simulator architecture that is suitable for the simulation of U(1) Abelian gauge theories such as quantum electrodynamics. Our approach relies on the ability to control the hopping of a particle through a barrier by means of the internal quantum states of a neutral or charged...... impurity-particle sitting at the barrier. This scheme is highly experimentally feasible, as the correlated hopping does not require fine-tuning of the intra- and inter-species interactions. We investigate the applicability of the scheme in a double well potential, which is the basic building block...

  1. Information structure in Wichí: focus marker hop

    OpenAIRE

    Ekaterina Levina

    2013-01-01

    Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as ...

  2. Novel Antibacterial Nanofibrous PLLA Scaffolds

    Science.gov (United States)

    Feng, Kai; Sun, Hongli; Bradley, Mark A.; Dupler, Ellen J.; Giannobile, William V.; Ma, Peter X.

    2010-01-01

    In order to achieve high local bioactivity and low systemic side effects of antibiotics in the treatment of dental, periodontal and bone infections, a localized and temporally controlled delivery system is crucial. In this study, a three-dimensional (3D) porous tissue engineering scaffold was developed with the ability to release antibiotics in a controlled fashion for long-term inhibition of bacterial growth. The highly soluble antibiotic drug, Doxycycline (DOXY), was successfully incorporated into PLGA nanospheres using a modified water-in-oil-in-oil (w/o/o) emulsion method. The PLGA nanospheres (NS) were then incorporated into prefabricated nanofibrous PLLA scaffolds with a well interconnected macroporous structure. The release kinetics of DOXY from four different PLGA NS formulations on a PLLA scaffold was investigated. DOXY could be released from the NS-scaffolds in a locally and temporally controlled manner. The DOXY release is controlled by DOXY diffusion out of the NS and is strongly dependent upon the physical and chemical properties of the PLGA. While PLGA50-6.5K, PLGA50-64K, and PLGA75-113K NS-scaffolds discharge DOXY rapidly with a high initial burst release, PLGA85-142K NS-scaffold can extend the release of DOXY to longer than 6 weeks with a low initial burst release. Compared to NS alone, the NS incorporated on a 3-D scaffold had significantly reduced the initial burst release. In vitro antibacterial tests of PLGA85 NS-scaffold demonstrated its ability to inhibit common bacterial growth (S.aureus and E.coli) for a prolonged duration. The successful incorporation of DOXY onto 3-D scaffolds and its controlled release from scaffolds extends the usage of nano-fibrous scaffolds from the delivery of large molecules such as growth factors to the delivery of small hydrophilic drugs, allowing for a broader application and a more complex tissue engineering strategy. PMID:20570700

  3. Protein Scaffolding for Small Molecule Catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Baker, David [Univ. of Washington, Seattle, WA (United States)

    2014-09-14

    We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.

  4. Semiotic scaffolding of multicellularity

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2015-01-01

    and animals this individuation process poses very different challenges in the three kingdoms of plants, fungi and animals, and the solutions found to these differences are discussed. In the same time as multicellularity ushered life into the epoch of mortality it logically also led to the appearance...... semiotic scaffoldings had to be invented in order to prevent this. While a unicellular self may go on to live practically forever, the multicellular self most often must run through an individuation process ending in the death of the individual. Due to basic differences in cells of plants, fungi...

  5. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  6. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  7. Nonwoven scaffolds for bone regeneration

    OpenAIRE

    Durham, Elaine R.; Tronci, Giuseppe; Yang,Xuebin; Wood, David J.; Russell, Stephen J.

    2016-01-01

    Developing successful scaffolds requires clinicians to adopt a multidisciplinary approach in order to understand and stimulate the natural bone regeneration process. A variety of natural and synthetic biomaterials, including naturally extracted, chemically functionalised collagen and synthetic Poly(epsilon-caprolactone) (PCL), can be manufactured into fibres, enabling the formation of nonwoven scaffolds. Many different nonwoven architectures and structural features can then be introduced, dep...

  8. Synthesis and antiangiogenic activity study of new hop chalcone Xanthohumol analogues.

    Science.gov (United States)

    Nuti, Elisa; Bassani, Barbara; Camodeca, Caterina; Rosalia, Lea; Cantelmo, AnnaRita; Gallo, Cristina; Baci, Denisa; Bruno, Antonino; Orlandini, Elisabetta; Nencetti, Susanna; Noonan, Douglas M; Albini, Adriana; Rossello, Armando

    2017-09-29

    Angiogenesis induction is a hallmark of cancer. Antiangiogenic properties of Xanthohumol (XN), a naturally occurring prenylated chalcone from hops, have been widely reported. Here we describe the synthesis and study the antiangiogenic activity in vitro of a series of XN derivatives, where different substituents on the B-ring of the chalcone scaffold were inserted. The new XN derivatives inhibited human umbilical-vein endothelial cell (HUVEC) proliferation, adhesion, migration, invasion and their ability to form capillary-like structures in vitro at 10 μM concentration. The preliminary results indicate that the phenolic OH group in R, present in natural XN, is not necessary for having antiangiogenic activity. In fact, the most effective compound from this series, 13, was characterized by a para-methoxy group in R and a fluorine atom in R2 on B-ring. This study paves the way for future development of synthetic analogues of XN to be used as cancer angiopreventive and chemopreventive agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Localization of networks with presence and distance constraints based on 1-hop and 2-hop mass–spring optimization

    Directory of Open Access Journals (Sweden)

    Gabriele Oliva

    2016-03-01

    Full Text Available In this paper we consider the localization of a sensor network where the nodes are heterogeneous, in that some of them are able to measure the distance from their neighbors, while some others are just able to detect their presence, and we provide a post-processing algorithm that can be used to improve an initial estimate for the location of the nodes, based on a mass–spring optimization approach, taking into account presence and distance information, as well as one-hop and two-hop information.

  10. Biomimetic formation of apatite on the surface of porous gelatin/bioactive glass nanocomposite scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    Mozafari, Masoud, E-mail: mmozafari@aut.ac.ir [Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence), Amirkabir University of Technology, PO Box 15875-4413, Tehran (Iran, Islamic Republic of); Rabiee, Mohammad; Azami, Mahmoud; Maleknia, Saied [Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence), Amirkabir University of Technology, PO Box 15875-4413, Tehran (Iran, Islamic Republic of)

    2010-12-15

    There have been several attempts to combine bioactive glasses (BaGs) with biodegradable polymers to create a scaffold material with excellent biocompatibility, bioactivity, biodegradability and toughness. In the present study, the nanocomposite scaffolds with compositions based on gelatin (Gel) and BaG nanoparticles in the ternary SiO{sub 2}-CaO-P{sub 2}O{sub 5} system were prepared. In vitro evaluations of the nanocomposite scaffolds were performed, and for investigating their bioactive capacity these scaffolds were soaked in a simulated body fluid (SBF) at different time intervals. The scaffolds showed significant enhancement in bioactivity within few days of immersion in SBF solution. The apatite formation at the surface of the nanocomposite samples confirmed by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray powder diffraction (XRD) analyses. In vitro experiments with osteoblast cells indicated an appropriate penetration of the cells into the scaffold's pores, and also the continuous increase in cell aggregation on the bioactive scaffolds with increase in the incubation time demonstrated the ability of the scaffolds to support cell growth. The SEM observations revealed that the prepared scaffolds were porous with three dimensional (3D) and interconnected microstructure, pore size was 200-500 {mu}m and the porosity was 72-86%. The nanocomposite scaffold made from Gel and BaG nanoparticles could be considered as a highly bioactive and potential bone tissue engineering implant.

  11. Collagen/chitosan based two-compartment and bi-functional dermal scaffolds for skin regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Wang, Mingbo [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); She, Zhending [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China); Fan, Kunwu; Xu, Cheng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Chu, Bin; Chen, Changsheng [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shi, Shengjun, E-mail: shengjunshi@yahoo.com [The Burns Department of Zhujiang Hospital, Southern Medical University, Guangzhou 510280 (China); Tan, Rongwei, E-mail: tanrw@landobiom.com [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China)

    2015-07-01

    Inspired from the sophisticated bilayer structures of natural dermis, here, we reported collagen/chitosan based two-compartment and bi-functional dermal scaffolds. Two functions refer to mediating rapid angiogenesis based on recombinant human vascular endothelial growth factor (rhVEGF) and antibacterial from gentamicin, which were encapsulated in PLGA microspheres. The gentamicin and rhVEGF encapsulated PLGA microspheres were further combined with collagen/chitosan mixtures in low (lower layer) and high (upper layer) concentrations, and molded to generate the two-compartment and bi-functional scaffolds. Based on morphology and pore structure analyses, it was found that the scaffold has a distinct double layered porous and connective structure with PLGA microspheres encapsulated. Statistical analysis indicated that the pores in the upper layer and in the lower layer have great variations in diameter, indicative of a two-compartment structure. The release profiles of gentamicin and rhVEGF exceeded 28 and 49 days, respectively. In vitro culture of mouse fibroblasts showed that the scaffold can facilitate cell adhesion and proliferation. Moreover, the scaffold can obviously inhibit proliferation of Staphylococcus aureus and Serratia marcescens, exhibiting its unique antibacterial effect. The two-compartment and bi-functional dermal scaffolds can be a promising candidate for skin regeneration. - Highlights: • The dermal scaffold is inspired from the bilayer structures of natural dermis. • The dermal scaffold has two-compartment structures. • The dermal scaffold containing VEGF and gentamicin encapsulated PLGA microspheres • The dermal scaffold can facilitate cell adhesion and proliferation.

  12. Development of porous Ti6Al4V/chitosan sponge composite scaffold for orthopedic applications

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Miao [College of Life Information Science & Instrument Engineering, Hangzhou Dianzi University, Hangzhou 310018 (China); Li, Xiang, E-mail: Xiangliwj@sjtu.edu.cn [School of Mechanical Engineering, Shanghai Jiao Tong University, State Key Laboratory of Mechanical System and Vibration, Shanghai 200240 (China)

    2016-01-01

    A novel composite scaffold consisting of porous Ti6Al4V part filled with chitosan sponge was fabricated using a combination of electron beam melting and freeze-drying. The mechanical properties of porous Ti6Al4V part were examined via compressive test. The ultimate compressive strength was 85.35 ± 8.68 MPa and the compressive modulus was 2.26 ± 0.42 GPa. The microstructure of composite scaffold was characterized using scanning electron microscopy. The chitosan sponge filled in Ti6Al4V part exhibited highly porous and well-interconnected micro-pore architecture. The osteoblastic cells were seeded on scaffolds to test their seeding efficiency and biocompatibility. Significantly higher cell seeding efficiency was found on composite scaffold. The biological response of osteoblasts on composite scaffolds was superior in terms of improved cell attachment, higher proliferation, and well-spread morphology in relation to porous Ti6Al4V part. These results suggest that the Ti6Al4V/chitosan composite scaffold is potentially useful as a biomedical scaffold for orthopedic applications. - Highlights: • A novel composite scaffold with sufficient mechanical properties and favorable cell affinity environment was developed. • Significantly higher cell seeding efficiency was found on composite scaffold. • The osteoblasts on composite scaffolds showed well-spread morphology, improved cell attachment and higher proliferation.

  13. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  14. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  15. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  16. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  17. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  18. Morphological and Cell Growth Assessment in Near Dense Hydroxyapatite Scaffold

    Directory of Open Access Journals (Sweden)

    Florencia Edith Wiria

    2013-01-01

    Full Text Available This paper reports the preliminary results on the morphology of low porosity hydroxyapatite scaffold and its compatibility as a substrate for osteoblast cells. Although having low porosity, the hydroxyapatite scaffold was found to be capable of sustaining cell growth and thus assisting bone ingrowth. Due to the low porosity nature, the scaffold provides higher strength and therefore more suitable for applications with load-bearing requirements such as spinal spacer. The hydroxyapatite scaffolds are prepared via powder processing techniques, using a combination of wet mixing, powder compaction, and sintering processes. The scaffold porosity is estimated via image analysis and micro-CT, which detect porosity level of approximately 16% and pore size of 13 μm. Cell culture investigation demonstrates that the hydroxyapatite substrate is able to provide favourable cell attachment and collagen matrix production, as compared to the commonly used cell culture control substrates. These results indicate that despite the low porosity in the hydroxyapatite scaffolds, they do not hinder being a preferred substrate to provide conducive environment osteoblast cell growth.

  19. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  20. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    Science.gov (United States)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  1. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, Torsten; Carle, Georg; Koucheryavy, Yevgeni; Tsaoussidis, Vassilis

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named Balanced Interference

  2. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  3. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed c...

  4. Potential African Substitutes for Hops in Tropical Beer Brewing

    African Journals Online (AJOL)

    1' Department of Food Science and Nutrition, E.N.S.A.I.. P. O. Box. 455, University ofNgaoundere, Cameroon. 2' Department of Food Technology, Faculty of Technology, University of Ibadan, Nigeria. "Corresponding author. Abstract. The potential ... Industry (Hough er dl., 1982, Grant,. 1977). Hops contribute to foam stability.

  5. Molecular mechanisms of Tetranychus urticae chemical adaptation in hop fields.

    Science.gov (United States)

    Piraneo, Tara G; Bull, Jon; Morales, Mariany A; Lavine, Laura C; Walsh, Douglas B; Zhu, Fang

    2015-12-01

    The two-spotted spider mite, Tetranychus urticae Koch is a major pest that feeds on >1,100 plant species. Many perennial crops including hop (Humulus lupulus) are routinely plagued by T. urticae infestations. Hop is a specialty crop in Pacific Northwest states, where 99% of all U.S. hops are produced. To suppress T. urticae, growers often apply various acaricides. Unfortunately T. urticae has been documented to quickly develop resistance to these acaricides which directly cause control failures. Here, we investigated resistance ratios and distribution of multiple resistance-associated mutations in field collected T. urticae samples compared with a susceptible population. Our research revealed that a mutation in the cytochrome b gene (G126S) in 35% tested T. urticae populations and a mutation in the voltage-gated sodium channel gene (F1538I) in 66.7% populations may contribute resistance to bifenazate and bifenthrin, respectively. No mutations were detected in Glutamate-gated chloride channel subunits tested, suggesting target site insensitivity may not be important in our hop T. urticae resistance to abamectin. However, P450-mediated detoxification was observed and is a putative mechanism for abamectin resistance. Molecular mechanisms of T. urticae chemical adaptation in hopyards is imperative new information that will help growers develop effective and sustainable management strategies.

  6. Interference-based routing in multi-hop wireless infrastructures

    NARCIS (Netherlands)

    Heijenk, Geert; Liu, F.; Braun, T.; Carle, G.; Koucheryavy, Y.; Tsaoussidis, V.

    In this paper, multi-hop wireless infrastructures are identified as a way to increase user data rates and/or capacity of wireless systems by means of a high base station density without high base station interconnection costs. For such a system, a new routing algorithm, named balanced interference

  7. Hopping in a supercooled binary Lennard-Jones liquid

    DEFF Research Database (Denmark)

    Schrøder, Thomas; Dyre, Jeppe

    1998-01-01

    A binary Lennard–Jones liquid has been investigated by molecular dynamics at equilibrium supercooled conditions. At the lowest temperature investigated, hopping is present in the system as indicated by a secondary peak in 4r2Gs(r,t), where Gs(r,t) is the van Hove self correlation function...

  8. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  9. Morphological and control criteria for self-stable underwater hopping.

    Science.gov (United States)

    Calisti, Marcello; Laschi, Cecilia

    2017-10-04

    This paper presents the self-stabilisation features of a hopping gait during underwater legged locomotion. We used a bio-inspired fundamental model of this gait, the underwater spring-loaded inverted pendulum model, to numerically derive quantitative (dimension of the basin of attraction, Floquet multipliers, mean horizontal speed) and qualitative (shape of the basin) features which characterise the self-stability of the system. Furthermore, we compared the results obtained with a terrestrial self-stable running model (i.e. the spring-loaded inverted pendulum with swing-leg retraction) to highlight the role of water-related components in relation to dynamic legged locomotion. The analysis revealed fundamental morphological and actuation parameters that could be used to design self-stabilising underwater hopping machines, as well as elucidating their role with respect to stability and speed. Underwater hopping is a simple and reliable locomotion, as it does not require complex control feedback to reject significant disturbances. Thanks to its high self-stabilising property, underwater hopping appears to be a reliable alternative locomotion for underwater robots. © 2017 IOP Publishing Ltd.

  10. Exact results on the steady state of a hopping model

    Science.gov (United States)

    Zhang, M. Q.

    1987-03-01

    A hopping model described by Katz, Lebowitz, and Spohn [J. Stat. Phys. 34, 497 (1983)] and by Valles and Marro [J. Stat. Phys. 43, 441 (1986)] is studied analytically for small lattice systems. The dependence of the nonequilibrium steady state on various parameters and transition rate functions is obtained exactly. The results are compared with simulations on large systems.

  11. Chicano Hip-Hop as Interethnic Contact Zone

    Science.gov (United States)

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  12. Surface hopping modeling of two-dimensional spectra

    NARCIS (Netherlands)

    Tempelaar, Roel; Vegte, Cornelis P. van der; Knoester, Jasper; Jansen, Thomas L.C.

    2013-01-01

    Recently, two-dimensional (2D) electronic spectroscopy has become an important tool to unravel the excited state properties of complex molecular assemblies, such as biological light harvesting systems. In this work, we propose a method for simulating 2D electronic spectra based on a surface hopping

  13. Multiple-hopping trajectories near a rotating asteroid

    Science.gov (United States)

    Shen, Hong-Xin; Zhang, Tian-Jiao; Li, Zhao; Li, Heng-Nian

    2017-03-01

    We present a study of the transfer orbits connecting landing points of irregular-shaped asteroids. The landing points do not touch the surface of the asteroids and are chosen several meters above the surface. The ant colony optimization technique is used to calculate the multiple-hopping trajectories near an arbitrary irregular asteroid. This new method has three steps which are as follows: (1) the search of the maximal clique of candidate target landing points; (2) leg optimization connecting all landing point pairs; and (3) the hopping sequence optimization. In particular this method is applied to asteroids 433 Eros and 216 Kleopatra. We impose a critical constraint on the target landing points to allow for extensive exploration of the asteroid: the relative distance between all the arrived target positions should be larger than a minimum allowed value. Ant colony optimization is applied to find the set and sequence of targets, and the differential evolution algorithm is used to solve for the hopping orbits. The minimum-velocity increment tours of hopping trajectories connecting all the landing positions are obtained by ant colony optimization. The results from different size asteroids indicate that the cost of the minimum velocity-increment tour depends on the size of the asteroids.

  14. In vitro biocompatibility of sheath-core cellulose-acetate-based electrospun scaffolds towards endothelial cells and platelets.

    Science.gov (United States)

    Rubenstein, David A; Venkitachalam, Subramaniam M; Zamfir, Dan; Wang, Fang; Lu, Hongbing; Frame, Mary D; Yin, Wei

    2010-01-01

    Typically, tissue-engineered scaffolds mimic the topographical properties of the native extracellular matrix. However, other physical properties, such as the scaffold mechanical stiffness, are not imitated. The purpose of this study was to fabricate scaffolds with improved mechanical properties and investigate their biocompatibility towards endothelial cells and platelets. To enhance mechanical properties, an electrospinning apparatus was developed that fabricates fibers with sheath-core morphologies. Different combinations of cellulose acetate and chitosan were chosen to modulate the mechanical properties of the formed fibers. We hypothesized that mechanically stiffer scaffolds would improve endothelial cell growth and that all scaffolds would be compatible towards endothelial cells and platelets. Endothelial cell-culture conditions were quantified up to 5 days. Migration onto scaffolds was monitored for 10 days. Platelet aggregation, antagonized by thrombin receptor agonist peptide 6, was measured after scaffold incubation. A platelet activation time-course was assessed with the modified prothrombinase assay. As scaffold mechanical stiffness increased, endothelial cell growth within and adhesion to and migration throughout the scaffolds was promoted. Also, scaffolds did not induce platelet aggregation or activation. These results indicate that the mechanical stiffness of engineered scaffolds regulates endothelial cell-culture parameters and that these sheath-core electrospun scaffolds are compatible towards endothelial cells and platelets.

  15. HapHop-Physio: a computer game to support cognitive therapies in children

    Directory of Open Access Journals (Sweden)

    Rico-Olarte C

    2017-07-01

    Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

  16. Fabrication and biocompatibility of poly(L-lactic acid) and chitosan composite scaffolds with hierarchical microstructures

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Tao, E-mail: taolou72@aliyun.com [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China); Wang, Xuejun [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China); Yan, Xu [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Miao, Yu [Department of Mechanical Engineering, Columbia University, New York, NY 10027 (United States); Long, Yun-Ze, E-mail: yunzelong@163.com [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Yin, Hai-Lei [Department of Osteology, No. 401 Hospital of P. L. A., Qingdao 266071 (China); Sun, Bin [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Song, Guojun [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China)

    2016-07-01

    The scaffold microstructure is crucial to reconstruct tissue normal functions. In this article, poly(L-lactic acid) and chitosan fiber (PLLA/CTSF) composite scaffolds with hierarchical microstructures both in fiber and pore sizes were successfully fabricated by combining thermal induced phase separation and salt leaching techniques. The composite scaffolds consisted of a nanofibrous PLLA matrix with diameter of 50–500 nm, and chitosan fibers with diameter of about 20 μm were homogenously distributed in the PLLA matrix as a microsized reinforcer. The composite scaffolds also had high porosity (> 94%) and hierarchical pore size, which were consisted of both micropores (50 nm–10 μm) and macropores (50–300 μm). By tailoring the microstructure and chemical composition, the mechanical property, pH buffer and protein adsorption capacity of the composite scaffold were improved significantly compared with those of PLLA scaffold. Cell culture results also revealed that the PLLA/CTSF composite scaffolds supported MG-63 osteoblast proliferation and penetration. - Highlights: • Composite scaffolds fabricated by combining thermal induced phase separation and salt leaching techniques • Hierarchical microstructure both in fiber and pore sizes • The scaffold microenvironment facilitates the protein adsorption, cell proliferation and penetration.

  17. Augmented Reality in the Science Museum: Lessons Learned in Scaffolding for Conceptual and Cognitive Learning

    Science.gov (United States)

    Yoon, Susan A.; Elinich, Karen; Wang, Joyce; Van Schooneveld, Jacqueline G.

    2012-01-01

    This research follows on previous studies that investigated how digitally augmented devices and knowledge scaffolds enhance learning in a science museum. We investigated what combination of scaffolds could be used in conjunction with the unique characteristics of informal participation to increase conceptual and cognitive outcomes. 307 students…

  18. Fragment-hopping-based discovery of a novel chemical series of proto-oncogene PIM-1 kinase inhibitors.

    Directory of Open Access Journals (Sweden)

    Gustavo Saluste

    Full Text Available A new chemical series, triazolo[4,5-b]pyridines, has been identified as an inhibitor of PIM-1 by a chemotype hopping strategy based on a chemically feasible fragment database. In this case, structure-based virtual screening and in silico chemogenomics provide added value to the previously reported strategy of prioritizing among proposed novel scaffolds. Pairwise comparison between compound 3, recently discontinued from Phase I clinical trials, and molecule 8, bearing the selected novel scaffold, shows that the primary activities are similar (IC(50 in the 20 to 150 nM range. At the same time, some ADME properties (for example, an increase of more than 45% in metabolic stability in human liver microsomes and the off-target selectivity (for example, an increase of more than 2 log units in IC(50vs. FLT3 are improved, and the intellectual property (IP position is enhanced. The discovery of a reliable starting point that fulfills critical criteria for a plausible medicinal chemistry project is demonstrated in this prospective study.

  19. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  20. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  1. Tailored PVA/ECM Scaffolds for Cartilage Regeneration

    Directory of Open Access Journals (Sweden)

    Elena Stocco

    2014-01-01

    Full Text Available Articular cartilage lesions are a particular challenge for regenerative medicine due to cartilage low self-ability repair in case of damage. Hence, a significant goal of musculoskeletal tissue engineering is the development of suitable structures in virtue of their matrix composition and biomechanical properties. The objective of our study was to design in vitro a supporting structure for autologous chondrocyte growth. We realized a biohybrid composite scaffold combining a novel and nonspecific extracellular matrix (ECM, which is decellularized Wharton’s jelly ECM, with the biomechanical properties of the synthetic hydrogel polyvinyl alcohol (PVA. Wharton’s jelly ECM was tested for its ability in promoting scaffold colonization by chondrocytes and compared with polyvinyl alcohol itself and the more specific decellularized cartilage matrix. Our preliminary evidences highlighted the chance of using Wharton’s jelly ECM in combination with PVA hydrogels as an innovative and easily available scaffold for cartilage restoration.

  2. Immunomodulation by the Pseudomonas syringae HopZ type III effector family in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    Full Text Available Pseudomonas syringae employs a type III secretion system to inject 20-30 different type III effector (T3SE proteins into plant host cells. A major role of T3SEs is to suppress plant immune responses and promote bacterial infection. The YopJ/HopZ acetyltransferases are a superfamily of T3SEs found in both plant and animal pathogenic bacteria. In P. syringae, this superfamily includes the evolutionarily diverse HopZ1, HopZ2 and HopZ3 alleles. To investigate the roles of the HopZ family in immunomodulation, we generated dexamethasone-inducible T3SE transgenic lines of Arabidopsis for HopZ family members and characterized them for immune suppression phenotypes. We show that all of the HopZ family members can actively suppress various facets of Arabidopsis immunity in a catalytic residue-dependent manner. HopZ family members can differentially suppress the activation of mitogen-activated protein (MAP kinase cascades or the production of reactive oxygen species, whereas all members can promote the growth of non-virulent P. syringae. Localization studies show that four of the HopZ family members containing predicted myristoylation sites are localized to the vicinity of the plasma membrane while HopZ3 which lacks the myristoylation site is at least partially nuclear localized, suggesting diversification of immunosuppressive mechanisms. Overall, we demonstrate that despite significant evolutionary diversification, all HopZ family members can suppress immunity in Arabidopsis.

  3. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  4. DNA-scaffolded nanoparticle structures

    Energy Technology Data Exchange (ETDEWEB)

    Hoegberg, Bjoern; Olin, Haakan [Department of Engineering Physics and Mathematics, Mid Sweden University, SE-851 70 Sundsvall, Sweden (Sweden)

    2007-03-15

    DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications.

  5. In Vitro Testing of Scaffolds for Mesenchymal Stem Cell-Based Meniscus Tissue Engineering—Introducing a New Biocompatibility Scoring System

    Directory of Open Access Journals (Sweden)

    Felix P. Achatz

    2016-04-01

    Full Text Available A combination of mesenchymal stem cells (MSCs and scaffolds seems to be a promising approach for meniscus repair. To facilitate the search for an appropriate scaffold material a reliable and objective in vitro testing system is essential. This paper introduces a new scoring for this purpose and analyzes a hyaluronic acid (HA gelatin composite scaffold and a polyurethane scaffold in combination with MSCs for tissue engineering of meniscus. The pore quality and interconnectivity of pores of a HA gelatin composite scaffold and a polyurethane scaffold were analyzed by surface photography and Berliner-Blau-BSA-solution vacuum filling. Further the two scaffold materials were vacuum-filled with human MSCs and analyzed by histology and immunohistochemistry after 21 days in chondrogenic media to determine cell distribution and cell survival as well as proteoglycan production, collagen type I and II content. The polyurethane scaffold showed better results than the hyaluronic acid gelatin composite scaffold, with signs of central necrosis in the HA gelatin composite scaffolds. The polyurethane scaffold showed good porosity, excellent pore interconnectivity, good cell distribution and cell survival, as well as an extensive content of proteoglycans and collagen type II. The polyurethane scaffold seems to be a promising biomaterial for a mesenchymal stem cell-based tissue engineering approach for meniscal repair. The new score could be applied as a new standard for in vitro scaffold testing.

  6. Information structure in Wichí: focus marker hop

    Directory of Open Access Journals (Sweden)

    Ekaterina Levina

    2013-12-01

    Full Text Available Abstract: The present paper provides an overview of the functions of the morphological focus marker hop in the grammar of Wichí, a Mataco-Mataguayan language spoken in the North of Argentina and the South of Bolivia. Basing the analysis on the corpus which I have compiled from the existing research which has been published on the language so far, we can conclude that the focus marker hop can but does not have to be used for the focusing of the subject, object, predicate, adverbial as well as on entire dependent clauses in the language. The focus marker hop can express both the informational focus as well as the contrastive focus. In the case of predicate focusing the verum-focus can also be marked and the focus marker can scope over the complex predicate. Key words: Wichí; Languages of America; Information structure; Focus marker.  Resumo: O presente artigo fornece uma visão geral das funções do marcador morfológico hop na gramática de Wichí, uma linguagem Mataco-Mataguayan falada no norte da Argentina e no sul da Bolívia. Com base na análise do corpus que compilamos a partir das pesquisas existentes e publicadas sobre a língua até agora, podemos concluir que o marcador de foco hop pode, mas não tem que, necessariamente, ser usado para o foco no sujeito, objeto, predicado, advérbio, bem como nas cláusulas inteiramente dependentes na língua. O marcador de foco hop pode expressar tanto o foco informacional quanto o foco contrastante. No caso do predicado com foco no verum-foco, também pode ser marcado e o marcador de foco sobre o predicado complexo pode se estender. Palavras-chave: Wichí; idiomas da América; estrutura de informação; marcador de foco.  Resumen: El articulo presentado ofrece una descripción general de las funciones del marcador morfológico de foco hop en la gramática de la lengua Wichí, hablada en el Norte de Argentina y el Sur de Bolivia. El presente análisis hecho a base del corpus formado de

  7. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  8. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  9. Low-coverage surface diffusion in complex periodic energy landscapes: Analytical solution for systems with symmetric hops and application to intercalation in topological insulators

    Science.gov (United States)

    Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.

    2016-02-01

    This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.

  10. HOP/OB1/NECC1 promoter DNA is frequently hypermethylated and involved in tumorigenic ability in esophageal squamous cell carcinoma.

    Science.gov (United States)

    Yamashita, Keishi; Kim, Myoung Sook; Park, Hannah Lui; Tokumaru, Yutaka; Osada, Motonobu; Inoue, Hiroshi; Mori, Masaki; Sidransky, David

    2008-01-01

    Promoter DNA hypermethylation with gene silencing is a common feature of human cancer, and cancer-prone methylation is believed to be a landmark of tumor suppressor genes (TSG). Identification of novel methylated genes would not only aid in the development of tumor markers but also elucidate the biological behavior of human cancers. We identified several epigenetically silenced candidate TSGs by pharmacologic unmasking of esophageal squamous cell carcinoma (ESCC) cell lines by demethylating agents (5-aza-2'-deoxycitidine and trichostatin A) combined with ESCC expression profiles using expression microarray. HOP/OB1/NECC1 was identified as an epigenetically silenced candidate TSG and further examined for (a) expression status, (b) methylation status, and (c) functional involvement in cancer cell lines. (a) The HOP gene encodes two putative promoters (promoters A and B) associated with two open reading frames (HOPalpha and HOPbeta, respectively), and HOPalpha and HOPbeta were both down-regulated in ESCC independently. (b) Promoter B harbors dense CpG islands, in which we found dense methylation in a cancer-prone manner (55% in tumor tissues by TaqMan methylation-specific PCR), whereas promoter A does not harbor CpG islands. HOPbeta silencing was associated with DNA methylation of promoter B in nine ESCC cell lines tested, and reactivated by optimal conditions of demethylating agents, whereas HOPalpha silencing was not reactivated by such treatments. Forced expression of HOP suppressed tumorigenesis in soft agar in four different squamous cell carcinoma cell lines. More convincingly, RNA interference knockdown of HOP in TE2 cells showed drastic restoration of the oncogenic phenotype. In conclusion, HOP is a putative TSG that harbors tumor inhibitory activity, and we for the first time showed that the final shutdown process of HOP expression is linked to promoter DNA hypermethylation under the double control of the discrete promoter regions in cancer.

  11. Influence of the constituent alpha acids of Ukrainian varieties of hops and hop preparations on quality indicators of mash and beer

    Directory of Open Access Journals (Sweden)

    L. Protsenko

    2015-05-01

    Full Text Available Introduction. The aim of the study is to establish the dependence of the bitterness of mash and the beer intoxication on the quality and quantity of the homologues of alpha acids in the Ukrainian varieties of hops, and on the content of cohumulone in alpha acids in particular. Materials and methods.Aromatic and bitter hop sorts of Ukrainian selection with different content of cohumulone in alpha-acids were investigated and so was the beer, made of these components. High performance liquid chromatography (HPLC was used to determine the amount and composition of bitter hop substances and their transformation products in the brewing process; also there were spectrophotometric methods for quality control of bitterness of hopped mash and finished beer in use. Results and discussion. The composition of bitter substances of aromatic and bitter hop sorts of Ukrainian selection was analyzed and so the beer, made of them. It was noted that the alpha-acids of the analyzed sorts incorporate a wide range of cohumulone content rated from 16.7% in the Kumyr sort to 44,1% in the Ruslan sort. The dependences between the quality and quantity of the bitter hop sorts and bitterness and quality of hopped mash and beer were established. The content of cohumulone in alphaacids of hops has to be less than 28% to obtain quality bitter beer. The role of the beta-acid compoundsin the formation of bitter mash, hopped with aroma hop varieties with a ratio of beta to alpha acids acids around one, is much more important compared to the bitter varieties. Conclusions. The conducted researches show that in applying the bitter hops with different compositon of alphaacids for mash intoxication, this usage is more effective in the sorts that have a large content of cohumulone.

  12. Bioinspired scaffolds for osteochondral regeneration.

    Science.gov (United States)

    Lopa, Silvia; Madry, Henning

    2014-08-01

    Osteochondral defects are difficult to treat because the articular cartilage and the subchondral bone have dissimilar characteristics and abilities to regenerate. Bioinspired scaffolds are designed to mimic structural and biological cues of the native osteochondral unit, supporting both cartilaginous and subchondral bone repair and the integration of the newly formed osteochondral matrix with the surrounding tissues. The aim of this review is to outline fundamental requirements and strategies for the development of biomimetic scaffolds reproducing the unique and multifaceted anatomical structure of the osteochondral unit. Recent progress in preclinical animal studies using bilayer and multilayer scaffolds, together with continuous gradient scaffolds will be discussed and placed in a translational perspective with data emerging from their clinical application to treat osteochondral defects in patients.

  13. Multilayered Magnetic Gelatin Membrane Scaffolds

    Science.gov (United States)

    Samal, Sangram K.; Goranov, Vitaly; Dash, Mamoni; Russo, Alessandro; Shelyakova, Tatiana; Graziosi, Patrizio; Lungaro, Lisa; Riminucci, Alberto; Uhlarz, Marc; Bañobre-López, Manuel; Rivas, Jose; Herrmannsdörfer, Thomas; Rajadas, Jayakumar; De Smedt, Stefaan; Braeckmans, Kevin; Kaplan, David L.; Dediu, V. Alek

    2016-01-01

    A versatile approach for the design and fabrication of multilayer magnetic scaffolds with tunable magnetic gradients is described. Multilayer magnetic gelatin membrane scaffolds with intrinsic magnetic gradients were designed to encapsulate magnetized bioagents under an externally applied magnetic field for use in magnetic-field-assisted tissue engineering. The temperature of the individual membranes increased up to 43.7 °C under an applied oscillating magnetic field for 70 s by magnetic hyperthermia, enabling the possibility of inducing a thermal gradient inside the final 3D multilayer magnetic scaffolds. On the basis of finite element method simulations, magnetic gelatin membranes with different concentrations of magnetic nanoparticles were assembled into 3D multilayered scaffolds. A magnetic-gradient-controlled distribution of magnetically labeled stem cells was demonstrated in vitro. This magnetic biomaterial–magnetic cell strategy can be expanded to a number of different magnetic biomaterials for various tissue engineering applications. PMID:26451743

  14. Approaching rational epitope vaccine design for hepatitis C virus with meta-server and multivalent scaffolding

    Science.gov (United States)

    He, Linling; Cheng, Yushao; Kong, Leopold; Azadnia, Parisa; Giang, Erick; Kim, Justin; Wood, Malcolm R.; Wilson, Ian A.; Law, Mansun; Zhu, Jiang

    2015-08-01

    Development of a prophylactic vaccine against hepatitis C virus (HCV) has been hampered by the extraordinary viral diversity and the poor host immune response. Scaffolding, by grafting an epitope onto a heterologous protein scaffold, offers a possible solution to epitope vaccine design. In this study, we designed and characterized epitope vaccine antigens for the antigenic sites of HCV envelope glycoproteins E1 (residues 314-324) and E2 (residues 412-423), for which neutralizing antibody-bound structures are available. We first combined six structural alignment algorithms in a “scaffolding meta-server” to search for diverse scaffolds that can structurally accommodate the HCV epitopes. For each antigenic site, ten scaffolds were selected for computational design, and the resulting epitope scaffolds were analyzed using structure-scoring functions and molecular dynamics simulation. We experimentally confirmed that three E1 and five E2 epitope scaffolds bound to their respective neutralizing antibodies, but with different kinetics. We then investigated a “multivalent scaffolding” approach by displaying 24 copies of an epitope scaffold on a self-assembling nanoparticle, which markedly increased the avidity of antibody binding. Our study thus demonstrates the utility of a multi-scale scaffolding strategy in epitope vaccine design and provides promising HCV immunogens for further assessment in vivo.

  15. Characterization of Three-Dimensional Printed Composite Scaffolds Prepared with Different Fabrication Methods

    Directory of Open Access Journals (Sweden)

    Szlązak K.

    2016-06-01

    Full Text Available An optimal method for composites preparation as an input to rapid prototyping fabrication of scaffolds with potential application in osteochondral tissue engineering is still needed. Scaffolds in tissue engineering applications play a role of constructs providing appropriate mechanical support with defined porosity to assist regeneration of tissue. The aim of the presented study was to analyze the influence of composite fabrication methods on scaffolds mechanical properties. The evaluation was performed on polycaprolactone (PCL with 5 wt% beta-tricalcium phosphate (TCP scaffolds fabricated using fused deposition modeling (FDM. Three different methods of PCL-TCP composite preparation: solution casting, particles milling, extrusion and injection were used to provide material for scaffold fabrication. The obtained scaffolds were investigated by means of scanning electron microscope, x-ray micro computed tomography, thermal gravimetric analysis and static material testing machine. All of the scaffolds had the same geometry (cylinder, 4×6 mm and fiber orientation (0/60/120°. There were some differences in the TCP distribution and formation of the ceramic agglomerates in the scaffolds. They depended on fabrication method. The use of composites prepared by solution casting method resulted in scaffolds with the best combination of compressive strength (5.7±0.2 MPa and porosity (48.5±2.7 %, both within the range of trabecular bone.

  16. Three-dimensional nanocomposite scaffolds fabricated via selective laser sintering for bone tissue engineering.

    Science.gov (United States)

    Duan, Bin; Wang, Min; Zhou, Wen You; Cheung, Wai Lam; Li, Zhao Yang; Lu, William W

    2010-12-01

    Bionanocomposites formed by combining biodegradable polymers and nanosized osteoconductive inorganic solids have been regarded as promising biomimetic systems which possess much improved structural and functional properties for bone tissue regeneration. In this study three-dimensional nanocomposite scaffolds based on calcium phosphate (Ca-P)/poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV) and carbonated hydroxyapatite (CHAp)/poly(l-lactic acid) (PLLA) nanocomposite microspheres were successfully fabricated using selective laser sintering, which is a rapid prototyping technology. The sintered scaffolds had controlled material microstructure, totally interconnected porous structure and high porosity. The morphology and mechanical properties of Ca-P/PHBV and CHAp/PLLA nanocomposite scaffolds as well as PHBV and PLLA polymer scaffolds were studied. In vitro biological evaluation showed that SaOS-2 cells had high cell viability and normal morphology and phenotype after 3 and 7 days culture on all scaffolds. The incorporation of Ca-P nanoparticles significantly improved cell proliferation and alkaline phosphatase activity for Ca-P/PHBV scaffolds, whereas CHAp/PLLA nanocomposite scaffolds exhibited a similar level of cell response compared with PLLA polymer scaffolds. The nanocomposite scaffolds provide a biomimetic environment for osteoblastic cell attachment, proliferation and differentiation and have great potential for bone tissue engineering applications. Copyright © 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  17. Boron containing poly-(lactide-co-glycolide) (PLGA) scaffolds for bone tissue engineering.

    Science.gov (United States)

    Doğan, Ayşegül; Demirci, Selami; Bayir, Yasin; Halici, Zekai; Karakus, Emre; Aydin, Ali; Cadirci, Elif; Albayrak, Abdulmecit; Demirci, Elif; Karaman, Adem; Ayan, Arif Kursat; Gundogdu, Cemal; Sahin, Fikrettin

    2014-11-01

    Scaffold-based bone defect reconstructions still face many challenges due to their inadequate osteoinductive and osteoconductive properties. Various biocompatible and biodegradable scaffolds, combined with proper cell type and biochemical signal molecules, have attracted significant interest in hard tissue engineering approaches. In the present study, we have evaluated the effects of boron incorporation into poly-(lactide-co-glycolide-acid) (PLGA) scaffolds, with or without rat adipose-derived stem cells (rADSCs), on bone healing in vitro and in vivo. The results revealed that boron containing scaffolds increased in vitro proliferation, attachment and calcium mineralization of rADSCs. In addition, boron containing scaffold application resulted in increased bone regeneration by enhancing osteocalcin, VEGF and collagen type I protein levels in a femur defect model. Bone mineralization density (BMD) and computed tomography (CT) analysis proved that boron incorporated scaffold administration increased the healing rate of bone defects. Transplanting stem cells into boron containing scaffolds was found to further improve bone-related outcomes compared to control groups. Additional studies are highly warranted for the investigation of the mechanical properties of these scaffolds in order to address their potential use in clinics. The study proposes that boron serves as a promising innovative approach in manufacturing scaffold systems for functional bone tissue engineering. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Physicochemical and Microstructural Characterization of Injectable Load-Bearing Calcium Phosphate Scaffold

    Directory of Open Access Journals (Sweden)

    Mazen Alshaaer

    2013-01-01

    Full Text Available Injectable load-bearing calcium phosphate scaffolds are synthesized using rod-like mannitol grains as porogen. These degradable injectable strong porous scaffolds, prepared by calcium phosphate cement, could represent a valid solution to achieve adequate porosity requirements while providing adequate support in load-bearing applications. The proposed process for preparing porous injectable scaffolds is as quick and versatile as conventional technologies. Using this method, porous CDHA-based calcium phosphate scaffolds with macropores sizes ranging from 70 to 300 μm, micropores ranging from 5 to 30 μm, and 30% open macroporosity were prepared. The setting time of the prepared scaffolds was 15 minutes. Also their compressive strength and e-modulus, 4.9 MPa and 400 MPa, respectively, were comparable with those of the cancellous bone. Finally, the bioactivity of the scaffolds was confirmed by cell growth with cytoplasmic extensions in the scaffolds in culture, demonstrating that the scaffold has a potential for MSC seeding and growth architecture. This combination of an interconnected macroporous structure with pore size suitable for the promotion of cell seeding and proliferation, plus adequate mechanical features, represents a porous scaffold which is a promising candidate for bone tissue engineering.

  19. Boron containing poly-(lactide-co-glycolide) (PLGA) scaffolds for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Doğan, Ayşegül; Demirci, Selami [Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Yeditepe University 34755 Istanbul (Turkey); Bayir, Yasin [Department of Biochemistry, Faculty of Pharmacy, Ataturk University, 25240, Erzurum (Turkey); Halici, Zekai [Department of Pharmacology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Karakus, Emre [Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Ataturk University, 25240, Erzurum (Turkey); Aydin, Ali [Department of Orthopedics and Traumatology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Cadirci, Elif [Department of Pharmacology, Faculty of Pharmacy, Ataturk University, 25240, Erzurum (Turkey); Albayrak, Abdulmecit [Department of Pharmacology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Demirci, Elif [Department of Pathology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Karaman, Adem [Department of Radiology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Ayan, Arif Kursat [Department of Nuclear Medicine, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Gundogdu, Cemal [Department of Pathology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Şahin, Fikrettin, E-mail: fsahin@yeditepe.edu.tr [Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Yeditepe University 34755 Istanbul (Turkey)

    2014-11-01

    Scaffold-based bone defect reconstructions still face many challenges due to their inadequate osteoinductive and osteoconductive properties. Various biocompatible and biodegradable scaffolds, combined with proper cell type and biochemical signal molecules, have attracted significant interest in hard tissue engineering approaches. In the present study, we have evaluated the effects of boron incorporation into poly-(lactide-co-glycolide-acid) (PLGA) scaffolds, with or without rat adipose-derived stem cells (rADSCs), on bone healing in vitro and in vivo. The results revealed that boron containing scaffolds increased in vitro proliferation, attachment and calcium mineralization of rADSCs. In addition, boron containing scaffold application resulted in increased bone regeneration by enhancing osteocalcin, VEGF and collagen type I protein levels in a femur defect model. Bone mineralization density (BMD) and computed tomography (CT) analysis proved that boron incorporated scaffold administration increased the healing rate of bone defects. Transplanting stem cells into boron containing scaffolds was found to further improve bone-related outcomes compared to control groups. Additional studies are highly warranted for the investigation of the mechanical properties of these scaffolds in order to address their potential use in clinics. The study proposes that boron serves as a promising innovative approach in manufacturing scaffold systems for functional bone tissue engineering. - Highlights: • Boron containing PLGA scaffolds were developed for bone tissue engineering. • Boron incorporation increased cell viability and mineralization of stem cells. • Boron containing scaffolds increased bone-related protein expression in vivo. • Implantation of stem cells on boron containing scaffolds improved bone healing.

  20. A mechanistic approach to design smart scaffolds for tissue engineering

    NARCIS (Netherlands)

    Moroni, Lorenzo

    2006-01-01

    This thesis describes a library of novel 3D scaffolds designed and optimized for tissue engineering and regenerative medicine applications. Tissue engineering aims at restoring or regenerating a deamaged tissue by combining cells, derived from a patient biopsy, with a 3D porous matrix, functioning

  1. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  2. Mixed quantum-classical equilibrium in global flux surface hopping.

    Science.gov (United States)

    Sifain, Andrew E; Wang, Linjun; Prezhdo, Oleg V

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  3. Mixed quantum-classical equilibrium in global flux surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun; Prezhdo, Oleg V. [Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2015-06-14

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors.

  4. Stationary Currents in Particle Systems with Constrained Hopping Rates

    Science.gov (United States)

    Cirillo, Emilio N. M.; Colangeli, Matteo; Muntean, Adrian

    2016-04-01

    We study the effect on the stationary currents of constraints affecting the hopping rates in stochastic particle systems. In the framework of zero range processes with drift within a finite volume, we discuss how the current is reduced by the presence of the constraint and deduce exact formulae, fully explicit in some cases. The model discussed here has been introduced by Cirillo et al. (Does communication enhance pedestrians transport in the dark? To appear in C. R. Mécanique 344 (2016), 19-23) and is relevant for the description of pedestrian motion in elongated dark corridors, where the constraint on the hopping rates can be related to limitations on the interaction distance among pedestrians, but finds also applications in the modeling of various transport phenomena.

  5. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  6. Effects of Powdery Mildew Fungicide Programs on Twospotted Spider Mite (Acari: Tetranychidae), Hop Aphid (Homoptera: Aphididae), and Their Natural Enemies in Hop Yards

    Science.gov (United States)

    Twospotted spider mite, Tetranychus urticae Koch (Acari:Tetranychidae), and hop aphid, Phorodon humuli (Schrank) (Homoptera:Aphidiae), are the most important arthropod pests of hop (Humulus lupulus L.) in the Northern Hemisphere. A potential barrier for greater adoption of conservation biological c...

  7. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  8. Development of chemotactic smart scaffold for use in tissue regeneration.

    Science.gov (United States)

    Hokugo, Akishige; Li, Andrew; Segovia, Luis A; Yalom, Anisa; Rezzadeh, Kameron; Zhou, Situo; Zhang, Zheyu; Zuk, Patricia A; Jarrahy, Reza

    2015-05-01

    Regenerative medicine aims to obviate the need for autologous grafting through the use of bioengineered constructs that combine stem cells, growth factors, and biocompatible vehicles. Human mesenchymal stem cells and vascular endothelial growth factor (VEGF) have both shown promise for use in this context, the former because of their pluripotent capacity and the latter because of its chemotactic activity. The authors harnessed the regenerative potential of human mesenchymal stem cells and VEGF to develop a chemotactic scaffold for use in tissue engineering. Human mesenchymal stem cells were transduced with human VEGF via lentivirus particles to secrete VEGF. The chemotactic activity of the VEGF-transduced stem cells was evaluated via a trans-well assay. Migration through semipermeable membranes was significantly greater in chambers filled with medium conditioned by VEGF-transduced cells. VEGF-transduced cells were then seeded on apatite-coated poly(lactic-co-glycolic acid) scaffolds, thereby creating the Smart Scaffold. To determine in vivo angiogenesis, the Smart Scaffolds were implanted into subcutaneous pockets in the backs of nude mice. Significantly larger numbers of capillaries were observed in the Smart Scaffold compared with control implants on immunohistologic studies. For the chemotactic in vivo study, human mesenchymal stem cells tagged with a fluorescent dye (1,1-dioctadecyl-3,3,3,3-tetramethylindotricarbocyanine iodide) were injected intravenously via tail vein after the subcutaneous implantation of the Smart Scaffolds. In vivo fluorescent imaging revealed that fluorescent dye-tagged human mesenchymal stem cells successfully accumulated within the Smart Scaffolds. These observations suggest that VEGF may play a vital role in the design of clinically relevant tissue regeneration graft substitutes through its angiogenic effects and ability to chemoattract mesenchymal stem cells.

  9. HipHop Scholastics: Effective Teacher Professional Learning

    OpenAIRE

    Garcia, Itoco

    2016-01-01

    AbstractHipHop Scholastics: Effective Teacher Professional LearningbyItoco GarcíaDoctor of EducationUniversity of California, BerkeleyProfessor P. David Pearson, ChairMeeting the needs of culturally and linguistically diverse students in order to improve their academic engagement and achievement is a central challenge to American education. A Critical Race analysis and synthesis of academic research on teacher professional learning, Culturally Relevant Pedagogy (CRP), and the mismatch between...

  10. Reconstruction of Frequency Hopping Signals From Multi-Coset Samples

    OpenAIRE

    Lim, Chia Wei; Wakin, Michael B.

    2016-01-01

    Multi-Coset (MC) sampling is a well established, practically feasible scheme for sampling multiband analog signals below the Nyquist rate. MC sampling has gained renewed interest in the Compressive Sensing (CS) community, due partly to the fact that in the frequency domain, MC sampling bears a strong resemblance to other sub-Nyquist CS acquisition protocols. In this paper, we consider MC sampling of analog frequency hopping signals, which can be viewed as multiband signals with changing band ...

  11. Opportunistic Access in Frequency Hopping Cognitive Radio Networks

    Science.gov (United States)

    2014-03-27

    frequency hopping radio to mitigate the interference caused by other transmitters in a contentious environment such as the unlicensed 2.4 GHz region...Avionics Circle WPAFB, OH 45433 vasu.chakravarthy@us.af.mil 937- 528 -8269 AFRL/RYWE 12. DISTRIBUTION / AVAILABILITY STATEMENT DISTRIBUTION STATEMENT A...unlicensed 2.4 GHz region. Additionally, this work demonstrates how dynamic spectrum access techniques can be used not only to prevent interfering with

  12. Nanoscale live cell imaging using hopping probe ion conductance microscopy

    Science.gov (United States)

    Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

    2009-01-01

    We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

  13. Simulation of Frequency Hopping Communication System Based On MATLAB

    OpenAIRE

    Xu Xiaoping; Wang Weiqi; Yi Lan; Rong Jie; Wang Anqi

    2016-01-01

    In today’s information age, how to carry out the accurate information communication is a crucial issue in the field of communication, which is widely used in civil and military fields. Frequency hopping communication system is a typical spectrum communication system, it is in military communication, mobile communication, computer wireless data transmission and wireless LAN and other fields have a very wide range of applications, has become the current short wave communication is one of the im...

  14. Two-legged hopping in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Matthew F. Moran

    2013-03-01

    Full Text Available Sensory processing deficits are common within autism spectrum disorders (ASD. Deficits have a heterogeneous dispersion across the spectrum and multimodal processing tasks are thought to magnify integration difficulties. Two-legged hopping in place in sync with an auditory cue (2.3, 3.0 Hz was studied in a group of six individuals with expressive language impaired ASD (ELI-ASD and an age-matched control group. Vertical ground reaction force data were collected and discrete Fourier transforms were utilized to determine dominant hopping cadence. Effective leg stiffness was computed through a mass-spring model representation. The ELI-ASD group were unsuccessful in matching their hopping cadence (2.21±0.30 hops•sec-1, 2.35±0.41 hops•sec-1 to either auditory cue with greater deviations at the 3.0 Hz cue. In contrast, the control group was able to match hopping cadence (2.35±0.06 hops•sec-1, 3.02±0.10 hops•sec-1 to either cue via an adjustment of effective leg stiffness. The ELI-ASD group demonstrated a varied response with an interquartile range (IQR in excess of 0.5 hops•sec-1 as compared to the control group with an IQR < 0.03 hops•sec-1. Several sensorimotor mechanisms could explain the inability of participants with ELI-ASD to modulate motor output to match an external auditory cue. These results suggest that a multimodal gross motor task can (1 discriminate performance among a group of individuals with severe autism, and (2 could be a useful quantitative tool for evaluating motor performance in individuals with ASD individuals.

  15. Hip-Hop Development™ Bridging the Generational Divide for Youth Development

    Directory of Open Access Journals (Sweden)

    P. Thandi Hicks Harper

    2007-09-01

    Full Text Available Hip-Hop culture in the lives of youth can not be ignored. This research is based on the premise that youth workers who expect ongoing successes must increase their Hip-Hop culture competence. The study examined the knowledge of and attitude towards Hip-Hop by educators who participated in a Hip-Hop 101 workshop. Their perceptions relevant to the importance of Hip-Hop awareness and application for positively influencing youth behaviors were also explored. Results revealed that workshop participants significantly increased their Hip-Hop knowledge. They also demonstrated significantly more favorable attitudes toward Hip-Hop and its use for youth development. Findings suggest that the workshop promoted an environment conducive to bridging the generation gap between youth who embrace Hip-Hop, and educators who have a less favorable view. This research provides insight into Hip-Hop Developmenttm as a core component for establishing the kinds of youth-adult partnerships necessary for today’s Hip-Hop generation’s self-growth, skill enhancement, and leadership development.

  16. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  17. Lack of association between gastric cancer and hopQ alleles in Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Kazemi Elham

    2016-01-01

    Full Text Available Helicobacter pylori use a number of mechanisms to survive in the stomach lumen. The presence of these bacteria in the stomach can lead to gastritis and reduction in stomach acid production. Acute inflammation can directly damage to the peripheral cells that are responsible for the secretion of acid. The risk of developing gastric carcinoma is associated to heterogeneity of Helicobacter pylori virulence factors (such as cagA. The HopQ is one of the outer membrane proteins involved in bacterial adherence to gastric mucosa and has been suggested to also play a role in the virulence of H. pylori. This gene has been shown in two types. The purpose of the current study was to investigate the association between different H. pylori virulence hopQ alleles (types I and II and patients with gastroduodenal disorders. For this purpose 58 stomach biopsies the of patients with gastric cancer and 100 saliva samples from healthy individuals were collected. Then genomic DNA was purified and PCR for was done for desired genes via specific primers. The H. pylori infections were diagnosed by PCR for GlmM gene. Then frequencies of hopQI+, hopQII+ and hopQI+ hopQII+ genotypes were determined in H. pylori infected cases. Statistical analysis showed that there were not significant differences between healthy and diseased ones for genotypes hopQI+, hopQII+ and hopQI+ hopQII+.

  18. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration.

    Science.gov (United States)

    Zhang, Shufang; Chen, Longkun; Jiang, Yangzi; Cai, Youzhi; Xu, Guowei; Tong, Tong; Zhang, Wei; Wang, Linlin; Ji, Junfeng; Shi, Peihua; Ouyang, Hong Wei

    2013-07-01

    An optimal scaffold is crucial for osteochondral regeneration. Collagen and electrospun nanofibers have been demonstrated to facilitate cartilage and bone regeneration, respectively. However, the effect of combining collagen and electrospun nanofibers on osteochondral regeneration has yet to be evaluated. Here, we report that the combination of collagen and electrospun poly-l-lactic acid nanofibers synergistically promotes osteochondral regeneration. We first fabricated bi-layer microporous scaffold with collagen and electrospun poly-l-lactic acid nanofibers (COL-nanofiber). Mesenchymal stem cells were cultured on the bi-layer scaffold and their adhesion, proliferation and differentiation were examined. Moreover, osteochondral defects were created in rabbits and implanted with COL-nanofiber scaffold. Cartilage and subchondral bone regeneration were evaluated at 6 and 12weeks after surgery. Compared with COL scaffold, cells on COL-nanofiber scaffold exhibited more robust osteogenic differentiation, indicated by higher expression levels of OCN and runx2 genes as well as the accumulation of calcium nodules. Furthermore, implantation of COL-nanofiber scaffold seeded with cells induced more rapid subchondral bone emergence, and better cartilage formation, which led to better functional repair of osteochondral defects as manifested by histological staining, biomechanical test and micro-computed tomography data. Our study underscores the potential of using the bi-layer microporous COL-nanofiber scaffold for the treatment of deep osteochondral defects. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  19. Hybrid nanofibrous scaffolds from electrospinning of a synthetic biodegradable elastomer and urinary bladder matrix

    Science.gov (United States)

    Stankus, John J.; Freytes, Donald O.; Badylak, Stephen F.; Wagner, William R.

    2010-01-01

    Synthetic materials can be electrospun into submicron or nanofibrous scaffolds to mimic extracellular matrix (ECM) scale and architecture with reproducible composition and adaptable mechanical properties. However, these materials lack the bioactivity present in natural ECM. ECM-derived scaffolds contain bioactive molecules that exert in vivo mimicking effects as applied for soft tissue engineering, yet do not possess the same flexibility in mechanical property control as some synthetics. The objective of the present study was to combine the controllable properties of a synthetic, biodegradable elastomer with the inherent bioactivity of an ECM derived scaffold. A hybrid electrospun scaffold composed of a biodegradable poly(ester-urethane)urea (PEUU) and a porcine ECM scaffold (urinary bladder matrix, UBM) was fabricated and characterized for its bioactive and physical properties both in vitro and in vivo. Increasing amounts of PEUU led to linear increases in both tensile strength and breaking strain while UBM incorporation led to increased in vitro smooth muscle cell adhesion and proliferation and in vitro mass loss. Subcutaneous implantation of the hybrid scaffolds resulted in increased scaffold degradation and a large cellular infiltrate when compared with electrospun PEUU alone. Electrospun UBM/PEUU combined the attractive bioactivity and mechanical features of its individual components to result in scaffolds with considerable potential for soft tissue engineering applications. PMID:18419942

  20. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  1. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  2. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  3. Living bacterial sacrificial porogens to engineer decellularized porous scaffolds.

    Directory of Open Access Journals (Sweden)

    Feng Xu

    Full Text Available Decellularization and cellularization of organs have emerged as disruptive methods in tissue engineering and regenerative medicine. Porous hydrogel scaffolds have widespread applications in tissue engineering, regenerative medicine and drug discovery as viable tissue mimics. However, the existing hydrogel fabrication techniques suffer from limited control over pore interconnectivity, density and size, which leads to inefficient nutrient and oxygen transport to cells embedded in the scaffolds. Here, we demonstrated an innovative approach to develop a new platform for tissue engineered constructs using live bacteria as sacrificial porogens. E.coli were patterned and cultured in an interconnected three-dimensional (3D hydrogel network. The growing bacteria created interconnected micropores and microchannels. Then, the scafold was decellularized, and bacteria were eliminated from the scaffold through lysing and washing steps. This 3D porous network method combined with bioprinting has the potential to be broadly applicable and compatible with tissue specific applications allowing seeding of stem cells and other cell types.

  4. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  5. Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

    Science.gov (United States)

    Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

    2017-10-01

    Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

  6. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  7. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  8. PERFORMANCE ANALYSIS OF ARQ AND HYBRID ARQ OVER SINGLE-HOP, DUAL-HOP, AND MULTIBRANCH DUAL-HOP NETWORKS

    KAUST Repository

    Hadjtaieb, Amir

    2014-05-01

    During the last decade, relay networks have attracted a lot of interest due to their numerous benefits. The relaying technique allows extending the coverage zone of wireless networks and offers a higher reliability for communication systems. The performance of relay networks can be improved further by the use of automatic repeat request (ARQ) and hybrid automatic repeat request (HARQ) techniques. ARQ and HARQ are retransmission mechanisms that ensure a good quality of service even in absence of channel state information at the transmitter. We, firstly, study the spectral and energy efficiency of ARQ in Nakagami-m block-fading channels. We maximize both spectral efficiency and energy efficiency with respect to the transmitted power. We derive exact expressions as well as compact and tight approximation for the solutions of these problems. Our analysis shows that the two problems of maximizing spectral efficiency and energy efficiency with respect to the transmitted power are completely different and give different solutions. Additionally, operating with a power that maximizes energy efficiency can lead to a significant drop in the spectral efficiency, and vice versa. Next, we consider a three node relay network comprising a source, a relay, and a destination. The source transmits the message to the destination using HARQ with incremental redundancy (IR). The relay overhears the transmitted message, amplifies it using a variable gain amplifier, and then forwards the message to the destination. This latter combines both the source and the relay message and tries to decode the information. In case of decoding failure, the destination sends a negative acknowledgement. A new replica of the message containing new parity bits is then transmitted in the subsequent HARQ round. This process continues until successful decoding occurs at the destination or a maximum number M of rounds is reached. We study the performance of HARQ-IR over the considered relay channel from an

  9. VizieR Online Data Catalog: The Herschel Orion Protostar Survey (HOPS): SEDs (Furlan+, 2016)

    Science.gov (United States)

    Furlan, E.; Fischer, W. J.; Ali, B.; Stutz, A. M.; Stanke, T.; Tobin, J. J.; Megeath, S. T.; Osorio, M.; Hartmann, L.; Calvet, N.; Poteet, C. A.; Booker, J.; Manoj, P.; Watson, D. M.; Allen, L.

    2016-06-01

    To summarize, starting from a sample of 410 Herschel Orion Protostar Survey (HOPS) targets (see section 2), but excluding likely contaminants and objects not observed or detected by PACS, there are 330 remaining objects that have Spitzer and Herschel data and are considered protostars (based on their Spitzer classification from Megeath et al. 2012, J/AJ/144/192). They form the sample studied in this work. In order to construct SEDs for our sample of 330 YSOs, we combined our own Herschel/PACS observations (see Proposal KPOTtmegeath2) with data from the literature and existing catalogs (see section 3.1). To extend the SEDs into the submillimeter, most of the YSOs were also observed in the continuum at 350 and 870um with the Atacama Pathfinder Experiment (APEX) telescope (Stutz et al. 2013, J/ApJ/767/36). (5 data files).

  10. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    Directory of Open Access Journals (Sweden)

    Dong-Gwang Ha

    2016-04-01

    Full Text Available Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs. Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenylamine (TCTA :1,3-bis(3,5-dipyrid-3-yl-phenylbenzene (BmPyPb mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.

  11. Creating hierarchical porosity hydroxyapatite scaffolds with osteoinduction by three-dimensional printing and microwave sintering.

    Science.gov (United States)

    Pei, Xuan; Ma, Liang; Zhang, Boqing; Sun, Jianxun; Sun, Yong; Fan, Yujiang; Gou, Zhongru; Zhou, Changchun; Zhang, Xingdong

    2017-11-14

    Hierarchical porosity, which includes micropores and macropores in scaffolds, contributes to important multiple biological functions for tissue regeneration. This paper introduces a two-step method of combining three-dimensional printing (3DP) and microwave sintering to fabricate two-level hierarchical porous scaffolds. The results showed that 3D printing made the macroporous structure well-controlled and microwave sintering generated micropores on the macropore surface. The resulting hierarchical macro/microporous hydroxyapatite scaffold induced bone formation following intramuscular implantation. Moreover, when comparing the hierarchical macro/microporous hydroxyapatite scaffold to the non-osteoinductive hydroxyapatite scaffolds (either 3D printed or H 2 O 2 foamed) subjected to muffle sintering which do not have micropores, the critical role of micropores in material-driven bone formation was shown. The findings presented herein could be useful for the further optimization of bone grafting materials for bone regeneration.

  12. Composite 3D printed scaffold with structured electrospun nanofibers promotes chondrocyte adhesion and infiltration.

    Science.gov (United States)

    Rampichová, M; Košt'áková Kuželová, E; Filová, E; Chvojka, J; Šafka, J; Pelcl, M; Daňková, J; Prosecká, E; Buzgo, M; Plencner, M; Lukáš, D; Amler, E

    2017-11-13

    Additive manufacturing, also called 3D printing, is an effective method for preparing scaffolds with defined structure and porosity. The disadvantage of the technique is the excessive smoothness of the printed fibers, which does not support cell adhesion. In the present study, a 3D printed scaffold was combined with electrospun classic or structured nanofibers to promote cell adhesion. Structured nanofibers were used to improve the infiltration of cells into the scaffold. Electrospun layers were connected to 3D printed fibers by gluing, thus enabling the fabrication of scaffolds with unlimited thickness. The composite 3D printed/nanofibrous scaffolds were seeded with primary chondrocytes and tested in vitro for cell adhesion, proliferation and differentiation. The experiment showed excellent cell infiltration, viability, and good cell proliferation. On the other hand, partial chondrocyte dedifferentiation was shown. Other materials supporting chondrogenic differentiation will be investigated in future studies.

  13. 3D Printed Silicone–Hydrogel Scaffold with Enhanced Physicochemical Properties

    DEFF Research Database (Denmark)

    Mohanty, Soumyaranjan; Alm, Martin; Hemmingsen, Mette

    2016-01-01

    is currently a huge challenge. The goal of this work was to fabricate a tissue engineering scaffold from clinically approved materials with the capability of delivering biomolecules and direct cell fate. We have used a simple 3D printing approach, that combines polymer casting with supercritical fluid...... technology to produce 3D interpenetrating polymer network (IPN) scaffold of silicone-poly(2-hydroxyethyl methacrylate)-co-poly(ethylene glycol) methyl ether acrylate (pHEMA-co-PEGMEA). The pHEMA-co-PEGMEA IPN materials were employed to support growth of human mesenchymal stem cells (hMSC), resulting in high...... cell viability and metabolic activity over a 3 weeks period. In addition, the IPN scaffolds support 3D tissue formation inside the porous scaffold with well spread cell morphology on the surface of the scaffold. As a proof of concept, sustained doxycycline (DOX) release from pHEMA-co-PEGMEA IPN...

  14. Structural influence on atomic hopping and electronic states of Pd-based bulk metallic glasses

    OpenAIRE

    Tang, X.-P.; Löffler, Jörg F.; Schwarz, R. B.; Johnson, William L.; Wu, Yue

    2005-01-01

    Atomic motion and electronic structures of Pd–Ni–Cu–P bulk metallic glasses were investigated using 31P nuclear magnetic resonance. The hopping rate of P atoms was determined by the stimulated echo technique. Significant hopping was observed in all alloys well below the glass transition temperature. Increasing the Cu content to above 25 at. % increases P hopping significantly, consistent with the previous finding that the openness of the structure increases with Cu content. In contrast, P h...

  15. Ornamenting 3D printed scaffolds with cell-laid extracellular matrix for bone tissue regeneration.

    Science.gov (United States)

    Pati, Falguni; Song, Tae-Ha; Rijal, Girdhari; Jang, Jinah; Kim, Sung Won; Cho, Dong-Woo

    2015-01-01

    3D printing technique is the most sophisticated technique to produce scaffolds with tailorable physical properties. But, these scaffolds often suffer from limited biological functionality as they are typically made from synthetic materials. Cell-laid mineralized ECM was shown to be potential for improving the cellular responses and drive osteogenesis of stem cells. Here, we intend to improve the biological functionality of 3D-printed synthetic scaffolds by ornamenting them with cell-laid mineralized extracellular matrix (ECM) that mimics a bony microenvironment. We developed bone graft substitutes by using 3D printed scaffolds made from a composite of polycaprolactone (PCL), poly(lactic-co-glycolic acid) (PLGA), and β-tricalcium phosphate (β-TCP) and mineralized ECM laid by human nasal inferior turbinate tissue-derived mesenchymal stromal cells (hTMSCs). A rotary flask bioreactor was used to culture hTMSCs on the scaffolds to foster formation of mineralized ECM. A freeze/thaw cycle in hypotonic buffer was used to efficiently decellularize (97% DNA reduction) the ECM-ornamented scaffolds while preserving its main organic and inorganic components. The ECM-ornamented 3D printed scaffolds supported osteoblastic differentiation of newly-seeded hTMSCs by upregulating four typical osteoblastic genes (4-fold higher RUNX2; 3-fold higher ALP; 4-fold higher osteocalcin; and 4-fold higher osteopontin) and increasing calcium deposition compared to bare 3D printed scaffolds. In vivo, in ectopic and orthotopic models in rats, ECM-ornamented scaffolds induced greater bone formation than that of bare scaffolds. These results suggest a valuable method to produce ECM-ornamented 3D printed scaffolds as off-the-shelf bone graft substitutes that combine tunable physical properties with physiological presentation of biological signals. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Characterizing the macro and micro mechanical properties of scaffolds for rotator cuff repair.

    Science.gov (United States)

    Smith, Richard D J; Zargar, Nasim; Brown, Cameron P; Nagra, Navraj S; Dakin, Stephanie G; Snelling, Sarah J B; Hakimi, Osnat; Carr, Andrew

    2017-11-01

    Retearing after rotator cuff surgery is a major clinical problem. Numerous scaffolds are being used to try to reduce retear rates. However, few have demonstrated clinical efficacy. We hypothesize that this lack of efficacy is due to insufficient mechanical properties. Therefore, we compared the macro and nano/micro mechanical properties of 7 commercially available scaffolds to those of the human supraspinatus tendons, whose function they seek to restore. The clinically approved scaffolds tested were X-Repair, LARS ligament, Poly-Tape, BioFiber, GraftJacket, Permacol, and Conexa. Fresh frozen cadaveric human supraspinatus tendon samples were used. Macro mechanical properties were determined through tensile testing and rheometry. Scanning probe microscopy and scanning electron microscopy were performed to assess properties of materials at the nano/microscale (morphology, Young modulus, loss tangent). None of the scaffolds tested adequately approximated both the macro and micro mechanical properties of human supraspinatus tendon. Macroscale mechanical properties were insufficient to restore load-bearing function. The best-performing scaffolds on the macroscale (X-Repair, LARS ligament) had poor nano/microscale properties. Scaffolds approximating tendon properties on the nano/microscale (BioFiber, biologic scaffolds) had poor macroscale properties. Existing scaffolds failed to adequately approximate the mechanical properties of human supraspinatus tendons. Combining the macroscopic mechanical properties of a synthetic scaffold with the micro mechanical properties of biologic scaffold could better achieve this goal. Future work should focus on advancing techniques to create new scaffolds with more desirable mechanical properties. This may help improve outcomes for rotator cuff surgery patients. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  17. Systematic characterization of porosity and mass transport and mechanical properties of porous polyurethane scaffolds.

    Science.gov (United States)

    Wang, Yu-Fu; Barrera, Carlos M; Dauer, Edward A; Gu, Weiyong; Andreopoulos, Fotios; Huang, C-Y Charles

    2017-01-01

    One of the key challenges in porous scaffold design is to create a porous structure with desired mechanical function and mass transport properties which support delivery of biofactors and development of function tissue substitute. In recent years, polyurethane (PU) has become one of the most popular biomaterials in various tissue engineering fields. However, there are no studies fully investigating the relations between porosity and both mass transport and mechanical properties of PU porous scaffolds. In this paper, we fabricated PU scaffolds by combining phase inversion and salt (sodium chloride) leaching methods. The tensile and compressive moduli were examined on PU scaffolds fabricated with different PU concentrations (25%, 20% and 15% w/v) and salt/PU weight ratios (9/1, 6/1, 3/1 and 0/1). The mass transport properties of PU scaffolds including hydraulic permeability and glucose diffusivity were also measured. Furthermore, the relationships between the porosity and mass transport and mechanical properties of porous PU scaffold were systemically investigated. The results demonstrated that porosity is a key parameter which governs both mass transport and mechanical properties of porous PU scaffolds. With similar pore sizes, the mass transport and mechanical properties of porous PU scaffold can be described as single functions of porosity regardless of initial PU concentration. The relationships between scaffold porosity and properties can be utilized to facilitate porous PU scaffold fabrication with specific mass transport and mechanical properties. The systematic approach established in this study can be applied to characterization of other biomaterials for scaffold design and fabrication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Hybrid Carbon-Based Scaffolds for Applications in Soft Tissue Reconstruction

    Science.gov (United States)

    Lafdi, Khalid; Joseph, Robert M.; Tsonis, Panagiotis A.

    2012-01-01

    Current biomedical scaffolds utilized in surgery to repair soft tissues commonly fail to meet the optimal combination of biomechanical and tissue regenerative properties. Carbon is a scaffold alternative that potentially optimizes the balance between mechanical strength, durability, and function as a cell and biologics delivery vehicle that is necessary to restore tissue function while promoting tissue repair. The goals of this study were to investigate the feasibility of fabricating hybrid fibrous carbon scaffolds modified with biopolymer, polycaprolactone and to analyze their mechanical properties and ability to support cell growth and proliferation. Environmental scanning electron microscopy, micro-computed tomography, and cell adhesion and cell proliferation studies were utilized to test scaffold suitability as a cell delivery vehicle. Mechanical properties were tested to examine load failure and elastic modulus. Results were compared to an acellular dermal matrix scaffold control (GraftJacket® [GJ] Matrix), selected for its common use in surgery for the repair of soft tissues. Results indicated that carbon scaffolds exhibited similar mechanical maximums and capacity to support fibroblast adhesion and proliferation in comparison with GJ. Fibroblast adhesion and proliferation was collinear with carbon fiber orientation in regions of sparsely distributed fibers and occurred in clusters in regions of higher fiber density and low porosity. Overall, fibroblast adhesion and proliferation was greatest in lower porosity carbon scaffolds with highly aligned fibers. Stepwise multivariate regression showed that the variability in maximum load of carbon scaffolds and controls were dependent on unique and separate sets of parameters. These finding suggested that there were significant differences in the functional implications of scaffold design and material properties between carbon and dermis derived scaffolds that affect scaffold utility as a tissue replacement

  19. Scaffolding for solving problem in static fluid: A case study

    Science.gov (United States)

    Koes-H, Supriyono; Muhardjito, Wijaya, Charisma P.

    2018-01-01

    Problem solving is one of the basic abilities that should be developed from learning physics. However, students still face difficulties in the process of non-routine problem-solving. Efforts are necessary to be taken in order to identify such difficulties and the solutions to solve them. An effort in the form of a diagnosis of students' performance in problem solving can be taken to identify their difficulties, and various instructional scaffolding supports can be utilized to eliminate the difficulties. This case study aimed to describe the students' difficulties in solving static fluid problems and the effort to overcome such difficulties through different scaffolding supports. The research subjects consisted of four 10-grade students of (Public Senior High School) SMAN 4 Malang selected by purposive sampling technique. The data of students' difficulties were collected via think-aloud protocol implemented on students' performance in solving non-routine static fluid problems. Subsequently, combined scaffolding supports were given to the students based on their particular difficulties. The research findings pointed out that there were several conceptual difficulties discovered from the students when solving static fluid problems, i.e. the use of buoyancy force formula, determination of all forces acting on a plane in a fluid, the resultant force on a plane in a fluid, and determination of a plane depth in a fluid. An effort that can be taken to overcome such conceptual difficulties is providing a combination of some appropriate scaffolding supports, namely question prompts with specific domains, simulation, and parallel modeling. The combination can solve students' lack of knowledge and improve their conceptual understanding, as well as help them to find solutions by linking the problems with their prior knowledge. According to the findings, teachers are suggested to diagnose the students' difficulties so that they can provide an appropriate combination of

  20. Generalized adiabatic polaron hopping: Meyer-Neldel compensation and Poole-Frenkel behavior.

    Science.gov (United States)

    Emin, David

    2008-04-25

    The commonly employed adiabatic treatment of polaron hopping is extended to treat the continuous alteration of a carrier wave function with the atoms' movements and a carrier's long-range interaction with a polar surrounding. These features, respectively, introduce carrier-induced softening of the atoms' vibrations and a hopping activation energy that depends on hopping distance. The Meyer-Neldel compensation effect results from carrier-induced softening of vibrations. Poole-Frenkel behavior emerges for electric-field driven polaron hopping in ionic and polar media.

  1. Animal galloping and human hopping: an energetics and biomechanics laboratory exercise.

    Science.gov (United States)

    Lindstedt, Stan L; Mineo, Patrick M; Schaeffer, Paul J

    2013-12-01

    This laboratory exercise demonstrates fundamental principles of mammalian locomotion. It provides opportunities to interrogate aspects of locomotion from biomechanics to energetics to body size scaling. It has the added benefit of having results with robust signal to noise so that students will have success even if not "meticulous" in attention to detail. First, using respirometry, students measure the energetic cost of hopping at a "preferred" hop frequency. This is followed by hopping at an imposed frequency half of the preferred. By measuring the O2 uptake and work done with each hop, students calculate mechanical efficiency. Lessons learned from this laboratory include 1) that the metabolic cost per hop at half of the preferred frequency is nearly double the cost at the preferred frequency; 2) that when a person is forced to hop at half of their preferred frequency, the mechanical efficiency is nearly that predicted for muscle but is much higher at the preferred frequency; 3) that the preferred hop frequency is strongly body size dependent; and 4) that the hop frequency of a human is nearly identical to the galloping frequency predicted for a quadruped of our size. Together, these exercises demonstrate that humans store and recover elastic recoil potential energy when hopping but that energetic savings are highly frequency dependent. This stride frequency is dependent on body size such that frequency is likely chosen to maximize this function. Finally, by requiring students to make quantitative solutions using appropriate units and dimensions of the physical variables, these exercises sharpen analytic and quantitative skills.

  2. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  3. Helicobacter pylori adhesin HopQ engages in a virulence-enhancing interaction with human CEACAMs.

    Science.gov (United States)

    Javaheri, Anahita; Kruse, Tobias; Moonens, Kristof; Mejías-Luque, Raquel; Debraekeleer, Ayla; Asche, Carmen I; Tegtmeyer, Nicole; Kalali, Behnam; Bach, Nina C; Sieber, Stephan A; Hill, Darryl J; Königer, Verena; Hauck, Christof R; Moskalenko, Roman; Haas, Rainer; Busch, Dirk H; Klaile, Esther; Slevogt, Hortense; Schmidt, Alexej; Backert, Steffen; Remaut, Han; Singer, Bernhard B; Gerhard, Markus

    2016-10-17

    Helicobacter pylori specifically colonizes the human gastric epithelium and is the major causative agent for ulcer disease and gastric cancer development. Here, we identify members of the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family as receptors of H. pylori and show that HopQ is the surface-exposed adhesin that specifically binds human CEACAM1, CEACAM3, CEACAM5 and CEACAM6. HopQ-CEACAM binding is glycan-independent and targeted to the N-domain. H. pylori binding induces CEACAM1-mediated signalling, and the HopQ-CEACAM1 interaction enables translocation of the virulence factor CagA into host cells and enhances the release of pro-inflammatory mediators such as interleukin-8. Based on the crystal structure of HopQ, we found that a β-hairpin insertion (HopQ-ID) in HopQ's extracellular 3+4 helix bundle domain is important for CEACAM binding. A peptide derived from this domain competitively inhibits HopQ-mediated activation of the Cag virulence pathway, as genetic or antibody-mediated abrogation of the HopQ function shows. Together, our data suggest the HopQ-CEACAM1 interaction to be a potentially promising novel therapeutic target to combat H. pylori-associated diseases.

  4. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  5. Porous Allograft Bone Scaffolds: Doping with Strontium

    Science.gov (United States)

    Zhao, Yantao; Guo, Dagang; Hou, Shuxun; Zhong, Hongbin; Yan, Jun; Zhang, Chunli; Zhou, Ying

    2013-01-01

    Strontium (Sr) can promote the process of bone formation. To improve bioactivity, porous allograft bone scaffolds (ABS) were doped with Sr and the mechanical strength and bioactivity of the scaffolds were evaluated. Sr-doped ABS were prepared using the ion exchange method. The density and distribution of Sr in bone scaffolds were investigated by inductively coupled plasma optical emission spectrometry (ICP-OES), X-ray photoelectron spectroscopy (XPS), and energy-dispersive X-ray spectroscopy (EDS). Controlled release of strontium ions was measured and mechanical strength was evaluated by a compressive strength test. The bioactivity of Sr-doped ABS was investigated by a simulated body fluid (SBF) assay, cytotoxicity testing, and an in vivo implantation experiment. The Sr molar concentration [Sr/(Sr+Ca)] in ABS surpassed 5% and Sr was distributed nearly evenly. XPS analyses suggest that Sr combined with oxygen and carbonate radicals. Released Sr ions were detected in the immersion solution at higher concentration than calcium ions until day 30. The compressive strength of the Sr-doped ABS did not change significantly. The bioactivity of Sr-doped material, as measured by the in vitro SBF immersion method, was superior to that of the Sr-free freeze-dried bone and the Sr-doped material did not show cytotoxicity compared with Sr-free culture medium. The rate of bone mineral deposition for Sr-doped ABS was faster than that of the control at 4 weeks (3.28±0.23 µm/day vs. 2.60±0.20 µm/day; p<0.05). Sr can be evenly doped into porous ABS at relevant concentrations to create highly active bone substitutes. PMID:23922703

  6. Porous allograft bone scaffolds: doping with strontium.

    Directory of Open Access Journals (Sweden)

    Yantao Zhao

    Full Text Available Strontium (Sr can promote the process of bone formation. To improve bioactivity, porous allograft bone scaffolds (ABS were doped with Sr and the mechanical strength and bioactivity of the scaffolds were evaluated. Sr-doped ABS were prepared using the ion exchange method. The density and distribution of Sr in bone scaffolds were investigated by inductively coupled plasma optical emission spectrometry (ICP-OES, X-ray photoelectron spectroscopy (XPS, and energy-dispersive X-ray spectroscopy (EDS. Controlled release of strontium ions was measured and mechanical strength was evaluated by a compressive strength test. The bioactivity of Sr-doped ABS was investigated by a simulated body fluid (SBF assay, cytotoxicity testing, and an in vivo implantation experiment. The Sr molar concentration [Sr/(Sr+Ca] in ABS surpassed 5% and Sr was distributed nearly evenly. XPS analyses suggest that Sr combined with oxygen and carbonate radicals. Released Sr ions were detected in the immersion solution at higher concentration than calcium ions until day 30. The compressive strength of the Sr-doped ABS did not change significantly. The bioactivity of Sr-doped material, as measured by the in vitro SBF immersion method, was superior to that of the Sr-free freeze-dried bone and the Sr-doped material did not show cytotoxicity compared with Sr-free culture medium. The rate of bone mineral deposition for Sr-doped ABS was faster than that of the control at 4 weeks (3.28 ± 0.23 µm/day vs. 2.60 ± 0.20 µm/day; p<0.05. Sr can be evenly doped into porous ABS at relevant concentrations to create highly active bone substitutes.

  7. Influence of Controlled Cooling in Bimodal Scaffold Fabrication Using Polymers with Different Melting Temperatures

    Directory of Open Access Journals (Sweden)

    Hernan Lara-Padilla

    2017-06-01

    Full Text Available The combination of different materials and capabilities to manufacture at several scales open new possibilities in scaffold design for bone regeneration. This work is focused on bimodal scaffolds that combine polylactic acid (PLA melt extruded strands with polycaprolactone (PCL electrospun fibers. This type of bimodal scaffold offers better mechanical properties, compared to the use of PCL for the extruded strands, and provides potential a means for controlled drug and/or growth factor delivery through the electrospun fibers. The technologies of fused deposition modeling (FDM and electrospinning were combined to create 3D bimodal constructs. The system uses a controlled cooling system allowing the combination of polymers with different melting temperatures to generate integrated scaffold architecture. The thermoplastic polymers used in the FDM process enhance the mechanical properties of the bimodal scaffold and control the pore structure. Integrated layers of electrospun microfibers induce an increase of the surface area for cell culture purposes, as well as potential in situ controlled drug and/or growth factor delivery. The proposed bimodal scaffolds (PLA extruded strands and PCL electrospun fibers show appropriate morphology and better mechanical properties when compared to the use of PCL extruded strands. On average, bimodal scaffolds with overall dimensions of 30 × 30 × 2.4 mm3 (strand diameter of 0.5 mm, strand stepover of 2.5 mm, pore size of 2 mm, and layer height of 0.3 mm showed scaffold stiffness of 23.73 MPa and compression strength of 3.85 MPa. A cytotoxicity assay based human fibroblasts showed viability of the scaffold materials.

  8. Mechanical anisotropy of titanium scaffolds

    Directory of Open Access Journals (Sweden)

    Rüegg Jasmine

    2017-09-01

    Full Text Available The clinical performance of an implant, e.g. for the treatment of large bone defects, depends on the implant material, anchorage, surface topography and chemistry, but also on the mechanical properties, like the stiffness. The latter can be adapted by the porosity. Whereas foams show isotropic mechanical properties, digitally modelled scaffolds can be designed with anisotropic behaviour. In this study, we designed and produced 3D scaffolds based on an orthogonal architecture and studied its angle-dependent stiffness. The aim was to produce scaffolds with different orientations of the microarchitecture by selective laser melting and compare the angle-specific mechanical behaviour with an in-silico simulation. The anisotropic characteristics of open-porous implants and technical limitations of the production process were studied.

  9. Molecular Recognition within Synaptic Scaffolds

    DEFF Research Database (Denmark)

    Erlendsson, Simon

    function. At the molecular level PICK1 contains both a BAR and a PDZ domain making it quite unique. Especially the specificity and promiscuity of the PICK1 PDZ domain seems to be more complicated than normally seen for PDZ domains. Also, the ability of PICK1 to form dimeric structures via its central BAR...... by the spatial architecture of the synapse itself. In this thesis, the molecular scaffolding mechanisms of PICK1 have been investigated in both isolated and near native conditions. Our findings have significantly benefitted the general understanding of how PICK1 and PDZ domain scaffolding works. In the first......-inhibitory mechanism of PICK1 and allows the N-BAR domains or the PDZ domains themselves to cluster and shape membranes. Finally, we utilized our in-solution structural knowledge to investigate the scaffolding events in context of a native cell membrane. We initially showed that we were able to qualitatively assess...

  10. 3D Powder Printed Bioglass and β-Tricalcium Phosphate Bone Scaffolds

    Directory of Open Access Journals (Sweden)

    Michael Seidenstuecker

    2017-12-01

    Full Text Available The use of both bioglass (BG and β tricalcium phosphate (β-TCP for bone replacement applications has been studied extensively due to the materials’ high biocompatibility and ability to resorb when implanted in the body. 3D printing has been explored as a fast and versatile technique for the fabrication of porous bone scaffolds. This project investigates the effects of using different combinations of a composite BG and β-TCP powder for 3D printing of porous bone scaffolds. Porous 3D powder printed bone scaffolds of BG, β-TCP, 50/50 BG/β-TCP and 70/30 BG/β-TCP compositions were subject to a variety of characterization and biocompatibility tests. The porosity characteristics, surface roughness, mechanical strength, viability for cell proliferation, material cytotoxicity and in vitro bioactivity were assessed. The results show that the scaffolds can support osteoblast-like MG-63 cells growth both on the surface of and within the scaffold material and do not show alarming cytotoxicity; the porosity and surface characteristics of the scaffolds are appropriate. Of the two tested composite materials, the 70/30 BG/β-TCP scaffold proved to be superior in terms of biocompatibility and mechanical strength. The mechanical strength of the scaffolds makes them unsuitable for load bearing applications. However, they can be useful for other applications such as bone fillers.

  11. Development of Composite Scaffolds for Load-Bearing Segmental Bone Defects

    Directory of Open Access Journals (Sweden)

    Marcello Pilia

    2013-01-01

    Full Text Available The need for a suitable tissue-engineered scaffold that can be used to heal load-bearing segmental bone defects (SBDs is both immediate and increasing. During the past 30 years, various ceramic and polymer scaffolds have been investigated for this application. More recently, while composite scaffolds built using a combination of ceramics and polymeric materials are being investigated in a greater number, very few products have progressed from laboratory benchtop studies to preclinical testing in animals. This review is based on an exhaustive literature search of various composite scaffolds designed to serve as bone regenerative therapies. We analyzed the benefits and drawbacks of different composite scaffold manufacturing techniques, the properties of commonly used ceramics and polymers, and the properties of currently investigated synthetic composite grafts. To follow, a comprehensive review of in vivo models used to test composite scaffolds in SBDs is detailed to serve as a guide to design appropriate translational studies and to identify the challenges that need to be overcome in scaffold design for successful translation. This includes selecting the animal type, determining the anatomical location within the animals, choosing the correct study duration, and finally, an overview of scaffold performance assessment.

  12. Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review.

    Science.gov (United States)

    Chaudhari, Atul A; Vig, Komal; Baganizi, Dieudonné Radé; Sahu, Rajnish; Dixit, Saurabh; Dennis, Vida; Singh, Shree Ram; Pillai, Shreekumar R

    2016-11-25

    Over centuries, the field of regenerative skin tissue engineering has had several advancements to facilitate faster wound healing and thereby restoration of skin. Skin tissue regeneration is mainly based on the use of suitable scaffold matrices. There are several scaffold types, such as porous, fibrous, microsphere, hydrogel, composite and acellular, etc., with discrete advantages and disadvantages. These scaffolds are either made up of highly biocompatible natural biomaterials, such as collagen, chitosan, etc., or synthetic materials, such as polycaprolactone (PCL), and poly-ethylene-glycol (PEG), etc. Composite scaffolds, which are a combination of natural or synthetic biomaterials, are highly biocompatible with improved tensile strength for effective skin tissue regeneration. Appropriate knowledge of the properties, advantages and disadvantages of various biomaterials and scaffolds will accelerate the production of suitable scaffolds for skin tissue regeneration applications. At the same time, emphasis on some of the leading challenges in the field of skin tissue engineering, such as cell interaction with scaffolds, faster cellular proliferation/differentiation, and vascularization of engineered tissues, is inevitable. In this review, we discuss various types of scaffolding approaches and biomaterials used in the field of skin tissue engineering and more importantly their future prospects in skin tissue regeneration efforts.

  13. Biosilicate®-gelatine bone scaffolds by the foam replica technique: development and characterization.

    Science.gov (United States)

    Desimone, Deborah; Li, Wei; Roether, Judith A; Schubert, Dirk W; Crovace, Murilo C; Rodrigues, Ana Candida M; Zanotto, Edgar D; Boccaccini, Aldo R

    2013-08-01

    The development of bioactive glass-ceramic materials has been a topic of great interest aiming at enhancing the mechanical strength of traditional bioactive scaffolds. In the present study, we test and demonstrate the use of Biosilicate® glass-ceramic powder to fabricate bone scaffolds by the foam replica method. Scaffolds possessing the main requirements for use in bone tissue engineering (95% porosity, 200-500 μm pore size) were successfully produced. Gelatine coating was investigated as a simple approach to increase the mechanical competence of the scaffolds. The gelatine coating did not affect the interconnectivity of the pores and did not significantly affect the bioactivity of the Biosilicate® scaffold. The gelatine coating significantly improved the compressive strength (i.e. 0.80 ± 0.05 MPa of coated versus 0.06 ± 0.01 MPa of uncoated scaffolds) of the Biosilicate® scaffold. The combination of Biosilicate® glass-ceramic and gelatine is attractive for producing novel scaffolds for bone tissue engineering.

  14. Biosilicate®–gelatine bone scaffolds by the foam replica technique: development and characterization

    Directory of Open Access Journals (Sweden)

    Deborah Desimone, Wei Li, Judith A Roether, Dirk W Schubert, Murilo C Crovace, Ana Candida M Rodrigues, Edgar D Zanotto and Aldo R Boccaccini

    2013-01-01

    Full Text Available The development of bioactive glass-ceramic materials has been a topic of great interest aiming at enhancing the mechanical strength of traditional bioactive scaffolds. In the present study, we test and demonstrate the use of Biosilicate® glass-ceramic powder to fabricate bone scaffolds by the foam replica method. Scaffolds possessing the main requirements for use in bone tissue engineering (95% porosity, 200–500 μm pore size were successfully produced. Gelatine coating was investigated as a simple approach to increase the mechanical competence of the scaffolds. The gelatine coating did not affect the interconnectivity of the pores and did not significantly affect the bioactivity of the Biosilicate® scaffold. The gelatine coating significantly improved the compressive strength (i.e. 0.80 ± 0.05 MPa of coated versus 0.06 ± 0.01 MPa of uncoated scaffolds of the Biosilicate® scaffold. The combination of Biosilicate® glass-ceramic and gelatine is attractive for producing novel scaffolds for bone tissue engineering.

  15. Biosilicate®–gelatine bone scaffolds by the foam replica technique: development and characterization

    Science.gov (United States)

    Desimone, Deborah; Li, Wei; Roether, Judith A; Schubert, Dirk W; Crovace, Murilo C; Rodrigues, Ana Candida M; Zanotto, Edgar D; Boccaccini, Aldo R

    2013-01-01

    The development of bioactive glass-ceramic materials has been a topic of great interest aiming at enhancing the mechanical strength of traditional bioactive scaffolds. In the present study, we test and demonstrate the use of Biosilicate® glass-ceramic powder to fabricate bone scaffolds by the foam replica method. Scaffolds possessing the main requirements for use in bone tissue engineering (95% porosity, 200–500 μm pore size) were successfully produced. Gelatine coating was investigated as a simple approach to increase the mechanical competence of the scaffolds. The gelatine coating did not affect the interconnectivity of the pores and did not significantly affect the bioactivity of the Biosilicate® scaffold. The gelatine coating significantly improved the compressive strength (i.e. 0.80 ± 0.05 MPa of coated versus 0.06 ± 0.01 MPa of uncoated scaffolds) of the Biosilicate® scaffold. The combination of Biosilicate® glass-ceramic and gelatine is attractive for producing novel scaffolds for bone tissue engineering. PMID:27877601

  16. Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review

    Directory of Open Access Journals (Sweden)

    Atul A. Chaudhari

    2016-11-01

    Full Text Available Over centuries, the field of regenerative skin tissue engineering has had several advancements to facilitate faster wound healing and thereby restoration of skin. Skin tissue regeneration is mainly based on the use of suitable scaffold matrices. There are several scaffold types, such as porous, fibrous, microsphere, hydrogel, composite and acellular, etc., with discrete advantages and disadvantages. These scaffolds are either made up of highly biocompatible natural biomaterials, such as collagen, chitosan, etc., or synthetic materials, such as polycaprolactone (PCL, and poly-ethylene-glycol (PEG, etc. Composite scaffolds, which are a combination of natural or synthetic biomaterials, are highly biocompatible with improved tensile strength for effective skin tissue regeneration. Appropriate knowledge of the properties, advantages and disadvantages of various biomaterials and scaffolds will accelerate the production of suitable scaffolds for skin tissue regeneration applications. At the same time, emphasis on some of the leading challenges in the field of skin tissue engineering, such as cell interaction with scaffolds, faster cellular proliferation/differentiation, and vascularization of engineered tissues, is inevitable. In this review, we discuss various types of scaffolding approaches and biomaterials used in the field of skin tissue engineering and more importantly their future prospects in skin tissue regeneration efforts.

  17. Cardiomyocyte behavior on biodegradable polyurethane/gold nanocomposite scaffolds under electrical stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Ganji, Yasaman [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave, Tehran (Iran, Islamic Republic of); Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Li, Qian [Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Quabius, Elgar Susanne [Dept. of Otorhinolaryngology, Head and Neck Surgery, University of Kiel, Arnold-Heller-Str. 3, Building 27, D-24105 Kiel (Germany); Institute of Immunology, University of Kiel, Arnold-Heller-Str. 3, Building 17, D-24105 Kiel (Germany); Böttner, Martina [Department of Anatomy, University of Kiel, Otto-Hahn-Platz 8, 24118 Kiel (Germany); Selhuber-Unkel, Christine, E-mail: cse@tf.uni-kiel.de [Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Kasra, Mehran [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave, Tehran (Iran, Islamic Republic of)

    2016-02-01

    Following a myocardial infarction (MI), cardiomyocytes are replaced by scar tissue, which decreases ventricular contractile function. Tissue engineering is a promising approach to regenerate such damaged cardiomyocyte tissue. Engineered cardiac patches can be fabricated by seeding a high density of cardiac cells onto a synthetic or natural porous polymer. In this study, nanocomposite scaffolds made of gold nanotubes/nanowires incorporated into biodegradable castor oil-based polyurethane were employed to make micro-porous scaffolds. H9C2 cardiomyocyte cells were cultured on the scaffolds for one day, and electrical stimulation was applied to improve cell communication and interaction in neighboring pores. Cells on scaffolds were examined by fluorescence microscopy and scanning electron microscopy, revealing that the combination of scaffold design and electrical stimulation significantly increased cell confluency of H9C2 cells on the scaffolds. Furthermore, we showed that the gene expression levels of Nkx2.5, atrial natriuretic peptide (ANF) and natriuretic peptide precursor B (NPPB), which are functional genes of the myocardium, were up-regulated by the incorporation of gold nanotubes/nanowires into the polyurethane scaffolds, in particular after electrical stimulation. - Highlights: • Biodegradable polyurethane/gold nanocomposites for cardiomyocyte adhesion are proposed. • The nanocomposite scaffolds are porous and electrical stimulation enhances cell adhesion. • Expression levels of functional myocardium genes were upregulated after electrical stimulation.

  18. Composite Scaffolds for Bone Tissue Engineering

    OpenAIRE

    Min Wang

    2006-01-01

    Biomaterial and scaffold development underpins the advancement of tissue engineering. Traditional scaffolds based on biodegradable polymers such as poly(lactic acid) and poly(lactic acid-co-glycolic acid) are weak and non-osteoconductive. For bone tissue engineering, polymer-based composite scaffolds containing bioceramics such as hydroxyapatite can be produced and used. The bioceramics can be either incorporated in the scaffolds as a dispersed secondary phase or form a thin coating on the po...

  19. Anterior cruciate ligament reconstruction in a rabbit model using silk-collagen scaffold and comparison with autograft.

    Directory of Open Access Journals (Sweden)

    Fanggang Bi

    Full Text Available The objective of the present study was to perform an in vivo assessment of a novel silk-collagen scaffold for anterior cruciate ligament (ACL reconstruction. First, a silk-collagen scaffold was fabricated by combining sericin-extracted knitted silk fibroin mesh and type I collagen to mimic the components of the ligament. Scaffolds were electron-beam sterilized and rolled up to replace the ACL in 20 rabbits in the scaffold group, and autologous semitendinosus tendons were used to reconstruct the ACL in the autograft control group. At 4 and 16 weeks after surgery, grafts were retrieved and analyzed for neoligament regeneration and tendon-bone healing. To evaluate neoligament regeneration, H&E and immunohistochemical staining was performed, and to assess tendon-bone healing, micro-CT, biomechanical test, H&E and Russell-Movat pentachrome staining were performed. Cell infiltration increased over time in the scaffold group, and abundant fibroblast-like cells were found in the core of the scaffold graft at 16 weeks postoperatively. Tenascin-C was strongly positive in newly regenerated tissue at 4 and 16 weeks postoperatively in the scaffold group, similar to observations in the autograft group. Compared with the autograft group, tendon-bone healing was better in the scaffold group with trabecular bone growth into the scaffold. The results indicate that the silk-collagen scaffold has considerable potential for clinical application.

  20. Systematic Prediction of Scaffold Proteins Reveals New Design Principles in Scaffold-Mediated Signal Transduction

    Science.gov (United States)

    Hu, Jianfei; Neiswinger, Johnathan; Zhang, Jin; Zhu, Heng; Qian, Jiang

    2015-01-01

    Scaffold proteins play a crucial role in facilitating signal transduction in eukaryotes by bringing together multiple signaling components. In this study, we performed a systematic analysis of scaffold proteins in signal transduction by integrating protein-protein interaction and kinase-substrate relationship networks. We predicted 212 scaffold proteins that are involved in 605 distinct signaling pathways. The computational prediction was validated using a protein microarray-based approach. The predicted scaffold proteins showed several interesting characteristics, as we expected from the functionality of scaffold proteins. We found that the scaffold proteins are likely to interact with each other, which is consistent with previous finding that scaffold proteins tend to form homodimers and heterodimers. Interestingly, a single scaffold protein can be involved in multiple signaling pathways by interacting with other scaffold protein partners. Furthermore, we propose two possible regulatory mechanisms by which the activity of scaffold proteins is coordinated with their associated pathways through phosphorylation process. PMID:26393507

  1. Hypoxia Enhances Chondrogenic Differentiation of Human Cord Blood Multilineage Progenitor Cells Seeded on a Novel Scaffold of Freeze Dried Polycaprolactone

    DEFF Research Database (Denmark)

    Munir, Samir; Figueroa, Ryan Jude; Koch, Thomas Gadegaard

    pattern in relation to the oxygen tension. Induced scaffolds showed cellularity and matrix deposition superficially and to adjacent scaffold fibres. Induced MLPCs pellets and scaffolds had significantly higher gene expression of aggrecan, SOX9, CD-RAP, collagen I, II and X compared with controls. Ratios...... for chondrogenic differentiation. According to recent studies combined three-dimensional (3D) culturing in low oxygen tension enhances differentiation. Aim This study evaluates the chondrogenic potential of MLPC culturing in a novel 3D-scaffold of polycaprolactone and 5% O2. Materials and methods MLPCs were...

  2. Emerging Perspectives in Scaffold for Tissue Engineering in Oral Surgery

    Directory of Open Access Journals (Sweden)

    Gabriele Ceccarelli

    2017-01-01

    Full Text Available Bone regeneration is currently one of the most important and challenging tissue engineering approaches in regenerative medicine. Bone regeneration is a promising approach in dentistry and is considered an ideal clinical strategy in treating diseases, injuries, and defects of the maxillofacial region. Advances in tissue engineering have resulted in the development of innovative scaffold designs, complemented by the progress made in cell-based therapies. In vitro bone regeneration can be achieved by the combination of stem cells, scaffolds, and bioactive factors. The biomimetic approach to create an ideal bone substitute provides strategies for developing combined scaffolds composed of adult stem cells with mesenchymal phenotype and different organic biomaterials (such as collagen and hyaluronic acid derivatives or inorganic biomaterials such as manufactured polymers (polyglycolic acid (PGA, polylactic acid (PLA, and polycaprolactone. This review focuses on different biomaterials currently used in dentistry as scaffolds for bone regeneration in treating bone defects or in surgical techniques, such as sinus lift, horizontal and vertical bone grafts, or socket preservation. Our review would be of particular interest to medical and surgical researchers at the interface of cell biology, materials science, and tissue engineering, as well as industry-related manufacturers and researchers in healthcare, prosthetics, and 3D printing, too.

  3. Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2012-01-01

    Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

  4. Ultrasonic elasticity determination of 45S5 Bioglass(®)-based scaffolds: influence of polymer coating and crosslinking treatment.

    Science.gov (United States)

    Li, Wei; Pastrama, Maria-Ioana; Ding, Yaping; Zheng, Kai; Hellmich, Christian; Boccaccini, Aldo R

    2014-12-01

    Highly porous 45S5 Bioglass(®)-based scaffolds with interconnected pore structure are promising candidates for bone tissue engineering due to their bioactivity, biocompatibility, osteogenic and angiogenic effects. In the present study, to ensure the mechanical competence of the 45S5 Bioglass(®)-based scaffolds, their stiffness was adjusted by applying polymer coatings and further crosslinking treatment. A non-destructive ultrasonic technique was used to determine the stiffness of the scaffolds. The stiffness of uncoated scaffolds was shown to increase by applying polymer coatings, and a further increase was achieved by crosslinking the used polymer coatings. All uncoated and polymer-coated scaffolds were confirmed to exhibit stiffness values in the range of reported values in the literature for cancellous bone. A statistical evaluation of combined multiscale ultrasound-nanoindentation measurements indicated that the stiffness of the coated scaffold is directly dependent on the stiffness of the polymer coating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Exploiting sparsity in free energy basin-hopping

    Science.gov (United States)

    Sutherland-Cash, Kyle H.; Mantell, Rosemary G.; Wales, David J.

    2017-10-01

    We present acceleration of the vibrational frequency calculations required in free energy basin-hopping (FEBH) global optimisation using sparse Cholesky factorisation. We describe an interface with the SuiteSparse software package that facilitates these calculations, and present results detailing the accuracy and speedups obtained for atomic clusters and biomolecules. For the larger systems, exploiting sparsity reduces the computational cost by factors of ten to thirty, with no significant loss in accuracy. This approach will therefore provide access to the vibrational density of states, and hence to local harmonic free energies, for structure prediction and thermodynamic properties of more complex systems.

  6. Spectral Efficiency of Random Time-Hopping CDMA

    OpenAIRE

    Ferrante, Guido Carlo; Di Benedetto, Maria-Gabriella

    2013-01-01

    Traditionally paired with impulsive communications, Time-Hopping CDMA (TH-CDMA) is a multiple access technique that separates users in time by coding their transmissions into pulses occupying a subset of $N_\\mathsf{s}$ chips out of the total $N$ included in a symbol period, in contrast with traditional Direct-Sequence CDMA (DS-CDMA) where $N_\\mathsf{s}=N$. This work analyzes TH-CDMA with random spreading, by determining whether peculiar theoretical limits are identifiable, with both optimal a...

  7. The Analysis Of Slang Words In Selected Hip Hop Songs

    OpenAIRE

    Manalu, Sadrakh Anthony

    2015-01-01

    Slang is a language structure that evolved in modern times that in his particular use by young people. Slang develops in tune with its evolving culture in the environment so that the slang does not have a time, place or community background limit. Slang can also be found in almost every language in the world, in this case the author discusses the use of slang words contained in the English language in specialized its African American Hip Hop culture. In this paper entitled "The Analysis of Sl...

  8. Conscious Hip-Hop, Change, and the Obama Era

    Directory of Open Access Journals (Sweden)

    Murray Forman

    2010-05-01

    Full Text Available This article identifies a particular aspect of hip-hop’s range of cultural production—conscious rap—in order to isolate one of the more politicized discursive options available to youth in America and a site where critical perspectives on post-Civil Rights America have emerged most forcefully. It further suggests that Obama’s political rise corresponds with a new phase in hip-hop and has impacted the ways in which its creative artists frame and articulate issues of race, class, and identity.

  9. In vitro evaluation of marrow clot enrichment on microstructure decoration, cell delivery and proliferation of porous titanium scaffolds by selective laser melting three-dimensional printing.

    Science.gov (United States)

    Yao, Qing-Qiang; Hu, Jun; Zheng, Peng-Fei; Li, Jia-Yi; Zhou, Jin; Tian, Shu-Chang; Wei, Bo; Xu, Yan; Wang, Li-Ming

    2017-10-30

    Titanium alloy is a clinically approved material for bone substitution. Although three-dimensional printing (3DP) fabrication technique can build up porous Ti scaffolds with the designed shape and microstructure, the biomechanical performance of 3DP Ti scaffolds still need to be improved to increase the reliability of osseointegration capacity. To address this issue, rabbit bone marrow clot (MC) is used to modify 3DP Ti scaffolds by stem cell delivery and microenvironment decoration inside the pores of these scaffolds. Moreover, 3DP Ti scaffolds were built up using selective laser melting, and 3DP MC-Ti scaffolds were constructed through the enrichment of MC with Ti scaffolds in vitro. Results demonstrated that the obtained 3DP Ti scaffolds in current study has an average modulus of elasticity (ME) at 1294.48 MPa with average yield strength of 33.154 MPa. For MC-Ti scaffolds, MC enrichment obstructs the pores of 3DP scaffolds due to the large amount of fibrin and erythrocytes and leads to a decrease in ratio of live cells at 1-week culture. Cell proliferation and osteogenic differentiation performance of MC-Ti scaffolds were promoted with porous recanalization in the later 3 weeks. After 2 weeks in vitro culture, fivefold of cell number in MC-Ti scaffolds were observed than bone marrow-derived mesenchymal stem cell-seeded Ti scaffolds. Compared to Ti scaffolds, fourfold of deoxyribonucleic acid content, type I collagen-α1, osteocalcin, and alkaline phosphatase expression in MC-Ti scaffolds were observed after 4 weeks in vitro culture. Results suggested that the combination with MC is a highly efficient method that improves the biological performance of Ti scaffolds. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2017. © 2017 Wiley Periodicals, Inc.

  10. High-Speed On-Board Data Processing for Science Instruments: HOPS

    Science.gov (United States)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  11. Bilateral deficit of spring-like behaviour during hopping in sprinters.

    Science.gov (United States)

    Otsuka, Mitsuo; Kurihara, Toshiyuki; Isaka, Tadao

    2017-12-20

    Unilateral leg stiffness is a key contributor to sprint running speed, thereby great bilateral deficit (BLD) of leg stiffness would be expected to be observed in sprinters. However, it remains clear only BLD of leg stiffness at the preferred hopping frequency in non-sprinters. The purpose of this study was to clarify the BLD of spring-like behaviour in hopping at various frequencies and the effect of chronic adaptation via sprint running experience on BLD during the hopping. Fifteen male experienced sprinters and 12 male novices participated in this study. They were instructed to hop in place at three frequencies (2.0, 2.5, and 3.0 Hz), and to perform hopping with maximal effort. Ground reaction forces (GRF) of both legs during the hopping were recorded using two force plates. At higher hopping frequencies during the unilateral and bilateral hopping, smaller peak value of vertical GRF (F max) and greater leg stiffness (K leg) were significantly observed. The BLD index of F max and the BLD index of K leg were significantly smaller at higher hopping frequencies. No significant differences of BLD index of F max and BLD index of K leg were observed between sprinters and novices. Our results demonstrate that neuromuscular inhibition in the contralateral leg changes during the hopping based on hopping frequency. This suggests that plyometric training in the beginning of rehabilitation should involve bilateral jumping at a high frequency. In experienced sprinters, detailed mechanics of chronic neuromuscular adaptation via unilateral facilitation of spring-like behaviour should be assessed by measuring electromyographic activity.

  12. Low-temperature fabrication of macroporous scaffolds through foaming and hydration of tricalcium silicate paste and their bioactivity

    NARCIS (Netherlands)

    Huan, Z.; Chang, J.; Zhou, J.

    2009-01-01

    A low-temperature fabrication method for highly porous bioactive scaffolds was developed. The two-step method involved the foaming of tricalcium silicate cement paste and hydration to form calcium silicate hydrate and calcium hydroxide. Scaffolds with a combination of interconnected macro- and

  13. Investigating the Vascularization of Tissue-Engineered Bone Constructs Using Dental Pulp Cells and 45S5 Bioglass(®) Scaffolds.

    OpenAIRE

    El-Gendy, R; J Kirkham; Newby, PJ; Mohanram, Y; Boccaccini, AR; Yang, XB

    2015-01-01

    Identification of a suitable cell source combined with an appropriate 3D scaffold is an essential prerequisite for successful engineering of skeletal tissues. Both osteogenesis and angiogenesis are key processes for bone regeneration. This study investigated the vascularization potential of a novel combination of human dental pulp stromal cells (HDPSCs) with 45S5 Bioglass(®) scaffolds for tissue-engineered mineral constructs in vivo and in vitro. 45S5 Bioglass scaffolds were produced by the f...

  14. Problem Solving, Scaffolding and Learning

    Science.gov (United States)

    Lin, Shih-Yin

    2012-01-01

    Helping students to construct robust understanding of physics concepts and develop good solving skills is a central goal in many physics classrooms. This thesis examine students' problem solving abilities from different perspectives and explores strategies to scaffold students' learning. In studies involving analogical problem solving…

  15. scaffolds for tissue engineering application

    Indian Academy of Sciences (India)

    2017-07-27

    Jul 27, 2017 ... in chitosan (CH) and poly(vinyl alcohol) (PVA) scaffold for effective delivery of drug in a sustained manner to the wound site. Moreover, the peculiar ... as milieu biocompatible carrier to get rid of wound infection and to achieve ... (measuring 12 cm×10 cm) and dried at room temperature to get CH–CMP and ...

  16. Exploring the complex mechanical properties of xanthan scaffolds by AFM-based force spectroscopy

    Directory of Open Access Journals (Sweden)

    Hao Liang

    2014-03-01

    Full Text Available The polysaccharide xanthan has been extensively studied owing to its potential application in tissue engineering. In this paper, xanthan scaffold structures were investigated by atomic force microscope (AFM in liquid, and the mechanical properties of the complex xanthan structures were investigated by using AFM-based force spectroscopy (FS. In this work, three types of structures in the xanthan scaffold were identified based on three types of FS stretching events. The fact that the complex force responses are the combinations of different types of stretching events suggests complicated intermolecular interactions among xanthan fibrils. The results provide crucial information to understand the structures and mechanical properties of the xanthan scaffold.

  17. Scaffolding along Nucleic Acid Duplexes Using 2'-Amino-Locked Nucleic Acids

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2014-01-01

    Conspectus Incorporation of chemically modified nucleotide scaffolds into nucleic acids to form assemblies rich in function is an innovative area with great promise for nanotechnology and biomedical and material science applications. The intrinsic biorecognition potential of nucleic acids combined...... depends on the chemical nature of the modification, its price, its availability, and applications of the product. One of the most useful applications of the product LNA/DNA scaffolds containing 2'-amino-LNA is to detect complementary DNA and RNA targets. Examples of these applications include sensing...... functionalized 2'-amino-LNA scaffolds offer great opportunities for material science, diagnostics, and medicine of the future....

  18. Communication: Global flux surface hopping in Liouville space

    Science.gov (United States)

    Wang, Linjun; Sifain, Andrew E.; Prezhdo, Oleg V.

    2015-11-01

    Recent years have witnessed substantial progress in the surface hopping (SH) formulation of non-adiabatic molecular dynamics. A generalization of the traditional fewest switches SH (FSSH), global flux SH (GFSH) utilizes the gross population flow between states to derive SH probabilities. The Liouville space formulation of FSSH puts state populations and coherences on equal footing, by shifting the hopping dynamics from Hilbert to Liouville space. Both ideas have shown superior results relative to the standard FSSH in Hilbert space, which has been the most popular approach over the past two and a half decades. By merging the two ideas, we develop GFSH in Liouville space. The new method is nearly as straightforward as the standard FSSH, and carries comparable computational expense. Tested with a representative super-exchange model, it gives the best performance among all existing techniques in the FSSH series. The obtained numerical results match almost perfectly the exact quantum mechanical solutions. Moreover, the results are nearly invariant under the choice of a basis state representation for SH, in contrast to the earlier techniques which exhibit notable basis set dependence. Unique to the developed approach, this property is particularly encouraging, because exact quantum dynamics is representation independent. GFSH in Liouville space significantly improves accuracy and applicability of SH for a broad range of chemical and physical processes.

  19. A decentralized scheduling algorithm for time synchronized channel hopping

    Directory of Open Access Journals (Sweden)

    Andrew Tinka

    2011-09-01

    Full Text Available Time Synchronized Channel Hopping (TSCH is an existing Medium Access Control scheme which enables robust communication through channel hopping and high data rates through synchronization. It is based on a time-slotted architecture, and its correct functioning depends on a schedule which is typically computed by a central node. This paper presents, to our knowledge, the first scheduling algorithm for TSCH networks which both is distributed and which copes with mobile nodes. Two variations on scheduling algorithms are presented. Aloha-based scheduling allocates one channel for broadcasting advertisements for new neighbors. Reservation- based scheduling augments Aloha-based scheduling with a dedicated timeslot for targeted advertisements based on gossip information. A mobile ad hoc motorized sensor network with frequent connectivity changes is studied, and the performance of the two proposed algorithms is assessed. This performance analysis uses both simulation results and the results of a field deployment of floating wireless sensors in an estuarial canal environment. Reservation-based scheduling performs significantly better than Aloha-based scheduling, suggesting that the improved network reactivity is worth the increased algorithmic complexity and resource consumption.

  20. Augmented Ehrenfest dynamics yields a rate for surface hopping

    Science.gov (United States)

    Subotnik, Joseph E.

    2010-04-01

    We present a new algorithm for mixed quantum-classical dynamics that helps bridge the gap between mean-field (Ehrenfest) and surface-hopping dynamics by defining a natural rate of decoherence. In order to derive this decoherence result, we have expanded the number of independent variables in the usual Ehrenfest routine so that mixed quantum-classical derivatives are now propagated in time alongside the usual Ehrenfest variables. Having done so, we compute a unique rate of decoherence using two independent approaches: (i) by comparing the equations of motion for the joint nuclear-electronic probability density in phase space according to Ehrenfest dynamics versus partial Wigner transform dynamics and (ii) by introducing a frozen Gaussian interpretation of Ehrenfest dynamics which allows nuclear wave packets to separate. The first consequence of this work is a means to rigorously check the accuracy of standard Ehrenfest dynamics. Second, this paper suggests a nonadiabatic dynamics algorithm, whereby the nuclei are propagated on the mean-field (Ehrenfest) potential energy surface and undergo stochastic decoherence events. Our work resembles the surface-hopping algorithm of Schwartz and co-workers [J. Chem. Phys. 123, 234106 (2005)]—only now without any adjustable parameters. For the case of two electronic states, we present numerical results on the so-called "Tully problems" and emphasize that future numerical benchmarking is still needed. Future work will also treat the problem of three or more electronic states.

  1. Problem Formulation and Analysis of the 1-Hop ARQ Links

    Science.gov (United States)

    Cheung, K.-M.

    2013-08-01

    In space communications, standard link analysis assumes that messages are sent once. For a communication link that uses an error-correction coding scheme, bit-error rate (BER) or frame-error rate (FER), and link margins are common metrics that characterize the quality of a link, and they are used to determine the supportable data rate. With the advent of Automatic Repeat-reQuest (ARQ) protocols, when messages are corrupted during transmission, they can be resent multiple times automatically until they are correctly received and acknowledged. The concept of BER, FER, and link margin cannot be directly applied, and the link analysis approach for ARQ links needs to be reexamined. In this article, we provide the problem formulation and extend the standard link analysis approach to a 1-hop ARQ link (no routing), under the assumption that code-block errors occur independently as in the case of space communications. We develop analytical models that describe the statistical behavior of standard 1-hop ARQ links. By integrating these analytical ARQ protocol models into the standard link analysis, we bypass the need to simulate or emulate the ARQ protocol operations, and generate relevant statistics on effective data rate, effective throughput, latency, and FER.

  2. Surface-hopping dynamics and decoherence with quantum equilibrium structure.

    Science.gov (United States)

    Grunwald, Robbie; Kim, Hyojoon; Kapral, Raymond

    2008-04-28

    In open quantum systems, decoherence occurs through interaction of a quantum subsystem with its environment. The computation of expectation values requires a knowledge of the quantum dynamics of operators and sampling from initial states of the density matrix describing the subsystem and bath. We consider situations where the quantum evolution can be approximated by quantum-classical Liouville dynamics and examine the circumstances under which the evolution can be reduced to surface-hopping dynamics, where the evolution consists of trajectory segments exclusively evolving on single adiabatic surfaces, with probabilistic hops between these surfaces. The justification for the reduction depends on the validity of a Markovian approximation on a bath averaged memory kernel that accounts for quantum coherence in the system. We show that such a reduction is often possible when initial sampling is from either the quantum or classical bath initial distributions. If the average is taken only over the quantum dispersion that broadens the classical distribution, then such a reduction is not always possible.

  3. Robust hopping based on virtual pendulum posture control.

    Science.gov (United States)

    Sharbafi, Maziar A; Maufroy, Christophe; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Seyfarth, Andre

    2013-09-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved.

  4. OFDMA Cellular Networks with Opportunistic Two-Hop Relays

    Directory of Open Access Journals (Sweden)

    Calcev George

    2009-01-01

    Full Text Available We investigate the benefits of two-hop opportunistic relay in time division duplex (TDD OFDMA cellular network configurations. The paper starts with a short analytical model for the two-hop opportunistic relay. The model expresses the probability of finding a suitable relay node in the presence of lognormal fading and it allows the computation of the expected number of out-of-coverage nodes, as well as the end-to-end spectrum efficiency increase due to opportunistic relaying. The paper then presents results for Monte Carlo simulations of opportunistic relay in some realistic scenarios. Specifically, the simulations consider two scenarios. The first scenario uses the propagation model and a wide-area 19-cell configuration specified in 802.16 OFDMA cellular standard evaluation methodologies. In the second scenario, a Manhattan-like 19-cell topology is used. Our simulations show 11% to 33% in throughput increase when the opportunistic relay technology is used. Our results evaluate the benefits of the opportunistic relay in both scenarios in terms of coverage extension and throughput increase.

  5. Hip-Hop to Health Jr. for Latino preschool children.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  6. Results from HOPS: A multiwavelength census of Orion protostars

    Science.gov (United States)

    Fischer, W. J.; Megeath, S. T.; Stutz, A. M.; Tobin, J. J.; Ali, B.; Stanke, T.; Osorio, M.; Furlan, E.; HOPS Team; Orion Protostar Survey

    2013-02-01

    Surveys with the Spitzer and Herschel space observatories are now enabling the discovery and characterization of large samples of protostars in nearby molecular clouds, providing the observational basis for a detailed understanding of star formation in diverse environments. We are pursuing this goal with the Herschel Orion Protostar Survey (HOPS), which targets 328 Spitzer-identified protostars in the Orion molecular clouds, the largest star-forming region in the nearest 500 pc. The sample encompasses all phases of protostellar evolution and a wide range of formation environments, from dense clusters to relative isolation. With a grid of radiative transfer models, we fit the 1-870 μm spectral energy distributions (SEDs) of the protostars to estimate their envelope densities, cavity opening angles, inclinations, and total luminosities. After correcting the bolometric luminosities and temperatures of the sources for foreground extinction and inclination, we find a spread of several orders of magnitude in luminosity at all evolutionary states, a constant median luminosity over the more evolved stages, and a possible deficit of high-inclination, rapidly infalling envelopes among the Spitzer-identified sample. We have detected over 100 new sources in the Herschel images; some of them may fill this deficit. We also report results from modeling the pre- and post-outburst 1-870 μm SEDs of V2775 Ori (HOPS 223), a known FU Orionis outburster in the sample. It is the least luminous FU Ori star with a protostellar envelope.

  7. Hops 383: an Outbursting Class 0 Protostar in Orion

    Science.gov (United States)

    Safron, Emily J.; Fischer, William J.; Megeath, S. Thomas; Furlan, Elise; Stutz, Amelia M.; Stanke, Thomas; Billot, Nicolas; Rebull, Luisa M.; Tobin, John J.; Ali, Babar; Allen, Lori E.; Booker, Joseph; Watson, Dan M.; Wilson, T. L.

    2015-02-01

    We report the dramatic mid-infrared brightening between 2004 and 2006 of Herschel Orion Protostar Survey (HOPS) 383, a deeply embedded protostar adjacent to NGC 1977 in Orion. By 2008, the source became a factor of 35 brighter at 24 μm with a brightness increase also apparent at 4.5 μm. The outburst is also detected in the submillimeter by comparing APEX/SABOCA to SCUBA data, and a scattered-light nebula appeared in NEWFIRM Ks imaging. The post-outburst spectral energy distribution indicates a Class 0 source with a dense envelope and a luminosity between 6 and 14 {{L}⊙ }. Post-outburst time-series mid- and far-infrared photometry show no long-term fading and variability at the 18% level between 2009 and 2012. HOPS 383 is the first outbursting Class 0 object discovered, pointing to the importance of episodic accretion at early stages in the star formation process. Its dramatic rise and lack of fading over a 6 year period hint that it may be similar to FU Ori outbursts, although the luminosity appears to be significantly smaller than the canonical luminosities of such objects.

  8. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  9. Three-dimensional elastomeric scaffolds designed with cardiac-mimetic structural and mechanical features.

    Science.gov (United States)

    Neal, Rebekah A; Jean, Aurélie; Park, Hyoungshin; Wu, Patrick B; Hsiao, James; Engelmayr, George C; Langer, Robert; Freed, Lisa E

    2013-03-01

    Tissue-engineered constructs, at the interface of material science, biology, engineering, and medicine, have the capacity to improve outcomes for cardiac patients by providing living cells and degradable biomaterials that can regenerate the native myocardium. With an ultimate goal of both delivering cells and providing mechanical support to the healing heart, we designed three-dimensional (3D) elastomeric scaffolds with (1) stiffnesses and anisotropy mimicking explanted myocardial specimens as predicted by finite-element (FE) modeling, (2) systematically varied combinations of rectangular pore pattern, pore aspect ratio, and strut width, and (3) structural features approaching tissue scale. Based on predicted mechanical properties, three scaffold designs were selected from eight candidates for fabrication from poly(glycerol sebacate) by micromolding from silicon wafers. Large 20×20 mm scaffolds with high aspect ratio features (5:1 strut height:strut width) were reproducibly cast, cured, and demolded at a relatively high throughput. Empirically measured mechanical properties demonstrated that scaffolds were cardiac mimetic and validated FE model predictions. Two-layered scaffolds providing fully interconnected pore networks were fabricated by layer-by-layer assembly. C2C12 myoblasts cultured on one-layered scaffolds exhibited specific patterns of cell elongation and interconnectivity that appeared to be guided by the scaffold pore pattern. Neonatal rat heart cells cultured on two-layered scaffolds for 1 week were contractile, both spontaneously and in response to electrical stimulation, and expressed sarcomeric α-actinin, a cardiac biomarker. This work not only demonstrated several scaffold designs that promoted functional assembly of rat heart cells, but also provided the foundation for further computational and empirical investigations of 3D elastomeric scaffolds for cardiac tissue engineering.

  10. A porous tissue engineering scaffold selectively degraded by cell-generated reactive oxygen species.

    Science.gov (United States)

    Martin, John R; Gupta, Mukesh K; Page, Jonathan M; Yu, Fang; Davidson, Jeffrey M; Guelcher, Scott A; Duvall, Craig L

    2014-04-01

    Biodegradable tissue engineering scaffolds are commonly fabricated from poly(lactide-co-glycolide) (PLGA) or similar polyesters that degrade by hydrolysis. PLGA hydrolysis generates acidic breakdown products that trigger an accelerated, autocatalytic degradation mechanism that can create mismatched rates of biomaterial breakdown and tissue formation. Reactive oxygen species (ROS) are key mediators of cell function in both health and disease, especially at sites of inflammation and tissue healing, and induction of inflammation and ROS are natural components of the in vivo response to biomaterial implantation. Thus, polymeric biomaterials that are selectively degraded by cell-generated ROS may have potential for creating tissue engineering scaffolds with better matched rates of tissue in-growth and cell-mediated scaffold biodegradation. To explore this approach, a series of poly(thioketal) (PTK) urethane (PTK-UR) biomaterial scaffolds were synthesized that degrade specifically by an ROS-dependent mechanism. PTK-UR scaffolds had significantly higher compressive moduli than analogous poly(ester urethane) (PEUR) scaffolds formed from hydrolytically-degradable ester-based diols (p PEUR scaffolds, the PTK-UR scaffolds were stable under aqueous conditions out to 25 weeks but were selectively degraded by ROS, indicating that their biodegradation would be exclusively cell-mediated. The in vitro oxidative degradation rates of the PTK-URs followed first-order degradation kinetics, were significantly dependent on PTK composition (p PEUR scaffolds. These combined results indicate that ROS-degradable PTK-UR tissue engineering scaffolds have significant advantages over analogous polyester-based biomaterials and provide a robust, cell-degradable substrate for guiding new tissue formation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Delivery of growth factors using a smart porous nanocomposite scaffold to repair a mandibular bone defect.

    Science.gov (United States)

    Liu, Xian; Zhao, Kun; Gong, Tao; Song, Jian; Bao, Chongyun; Luo, En; Weng, Jie; Zhou, Shaobing

    2014-03-10

    Implantation of a porous scaffold with a large volume into the body in a convenient and safe manner is still a challenging task in the repair of bone defects. In this study, we present a porous smart nanocomposite scaffold with a combination of shape memory function and controlled delivery of growth factors. The shape memory function enables the scaffold with a large volume to be deformed into its temporal architecture with a small volume using hot-compression and can subsequently recover its original shape upon exposure to body temperature after it is implanted in the body. The scaffold consists of chemically cross-linked poly(ε-caprolactone) (c-PCL) and hydroxyapatite nanoparticles. The highly interconnected pores of the scaffold were obtained using the sugar leaching method. The shape memory porous scaffold loaded with bone morphogenetic protein-2 (BMP-2) was also fabricated by coating the calcium alginate layer and BMP-2 on the surface of the pore wall. Under both in vitro and in vivo environmental conditions, the porous scaffold displays good shape memory recovery from the compressed shape with deformed pores of 33 μm in diameter to recover its porous shape with original pores of 160 μm in diameter. In vitro cytotoxicity based on the MTT test revealed that the scaffold exhibited good cytocompatibility. The in vivo micro-CT and histomorphometry results demonstrated that the porous scaffold could promote new bone generation in the rabbit mandibular bone defect. Thus, our results indicated that this shape memory porous scaffold demonstrated great potential for application in bone regenerative medicine.

  12. 3D fibre deposition and stereolithography techniques for the design of multifunctional nanocomposite magnetic scaffolds.

    Science.gov (United States)

    De Santis, Roberto; D'Amora, Ugo; Russo, Teresa; Ronca, Alfredo; Gloria, Antonio; Ambrosio, Luigi

    2015-10-01

    Magnetic nanocomposite scaffolds based on poly(ε-caprolactone) and poly(ethylene glycol) were fabricated by 3D fibre deposition modelling (FDM) and stereolithography techniques. In addition, hybrid coaxial and bilayer magnetic scaffolds were produced by combining such techniques. The aim of the current research was to analyse some structural and functional features of 3D magnetic scaffolds obtained by the 3D fibre deposition technique and by stereolithography as well as features of multimaterial scaffolds in the form of coaxial and bilayer structures obtained by the proper integration of such methods. The compressive mechanical behaviour of these scaffolds was investigated in a wet environment at 37 °C, and the morphological features were analysed through scanning electron microscopy (SEM) and X-ray micro-computed tomography. The capability of a magnetic scaffold to absorb magnetic nanoparticles (MNPs) in water solution was also assessed. confocal laser scanning microscopy was used to assess the in vitro biological behaviour of human mesenchymal stem cells (hMSCs) seeded on 3D structures. Results showed that a wide range of mechanical properties, covering those spanning hard and soft tissues, can be obtained by 3D FDM and stereolithography techniques. 3D virtual reconstruction and SEM showed the precision with which the scaffolds were fabricated, and a good-quality interface between poly(ε-caprolactone) and poly(ethylene glycol) based scaffolds was observed for bilayer and coaxial scaffolds. Magnetised scaffolds are capable of absorbing water solution of MNPs, and a preliminary information on cell adhesion and spreading of hMSCs was obtained without the application of an external magnetic field.

  13. [Digital modeling for the individual mandibular 3D mesh scaffold based on 3D printing technology].

    Science.gov (United States)

    Yan, Rongzeng; Luo, Danmei; Qin, Xiaoyu; Li, Runxin; Rong, Qiguo; Hu, Min

    2016-05-01

    To investigate an ideal modeling method of designing 3D mesh scaffold substitutes based on tissue engineering to restore mandibular bone defects. By analyzing the theoretical model from titanium scaffolds fabricated by 3D printing, the feasibility and effectiveness of the proposed methodology were verified. Based on the CT scanned data of a subject, the Mimics 15.0 and Geomagic studio 12.0 reverse engineering software were adopted to generate surface model of mandibular bone and the defect area was separated from the 3D model of bone. Then prosthesis was designed via mirror algorithm, in which outer shape was used as the external shape of scaffold. Unigraphics software NX 8.5 was applied on Boolean calculation of subtraction between prosthesis and regular microstructure structure and ANSYS 14.0 software was used to design the inner construction of 3D mesh scaffolds. The topological structure and the geometrical parameters of 3D mesh titanium scaffolds were adjusted according to the aim of optimized structure and maximal strength with minimal weight. The 3D mesh scaffolds solid model through two kinds of computer-aided methods was input into 3D printing equipment to fabricate titanium scaffolds. Individual scaffolds were designed successfully by two modeling methods. The finite element optimization made 10% decrease of the stress peak and volume decrease of 43%, and the porosity increased to 76.32%. This modeling method was validated by 3D printing titanium scaffold to be feasible and effective. 3D printing technology combined with finite element topology optimization to obtain the ideal mandibular 3D mesh scaffold is feasible and effective.

  14. Link and route availability for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-09-01

    Full Text Available In inter-working multi-hop wireless networks, establishing resilient connectivity between source-destination node pairs is a major issue. The issue of connectivity in multi-hop wireless networks have been studied. However, these analyses focused...

  15. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    Science.gov (United States)

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  16. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  17. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    Science.gov (United States)

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  18. Effect of storage on the brewing properties of tropical hop substitutes

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... conventional hops stored at 25oC for 30 weeks (12-17%) by Marr (1985) and Laws (1983). The reduction in the soft resin content of hops is a common phenomenon which is associated with the oxidative depreciation of the soft resins to hard resins with storage, Hough (1980). However, the low percentage ...

  19. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  20. Characterisation of the Plasmodium falciparum Hsp70-Hsp90 organising protein (PfHop).

    Science.gov (United States)

    Gitau, Grace W; Mandal, Pradipta; Blatch, Gregory L; Przyborski, Jude; Shonhai, Addmore

    2012-03-01

    Malaria is caused by Plasmodium species, whose transmission to vertebrate hosts is facilitated by mosquito vectors. The transition from the cold blooded mosquito vector to the host represents physiological stress to the parasite, and additionally malaria blood stage infection is characterised by intense fever periods. In recent years, it has become clear that heat shock proteins play an essential role during the parasite's life cycle. Plasmodium falciparum expresses two prominent heat shock proteins: heat shock protein 70 (PfHsp70) and heat shock protein 90 (PfHsp90). Both of these proteins have been implicated in the development and pathogenesis of malaria. In eukaryotes, Hsp70 and Hsp90 proteins are functionally linked by an essential adaptor protein known as the Hsp70-Hsp90 organising protein (Hop). In this study, recombinant P. falciparum Hop (PfHop) was heterologously produced in E. coli and purified by nickel affinity chromatography. Using specific anti-PfHop antisera, the expression and localisation of PfHop in P. falciparum was investigated. PfHop was shown to co-localise with PfHsp70 and PfHsp90 in parasites at the trophozoite stage. Gel filtration and co-immunoprecipitation experiments suggested that PfHop was present in a complex together with PfHsp70 and PfHsp90. The association of PfHop with both PfHsp70 and PfHsp90 suggests that this protein may mediate the functional interaction between the two chaperones.

  1. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    Science.gov (United States)

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  2. Role of next-nearest-neighbour hopping in the internal structure of ...

    Indian Academy of Sciences (India)

    The thermodynamic properties such as entropy and specific heat are studied as functions of temperature with various NNN hopping strength. Results show that with the inclusion of negative NNN hopping, the system becomes more ordered. A qualitative transition temperature region has been estimated. It is shown that with ...

  3. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available In Inter-working multi-hop wireless networks, establishing resilient connectivity between source-destination node pairs is a major issue. The issues of connectivity in Multi-hop wireless networks have been studied. However, these analyses focused...

  4. Don't Believe the Hype: Hip-Hop Literacies and English Education

    Science.gov (United States)

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  5. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    Science.gov (United States)

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  6. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    Science.gov (United States)

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  7. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    Science.gov (United States)

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  8. Representin': Drawing from Hip-Hop and Urban Youth Culture to Inform Teacher Education

    Science.gov (United States)

    Irizarry, Jason G.

    2009-01-01

    The potential of drawing from urban youth culture, and hip-hop more specifically, to serve as a bridge to the standard curriculum has been well documented. However, the richness and potential benefits of hip-hop are more far-reaching and present significant implications for teacher education and professional development efforts as well. This…

  9. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    Science.gov (United States)

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  10. Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

    Science.gov (United States)

    Baszile, Denise Taliaferro

    2009-01-01

    Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

  11. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  12. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    Science.gov (United States)

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  13. HOP/NECC1, a novel regulator of mouse trophoblast differentiation.

    Science.gov (United States)

    Asanoma, Kazuo; Kato, Hidenori; Yamaguchi, Shinichiro; Shin, Chong Hyun; Liu, Zhi-Ping; Kato, Kiyoko; Inoue, Takafumi; Miyanari, Yoko; Yoshikawa, Koji; Sonoda, Kenzo; Fukushima, Kotaro; Wake, Norio

    2007-08-17

    Homeodomain-only protein/not expressed in choriocarcinoma clone 1 (HOP/NECC1) is a newly identified gene that modifies the expression of cardiac-specific genes and thereby regulates heart development. More recently, HOP/NECC1 was reported to be a suppressor of choriocarcinogenesis. Here, we examined the temporal expression profile of HOP/NECC1 in wild-type mouse placenta. We found that E8.5-E9.5 wild-type placenta expressed HOP/NECC1 in the giant cell and spongiotrophoblast layers. HOP/NECC1 (-/-) placenta exhibited marked propagation of giant cell layers and, in turn reduction of spongiotrophoblast formation. We demonstrated SRF transcriptional activity increased in the differentiating trophoblasts and forced expression of SRF in a trophoblast stem (TS) cell line induces the differentiation into giant cells. Negative regulation of SRF (serum response factor) by the binding of HOP/NECC1 protein contributed at least in part to the generation of these placental defects. Gradual induction of HOP/NECC1 in response to differentiation stimuli may result in the decision to differentiate into a particular type of trophoblastic cell lineage and result in non-lethal defects shown by the HOP/NECC1 (-/-) placentas.

  14. Expression of HopAI interferes with MAP kinase signalling in Magnaporthe oryzae.

    Science.gov (United States)

    Zhang, Xue; Liu, Wende; Li, Yang; Li, Guotian; Xu, Jin-Rong

    2017-10-01

    The Pmk1 and Mps1 MAP kinases are essential for appressorium formation and plant infection in Magnaporthe oryzae. However, their exact roles during invasive growth are not clear because pmk1 and mps1 mutants are defective in penetration. To further characterize their functions after penetration, in this study we expressed the Pseudomonas syringae effector HopAI known to inactivate plant MAP kinases in M. oryzae. Constitutive expression of HopAI with the RP27 or TrpC promoter resulted in defects in hyphal growth, conidiation, appressorium penetration and pathogenicity, which is similar to the phenotype of the mps1 mutant. HopAI interacted strongly with Mps1 in vivo and expression of dominant active MKK2 partially suppressed the defects of PRP27 -HopAI transformants, which were significantly reduced in Mps1 phosphorylation. When the infection-specific MIR1 (Magnaporthe-infection-related gene-1) promoter was used to express HopAI, PMIR1 -HopAI transformants were defective in the spreading of invasive hyphae and elicited strong defense responses in penetrated plant cells. Expression of HopAI in Fusarium graminearum also mainly affected the activation of Mgv1, an Mps1 orthologue. Taken together, our results showed that Mps1 is the major intracellular target of HopAI when it is overexpressed, and MAP kinase signalling is important for cell-to-cell movement of invasive hyphae in M. oryzae. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    Science.gov (United States)

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  16. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    Science.gov (United States)

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  17. Evaluating the Impact of Transmission Power on Selecting Tall Vehicles as Best Next Communication Hop

    NARCIS (Netherlands)

    Qiao, Yu; Klein Wolterink, W.; Karagiannis, Georgios; Heijenk, Geert

    The relatively low height of antennas on communicating vehicles in Vehicular Ad Hoc Networks (VANETs) makes one hop and as well multi-hop Vehicle-to-Vehicle (V2V) communication susceptible to obstruction by other vehicles on the road. When the transmitter or receiver (or both) is a Tall vehi- cle,

  18. Proust, Hip-Hop, and Death in First-Year Composition

    Science.gov (United States)

    Sirc, Geoffrey

    2006-01-01

    Hip-hop as content in a first-year writing course offers students a powerful way to connect with their worlds. This article draws on Marcel Proust as a kind of rhyme to legitimate hip-hop as a substantive expressive medium to achieve artistry in writing.

  19. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    Science.gov (United States)

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  20. Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

    Directory of Open Access Journals (Sweden)

    Alex S. Porco

    2014-12-01

    Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

  1. Geometry Design Optimization of Functionally Graded Scaffolds for Bone Tissue Engineering: A Mechanobiological Approach.

    Directory of Open Access Journals (Sweden)

    Antonio Boccaccio

    Full Text Available Functionally Graded Scaffolds (FGSs are porous biomaterials where porosity changes in space with a specific gradient. In spite of their wide use in bone tissue engineering, possible models that relate the scaffold gradient to the mechanical and biological requirements for the regeneration of the bony tissue are currently missing. In this study we attempt to bridge the gap by developing a mechanobiology-based optimization algorithm aimed to determine the optimal graded porosity distribution in FGSs. The algorithm combines the parametric finite element model of a FGS, a computational mechano-regulation model and a numerical optimization routine. For assigned boundary and loading conditions, the algorithm builds iteratively different scaffold geometry configurations with different porosity distributions until the best microstructure geometry is reached, i.e. the geometry that allows the amount of bone formation to be maximized. We tested different porosity distribution laws, loading conditions and scaffold Young's modulus values. For each combination of these variables, the explicit equation of the porosity distribution law-i.e the law that describes the pore dimensions in function of the spatial coordinates-was determined that allows the highest amounts of bone to be generated. The results show that the loading conditions affect significantly the optimal porosity distribution. For a pure compression loading, it was found that the pore dimensions are almost constant throughout the entire scaffold and using a FGS allows the formation of amounts of bone slightly larger than those obtainable with a homogeneous porosity scaffold. For a pure shear loading, instead, FGSs allow to significantly increase the bone formation compared to a homogeneous porosity scaffolds. Although experimental data is still necessary to properly relate the mechanical/biological environment to the scaffold microstructure, this model represents an important step towards

  2. Comparative transcriptional analysis of hop responses to infection with Verticillium nonalfalfae.

    Science.gov (United States)

    Progar, Vasja; Jakše, Jernej; Štajner, Nataša; Radišek, Sebastjan; Javornik, Branka; Berne, Sabina

    2017-10-01

    Dynamic transcriptome profiling revealed excessive, yet ineffective, immune response to V. nonalfalfae infection in susceptible hop, global gene downregulation in shoots of resistant hop and only a few infection-associated genes in roots. Hop (Humulus lupulus L.) production is hampered by Verticillium wilt, a disease predominantly caused by the soil-borne fungus Verticillium nonalfalfae. Only a few hop cultivars exhibit resistance towards it and mechanisms of this resistance have not been discovered. In this study, we compared global transcriptional responses in roots and shoots of resistant and susceptible hop plants infected by a lethal strain of V. nonalfalfae. Time-series differential gene expression profiles between infected and mock inoculated plants were determined and subjected to network-based analysis of functional enrichment. In the resistant hop cultivar, a remarkably low number of genes were differentially expressed in roots in response to V. nonalfalfae infection, while the majority of differentially expressed genes were down-regulated in shoots. The most significantly affected genes were related to cutin biosynthesis, cell wall biogenesis, lateral root development and terpenoid biosynthesis. On the other hand, susceptible hop exhibited a strong defence response in shoots and roots, including increased expression of genes associated with plant responses, such as innate immunity, wounding, jasmonic acid pathway and chitinase activity. Strong induction of defence-associated genes in susceptible hop and a low number of infection-responsive genes in the roots of resistant hop are consistent with previous findings, confirming the pattern of excessive response of the susceptible cultivar, which ultimately fails to protect the plant from V. nonalfalfae. This research offers a multifaceted overview of transcriptional responses of susceptible and resistant hop cultivars to V. nonalfalfae infection and represents a valuable resource in the study of this plant

  3. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    Science.gov (United States)

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  4. Characteristics of compounds in hops using cyclic voltammetry, UV-VIS, FTIR and GC-MS analysis.

    Science.gov (United States)

    Masek, Anna; Chrzescijanska, Ewa; Kosmalska, Anna; Zaborski, Marian

    2014-08-01

    The article presents the antioxidant properties of the extracts of hop EI and EII, by the electrochemical methods on a platinum electrode and comparative analysis of the composition of the extracts of hops using UV-VIS, FTIR and GC-MS methods. The hops extract EI, was obtained from the waste of the hops cone. The hops extract EII, was obtained from the hops cone itself. Hops contain a wide range of polyphenolic compounds with antioxidant properties divided in various chemical classes. Flavonoids and other polyphenolic compounds contained in hops show antioxidant capacity because of the presence of hydroxyl groups in various configurations and numbers within their molecules. The electrochemical properties and antioxidant capacity of hop samples were determined to select the most effective antioxidant. Based on the cyclic and pulse voltammograms, it was observed that hop extract EI contains polyphenols that are oxidised at a less positive potential than extract EII, i.e., it shows better antioxidant capacity. From the analysis of the UV-VIS and FTIR spectra and the GC-MS analysis, it was observed that extract EI contains less phenyl compounds than EII. In addition to flavonoids, EII contains hop acids and chlorophyll. The solutions of hop extracts show very good antioxidant capacities; therefore, they can effectively inhibit or slow negative oxidation reactions and scavenge free radicals and reactive oxygen species (ROS). Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Bringing Back Sweet (and Not so Sweet) Memories: The Cultural Politics of Memory, Hip-Hop, and Generational Identities

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…

  6. RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2011-07-28

    We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

  7. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    Science.gov (United States)

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  8. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  9. Multi-scale osteointegration and neovascularization of biphasic calcium phosphate bone scaffolds

    Science.gov (United States)

    Lan, Sheeny K.

    osteoinductive proteins. To further investigate the effects of scaffold osteoinductivity, BCP scaffolds were implanted in porcine mandibular defects with rhBMP-2, which was partially sequestered in the micropores. Cell migration into osteoinductive scaffold micropores can be enhanced through the delivery of exogenous rhBMP-2 further promoting multi-scale osteointegration. Finally, endothelial colony forming cells (ECFCs) isolated from human umbilical cord blood (UCB) were evaluated in terms of their in vivo vasculogenic potential in the context of bone formation. This work was completed to determine if ECFCs could be utilized in a bone tissue engineering construct to promote neovascularization. ECFCs were combined with a BCP scaffold and rhBMP-2 and implanted subcutaneously on the abdominal wall of NOD/SCID mice. The result was formation of perfused human vessels within BCP scaffold macropores that were present at 4 weeks. The high density and persistence of human vessels at four weeks indicates that human UCB ECFCs exceed their reported in vivo vasculogenic potential when combined with rhBMP-2 and a BCP scaffold. This shows a dual role for BMP-2 in the context of bone regeneration. Collectively, the thesis demonstrates that (1) the design of synthetic bone scaffolds should include controlled multi-scale porosity to promote multi-scale osteointegration, which may significantly improve scaffold mechanical properties and (2) human umbilical cord blood-derived endothelial colony forming cells have potential for promoting neovascularization in a bone defect when combined with rhBMP-2.

  10. PLLA-collagen and PLLA-gelatin hybrid scaffolds with funnel-like porous structure for skin tissue engineering

    Science.gov (United States)

    Lu, Hongxu; Oh, Hwan Hee; Kawazoe, Naoki; Yamagishi, Kozo; Chen, Guoping

    2012-12-01

    In skin tissue engineering, a three-dimensional porous scaffold is necessary to support cell adhesion and proliferation and to guide cells moving into the repair area in the wound healing process. Structurally, the porous scaffold should have an open and interconnected porous architecture to facilitate homogenous cell distribution. Moreover, the scaffolds should be mechanically strong to protect deformation during the formation of new skin. In this study, the hybrid scaffolds were prepared by forming funnel-like collagen or gelatin sponge on a woven poly(l-lactic acid) (PLLA) mesh. The hybrid scaffolds combined the advantages of both collagen or gelatin (good cell-interactions) and PLLA mesh (high mechanical strength). The hybrid scaffolds were used to culture dermal fibroblasts for dermal tissue engineering. The funnel-like porous structure promoted homogeneous cell distribution and extracellular matrix production. The PLLA mesh reinforced the scaffold to avoid deformation. Subcutaneous implantation showed that the PLLA-collagen and PLLA-gelatin scaffolds promoted the regeneration of dermal tissue and epidermis and reduced contraction during the formation of new tissue. These results indicate that funnel-like hybrid scaffolds can be used for skin tissue regeneration.

  11. Bioactive polymeric scaffolds for tissue engineering

    Science.gov (United States)

    Stratton, Scott; Shelke, Namdev B.; Hoshino, Kazunori; Rudraiah, Swetha; Kumbar, Sangamesh G.

    2016-01-01

    A variety of engineered scaffolds have been created for tissue engineering using polymers, ceramics and their composites. Biomimicry has been adopted for majority of the three-dimensional (3D) scaffold design both in terms of physicochemical properties, as well as bioactivity for superior tissue regeneration. Scaffolds fabricated via salt leaching, particle sintering, hydrogels and lithography have been successful in promoting cell growth in vitro and tissue regeneration in vivo. Scaffold systems derived from decellularization of whole organs or tissues has been popular due to their assured biocompatibility and bioactivity. Traditional scaffold fabrication techniques often failed to create intricate structures with greater resolution, not reproducible and involved multiple steps. The 3D printing technology overcome several limitations of the traditional techniques and made it easier to adopt several thermoplastics and hydrogels to create micro-nanostructured scaffolds and devices for tissue engineering and drug delivery. This review highlights scaffold fabrication methodologies with a focus on optimizing scaffold performance through the matrix pores, bioactivity and degradation rate to enable tissue regeneration. Review highlights few examples of bioactive scaffold mediated nerve, muscle, tendon/ligament and bone regeneration. Regardless of the efforts required for optimization, a shift in 3D scaffold uses from the laboratory into everyday life is expected in the near future as some of the methods discussed in this review become more streamlined. PMID:28653043

  12. Bioactive polymeric scaffolds for tissue engineering

    Directory of Open Access Journals (Sweden)

    Scott Stratton

    2016-12-01

    Full Text Available A variety of engineered scaffolds have been created for tissue engineering using polymers, ceramics and their composites. Biomimicry has been adopted for majority of the three-dimensional (3D scaffold design both in terms of physicochemical properties, as well as bioactivity for superior tissue regeneration. Scaffolds fabricated via salt leaching, particle sintering, hydrogels and lithography have been successful in promoting cell growth in vitro and tissue regeneration in vivo. Scaffold systems derived from decellularization of whole organs or tissues has been popular due to their assured biocompatibility and bioactivity. Traditional scaffold fabrication techniques often failed to create intricate structures with greater resolution, not reproducible and involved multiple steps. The 3D printing technology overcome several limitations of the traditional techniques and made it easier to adopt several thermoplastics and hydrogels to create micro-nanostructured scaffolds and devices for tissue engineering and drug delivery. This review highlights scaffold fabrication methodologies with a focus on optimizing scaffold performance through the matrix pores, bioactivity and degradation rate to enable tissue regeneration. Review highlights few examples of bioactive scaffold mediated nerve, muscle, tendon/ligament and bone regeneration. Regardless of the efforts required for optimization, a shift in 3D scaffold uses from the laboratory into everyday life is expected in the near future as some of the methods discussed in this review become more streamlined.

  13. Alginate based scaffolds for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Valente, J.F.A.; Valente, T.A.M. [CICS-UBI - Centro de Investigacao em Ciencias da Saude, Faculdade de Ciencias da Saude, Universidade da Beira Interior, Covilha (Portugal); Alves, P.; Ferreira, P. [CIEPQPF, Departamento de Engenharia Quimica, Universidade de Coimbra, Polo II, Pinhal de Marrocos, 3030-290 Coimbra (Portugal); Silva, A. [Centro de Ciencia e Tecnologia Aeroespaciais, Universidade da Beira Interior, Covilha (Portugal); Correia, I.J., E-mail: icorreia@ubi.pt [CICS-UBI - Centro de Investigacao em Ciencias da Saude, Faculdade de Ciencias da Saude, Universidade da Beira Interior, Covilha (Portugal)

    2012-12-01

    The design and production of scaffolds for bone tissue regeneration is yet unable to completely reproduce the native bone properties. In the present study new alginate microparticle and microfiber aggregated scaffolds were produced to be applied in this area of regenerative medicine. The scaffolds' mechanical properties were characterized by thermo mechanical assays. Their morphological characteristics were evaluated by isothermal nitrogen adsorption and scanning electron microscopy. The density of both types of scaffolds was determined by helium pycnometry and mercury intrusion porosimetry. Furthermore, scaffolds' cytotoxic profiles were evaluated in vitro by seeding human osteoblast cells in their presence. The results obtained showed that scaffolds have good mechanical and morphological properties compatible with their application as bone substitutes. Moreover, scaffold's biocompatibility was confirmed by the observation of cell adhesion and proliferation after 5 days of being seeded in their presence and by non-radioactive assays. - Highlights: Black-Right-Pointing-Pointer Design and production of scaffolds for bone tissue regeneration. Black-Right-Pointing-Pointer Microparticle and microfiber alginate scaffolds were produced through a particle aggregation technique; Black-Right-Pointing-Pointer Scaffolds' mechanically and biologically properties were characterized through in vitro studies;.

  14. Hybrid 3D-2D printing of bone scaffolds Hybrid 3D-2D printing methods for bone scaffolds fabrication.

    Science.gov (United States)

    Prinz, V Ya; Seleznev, Vladimir

    2016-12-13

    It is a well-known fact that bone scaffold topography on micro- and nanometer scale influences the cellular behavior. Nano-scale surface modification of scaffolds allows the modulation of biological activity for enhanced cell differentiation. To date, there has been only a limited success in printing scaffolds with micro- and nano-scale features exposed on the surface. To improve on the currently available imperfect technologies, in our paper we introduce new hybrid technologies based on a combination of 2D (nano imprint) and 3D printing methods. The first method is based on using light projection 3D printing and simultaneous 2D nanostructuring of each of the layers during the formation of the 3D structure. The second method is based on the sequential integration of preliminarily created 2D nanostructured films into a 3D printed structure. The capabilities of the developed hybrid technologies are demonstrated with the example of forming 3D bone scaffolds. The proposed technologies can be used to fabricate complex 3D micro- and nanostructured products for various fields. Copyright 2016 IOP Publishing Ltd.

  15. Developing bioactive composite scaffolds for bone tissue engineering

    Science.gov (United States)

    Chen, Yun

    Poly(L-lactic acid) (PLLA) films were fabricated using the method of dissolving and evaporation. PLLA scaffold was prepared by solid-liquid phase separation of polymer solutions and subsequent sublimation of solvent. Bonelike apatite coating was formed on PLLA films, PLLA scaffolds and poly(glycolic acid) (PGA) scaffolds in 24 hours through an accelerated biomimetic process. The ion concentrations in the simulated body fluid (SBF) were nearly 5 times of those in human blood plasma. The apatite formed was characterized using scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FTIR). The apatite formed in 5SBF was similar in morphology and composition to that formed in the classical biomimetic process employing SBF or 1.5SBF, and similar to that of natural bone. This indicated that the biomimetic apatite coating process could be accelerated by using concentrated simulated body fluid at 37°C. Besides saving time, the accelerated biomimetic process is particularly significant to biodegradable polymers. Some polymers which degrade too fast to be coated with apatite by a classical biomimetic process, for example PGA, could be coated with bone-like apatite in an accelerated biomimetic process. Collagen and apatite were co-precipitated as a composite coating on poly(L-lactic acid) (PLLA) in an accelerated biomimetic process. The incubation solution contained collagen (1g/L) and simulated body fluid (SBF) with 5 times inorganic ionic concentrations as human blood plasma. The coating formed on PLLA films and scaffolds after 24 hours incubation was characterized using EDX, XRD, FTIR, and SEM. It was shown that the coating contained carbonated bone-like apatite and collagen, the primary constituents of natural bone. SEM showed a complex composite coating of submicron bone-like apatite particulates combined with collagen fibrils. This work provided an efficient process to obtain

  16. A multi-scale controlled tissue engineering scaffold prepared by 3D printing and NFES technology

    Directory of Open Access Journals (Sweden)

    Feifei Yan

    2014-03-01

    Full Text Available The current focus in the field of life science is the use of tissue engineering scaffolds to repair human organs, which has shown great potential in clinical applications. Extracellular matrix morphology and the performance and internal structure of natural organs are required to meet certain requirements. Therefore, integrating multiple processes can effectively overcome the limitations of the individual processes and can take into account the needs of scaffolds for the material, structure, mechanical properties and many other aspects. This study combined the biological 3D printing technology and the near-field electro-spinning (NFES process to prepare a multi-scale controlled tissue engineering scaffold. While using 3D printing technology to directly prepare the macro-scaffold, the compositing NFES process to build tissue micro-morphology ultimately formed a tissue engineering scaffold which has the specific extracellular matrix structure. This scaffold not only takes into account the material, structure, performance and many other requirements, but also focuses on resolving the controllability problems in macro- and micro-forming which further aim to induce cell directed differentiation, reproduction and, ultimately, the formation of target tissue organs. It has in-depth immeasurable significance to build ideal scaffolds and further promote the application of tissue engineering.

  17. Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients.

    Science.gov (United States)

    Trachtenberg, Jordan E; Placone, Jesse K; Smith, Brandon T; Fisher, John P; Mikos, Antonios G

    2017-04-01

    The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (μCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications.

  18. 3D-Printed ABS and PLA Scaffolds for Cartilage and Nucleus Pulposus Tissue Regeneration

    Directory of Open Access Journals (Sweden)

    Derek H. Rosenzweig

    2015-07-01

    Full Text Available Painful degeneration of soft tissues accounts for high socioeconomic costs. Tissue engineering aims to provide biomimetics recapitulating native tissues. Biocompatible thermoplastics for 3D printing can generate high-resolution structures resembling tissue extracellular matrix. Large-pore 3D-printed acrylonitrile butadiene styrene (ABS and polylactic acid (PLA scaffolds were compared for cell ingrowth, viability, and tissue generation. Primary articular chondrocytes and nucleus pulposus (NP cells were cultured on ABS and PLA scaffolds for three weeks. Both cell types proliferated well, showed high viability, and produced ample amounts of proteoglycan and collagen type II on both scaffolds. NP generated more matrix than chondrocytes; however, no difference was observed between scaffold types. Mechanical testing revealed sustained scaffold stability. This study demonstrates that chondrocytes and NP cells can proliferate on both ABS and PLA scaffolds printed with a simplistic, inexpensive desktop 3D printer. Moreover, NP cells produced more proteoglycan than chondrocytes, irrespective of thermoplastic type, indicating that cells maintain individual phenotype over the three-week culture period. Future scaffold designs covering larger pore sizes and better mimicking native tissue structure combined with more flexible or resorbable materials may provide implantable constructs with the proper structure, function, and cellularity necessary for potential cartilage and disc tissue repair in vivo.

  19. Bone tissue engineering with a collagen–hydroxyapatite scaffold and culture expanded bone marrow stromal cells

    Science.gov (United States)

    Villa, Max M.; Wang, Liping; Huang, Jianping; Rowe, David W.; Wei, Mei

    2015-01-01

    Osteoprogenitor cells combined with supportive biomaterials represent a promising approach to advance the standard of care for bone grafting procedures. However, this approach faces challenges, including inconsistent bone formation, cell survival in the implant, and appropriate biomaterial degradation. We have developed a collagen–hydroxyapatite (HA) scaffold that supports consistent osteogenesis by donor derived osteoprogenitors, and is more easily degraded than a pure ceramic scaffold. Herein, the material properties are characterized as well as cell attachment, viability, and progenitor distribution in vitro. Furthermore, we examined the biological performance in vivo in a critical-size mouse calvarial defect. To aid in the evaluation of the in-house collagen–HA scaffold, the in vivo performance was compared with a commercial collagen–HA scaffold (Healos®, Depuy). The in-house collagen–HA scaffold supported consistent bone formation by predominantly donor-derived osteoblasts, nearly completely filling a 3.5 mm calvarial defect with bone in all samples (n=5) after 3 weeks of implantation. In terms of bone formation and donor cell retention at 3 weeks postimplantation, no statistical difference was found between the in-house and commercial scaffold following quantitative histomorphometry. The collagen–HA scaffold presented here is an open and well-defined platform that supports robust bone formation and should facilitate the further development of collagen–hydroxyapatite biomaterials for bone tissue engineering. PMID:24909953

  20. Periodontal Regeneration Using Strontium-Loaded Mesoporous Bioactive Glass Scaffolds in Osteoporotic Rats

    Science.gov (United States)

    Zhang, Yufeng; Wei, Lingfei; Wu, Chengtie; Miron, Richard J.

    2014-01-01

    Recent studies demonstrate that the rate of periodontal breakdown significantly increased in patients compromised from both periodontal disease and osteoporosis. One pharmacological agent used for their treatment is strontium renalate due to its simultaneous ability to increase bone formation and halt bone resorption. The aim of the present study was to achieve periodontal regeneration of strontium-incorporated mesoporous bioactive glass (Sr-MBG) scaffolds in an osteoporotic animal model carried out by bilateral ovariectomy (OVX). 15 female Wistar rats were randomly assigned to three groups: control unfilled periodontal defects, 2) MBG alone and 3) Sr-MBG scaffolds. 10 weeks after OVX, bilateral fenestration defects were created at the buccal aspect of the first mandibular molar and assessed by micro-CT and histomorphometric analysis after 28 days. Periodontal fenestration defects treated with Sr-MBG scaffolds showed greater new bone formation (46.67%) when compared to MBG scaffolds (39.33%) and control unfilled samples (17.50%). The number of TRAP-positive osteoclasts was also significantly reduced in defects receiving Sr-MBG scaffolds. The results from the present study suggest that Sr-MBG scaffolds may provide greater periondontal regeneration. Clinical studies are required to fully characterize the possible beneficial effect of Sr-releasing scaffolds for patients suffering from a combination of both periodontal disease and osteoporosis. PMID:25116811

  1. Electrospun biphasic tubular scaffold with enhanced mechanical properties for vascular tissue engineering.

    Science.gov (United States)

    Abdal-Hay, Abdalla; Bartnikowski, Michal; Hamlet, Stephen; Ivanovski, Sašo

    2018-01-01

    Polymer scaffolds produced through an electrospinning process are frequently explored as tissue substitutes for regenerative medicine. Despite offering desirable surface area to volume ratios and tailorable pore sizes, their poor structural mechanical properties limit their applicability in load-bearing regions. In this study, we present a simple strategy to improve the mechanical properties of a vascular graft scaffold. We achieved the formation of biphasic tubular scaffolds by electrospinning polyurethane (PU) onto an airbrushed tube made of polycaprolactone (PCL). After preparation, the scaffold was subsequently thermally-crosslinked (60°C) to strengthen the bonding between the two materials. The tensile strength and tensile elastic (Young's) modulus of the biphasic scaffolds were significantly enhanced from 4.5±1.72 and 45±15MPa (PU-only) up to 67.5±2.4 and 1039±81.8MPa (PCL/PU; pmechanically robust vascular graft scaffold using a novel combination of well-established fabrication techniques. This study could also be extended to the fabrication of other biphasic scaffolds to better enhance the mechanical properties of the electrospun fibers mat without deteriorating its architecture structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Development of porous Ti6Al4V/chitosan sponge composite scaffold for orthopedic applications.

    Science.gov (United States)

    Guo, Miao; Li, Xiang

    2016-01-01

    A novel composite scaffold consisting of porous Ti6Al4V part filled with chitosan sponge was fabricated using a combination of electron beam melting and freeze-drying. The mechanical properties of porous Ti6Al4V part were examined via compressive test. The ultimate compressive strength was 85.35 ± 8.68 MPa and the compressive modulus was 2.26 ± 0.42 GPa. The microstructure of composite scaffold was characterized using scanning electron microscopy. The chitosan sponge filled in Ti6Al4V part exhibited highly porous and well-interconnected micro-pore architecture. The osteoblastic cells were seeded on scaffolds to test their seeding efficiency and biocompatibility. Significantly higher cell seeding efficiency was found on composite scaffold. The biological response of osteoblasts on composite scaffolds was superior in terms of improved cell attachment, higher proliferation, and well-spread morphology in relation to porous Ti6Al4V part. These results suggest that the Ti6Al4V/chitosan composite scaffold is potentially useful as a biomedical scaffold for orthopedic applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Design and evaluation of antibiotic releasing self- assembled scaffolds at room temperature using biodegradable polymer particles.

    Science.gov (United States)

    Admane, Prasad; Gupta, Jatin; I J, Ancy; Kumar, Robin; Panda, Amulya K

    2017-03-30

    Biodegradable polymer-based drug-eluting implants offer many advantages such as predictable drug release kinetics, safety, and acceptable drug loading under ambient conditions. Herein, we describe fabrication and evaluation of antibiotic loaded scaffolds for localized delivery and tissue engineering applications. PDLLA particles entrapping gentamycin were formulated using solvent evaporation method and used for scaffold fabrication. Optimization of formulation parameters such as pH of the internal aqueous phase and combination of excipients like glycerol, polyvinyl alcohol (PVA) resulted in high entrapment efficiencies up to 96% of gentamicin in particles with drug load of 16-18μg/mg of polymer particles. These microparticles were fused in presence of methanol at ambient temperatures to form scaffolds of different geometry having reasonable mechanical strength. Porosity of these scaffolds was found to be more than 80%. Antibiotic released from the scaffolds was found to be bioactive as tested against Staphylococcus aureus and the release pattern was biphasic over a period of one week. The scaffolds were found to be non-toxic to murine fibroblasts cultures in vitro as well as to mice upon subcutaneous implantation. This method provides a novel and easy way of fabricating antibiotic loaded polymer scaffolds for varieties of applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. 3D-Printed ABS and PLA Scaffolds for Cartilage and Nucleus Pulposus Tissue Regeneration.

    Science.gov (United States)

    Rosenzweig, Derek H; Carelli, Eric; Steffen, Thomas; Jarzem, Peter; Haglund, Lisbet

    2015-07-03

    Painful degeneration of soft tissues accounts for high socioeconomic costs. Tissue engineering aims to provide biomimetics recapitulating native tissues. Biocompatible thermoplastics for 3D printing can generate high-resolution structures resembling tissue extracellular matrix. Large-pore 3D-printed acrylonitrile butadiene styrene (ABS) and polylactic acid (PLA) scaffolds were compared for cell ingrowth, viability, and tissue generation. Primary articular chondrocytes and nucleus pulposus (NP) cells were cultured on ABS and PLA scaffolds for three weeks. Both cell types proliferated well, showed high viability, and produced ample amounts of proteoglycan and collagen type II on both scaffolds. NP generated more matrix than chondrocytes; however, no difference was observed between scaffold types. Mechanical testing revealed sustained scaffold stability. This study demonstrates that chondrocytes and NP cells can proliferate on both ABS and PLA scaffolds printed with a simplistic, inexpensive desktop 3D printer. Moreover, NP cells produced more proteoglycan than chondrocytes, irrespective of thermoplastic type, indicating that cells maintain individual phenotype over the three-week culture period. Future scaffold designs covering larger pore sizes and better mimicking native tissue structure combined with more flexible or resorbable materials may provide implantable constructs with the proper structure, function, and cellularity necessary for potential cartilage and disc tissue repair in vivo.

  5. Activated carbon fibers/poly(lactic-co-glycolic) acid composite scaffolds: Preparation and characterizations

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Yanni [State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai 201620 (China); College of Materials Science and Engineering, Donghua University, Shanghai 201620 (China); Han, Hao [College of Materials Science and Engineering, Donghua University, Shanghai 201620 (China); Bayer Material Science China Co., Ltd, Shanghai 200120 (China); Quan, Haiyu; Zang, Yongju; Wang, Ning; Ren, Guizhi [College of Materials Science and Engineering, Donghua University, Shanghai 201620 (China); Xing, Melcolm [Department of Mechanical Engineering, Faculty of Engineering and Department of Biochemistry and Genetics, Faculty of Medicine P.I., Manitoba Institute of Child Health, University of Manitoba, Winnipeg, Manitoba (Canada); Wu, Qilin, E-mail: wql@dhu.edu.cn [State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai 201620 (China); College of Materials Science and Engineering, Donghua University, Shanghai 201620 (China)

    2014-10-01

    The present work is a first trial to introduce activated carbon fibers (ACF) with high adsorption capacity into poly(lactic-co-glycolic) acid (PLGA), resulting in a novel kind of scaffolds for tissue engineering applications. ACF, prepared via high-temperature processing of carbon fibers, are considered to possess bioactivity and biocompatibility. The ACF/PLGA composite scaffolds are prepared by solvent casting/particulate leaching method. Increments in both pore quantity and quality over the surface of ACF as well as a robust combination between ACF and PLGA matrix are observed via scanning electron microscopy (SEM). The high adsorption capacity of ACF is confirmed by methylene blue solution absorbency test. The surfaces of ACF are affiliated with many hydrophilic groups and characterized by Fourier transform infrared spectroscopy. Furthermore, the SEM images show that cells possess a favorable spreading morphology on the ACF/PLGA scaffolds. Besides, vivo experiments are also carried out to evaluate the histocompatibility of the composite scaffolds. The results show that ACF have the potential to become one of the most promising materials in biological fields. - Highlights: • ACF with strong adsorption capacity and porous structure for enhanced surface area • The incorporation of ACF promoting the porosity of composite scaffolds • The composite scaffolds having no side effect on cell adhesion and proliferation • The composite scaffolds presenting good biocompatibility in vivo.

  6. The effect of controlled release of PDGF-BB from heparin-conjugated electrospun PCL/gelatin scaffolds on cellular bioactivity and infiltration

    Science.gov (United States)

    Lee, Jongman; Yoo, James J.; Atala, Anthony; Lee, Sang Jin

    2013-01-01

    Heparin-conjugated electrospun poly(ε-caprolactone) (PCL)/gelatin scaffolds were developed to provide controlled release of platelet-derived growth factor-BB (PDGF-BB) and allow prolonged bioactivity of this molecule. A mixture of PCL and gelatin was electrospun into three different morphologies. Next, heparin molecules were conjugated to the reactive surface of the scaffolds. This heparin-conjugated scaffold allowed the immobilization of PDGF-BB via electrostatic interaction. In vitro PDGF-BB release profiles indicated that passive physical adsorption of PDGF-BB to non-heparinized scaffolds resulted in an initial burst release of PDGF-BB within 5 days, which then leveled off. However, electrostatic interaction between PDGF-BB and the heparin-conjugated scaffolds gave rise to a sustained release of PDGF-BB over the course of 20 days without an initial burst. Moreover, PDGF-BB that was strongly bound to the heparin-conjugated scaffolds enhanced smooth muscle cell (SMC) proliferation. In addition, scaffolds composed of 3.0 µm diameter fibers that were immobilized with PDGF-BB accelerated SMC infiltration into the scaffold when compared to scaffolds composed of smaller diameter fibers or scaffolds that did not release PDGF-BB. We concluded that the combination of the large pore structure in the scaffolds and the heparin-mediated delivery of PDGF-BB provided the most effective cellular interactions through synergistic physical and chemical cues. PMID:22770570

  7. Nanosized Mesoporous Bioactive Glass/Poly(lactic-co-glycolic Acid Composite-Coated CaSiO3 Scaffolds with Multifunctional Properties for Bone Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Mengchao Shi

    2014-01-01

    Full Text Available It is of great importance to prepare multifunctional scaffolds combining good mechanical strength, bioactivity, and drug delivery ability for bone tissue engineering. In this study, nanosized mesoporous bioglass/poly(lactic-co-glycolic acid composite-coated calcium silicate scaffolds, named NMBG-PLGA/CS, were successfully prepared. The morphology and structure of the prepared scaffolds were characterized by scanning electron microscopy and X-ray diffraction. The effects of NMBG on the apatite mineralization activity and mechanical strength of the scaffolds and the attachment, proliferation, and alkaline phosphatase activity of MC3T3 cells as well as drug ibuprofen delivery properties were systematically studied. Compared to pure CS scaffolds and PLGA/CS scaffolds, the prepared NMBG-PLGA/CS scaffolds had greatly improved apatite mineralization activity in simulated body fluids, much higher mechanical property, and supported the attachment of MC3T3 cells and enhanced the cell proliferation and ALP activity. Furthermore, the prepared NMBG-PLGA/CS scaffolds could be used for delivering ibuprofen with a sustained release profile. Our study suggests that the prepared NMBG-PLGA/CS scaffolds have improved physicochemical, biological, and drug-delivery property as compared to conventional CS scaffolds, indicating that the multifunctional property of the prepared scaffolds for the potential application of bone tissue engineering.

  8. Scaffolding With and Through Videos

    DEFF Research Database (Denmark)

    Otrel-Cass, Kathrin; Khoo, Elaine; Cowie, Bronwen

    2012-01-01

    to consider must be expanded. This article explicates theoretical and practical ideas related to teachers’ application of their ICT technology, pedagogy, and content knowledge (TPACK) in science. The article unpacks the social and technological dimensions of teachers’ use of TPACK when they use digital videos...... to scaffold learning. It showcases the intricate interplay between teachers’ knowledge about content, digital video technology, and students’ learning needs based on a qualitative study of two science teachers and their students in a New Zealand primary school....

  9. A comparison study between electrospun polycaprolactone and piezoelectric poly(3-hydroxybutyrate-co-3-hydroxyvalerate) scaffolds for bone tissue engineering.

    Science.gov (United States)

    Gorodzha, Svetlana N; Muslimov, Albert R; Syromotina, Dina S; Timin, Alexander S; Tcvetkov, Nikolai Y; Lepik, Kirill V; Petrova, Aleksandra V; Surmeneva, Maria A; Gorin, Dmitry A; Sukhorukov, Gleb B; Surmenev, Roman A

    2017-12-01

    In this study, bone scaffolds composed of polycaprolactone (PCL), piezoelectric poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) and a combination of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) and silicate containing hydroxyapatite (PHBV-SiHA) were successfully fabricated by a conventional electrospinning process. The morphological, chemical, wetting and biological properties of the scaffolds were examined. All fabricated scaffolds are composed of randomly oriented fibres with diameters from 800nm to 12μm. Fibre size increased with the addition of SiHA to PHBV scaffolds. Moreover, fibre surface roughness in the case of hybrid scaffolds was also increased. XRD, FTIR and Raman spectroscopy were used to analyse the chemical composition of the scaffolds, and contact angle measurements were performed to reveal the wetting behaviour of the synthesized materials. To determine the influence of the piezoelectric nature of PHBV in combination with SiHA nanoparticles on cell attachment and proliferation, PCL (non-piezoelectric), pure PHBV, and PHBV-SiHA scaffolds were seeded with human mesenchymal stem cells (hMSCs). In vitro study on hMSC adhesion, viability, spreading and osteogenic differentiation showed that the PHBV-SiHA scaffolds had the largest adhesion and differentiation abilities compared with other scaffolds. Moreover, the piezoelectric PHBV scaffolds have demonstrated better calcium deposition potential compared with non-piezoelectric PCL. The results of the study revealed pronounced advantages of hybrid PHBV-SiHA scaffolds to be used in bone tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Nano scaffolds and stem cell therapy in liver tissue engineering

    Science.gov (United States)

    Montaser, Laila M.; Fawzy, Sherin M.

    2015-08-01

    Tissue engineering and regenerative medicine have been constantly developing of late due to the major progress in cell and organ transplantation, as well as advances in materials science and engineering. Although stem cells hold great potential for the treatment of many injuries and degenerative diseases, several obstacles must be overcome before their therapeutic application can be realized. These include the development of advanced techniques to understand and control functions of micro environmental signals and novel methods to track and guide transplanted stem cells. A major complication encountered with stem cell therapies has been the failure of injected cells to engraft to target tissues. The application of nanotechnology to stem cell biology would be able to address those challenges. Combinations of stem cell therapy and nanotechnology in tissue engineering and regenerative medicine have achieved significant advances. These combinations allow nanotechnology to engineer scaffolds with various features to control stem cell fate decisions. Fabrication of Nano fiber cell scaffolds onto which stem cells can adhere and spread, forming a niche-like microenvironment which can guide stem cells to proceed to heal damaged tissues. In this paper, current and emergent approach based on stem cells in the field of liver tissue engineering is presented for specific application. The combination of stem cells and tissue engineering opens new perspectives in tissue regeneration for stem cell therapy because of the potential to control stem cell behavior with the physical and chemical characteristics of the engineered scaffold environment.

  11. SDN-Based Double Hopping Communication against Sniffer Attack

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2016-01-01

    Full Text Available Sniffer attack has been a severe threat to network communication security. Traditional network usually uses static network configuration, which provides convenience to sniffer attack. In this paper, an SDN-based double hopping communication (DHC approach is proposed to solve this problem. In DHC, ends in communication packets as well as the routing paths are changed dynamically. Therefore, the traffic will be distributed to multiple flows and transmitted along different paths. Moreover, the data from multiple users will be mixed, bringing difficulty for attackers in obtaining and recovering the communication data, so that sniffer attack will be prevented effectively. It is concluded that DHC is able to increase the overhead of sniffer attack, as well as the difficulty of communication data recovery.

  12. Systematic network coding for two-hop lossy transmissions

    Science.gov (United States)

    Li, Ye; Blostein, Steven; Chan, Wai-Yip

    2015-12-01

    In this paper, we consider network transmissions over a single or multiple parallel two-hop lossy paths. These scenarios occur in applications such as sensor networks or WiFi offloading. Random linear network coding (RLNC), where previously received packets are re-encoded at intermediate nodes and forwarded, is known to be a capacity-achieving approach for these networks. However, a major drawback of RLNC is its high encoding and decoding complexity. In this work, a systematic network coding method is proposed. We show through both analysis and simulation that the proposed method achieves higher end-to-end rate as well as lower computational cost than RLNC for finite field sizes and finite-sized packet transmissions.

  13. Double-hop networks using VSATs for the Intelsat system

    Science.gov (United States)

    Mizuno, Toshio; Nohara, Mitsuo; Watanabe, Fumio; Takeuchi, Yoshio; Honda, Teruhiko

    The double-hop VSAT (very small aperture terminal) network was studied with emphasis on its feasibility and networking in the Intelsat system. The results of channel-capacity estimation indicate that reasonable channel capacity and availability objectives equal to those for Super IBS (Intelsat business services) are attainable through the use of the uplink and downlink power control incorporated in the outbound link with BPSK/SCPC (binary-phase shift keying/single channel per carrier) transmission. Possible network architectures for various beam configurations were devised, and the accessibility of individual network architectures was analyzed in terms of blocking probability and call setup time. Based on the results of architecture study, an example implementation of VSAT system is shown. Furthermore, experimental results on the developed VSAT system are discussed. The experiment showed that the transmit power control for the outbound SCPC carrier is conducive to meeting stringent performance objectives stipulated for international digital transmissions.

  14. Cu1-x Fe x O: hopping transport and ferromagnetism.

    Science.gov (United States)

    Nasir, Mohd; Islam, Rakibul; Ahmed, Md A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C L; Roussel, Frederick; Biring, Sajal; Sen, Somaditya

    2017-09-01

    Single phase, sol-gel prepared Cu1-x Fe x O (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase.

  15. Transport of hop aroma compounds across Caco-2 monolayers.

    Science.gov (United States)

    Heinlein, A; Metzger, M; Walles, H; Buettner, A

    2014-11-01

    Although being reported and used as a sedative remedy for several years, the bioactive principle of hop preparations is still not decisively clarified. Understanding absorption and transformation processes of potential physiologically active constituents is essential to evaluate the likeliness of biological effects on humans. Therefore, single hop aroma compounds as well as digestive transformation products thereof have been investigated in view of their human intestinal absorption, applying Caco-2 transport experiments as well as investigations on potential biotransformation processes. Selective and sensitive identification and quantification were thereby achieved by application of two-dimensional high resolution gas chromatography-mass spectrometry in conjunction with stable isotope dilution analysis, leading to the determination of apparent permeability values by different mathematical approaches considering sink and non-sink conditions. Overall, calculated permeability values ranged from 2.6 × 10(-6) to 1.8 × 10(-4) cm s(-1) with all mathematical approaches, indicating high absorption potential and almost complete bioavailability for all tested compounds with hydroxyl-functionalities. Considering this high permeability together with the high lipophilicity of these substances, a passive transcellular uptake route can be speculated. Investigated sesquiterpenes and β-myrcene showed flat absorption profiles while the investigated esters showed decreasing profiles. In view of the lipophilic and volatile nature of the investigated substances, special attention was paid to recovery and mass balance determination. Furthermore, in the course of the transport experiments of 1-octen-3-ol and 3-methyl-2-buten-1-ol, additional biotransformation products were observed, namely 3-octanone and 3-methyl-2-butenal, respectively. The absence of these additional substances in control experiments strongly indicates an intestinal first-pass metabolism of the

  16. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems.

    Science.gov (United States)

    Brummitt, Charles D; Barnett, George; D'Souza, Raissa M

    2015-11-06

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast-slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to 'hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. © 2015 The Authors.

  17. Development of a guided bone regeneration device using salicylic acid-poly(anhydride-ester) polymers and osteoconductive scaffolds.

    Science.gov (United States)

    Mitchell, Ashley; Kim, Brian; Cottrell, Jessica; Snyder, Sabrina; Witek, Lukasz; Ricci, John; Uhrich, Kathryn E; O'Connor, J Patrick

    2014-03-01

    Successful repair of craniofacial and periodontal tissue defects ideally involves a combined therapy that includes inflammation modulation, control of soft tissue infiltration, and bone regeneration. In this study, an anti-inflammatory polymer, salicylic acid-based poly(anhydride-ester) (SAPAE) and a three-dimensional osteoconductive ceramic scaffold were evaluated as a combined guided bone regeneration (GBR) system for concurrent control of inflammation, soft tissue ingrowth, and bone repair in a rabbit cranial defect model. At time periods of 1, 3, and 8 weeks, five groups were compared: (1) scaffolds with a solid ceramic cap (as a GBR structure); (2) scaffolds with no cap; (3) scaffolds with a poly(lactide-glycolide) cap; (4) scaffolds with a slow release SAPAE polymer cap; and (5) scaffolds with a fast release SAPAE polymer cap. Cellular infiltration and bone formation in these scaffolds were evaluated to assess inflammation and bone repair capacity of the test groups. The SAPAE polymers suppressed inflammation and displayed no deleterious effect on bone formation. Additional work is warranted to optimize the anti-inflammatory action of the SAPAE, GBR suppression of soft tissue infiltration, and stimulation of bone formation in the scaffolds and create a composite device for successful repair of craniofacial and periodontal tissue defects. Copyright © 2013 Wiley Periodicals, Inc.

  18. Fabrication of a Highly Aligned Neural Scaffold via a Table Top Stereolithography 3D Printing and Electrospinning().

    Science.gov (United States)

    Lee, Se-Jun; Nowicki, Margaret; Harris, Brent; Zhang, Lijie Grace

    2017-06-01

    Three-dimensional (3D) bioprinting is a rapidly emerging technique in the field of tissue engineering to fabricate extremely intricate and complex biomimetic scaffolds in the range of micrometers. Such customized 3D printed constructs can be used for the regeneration of complex tissues such as cartilage, vessels, and nerves. However, the 3D printing techniques often offer limited control over the resolution and compromised mechanical properties due to short selection of printable inks. To address these limitations, we combined stereolithography and electrospinning techniques to fabricate a novel 3D biomimetic neural scaffold with a tunable porous structure and embedded aligned fibers. By employing two different types of biofabrication methods, we successfully utilized both synthetic and natural materials with varying chemical composition as bioink to enhance biocompatibilities and mechanical properties of the scaffold. The resulting microfibers composed of polycaprolactone (PCL) polymer and PCL mixed with gelatin were embedded in 3D printed hydrogel scaffold. Our results showed that 3D printed scaffolds with electrospun fibers significantly improve neural stem cell adhesion when compared to those without the fibers. Furthermore, 3D scaffolds embedded with aligned fibers showed an enhancement in cell proliferation relative to bare control scaffolds. More importantly, confocal microscopy images illustrated that the scaffold with PCL/gelatin fibers greatly increased the average neurite length and directed neurite extension of primary cortical neurons along the fiber. The results of this study demonstrate the potential to create unique 3D neural tissue constructs by combining 3D bioprinting and electrospinning techniques.

  19. Human platelet-rich plasma improves the nesting and differentiation of human chondrocytes cultured in stabilized porous chitosan scaffolds.

    Science.gov (United States)

    Sancho-Tello, Maria; Martorell, Sara; Mata Roig, Manuel; Milián, Lara; Gámiz-González, M A; Gómez Ribelles, Jose Luis; Carda, Carmen

    2017-01-01

    The clinical management of large-size cartilage lesions is difficult due to the limited regenerative ability of the cartilage. Different biomaterials have been used to develop tissue engineering substitutes for cartilage repair, including chitosan alone or in combination with growth factors to improve its chondrogenic properties. The main objective of this investigation was to evaluate the benefits of combining activated platelet-rich plasma with a stabilized porous chitosan scaffold for cartilage regeneration. To achieve this purpose, stabilized porous chitosan scaffolds were prepared using freeze gelation and combined with activated platelet-rich plasma. Human primary articular chondrocytes were isolated and cultured in stabilized porous chitosan scaffolds with and without combination to activated platelet-rich plasma. Scanning electron microscopy was used for the morphological characterization of the resulting scaffolds. Cell counts were performed in hematoxylin and eosin-stained sections, and type I and II collagen expression was evaluated using immunohistochemistry. Significant increase in cell number in activated platelet-rich plasma/stabilized porous chitosan was found compared with stabilized porous chitosan scaffolds. Chondrocytes grown on stabilized porous chitosan expressed high levels of type I collagen but type II was not detectable, whereas cells grown on activated platelet rich plasma/stabilized porous chitosan scaffolds expressed high levels of type II collagen and type I was almost undetectable. In summary, activated platelet-rich plasma increases nesting and induces the differentiation of chondrocytes cultured on stabilized porous chitosan scaffolds.

  20. Silk scaffolds in bone tissue engineering: An overview.

    Science.gov (United States)

    Bhattacharjee, Promita; Kundu, Banani; Naskar, Deboki; Kim, Hae-Won; Maiti, Tapas K; Bhattacharya, Debasis; Kundu, Subhas C

    2017-11-01

    applications as cell scaffolding matrices to micro-nano carriers for delivering bone growth factors and therapeutic molecules to diseased or damaged sites to facilitate bone regeneration, is emphasized here. The review rationalizes that the choice of silk protein as a biomaterial is not only because of its natural polymeric nature, mechanical robustness, flexibility and wide range of cell compatibility but also because of its ability to template the growth of hydroxyapatite, the chief inorganic component of bone mineral matrix, resulting in improved osteointegration. The discussion extends to the role of inorganic ions such as Si and Ca as matrix components in combination with silk to influence bone regrowth. The effect of ions or growth factor-loaded vehicle incorporation into regenerative matrix, nanotopography is also considered. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Rossini

    2016-08-01

    Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

  2. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  3. Effect of Drive Row Ground Covers on Hop (Rosales: Cannabaceae) Yard Arthropod Pests in Vermont, USA.

    Science.gov (United States)

    Calderwood, L; Cubins, J; Vesty, D; Darby, H

    2017-04-01

    Alternatives to pesticides are necessary for the management of hop (Humulus lupulus L.) arthropod pests. The three major arthropod pests in northeastern US hop production include two-spotted spider mite, Tetranychus urticae Koch, hop aphid Phorodon humuli (Schrank), and potato leafhopper, Empoasca fabae Harris. This 3-yr study (2012-2014) in Vermont investigated the effect of flowering ground covers on arthropod pest abundance. Hop cultivars 'Nugget' and 'Cascade' were evaluated under a strip-split plot experimental design. Ground cover treatments included 1) Control: mowed red clover (Trifolium pratense) and resident weeds, 2) Clover: red clover, and 3) Diverse: common yarrow (Achillea millefolium), beebalm (Monarda fistulosa), red clover, and annual sunflower (Helianthus annuus). Natural enemies were grouped by associated pest and indicated by our mixed model to be strong predictors of the number of hop aphid and potato leafhopper on hop plants. In year two, ground cover treatment had a significant effect on two-spotted spider mite abundance where fewer two-spotted spider mite were observed on hop plants in Diverse plots. The established, un-mowed Clover treatment was preferred by potato leafhopper over Diverse ground cover and hop plants. This revealed the potential for clover ground cover to serve as a trap crop for potato leafhopper management in northeastern hop yards. Our findings are evidence that ground covers implemented for conservation biological control may serve more specific pest management functions instead of or in addition to boosting top-down pest pressure. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Enhanced bioactive scaffolds for bone tissue regeneration

    Science.gov (United States)

    Karnik, Sonali

    Bone injuries are commonly termed as fractures and they vary in their severity and causes. If the fracture is severe and there is loss of bone, implant surgery is prescribed. The response to the implant depends on the patient's physiology and implant material. Sometimes, the compromised physiology and undesired implant reactions lead to post-surgical complications. [4, 5, 20, 28] Efforts have been directed towards the development of efficient implant materials to tackle the problem of post-surgical implant failure. [ 15, 19, 24, 28, 32]. The field of tissue engineering and regenerative medicine involves the use of cells to form a new tissue on bio-absorbable or inert scaffolds. [2, 32] One of the applications of this field is to regenerate the damaged or lost bone by using stem cells or osteoprogenitor cells on scaffolds that can integrate in the host tissue without causing any harmful side effects. [2, 32] A variety of natural, synthetic materials and their combinations have been used to regenerate the damaged bone tissue. [2, 19, 30, 32, 43]. Growth factors have been supplied to progenitor cells to trigger a sequence of metabolic pathways leading to cellular proliferation, differentiation and to enhance their functionality. [56, 57] The challenge persists to supply these proteins, in the range of nano or even picograms, and in a sustained fashion over a period of time. A delivery system has yet to be developed that would mimic the body's inherent mechanism of delivering the growth factor molecules in the required amount to the target organ or tissue. Titanium is the most preferred metal for orthopedic and orthodontic implants. [28, 46, 48] Even though it has better osteogenic properties as compared to other metals and alloys, it still has drawbacks like poor integration into the surrounding host tissue leading to bone resorption and implant failure. [20, 28, 35] It also faces the problem of postsurgical infections that contributes to the implant failure. [26, 37

  5. Climbing the scaffolds of Parkinson's disease pathogenesis.

    Science.gov (United States)

    Spencer, Brian; Crews, Leslie; Masliah, Eliezer

    2007-02-15

    Several neurodegenerative disorders, including Parkinson's and Alzheimer's diseases, are characterized neuropathologically by accumulation of misfolded proteins such as alpha-synuclein that disrupts scaffold molecules in the caveolae. A new study by Ihara et al. in this issue of Neuron shows that a novel scaffold protein, Sept4, may be an important player in modulating the pathological alterations of alpha-synuclein in models of Parkinson's disease, suggesting that gene therapies targeting scaffold proteins might be effective in the treatment of neurodegenerative disorders.

  6. Oriented Collagen Scaffolds for Tissue Engineering

    OpenAIRE

    Shohta Kodama; Taro Saku; Hiroshi Mikami; Go Kuwahara; Toru Kosaka; Yoshihiro Isobe

    2012-01-01

    Oriented collagen scaffolds were developed in the form of sheet, mesh and tube by arraying flow-oriented collagen string gels and dehydrating the arrayed gels. The developed collagen scaffolds can be any practical size with any direction of orientation for tissue engineering applications. The birefringence of the collagen scaffolds was quantitatively analyzed by parallel Nicols method. Since native collagen in the human body has orientations such as bone, cartilage, tendon and cornea, and the...

  7. Synergistic effect of scaffold composition and dynamic culturing environment in multilayered systems for bone tissue engineering.

    Science.gov (United States)

    Rodrigues, Márcia T; Martins, Albino; Dias, Isabel R; Viegas, Carlos A; Neves, Nuno M; Gomes, Manuela E; Reis, Rui L

    2012-11-01

    Bone extracellular matrix (ECM) is composed of mineralized collagen fibrils which support biological apatite nucleation that participates in bone outstanding properties. Understanding and mimicking bone morphological and physiological parameters at a biological scale is a major challenge in tissue engineering scaffolding. Using emergent (nano)technologies scaffold designing may be critically improved, enabling highly functional tissue substitutes for bone applications. This study aims to develop novel biodegradable composite scaffolds of tricalcium phosphate (TCPs) and electrospun nanofibers of poly(ϵ-caprolactone) (PCL), combining TCPs osteoconductivity with PCL biocompatibility and elasticity, mimicking bone structure and composition. We hypothesized that scaffolds with such structure/composition would stimulate the proliferation and differentiation of bone marrow stromal cells (BMSCs) towards the osteogenic phenotype. Composite scaffolds, developed by electrospining using consecutive stacked layers of PCL and TCPs, were characterized by FTIR spectroscopy, X-Ray diffraction and scanning electronic microscopy. Cellular behavior was assessed in goat BMSCs seeded onto composite scaffolds and cultured in static or dynamic conditions, using basal or osteogenic media during 7, 14 or 21 days. Cellular proliferation was quantified and osteogenic differentiation confirmed by alkaline phosphatase activity, alizarin red staining and immunocytochemistry for osteocalcin and collagen I. Results suggest that PCL-TCP scaffolds provide a 3D support for gBMSCs proliferation and osteogenic differentiation with production of ECM. TCPs positively stimulate the osteogenic process, especially under dynamic conditions, where PCL-TCP scaffolds are sufficient to promote osteogenic differentiation even in basal medium conditions. The enhancement of the osteogenic potential in dynamic conditions evidences the synergistic effect of scaffold composition and dynamic stimulation in g

  8. Biofunctional Ionic-Doped Calcium Phosphates: Silk Fibroin Composites for Bone Tissue Engineering Scaffolding.

    Science.gov (United States)

    Pina, S; Canadas, R F; Jiménez, G; Perán, M; Marchal, J A; Reis, R L; Oliveira, J M

    2017-01-01

    The treatment and regeneration of bone defects caused by traumatism or diseases have not been completely addressed by current therapies. Lately, advanced tools and technologies have been successfully developed for bone tissue regeneration. Functional scaffolding materials such as biopolymers and bioresorbable fillers have gained particular attention, owing to their ability to promote cell adhesion, proliferation, and extracellular matrix production, which promote new bone growth. Here, we present novel biofunctional scaffolds for bone regeneration composed of silk fibroin (SF) and β-tricalcium phosphate (β-TCP) and incorporating Sr, Zn, and Mn, which were successfully developed using salt-leaching followed by a freeze-drying technique. The scaffolds presented a suitable pore size, porosity, and high interconnectivity, adequate for promoting cell attachment and proliferation. The degradation behavior and compressive mechanical strengths showed that SF/ionic-doped TCP scaffolds exhibit improved characteristics for bone tissue engineering when compared with SF scaffolds alone. The in vitro bioactivity assays using a simulated body fluid showed the growth of an apatite layer. Furthermore, in vitro assays using human adipose-derived stem cells presented different effects on cell proliferation/differentiation when varying the doping agents in the biofunctional scaffolds. The incorporation of Zn into the scaffolds led to improved proliferation, while the Sr- and Mn-doped scaffolds presented higher osteogenic potential as demonstrated by DNA quantification and alkaline phosphatase activity. The combination of Sr with Zn led to an influence on cell proliferation and osteogenesis when compared with single ions. Our results indicate that biofunctional ionic-doped composite scaffolds are good candidates for further in vivo studies on bone tissue regeneration. © 2017 S. Karger AG, Basel.

  9. [Preparation and characteristics of non-woven silk fibroin/nano-hydroxyapatite scaffolds].

    Science.gov (United States)

    Zhao, Yong; Li, Gang; Chen, Jing; Chen, Zhi-Qing

    2008-04-01

    The aim of the present study was to design and fabricate a three dimensional (3D) porous structure of silk fibroin/apatite used as a potential scaffold in bone tissue engineering. With the combining use of non-woven silk fibroin net and biomimetic method, porous non-woven silk fibroin/nano-hydroxyapatite net (NSF/nHAP) was prepared and characterized with X-ray diffraction (XRD), scanning electron microscope (SEM) and fourier transform infrared spectroscopy (FTIR). The porosity and swelling ratio of the 3D scaffold were also measured. Besides, the osteoblasts from the cranium of new born SD rat were cultured on the pre-fabricated scaffold to evaluate the biological reaction of the scaffold. The nano-sized hydroxyapatite crystals were needle-like with the length of 100-300 nm and the diameter of 20-60 nm. The scaffold fabricated in the present study exhibited the porous microstructure with open porosity around 70%-78%. Its average pore size was about (163.4 +/- 42.6) microm. The swelling ratio and water uptaking were 4.56% and 81.93%, respectively, which revealed that the 3D porous scaffold had an excellent hydrophilicity. The rod-shaped apatite crystals could rapidly form on the surface of fibroin fibers throughout the network by immersing the net into calcium and phosphate solutions alternatively. A 3D porous NSF/nHAP scaffold can be fabricated by biomimetic mineralization and none-woven silk fibroin method. The novel NSF/nHAP scaffold has an excellent cytocompatibility for the growth of osteoblasts. Porous NSF/nHAP scaffold may be a hopeful biomaterial used in bone tissue engineering.

  10. Mott and Efros-Shklovskii hopping conductions in porous silicon nanostructures

    Science.gov (United States)

    Islam, Md. Nazrul; Ram, Sanjay K.; Kumar, Satyendra

    2009-05-01

    Electrical conductivity of electrochemically etched porous silicon was studied over a wide temperature range from 15 to 450 K. Applicability of various electrical transport mechanisms has been critically analyzed. While the conductivity data above room temperature shows extended state conduction, lowering the temperature leads to Berthelot-type conduction (180-280 K). Further, Mott's hopping (in the range 140-180 K) and Efros-Shklovskii hopping (below 120 K) conduction are found to be operating in lower temperature ranges. A clear crossover from Mott to Efros-Shklovskii variable range hopping transport is observed at low temperatures.

  11. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer

    2016-07-28

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

  12. High temperature electrical conductivity due to small polaron hopping motion in DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Triberis, G P [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Karavolas, V C [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Simserides, C D [University of Athens, Physics Department, Solid State Section, Panepistimiopolis, 15784 Zografos, Athens (Greece); Leibniz Institute for Neurobiology, Special Lab for Non-Invasing Brain Imaging, Brenneckestr. 6, D-39118 Magdeburg (Germany)

    2005-01-01

    We present a small polaron hopping model to interpret the high-temperature electrical conductivity measured along the DNA molecules. The model takes into account the one-dimensional character of the system and the presence of disorder in the DNA double helix. The experimental data for the lambda phage DNA ({lambda}-DNA) and the poly(dA)-poly(dT) DNA follow nicely the theoretically predicted behavior leading to realistic values of the maximum hopping distances supporting the idea of multiphonon-assisted hopping of small polarons between next nearest neighbors of the DNA molecular 'wire'.

  13. Oriented Collagen Scaffolds for Tissue Engineering

    Science.gov (United States)

    Isobe, Yoshihiro; Kosaka, Toru; Kuwahara, Go; Mikami, Hiroshi; Saku, Taro; Kodama, Shohta

    2012-01-01

    Oriented collagen scaffolds were developed in the form of sheet, mesh and tube by arraying flow-oriented collagen string gels and dehydrating the arrayed gels. The developed collagen scaffolds can be any practical size with any direction of orientation for tissue engineering applications. The birefringence of the collagen scaffolds was quantitatively analyzed by parallel Nicols method. Since native collagen in the human body has orientations such as bone, cartilage, tendon and cornea, and the orientation has a special role for the function of human organs, the developed various types of three-dimensional oriented collagen scaffolds are expected to be useful biomaterials for tissue engineering and regenerative medicines. PMID:28817059

  14. Platelet lysate embedded scaffolds for skin regeneration.

    Science.gov (United States)

    Sandri, Giuseppina; Bonferoni, Maria Cristina; Rossi, Silvia; Ferrari, Franca; Mori, Michela; Cervio, Marila; Riva, Federica; Liakos, Ioannis; Athanassiou, Athanassia; Saporito, Francesca; Marini, Lara; Caramella, Carla

    2015-04-01

    The work presents the development of acellular scaffolds extemporaneously embedded with platelet lysate (PL), as an innovative approach in the field of tissue regeneration/reparation. PL embedded scaffolds should have a tridimensional architecture to support cell migration and growth, in order to restore skin integrity. For this reason, chondroitin sulfate (CS) was associated with sodium alginate (SA) to prepare highly porous systems. The developed scaffolds were characterized for chemical stability to γ-radiation, morphology, hydration and mechanical properties. Moreover, the capability of fibroblasts and endothelial cells to populate the scaffold was evaluated by means of proliferation test 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and confocal laser scanning microscopy study. The scaffolds, not altered by sterilization, were characterized by limited swelling and high flexibility, by foam-like structure with bubbles that formed a high surface area and irregular texture suitable for cell adhesion. Cell growth and scaffold population were evident on the bubble surface, where the cells appeared anchored to the scaffold structure. Scaffold network based on CS and SA demonstrated to be an effective support to enhance and to allow fibroblasts and endothelial cells (human umbilical vein endothelial cells, HUVEC) adhesion and proliferation. In particular, it could be hypothesized that cell adhesion was facilitated by the synergic effect of PL and CS. Although further in vivo evaluation is needed, on the basis of in vitro results, PL embedded scaffolds seem promising systems for skin wound healing.

  15. Oriented Collagen Scaffolds for Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Shohta Kodama

    2012-03-01

    Full Text Available Oriented collagen scaffolds were developed in the form of sheet, mesh and tube by arraying flow-oriented collagen string gels and dehydrating the arrayed gels. The developed collagen scaffolds can be any practical size with any direction of orientation for tissue engineering applications. The birefringence of the collagen scaffolds was quantitatively analyzed by parallel Nicols method. Since native collagen in the human body has orientations such as bone, cartilage, tendon and cornea, and the orientation has a special role for the function of human organs, the developed various types of three-dimensional oriented collagen scaffolds are expected to be useful biomaterials for tissue engineering and regenerative medicines.

  16. Oriented Collagen Scaffolds for Tissue Engineering.

    Science.gov (United States)

    Isobe, Yoshihiro; Kosaka, Toru; Kuwahara, Go; Mikami, Hiroshi; Saku, Taro; Kodama, Shohta

    2012-03-16

    Oriented collagen scaffolds were developed in the form of sheet, mesh and tube by arraying flow-oriented collagen string gels and dehydrating the arrayed gels. The developed collagen scaffolds can be any practical size with any direction of orientation for tissue engineering applications. The birefringence of the collagen scaffolds was quantitatively analyzed by parallel Nicols method. Since native collagen in the human body has orientations such as bone, cartilage, tendon and cornea, and the orientation has a special role for the function of human organs, the developed various types of three-dimensional oriented collagen scaffolds are expected to be useful biomaterials for tissue engineering and regenerative medicines.

  17. Fabrication, characterization and cell cultures on a novel composite chitosan-nano-hydroxyapatite scaffold.

    Science.gov (United States)

    Palazzo, B; Gallo, A; Casillo, A; Nitti, P; Ambrosio, L; Piconi, C

    2011-01-01

    This paper deals with the characterizations made during the development of a nano-HAp loaded chitosan scaffold, obtained by the freeze-drying technique combined with a novel in situ crystal growth method. The nano-composites were characterized by a highly porous and interconnected structure. The XRD patterns and calculated domain sizes of the HAp nano-crystals nucleated on the chitosan scaffolds are very similar to the ones recorded for deproteinated bone apatite. Both osteoblasts (MG63) and mesenchimal cells (hMSC) were showing good proliferation and adhesion onto the scaffolds. The presence of extensive filopodia and excellent spreading in and around the interconnected porous structure, indicated a strong cellular adhesion and growth. Moreover a good hMSC osteogenic differentiation has been verified. The observations related to well-developed structure morphology, physicochemical properties and high cytocompatibility suggest that the obtained chitosan-nHA porous scaffolds are potential candidate materials for bone regeneration.

  18. Injectable scaffold materials differ in their cell instructive effects on primary human myoblasts

    DEFF Research Database (Denmark)

    Hejbøl, Eva Kildall; Sellathurai, Jeeva; Nair, Prabha Damodaran

    2017-01-01

    a minimally invasive technique. In this study, we examined in vitro the cell instructive effects of three types of injectable scaffolds, fibrin, alginate, and poly(lactic-co-glycolic acid)-based microparticles on primary human myoblasts. The myoblast morphology and progression in the myogenic program differed......, depending on the type of scaffold material. In alginate gel, the cells obtained a round morphology, they ceased to proliferate, and entered quiescence. In the fibrin gels, differentiation was promoted, and myotubes were observed within a few days in culture, while poly(lactic-co-glycolic acid......)-based microparticles supported prolonged proliferation. Myoblasts released from the alginate and fibrin gels were studied, and cells released from these scaffolds had retained the ability to proliferate and differentiate. Thus, the study shows that human myogenic cells combined with injectable scaffold materials...

  19. Drug delivery using composite scaffolds in the context of bone tissue engineering

    Science.gov (United States)

    Romagnoli, Cecilia; D’Asta, Federica; Brandi, Maria Luisa

    2013-01-01

    Summary Introduction Due to the disadvantages of the current bone autograft and allograft in many clinical condition in which bone regeneration is required in large quantity, engineered biomaterials combined with growth factors, such as bone morphogenetic protein-2 (BMP-2), have been demonstrated to be an effective approach in bone tissue engineering, since they can act both as a scaffold and as a drug delivery system to promote bone repair and regeneration. Area covered Recent advantages in the field of engineered scaffolds have been obtained from the investigation of composite scaffolds designed by the combination of bioceramics, especially hydroxyapatite (HA), and biodegradable polymers, such as poly (D,L-lactide-co-glycolide) (PLGA) and chitosan, in order to realize osteoconductive structures that can mimic the natural properties of bone tissue. Herein it is demonstrated that the incorporation of BMP-2 into different composite scaffolds, by encapsulation, absorption or entrapment, could be advantageous in terms of osteoinduction for new bone tissue engineered scaffolds as drug delivery systems and some of them should be further analyzed to optimized the drug release for future therapeutic applications. Expert opinion New design concepts and fabrication techniques represent novel challenges for further investigations about the development of scaffolds as a drug delivery system for bone tissue regeneration. PMID:24554923

  20. The effects of scaffold architecture and fibrin gel addition on tendon cell phenotype.

    Science.gov (United States)

    Pawelec, K M; Wardale, R J; Best, S M; Cameron, R E

    2015-01-01

    Development of tissue engineering scaffolds relies on careful selection of pore architecture and chemistry of the cellular environment. Repair of skeletal soft tissue, such as tendon, is particularly challenging, since these tissues have a relatively poor healing response. When removed from their native environment, tendon cells (tenocytes) lose their characteristic morphology and the expression of phenotypic markers. To stimulate tendon cells to recreate a healthy extracellular matrix, both architectural cues and fibrin gels have been used in the past, however, their relative effects have not been studied systematically. Within this study, a combination of collagen scaffold architecture, axial and isotropic, and fibrin gel addition was assessed, using ovine tendon-derived cells to determine the optimal strategy for controlling the proliferation and protein expression. Scaffold architecture and fibrin gel addition influenced tendon cell behavior independently in vitro. Addition of fibrin gel within a scaffold doubled cell number and increased matrix production for all architectures studied. However, scaffold architecture dictated the type of matrix produced by cells, regardless of fibrin addition. Axial scaffolds, mimicking native tendon, promoted a mature matrix, with increased tenomodulin, a marker for mature tendon cells, and decreased scleraxis, an early transcription factor for connective tissue. This study demonstrated that both architectural cues and fibrin gel addition alter cell behavior and that the combination of these signals could improve clinical performance of current tissue engineering constructs.

  1. Scaffolding in teacher-student interaction: a decade of research

    NARCIS (Netherlands)

    van de Pol, J.; Volman, M.; Beishuizen, J.

    2010-01-01

    Although scaffolding is an important and frequently studied concept, much discussion exists with regard to its conceptualizations, appearances, and effectiveness. Departing from the last decade’s scaffolding literature, this review scrutinizes these three areas of scaffolding. First, contingency,

  2. A justification for a nonadiabatic surface hopping Herman-Kluk semiclassical initial value representation of the time evolution operator.

    Science.gov (United States)

    Wu, Yinghua; Herman, Michael F

    2006-10-21

    A justification is given for the validity of a nonadiabatic surface hopping Herman-Kluk (HK) semiclassical initial value representation (SC-IVR) method. The method is based on a propagator that combines the single surface HK SC-IVR method [J. Chem. Phys. 84, 326 (1986)] and Herman's nonadiabatic semiclassical surface hopping theory [J. Chem. Phys. 103, 8081 (1995)], which was originally developed using the primitive semiclassical Van Vleck propagator. We show that the nonadiabatic HK SC-IVR propagator satisfies the time-dependent Schrodinger equation to the first order of variant Planck's over 2pi and the error is O(variant Planck's over 2pi(2)). As a required lemma, we show that the stationary phase approximation, under current assumptions, has an error term variant Planck's over 2pi(1) order higher than the leading term. Our derivation suggests some changes to the previous development, and it is shown that the numerical accuracy in applications to Tully's three model systems in low energies is improved.

  3. A fresh look at bioresorbable scaffold technology: Intuition pumps

    Directory of Open Access Journals (Sweden)

    Sundeep Mishra

    2017-01-01

    Full Text Available Bioresorbable scaffolds (BRS are a new enticing treatment option in coronary interventions. Absorb BVS™ Is the most widely used and researched polymer based BRS, eluting everolimus. However currently it has several technical limitations; low radial support, larger strut size, poor visualization, poor deliverability and complex implantation technique. Magnesium based BRS are an alternate but they are also limited not only by lower radial support and poor visualization but also earlier bio-absorption. Material processing: blow-molding, annealing, polymer orientation, change in composition and use of higher molecular weight polymer, as well new polymers like tyrosine or salicyclate analogs and even hybrid (polymer and metallic combined with intelligent cell design has led to evolution of BRS technology. Newer BRS has higher radial strength, lower strut thickness, improved visualization, ease of scaffold implantation as also optimal bio-resorption time.

  4. Evaluation of an injectable, photopolymerizable, and three-dimensional scaffold based on methacrylate-endcapped poly(D,L-lactide-co-epsilon-caprolactone) combined with autologous mesenchymal stem cells in a goat tibial unicortical defect model.

    Science.gov (United States)

    Vertenten, Geert; Lippens, Evi; Gironès, Jordi; Gorski, Tomasz; Declercq, Heidi; Saunders, Jimmy; Van den Broeck, Wim; Chiers, Koen; Duchateau, Luc; Schacht, Etiene; Cornelissen, Maria; Gasthuys, Frank; Vlaminck, Lieven

    2009-07-01

    An in situ crosslinkable, biodegradable, methacrylate-endcapped poly(D,L-lactide-co-epsilon-caprolactone) in which crosslinkage is achieved by photoinitiators was developed for bone tissue regeneration. Different combinations of the polymer with bone marrow-derived mesenchymal stem cells (BMSCs) and alpha-tricalcium phosphate (alpha-TCP) were tested in a unicortical tibial defect model in eight goats. The polymers were randomly applied in one of three defects (6.0 mm diameter) using a fourth unfilled defect as control. Biocompatibility and bone-healing characteristics were evaluated by serial radiographies, histology, histomorphometry, and immunohistochemistry. The results demonstrated cell survival and proliferation in the polymer-substituted bone defects. The addition of alpha-TCP was associated with less expansion and growth of the BMSCs than other polymer composites.

  5. The effects of next-to-nearest-neighbour hopping on Bose–Einstein ...

    Indian Academy of Sciences (India)

    - to-nearest-neighbour boson hopping (t ) energy on Bose–Einstein condensation in cubic lattices. We consider both non-interacting and repulsively interacting bosons moving in the lowest Bloch band. The interacting bosons are studied using ...

  6. You know what it is: learning words through listening to hip-hop.

    Science.gov (United States)

    Chesley, Paula

    2011-01-01

    Music listeners have difficulty correctly understanding and remembering song lyrics. However, results from the present study support the hypothesis that young adults can learn African-American English (AAE) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks, their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores. Additionally, participants were more likely to know an AAE vocabulary item if the hip-hop artists they listen to use the word in their song lyrics. Together, these results suggest that young adults can acquire vocabulary through exposure to hip-hop music, a finding relevant for research on vocabulary acquisition, the construction of adolescent and adult identities, and the adoption of lexical innovations.

  7. Juventud y comunicacion: reflexiones sobre practicas comunicativas de resistencia en la cultura hip hop de Medellin

    National Research Council Canada - National Science Library

    Garces Montoya, Angela

    2011-01-01

    ... de la apropiacion de medios de comunicacion alternativos. En este articulo se reconocen los desarrollos comunicativos en portales web y estudios de grabacion, apropiados por las culturas juveniles, en especial el movimiento hip hop de Medellin...

  8. Research on Improved DV-HOP Algorithm against Wormhole Attacks in WSN

    Directory of Open Access Journals (Sweden)

    Wang Xue-Wen

    2016-01-01

    Full Text Available The secure location of node is significant in the WSN (Wireless Sensor Networks of the troop frontier defence system. The wormhole attack is a big threat in the secure location. The credibility of the beacon node was used to determine the malicious nodes produced by wormhole attack in the WSN. The estimated method of multibeacon nodes was adopted to improve DV-HOP algorithm after excluding the malicious nodes. In this paper, we compared the basic DV-HOP algorithm and the improved DV-HOP algorithm in the coverage percentage and the error of network localization by simulating. The simulation results indicate that the improved DV-HOP algorithm makes the localization coverage percentage can reach 90% on a certain scale of the network, and it makes the error percentage lower when the number of beacons is different.

  9. You Know What It Is: Learning Words through Listening to Hip-Hop: e28248

    National Research Council Canada - National Science Library

    Paula Chesley

    2011-01-01

    ..., their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores...

  10. You know what it is: learning words through listening to hip-hop

    National Research Council Canada - National Science Library

    Chesley, Paula

    2011-01-01

    ..., their musical preferences, and their knowledge of popular culture. Results from the survey show a positive association between the number of hip-hop artists listened to and AAE comprehension vocabulary scores...

  11. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    Science.gov (United States)

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2017-04-04

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p hop (417 ± 106 vs 519 ± 102% limb length, p hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the

  12. You know what it is: learning words through listening to hip-hop

    National Research Council Canada - National Science Library

    Chesley, Paula

    2011-01-01

    ...) vocabulary from listening to hip-hop music. Non-African-American participants first gave free-response definitions to AAE vocabulary items, after which they answered demographic questions as well as questions addressing their social networks...

  13. HOP/NECC1, A Novel Regulator of Mouse Trophoblast Differentiation

    National Research Council Canada - National Science Library

    Kazuo Asanoma; Hidenori Kato; Shinichiro Yamaguchi; Chong Hyun Shin; Zhi-Ping Liu; Kiyoko Kato; Takafumi Inoue; Yoko Miyanari; Koji Yoshikawa; Kenzo Sonoda; Kotaro Fukushima; Norio Wake

    2007-01-01

    Homeodomain-only protein/not expressed in choriocarcinoma clone 1 (HOP/NECC1) is a newly identified gene that modifies the expression of cardiac-specific genes and thereby regulates heart development...

  14. STUDY ON THE EVOLUTION OF THE HOP MARKET IN ROMANIA DURING THE PERIOD 2007-2014

    Directory of Open Access Journals (Sweden)

    Irina - Adriana CHIURCIU

    2015-06-01

    Full Text Available The aim of this article is to present the evolution of hop market during the period 2007-2014 in Romania. It is based on the statistical data provided by the National Institute of Statistics and by the Ministry of Agriculture and Rural Development. The indicators used for processing the data are the following: the total production, the cultivated areas of hop and the quantity of hop imported and exported. From the analysis of the results obtained we can observe a decrease of 69.51% in 2012 from the total production in comparison with 2007. In the last years of the period in study, from 2012 to 2014, it increased by 104.4%. However the inland production is insufficient for the local beer industry. Romania has to import vast amounts of hops to ensure the brewers requirements across the country.

  15. Semiotic Scaffolding in Living Systems

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2008-01-01

    a diversity of levels. Such semiotic controls may be distinguished from ordinary deterministic control mechanisms through an inbuilt anticipatory capacity based on a distinct kind of causation that I call here "semiotic causation" to denote the bringing about of changes under the guidance of interpretation...... in a local .context. Anticipation through the skilled interpretation of indicators of temporal relations in the context of a particular survival project (or life strategy) guides organismic behavior towards local ends. This network of semiotic controls establishes an enormously complex semiotic scaffolding...

  16. A practice scaffolding interactive platform

    DEFF Research Database (Denmark)

    Bundsgaard, Jeppe

    2009-01-01

    A Practice Scaffolding Interactive Platform (PracSIP) is a social learning platform which supports students in collaborative project based learning by simulating a professional practice. A PracSIP puts the core tools of the simulated practice at the students' disposal, it organizes collaboration......, structures the students' activity, and interactively supports subject learning. A PracSIP facilitates students' development of complex competencies, and at the same time it supports the students' development of skills defined in the curriculum. The paper introduces the concept, presents the theoretical...... foundations, and gives an example of a PracSIP....

  17. Molecular Recognition within Synaptic Scaffolds

    DEFF Research Database (Denmark)

    Erlendsson, Simon

    domains, responsible for tethering their respective synaptic protein ligands. Therefore, understanding the specificity and binding mechanisms of PDZ domain proteins is essential to understand regulation of synaptic plasticity. PICK1 is a PDZ domain-containing scaffolding protein predominantly expressed...... and characterized in the postsynaptic neurons, where it is involved in regulating processes underlying LTP and LTD. However, PICK1 has also been found to interact with a wide range of other regulatory proteins, receptors and transporters, which implicates PICK1 in several processes important for proper synaptic...

  18. Acceleration of segmental bone regeneration in a rabbit model by strontium-doped calcium polyphosphate scaffold through stimulating VEGF and bFGF secretion from osteoblasts

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Zhipeng [College of Polymer Science and Engineering, Sichuan University, Chengdu 610065 (China); Suzhou Institute of Sichuan University, Suzhou 215123 (China); Zhang, Xu [College of Polymer Science and Engineering, Sichuan University, Chengdu 610065 (China); Li, Li [Department of Oncology, the 452 Hospital of Chinese PLA, Chengdu, Sichuan Province 610021 (China); Wang, Qiguang [College of Polymer Science and Engineering, Sichuan University, Chengdu 610065 (China); Yu, Xixun, E-mail: yuxixun@163.com [College of Polymer Science and Engineering, Sichuan University, Chengdu 610065 (China); Suzhou Institute of Sichuan University, Suzhou 215123 (China); Feng, Ting [The Joint Research Center of West China Second University Hospital of Sichuan University and University of Hong Kong, Chengdu 610041 (China)

    2013-01-01

    The development of suitable bioactive three-dimensional scaffold for the promotion of bone regeneration is critical in bone tissue engineering. The purpose of this study was to investigate in vivo osteogenesis of the porous strontium-doped calcium polyphosphate (SCPP) scaffolds for bone repair, as well as the relationship between osteogenic properties of SCPP scaffolds and the secretion of bFGF and VEGF from osteoblasts stimulated by SCPP. Besides, the advantages of scaffolds seeded with mesenchymal stem cells (MSCs) for bone repair were also studied. Firstly, the bone repair evaluation of scaffolds was performed on a rabbit segmental bony defects model over a period of 16 weeks by histology combined with X-ray microradiography. And then, in order to avoid the influence from the other factors such as hypoxia which emerge in vivo study and affect the secretion of VEGF and bFGF from host cells, human osteoblast-like cells (MG63) were seeded to SCPP, CPP and HA scaffolds in vitro to determine the ability of these scaffolds to stimulate the secretion of angiogenic growth factors (VEGF and bFGF) from MG63 and further explore the reason for the better osteogenic properties of SCPP scaffolds. The histological and X-ray microradiographic results showed that the SCPP scaffolds presented better osteogenic potential than CPP and HA scaffolds, when combined with MSCs, the SCPP scaffolds could further accelerate the bone repair. And the amounts of VEGF measured by ELISA assay in SCPP, CPP and HA groups after cultured for 7 days were about 364.989 pg/mL, 244.035 pg/mL and 232.785 pg/mL, respectively. Accordingly, the amounts of bFGF were about 27.085 pg/mL, 15.727 pg/mL and 8.326 pg/mL. The results revealed that the SCPP scaffolds significantly enhanced the bFGF and VEGF secretion compared with other scaffolds. The results presented in vivo and in vitro study demonstrated that the SCPP could accelerate bone formation through stimulating the secretion of VEGF and bFGF from

  19. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    OpenAIRE

    Chen Ying; Zhong Fei; Guo Shuxu

    2016-01-01

    To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS) is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require pr...

  20. Electron Tunneling and Hopping Possibilites in RuO2 Thick Films

    OpenAIRE

    Halder, N. C.

    1983-01-01

    It is proposed in this paper that the temperature coefficient of resistivity (TCR) in thick film resistors arises from (i) the usual particle-to-particle conduction, (ii) electron tunneling, and (iii) the phononassisted hopping. Equations for activation energies are derived for the temperature minimum of the resistance with and without hopping. New equations for TCR are suggested. Some extensive calculations of TCR and activation energy have been made for RuO2 thick film resistors, the result...

  1. Study of one-dimensional electron hopping and its effects on ESR line shape

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jau [Argonne National Lab., IL (United States); Dikshit, S.N. [Univ. of Chicago, IL (United States). Dept. of Chemistry; Norris, J.R. [Argonne National Lab., IL (United States)]|[Univ. of Chicago, IL (United States). Dept. of Chemistry

    1997-08-01

    Random hopping processes between discrete sites along a finite open chain or around a closed finite loop are examined. Closed form formulae are prescribed for the dependence of the ESR (electron spin resonance) line shape on the chain length and hopping rate. Significant differences between the closed loop and open chain are demonstrated. Deviation at short time from the results of diffusion in a continuum is presented.

  2. Measurement and Analysis of Single-Hop Delay on an IP Backbone Network

    OpenAIRE

    Papagiannaki, Konstantina; Moon, Sue; Fraleigh, Chuck; Thiran, Patrick; Diot, Christophe

    2003-01-01

    We measure and analyze the single-hop packet delay through operational routers in the Sprint Internet protocol (IP) backbone network. After presenting our delay measurements through a single router for OC-3 and OC-12 link speeds, we propose a methodology to identify the factors contributing to single-hop delay. In addition to packet processing, transmission, and queueing delay at the output link, we observe the presence of very large delays that cannot be explained within the context of a fir...

  3. Age-related muscle activation profiles and joint stiffness regulation in repetitive hopping

    OpenAIRE

    Hoffrén, Merja; Ishikawa, Masaki; Rantalainen, Timo; Avela, Janne; Komi, Paavo

    2011-01-01

    It is well documented that increasing effort during exercise is characterized by an increase in electromyographic activity of the relevant muscles. How aging influences this relationship is a matter of great interest. In the present study, nine young and 24 elderly subjects did repetitive hopping with maximal effort as well as with 50%, 65%, 75% and 90% intensities. During hopping joint kinematics were measured together with electromyographic activity (EMG) from the soleus, gastrocnemius medi...

  4. Effective one-dimensionality of universal ac hopping conduction in the extreme disorder limit

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    1996-01-01

    A phenomenological picture of ac hopping in the symmetric hopping model (regular lattice, equal site energies, random energy barriers) is proposed according to which conduction in the extreme disorder limit is dominated by essentially one-dimensional "percolation paths." Modeling a percolation pa...... as strictly one dimensional with a sharp jump rate cutoff leads to an expression for the universal ac conductivity that fits computer simulations in two and three dimensions better than the effective medium approximation....

  5. Scaffolding Mathematical Modelling with a Solution Plan

    Science.gov (United States)

    Schukajlow, Stanislaw; Kolter, Jana; Blum, Werner

    2015-01-01

    In the study presented in this paper, we examined the possibility to scaffold mathematical modelling with strategies. The strategies were prompted using an instrument called "solution plan" as a scaffold. The effects of this step by step instrument on mathematical modelling competency and on self-reported strategies were tested using…

  6. Scaffold Filling under the Breakpoint Distance

    Science.gov (United States)

    Jiang, Haitao; Zheng, Chunfang; Sankoff, David; Zhu, Binhai

    Motivated by the trend of genome sequencing without completing the sequence of the whole genomes, Muñoz et al. recently studied the problem of filling an incomplete multichromosomal genome (or scaffold) I with respect to a complete target genome G such that the resulting genomic distance between I' and G is minimized, where I' is the corresponding filled scaffold. We call this problem the one-sided scaffold filling problem. In this paper, we follow Muñoz et al. to investigate the scaffold filling problem under the breakpoint distance for the simplest unichromosomal genomes. When the input genome contains no gene repetition (i.e., is a fragment of a permutation), we show that the two-sided scaffold filling problem is polynomially solvable. However, when the input genome contains some genes which appear twice, even the one-sided scaffold filling problem becomes NP-complete. Finally, using the ideas for solving the two-sided scaffold filling problem under the breakpoint distance we show that the two-sided scaffold filling problem under the genomic/rearrangement distance is also polynomially solvable.

  7. Reasons for applying innovations for scaffolding work

    NARCIS (Netherlands)

    Jong, A.M. de; Molen, H. van der; Vink, P.; Eikhout, S.; Koningsveld, E.

    2003-01-01

    In this paper reasons for applying and for not applying technical and organisational innovations in scaffolding work are studied. In a participatory ergonomic approach these innovations were developed to reduce problems concerning physical load of scaffolders. In this study reasons for the adoption

  8. Teaching language teachers scaffolding professional learning

    CERN Document Server

    Maggioli, Gabriel Diaz

    2012-01-01

    Teaching Language Teachers: Scaffolding Professional Learning provides an updated view of as well as a reader-friendly introduction to the field of Teaching Teachers, with special reference to language teaching. By taking a decidedly Sociocultural perspective, the book addresses the main role of the Teacher of Teachers (ToT) as that of scaffolding the professional learning of aspiring teachers.

  9. Neural stem cell proliferation and differentiation in the conductive PEDOT-HA/Cs/Gel scaffold for neural tissue engineering.

    Science.gov (United States)

    Wang, Shuping; Guan, Shui; Xu, Jianqiang; Li, Wenfang; Ge, Dan; Sun, Changkai; Liu, Tianqing; Ma, Xuehu

    2017-09-26

    Engineering scaffolds with excellent electro-activity is increasingly important in tissue engineering and regenerative medicine. Herein, conductive poly(3,4-ethylenedioxythiophene) doped with hyaluronic acid (PEDOT-HA) nanoparticles were firstly synthesized via chemical oxidant polymerization. A three-dimensional (3D) PEDOT-HA/Cs/Gel scaffold was then developed by introducing PEDOT-HA nanoparticles into a chitosan/gelatin (Cs/Gel) matrix. HA, as a bridge, not only was used as a dopant, but also combined PEDOT into the Cs/Gel via chemical crosslinking. The PEDOT-HA/Cs/Gel scaffold was used as a conductive substrate for neural stem cell (NSC) culture in vitro. The results demonstrated that the PEDOT-HA/Cs/Gel scaffold had excellent biocompatibility for NSC proliferation and differentiation. 3D confocal fluorescence images showed cells attached on the channel surface of Cs/Gel and PEDOT-HA/Cs/Gel scaffolds with a normal neuronal morphology. Compared to the Cs/Gel scaffold, the PEDOT-HA/Cs/Gel scaffold not only promoted NSC proliferation with up-regulated expression of Ki67, but also enhanced NSC differentiation into neurons and astrocytes with up-regulated expression of β tubulin-III and GFAP, respectively. It is expected that this electro-active and bio-active PEDOT-HA/Cs/Gel scaffold will be used as a conductive platform to regulate NSC behavior for neural tissue engineering.

  10. Osteoconductivity and Biodegradability of Collagen Scaffold Coated with Nano-β-TCP and Fibroblast Growth Factor 2

    Directory of Open Access Journals (Sweden)

    Asako Ibara

    2013-01-01

    Full Text Available Nanoparticle bioceramics have become anticipated for biomedical applications. Highly bioactive and biodegradable scaffolds would be developed using nanoparticles of β-tricalcium phosphate (β-TCP. We prepared collagen scaffolds coated by nano-β-TCP and fibroblast growth factor 2 (FGF2 and evaluated the effects on new bone augmentation and biodegradation. The collagen sponge was coated with the nano-TCP dispersion and freeze-dried. Scaffold was characterized by SEM, TEM, XRD, compressive testing and cell seeding. Subsequently, the nano-β-TCP/collagen scaffold, collagen sponge, and each material loaded with FGF2 were implanted on rat cranial bone. As a control, no implantation was performed. Nano-TCP particles were found to be attached to the fibers of the collagen sponge by SEM and TEM observations. Scaffold coated with nano-TCP showed higher compressive strength and cytocompatibility. In histological evaluations at 10 days, inflammatory cells were rarely seen around the residual scaffold, suggesting that the nano-TCP material possesses good tissue compatibility. At 35 days, bone augmentation and scaffold degradation in histological samples receiving nano-β-TCP scaffold were significantly greater than those in the control. By loading of FGF2, advanced bone formation is facilitated, indicating that a combination with FGF2 would be effective for bone tissue engineering.

  11. Fabrication of triple-layered bifurcated vascular scaffold with a certain degree of three-dimensional structure

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Weijian; Yang, Yang; Pu, Huayan; Peng, Yan; Xin, Liming; Zhang, Yi; Sun, Yu

    2018-01-01

    Constructing vascular scaffolds is important in tissue engineering. However, scaffolds with characteristics such as multiple layers and a certain degree of spatial morphology still cannot be readily constructed by current vascular scaffolds fabrication techniques. This paper presents a three-layered bifurcated vascular scaffold with a curved structure. The technique combines 3D printed molds and casting hydrogel and fugitive ink to create vessel-mimicking constructs with customizable structural parameters. Compared with other fabrication methods, the technique can create more native-like 3D geometries. The diameter and wall thickness of the fabricated constructs can be independently controlled, providing a feasible approach for vascular scaffold construction. Enzymatically-crosslinked gelatin was used as the scaffold material. The morphology and mechanical properties were evaluated. Human umbilical cord derived endothelial cells (HUVECs) were seeded on the scaffolds and cultured for 72 h. Cell viability and morphology were assessed. The results showed that the proposed process had good application potentials, and will hopefully provide a feasible approach for constructing vascular scaffolds.

  12. Collagen Hydrogel Scaffold and Fibroblast Growth Factor-2 Accelerate Periodontal Healing of Class II Furcation Defects in Dog.

    Science.gov (United States)

    Momose, Takehito; Miyaji, Hirofumi; Kato, Akihito; Ogawa, Kosuke; Yoshida, Takashi; Nishida, Erika; Murakami, Syusuke; Kosen, Yuta; Sugaya, Tsutomu; Kawanami, Masamitsu

    2016-01-01

    Collagen hydrogel scaffold exhibits bio-safe properties and facilitates periodontal wound healing. However, regenerated tissue volume is insufficient. Fibroblast growth factor-2 (FGF2) up-regulates cell behaviors and subsequent wound healing. We evaluated whether periodontal wound healing is promoted by application of collagen hydrogel scaffold in combination with FGF2 in furcation defects in beagle dogs. Collagen hydrogel was fabricated from bovine type I collagen with an ascorbate-copper ion cross-linking system. Collagen hydrogel was mingled with FGF2 and injected into sponge-form collagen. Subsequently, FGF2 (50 µg)/collagen hydrogel scaffold and collagen hydrogel scaffold alone were implanted into class II furcation defects in dogs. In addition, no implantation was performed as a control. Histometric parameters were assessed at 10 days and 4 weeks after surgery. FGF2 application to scaffold promoted considerable cell and tissue ingrowth containing numerous cells and blood vessel-like structure at day 10. At 4 weeks, reconstruction of alveolar bone was stimulated by implantation of scaffold loaded with FGF2. Furthermore, periodontal attachment, consisting of cementum-like tissue, periodontal ligament-like tissue and Sharpey's fibers, was also repaired, indicating that FGF2-loaded scaffold guided self-assembly and then re-established the function of periodontal organs. Aberrant healing, such as ankylosis and root resorption, was not observed. FGF2-loaded collagen hydrogel scaffold possessed excellent biocompatibility and strongly promoted periodontal tissue engineering, including periodontal attachment re-organization.

  13. The Significance of Pore Microarchitecture in a Multi-Layered Elastomeric Scaffold for Contractile Cardiac Muscle Constructs

    Science.gov (United States)

    Park, H.; Larson, B.L.; Guillemette, M.D.; Jain, S.R.; Hua, C.; Engelmayr, G.C.; Freed, L.E.

    2010-01-01

    Multi-layered poly(glycerol sebacate) (PGS) scaffolds with controlled pore microarchitectures were fabricated, combined with heart cells, and cultured with perfusion to engineer contractile cardiac muscle constructs. First, one-layered (1L) scaffolds with accordion-like honeycomb shaped pores and elastomeric mechanical properties were fabricated by laser microablation of PGS membranes. Second, two-layered (2L) scaffolds with fully interconnected three dimensional pore networks were fabricated by oxygen plasma treatment of 1L scaffolds followed by stacking with off-set laminae to produce a tightly bonded composite. Third, heart cells were cultured on scaffolds with or without interstitial perfusion for 7 days. The laser-microablated PGS scaffolds exhibited ultimate tensile strength and strain-to-failure higher than normal adult rat left ventricular myocardium, and effective stiffnesses ranging from 220 to 290 kPa. The 7 day constructs contracted in response to electrical field stimulation. Excitation thresholds were unaffected by scaffold scale up from 1L to 2L. The 2L constructs exhibited reduced apoptosis, increased expression of connexin-43 (Cx-43) and matrix metalloprotease-2 (MMP-2) genes, and increased Cx-43 and cardiac troponin-I proteins when cultured with perfusion as compared to static controls. Together, these findings suggest that multi-layered, microfabricated PGS scaffolds may be applicable to myocardial repair applications requiring mechanical support, cell delivery and active implant contractility. PMID:21144580

  14. Development of aromatic hop compounds and bitterness in beer during room temperature- and cold storage based on three different hopping methods

    OpenAIRE

    Torgals, Ann Elisabeth

    2015-01-01

    The main objective of this study was to determine whether storage temperature or hopping method had influence on the aroma and bitterness in beer. The focus was set on the aroma that comes from hops, and not from yeast. The secondary objective to this study was to explore the development of the alcohol, CO2 and bitterness in the beer after priming and bottling. The thesis’ main perspective is that of home brewers, and to some extent that of microbreweries. Beer was brewed with 100 % pilsn...

  15. PHBV/PLLA-based composite scaffolds fabricated using an emulsion freezing/freeze-drying technique for bone tissue engineering: surface modification and in vitro biological evaluation.

    Science.gov (United States)

    Sultana, Naznin; Wang, Min

    2012-03-01

    Tissue engineering combines living cells with biodegradable materials and/or bioactive components. Composite scaffolds containing biodegradable polymers and nanosized osteoconductive bioceramic with suitable properties are promising for bone tissue regeneration. In this paper, based on blending two biodegradable and biocompatible polymers, namely poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV) and poly(L-lactic acid) (PLLA) with incorporated nano hydroxyapatite (HA), three-dimensional composite scaffolds with controlled microstructures and an interconnected porous structure, together with high porosity, were fabricated using an emulsion freezing/freeze-drying technique. The influence of various parameters involved in the emulsion freezing/freeze-drying technique was studied for the fabrication of good-quality polymer scaffolds based on PHBV polymers. The morphology, mechanical properties and crystallinity of PHBV/PLLA and HA in PHBV/PLLA composite scaffolds and PHBV polymer scaffolds were studied. The scaffolds were coated with collagen in order to improve wettability. During in vitro biological evaluation study, it was observed that SaOS-2 cells had high attachment on collagen-coated scaffolds. Significant improvement in cell proliferation and alkaline phosphatase activity for HA-incorporated composite scaffolds was observed due to the incorporation of HA. After 3 and 7 days of culture on all scaffolds, SaOS-2 cells also had normal morphology and growth. These results indicated that PHBV/PLLA-based scaffolds fabricated via an emulsion freezing/freeze-drying technique were favorable sites for osteoblastic cells and are promising for the applications of bone tissue engineering.

  16. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    Science.gov (United States)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  17. Random free energy barrier hopping model for ac conduction in chalcogenide glasses

    Directory of Open Access Journals (Sweden)

    Ram Murti

    2016-03-01

    Full Text Available The random free energy barrier hopping model is proposed to explain the ac conductivity (σac of chalcogenide glasses. The Coulomb correlation is consistently accounted for in the polarizability and defect distribution functions and the relaxation time is augmented to include the overlapping of hopping particle wave functions. It is observed that ac and dc conduction in chalcogenides are due to same mechanism and Meyer-Neldel (MN rule is the consequence of temperature dependence of hopping barriers. The exponential parameter s is calculated and it is found that s is subjected to sample preparation and measurement conditions and its value can be less than or greater than one. The calculated results for a − Se, As2S3, As2Se3 and As2Te3 are found in close agreement with the experimental data. The bipolaron and single polaron hopping contributions dominates at lower and higher temperatures respectively and in addition to high energy optical phonons, low energy optical and high energy acoustic phonons also contribute to the hopping process. The variations of hopping distance with temperature is also studied. The estimated defect number density and static barrier heights are compared with other existing calculations.

  18. Condom use and hip hop culture: the case of urban young men in New York City.

    Science.gov (United States)

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  19. No evidence hip joint angle modulates intrinsically produced stretch reflex in human hopping.

    Science.gov (United States)

    Gibson, W; Campbell, A; Allison, G

    2013-09-01

    Motor output in activities such as walking and hopping is suggested to be mediated neurally by purported stretch reflex augmentation of muscle output. Reflex EMG activity during these tasks has been frequently investigated in the soleus muscle; with alterations in reflex amplitude being associated with changes in hip joint angle/phase of the gait cycle. Previous work has focussed on reflex activity induced by an artificial perturbation or by induction of H-reflexes. As such, it is currently unknown if stretch reflex activity induced intrinsically (as part of the task) is modulated by changes in hip joint angle. This study investigated whether hip joint angle modulated reflex EMG 'burst' activity during a hopping task performed on a custom-built partially reclined sleigh. Ten subjects participated; EMG and kinematic data (VICON motor capture system) was collected for each hop cycle. Participants completed 5 sets of 30s of self-paced hopping in (1) hip neutral and (2) hip 60° flexion conditions. There was no difference in EMG 'burst' activity or in sagittal plane kinematics (knee/ankle) in the hopping task between the two conditions. The results indicate that during a functional task such as hopping, changes in hip angle do not alter the stretch reflex-like activity associated with landing. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. The potential of encapsulating "raw materials" in 3D osteochondral gradient scaffolds.

    Science.gov (United States)

    Mohan, Neethu; Gupta, Vineet; Sridharan, Banupriya; Sutherland, Amanda; Detamore, Michael S

    2014-04-01

    Scaffolds with continuous gradients in material composition and bioactive signals enable a smooth transition of properties at the interface. Components like chondroitin sulfate (CS) and bioactive glass (BG) in 3D scaffolds may serve as "raw materials" for synthesis of new extracellular matrix (ECM), and may have the potential to completely or partially replace expensive growth factors. We hypothesized that scaffolds with gradients of ECM components would enable superior performance of engineered constructs. Raw material encapsulation altered the appearance, structure, porosity, and degradation of the scaffolds. They allowed the scaffolds to better retain their 3D structure during culture and provided a buffering effect to the cells in culture. Following seeding of rat mesenchymal stem cells, there were several instances where glycosaminoglycan (GAG), collagen, or calcium contents were higher with the scaffolds containing raw materials (CS or BG) than with those containing transforming growth factor (TGF)-β3 or bone morphogenetic protein (BMP)-2. It was also noteworthy that a combination of both CS and TGF-β3 increased the secretion of collagen type II. Moreover, cells seeded in scaffolds containing opposing gradients of CS/TGF-β3 and BG/BMP-2 produced clear regional variations in the secretion of tissue-specific ECM. The study demonstrated raw materials have the potential to create a favorable microenvironment for cells; they can significantly enhance the synthesis of certain extracellular matrix (ECM) components when compared to expensive growth factors; either alone or in combination with growth factors they can enhance the secretion of tissue specific matrix proteins. Raw materials are promising candidates that can be used to either replace or be used in combination with growth factors. Success with raw materials in lieu of growth factors could have profound implications in terms of lower cost and faster regulatory approval for more rapid translation of