WorldWideScience

Sample records for scaffold hopping combining

  1. Scaffold hopping in drug discovery using inductive logic programming.

    Science.gov (United States)

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  2. SHOP: scaffold hopping by GRID-based similarity searches

    DEFF Research Database (Denmark)

    Bergmann, Rikke; Linusson, Anna; Zamora, Ismael

    2007-01-01

    A new GRID-based method for scaffold hopping (SHOP) is presented. In a fully automatic manner, scaffolds were identified in a database based on three types of 3D-descriptors. SHOP's ability to recover scaffolds was assessed and validated by searching a database spiked with fragments of known...... scaffolds were in the 31 top-ranked scaffolds. SHOP also identified new scaffolds with substantially different chemotypes from the queries. Docking analysis indicated that the new scaffolds would have similar binding modes to those of the respective query scaffolds observed in X-ray structures...

  3. Hops

    Science.gov (United States)

    ... The effectiveness ratings for HOPS are as follows:Body odor. Early research suggests that applying a deodorant that ... specific zinc salt to the underarm can reduce body odor. Insomnia. Some research suggests that taking a combination ...

  4. [A novel dipeptidyl peptidase IV inhibitors developed through scaffold hopping and drug splicing strategy].

    Science.gov (United States)

    Wang, Shan-Chun; Zeng, Li-Li; Ding, Yu-Yang; Zeng, Shao-Gao; Song, Hong-Rui; Hu, Wen-Hui; Xie, Hui

    2014-01-01

    Though all the marketed drugs of dipeptidyl peptidase IV inhibitors are structurally different, their inherent correlation is worthy of further investigation. Herein we rapidly discovered a novel DPP-IV inhibitor 8g (IC50 = 4.9 nmol.L-1) which exhibits as good activity and selectivity as the market drugs through scaffold hopping and drug splicing strategies based on alogliptin and linagliptin. This study demonstrated that the employment of classic medicinal chemistry strategy to the marketed drugs with specific target is an efficient approach to discover novel bioactive molecules.

  5. Scaffold Hopping Toward Agomelatine: Novel 3, 4-Dihydroisoquinoline Compounds as Potential Antidepressant Agents

    Science.gov (United States)

    Yang, Yang; Ang, Wei; Long, Haiyue; Chang, Ying; Li, Zicheng; Zhou, Liangxue; Yang, Tao; Deng, Yong; Luo, Youfu

    2016-10-01

    A scaffold-hopping strategy toward Agomelatine based on in silico screening and knowledge analysis was employed to design novel antidepressant agents. A series of 3, 4-dihydroisoquinoline compounds were selected for chemical synthesis and biological assessment. Three compounds (6a-1, 6a-2, 6a-9) demonstrated protective effects on corticosterone-induced lesion of PC12 cells. Compound 6a-1 also displayed low inhibitory effects on the growth of HEK293 and L02 normal cells and it was further evaluated for its potential antidepressant effects in vivo. The forced swim test (FST) results revealed that compound 6a-1 remarkably reduced the immobility time of rats and the open field test (OFT) results indicated a better general locomotor activity of the rats treated with compound 6a-1 than those with Agomelatine or Fluoxetine. Mechanism studies implied that compound 6a-1 can significantly reduce PC12 cell apoptosis by up-regulation of GSH and down-regulation of ROS in corticosterone-induced lesion of PC12 cells. Meanwhile, the down-regulation of calcium ion concentration and up-regulation of BDNF level in PC12 cells may account for the neuroprotective effects. Furthermore, compound 6a-1 can increase cell survival and cell proliferation, promote cell maturation in the rat hippocampus after chronic treatment. The acute toxicity data in vivo indicated compound 6a-1 exhibited less hepatotoxicity than Agomelatine.

  6. Similarity searching and scaffold hopping in synthetically accessible combinatorial chemistry spaces.

    Science.gov (United States)

    Boehm, Markus; Wu, Tong-Ying; Claussen, Holger; Lemmen, Christian

    2008-04-24

    Large collections of combinatorial libraries are an integral element in today's pharmaceutical industry. It is of great interest to perform similarity searches against all virtual compounds that are synthetically accessible by any such library. Here we describe the successful application of a new software tool CoLibri on 358 combinatorial libraries based on validated reaction protocols to create a single chemistry space containing over 10 (12) possible products. Similarity searching with FTrees-FS allows the systematic exploration of this space without the need to enumerate all product structures. The search result is a set of virtual hits which are synthetically accessible by one or more of the existing reaction protocols. Grouping these virtual hits by their synthetic protocols allows the rapid design and synthesis of multiple follow-up libraries. Such library ideas support hit-to-lead design efforts for tasks like follow-up from high-throughput screening hits or scaffold hopping from one hit to another attractive series.

  7. Discovery of a novel 2,4-dimethylquinoline-6-carboxamide M4 positive allosteric modulator (PAM) chemotype via scaffold hopping.

    Science.gov (United States)

    Long, Madeline F; Engers, Julie L; Chang, Sichen; Zhan, Xiaoyan; Weiner, Rebecca L; Luscombe, Vincent B; Rodriguez, Alice L; Cho, Hyekyung P; Niswender, Colleen M; Bridges, Thomas M; Conn, P Jeffrey; Engers, Darren W; Lindsley, Craig W

    2017-11-15

    This Letter details our efforts to replace the 3-amino moiety, an essential pharmacophore for M 4 PAM activity in most M 4 PAMs to date, within the thieno[2,3-b]pyridine core, as the β-amino carboxamide motif has been shown to engender poor solubility, varying degrees of P-gp efflux and represents a structural alert. A scaffold hopping exercise identified a novel 2,4-dimethylquinoline carboxamide core that provided M 4 PAM activity and good CNS penetration without an amino moiety. In addition, MacMillan photoredox catalysis chemistry was essential for construction of the 2,4-dimethylquinoline core. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Scaffold-hopping from xanthines to tricyclic guanines: A case study of dipeptidyl peptidase 4 (DPP4) inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Pissarnitski, Dmitri A.; Zhao, Zhiqiang; Cole, David; Wu, Wen-Lian; Domalski, Martin; Clader, John W.; Scapin, Giovanna; Voigt, Johannes; Soriano, Aileen; Kelly, Theresa; Powles, Mary Ann; Yao, Zuliang; Burnett, Duane A. (Merck)

    2016-11-01

    Molecular modeling of unbound tricyclic guanine scaffolds indicated that they can serve as effective bioisosteric replacements of xanthines. This notion was further confirmed by a combination of X-ray crystallography and SAR studies, indicating that tricyclic guanine DPP4 inhibitors mimic the binding mode of xanthine inhibitors, exemplified by linagliptin. Realization of the bioisosteric relationship between these scaffolds potentially will lead to a wider application of cyclic guanines as xanthine replacements in drug discovery programs for a variety of biological targets. Newly designed DPP4 inhibitors achieved sub-nanomolar potency range and demonstrated oral activity in vivo in mouse glucose tolerance test.

  9. Improved Intelligent Underlay-Overlay Combined with Frequency Hopping in GSM

    DEFF Research Database (Denmark)

    Wigard, Jeroen; Nielsen, Thomas Toftegaard; Mogensen, Preben Elgaard

    1997-01-01

    IUO (intelligent underlay-overlay) in a combination with random frequency hopping in GSM is analysed. Several improvements to the original IUO concept analysed in Nielsen et al. (1997) are introduced. With the improved IUO concept it is possible to load a network configuration consisting of 4...

  10. Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation

  11. Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential NNRTIs.

    Science.gov (United States)

    Babkov, Denis A; Valuev-Elliston, Vladimir T; Paramonova, Maria P; Ozerov, Alexander A; Ivanov, Alexander V; Chizhov, Alexander O; Khandazhinskaya, Anastasia L; Kochetkov, Sergey N; Balzarini, Jan; Daelemans, Dirk; Pannecouque, Christophe; Seley-Radtke, Katherine L; Novikov, Mikhail S

    2015-03-01

    In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Identification of Leishmania donovani Topoisomerase 1 inhibitors via intuitive scaffold hopping and bioisosteric modification of known Top 1 inhibitors

    Science.gov (United States)

    Mamidala, Rajinikanth; Majumdar, Papiya; Jha, Kunal Kumar; Bathula, Chandramohan; Agarwal, Rahul; Chary, M. Thirumala; Mazumdar, H. K.; Munshi, Parthapratim; Sen, Subhabrata

    2016-05-01

    A library of arylidenefuropyridinediones was discovered as potent inhibitors of Leishmania donovani Topoisomerase 1 (LdTop1) where the active molecules displayed considerable inhibition with single digit micromolar EC50 values. This molecular library was designed via intuitive scaffold hopping and bioisosteric modification of known topoisomerase 1 inhibitors such as camptothecin, edotecarin and etc. The design was rationalized by molecular docking analysis of the compound prototype with human topoisomerase 1 (HTop1) and Leishmania donovani topoisomerase 1(LdTop1). The most active compound 4 displayed no cytotoxicity against normal mammalian COS7 cell line (~100 fold less inhibition at the EC50). Similar to camptothecin, 4 interacted with free LdTop1 as observed in the preincubation DNA relaxation inhibition experiment. It also displayed anti-protozoal activity against Leishmania donovani promastigote. Crystal structure investigation of 4 and its molecular modelling with LdTop1 revealed putative binding sites in the enzyme that could be harnessed to generate molecules with better potency.

  13. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    Science.gov (United States)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  14. Combined Sector and Channel Hopping Schemes for Efficient Rendezvous in Directional Antenna Cognitive Radio Networks

    Directory of Open Access Journals (Sweden)

    AbdulMajid M. Al-Mqdashi

    2017-01-01

    Full Text Available Rendezvous is a prerequisite and important process for secondary users (SUs to establish data communications in cognitive radio networks (CRNs. Recently, there has been a proliferation of different channel hopping- (CH- based schemes that can provide rendezvous without relying on any predetermined common control channel. However, the existing CH schemes were designed with omnidirectional antennas which can degrade their rendezvous performance when applied in CRNs that are highly crowded with primary users (PUs. In such networks, the large number of PUs may lead to the inexistence of any common available channel between neighboring SUs which result in a failure of their rendezvous process. In this paper, we consider the utilization of directional antennas in CRNs for tackling the issue. Firstly, we propose two coprimality-based sector hopping (SH schemes that can provide efficient pairwise sector rendezvous in directional antenna CRNs (DIR-CRNs. Then, we propose an efficient CH scheme that can be combined within the SH schemes for providing a simultaneous sector and channel rendezvous. The guaranteed rendezvous of our schemes are proven by deriving the theoretical upper bounds of their rendezvous delay metrics. Furthermore, extensive simulation comparisons with other related rendezvous schemes are conducted to illustrate the significant outperformance of our schemes.

  15. Low-Complexity Combining Schemes in Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-07-18

    This paper investigates the performance of different low-complexity combining schemes in the context of dual-hop amplify-and-forward (AF) relaying networks. It is assumed that the relay uses single transmit (receive) antenna due to space limitation and to reduce the processing complexity. On the other hand, the transmitter and the receiver use antenna arrays to improve the overall diversity gain. However, this gain is achieved at the expense of increased processing complexity and power consumption. To this end, some combining schemes aiming at reducing the processing complexity and decreasing the number of active receive channels are investigated. Through the analysis, new formulas for the end-to-end signal-to-noise ratio (SNR) statistics in slowly varying and frequency flat Rayleigh fading channels are derived, which are then used to present some performance measures. Numerical and simulation results are presented to clarify the trade-off between the achieved diversity gain and the receive processing complexity. © 2011 IEEE.

  16. Combining technologies to create bioactive hybrid scaffolds for bone tissue engineering

    NARCIS (Netherlands)

    Nandakumar, A.; Barradas, A.M.C.; de Boer, Jan; Moroni, Lorenzo; van Blitterswijk, Clemens; Habibovic, Pamela

    2013-01-01

    Combining technologies to engineer scaffolds that can offer physical and chemical cues to cells is an attractive approach in tissue engineering and regenerative medicine. In this study, we have fabricated polymer-ceramic hybrid scaffolds for bone regeneration by combining rapid prototyping (RP),

  17. HOP: Achieving Efficient Anonymity in MANETs by Combining HIP, OLSR, and Pseudonyms

    Directory of Open Access Journals (Sweden)

    Campos Javier

    2011-01-01

    Full Text Available Offering secure and anonymous communications in mobile ad hoc networking environments is essential to achieve confidence and privacy, thus promoting widespread adoption of this kind of networks. In addition, some minimum performance levels must be achieved for any solution to be practical and become widely adopted. In this paper, we propose and implement HOP, a novel solution based on cryptographic Host Identity Protocol (HIP that offers security and user-level anonymity in MANET environments while maintaining good performance levels. In particular, we introduce enhancements to the authentication process to achieve Host Identity Tag (HIT relationship anonymity, along with source/destination HIT anonymity when combined with multihoming. Afterward we detail how we integrate our improved version of HIP with the OLSR routing protocol to achieve efficient support for pseudonyms. We implemented our proposal in an experimental testbed, and the results obtained show that performance levels achieved are quite good, and that the integration with OLSR is achieved with a low overhead.

  18. Metacognitive Scaffolding during Collaborative Learning: A Promising Combination

    Science.gov (United States)

    Molenaar, Inge; Sleegers, Peter; van Boxtel, Carla

    2014-01-01

    This article explores the effect of computerized scaffolding with different scaffolds (structuring vs. problematizing) on intra-group metacognitive interaction. In this study, we investigate 4 types of intra-group social metacognitive activities; namely ignored, accepted, shared and co-constructed metacognitive activities in 18 triads (6 control…

  19. Scaffold hopping from (5-hydroxymethyl) isophthalates to multisubstituted pyrimidines diminishes binding affinity to the C1 domain of protein kinase C.

    Science.gov (United States)

    Provenzani, Riccardo; Tarvainen, Ilari; Brandoli, Giulia; Lempinen, Antti; Artes, Sanna; Turku, Ainoleena; Jäntti, Maria Helena; Talman, Virpi; Yli-Kauhaluoma, Jari; Tuominen, Raimo K; Boije Af Gennäs, Gustav

    2018-01-01

    Protein kinase C (PKC) isoforms play a pivotal role in the regulation of numerous cellular functions, making them extensively studied and highly attractive drug targets. Utilizing the crystal structure of the PKCδ C1B domain, we have developed hydrophobic isophthalic acid derivatives that modify PKC functions by binding to the C1 domain of the enzyme. In the present study, we aimed to improve the drug-like properties of the isophthalic acid derivatives by increasing their solubility and enhancing the binding affinity. Here we describe the design and synthesis of a series of multisubstituted pyrimidines as analogs of C1 domain-targeted isophthalates and characterize their binding affinities to the PKCα isoform. In contrast to our computational predictions, the scaffold hopping from phenyl to pyrimidine core diminished the binding affinity. Although the novel pyrimidines did not establish improved binding affinity for PKCα compared to our previous isophthalic acid derivatives, the present results provide useful structure-activity relationship data for further development of ligands targeted to the C1 domain of PKC.

  20. Combining technologies to create bioactive hybrid scaffolds for bone tissue engineering.

    Science.gov (United States)

    Nandakumar, Anandkumar; Barradas, Ana; de Boer, Jan; Moroni, Lorenzo; van Blitterswijk, Clemens; Habibovic, Pamela

    2013-01-01

    Combining technologies to engineer scaffolds that can offer physical and chemical cues to cells is an attractive approach in tissue engineering and regenerative medicine. In this study, we have fabricated polymer-ceramic hybrid scaffolds for bone regeneration by combining rapid prototyping (RP), electrospinning (ESP) and a biomimetic coating method in order to provide mechanical support and a physico-chemical environment mimicking both the organic and inorganic phases of bone extracellular matrix (ECM). Poly(ethylene oxide terephthalate)-poly(buthylene terephthalate) (PEOT/PBT) block copolymer was used to produce three dimensional scaffolds by combining 3D fiber (3DF) deposition, and ESP, and these constructs were then coated with a Ca-P layer in a simulated physiological solution. Scaffold morphology and composition were studied using scanning electron microscopy (SEM) coupled to energy dispersive X-ray analyzer (EDX) and Fourier Tranform Infrared Spectroscopy (FTIR). Bone marrow derived human mesenchymal stromal cells (hMSCs) were cultured on coated and uncoated 3DF and 3DF + ESP scaffolds for up to 21 d in basic and mineralization medium and cell attachment, proliferation, and expression of genes related to osteogenesis were assessed. Cells attached, proliferated and secreted ECM on all the scaffolds. There were no significant differences in metabolic activity among the different groups on days 7 and 21. Coated 3DF scaffolds showed a significantly higher DNA amount in basic medium at 21 d compared with the coated 3DF + ESP scaffolds, whereas in mineralization medium, the presence of coating in 3DF+ESP scaffolds led to a significant decrease in the amount of DNA. An effect of combining different scaffolding technologies and material types on expression of a number of osteogenic markers (cbfa1, BMP-2, OP, OC and ON) was observed, suggesting the potential use of this approach in bone tissue engineering.

  1. Human amniotic epithelial cells combined with silk fibroin scaffold in the repair of spinal cord injury

    Directory of Open Access Journals (Sweden)

    Ting-gang Wang

    2016-01-01

    Full Text Available Treatment and functional reconstruction after central nervous system injury is a major medical and social challenge. An increasing number of researchers are attempting to use neural stem cells combined with artificial scaffold materials, such as fibroin, for nerve repair. However, such approaches are challenged by ethical and practical issues. Amniotic tissue, a clinical waste product, is abundant, and amniotic epithelial cells are pluripotent, have low immunogenicity, and are not the subject of ethical debate. We hypothesized that amniotic epithelial cells combined with silk fibroin scaffolds would be conducive to the repair of spinal cord injury. To test this, we isolated and cultured amniotic epithelial cells, and constructed complexes of these cells and silk fibroin scaffolds. Implantation of the cell-scaffold complex into a rat model of spinal cord injury resulted in a smaller glial scar in the damaged cord tissue than in model rats that received a blank scaffold, or amniotic epithelial cells alone. In addition to a milder local immunological reaction, the rats showed less inflammatory cell infiltration at the transplant site, milder host-versus-graft reaction, and a marked improvement in motor function. These findings confirm that the transplantation of amniotic epithelial cells combined with silk fibroin scaffold can promote the repair of spinal cord injury. Silk fibroin scaffold can provide a good nerve regeneration microenvironment for amniotic epithelial cells.

  2. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

    Science.gov (United States)

    Liu, Zechang; Wang, Liping; Liu, Yumei

    2018-01-18

    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  3. Hydroxyapatite/polylactide biphasic combination scaffold loaded with dexamethasone for bone regeneration.

    Science.gov (United States)

    Son, Jun-Sik; Kim, Su-Gwan; Oh, Ji-Su; Appleford, Mark; Oh, Sunho; Ong, Joo L; Lee, Kyu-Bok

    2011-12-15

    This study presents a novel design of a ceramic/polymer biphasic combination scaffold that mimics natural bone structures and is used as a bone graft substitute. To mimic the natural bone structures, the outside cortical-like shells were composed of porous hydroxyapatite (HA) with a hollow interior using a polymeric template-coating technique; the inner trabecular-like core consisted of porous poly(D,L-lactic acid) (PLA) that was loaded with dexamethasone (DEX) and was directly produced using a particle leaching/gas forming technique to create the inner diameter of the HA scaffold. It was observed that the HA and PLA parts of the fabricated HA/PLA biphasic scaffold contained open and interconnected pore structures, and the boundary between both parts was tightly connected without any gaps. It was found that the structure of the combination scaffold was analogous to that of natural bone based on micro-computed tomography analysis. Additionally, the dense, uniform apatite layer was formed on the surface of the HA/PLA biphasic scaffold through a biomimetic process, and DEX was successfully released from the PLA of the biphasic scaffold over a 1-month period. This release caused human embryonic palatal mesenchyme cells to proliferate, differentiate, produce ECM, and form tissue in vitro. Therefore, it was concluded that this functionally graded scaffold is similar to natural bone and represents a potential bone-substitute material. Copyright © 2011 Wiley Periodicals, Inc.

  4. An Effective Hybrid Routing Algorithm in WSN: Ant Colony Optimization in combination with Hop Count Minimization

    Directory of Open Access Journals (Sweden)

    Ailian Jiang

    2018-03-01

    Full Text Available Low cost, high reliability and easy maintenance are key criteria in the design of routing protocols for wireless sensor networks (WSNs. This paper investigates the existing ant colony optimization (ACO-based WSN routing algorithms and the minimum hop count WSN routing algorithms by reviewing their strengths and weaknesses. We also consider the critical factors of WSNs, such as energy constraint of sensor nodes, network load balancing and dynamic network topology. Then we propose a hybrid routing algorithm that integrates ACO and a minimum hop count scheme. The proposed algorithm is able to find the optimal routing path with minimal total energy consumption and balanced energy consumption on each node. The algorithm has unique superiority in terms of searching for the optimal path, balancing the network load and the network topology maintenance. The WSN model and the proposed algorithm have been implemented using C++. Extensive simulation experimental results have shown that our algorithm outperforms several other WSN routing algorithms on such aspects that include the rate of convergence, the success rate in searching for global optimal solution, and the network lifetime.

  5. Polyurethane scaffold formation via a combination of salt leaching and thermally induced phase separation

    NARCIS (Netherlands)

    Heijkants, R. G. J. C.; van Calck, R. V.; van Tienen, T. G.; de Groot, J. H.; Pennings, A. J.; Buma, P.; Veth, R. P. H.; Schouten, A. J.

    2008-01-01

    Porous scaffolds have been made from two polyurethanes based on thermally induced phase separation of polymer dissolved in a DMSO/water mixture in combination with salt leaching. It is possible to obtain very porous foams with a very high interconnectivity. A major advantage of this method is that

  6. Tailorable Surface Morphology of 3D Scaffolds by Combining Additive Manufacturing with Thermally Induced Phase Separation.

    Science.gov (United States)

    Di Luca, Andrea; de Wijn, Joost R; van Blitterswijk, Clemens A; Camarero-Espinosa, Sandra; Moroni, Lorenzo

    2017-08-01

    The functionalization of biomaterials substrates used for cell culture is gearing towards an increasing control over cell activity. Although a number of biomaterials have been successfully modified by different strategies to display tailored physical and chemical surface properties, it is still challenging to step from 2D substrates to 3D scaffolds with instructive surface properties for cell culture and tissue regeneration. In this study, additive manufacturing and thermally induced phase separation are combined to create 3D scaffolds with tunable surface morphology from polymer gels. Surface features vary depending on the gel concentration, the exchanging temperature, and the nonsolvent used. When preosteoblasts (MC-3T3 cells) are cultured on these scaffolds, a significant increase in alkaline phosphatase activity is measured for submicron surface topography, suggesting a potential role on early cell differentiation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Electrospun fibrous scaffolds combined with nanoscale hydroxyapatite induce osteogenic differentiation of human periodontal ligament cells

    Directory of Open Access Journals (Sweden)

    Wu XN

    2014-08-01

    extended gradually with stretched filopodia, indicating an ability to fill the fiber pores. A Cell Counting Kit-8 assay showed that both scaffolds supported cell proliferation. However, real-time quantitative polymerase chain reaction analysis showed that expression of the bone-related markers, alkaline phosphatase and osteocalcin, was upregulated only on the COL/PCL/nHA-SBF scaffold, indicating that this scaffold had the ability to induce osteogenic differentiation of periodontal ligament cells. In this study, COL/PCL/nHA-SBF produced by electrospinning followed by biomimetic mineralization had combined electrospun fibers with nHA in it. This scaffold has good biocompatibility and osteoinductive ability as a result of the characteristics of nHA, so could be innovatively applied to periodontal tissue engineering as a potential scaffold. Keywords: nanoscale hydroxyapatite, electrospinning, periodontal ligament cells 

  8. The potential of chitosan combined with chicken shank collagen as scaffold on bone defect regeneration process in Rattus norvegicus

    Directory of Open Access Journals (Sweden)

    Fitria Rahmitasari

    2016-12-01

    Full Text Available Background: In the field of dentistry, alveolar bone damage can be caused by periodontal disease, traumatic injury due to tooth extraction, cyst enucleation, and tumor surgery. One of the ways to regenerate the bone defect is using graft scaffold. Thus, combination of chitosan and collagen can stimulate osteogenesis. Purpose: The aim of this study was to examine the potential of chitosan combined with chicken shank collagen on bone defect regeneration process. Method: Twelve Rattus norvegicus were prepared as animal models in this research. A bone defect was intentionally created at both of the right and left femoral bones of the models. Next, 24 samples were divided into four groups, namely Group 1 using chitosan – collagen scaffold (50:50, Group 2 using chitosan collagen-scaffold (80:20, Group 3 using chitosan scaffold only, and Control Group using 3% CMC-Na. On 14th day, those animals were sacrificed, and histopathological anatomy examination was conducted to observe osteoclast cells. In addition, immunohistochemistry examination was also performed to observe RANKL expressions. Result: There was a significant difference in RANKL expressions among the groups, except between Group 3 using chitosan scaffold only and control group (p value > 0.05. The highest expression of RANKL was found in Group 1 with chitosan – collagen scaffold (50:50, followed by Group 2 with chitosan-collagen scaffold (80:20. Moreover, there was also a significant difference in osteoclast generation, except between Group 1 using chitosan – collagen scaffold (50:50 and Group 2 using chitosan-collagen scaffold (80:20, p value 0.05. Less osteoclast was found in the groups using chitosan – collagen scaffold (Group 1 and Group 2. Conclusion: Combination of chitosan and chicken shank collagen scaffold can improve regeneration process of bone defect in Rattus novergicus animals through increasing of RANKL expressions, and decreasing of osteoclast.

  9. [Experimental study of tissue engineered cartilage construction using oriented scaffold combined with bone marrow mesenchymal stem cells in vivo].

    Science.gov (United States)

    Duan, Wei; Da, Hu; Wang, Wentao; Lü, Shangjun; Xiong, Zhuo; Liu, Jian

    2013-05-01

    To investigate the feasibility of fabricating an oriented scaffold combined with chondrogenic-induced bone marrow mesenchymal stem cells (BMSCs) for enhancement of the biomechanical property of tissue engineered cartilage in vivo. Temperature gradient-guided thermal-induced phase separation was used to fabricate an oriented cartilage extracellular matrix-derived scaffold composed of microtubules arranged in parallel in vertical section. No-oriented scaffold was fabricated by simple freeze-drying. Mechanical property of oriented and non-oriented scaffold was determined by measurement of compressive modulus. Oriented and non-oriented scaffolds were seeded with chondrogenic-induced BMSCs, which were obtained from the New Zealand white rabbits. Proliferation, morphological characteristics, and the distribution of the cells on the scaffolds were analyzed by MTT assay and scanning electron microscope. Then cell-scaffold composites were implanted subcutaneously in the dorsa of nude mice. At 2 and 4 weeks after implantation, the samples were harvested for evaluating biochemical, histological, and biomechanical properties. The compressive modulus of oriented scaffold was significantly higher than that of non-oriented scaffold (t=201.099, P=0.000). The cell proliferation on the oriented scaffold was significantly higher than that on the non-oriented scaffold from 3 to 9 days (P fibers with chondrocyte-like cells on the oriented-structure constructs. Total DNA, glycosaminoglycan (GAG), and collagen contents increased with time, and no significant difference was found between 2 groups (P > 0.05). The compressive modulus of the oriented tissue engineered cartilage was significantly higher than that of the non-oriented tissue engineered cartilage at 2 and 4 weeks after implantation (P < 0.05). Total DNA, GAG, collagen contents, and compressive modulus in the 2 tissue engineered cartilages were significantly lower than those in normal cartilage (P < 0.05). Oriented extracellular

  10. Electrospun PLLA nanofiber scaffolds and their use in combination with BMP-2 for reconstruction of bone defects.

    Directory of Open Access Journals (Sweden)

    Markus D Schofer

    Full Text Available Adequate migration and differentiation of mesenchymal stem cells is essential for regeneration of large bone defects. To achieve this, modern graft materials are becoming increasingly important. Among them, electrospun nanofiber scaffolds are a promising approach, because of their high physical porosity and potential to mimic the extracellular matrix (ECM.The objective of the present study was to examine the impact of electrospun PLLA nanofiber scaffolds on bone formation in vivo, using a critical size rat calvarial defect model. In addition we analyzed whether direct incorporation of bone morphogenetic protein 2 (BMP-2 into nanofibers could enhance the osteoinductivity of the scaffolds. Two critical size calvarial defects (5 mm were created in the parietal bones of adult male Sprague-Dawley rats. Defects were either (1 left unfilled, or treated with (2 bovine spongiosa, (3 PLLA scaffolds alone or (4 PLLA/BMP-2 scaffolds. Cranial CT-scans were taken at fixed intervals in vivo. Specimens obtained after euthanasia were processed for histology, histomorphometry and immunostaining (Osteocalcin, BMP-2 and Smad5.PLLA scaffolds were well colonized with cells after implantation, but only showed marginal ossification. PLLA/BMP-2 scaffolds showed much better bone regeneration and several ossification foci were observed throughout the defect. PLLA/BMP-2 scaffolds also stimulated significantly faster bone regeneration during the first eight weeks compared to bovine spongiosa. However, no significant differences between these two scaffolds could be observed after twelve weeks. Expression of osteogenic marker proteins in PLLA/BMP-2 scaffolds continuously increased throughout the observation period. After twelve weeks osteocalcin, BMP-2 and Smad5 were all significantly higher in the PLLA/BMP-2 group than in all other groups.Electrospun PLLA nanofibers facilitate colonization of bone defects, while their use in combination with BMP-2 also increases bone

  11. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

    Energy Technology Data Exchange (ETDEWEB)

    Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Trifol, Jon; Szabo, Peter [Danish Polymer Centre, Department of Chemical and Biochemical Engineering, Søltofts Plads, Building 229, DK-2800 Kgs. Lyngby (Denmark); Dufva, Marin; Emnéus, Jenny [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark); Wolff, Anders, E-mail: anders.wolff@nanotech.dtu.dk [DTU Nanotech, Department of Micro- and Nanotechnology, Technical University of Denmark, Ørsteds Plads, DK-2800 Kgs. Lyngby (Denmark)

    2016-04-01

    Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

  12. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

    International Nuclear Information System (INIS)

    Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto; Trifol, Jon; Szabo, Peter; Dufva, Marin; Emnéus, Jenny; Wolff, Anders

    2016-01-01

    Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

  13. Composite vascular scaffold combining electrospun fibers and physically-crosslinked hydrogel with copper wire-induced grooves structure.

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Chen; Li, Shuai; Hu, Qingxi

    2016-08-01

    While the field of tissue engineered vascular grafts has greatly advanced, many inadequacies still exist. Successfully developed scaffolds require mechanical and structural properties that match native vessels and optimal microenvironments that foster cell integration, adhesion and growth. We have developed a small diameter, three-layered composite vascular scaffold which consists of electrospun fibers and physically-crosslinked hydrogel with copper wire-induced grooves by combining the electrospinning and dip-coating methods. Scaffold morphology and mechanics were assessed, quantified and compared to native vessels. Scaffolds were seeded with Human Umbilical Vein Endothelial Cells (HUVECs), cultured in vitro for 3 days and were evaluated for cell viability and morphology. The results showed that composite scaffolds had adjustable mechanical strength and favorable biocompatibility, which is important in the future clinical application of Tissue-engineered vascular grafts (TEVGs). Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching.

    Science.gov (United States)

    Mohanty, Soumyaranjan; Sanger, Kuldeep; Heiskanen, Arto; Trifol, Jon; Szabo, Peter; Dufva, Marin; Emnéus, Jenny; Wolff, Anders

    2016-04-01

    Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random pore regions of the scaffold. After crosslinking the casted polymer the combined PVA-salt mould was dissolved in water. The technique has advantages over previously reported ones, such as automated assembly of the sacrificial mould, and precise control over pore architecture/dimensions by 3D printing parameters. In this study, polydimethylsiloxane and biodegradable poly(ϵ-caprolactone) were used for fabrication. However, we show that this technique is also suitable for other biocompatible/biodegradable polymers. Various physical and mechanical properties of the dual-pore scaffolds were compared with control scaffolds with either only structured or only random pores, fabricated using previously reported methods. The fabricated dual-pore scaffolds supported high cell density, due to the random pores, in combination with uniform cell distribution throughout the scaffold, and higher cell proliferation and viability due to efficient nutrient/oxygen transport through the structured pores. In conclusion, the described fabrication technique is rapid, inexpensive, scalable, and compatible

  15. Liquid Phase Sintered Ceramic Bone Scaffolds by Combined Laser and Furnace

    Directory of Open Access Journals (Sweden)

    Pei Feng

    2014-08-01

    Full Text Available Fabrication of mechanically competent bioactive scaffolds is a great challenge in bone tissue engineering. In this paper, β-tricalcium phosphate (β-TCP scaffolds were successfully fabricated by selective laser sintering combined with furnace sintering. Bioglass 45S5 was introduced in the process as liquid phase in order to improve the mechanical and biological properties. The results showed that sintering of β-TCP with the bioglass revealed some features of liquid phase sintering. The optimum amount of 45S5 was 5 wt %. At this point, the scaffolds were densified without defects. The fracture toughness, compressive strength and stiffness were 1.67 MPam1/2, 21.32 MPa and 264.32 MPa, respectively. Bone like apatite layer was formed and the stimulation for apatite formation was increased with increase in 45S5 content after soaking in simulated body fluid, which indicated that 45S5 could improve the bioactivity. Furthermore, MG-63 cells adhered and spread well, and proliferated with increase in the culture time.

  16. Liquid phase sintered ceramic bone scaffolds by combined laser and furnace.

    Science.gov (United States)

    Feng, Pei; Deng, Youwen; Duan, Songlin; Gao, Chengde; Shuai, Cijun; Peng, Shuping

    2014-08-21

    Fabrication of mechanically competent bioactive scaffolds is a great challenge in bone tissue engineering. In this paper, β-tricalcium phosphate (β-TCP) scaffolds were successfully fabricated by selective laser sintering combined with furnace sintering. Bioglass 45S5 was introduced in the process as liquid phase in order to improve the mechanical and biological properties. The results showed that sintering of β-TCP with the bioglass revealed some features of liquid phase sintering. The optimum amount of 45S5 was 5 wt %. At this point, the scaffolds were densified without defects. The fracture toughness, compressive strength and stiffness were 1.67 MPam1/2, 21.32 MPa and 264.32 MPa, respectively. Bone like apatite layer was formed and the stimulation for apatite formation was increased with increase in 45S5 content after soaking in simulated body fluid, which indicated that 45S5 could improve the bioactivity. Furthermore, MG-63 cells adhered and spread well, and proliferated with increase in the culture time.

  17. Fabrication of scalable tissue engineering scaffolds with dual-pore microarchitecture by combining 3D printing and particle leaching

    DEFF Research Database (Denmark)

    Mohanty, Soumyaranjan; Kuldeep, Kuldeep; Heiskanen, Arto

    2016-01-01

    Limitations in controlling scaffold architecture using traditional fabrication techniques are a problem when constructing engineered tissues/organs. Recently, integration of two pore architectures to generate dual-pore scaffolds with tailored physical properties has attracted wide attention...... in tissue engineering community. Such scaffolds features primary structured pores which can efficiently enhance nutrient/oxygen supply to the surrounding, in combination with secondary random pores, which give high surface area for cell adhesion and proliferation. Here, we present a new technique...... to fabricate dual-pore scaffolds for various tissue engineering applications where 3D printing of poly(vinyl alcohol) (PVA) mould is combined with salt leaching process. In this technique the sacrificial PVA mould, determining the structured pore architecture, was filled with salt crystals to define the random...

  18. Wireless Multi Hop Access Networks and Protocols

    OpenAIRE

    Nilsson Plymoth, Anders

    2007-01-01

    As more and more applications and services in our society now depend on the Internet, it is important that dynamically deployed wireless multi hop networks are able to gain access to the Internet and other infrastructure networks and services. This thesis proposes and evaluates solutions for providing multi hop Internet Access. It investigates how ad hoc networks can be combined with wireless and mesh networks in order to create wireless multi hop access networks. When several access points t...

  19. Suitability of a PLCL fibrous scaffold for soft tissue engineering applications: A combined biological and mechanical characterisation.

    Science.gov (United States)

    Laurent, Cédric P; Vaquette, Cédryck; Liu, Xing; Schmitt, Jean-François; Rahouadj, Rachid

    2018-04-01

    Poly(lactide-co-ε-caprolactone) (PLCL) has been reported to be a good candidate for tissue engineering because of its good biocompatibility. Particularly, a braided PLCL scaffold (PLL/PCL ratio = 85/15) has been recently designed and partially validated for ligament tissue engineering. In the present study, we assessed the in vivo biocompatibility of acellular and cellularised scaffolds in a rat model. We then determined its in vitro biocompatibility using stem cells issued from both bone marrow and Wharton Jelly. From a biological point of view, the scaffold was shown to be suitable for tissue engineering in all these cases. Secondly, while the initial mechanical properties of this scaffold have been previously reported to be adapted to load-bearing applications, we studied the evolution in time of the mechanical properties of PLCL fibres due to hydrolytic degradation. Results for isolated PLCL fibres were extrapolated to the fibrous scaffold using a previously developed numerical model. It was shown that no accumulation of plastic strain was to be expected for a load-bearing application such as anterior cruciate ligament tissue engineering. However, PLCL fibres exhibited a non-expected brittle behaviour after two months. This may involve a potential risk of premature failure of the scaffold, unless tissue growth compensates this change in mechanical properties. This combined study emphasises the need to characterise the properties of biomaterials in a pluridisciplinary approach, since biological and mechanical characterisations led in this case to different conclusions concerning the suitability of this scaffold for load-bearing applications.

  20. Composite scaffolds for osteochondral repair obtained by combination of additive manufacturing, leaching processes and hMSC-CM functionalization.

    Science.gov (United States)

    Díaz Lantada, Andrés; Alarcón Iniesta, Hernán; García-Ruíz, Josefa Predestinación

    2016-02-01

    Articular repair is a relevant and challenging area for the emerging fields of tissue engineering and biofabrication. The need of significant gradients of properties, for the promotion of osteochondral repair, has led to the development of several families of composite biomaterials and scaffolds, using different effective approaches, although a perfect solution has not yet been found. In this study we present the design, modeling, rapid manufacturing and in vitro testing of a composite scaffold aimed at osteochondral repair. The presented composite scaffold stands out for having a functional gradient of density and stiffness in the bony phase, obtained in titanium by means of computer-aided design combined with additive manufacture using selective laser sintering. The chondral phase is obtained by sugar leaching, using a PDMS matrix and sugar as porogen, and is joined to the bony phase during the polymerization of PDMS, therefore avoiding the use of supporting adhesives or additional intermediate layers. The mechanical performance of the construct is biomimetic and the stiffness values of the bony and chondral phases can be tuned to the desired applications, by means of controlled modifications of different parameters. A human mesenchymal stem cell (h-MSC) conditioned medium (CM) is used for improving scaffold response. Cell culture results provide relevant information regarding the viability of the composite scaffolds used. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Porous alumina scaffold produced by sol-gel combined polymeric sponge method

    Science.gov (United States)

    Hasmaliza, M.; Fazliah, M. N.; Shafinaz, R. J.

    2012-09-01

    Sol gel is a novel method used to produce high purity alumina with nanometric scale. In this study, three-dimensional porous alumina scaffold was produced using sol-gel polymeric sponge method. Briefly, sol gel alumina was prepared by evaporation and polymeric sponge cut to designated sizes were immersed in the sol gel followed by sintering at 1250 and 1550°C. In order to study the cell interaction, the porous alumina scaffold was sterilized using autoclave prior to Human Mesenchymal Stem Cells (HMSCs) seeding on the scaffold and the cell proliferation was assessed by alamarBlue® assay. SEM results showed that during the 21 day period, HMSCs were able to attach on the scaffold surface and the interconnecting pores while maintaining its proliferation. These findings suggested the potential use of the porous alumina produced as a scaffold for implantation procedure.

  2. Biocompatibility and biomechanical characteristics of loofah based scaffolds combined with hydroxyapatite, cellulose, poly-L-lactic acid with chondrocyte-like cells

    International Nuclear Information System (INIS)

    Cecen, Berivan; Kozaci, Leyla Didem; Yuksel, Mithat; Ustun, Ozcan; Ergur, Bekir Ugur; Havitcioglu, Hasan

    2016-01-01

    The current study reports the biocompatibility and biomechanical characteristics of loofah-based scaffolds combined with hydroxyapatite (HA), cellulose, poly-L-lactic acid (PLLA) with chondrocytes-like cells. Scanning electron microscope (SEM) micrographs of the scaffolds showed that the addition of PLLA usually resulted in an increase in cell's attachment on scaffolds. Mechanical and elemental analyzes were assessed using tensile test and Energy Dispersive X-ray spectrometry (EDS), respectively. In summary, we showed that the loofah + PLLA + HA scaffolds perform significantly better than other loofah–based scaffolds employed in terms of increasing a diversity of mechanical properties including tensile strength and Young's modulus. Based on the analysis of the differential scanning calorimetry (DSC) thermograms and EDS spectrums that give an idea about the calcium phosphate (CaP) ratios, the improvement in the mechanical properties could principally be recognized to the strong interaction formed between loofah, PLLA and HA. The viability of chondrocytes on loofah–based scaffolds was analyzed by XTT tests. However, none of the scaffolds have proved to be toxic in metabolic activity. The histological evaluation obtained by hematoxylin and eosin (H&E), Masson trichrome, toluidine blue and immunohistochemistry methods showed that cells in all scaffolds produced extracellular matrix that defined proteoglycan and type I-II collagens. The results of this study suggest that the loofah-based scaffold with desirable properties can be considered as an ideal candidate for cartilage tissue engineering applications. - Highlights: • In this study we designed a new scaffold and characterized it using biochemical and biomechanical assays. • Our manuscript with the novelty of the scaffold design will add new perspective in the literature about loofah based scaffolds. • The objective of the study is to investigate the natural and novel loofah based scaffolds with

  3. Biocompatibility and biomechanical characteristics of loofah based scaffolds combined with hydroxyapatite, cellulose, poly-L-lactic acid with chondrocyte-like cells

    Energy Technology Data Exchange (ETDEWEB)

    Cecen, Berivan, E-mail: berivan.erik@deu.edu.tr [Dokuz Eylul University, The Institute of Health Science, Department of Biomechanics, 35340 Izmir (Turkey); Kozaci, Leyla Didem [Yildirim Beyazit University, Medical Faculty, Department of Medical Biochemistry, 06800 Ankara (Turkey); Yildirim Beyazit University, Musculoskeletal System Studies Research Center, 06800 Ankara (Turkey); Yuksel, Mithat [Ege University, Engineering Faculty, Department of Chemical Engineering, 35100 Izmir (Turkey); Ustun, Ozcan; Ergur, Bekir Ugur [Dokuz Eylul University, Department of Histology & Embryology, 35340 Izmir (Turkey); Havitcioglu, Hasan [Dokuz Eylul University, The Institute of Health Science, Department of Biomechanics, 35340 Izmir (Turkey); Dokuz Eylul University, Medicine Faculty, Department of Orthopaedics and Traumatology, 35340 Izmir (Turkey)

    2016-12-01

    The current study reports the biocompatibility and biomechanical characteristics of loofah-based scaffolds combined with hydroxyapatite (HA), cellulose, poly-L-lactic acid (PLLA) with chondrocytes-like cells. Scanning electron microscope (SEM) micrographs of the scaffolds showed that the addition of PLLA usually resulted in an increase in cell's attachment on scaffolds. Mechanical and elemental analyzes were assessed using tensile test and Energy Dispersive X-ray spectrometry (EDS), respectively. In summary, we showed that the loofah + PLLA + HA scaffolds perform significantly better than other loofah–based scaffolds employed in terms of increasing a diversity of mechanical properties including tensile strength and Young's modulus. Based on the analysis of the differential scanning calorimetry (DSC) thermograms and EDS spectrums that give an idea about the calcium phosphate (CaP) ratios, the improvement in the mechanical properties could principally be recognized to the strong interaction formed between loofah, PLLA and HA. The viability of chondrocytes on loofah–based scaffolds was analyzed by XTT tests. However, none of the scaffolds have proved to be toxic in metabolic activity. The histological evaluation obtained by hematoxylin and eosin (H&E), Masson trichrome, toluidine blue and immunohistochemistry methods showed that cells in all scaffolds produced extracellular matrix that defined proteoglycan and type I-II collagens. The results of this study suggest that the loofah-based scaffold with desirable properties can be considered as an ideal candidate for cartilage tissue engineering applications. - Highlights: • In this study we designed a new scaffold and characterized it using biochemical and biomechanical assays. • Our manuscript with the novelty of the scaffold design will add new perspective in the literature about loofah based scaffolds. • The objective of the study is to investigate the natural and novel loofah based scaffolds with

  4. Cytocompatibility and biologic characteristics of synthetic scaffold materials of rabbit acellular vascular matrix combining with human-like collagen I.

    Science.gov (United States)

    Liu, Xuqian; Wang, Jie; Dong, Fusheng; Song, Peng; Tian, Songbo; Li, Hexiang; Hou, Yali

    2017-10-01

    Scaffold material provides a three-dimensional growing environment for seed cells in the research field of tissue engineering. In the present study, rabbit arterial blood vessel cells were chemically removed with trypsin and Triton X-100 to prepare rabbit acellular vascular matrix scaffold material. Observation by He&Masson staining revealed that no cellular components or nuclei existed in the vascular intima and media after decellularization. Human-like collagen I was combined with acellular vascular matrix by freeze-drying to prepare an acellular vascular matrix-0.25% human-like collagen I scaffold to compensate for the extracellular matrix loss during the decellularization process. We next performed a series of experiments to test the water absorbing quality, biomechanics, pressure resistance, cytotoxicity, and ultra-micro structure of the acellular vascular matrix composite material and natural rabbit artery and found that the acellular vascular matrix-0.25% human-like collagen I material behaved similarly to natural rabbit artery. In conclusion, the acellular vascular matrix-0.25% human-like collagen I composite material provides a new approach and lays the foundation for novel scaffold material research into tissue engineering of blood vessels.

  5. Classification of Scaffold-Hopping Approaches

    Science.gov (United States)

    2011-11-01

    Discov Today (2011), doi:10.1016/j.drudis.2011.10.024 2 www.drugdiscoverytoday.com R eview s K E Y N O T E R E V IE W by the Schering- Plough ...pain- killing drugs: (a) morphine, (b) tramadol and (c) 3D superposition of (a) in green and (b) in magenta. (a) (e) (f) (b) (c) (d) N N N N N N S Drug

  6. Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: a combined gene therapy-cell transplantation approach.

    Science.gov (United States)

    Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M; Jiang, Tao; Wirtel, Anthony J; Deng, Meng; Lv, Qing; Nair, Lakshmi S; Doty, Steven B; Laurencin, Cato T

    2008-08-12

    One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials.

  7. Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: A combined gene therapy–cell transplantation approach

    Science.gov (United States)

    Jabbarzadeh, Ehsan; Starnes, Trevor; Khan, Yusuf M.; Jiang, Tao; Wirtel, Anthony J.; Deng, Meng; Lv, Qing; Nair, Lakshmi S.; Doty, Steven B.; Laurencin, Cato T.

    2008-01-01

    One of the fundamental principles underlying tissue engineering approaches is that newly formed tissue must maintain sufficient vascularization to support its growth. Efforts to induce vascular growth into tissue-engineered scaffolds have recently been dedicated to developing novel strategies to deliver specific biological factors that direct the recruitment of endothelial cell (EC) progenitors and their differentiation. The challenge, however, lies in orchestration of the cells, appropriate biological factors, and optimal factor doses. This study reports an approach as a step forward to resolving this dilemma by combining an ex vivo gene transfer strategy and EC transplantation. The utility of this approach was evaluated by using 3D poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds for bone tissue engineering applications. Our goal was achieved by isolation and transfection of adipose-derived stromal cells (ADSCs) with adenovirus encoding the cDNA of VEGF. We demonstrated that the combination of VEGF releasing ADSCs and ECs results in marked vascular growth within PLAGA scaffolds. We thereby delineate the potential of ADSCs to promote vascular growth into biomaterials. PMID:18678895

  8. Pertunjukan Teater Karo Hip Hop Kontemporer KAI

    Directory of Open Access Journals (Sweden)

    Silvia Anggreni Purba

    2013-11-01

    Pertunjukan Teater Karo Hip Hop Kontemporer KAI. The performance of Karo Theater collaborated with Hip Hop stems from a simple idea to collaborate Karo cultural traditions with popular culture. The performances can be enjoyed without having limitation on the language and culture. The process of combining two different cultures is a form of hybrid culture, and it may occur due to the globalization process. Through the process of deposition of the observations and strong impression, this performance is then brought into the form of Hip Hop as a preferred form which is energetic, personal and global. This performance is part of a modern tragedy with its destructive character which has explored the emotion and has presented it to the audiences. The exploration of Karo cultural tradition and Hip Hop dance as a language of symbols is able to reinforce words. The movement is not revealed by the verbal phrase but is presented through the movement of Hip Hop dance. The interpretation of the legend and texts into movement is carried out through the training process at the laboratory as a searching process and experiment, and afterward can be realized by considering the basic elements of Hip Hop, Karo cultural elements and performance. Karo Hip Hop Theatre is expected to become a preferred aesthetic form of a modern theater without losing its tradition form. Keyword: a contemporary Karo theater, Hip Hop, hybrid culture.

  9. Combining mechanical foaming and thermally induced phase separation to generate chitosan scaffolds for soft tissue engineering.

    Science.gov (United States)

    Biswas, D P; Tran, P A; Tallon, C; O'Connor, A J

    2017-02-01

    In this paper, a novel foaming methodology consisting of turbulent mixing and thermally induced phase separation (TIPS) was used to generate scaffolds for tissue engineering. Air bubbles were mechanically introduced into a chitosan solution which forms the continuous polymer/liquid phase in the foam created. The air bubbles entrained in the foam act as a template for the macroporous architecture of the final scaffolds. Wet foams were crosslinked via glutaraldehyde and frozen at -20 °C to induce TIPS in order to limit film drainage, bubble coalescence and Ostwald ripening. The effects of production parameters, including mixing speed, surfactant concentration and chitosan concentration, on foaming are explored. Using this method, hydrogel scaffolds were successfully produced with up to 80% porosity, average pore sizes of 120 μm and readily tuneable compressive modulus in the range of 2.6 to 25 kPa relevant to soft tissue engineering applications. These scaffolds supported 3T3 fibroblast cell proliferation and penetration and therefore show significant potential for application in soft tissue engineering.

  10. Biodegradable porous sheet-like scaffolds for soft-tissue engineering using a combined particulate leaching of salt particles and magnetic sugar particles.

    Science.gov (United States)

    Hu, Chengzhi; Tercero, Carlos; Ikeda, Seiichi; Nakajima, Masahiro; Tajima, Hirotaka; Shen, Yajing; Fukuda, Toshio; Arai, Fumihito

    2013-07-01

    Scaffolds serving as artificial extracellular matrixes (ECMs) play a pivotal role in the process of tissue regeneration by providing optimal cellular environments for penetration, ingrowth, and vascularization. Stacks of sheet-like scaffold can be engineered to become artificial ECMs, suggesting a great potential for achieving complex 3-D tissue regeneration to support cell survival and growth. In this study, we proposed and investigated a combined particulate leaching of magnetic sugar particles (MSPs) and salt particles for the development of a sheet-like scaffold. MSPs were fabricated by encapsulating NdFeB particles inside sugar spheres and were controlled using magnetic fields as a porogen to control pore size, pore structure and pore density while fabricating the scaffold. We studied the influence of the strength of the magnetic fields in controlling the coating thickness of the unmagnetized MSPs during the fabrication of the sheet-like scaffolds. The experimental relationship between magnetic flux density and the thickness of the MSP layer was illustrated. Furthermore, we investigated the infiltration capacity of different concentrations of poly(L-lactide-co-ɛ-caprolactone) (PLCL) as a scaffold material on MSP clusters. Following polymer casting and removal of the sugar template, spherical pores were generated inside the scaffolds. Cultivation of NIH/3T3 fibroblasts on the fabricated scaffold proves that the proposed method can be applied in the cell sheet fabrication. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. A three-dimensional hierarchical collagen scaffold fabricated by a combined solid freeform fabrication (SFF) and electrospinning process to enhance mesenchymal stem cell (MSC) proliferation

    International Nuclear Information System (INIS)

    Ahn, SeungHyun; Kim, GeunHyung; Koh, Young Ho

    2010-01-01

    Collagen has the advantage of being very similar to macromolecular substances that can be recognized and metabolized in the biological environment. Although the natural material has superior property for this purpose, its use to fabricate reproducible and pore-structure-controlled 3D structures, which are designed to allow the entry of sufficient cells and the easy diffusion of nutrients, has been limited due to its low processability. Here, we propose a hybrid technology that combines a cryogenic plotting system with an electrospinning process. Using this technique, an easily pore-size-controllable hierarchical 3D scaffold consisting of micro-sized highly porous collagen strands and micro/nano-sized collagen fibers was fabricated. The pore structure of the collagen scaffold was controlled by the collagen micro/nanofibers, which were layered in the scaffold. The hierarchical scaffolds were characterized with respect to initial cell attachment and proliferation of bone marrow-derived mesenchymal stem cells within the scaffolds. The hierarchical scaffold exhibited incredibly enhanced initial cell attachment and cell compactness between pores of the plotted scaffold relative to the normally designed 3D collagen scaffold.

  12. Wheeled hopping robot

    Science.gov (United States)

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  13. A magnetically responsive nanocomposite scaffold combined with Schwann cells promotes sciatic nerve regeneration upon exposure to magnetic field

    Directory of Open Access Journals (Sweden)

    Liu ZY

    2017-10-01

    Full Text Available Zhongyang Liu,1,* Shu Zhu,1,* Liang Liu,2,* Jun Ge,3,4,* Liangliang Huang,1 Zhen Sun,1 Wen Zeng,5 Jinghui Huang,1 Zhuojing Luo1 1Department of Orthopedics, Xijing Hospital, Fourth Military Medical University, Xi’an, Shaanxi, 2Department of Orthopedics, No 161 Hospital of PLA, Wuhan, Hubei, 3Department of Orthopedics, No 323 Hospital of PLA, Xi’an, Shaanxi, 4Department of Anatomy, Fourth Military Medical University, Xi’an, Shaanxi, 5Department of Neurosurgery, Tangdu Hospital, Fourth Military Medical University, Xi’an, Shaanxi, People’s Republic of China *These authors contributed equally to this work Abstract: Peripheral nerve repair is still challenging for surgeons. Autologous nerve transplantation is the acknowledged therapy; however, its application is limited by the scarcity of available donor nerves, donor area morbidity, and neuroma formation. Biomaterials for engineering artificial nerves, particularly materials combined with supportive cells, display remarkable promising prospects. Schwann cells (SCs are the absorbing seeding cells in peripheral nerve engineering repair; however, the attenuated biologic activity restricts their application. In this study, a magnetic nanocomposite scaffold fabricated from magnetic nanoparticles and a biodegradable chitosan–glycerophosphate polymer was made. Its structure was evaluated and characterized. The combined effects of magnetic scaffold (MG with an applied magnetic field (MF on the viability of SCs and peripheral nerve injury repair were investigated. The magnetic nanocomposite scaffold showed tunable magnetization and degradation rate. The MGs synergized with the applied MF to enhance the viability of SCs after transplantation. Furthermore, nerve regeneration and functional recovery were promoted by the synergism of SCs-loaded MGs and MF. Based on the current findings, the combined application of MGs and SCs with applied MF is a promising therapy for the engineering of peripheral

  14. Combining Organometallic Catalysis and Organocatalysis for the Synthesis of Heterocyclic Scaffolds

    DEFF Research Database (Denmark)

    Hansen, Casper Lykke

    The main work presented in this thesis describes the development of efficient and novel methodologies for the synthesis of pharmaceutically interesting indolecontaining alkaloids, i.e., the 1,2,3,4-tetrahydro-β-carboline and the 1,2,3,4-tetrahydrocarbazole scaffolds. The synthesis of 1...... to the nitrogen in the allylic system proved to be highly important for the enantioselectivity. Enantiomeric excesses up to 57% was obtained. The synthesis of 1,2,3,4-tetrahydrocarbazole relied on novel Brønsted acidcatalyzed Friedel-Crafts-type reactions. Three different kinds of 1,2,3,4-tetrahydrocarbazole...

  15. Combined Effect of a Microporous Layer and Type I Collagen Coating on a Biphasic Calcium Phosphate Scaffold for Bone Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Mun-Hwan Lee

    2015-03-01

    Full Text Available In this study, type I collagen was coated onto unmodified and modified microporous biphasic calcium phosphate (BCP scaffolds. Surface characterization using a scanning electron microscope (SEM and a surface goniometer confirmed the modification of the BCP coating. The quantity of the collagen coating was investigated using Sirius Red staining, and quantitative assessment of the collagen coating showed no significant differences between the two groups. MG63 cells were used to evaluate cell proliferation and ALP activity on the modified BCP scaffolds. The modified microporous surfaces showed low contact angles and large surface areas, which enhanced cell spreading and proliferation. Coating of the BCP scaffolds with type I collagen led to enhanced cell-material interactions and improved MG63 functions, such as spreading, proliferation, and differentiation. The micropore/collagen-coated scaffold showed the highest rate of cell response. These results indicate that a combination of micropores and collagen enhances cellular function on bioengineered bone allograft tissue.

  16. Combined effects of scaffold stiffening and mechanical preconditioning cycles on construct biomechanics, gene expression, and tendon repair biomechanics.

    Science.gov (United States)

    Nirmalanandhan, Victor Sanjit; Juncosa-Melvin, Natalia; Shearn, Jason T; Boivin, Gregory P; Galloway, Marc T; Gooch, Cynthia; Bradica, Gino; Butler, David L

    2009-08-01

    Our group has previously reported that in vitro mechanical stimulation of tissue-engineered tendon constructs significantly increases both construct stiffness and the biomechanical properties of the repair tissue after surgery. When optimized using response surface methodology, our results indicate that a mechanical stimulus with three components (2.4% strain, 3000 cycles/day, and one cycle repetition) produced the highest in vitro linear stiffness. Such positive correlations between construct and repair stiffness after surgery suggest that enhancing structural stiffness before surgery could not only accelerate repair stiffness but also prevent premature failures in culture due to poor mechanical integrity. In this study, we examined the combined effects of scaffold crosslinking and subsequent mechanical stimulation on construct mechanics and biology. Autologous tissue-engineered constructs were created by seeding mesenchymal stem cells (MSCs) from 15 New Zealand white rabbits on type I collagen sponges that had undergone additional dehydrothermal crosslinking (termed ADHT in this manuscript). Both constructs from each rabbit were mechanically stimulated for 8h/day for 12 consecutive days with half receiving 100 cycles/day and the other half receiving 3000 cycles/day. These paired MSC-collagen autologous constructs were then implanted in bilateral full-thickness, full-length defects in the central third of rabbit patellar tendons. Increasing the number of in vitro cycles/day delivered to the ADHT constructs in culture produced no differences in stiffness or gene expression and no changes in biomechanical properties or histology 12 weeks after surgery. Compared to MSC-based repairs from a previous study that received no additional treatment in culture, ADHT crosslinking of the scaffolds actually lowered the 12-week repair stiffness. Thus, while ADHT crosslinking may initially stiffen a construct in culture, this specific treatment also appears to mask any benefits

  17. Accelerated differentiation of osteoblast cells on polycaprolactone scaffolds driven by a combined effect of protein coating and plasma modification

    Energy Technology Data Exchange (ETDEWEB)

    Yildirim, Eda D; Gueceri, Selcuk; Sun, Wei [Department of Mechanical Engineering and Mechanics, Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States); Besunder, Robyn; Allen, Fred [Drexel University, School of Biomedical Engineering Science and Health System, 3141 Chestnut Street, Philadelphia, PA 19104 (United States); Pappas, Daphne, E-mail: edy22@drexel.ed [Army Research Laboratory, Aberdeen Proving Ground, MD 21005 (United States)

    2010-03-15

    A combined effect of protein coating and plasma modification on the quality of the osteoblast-scaffold interaction was investigated. Three-dimensional polycaprolactone (PCL) scaffolds were manufactured by the precision extrusion deposition (PED) system. The structural, physical, chemical and biological cues were introduced to the surface through providing 3D structure, coating with adhesive protein fibronectin and modifying the surface with oxygen-based plasma. The changes in the surface properties of PCL after those modifications were examined by contact angle goniometry, surface energy calculation, surface chemistry analysis (XPS) and surface topography measurements (AFM). The effects of modification techniques on osteoblast short-term and long-term functions were examined by cell adhesion, proliferation assays and differentiation markers, namely alkaline phosphatase activity (ALP) and osteocalcin secretion. The results suggested that the physical and chemical cues introduced by plasma modification might be sufficient for improved cell adhesion, but for accelerated osteoblast differentiation the synergetic effects of structural, physical, chemical and biological cues should be introduced to the PCL surface.

  18. Hopping transport in solids

    CERN Document Server

    Pollak, M

    1991-01-01

    The hopping process, which differs substantially from conventional transport processes in crystals, is the central process in the transport phenomena discussed in this book. Throughout the book the term ``hopping'' is defined as the inelastic tunneling transfer of an electron between two localized electronic states centered at different locations. Such processes do not occur in conventional electronic transport in solids, since localized states are not compatible with the translational symmetry of crystals.The rapid growth of interest in hopping transport has followed in the footsteps of the

  19. Porous stable poly(lactic acid)/ethyl cellulose/hydroxyapatite composite scaffolds prepared by a combined method for bone regeneration.

    Science.gov (United States)

    Mao, Daoyong; Li, Qing; Bai, Ningning; Dong, Hongzhou; Li, Daikun

    2018-01-15

    A major challenge in bone tissue engineering is the development of biomimetic scaffolds which should simultaneously meet mechanical strength and pore structure requirements. Herein, we combined technologies of high concentration solvent casting, particulate leaching, and room temperature compression molding to prepare a novel poly(lactic acid)/ethyl cellulose/hydroxyapatite (PLA/EC/HA) scaffold. The functional, structural and mechanical properties of the obtained porous scaffolds were characterized. The results indicated that the PLA/EC/HA scaffolds at the 20wt% HA loading level showed optimal mechanical properties and desired porous structure. Its porosity, contact angle, compressive yield strength and weight loss after 56days were 84.28±7.04%, 45.13±2.40°, 1.57±0.09MPa and 4.77±0.32%, respectively, which could satisfy the physiological demands to guide bone regeneration. Thus, the developed scaffolds have potential to be used as a bone substitute material for bone tissue engineering application. Copyright © 2017. Published by Elsevier Ltd.

  20. The Philippine "Hip Hop Stick Dance"

    Science.gov (United States)

    Lewis, Lisa

    2012-01-01

    This article introduces a dance that blends the traditional cultural heritage of the Philippines with modern music and moves. "Hip Hop Stick Dance" incorporates Tinikling (the Philippine national dance) and Arnis (a Filipino style of martial arts) to create a contemporary combination of rhythm, dance, and fitness. It was designed to introduce…

  1. Flow velocity-driven differentiation of human mesenchymal stromal cells in silk fibroin scaffolds: A combined experimental and computational approach.

    Directory of Open Access Journals (Sweden)

    Jolanda Rita Vetsch

    Full Text Available Mechanical loading plays a major role in bone remodeling and fracture healing. Mimicking the concept of mechanical loading of bone has been widely studied in bone tissue engineering by perfusion cultures. Nevertheless, there is still debate regarding the in-vitro mechanical stimulation regime. This study aims at investigating the effect of two different flow rates (vlow = 0.001m/s and vhigh = 0.061m/s on the growth of mineralized tissue produced by human mesenchymal stromal cells cultured on 3-D silk fibroin scaffolds. The flow rates applied were chosen to mimic the mechanical environment during early fracture healing or during bone remodeling, respectively. Scaffolds cultured under static conditions served as a control. Time-lapsed micro-computed tomography showed that mineralized extracellular matrix formation was completely inhibited at vlow compared to vhigh and the static group. Biochemical assays and histology confirmed these results and showed enhanced osteogenic differentiation at vhigh whereas the amount of DNA was increased at vlow. The biological response at vlow might correspond to the early stage of fracture healing, where cell proliferation and matrix production is prominent. Visual mapping of shear stresses, simulated by computational fluid dynamics, to 3-D micro-computed tomography data revealed that shear stresses up to 0.39mPa induced a higher DNA amount and shear stresses between 0.55mPa and 24mPa induced osteogenic differentiation. This study demonstrates the feasibility to drive cell behavior of human mesenchymal stromal cells by the flow velocity applied in agreement with mechanical loading mimicking early fracture healing (vlow or bone remodeling (vhigh. These results can be used in the future to tightly control the behavior of human mesenchymal stromal cells towards proliferation or differentiation. Additionally, the combination of experiment and simulation presented is a strong tool to link biological responses to

  2. Climate, weather, and hops

    Science.gov (United States)

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  3. Electron hopping through proteins

    Czech Academy of Sciences Publication Activity Database

    Warren, J. J.; Ener, M. E.; Vlček, Antonín; Winkler, J. R.; Gray, H. B.

    2012-01-01

    Roč. 256, 21-22 (2012), s. 2478-2487 ISSN 0010-8545 R&D Projects: GA MŠk(CZ) ME10124 Institutional support: RVO:61388955 Keywords : electron transfer * multistep tunneling * hopping maps Subject RIV: CG - Electrochemistry Impact factor: 11.016, year: 2012

  4. Basin Hopping Graph

    DEFF Research Database (Denmark)

    Kucharik, Marcel; Hofacker, Ivo; Stadler, Peter

    2014-01-01

    of the folding free energy landscape, however, can provide the relevant information. Results We introduce the basin hopping graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect...

  5. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  6. Fabrication of BCP/Silica Scaffolds with Dual-Pore by Combining Fused Deposition Modeling and the Particle Leaching Method

    International Nuclear Information System (INIS)

    Sa, Min-Woo; Kim, Jong Young

    2016-01-01

    In recent years, traditional scaffold fabrication techniques such as gas foaming, salt leaching, sponge replica, and freeze casting in tissue engineering have significantly limited sufficient mechanical property and cell interaction effect due to only random pores. Fused deposition modeling is the most apposite technology for fabricating the 3D scaffolds using the polymeric materials in tissue engineering application. In this study, 3D slurry mould was fabricated with a blended biphasic calcium phosphate (BCP)/Silica/Alginic acid sodium salt slurry in PCL mould and heated for two hours at 100 .deg. C to harden the blended slurry. 3D dual-pore BCP/Silica scaffold, composed of macro pores interconnected with micro pores, was successfully fabricated by sintering at furnace of 1100 .deg. C. Surface morphology and 3D shape of dual-pore BCP/Silica scaffold from scanning electron microscopy were observed. Also, the mechanical properties of 3D BCP/Silica scaffold, according to blending ratio of alginic acid sodium salt, were evaluated through compression test

  7. Fabrication of BCP/Silica Scaffolds with Dual-Pore by Combining Fused Deposition Modeling and the Particle Leaching Method

    Energy Technology Data Exchange (ETDEWEB)

    Sa, Min-Woo; Kim, Jong Young [Andong National Univ., Andong (Korea, Republic of)

    2016-10-15

    In recent years, traditional scaffold fabrication techniques such as gas foaming, salt leaching, sponge replica, and freeze casting in tissue engineering have significantly limited sufficient mechanical property and cell interaction effect due to only random pores. Fused deposition modeling is the most apposite technology for fabricating the 3D scaffolds using the polymeric materials in tissue engineering application. In this study, 3D slurry mould was fabricated with a blended biphasic calcium phosphate (BCP)/Silica/Alginic acid sodium salt slurry in PCL mould and heated for two hours at 100 .deg. C to harden the blended slurry. 3D dual-pore BCP/Silica scaffold, composed of macro pores interconnected with micro pores, was successfully fabricated by sintering at furnace of 1100 .deg. C. Surface morphology and 3D shape of dual-pore BCP/Silica scaffold from scanning electron microscopy were observed. Also, the mechanical properties of 3D BCP/Silica scaffold, according to blending ratio of alginic acid sodium salt, were evaluated through compression test.

  8. Communication: Fully coherent quantum state hopping

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Craig C., E-mail: cmartens@uci.edu [University of California, Irvine, California 92697-2025 (United States)

    2015-10-14

    In this paper, we describe a new and fully coherent stochastic surface hopping method for simulating mixed quantum-classical systems. We illustrate the approach on the simple but unforgiving problem of quantum evolution of a two-state quantum system in the limit of unperturbed pure state dynamics and for dissipative evolution in the presence of both stationary and nonstationary random environments. We formulate our approach in the Liouville representation and describe the density matrix elements by ensembles of trajectories. Population dynamics are represented by stochastic surface hops for trajectories representing diagonal density matrix elements. These are combined with an unconventional coherent stochastic hopping algorithm for trajectories representing off-diagonal quantum coherences. The latter generalizes the binary (0,1) “probability” of a trajectory to be associated with a given state to allow integers that can be negative or greater than unity in magnitude. Unlike existing surface hopping methods, the dynamics of the ensembles are fully entangled, correctly capturing the coherent and nonlocal structure of quantum mechanics.

  9. Combining 3-dimensional degradable electrostatic spinning scaffold and dental follicle cells to build peri-implant periodontium

    Directory of Open Access Journals (Sweden)

    Ximu Zhang

    2013-01-01

    Full Text Available Introduction: Some inevitable problems, such as concentrated bite force and lacked ability of self-renewal, are proved to be the major challenge in the management of implants failures. Thus, it is meaningful to find an ideal dental implant harboring its own peri-implant periodontium, just as the natural teeth. Various studies attempted to reconstruct the periodontium around implants, but unfortunately, it was previously revealed that the artificial periodotium around implants was just a wilderness of fibers, while without the physiological function of natural periodontium, like sensory and homeostatic. The Hypothesis: In this paper, we propose a hypothesis that a modified three-dimensional scaffold with reconstructed peri-implant tissues can be a network for stem cells differentiation. After seeded on the scaffold, stem cells produce various growth factors and differentiate to different orientations in places necessary. This hypothesis, if proven to be valid, will offer a novel and effective therapy for the restoration of missing teeth by implant. Evaluation of the Hypothesis: The scaffold involves three different tissues. Though degradation rate of electrospinning scaffold is under control, its degradation rate should be in consistent with the generation of three tissues. Therefore, the relative experiments are necessary to define the best rate of degradation. Further verification is necessary to check whether the rebuilt cementum, bone and periodontium are strong enough to keep the implant stable and maintain its function.

  10. Majorana edge States in atomic wires coupled by pair hopping.

    Science.gov (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  11. Hip-Hop Education Resources

    Science.gov (United States)

    Hall, Marcella Runell

    2009-01-01

    Hip-hop music and culture are often cited as being public pedagogy, meaning the music itself has intrinsic educational value. Non-profit organizations and individual educators have graciously taken the lead in utilizing hip-hop to educate. As the academy continues to debate its effectiveness, teachers and community organizers are moving forward.…

  12. The combination of mesenchymal stem cells and a bone scaffold in the treatment of vertebral body defects

    Czech Academy of Sciences Publication Activity Database

    Vaněček, Václav; Klíma, K.; Kohout, A.; Foltán, R.; Jiroušek, Ondřej; Šedý, Jiří; Štulík, J.; Syková, Eva; Jendelová, Pavla

    2013-01-01

    Roč. 22, č. 12 (2013), s. 2777-2786 ISSN 0940-6719 R&D Projects: GA ČR GAP304/10/0320; GA MZd(CZ) NT13477 Institutional support: RVO:68378041 ; RVO:68378297 ; RVO:67985823 Keywords : vertebral body defect * mesenchymal stem cells * hydroxyapatite scaffold Subject RIV: FH - Neurology ; FI - Traumatology, Orthopedics (UTAM-F); FI - Traumatology, Orthopedics (FGU-C) Impact factor: 2.473, year: 2013

  13. Supercritical fluid extraction of hops

    Directory of Open Access Journals (Sweden)

    ZORAN ZEKOVIC

    2007-01-01

    Full Text Available Five cultivars of hop were extracted by the method of supercritical fluid extraction using carbon dioxide (SFE–CO2 as extractant. The extraction (50 g of hop sample using a CO2 flow rate of 97.725 L/h was done in the two steps: 1. extraction at 150 bar and 40°C for 2.5 h (sample of series A was obtained and, after that, the same sample of hop was extracted in the second step: 2. extraction at 300 bar and 40 °C for 2.5 h (sample of series B was obtained. The Magnum cultivar was chosen for the investigation of the extraction kinetics. For the qualitative and quantitative analysis of the obtained hop extracts, the GC-MS method was used. Two of four themost common compounds of hop aroma (a-humulene and b-caryophyllene were detected in samples of series A. In addition, isomerized a-acids and a high content of b-acids were detected. The a-acids content in the samples of series B was the highest in the extract of the Magnum cultivar (it is a bitter variety of hop. The low contents of a-acids in all the other hop samples resulted in extracts with low a-acids content, i.e., that contents were under the prescribed a-acids content.

  14. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    Science.gov (United States)

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  15. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    Science.gov (United States)

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (pHip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  16. Hall effect in hopping regime

    International Nuclear Information System (INIS)

    Avdonin, A.; Skupiński, P.; Grasza, K.

    2016-01-01

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  17. Hall effect in hopping regime

    Energy Technology Data Exchange (ETDEWEB)

    Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)

    2016-02-15

    A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.

  18. On the Capacity of a GSM Frequency Hopping network with Intelligent Underlayer-Overlayer

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wigard, Jeroen; Mogensen, Preben Elgaard

    1997-01-01

    . By combining this reuse partitioning with frequency hopping, an increase in the network capacity in terms of carried traffic per cell is achieved. Simulations have indicated that for slow moving mobiles a gain of approximately 35% is achieved by this new feature when compared with a frequency hopping network...

  19. Supercritical carbon dioxide hop extraction

    Directory of Open Access Journals (Sweden)

    Pfaf-Šovljanski Ivana I.

    2005-01-01

    Full Text Available The hop of Magnum cultivar was extracted using supercritical carbon dioxide (SFE-as extractant. Extraction was carried out in the two steps: the first one being carried out at 150 bar and 40°C for 2.5 h (Extract A, and the second was the extraction of the same hop sample at 300 bar and 40°C for 2.5 h (Extract B. Extraction kinetics of the system hop-SFE-CO2 was investigated. Two of four most common compounds of hop aroma (α-humulene and β-caryophyllene were detected in Extract A. Isomerised α-acids and β-acids were detected too. a-Acid content in Extract B was high (that means it is a bitter variety of hop. Mathematical modeling using empirical model characteristic time model and simple single sphere model has been performed on Magnum cultivar extraction experimental results. Characteristic time model equations, best fitted experimental results. Empirical model equation, fitted results well, while simple single sphere model equation poorly approximated the results.

  20. Scaffolded biology.

    Science.gov (United States)

    Minelli, Alessandro

    2016-09-01

    Descriptions and interpretations of the natural world are dominated by dichotomies such as organism vs. environment, nature vs. nurture, genetic vs. epigenetic, but in the last couple of decades strong dissatisfaction with those partitions has been repeatedly voiced and a number of alternative perspectives have been suggested, from perspectives such as Dawkins' extended phenotype, Turner's extended organism, Oyama's Developmental Systems Theory and Odling-Smee's niche construction theory. Last in time is the description of biological phenomena in terms of hybrids between an organism (scaffolded system) and a living or non-living scaffold, forming unit systems to study processes such as reproduction and development. As scaffold, eventually, we can define any resource used by the biological system, especially in development and reproduction, without incorporating it as happens in the case of resources fueling metabolism. Addressing biological systems as functionally scaffolded systems may help pointing to functional relationships that can impart temporal marking to the developmental process and thus explain its irreversibility; revisiting the boundary between development and metabolism and also regeneration phenomena, by suggesting a conceptual framework within which to investigate phenomena of regular hypermorphic regeneration such as characteristic of deer antlers; fixing a periodization of development in terms of the times at which a scaffolding relationship begins or is terminated; and promoting plant galls to legitimate study objects of developmental biology.

  1. Semiotic scaffolding

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2015-01-01

    Life processes at all levels (from the genetic to the behavioral) are coordinated by semiotic interactions between cells, tissues, membranes, organs, or individuals and tuned through evolution to stabilize important functions. A stabilizing dynamics based on a system of semiotic scaffoldings impl...... semiotic scaffolding is not, of course, exclusive for phylogenetic and ontogenetic development, it is also an important dynamical element in cultural evolution.......Life processes at all levels (from the genetic to the behavioral) are coordinated by semiotic interactions between cells, tissues, membranes, organs, or individuals and tuned through evolution to stabilize important functions. A stabilizing dynamics based on a system of semiotic scaffoldings...... (the representamen) and the effect. Semiotic interaction patterns therefore provide fast and versatile mechanisms for adaptations, mechanisms that depend on communication and “learning” rather than on genetic preformation. Seen as a stabilizing agency supporting the emergence of higher-order structure...

  2. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  3. Hip-Hop and the Academic Canon

    Science.gov (United States)

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  4. Young Children Manifest Spiritualities in Their Hip-Hop Writing

    Science.gov (United States)

    Norton, Nadjwa E. L.

    2014-01-01

    In this article, the author combines multicultural feminist critical theories with the voices of Black and Latina/Latino young spiritual children to extend culturally responsive teaching. The author illuminates how children use their hip-hop writing to construct themselves as people who communicate with God, choose spiritual content for their…

  5. Design of nano- and microfiber combined scaffolds by electrospinning of collagen onto starch-based fiber meshes: a man-made equivalent of natural extracellular matrix.

    Science.gov (United States)

    Tuzlakoglu, Kadriye; Santos, Marina I; Neves, Nuno; Reis, Rui L

    2011-02-01

    Mimicking the structural organization and biologic function of natural extracellular matrix has been one of the main goals of tissue engineering. Nevertheless, the majority of scaffolding materials for bone regeneration highlights biochemical functionality in detriment of mechanical properties. In this work we present a rather innovative construct that combines in the same structure electrospun type I collagen nanofibers with starch-based microfibers. These combined structures were obtained by a two-step methodology and structurally consist in a type I collagen nano-network incorporated on a macro starch-based support. The morphology of the developed structures was assessed by several microscopy techniques and the collagenous nature of the nano-network was confirmed by immunohistochemistry. In addition, and especially regarding the requirements of large bone defects, we also successfully introduced the concept of layer by layer, as a way to produce thicker structures. In an attempt to recreate bone microenvironment, the design and biochemical composition of the combined structures also envisioned bone-forming cells and endothelial cells (ECs). The inclusion of a type I collagen nano-network induced a stretched morphology and improved the metabolic activity of osteoblasts. Regarding ECs, the presence of type I collagen on the combined structures provided adhesive support and obviated the need of precoating with fibronectin. It was also importantly observed that ECs on the nano-network organized into circular structures, a three-dimensional arrangement distinct from that observed for osteoblasts and resembling the microcappillary-like organizations formed during angiogenesis. By providing simultaneously physical and chemical cues for cells, the herein-proposed combined structures hold a great potential in bone regeneration as a man-made equivalent of extracellular matrix.

  6. Hip-Hop Pop Art

    Science.gov (United States)

    Talley, Clarence, Sr.

    2011-01-01

    Art has a way of helping students better understand and appreciate the world around them, particularly the things that are most important to them. Hip hop is one of those generational genres that capture the attention of young students like few other things do. Drawing on this genre to get students to create art is an excellent way to demonstrate…

  7. Repairing rabbit radial defects by combining bone marrow stroma stem cells with bone scaffold material comprising a core-cladding structure.

    Science.gov (United States)

    Wu, H; Liu, G H; Wu, Q; Yu, B

    2015-10-05

    We prepared a bone scaffold material comprising a PLGA/β-TCP core and a Type I collagen cladding, and recombined it with bone marrow stroma stem cells (BMSCs) to evaluate its potential for use in bone tissue engineering by in vivo and in vitro experiments. PLGA/β-TCP without a cladding was used for comparison. The adherence rate of the BMSCs to the scaffold was determined by cell counting. Cell proliferation rate was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method. The osteogenic capability was evaluated by alkaline phosphatase activity. The scaffold materials were recombined with the BMSCs and implanted into a large segmental rabbit radial defect model to evaluate defect repair. Osteogenesis was assessed in the scaffold materials by histological and double immunofluorescence labeling, etc. The adherence number, proliferation number, and alkaline phosphatase expression of the cells on the bone scaffold material with core-cladding structure were significantly higher than the corresponding values in the PLGA/β-TCP composite scaffold material (P structure completely degraded at the bone defect site and bone formation was completed. The rabbit large sentimental radial defect was successfully repaired. The degradation and osteogenesis rates matched well. The bone scaffold with core-cladding structure exhibited better osteogenic activity and capacity to repair a large segmental bone defect compared to the PLGA/β-TCP composite scaffold. The bone scaffold with core-cladding structure has excellent physical properties and biocompatibility. It is an ideal scaffold material for bone tissue engineering.

  8. In Vivo Evaluation of 3D-Printed Polycaprolactone Scaffold Implantation Combined with β-TCP Powder for Alveolar Bone Augmentation in a Beagle Defect Model

    Directory of Open Access Journals (Sweden)

    Su A. Park

    2018-02-01

    Full Text Available Insufficient bone volume is one of the major challenges encountered by dentists after dental implant placement. This study aimed to evaluate the efficacy of a customized three-dimensional polycaprolactone (3D PCL scaffold implant fabricated with a 3D bio-printing system to facilitate rapid alveolar bone regeneration. Saddle-type bone defects were surgically created on the healed site after extracting premolars from the mandibles of four beagle dogs. The defects were radiologically examined using computed tomography for designing a customized 3D PCL scaffold block to fit the defect site. After fabricating 3D PCL scaffolds using rapid prototyping, the scaffolds were implanted into the alveolar bone defects along with β-tricalcium phosphate powder. In vivo analysis showed that the PCL blocks maintained the physical space and bone conductivity around the defects. In addition, no inflammatory infiltrates were observed around the scaffolds. However, new bone formation occurred adjacent to the scaffolds, rather than directly in contact with them. More new bone was observed around PCL blocks with 400/1200 lattices than around blocks with 400/400 lattices, but the difference was not significant. These results indicated the potential of 3D-printed porous PCL scaffolds to promote alveolar bone regeneration for defect healing in dentistry.

  9. Preparation of a new composite combining strengthened β-tricalcium phosphate with platelet-rich plasma as a potential scaffold for the repair of bone defects

    Science.gov (United States)

    WANG, CHENGGONG; ZHONG, DA; ZHOU, XING; YIN, KE; LIAO, QIANDE; KONG, LINGYU; LIU, ANSONG

    2014-01-01

    β-tricalcium phosphate (β-TCP) and platelet-rich plasma (PRP) are commonly used in bone tissue engineering. In the present study, a new composite combining strengthened β-TCP and PRP was prepared and its morphological and mechanical properties were investigated by scanning electron microscopy (SEM) and material testing. The biocompatibility was evaluated by measuring the adhesion rate and cytotoxicity of bone marrow stromal cells (BMSCs). The strengthened β-TCP/PRP composite had an appearance like the fungus Boletus kermesinus with the PRP gel distributed on the surface of the micropores. The maximum load and load intensity were 945.6±86.4 N and 13.1±0.5 MPa, which were significantly higher than those of β-TCP (110.1±14.3 N and 1.6±0.2 MPa; P96% after 24 h, with a cell cytotoxicity value of zero. SEM micrographs revealed that following seeding of BMSCs onto the composite in high-glucose Dulbecco’s modified Eagle’s medium culture for two weeks, the cells grew well and exhibited fusiform, spherical and polygonal morphologies, as well as pseudopodial connections. The strengthened β-TCP/PRP composite has the potential to be used as a scaffold in bone tissue engineering due to its effective biocompatibility and mechanical properties. PMID:25187800

  10. Hopping models and ac universality

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2002-01-01

    Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA) is the h......Some general relations for hopping models are established. We proceed to discuss the universality of the ac conductivity which arises in the extreme disorder limit of the random barrier model. It is shown that the relevant dimension entering into the diffusion cluster approximation (DCA......) is the harmonic (fracton) dimension of the diffusion cluster. The temperature scaling of the dimensionless frequency entering into the DCA is discussed. Finally, some open problems regarding ac universality are listed....

  11. Range and energetics of charge hopping in organic semiconductors

    Science.gov (United States)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  12. Fundamentals of beer and hop chemistry

    Directory of Open Access Journals (Sweden)

    Denis De Keukeleire

    2000-02-01

    Full Text Available Beer brewing is an intricate process encompassing mixing and further elaboration of four essential raw materials, including barley malt, brewing water, hops and yeast. Particularly hops determine to a great extent typical beer qualities such as bitter taste, hoppy flavour, and foam stability. Conversely, hop-derived bitter acids account for an offending lightstruck flavour, which is formed on exposure of beer to light. These various processes are presented in detail, while due emphasis is placed on state-of-the-art hop technology, which provides brewers with efficient means to control bitterness, foam, and light-stability thereby allowing for the production of beers with consistent quality.

  13. Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya

    OpenAIRE

    Yanuar, Sandy

    2014-01-01

    Fasilitas Pelatihan dan Pergelaran Seni Tari Hip Hop di Surabaya merupakan fasilitas yang disediakan bagi semua penari Hip Hop di Surabaya untuk berlatih menari dan mempertunjukan tarian Hip Hop. Fasilitas ini tersedia bagi semua penari Hip Hop termasuk penari difable, mengingat kaum difable juga dapat menari Hip Hop. Namun karena di Surabaya belum memiliki fasilitas yang memadai bagi semua penari Hip Hop termasuk penari difable untuk menari dan memiliki tempat pertunjukan yang berkarakter Hi...

  14. Hop-by-HopWorm Propagation with Carryover Epidemic Model in Mobile Sensor Networks

    Directory of Open Access Journals (Sweden)

    Jun-Won Ho

    2015-10-01

    Full Text Available In the internet, a worm is usually propagated in a random multi-hop contact manner. However, the attacker will not likely select this random multi-hop propagation approach in a mobile sensor network. This is because multi-hop worm route paths to random vulnerable targets can be often breached due to node mobility, leading to failure of fast worm spread under this strategy. Therefore, an appropriate propagation strategy is needed for mobile sensor worms. To meet this need, we discuss a hop-by-hop worm propagation model in mobile sensor networks. In a hop-by-hop worm propagation model, benign nodes are infected by worm in neighbor-to-neighbor spread manner. Since worm infection occurs in hop-by-hop contact, it is not substantially affected by a route breach incurred by node mobility. We also propose the carryover epidemic model to deal with the worm infection quota deficiency that might occur when employing an epidemic model in a mobile sensor network. We analyze worm infection capability under the carryover epidemic model. Moreover, we simulate hop-by-hop worm propagation with carryover epidemic model by using an ns-2 simulator. The simulation results demonstrate that infection quota carryovers are seldom observed where a node’s maximum speed is no less than 20 m/s.

  15. How Does a Hopping Kangaroo Breathe?

    Science.gov (United States)

    Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

    2010-01-01

    We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

  16. Hip-hop and urban studies

    NARCIS (Netherlands)

    Jaffe, R.

    2014-01-01

    How can urban studies research engage fruitfully with hip-hop? This contribution responds to the essays by David Beer and Martin Lamotte on ‘street music’, urban ethnography and ghettoized communities. It discusses how a social science engagement with hip-hop texts might differ from cultural studies

  17. Hopping Conductivity Enhanced by Microwave Radiation

    International Nuclear Information System (INIS)

    Ovadyahu, Z

    2012-01-01

    Hopping conductivity is enhanced when exposed to microwave (MW) fields. Data taken on several Anderson-localized systems and granular-aluminium are presented to illustrate the generality of the phenomenon. It is suggested that the effect is due to a field-enhanced hopping, which is the ac version of a non-ohmic effect familiar from studies in the dc transport regime.

  18. Recombinant protein scaffolds for tissue engineering

    International Nuclear Information System (INIS)

    Werkmeister, Jerome A; Ramshaw, John A M

    2012-01-01

    New biological materials for tissue engineering are now being developed using common genetic engineering capabilities to clone and express a variety of genetic elements that allow cost-effective purification and scaffold fabrication from these recombinant proteins, peptides or from chimeric combinations of these. The field is limitless as long as the gene sequences are known. The utility is dependent on the ease, product yield and adaptability of these protein products to the biomedical field. The development of recombinant proteins as scaffolds, while still an emerging technology with respect to commercial products, is scientifically superior to current use of natural materials or synthetic polymer scaffolds, in terms of designing specific structures with desired degrees of biological complexities and motifs. In the field of tissue engineering, next generation scaffolds will be the key to directing appropriate tissue regeneration. The initial period of biodegradable synthetic scaffolds that provided shape and mechanical integrity, but no biological information, is phasing out. The era of protein scaffolds offers distinct advantages, particularly with the combination of powerful tools of molecular biology. These include, for example, the production of human proteins of uniform quality that are free of infectious agents and the ability to make suitable quantities of proteins that are found in low quantity or are hard to isolate from tissue. For the particular needs of tissue engineering scaffolds, fibrous proteins like collagens, elastin, silks and combinations of these offer further advantages of natural well-defined structural scaffolds as well as endless possibilities of controlling functionality by genetic manipulation. (topical review)

  19. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    Science.gov (United States)

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  20. Weft-knitted silk-poly(lactide-co-glycolide) mesh scaffold combined with collagen matrix and seeded with mesenchymal stem cells for rabbit Achilles tendon repair.

    Science.gov (United States)

    Zhang, Wenyuan; Yang, Yadong; Zhang, Keji; Li, Ying; Fang, Guojian

    2015-02-01

    Natural silk fibroin fiber scaffolds have excellent mechanical properties, but degrade slowly. In this study, we used poly(lactide-co-glycolide) (PLGA, 10:90) fibers to adjust the overall degradation rate of the scaffolds and filled them with collagen to reserve space for cell growth. Silk fibroin-PLGA (36:64) mesh scaffolds were prepared using weft-knitting, filled with type I collagen, and incubated with rabbit autologous bone marrow-derived mesenchymal stem cells (MSCs). These scaffold-cells composites were implanted into rabbit Achilles tendon defects. At 16 weeks after implantation, morphological and histological observations showed formation of tendon-like tissues that expressed type I collagen mRNA and a uniformly dense distribution of collagen fibers. The maximum load of the regenerated Achilles tendon was 58.32% of normal Achilles tendon, which was significantly higher than control group without MSCs. These findings suggest that it is feasible to construct tissue engineered tendon using weft-knitted silk fibroin-PLGA fiber mesh/collagen matrix seeded with MSCs for rabbit Achilles tendon defect repair.

  1. Continuous infusion (CI) 5-FU and leucovorin (LCV) combined with hepatic (H), nodal (N), and tumor bed (TB) irradiation (XRT) following pancreaticoduodenectomy (PDD) for head of pancreas (HOP) and other periampullary (PA) adenocarcinoma

    International Nuclear Information System (INIS)

    Abrams, R.A.; Yeo, C.J.; Grochow, L.B.; Chakravarthy, A.; Sohn, T.A.; Zahurek, M.L.; Haulk, T.; Ord, S.; Hruban, R.H.; Lillemoe, K.D.; Pitt, H.A.; Cameron, J.L.

    1996-01-01

    Purpose: To make preliminary assessment of whether use of this regimen in the post PDD adjuvant context is associated with: (1) an acceptable toxicity profile and (2) encouraging survival results as compared to either no or standard (GITSG) adjuvant (adj) therapy. Methods: From 10/1/91 through 9/30/95 28 post PDD patients (pts) (21 HOP, 7 PA) received adj chemoxrt with CI 5-FU (200 mg/m 2 ) and LCV (5 mg/m 2 ) via a semi-permanent central line Monday thru Friday along with H, N, and TB XRT. The first 18 pts received XRT doses of 2340 cGy (H) and 5040 cGy (N and TB). The last 10 pts received XRT doses of 2700 cGy (H), 5400 cGy (N), and 5760 cGy (TB). Fraction size = 180 cGy. XRT was administered after computerized and CAT scan based planning using 6 MV or greater photon energy. Therapy began within 10 wks of PDD. 1 month following chemoxrt, pts were to begin the first of 4 monthly cycles of 5-FU/LCV given without xrt but at the same doses and scheduled Monday thru Friday for 2 weeks on followed by 2 weeks off. Results: (M(F)) ratio (12(16)). The median age was 58 yrs (range 44-76). 23 pts had +ve nodes (10 pts had 5 or more +ve nodes). 6 pts had microscopically +ve resection margins of whom 5 also had +ve nodes. 26 pts completed chemoxrt as planned. 1 pt failed to complete chemoxrt due to the onset of immune thrombocytopenia. 1 pt completed after delay due to family death. 15 pts did not complete the planned 4 cycles of 5-FU/LCV (9-disease progression on therapy, 3-toxicity, 3-other). 9 pts had IV catheter problems. 7 pts had mild to moderate emotional depression while on therapy. Pts were monitored for wt loss, decline in performance status, liver, GI, heme, esophageal, oral mucosal and hand/foot toxicities. There were no grade (4(5)) toxicities. The only grade 3 toxicities were hepatic (3 pts) (elevations in AST, ALT, OR ALK PHOS without jaundice or hepatic failure). Median actuarial survival for these 28 pts was 15 months (20 pts deceased). For the 21 HOP pts

  2. Cell–scaffold interaction within engineered tissue

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Haiping; Liu, Yuanyuan, E-mail: Yuanyuan_liu@shu.edu.cn; Jiang, Zhenglong; Chen, Weihua; Yu, Yongzhe; Hu, Qingxi

    2014-05-01

    The structure of a tissue engineering scaffold plays an important role in modulating tissue growth. A novel gelatin–chitosan (Gel–Cs) scaffold with a unique structure produced by three-dimensional printing (3DP) technology combining with vacuum freeze-drying has been developed for tissue-engineering applications. The scaffold composed of overall construction, micro-pore, surface morphology, and effective mechanical property. Such a structure meets the essential design criteria of an ideal engineered scaffold. The favorable cell–matrix interaction supports the active biocompatibility of the structure. The structure is capable of supporting cell attachment and proliferation. Cells seeded into this structure tend to maintain phenotypic shape and secreted large amounts of extracellular matrix (ECM) and the cell growth decreased the mechanical properties of scaffold. This novel biodegradable scaffold has potential applications for tissue engineering based upon its unique structure, which acts to support cell growth. - Highlights: • The scaffold is not only for providing a surface for cell residence but also for determining cell phenotype and retaining structural integrity. • The mechanical property of scaffold can be affected by activities of cell. • The scaffold provides a microenvironment for cell attachment, growth, and migration.

  3. Neuronal Networks on Nanocellulose Scaffolds.

    Science.gov (United States)

    Jonsson, Malin; Brackmann, Christian; Puchades, Maja; Brattås, Karoline; Ewing, Andrew; Gatenholm, Paul; Enejder, Annika

    2015-11-01

    Proliferation, integration, and neurite extension of PC12 cells, a widely used culture model for cholinergic neurons, were studied in nanocellulose scaffolds biosynthesized by Gluconacetobacter xylinus to allow a three-dimensional (3D) extension of neurites better mimicking neuronal networks in tissue. The interaction with control scaffolds was compared with cationized nanocellulose (trimethyl ammonium betahydroxy propyl [TMAHP] cellulose) to investigate the impact of surface charges on the cell interaction mechanisms. Furthermore, coatings with extracellular matrix proteins (collagen, fibronectin, and laminin) were investigated to determine the importance of integrin-mediated cell attachment. Cell proliferation was evaluated by a cellular proliferation assay, while cell integration and neurite propagation were studied by simultaneous label-free Coherent anti-Stokes Raman Scattering and second harmonic generation microscopy, providing 3D images of PC12 cells and arrangement of nanocellulose fibrils, respectively. Cell attachment and proliferation were enhanced by TMAHP modification, but not by protein coating. Protein coating instead promoted active interaction between the cells and the scaffold, hence lateral cell migration and integration. Irrespective of surface modification, deepest cell integration measured was one to two cell layers, whereas neurites have a capacity to integrate deeper than the cell bodies in the scaffold due to their fine dimensions and amoeba-like migration pattern. Neurites with lengths of >50 μm were observed, successfully connecting individual cells and cell clusters. In conclusion, TMAHP-modified nanocellulose scaffolds promote initial cellular scaffold adhesion, which combined with additional cell-scaffold treatments enables further formation of 3D neuronal networks.

  4. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    Science.gov (United States)

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Hopping models for ion conduction in noncrystals

    DEFF Research Database (Denmark)

    Dyre, Jeppe; Schrøder, Thomas

    2007-01-01

    semiconductors). These universalities are subject of much current interest, for instance interpreted in the context of simple hopping models. In the present paper we first discuss the temperature dependence of the dc conductivity in hopping models and the importance of the percolation phenomenon. Next......, the experimental (quasi)universality of the ac conductivity is discussed. It is shown that hopping models are able to reproduce the experimental finding that the response obeys time-temperature superposition, while at the same time a broad range of activation energies is involved in the conduction process. Again...

  6. Variable range hopping in ZnO films

    Science.gov (United States)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  7. Combined Effect of a Microporous Layer and Type I Collagen Coating on a Biphasic Calcium Phosphate Scaffold for Bone Tissue Engineering

    OpenAIRE

    Mun-Hwan Lee; Changkook You; Kyo-Han Kim

    2015-01-01

    In this study, type I collagen was coated onto unmodified and modified microporous biphasic calcium phosphate (BCP) scaffolds. Surface characterization using a scanning electron microscope (SEM) and a surface goniometer confirmed the modification of the BCP coating. The quantity of the collagen coating was investigated using Sirius Red staining, and quantitative assessment of the collagen coating showed no significant differences between the two groups. MG63 cells were used to evaluate cell p...

  8. Hopping absorption edge in silicon inversion layers

    International Nuclear Information System (INIS)

    Kostadinov, I.Z.

    1983-09-01

    The low frequency gap observed in the absorption spectrum of silicon inversion layers is related to the AC variable range hopping. The frequency dependence of the absorption coefficient is calculated. (author)

  9. Hip-hop, Onegin - pop! / Tatjana Aleksandrova

    Index Scriptorium Estoniae

    Aleksandrova, Tatjana, 1945-

    2004-01-01

    Erateatrikooli KS, mida juhib Svetlana Krassman, lavastus A. Pushkini poeemi "Jevgeni Onegin" motiividel. Noortelavastuse muusikalises seades kasutatakse klassikalise muusika aranzheeringuid ja räppi, kostüümidraamat koos hip-hop rõivastiiliga

  10. Beer spoilage bacteria and hop resistance.

    Science.gov (United States)

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However

  11. Degradation of hop bitter acids by fungi

    International Nuclear Information System (INIS)

    Huszcza, Ewa; Bartmanska, Agnieszka; Aniol, Miroslaw; Maczka, Wanda; Zolnierczyk, Anna; Wawrzenczyk, Czeslaw

    2008-01-01

    Nine fungal strains related to: Trametes versicolor, Nigrospora oryzae, Inonotus radiatus, Crumenulopsis sororia, Coryneum betulinum, Cryptosporiopsis radicicola, Fusarium equiseti, Rhodotorula glutinis and Candida parapsilosis were tested for their ability to degrade humulones and lupulones. The best results were obtained for T. versicolor culture, in which humulones and lupulones were fully degraded after 4 days of incubation in the dark or after 36 h in the light. The experiments were performed on a commercial hop extract and on sterilized spent hops

  12. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2012-01-01

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a

  13. Nano/micro hybrid scaffold of PCL or P3HB nanofibers combined with silk fibroin for tendon and ligament tissue engineering.

    Science.gov (United States)

    Naghashzargar, Elham; Farè, Silvia; Catto, Valentina; Bertoldi, Serena; Semnani, Dariush; Karbasi, Saeed; Tanzi, Maria Cristina

    2015-07-04

    A novel biodegradable nano/micro hybrid structure was obtained by electrospinning P3HB or PCL nanofibers onto a twisted silk fibroin (SF) structure, with the aim of fabricating a suitable scaffold for tendon and ligament tissue engineering. The electrospinning (ES) processing parameters for P3HB and PCL were optimized on 2D samples, and applied to produce two different nano/micro hybrid constructs (SF/ES-PCL and SF/ES-P3HB).Morphological, chemico-physical and mechanical properties of the novel hybrid scaffolds were evaluated by SEM, ATR FT-IR, DSC, tensile and thermodynamic mechanical tests. The results demonstrated that the nanofibers were tightly wrapped around the silk filaments, and the crystallinity of the SF twisted yarns was not influenced by the presence of the electrospun polymers. The slightly higher mechanical properties of the hybrid constructs confirmed an increase of internal forces due to the interaction between nano and micro components. Cell culture tests with L929 fibroblasts, in the presence of the sample eluates or in direct contact with the hybrid structures, showed no cytotoxic effects and a good level of cytocompatibility of the nano/micro hybrid structures in term of cell viability, particularly at day 1. Cell viability onto the nano/micro hybrid structures decreased from the first to the third day of culture when compared with the control culture plastic, but appeared to be higher when compared with the uncoated SF yarns. Although additional in vitro and in vivo tests are needed, the original fabrication method here described appears promising for scaffolds suitable for tendon and ligament tissue engineering.

  14. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    Science.gov (United States)

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  15. Formation of proteoglycan and collagen-rich scaffold-free stiff cartilaginous tissue using two-step culture methods with combinations of growth factors.

    Science.gov (United States)

    Miyazaki, Tatsuya; Miyauchi, Satoshi; Matsuzaka, Satoshi; Yamagishi, Chie; Kobayashi, Kohei

    2010-05-01

    Tissue-engineered cartilage may be expected to serve as an alternative to autologous chondrocyte transplantation treatment. Several methods for producing cartilaginous tissue have been reported. In this study, we describe the production of scaffold-free stiff cartilaginous tissue of pig and human, using allogeneic serum and growth factors. The tissue was formed in a mold using chondrocytes recovered from alginate bead culture and maintained in a medium with transforming growth factor-beta and several other additives. In the case of porcine tissue, the tear strength of the tissue and the contents of proteoglycan (PG) and collagen per unit of DNA increased dose-dependently with transforming growth factor-beta. The length of culture was significantly and positively correlated with thickness, tear strength, and PG and collagen contents. Tear strength showed positive high correlations with both PG and collagen contents. A positive correlation was also seen between PG content and collagen content. Similar results were obtained with human cartilaginous tissue formed from chondrocytes expanded in monolayer culture. Further, an in vivo pilot study using pig articular cartilage defect model demonstrated that the cartilaginous tissue was well integrated with surrounding tissue at 13 weeks after the implantation. In conclusion, we successfully produced implantable scaffold-free stiff cartilaginous tissue, which characterized high PG and collagen contents.

  16. RAZVOJ OBLAČIL V HIP HOP KULTURI

    OpenAIRE

    Marić, Sanja

    2010-01-01

    V diplomskem delu smo raziskovali, kako so se hip hop oblačila razvijala skozi obdobja v hip hop kulturi. V teoretičnem deli smo ugotavljali ozadje in dejavnike, ki so vplivali na razvoj hip hop kulture, v empiričnem delu diplomske naloge pa smo izvedli anketni vprašalnik z glavnimi akterji hip hop kulture na slovenski hip hop sceni. Rezultati, ki smo jih dobili, kažejo da so imela oblačila velik vpliv na prepoznavnost in razvoj hip hop kulture po celem svetu. K temu so največ pripomogli ustv...

  17. Collective probabilities algorithm for surface hopping calculations

    International Nuclear Information System (INIS)

    Bastida, Adolfo; Cruz, Carlos; Zuniga, Jose; Requena, Alberto

    2003-01-01

    General equations that transition probabilities of the hopping algorithms in surface hopping calculations must obey to assure the equality between the average quantum and classical populations are derived. These equations are solved for two particular cases. In the first it is assumed that probabilities are the same for all trajectories and that the number of hops is kept to a minimum. These assumptions specify the collective probabilities (CP) algorithm, for which the transition probabilities depend on the average populations for all trajectories. In the second case, the probabilities for each trajectory are supposed to be completely independent of the results from the other trajectories. There is, then, a unique solution of the general equations assuring that the transition probabilities are equal to the quantum population of the target state, which is referred to as the independent probabilities (IP) algorithm. The fewest switches (FS) algorithm developed by Tully is accordingly understood as an approximate hopping algorithm which takes elements from the accurate CP and IP solutions. A numerical test of all these hopping algorithms is carried out for a one-dimensional two-state problem with two avoiding crossings which shows the accuracy and computational efficiency of the collective probabilities algorithm proposed, the limitations of the FS algorithm and the similarity between the results offered by the IP algorithm and those obtained with the Ehrenfest method

  18. Two-surface Monte Carlo with basin hopping: quantum mechanical trajectory and multiple stationary points of water cluster.

    Science.gov (United States)

    Bandyopadhyay, Pradipta

    2008-04-07

    The efficiency of the two-surface monte carlo (TSMC) method depends on the closeness of the actual potential and the biasing potential used to propagate the system of interest. In this work, it is shown that by combining the basin hopping method with TSMC, the efficiency of the method can be increased by several folds. TSMC with basin hopping is used to generate quantum mechanical trajectory and large number of stationary points of water clusters.

  19. Surface-enrichment with hydroxyapatite nanoparticles in stereolithography-fabricated composite polymer scaffolds promotes bone repair

    NARCIS (Netherlands)

    Guillaume, O.; Geven, M. A.; Sprecher, C. M.; Stadelmann, V. A.; Grijpma, D. W.; Tang, T.T.; Qin, L.; Lai, Y.; Alini, M.; de Bruijn, J. D.; Yuan, H.; Richards, R.G.; Eglin, D.

    2017-01-01

    Fabrication of composite scaffolds using stereolithography (SLA) for bone tissue engineering has shown great promises. However, in order to trigger effective bone formation and implant integration, exogenous growth factors are commonly combined to scaffold materials. In this study, we fabricated

  20. Research on synchronization technology of frequency hopping communication system

    Science.gov (United States)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  1. Hip-Hopping across China: Intercultural Formulations of Local Identities

    Science.gov (United States)

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  2. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    Science.gov (United States)

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  3. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    Science.gov (United States)

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  4. Performance analysis of multi-hop wireless packet networks

    Directory of Open Access Journals (Sweden)

    Lim J.-T.

    1997-01-01

    Full Text Available In this paper, a unified analytical framework for performance analysis of multi-hop wireless packet networks is developed. The effect of coupling between the hops on the degradation of the delay-throughput characteristics and the probability of blocking is investigated. The issue of hop decoupling is addressed.

  5. Uudised : Ooper. Hip-hop. Madonna

    Index Scriptorium Estoniae

    2005-01-01

    Rumeenia sopran Nelly Miricioiu Vincenzo Bellini ooperi "Norma" nimiosas Nederlandse Operas Amsaterdamis 7.-28. märtsini. 4. märtsil Tallinna klubis Hollywood üritusel "Hip-Hop Café" New Yorgi duo Camp Lo. Ameerika poplaulja Madonna võttis vastu filmirolli

  6. Injury incidence in hip hop dance.

    Science.gov (United States)

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  7. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    Science.gov (United States)

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  8. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  9. Bioactive Nano-fibrous Scaffold for Vascularized Craniofacial Bone Regeneration

    DEFF Research Database (Denmark)

    Prabha, Rahul Damodaran; Kraft, David Christian Evar; Harkness, Linda

    2018-01-01

    the limitation of cell penetration of electrospun scaffolds and improve on its osteoconductive nature, in this study, we fabricated a novel electrospun composite scaffold of polyvinyl alcohol (PVA) - poly (ε) caprolactone (PCL) - Bioceramic (HAB), namely, PVA-PCL-HAB. The scaffold prepared by dual...... electrospinning of PVA and PCL with HAB overcomes reduced cell attachment associated with hydrophobic poly (ε) caprolactone (PCL) by combination with a hydrophilic polyvinyl alcohol (PVA) and the bioceramic (HAB) can contribute to enhance osteo-conductivity. We characterized the physicochemical...... and biocompatibility properties of the new scaffold material. Our results indicate PVA-PCL-HAB scaffolds support attachment and growth of stromal stem cells; (human bone marrow skeletal (mesenchymal) stem cells (hMSC) and dental pulp stem cells (DPSC)). In addition, the scaffold supported in vitro osteogenic...

  10. Impedance Spectroscopic Characterisation of Porosity in 3D Cell Culture Scaffolds with Different Channel Networks

    DEFF Research Database (Denmark)

    Canali, Chiara; Mohanty, Soumyaranjan; Heiskanen, Arto

    2015-01-01

    We present the application of electrochemical impedance spectroscopy (EIS) as a method for discriminating between different polydimethylsiloxane (PDMS) scaffolds for three-dimensional (3D) cell cultures. The validity of EIS characterisation for scaffolds having different degree of porosity...... serve as means of single-frequency measurements for fast scaffold characterization combined with in vitro monitoring of 3D cell cultures....

  11. Epigenetic changes detected in micropropagated hop plants.

    Science.gov (United States)

    Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

    2009-07-01

    Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

  12. Quantitation of 4-Methyl-4-sulfanylpentan-2-one (4MSP) in Hops by a Stable Isotope Dilution Assay in Combination with GC×GC-TOFMS: Method Development and Application To Study the Influence of Variety, Provenance, Harvest Year, and Processing on 4MSP Concentrations.

    Science.gov (United States)

    Reglitz, Klaas; Steinhaus, Martin

    2017-03-22

    A stable isotope dilution assay was developed for quantitation of 4-methyl-4-sulfanylpentan-2-one (4MSP) in hops. The approach included the use of 4-( 13 C)methyl-4-sulfanyl(1,3,5- 13 C 3 )pentan-2-one as internal standard, selective isolation of hop thiols by mercurated agarose, and GC×GC-TOFMS analysis. Application of the method to 53 different hop samples revealed 4MSP concentrations between <1 and 114 μg/kg. Notably high concentrations were associated with United States varieties such as Citra, Eureka, Simcoe, and Apollo, whereas 4MSP was absent from traditional German and English varieties. Further experiments showed that besides the variety, also harvest year and storage vitally influenced 4MSP concentrations, whereas the impact of provenance was less pronounced. Hop processing such as drying and pelletizing had only a minor impact on 4MSP concentrations. Like the majority of other hop volatiles, 4MSP is predominantly located in the lupulin glands.

  13. Exploiting Multi-user Diversity and Multi-hop Diversity in Dual-hop Broadcast Channels

    KAUST Repository

    Zafar, Ammar

    2013-05-21

    We propose joint user-and-hop scheduling over dual-hop block-fading broadcast channels in order to exploit multi-user diversity gains and multi-hop diversity gains all together. To achieve this objective, the first and second hops are scheduled opportunistically based on the channel state information. The joint scheduling problem is formulated as maximizing the weighted sum of the long term achievable rates of the users under a stability constraint, which means that in the long term the rate received by the relay should equal the rate transmitted by it, in addition to power constraints. We show that this problem is equivalent to a single-hop broadcast channel by treating the source as a virtual user with an optimal weight that maintains the stability constraint. We show how to obtain the source weight either off-line based on channel statistics or on real-time based on channel measurements. Furthermore, we consider special cases including the maximum sum-rate scheduler and the proportional fair scheduler. We also show how to extend the scheme into one that allows multiple user scheduling via superposition coding with successive decoding. Numerical results demonstrate that our proposed joint scheduling scheme enlarges the rate region as compared to scheduling schemes that exploit the diversity gains partially.

  14. Uudised : Pop-karneval. Hip-hop

    Index Scriptorium Estoniae

    2005-01-01

    Muusika- ja kunstikarnevalist "Beta Bubble" 1. apr. Tallinnas Von Krahlis. Pärnu taasühinenud hip-hop-bänd Noizmakaz (TommyBoy ja Alko) sõlmis lepingu plaadifirmaga Mindnote ja annab selle alt apr. keskel välja oma teise albumi "Valitud mõtted".1. apr. tuleb müügile Noizmakazi singel "Miski muu ei loe", debüüt "Social Poetry" ilmus aastal 2001

  15. Small polaron hopping in magnetic semiconductors

    International Nuclear Information System (INIS)

    Emin, D.; Liu, N.L.H.

    1978-01-01

    In a number of magnetic insulators it has been hypothesized that the charge carriers form small polarons. The transfer of an electron between magnetic sites and how the magnetic nature of the material affects the rate which characterizes small-polaron hops between magnetic sites were studied. The basic transfer processes are addressed from a many-electron point in which the itinerant electron is treated as indistinguishable from those which contribute unpaired spins at the magnetic sites

  16. Chitosan composite three dimensional macrospheric scaffolds for bone tissue engineering.

    Science.gov (United States)

    Vyas, Veena; Kaur, Tejinder; Thirugnanam, Arunachalam

    2017-11-01

    The present work deals with the fabrication of chitosan composite scaffolds with controllable and predictable internal architecture for bone tissue engineering. Chitosan (CS) based composites were developed by varying montmorillonite (MMT) and hydroxyapatite (HA) combinations to fabricate macrospheric three dimensional (3D) scaffolds by direct agglomeration of the sintered macrospheres. The fabricated CS, CS/MMT, CS/HA and CS/MMT/HA 3D scaffolds were characterized for their physicochemical, biological and mechanical properties. The XRD and ATR-FTIR studies confirmed the presence of the individual constituents and the molecular interaction between them, respectively. The reinforcement with HA and MMT showed reduced swelling and degradation rate. It was found that in comparison to pure CS, the CS/HA/MMT composites exhibited improved hemocompatibility and protein adsorption. The sintering of the macrospheres controlled the swelling ability of the scaffolds which played an important role in maintaining the mechanical strength of the 3D scaffolds. The CS/HA/MMT composite scaffold showed 14 folds increase in the compressive strength when compared to pure CS scaffolds. The fabricated scaffolds were also found to encourage the MG 63 cell proliferation. Hence, from the above studies it can be concluded that the CS/HA/MMT composite 3D macrospheric scaffolds have wider and more practical application in bone tissue regeneration applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Exact approaches for scaffolding

    OpenAIRE

    Weller, Mathias; Chateau, Annie; Giroudeau, Rodolphe

    2015-01-01

    This paper presents new structural and algorithmic results around the scaffolding problem, which occurs prominently in next generation sequencing. The problem can be formalized as an optimization problem on a special graph, the "scaffold graph". We prove that the problem is polynomial if this graph is a tree by providing a dynamic programming algorithm for this case. This algorithm serves as a basis to deduce an exact algorithm for general graphs using a tree decomposition of the input. We ex...

  18. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    Science.gov (United States)

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  19. Membrane supported scaffold architectures for tissue engineering

    NARCIS (Netherlands)

    Bettahalli Narasimha, M.S.

    2011-01-01

    Tissue engineering aims at restoring or regenerating a damaged tissue. Often the tissue recreation occurs by combining cells, derived from a patient biopsy, onto a 3D porous matrix, functioning as a scaffold. One of the current limitations of tissue engineering is the inability to provide sufficient

  20. Multiscale fabrication of biomimetic scaffolds for tympanic membrane tissue engineering

    International Nuclear Information System (INIS)

    Mota, Carlos; Danti, Serena; D’Alessandro, Delfo; Trombi, Luisa; Ricci, Claudio; Berrettini, Stefano; Puppi, Dario; Dinucci, Dinuccio; Chiellini, Federica; Milazzo, Mario; Stefanini, Cesare; Moroni, Lorenzo

    2015-01-01

    The tympanic membrane (TM) is a thin tissue able to efficiently collect and transmit sound vibrations across the middle ear thanks to the particular orientation of its collagen fibers, radiate on one side and circular on the opposite side. Through the combination of advanced scaffolds and autologous cells, tissue engineering (TE) could offer valuable alternatives to autografting in major TM lesions. In this study, a multiscale approach based on electrospinning (ES) and additive manufacturing (AM) was investigated to fabricate scaffolds, based on FDA approved copolymers, resembling the anatomic features and collagen fiber arrangement of the human TM. A single scale TM scaffold was manufactured using a custom-made collector designed to confer a radial macro-arrangement to poly(lactic-co-glycolic acid) electrospun fibers during their deposition. Dual and triple scale scaffolds were fabricated combining conventional ES with AM to produce poly(ethylene oxide terephthalate)/poly(butylene terephthalate) block copolymer scaffolds with anatomic-like architecture. The processing parameters were optimized for each manufacturing method and copolymer. TM scaffolds were cultured in vitro with human mesenchymal stromal cells, which were viable, metabolically active and organized following the anisotropic character of the scaffolds. The highest viability, cell density and protein content were detected in dual and triple scale scaffolds. Our findings showed that these biomimetic micro-patterned substrates enabled cell disposal along architectural directions, thus appearing as promising substrates for developing functional TM replacements via TE. (paper)

  1. Nonregenerative Dual-Hop Cooperative Links with Selection Diversity

    Directory of Open Access Journals (Sweden)

    Karagiannidis George K

    2006-01-01

    Full Text Available The end-to-end performance of dual-hop cooperative diversity systems equipped with nonregenerative relays and a selection combining receiver at the destination terminal over independent and nonidentical Nakagami- fading channels is studied. Closed-form expressions for the cumulative distribution function and the probability density function of the end-to-end signal-to-noise ratio ( are presented, while analytical formulae are derived for the moments and the moment generating function. Using these statistical results, closed-form expressions for the outage probability are presented for both channel state information and fixed gain relays. Furthermore, for the case of fixed gain relay, the average end-to-end , the amount of fading, and the average bit error rate can be numerically evaluated. The proposed mathematical analysis is complemented by numerical examples, including the effects on the overall performance of the s unbalancing as well as the fading severity.

  2. Design and Dynamics Analysis of a Bio-Inspired Intermittent Hopping Robot for Planetary Surface Exploration

    Directory of Open Access Journals (Sweden)

    Long Bai

    2012-10-01

    Full Text Available A small, bio-inspired and minimally actuated intermittent hopping robot for planetary surface exploration is proposed in this paper. The robot uses a combined-geared six-bar linkage/spring mechanism, which has a possible rich trajectory and metamorphic characteristics and, due to this, the robot is able to recharge, lock/release and jump by using just a micro-power motor as the actuator. Since the robotic system has a closed-chain structure and employs underactuated redundant motion, the constrained multi-body dynamics are derived with time-varying driving parameters and ground unilateral constraint both taken into consideration. In addition, the established dynamics equations, mixed of higher order differential and algebraic expressions, are solved by the immediate integration algorithm. A prototype is implemented and experiments are carried out. The results show that the robot, using a micro-power motor as the actuator and solar cells as the power supply, can achieve a biomimetic multi-body hopping stance and a nonlinearly increasing driving force. Typically, the robot can jump a horizontal distance of about 1 m and a vertical height of about 0.3 m, with its trunk and foot moving stably during takeoff. In addition, the computational and experimental results are consistent as regards the hopping performance of the robot, which suggests that the proposed dynamics model and its solution have general applicability to motion prediction and the performance analysis of intermittent hopping robots.

  3. Analysis of the trajectory surface hopping method from the Markov state model perspective

    International Nuclear Information System (INIS)

    Akimov, Alexey V.; Wang, Linjun; Prezhdo, Oleg V.; Trivedi, Dhara

    2015-01-01

    We analyze the applicability of the seminal fewest switches surface hopping (FSSH) method of Tully to modeling quantum transitions between electronic states that are not coupled directly, in the processes such as Auger recombination. We address the known deficiency of the method to describe such transitions by introducing an alternative definition for the surface hopping probabilities, as derived from the Markov state model perspective. We show that the resulting transition probabilities simplify to the quantum state populations derived from the time-dependent Schrödinger equation, reducing to the rapidly switching surface hopping approach of Tully and Preston. The resulting surface hopping scheme is simple and appeals to the fundamentals of quantum mechanics. The computational approach is similar to the FSSH method of Tully, yet it leads to a notably different performance. We demonstrate that the method is particularly accurate when applied to superexchange modeling. We further show improved accuracy of the method, when applied to one of the standard test problems. Finally, we adapt the derived scheme to atomistic simulation, combine it with the time-domain density functional theory, and show that it provides the Auger energy transfer timescales which are in good agreement with experiment, significantly improving upon other considered techniques. (author)

  4. [Strategies to choose scaffold materials for tissue engineering].

    Science.gov (United States)

    Gao, Qingdong; Zhu, Xulong; Xiang, Junxi; Lü, Yi; Li, Jianhui

    2016-02-01

    mixed with sustained-release nano-microsphere containing growth factors. What's more, the stent internal surface coated with glue/collagen matrix mixing layer containing bFGF and EGF so could supplying the early release of the two cytokines. Finally, combining the poly(L-lactic acid)/poly(ε-caprolactone) biliary stent with the induced cells was the last step for preparing tissue-engineered bile duct. This literature reviewed a variety of the existing tissue engineering scaffold materials and briefly introduced the impact factors on the characteristics of tissue engineering scaffold materials such as preparation procedure, surface modification of scaffold, and so on. We explored the choosing strategy of desired tissue engineering scaffold materials.

  5. Analysis of the in vitro degradation and the in vivo tissue response to bi-layered 3D-printed scaffolds combining PLA and biphasic PLA/bioglass components - Guidance of the inflammatory response as basis for osteochondral regeneration.

    Science.gov (United States)

    Barbeck, Mike; Serra, Tiziano; Booms, Patrick; Stojanovic, Sanja; Najman, Stevo; Engel, Elisabeth; Sader, Robert; Kirkpatrick, Charles James; Navarro, Melba; Ghanaati, Shahram

    2017-12-01

    The aim of the present study was the in vitro and in vivo analysis of a bi-layered 3D-printed scaffold combining a PLA layer and a biphasic PLA/bioglass G5 layer for regeneration of osteochondral defects in vivo Focus of the in vitro analysis was on the (molecular) weight loss and the morphological and mechanical variations after immersion in SBF. The in vivo study focused on analysis of the tissue reactions and differences in the implant bed vascularization using an established subcutaneous implantation model in CD-1 mice and established histological and histomorphometrical methods. Both scaffold parts kept their structural integrity, while changes in morphology were observed, especially for the PLA/G5 scaffold. Mechanical properties decreased with progressive degradation, while the PLA/G5 scaffolds presented higher compressive modulus than PLA scaffolds. The tissue reaction to PLA included low numbers of BMGCs and minimal vascularization of its implant beds, while the addition of G5 lead to higher numbers of BMGCs and a higher implant bed vascularization. Analysis revealed that the use of a bi-layered scaffold shows the ability to observe distinct in vivo response despite the physical proximity of PLA and PLA/G5 layers. Altogether, the results showed that the addition of G5 enables to reduce scaffold weight loss and to increase mechanical strength. Furthermore, the addition of G5 lead to a higher vascularization of the implant bed required as basis for bone tissue regeneration mediated by higher numbers of BMGCs, while within the PLA parts a significantly lower vascularization was found optimally for chondral regeneration. Thus, this data show that the analyzed bi-layered scaffold may serve as an ideal basis for the regeneration of osteochondral tissue defects. Additionally, the results show that it might be able to reduce the number of experimental animals required as it may be possible to analyze the tissue response to more than one implant in one

  6. Comparison of Low-Complexity Diversity Schemes for Dual-Hop AF Relaying Systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-02-13

    This paper investigates the performance of two low-complexity combining schemes, which are based on one- or two-phase observation, to mitigate multipath fading in dual-hop amplify-and-forward relaying systems. For the one-phase-based combining, a single-antenna station is assumed to relay information from a multiple-antenna transmitter to a multiple-antenna receiver, and the activation of the receive antennas is adaptively performed based on the second-hop statistics, regardless of the first-hop conditions. On the other hand, the two-phase-based combining suggests using multiple single-antenna stations between the multiple-antenna transmitter and the single-antenna receiver, where the suitable set of active relays is identified according to the precombining end-to-end fading conditions. To facilitate comparisons between the two schemes, formulations for the statistics of the combined signal-to-noise ratio and some performance measures are presented. Numerical and simulation results are shown to clarify the tradeoff between the achieved diversity-array gain, the processing complexity, and the power consumption.

  7. Hip-Hop Is the Healer: Sense of Belonging and Diversity among Hip-Hop Collegians

    Science.gov (United States)

    Sulé, V. Thandi

    2016-01-01

    Sense of belonging is recognized as a factor contributing to persistence to graduation. Furthermore, interactional diversity is associated with learning and civic outcomes--touted higher education goals. Hip-hop culture, one of the most influential cultural creations of the mid-20th century, has succeeded in attracting devotees from diverse…

  8. Extraction of bitter acids from hops and hop products using pressurized solvent extraction (PSE)

    Czech Academy of Sciences Publication Activity Database

    Čulík, J.; Jurková, M.; Horák, T.; Čejka, P.; Kellner, V.; Dvořák, J.; Karásek, Pavel; Roth, Michal

    2009-01-01

    Roč. 115, č. 3 (2009), s. 220-225 ISSN 0046-9750 R&D Projects: GA ČR GA203/08/1536; GA MŠk 1M0570 Institutional research plan: CEZ:AV0Z40310501 Keywords : hops * bitter acids * pressurized solvent extraction Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.000, year: 2009

  9. Being Hipped to Their Hop: Tapping into Young Minds through Hip Hop Play

    Science.gov (United States)

    Broughton, Anthony

    2017-01-01

    Adults gain a wealth of knowledge from listening to the voices of children through intentional observations and interactions [Owocki, G., and Y. M. Goodman. 2002. "Kidwatching: Documenting Children's Literacy Development." Portsmouth: Heinemann]. Hip Hop play may provide optimal opportunities for teachers to tap into the young minds of…

  10. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  11. Security for multi-hop wireless networks

    CERN Document Server

    Mahmoud, Mohamed M E A

    2014-01-01

    This Springer Brief discusses efficient security protocols and schemes for multi-hop wireless networks. It presents an overview of security requirements for these networks, explores challenges in securing networks and presents system models. The authors introduce mechanisms to reduce the overhead and identify malicious nodes that drop packets intentionally. Also included is a new, efficient cooperation incentive scheme to stimulate the selfish nodes to relay information packets and enforce fairness. Many examples are provided, along with predictions for future directions of the field. Security

  12. The effect of scaffold pore size in cartilage tissue engineering.

    Science.gov (United States)

    Nava, Michele M; Draghi, Lorenza; Giordano, Carmen; Pietrabissa, Riccardo

    2016-07-26

    The effect of scaffold pore size and interconnectivity is undoubtedly a crucial factor for most tissue engineering applications. The aim of this study was to examine the effect of pore size and porosity on cartilage construct development in different scaffolds seeded with articular chondrocytes. We fabricated poly-L-lactide-co-trimethylene carbonate scaffolds with different pore sizes, using a solvent-casting/particulate-leaching technique. We seeded primary bovine articular chondrocytes on these scaffolds, cultured the constructs for 2 weeks and examined cell proliferation, viability and cell-specific production of cartilaginous extracellular matrix proteins, including GAG and collagen. Cell density significantly increased up to 50% with scaffold pore size and porosity, likely facilitated by cell spreading on the internal surface of bigger pores, and by increased mass transport of gases and nutrients to cells, and catabolite removal from cells, allowed by lower diffusion barriers in scaffolds with a higher porosity. However, both the cell metabolic activity and the synthesis of cartilaginous matrix proteins significantly decreased by up to 40% with pore size. We propose that the association of smaller pore diameters, causing 3-dimensional cell aggregation, to a lower oxygenation caused by a lower porosity, could have been the condition that increased the cell-specific synthesis of cartilaginous matrix proteins in the scaffold with the smallest pores and the lowest porosity among those tested. In the initial steps of in vitro cartilage engineering, the combination of small scaffold pores and low porosity is an effective strategy with regard to the promotion of chondrogenesis.

  13. Semiotic Scaffolding in Mathematics

    DEFF Research Database (Denmark)

    Johansen, Mikkel Willum; Misfeldt, Morten

    2015-01-01

    This paper investigates the notion of semiotic scaffolding in relation to mathematics by considering its influence on mathematical activities, and on the evolution of mathematics as a research field. We will do this by analyzing the role different representational forms play in mathematical...... cognition, and more broadly on mathematical activities. In the main part of the paper, we will present and analyze three different cases. For the first case, we investigate the semiotic scaffolding involved in pencil and paper multiplication. For the second case, we investigate how the development of new...... in both mathematical cognition and in the development of mathematics itself, but mathematical cognition cannot itself be reduced to the use of semiotic scaffolding....

  14. 3D printed porous polycaprolactone/oyster shell powder (PCL/OSP) scaffolds for bone tissue engineering

    Science.gov (United States)

    Luo, Wenfeng; Zhang, Shuangying; Lan, Yuewei; Huang, Chen; Wang, Chao; Lai, Xuexu; Chen, Hanwei; Ao, Ningjian

    2018-04-01

    In this work, oyster shell powder (OSP) was used as the bio-filler and combined with polycaprolactone (PCL) through melt blending methodology. The PCL and PCL/OSP scaffolds were prepared using additive manufacturing process. All the 3D printed scaffolds hold a highly porosity and interconnected pore structures. OSP particles are dispersed in the polymer matrix, which helped to improve the degree of crystallinity and mineralization ability of the scaffolds. There was no significant cytotoxicity of the prepared scaffolds towards MG-63 cells, and all the scaffolds showed a well ALP activity. Therefore, PCL/OSP scaffolds had a high potential to be employed in the bone tissue engineering.

  15. Being Hip-Hop: Beyond Skills and Songs

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    In this article, I offer four principles relevant to hip-hop cultures (keep it real, flip the script, make some noise, and stay fresh) and explore how these principles might affect music classrooms. I argue that a music classroom that works to keep it real, flip the script, make some noise, and stay fresh might go beyond teaching hip-hop skills…

  16. Framing Hip Hop: New Methodologies for New Times

    Science.gov (United States)

    Dimitriadis, Greg

    2015-01-01

    This article revisits the central impulse behind early advocacy for ethnographic approaches to hip hop--that critics should try as much as possible to limit their own certainties around what hip hop can and might mean. While ethnographic approaches can engender the kinds of personal dislocations that allow for this negotiation, they do not…

  17. Christian Hip Hop as Pedagogy: A South African Case Study

    Science.gov (United States)

    Abraham, Ibrahim

    2015-01-01

    Drawing on interviews with creators of Christian hip hop music in South Africa, this article demonstrates that this genre of popular music and youth culture is utilised as a form of pedagogy to transmit religious beliefs and values to contemporary youth. The pedagogical aspects of hip hop have been recognised in research on the topic, but the…

  18. Hip-Hop, the "Obama Effect," and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher; Lee, Okhee

    2012-01-01

    Background/Context: With the ever increasing diversity of schools, and the persistent need to develop teaching strategies for the students who attend today's urban schools, hip-hop culture has been proposed to be a means through which urban youth can find success in school. As a result, studies of the role of hip-hop in urban education have grown…

  19. Romani Music - Roma and the Hip-hop Culture

    OpenAIRE

    Dočkal, Tomáš

    2007-01-01

    This thesis is focused on Romani music and its importance for the Romani culture. It examines the popularity of hip-hop among the young Romani generation and Romani hip- hip production. It attempts to define the role of hip-hop culture in young Romanies' lives.

  20. Hip Hop as Empowerment: Voices in El Alto, Bolivia

    Science.gov (United States)

    Tarifa, Ariana

    2012-01-01

    In response to neoliberal policies that have been in place since 1985, Bolivian young people have increasingly used hip hop music as a means of protest and to reclaim social and political participation. Hip hop in Latin America tells the story of the struggles that marginalized people have suffered, and speaks to the effects of international…

  1. Hop powdery mildew control through alteration of spring pruning practices

    Science.gov (United States)

    Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

  2. Investigating Cultural Collision: Educators' Perceptions of Hip-Hop Culture

    Science.gov (United States)

    Beachum, Floyd D.

    2013-01-01

    Hip-hop music has been embraced worldwide by youth, pummeled in the media for supposedly increasing social misery and hailed as a significant musical breakthrough. Hip-hop culture has transcended musical boundaries and now impacts speech, clothing, mannerisms, movies, websites, television programming, magazines, and energy drinks (Dyson, 2007;…

  3. Gap solitons in periodic Schrodinger lattice system with nonlinear hopping

    Directory of Open Access Journals (Sweden)

    Ming Cheng

    2016-10-01

    Full Text Available This article concerns the periodic discrete Schrodinger equation with nonlinear hopping on the infinite integer lattice. We obtain the existence of gap solitons by the linking theorem and concentration compactness method together with a periodic approximation technique. In addition, the behavior of such solutions is studied as $\\alpha\\to 0$. Notice that the nonlinear hopping can be sign changing.

  4. Toward Hip-Hop Pedagogies for Music Education

    Science.gov (United States)

    Kruse, Adam J.

    2016-01-01

    Music education scholarship in the areas of popular, vernacular, and participatory musicianship has grown in the past decades; however, music education research concerned specifically with hip-hop has been relatively scarce. Because hip-hop music can differ tremendously from the traditional western genres with which many music educators are most…

  5. Framing and Reviewing Hip-Hop Educational Research

    Science.gov (United States)

    Petchauer, Emery

    2009-01-01

    Hip-hop has become relevant to the field of education because of its implications for understanding language, learning, identity, curriculum, and other areas. This integrative review provides historical context and cohesion for the burgeoning and discursive body of hip-hop scholarship by framing it according to three heuristic categories and…

  6. Towards a Pedagogy of Hip Hop in Urban Teacher Education

    Science.gov (United States)

    Bridges, Thurman

    2011-01-01

    This article draws from a qualitative study often Black male K-12 teachers from the Hip Hop Generation who are closely connected to Hip Hop culture and have been effective in addressing the academic and social needs of Black boys. Through an analysis of their social, educational and cultural experiences, this article highlights three organizing…

  7. Embroidered polymer-collagen hybrid scaffold variants for ligament tissue engineering.

    Science.gov (United States)

    Hoyer, M; Drechsel, N; Meyer, M; Meier, C; Hinüber, C; Breier, A; Hahner, J; Heinrich, G; Rentsch, C; Garbe, L-A; Ertel, W; Schulze-Tanzil, G; Lohan, A

    2014-10-01

    Embroidery techniques and patterns used for scaffold production allow the adaption of biomechanical scaffold properties. The integration of collagen into embroidered polylactide-co-caprolactone [P(LA-CL)] and polydioxanone (PDS) scaffolds could stimulate neo-tissue formation by anterior cruciate ligament (ACL) cells. Therefore, the aim of this study was to test embroidered P(LA-CL) and PDS scaffolds as hybrid scaffolds in combination with collagen hydrogel, sponge or foam for ligament tissue engineering. ACL cells were cultured on embroidered P(LA-CL) and PDS scaffolds without or with collagen supplementation. Cell adherence, vitality, morphology and ECM synthesis were analyzed. Irrespective of thread size, ACL cells seeded on P(LA-CL) scaffolds without collagen adhered and spread over the threads, whereas the cells formed clusters on PDS and larger areas remained cell-free. Using the collagen hydrogel, the scaffold colonization was limited by the gel instability. The collagen sponge layers integrated into the scaffolds were hardly penetrated by the cells. Collagen foams increased scaffold colonization in P(LA-CL) but did not facilitate direct cell-thread contacts in the PDS scaffolds. The results suggest embroidered P(LA-CL) scaffolds as a more promising basis for tissue engineering an ACL substitute than PDS due to superior cell attachment. Supplementation with a collagen foam presents a promising functionalization strategy. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Fabrication and characterization of strontium incorporated 3-D bioactive glass scaffolds for bone tissue from biosilica

    Energy Technology Data Exchange (ETDEWEB)

    Özarslan, Ali Can, E-mail: alicanozarslan@gmail.com; Yücel, Sevil, E-mail: syucel@yildiz.edu.tr

    2016-11-01

    Bioactive glass scaffolds that contain silica are high viable biomaterials as bone supporters for bone tissue engineering due to their bioactive behaviour in simulated body fluid (SBF). In the human body, these materials help inorganic bone structure formation due to a combination of the particular ratio of elements such as silicon (Si), calcium (Ca), sodium (Na) and phosphorus (P), and the doping of strontium (Sr) into the scaffold structure increases their bioactive behaviour. In this study, bioactive glass scaffolds were produced by using rice hull ash (RHA) silica and commercial silica based bioactive glasses. The structural properties of scaffolds such as pore size, porosity and also the bioactive behaviour were investigated. The results showed that undoped and Sr-doped RHA silica-based bioactive glass scaffolds have better bioactivity than that of commercial silica based bioactive glass scaffolds. Moreover, undoped and Sr-doped RHA silica-based bioactive glass scaffolds will be able to be used instead of undoped and Sr-doped commercial silica based bioactive glass scaffolds for bone regeneration applications. Scaffolds that are produced from undoped or Sr-doped RHA silica have high potential to form new bone for bone defects in tissue engineering. - Highlights: • Production of 3-D bioactive glass scaffolds from different silica sources • The effect of biosilica from rice hull ash on the bioactive glass scaffold • Sr additive impact on the bioactivity and biodegradability properties of scaffolds.

  9. Use of hop extract as antifungal ingredient for bread making and selection of autochthonous resistant starters for sourdough fermentation.

    Science.gov (United States)

    Nionelli, Luana; Pontonio, Erica; Gobbetti, Marco; Rizzello, Carlo Giuseppe

    2018-02-02

    Aiming at meeting the consumers' demand in terms of bio-preservation, the potential of the combination of the lactic acid bacteria fermentation and the addition of hop extract as natural preservative in breadmaking, was exploited. The antifungal properties of a hop (Humulus lupulus) extract were investigated, showing a significant inhibition of the hyphal growth of Aspergillus parasiticus, Penicillium carneum, Penicillium polonicum, Penicillium paneum, Penicillium chermesinum, Aspergillus niger, Penicillium roqueforti. Lactic acid bacteria belonging to species of Enterococcus feacium, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus helveticus, Lactobacillus curvatus, Pediococcus pentosaceus, and Pediococcus acidilactici were isolated from hop and subjected to selection based on kinetics of growth and acidification. The sourdough (hS) enriched with hop extract (hE), started with three selected strains, had phenols concentration and antioxidant activity higher than those obtained in the same condition but without the hE. Hop-sourdough used in breadmaking delayed the fungal growth (14 days), giving a bread characterized by free aminoacids concentration, antioxidant and phytase activities higher than bread started only with baker's yeast, with or without the addition of hE. Specific volume and cell-total area of the bread containing hE improved, and its sensory profile was characterized by typical sourdough attributes, and a moderate bitter/herbaceous perception.

  10. Electronic and vibrational hopping transport in boron carbides

    International Nuclear Information System (INIS)

    Emin, D.

    1991-01-01

    General concepts of hopping-type transport and localization are reviewed. Disorder, electronic correlations and atomic displacements, effects ignored in electronic band structure calculations, foster localization of electronic charge carriers. Examples are given that illustrate the efficacy of these effects in producing localization. This introduction is followed by a brief discussion of the relation between hopping-type transport and localization. The fundamentals of the formation, localization, and hopping transport of small polarons and/or bipolarons is then described. Electronic transport in boron carbides is presented as an example of the adiabatic hopping of small bipolarons. Finally, the notion of vibrational hopping is introduced. The high-temperature thermal diffusion in boron carbides is presented as a potential application of this idea

  11. Vortex variable range hopping in a conventional superconducting film

    Science.gov (United States)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  12. Enhancing Network Quality using Baseband Frequency Hopping, Downlink Power Control and DTX in a Live GSM Network

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wagard, Jeroen; Skjærris, Søren

    1998-01-01

    Baseband frequency hopping in the combination with downlink power control and discontinuous transmission has been investigated as a quality improving feature in a live GSM network. Using the dropped call rate and the frame erasure rate to measure the network quality, the use of frequency hopping...... to the statistical inaccuracy with discontinuous transmission in GSM and maybe due to poor performance of the mobile stations, was encountered. The current status is therefore to reject the use of downlink discontinuous transmission until more information about the performance of the mobile stations is found...

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Bone tissue engineering scaffolding: computer-aided scaffolding techniques.

    Science.gov (United States)

    Thavornyutikarn, Boonlom; Chantarapanich, Nattapon; Sitthiseripratip, Kriskrai; Thouas, George A; Chen, Qizhi

    Tissue engineering is essentially a technique for imitating nature. Natural tissues consist of three components: cells, signalling systems (e.g. growth factors) and extracellular matrix (ECM). The ECM forms a scaffold for its cells. Hence, the engineered tissue construct is an artificial scaffold populated with living cells and signalling molecules. A huge effort has been invested in bone tissue engineering, in which a highly porous scaffold plays a critical role in guiding bone and vascular tissue growth and regeneration in three dimensions. In the last two decades, numerous scaffolding techniques have been developed to fabricate highly interconnective, porous scaffolds for bone tissue engineering applications. This review provides an update on the progress of foaming technology of biomaterials, with a special attention being focused on computer-aided manufacturing (Andrade et al. 2002) techniques. This article starts with a brief introduction of tissue engineering (Bone tissue engineering and scaffolds) and scaffolding materials (Biomaterials used in bone tissue engineering). After a brief reviews on conventional scaffolding techniques (Conventional scaffolding techniques), a number of CAM techniques are reviewed in great detail. For each technique, the structure and mechanical integrity of fabricated scaffolds are discussed in detail. Finally, the advantaged and disadvantage of these techniques are compared (Comparison of scaffolding techniques) and summarised (Summary).

  15. Fabrication and characterization of novel nano-biocomposite scaffold of chitosan–gelatin–alginate–hydroxyapatite for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Chhavi, E-mail: chhavisharma19@gmail.com [Department of Polymer and Process Engineering, Indian Institute of Technology Roorkee, Roorkee (India); Dinda, Amit Kumar, E-mail: amit_dinda@yahoo.com [Department of Molecular Medicine and Biology, Jaslok Hospital and Research Centre, Mumbai 400 026 (India); Potdar, Pravin D., E-mail: ppotdar@jaslokhospital.net [Department of Pathology, All India Institute of Medical Sciences, New Delhi 110029 (India); Chou, Chia-Fu, E-mail: cfchou@phys.sinica.edu.tw [Institute of Physics, Academia Sinica, Taipei 11529, Taiwan (China); Mishra, Narayan Chandra, E-mail: mishrawise@gmail.com [Department of Polymer and Process Engineering, Indian Institute of Technology Roorkee, Roorkee (India)

    2016-07-01

    A novel nano-biocomposite scaffold was fabricated in bead form by applying simple foaming method, using a combination of natural polymers–chitosan, gelatin, alginate and a bioceramic–nano-hydroxyapatite (nHAp). This approach of combining nHAp with natural polymers to fabricate the composite scaffold, can provide good mechanical strength and biological property mimicking natural bone. Environmental scanning electron microscopy (ESEM) images of the nano-biocomposite scaffold revealed the presence of interconnected pores, mostly spread over the whole surface of the scaffold. The nHAp particulates have covered the surface of the composite matrix and made the surface of the scaffold rougher. The scaffold has a porosity of 82% with a mean pore size of 112 ± 19.0 μm. Swelling and degradation studies of the scaffold showed that the scaffold possesses excellent properties of hydrophilicity and biodegradability. Short term mechanical testing of the scaffold does not reveal any rupturing after agitation under physiological conditions, which is an indicative of good mechanical stability of the scaffold. In vitro cell culture studies by seeding osteoblast cells over the composite scaffold showed good cell viability, proliferation rate, adhesion and maintenance of osteoblastic phenotype as indicated by MTT assay, ESEM of cell–scaffold construct, histological staining and gene expression studies, respectively. Thus, it could be stated that the nano-biocomposite scaffold of chitosan–gelatin–alginate–nHAp has the paramount importance for applications in bone tissue-engineering in future regenerative therapies. - Highlights: • nHAp–chitosan–gelatin–alginate composite scaffold was successfully fabricated. • Foaming method, without surfactant, was applied successfully for fabricating the scaffold. • nHAp provided mechanical stability and nanotopographic features to scaffold matrix. • This scaffold shows good biocompatibility and proliferation with

  16. Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

    Science.gov (United States)

    Buchanan, Ian P.

    2013-01-01

    Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

  17. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    Science.gov (United States)

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  18. Nano/macro porous bioactive glass scaffold

    Science.gov (United States)

    Wang, Shaojie

    Bioactive glass (BG) and ceramics have been widely studied and developed as implants to replace hard tissues of the musculo-skeletal system, such as bones and teeth. Recently, instead of using bulk materials, which usually do not degrade rapidly enough and may remain in the human body for a long time, the idea of bioscaffold for tissue regeneration has generated much interest. An ideal bioscaffold is a porous material that would not only provide a three-dimensional structure for the regeneration of natural tissue, but also degrade gradually and, eventually be replaced by the natural tissue completely. Among various material choices the nano-macro dual porous BG appears as the most promising candidate for bioscaffold applications. Here macropores facilitate tissue growth while nanopores control degradation and enhance cell response. The surface area, which controls the degradation of scaffold can also be tuned by changing the nanopore size. However, fabrication of such 3D structure with desirable nano and macro pores has remained challenging. In this dissertation, sol-gel process combined with spinodal decomposition or polymer sponge replication method has been developed to fabricate the nano-macro porous BG scaffolds. Macropores up to 100microm are created by freezing polymer induced spinodal structure through sol-gel transition, while larger macropores (>200um) of predetermined size are obtained by the polymer sponge replication technique. The size of nanopores, which are inherent to the sol-gel method of glass fabrication, has been tailored using several approaches: Before gel point, small nanopores are generated using acid catalyst that leads to weakly-branched polymer-like network. On the other hand, larger nanopores are created with the base-catalyzed gel with highly-branched cluster-like structure. After the gel point, the nanostructure can be further modified by manipulating the sintering temperature and/or the ammonia concentration used in the solvent

  19. Switched diversity strategies for dual-hop amplify-and-forward relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2012-01-01

    This study investigates different receive single-branch switch-based diversity schemes for dual-hop amplify-and-forward relaying networks. Specifically, three receive processing algorithms are adopted, in which the receive branch is selected using the arbitrary selection algorithm, the switching algorithm, or the switching algorithm with post-examining best branch selection. The identification of the receive branch is carried out for two different system models. For the first model, a single-antenna relaying station is used in conjunction with a multiple-antenna transceiver, where the processing is performed independently of the first hop-fading conditions. The second model suggests the use of parallel deployment of single-antenna relays to transfer information from a multiple-antenna transmitter to a single-antenna receiver, where the active relaying station is determined based on the pre-combining end-to-end fading conditions. Performance comparisons for various transmission scenarios on the first hop are presented using new formulations for the statistics of the combined signal-to-noise ratio. Simulation results are also provided to validate the mathematical development and to verify the numerical computations. © 2012 The Institution of Engineering and Technology.

  20. Communication devices for network-hopping communications and methods of network-hopping communications

    Science.gov (United States)

    Buttles, John W

    2013-04-23

    Wireless communication devices include a software-defined radio coupled to processing circuitry. The system controller is configured to execute computer programming code. Storage media is coupled to the system controller and includes computer programming code configured to cause the system controller to configure and reconfigure the software-defined radio to operate on each of a plurality of communication networks according to a selected sequence. Methods for communicating with a wireless device and methods of wireless network-hopping are also disclosed.

  1. Direct current hopping conductance along DNA chain

    Institute of Scientific and Technical Information of China (English)

    Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun

    2007-01-01

    This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.

  2. Bit-padding information guided channel hopping

    KAUST Repository

    Yang, Yuli

    2011-02-01

    In the context of multiple-input multiple-output (MIMO) communications, we propose a bit-padding information guided channel hopping (BP-IGCH) scheme which breaks the limitation that the number of transmit antennas has to be a power of two based on the IGCH concept. The proposed scheme prescribes different bit-lengths to be mapped onto the indices of the transmit antennas and then uses padding technique to avoid error propagation. Numerical results and comparisons, on both the capacity and the bit error rate performances, are provided and show the advantage of the proposed scheme. The BP-IGCH scheme not only offers lower complexity to realize the design flexibility, but also achieves better performance. © 2011 IEEE.

  3. Particle hopping vs. fluid-dynamical models for traffic flow

    Energy Technology Data Exchange (ETDEWEB)

    Nagel, K.

    1995-12-31

    Although particle hopping models have been introduced into traffic science in the 19509, their systematic use has only started recently. Two reasons for this are, that they are advantageous on modem computers, and that recent theoretical developments allow analytical understanding of their properties and therefore more confidence for their use. In principle, particle hopping models fit between microscopic models for driving and fluiddynamical models for traffic flow. In this sense, they also help closing the conceptual gap between these two. This paper shows connections between particle hopping models and traffic flow theory. It shows that the hydrodynamical limits of certain particle hopping models correspond to the Lighthill-Whitham theory for traffic flow, and that only slightly more complex particle hopping models produce already the correct traffic jam dynamics, consistent with recent fluid-dynamical models for traffic flow. By doing so, this paper establishes that, on the macroscopic level, particle hopping models are at least as good as fluid-dynamical models. Yet, particle hopping models have at least two advantages over fluid-dynamical models: they straightforwardly allow microscopic simulations, and they include stochasticity.

  4. Suppression of hop looper (Lepidoptera: Noctuidae) by the fungicide pyraclostrobin.

    Science.gov (United States)

    Woods, J L; Gent, D H

    2014-04-01

    The hop looper, Hypena humuli Harris, is a reemergent pest of hop that often requires treatment to mitigate crop damage. In 4 yr of field trials, plots treated with fungicides were observed to sustain less hop looper defoliation compared with nontreated plots. Further investigation revealed that abundance of hop looper and associated defoliation were reduced when the fungicide pyraclostrobin was applied in late July to early August. Two other fungicides possessing active ingredients in the same chemical family (quinone outside inhibitor) did not reduce abundance of hop looper or its defoliation. Pyraclostrobin is efficacious against powdery mildew diseases, and the application timing evaluated in these studies corresponds with a period of juvenile susceptibility of hop cones to the disease. Use of fungicides containing pyraclostrobin at this time may have the ancillary benefit of reducing hop looper damage, potentially obviating the need for broad-spectrum insecticides later in the season. Follow-up studies are warranted to determine whether pyraclostrobin may inhibit other lepidopteran species.

  5. Acellular organ scaffolds for tumor tissue engineering

    Science.gov (United States)

    Guller, Anna; Trusova, Inna; Petersen, Elena; Shekhter, Anatoly; Kurkov, Alexander; Qian, Yi; Zvyagin, Andrei

    2015-12-01

    Rationale: Tissue engineering (TE) is an emerging alternative approach to create models of human malignant tumors for experimental oncology, personalized medicine and drug discovery studies. Being the bottom-up strategy, TE provides an opportunity to control and explore the role of every component of the model system, including cellular populations, supportive scaffolds and signalling molecules. Objectives: As an initial step to create a new ex vivo TE model of cancer, we optimized protocols to obtain organ-specific acellular matrices and evaluated their potential as TE scaffolds for culture of normal and tumor cells. Methods and results: Effective decellularization of animals' kidneys, ureter, lungs, heart, and liver has been achieved by detergent-based processing. The obtained scaffolds demonstrated biocompatibility and growthsupporting potential in combination with normal (Vero, MDCK) and tumor cell lines (C26, B16). Acellular scaffolds and TE constructs have been characterized and compared with morphological methods. Conclusions: The proposed methodology allows creation of sustainable 3D tumor TE constructs to explore the role of organ-specific cell-matrix interaction in tumorigenesis.

  6. Hopping conductivity via deep impurity states in InP

    International Nuclear Information System (INIS)

    Kuznetsov, V.P.; Messerer, M.A.; Omel'yanovskij, Eh.M.

    1984-01-01

    Hopping (epsilon 3 ) and Mott conductivities via deep impurity compounds with localization radius below 10 A have been studied using as an example Mn in InP. It is shown, that the existing theory of hopping conductivity in low-alloyed semiconductors with Na 3 << 1 can be Used for the case of deep centres as successfully as for the case of insignificant hydrogen-like impurities. Fundamental parameters of the theory: localization radius of wave function of deep impurities, state density near the Fermi level, mean hop length, are determined

  7. Crossover in tunneling hops in systems of strongly localized electrons

    International Nuclear Information System (INIS)

    Lien Nguyen, V.; Gamietea, A.D.

    1995-11-01

    Accurate Monte-Carlo simulation data show a consistent crossover in different characters of tunneling hops in two-dimensional systems of strongly localized electrons in the presence of scattering and quantum interference of hopping paths. The results also suggest a negative answer to the question whether there is a two-dimensional sign phase transition. The fractal behaviour observed in the direction perpendicular to the hopping direction is found to be similar to that for eigenstates in one-dimensional localized systems. (author). 16 refs, 6 figs

  8. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    Science.gov (United States)

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  9. Characterization of hop pectins shows the presence of an arabinogalactan-protein

    NARCIS (Netherlands)

    Oosterveld, A.; Voragen, A.G.J.; Schols, H.A.

    2002-01-01

    Hop pectins were extracted from spent hops using acid extraction conditions and were characterized chemically. The acid extraction of spent hops resulted in a yield of 2°containing 59 f polysaccharides. The hop pectins under investigation had a relatively high molecular weight and an intrinsic

  10. Understanding Mott's law from scaling of variable-range-hopping currents and intrinsic current fluctuations

    NARCIS (Netherlands)

    Pasveer, W.F.; Michels, M.A.J.

    2006-01-01

    We have used the master equation to simulate variable-range hopping (VRH) of charges in a strongly disordered d-dimensional energy landscape (d=1,2,3). The current distribution over hopping distances and hopping energies gives a clear insight into the difference between hops that occur most

  11. Parallel fabrication of macroporous scaffolds.

    Science.gov (United States)

    Dobos, Andrew; Grandhi, Taraka Sai Pavan; Godeshala, Sudhakar; Meldrum, Deirdre R; Rege, Kaushal

    2018-07-01

    Scaffolds generated from naturally occurring and synthetic polymers have been investigated in several applications because of their biocompatibility and tunable chemo-mechanical properties. Existing methods for generation of 3D polymeric scaffolds typically cannot be parallelized, suffer from low throughputs, and do not allow for quick and easy removal of the fragile structures that are formed. Current molds used in hydrogel and scaffold fabrication using solvent casting and porogen leaching are often single-use and do not facilitate 3D scaffold formation in parallel. Here, we describe a simple device and related approaches for the parallel fabrication of macroporous scaffolds. This approach was employed for the generation of macroporous and non-macroporous materials in parallel, in higher throughput and allowed for easy retrieval of these 3D scaffolds once formed. In addition, macroporous scaffolds with interconnected as well as non-interconnected pores were generated, and the versatility of this approach was employed for the generation of 3D scaffolds from diverse materials including an aminoglycoside-derived cationic hydrogel ("Amikagel"), poly(lactic-co-glycolic acid) or PLGA, and collagen. Macroporous scaffolds generated using the device were investigated for plasmid DNA binding and cell loading, indicating the use of this approach for developing materials for different applications in biotechnology. Our results demonstrate that the device-based approach is a simple technology for generating scaffolds in parallel, which can enhance the toolbox of current fabrication techniques. © 2018 Wiley Periodicals, Inc.

  12. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

    Directory of Open Access Journals (Sweden)

    Haejoon Jung

    2018-01-01

    Full Text Available As an intrinsic part of the Internet of Things (IoT ecosystem, machine-to-machine (M2M communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  13. Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

    Science.gov (United States)

    Jung, Haejoon; Lee, In-Ho

    2018-01-12

    As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

  14. Scaffolding students’ assignments

    DEFF Research Database (Denmark)

    Slot, Marie Falkesgaard

    2013-01-01

    This article discusses scaffolding in typical student assignments in mother tongue learning materials in upper secondary education in Denmark and the United Kingdom. It has been determined that assignments do not have sufficient scaffolding end features to help pupils understand concepts and build...... objects. The article presents the results of empirical research on tasks given in Danish and British learning materials. This work is based on a further development of my PhD thesis: “Learning materials in the subject of Danish” (Slot 2010). The main focus is how cognitive models (and subsidiary explicit...... learning goals) can help students structure their argumentative and communica-tive learning processes, and how various multimodal representations can give more open-ended learning possibilities for collaboration. The article presents a short introduction of the skills for 21st century learning and defines...

  15. Hip hop jako kulturní styl, jeho spicifika a vliv na teenagery

    OpenAIRE

    POSPÍŠIL, Jan

    2008-01-01

    This thesis involves history of hip hop, its specifics and elements, it talks about influence of hip hip subculture on teenagers and points to positive and negative aspects connected to this culture style. In this way is work sectionalized into chapters. First part talks about history of hip hop, connection between religion and hip hop and also about Czech hip hop. Second part specifies on main elements of hip hop culture as DJing, MCing, breakdance, beatbox and graffiti. Last part focuses on...

  16. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine; Alouini, Mohamed-Slim; Radaydeh, Redha M.

    2011-01-01

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station

  17. A Method for Dynamically Selecting the Best Frequency Hopping Technique in Industrial Wireless Sensor Network Applications.

    Science.gov (United States)

    Fernández de Gorostiza, Erlantz; Berzosa, Jorge; Mabe, Jon; Cortiñas, Roberto

    2018-02-23

    Industrial wireless applications often share the communication channel with other wireless technologies and communication protocols. This coexistence produces interferences and transmission errors which require appropriate mechanisms to manage retransmissions. Nevertheless, these mechanisms increase the network latency and overhead due to the retransmissions. Thus, the loss of data packets and the measures to handle them produce an undesirable drop in the QoS and hinder the overall robustness and energy efficiency of the network. Interference avoidance mechanisms, such as frequency hopping techniques, reduce the need for retransmissions due to interferences but they are often tailored to specific scenarios and are not easily adapted to other use cases. On the other hand, the total absence of interference avoidance mechanisms introduces a security risk because the communication channel may be intentionally attacked and interfered with to hinder or totally block it. In this paper we propose a method for supporting the design of communication solutions under dynamic channel interference conditions and we implement dynamic management policies for frequency hopping technique and channel selection at runtime. The method considers several standard frequency hopping techniques and quality metrics, and the quality and status of the available frequency channels to propose the best combined solution to minimize the side effects of interferences. A simulation tool has been developed and used in this work to validate the method.

  18. HapHop-Physio: a computer game to support cognitive therapies in children.

    Science.gov (United States)

    Rico-Olarte, Carolina; López, Diego M; Narváez, Santiago; Farinango, Charic D; Pharow, Peter S

    2017-01-01

    Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch ® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies.

  19. Integrating model checking with HiP-HOPS in model-based safety analysis

    International Nuclear Information System (INIS)

    Sharvia, Septavera; Papadopoulos, Yiannis

    2015-01-01

    The ability to perform an effective and robust safety analysis on the design of modern safety–critical systems is crucial. Model-based safety analysis (MBSA) has been introduced in recent years to support the assessment of complex system design by focusing on the system model as the central artefact, and by automating the synthesis and analysis of failure-extended models. Model checking and failure logic synthesis and analysis (FLSA) are two prominent MBSA paradigms. Extensive research has placed emphasis on the development of these techniques, but discussion on their integration remains limited. In this paper, we propose a technique in which model checking and Hierarchically Performed Hazard Origin and Propagation Studies (HiP-HOPS) – an advanced FLSA technique – can be applied synergistically with benefit for the MBSA process. The application of the technique is illustrated through an example of a brake-by-wire system. - Highlights: • We propose technique to integrate HiP-HOPS and model checking. • State machines can be systematically constructed from HiP-HOPS. • The strengths of different MBSA techniques are combined. • Demonstrated through modeling and analysis of brake-by-wire system. • Root cause analysis is automated and system dynamic behaviors analyzed and verified

  20. Chitosan/bioactive glass nanoparticles scaffolds with shape memory properties.

    Science.gov (United States)

    Correia, Cristina O; Leite, Álvaro J; Mano, João F

    2015-06-05

    We propose a combination of chitosan (CHT) with bioactive glass nanoparticles (BG-NPs) in order to produce CHT/BG-NPs scaffolds that combine the shape memory properties of chitosan and the biomineralization ability of BG-NPs for applications in bone regeneration. The addition of BG-NPs prepared by a sol-gel route to the CHT polymeric matrix improved the bioactivity of the nanocomposite scaffold, as seen by the precipitation of bone-like apatite layer upon immersion in simulated body fluid (SBF). Shape memory tests were carried out while the samples were immersed in varying compositions of water/ethanol mixtures. Dehydration with ethanol enables to fix a temporary shape of a deformed scaffold that recovers the initial geometry upon water uptake. The scaffolds present good shape memory properties characterized by a recovery ratio of 87.5% for CHT and 89.9% for CHT/BG-NPs and a fixity ratio of 97.2% for CHT and 98.2% for CHT/BG-NPs (for 30% compressive deformation). The applicability of such structures was demonstrated by a good geometrical accommodation of a previously compressed scaffold in a bone defect. The results indicate that the developed CHT/BG-NPs nanocomposite scaffolds have potential for being applied in bone tissue engineering. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Signaling induced by hop/STI-1 depends on endocytosis

    International Nuclear Information System (INIS)

    Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

    2007-01-01

    The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP C ), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP C and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling induced by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP C by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases

  2. The Hip-Hop club scene: Gender, grinding and sex.

    Science.gov (United States)

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  3. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    Science.gov (United States)

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  4. Fast Hopping Frequency Generation in Digital CMOS

    CERN Document Server

    Farazian, Mohammad; Gudem, Prasad S

    2013-01-01

    Overcoming the agility limitations of conventional frequency synthesizers in multi-band OFDM ultra wideband is a key research goal in digital technology. This volume outlines a frequency plan that can generate all the required frequencies from a single fixed frequency, able to implement center frequencies with no more than two levels of SSB mixing. It recognizes the need for future synthesizers to bypass on-chip inductors and operate at low voltages to enable the increased integration and efficiency of networked appliances. The author examines in depth the architecture of the dividers that generate the necessary frequencies from a single base frequency and are capable of establishing a fractional division ratio.   Presenting the first CMOS inductorless single PLL 14-band frequency synthesizer for MB-OFDMUWB makes this volume a key addition to the literature, and with the synthesizer capable of arbitrary band-hopping in less than two nanoseconds, it operates well within the desired range on a 1.2-volt power s...

  5. Protein Scaffolding for Small Molecule Catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Baker, David [Univ. of Washington, Seattle, WA (United States)

    2014-09-14

    We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.

  6. In silico simulation and in vitro evaluation of an elastomeric scaffold using ultrasonic shear wave imaging

    Science.gov (United States)

    Yu, Jiao; Nie, Erwei; Zhu, Yanying; Hong, Yi

    2018-03-01

    Biodegradable elastomeric scaffolds for soft tissue repair represent a growing area of biomaterials research. Mechanical strength is one of the key factors to consider in the evaluation of candidate materials and the designs for tissue scaffolds. It is desirable to develop non-invasive evaluation methods of the mechanical property of scaffolds which would provide options for monitoring temporal mechanical property changes in situ. In this paper, we conduct in silico simulation and in vitro evaluation of an elastomeric scaffold using a novel ultrasonic shear wave imaging (USWI). The scaffold is fabricated from a biodegradable elastomer, poly(carbonate urethane) urea using salt leaching method. A numerical simulation is performed to test the robustness of the developed inversion algorithm for the elasticity map reconstruction which will be implemented in the phantom experiment. The generation and propagation of shear waves in a homogeneous tissue-mimicking medium with a circular scaffold inclusion is simulated and the elasticity map is well reconstructed. A PVA phantom experiment is performed to test the ability of USWI combined with the inversion algorithm to non-invasively characterize the mechanical property of a porous, biodegradable elastomeric scaffold. The elastic properties of the tested scaffold can be easily differentiated from the surrounding medium in the reconstructed image. The ability of the developed method to identify the edge of the scaffold and characterize the elasticity distribution is demonstrated. Preliminary results in this pilot study support the idea of applying the USWI based method for non-invasive elasticity characterization of tissue scaffolds.

  7. Collagen/chitosan based two-compartment and bi-functional dermal scaffolds for skin regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Feng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Wang, Mingbo [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); She, Zhending [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China); Fan, Kunwu; Xu, Cheng [Department of Plastic Surgery and Burns, Shenzhen Second People' s Hospital, Shenzhen 518035 (China); Chu, Bin; Chen, Changsheng [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shi, Shengjun, E-mail: shengjunshi@yahoo.com [The Burns Department of Zhujiang Hospital, Southern Medical University, Guangzhou 510280 (China); Tan, Rongwei, E-mail: tanrw@landobiom.com [Key Laboratory of Biomedical Materials and Implants, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Shenzhen Lando Biomaterials Co., Ltd., Shenzhen 518057 (China)

    2015-07-01

    Inspired from the sophisticated bilayer structures of natural dermis, here, we reported collagen/chitosan based two-compartment and bi-functional dermal scaffolds. Two functions refer to mediating rapid angiogenesis based on recombinant human vascular endothelial growth factor (rhVEGF) and antibacterial from gentamicin, which were encapsulated in PLGA microspheres. The gentamicin and rhVEGF encapsulated PLGA microspheres were further combined with collagen/chitosan mixtures in low (lower layer) and high (upper layer) concentrations, and molded to generate the two-compartment and bi-functional scaffolds. Based on morphology and pore structure analyses, it was found that the scaffold has a distinct double layered porous and connective structure with PLGA microspheres encapsulated. Statistical analysis indicated that the pores in the upper layer and in the lower layer have great variations in diameter, indicative of a two-compartment structure. The release profiles of gentamicin and rhVEGF exceeded 28 and 49 days, respectively. In vitro culture of mouse fibroblasts showed that the scaffold can facilitate cell adhesion and proliferation. Moreover, the scaffold can obviously inhibit proliferation of Staphylococcus aureus and Serratia marcescens, exhibiting its unique antibacterial effect. The two-compartment and bi-functional dermal scaffolds can be a promising candidate for skin regeneration. - Highlights: • The dermal scaffold is inspired from the bilayer structures of natural dermis. • The dermal scaffold has two-compartment structures. • The dermal scaffold containing VEGF and gentamicin encapsulated PLGA microspheres • The dermal scaffold can facilitate cell adhesion and proliferation.

  8. Three-Dimensional Printing of Hollow-Struts-Packed Bioceramic Scaffolds for Bone Regeneration.

    Science.gov (United States)

    Luo, Yongxiang; Zhai, Dong; Huan, Zhiguang; Zhu, Haibo; Xia, Lunguo; Chang, Jiang; Wu, Chengtie

    2015-11-04

    Three-dimensional printing technologies have shown distinct advantages to create porous scaffolds with designed macropores for application in bone tissue engineering. However, until now, 3D-printed bioceramic scaffolds only possessing a single type of macropore have been reported. Generally, those scaffolds with a single type of macropore have relatively low porosity and pore surfaces, limited delivery of oxygen and nutrition to surviving cells, and new bone tissue formation in the center of the scaffolds. Therefore, in this work, we present a useful and facile method for preparing hollow-struts-packed (HSP) bioceramic scaffolds with designed macropores and multioriented hollow channels via a modified coaxial 3D printing strategy. The prepared HSP scaffolds combined high porosity and surface area with impressive mechanical strength. The unique hollow-struts structures of bioceramic scaffolds significantly improved cell attachment and proliferation and further promoted formation of new bone tissue in the center of the scaffolds, indicating that HSP ceramic scaffolds can be used for regeneration of large bone defects. In addition, the strategy can be used to prepare other HSP ceramic scaffolds, indicating a universal application for tissue engineering, mechanical engineering, catalysis, and environmental materials.

  9. Development of porous Ti6Al4V/chitosan sponge composite scaffold for orthopedic applications

    International Nuclear Information System (INIS)

    Guo, Miao; Li, Xiang

    2016-01-01

    A novel composite scaffold consisting of porous Ti6Al4V part filled with chitosan sponge was fabricated using a combination of electron beam melting and freeze-drying. The mechanical properties of porous Ti6Al4V part were examined via compressive test. The ultimate compressive strength was 85.35 ± 8.68 MPa and the compressive modulus was 2.26 ± 0.42 GPa. The microstructure of composite scaffold was characterized using scanning electron microscopy. The chitosan sponge filled in Ti6Al4V part exhibited highly porous and well-interconnected micro-pore architecture. The osteoblastic cells were seeded on scaffolds to test their seeding efficiency and biocompatibility. Significantly higher cell seeding efficiency was found on composite scaffold. The biological response of osteoblasts on composite scaffolds was superior in terms of improved cell attachment, higher proliferation, and well-spread morphology in relation to porous Ti6Al4V part. These results suggest that the Ti6Al4V/chitosan composite scaffold is potentially useful as a biomedical scaffold for orthopedic applications. - Highlights: • A novel composite scaffold with sufficient mechanical properties and favorable cell affinity environment was developed. • Significantly higher cell seeding efficiency was found on composite scaffold. • The osteoblasts on composite scaffolds showed well-spread morphology, improved cell attachment and higher proliferation.

  10. Biomimetic formation of apatite on the surface of porous gelatin/bioactive glass nanocomposite scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    Mozafari, Masoud, E-mail: mmozafari@aut.ac.ir [Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence), Amirkabir University of Technology, PO Box 15875-4413, Tehran (Iran, Islamic Republic of); Rabiee, Mohammad; Azami, Mahmoud; Maleknia, Saied [Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence), Amirkabir University of Technology, PO Box 15875-4413, Tehran (Iran, Islamic Republic of)

    2010-12-15

    There have been several attempts to combine bioactive glasses (BaGs) with biodegradable polymers to create a scaffold material with excellent biocompatibility, bioactivity, biodegradability and toughness. In the present study, the nanocomposite scaffolds with compositions based on gelatin (Gel) and BaG nanoparticles in the ternary SiO{sub 2}-CaO-P{sub 2}O{sub 5} system were prepared. In vitro evaluations of the nanocomposite scaffolds were performed, and for investigating their bioactive capacity these scaffolds were soaked in a simulated body fluid (SBF) at different time intervals. The scaffolds showed significant enhancement in bioactivity within few days of immersion in SBF solution. The apatite formation at the surface of the nanocomposite samples confirmed by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray powder diffraction (XRD) analyses. In vitro experiments with osteoblast cells indicated an appropriate penetration of the cells into the scaffold's pores, and also the continuous increase in cell aggregation on the bioactive scaffolds with increase in the incubation time demonstrated the ability of the scaffolds to support cell growth. The SEM observations revealed that the prepared scaffolds were porous with three dimensional (3D) and interconnected microstructure, pore size was 200-500 {mu}m and the porosity was 72-86%. The nanocomposite scaffold made from Gel and BaG nanoparticles could be considered as a highly bioactive and potential bone tissue engineering implant.

  11. Biomimetic formation of apatite on the surface of porous gelatin/bioactive glass nanocomposite scaffolds

    Science.gov (United States)

    Mozafari, Masoud; Rabiee, Mohammad; Azami, Mahmoud; Maleknia, Saied

    2010-12-01

    There have been several attempts to combine bioactive glasses (BaGs) with biodegradable polymers to create a scaffold material with excellent biocompatibility, bioactivity, biodegradability and toughness. In the present study, the nanocomposite scaffolds with compositions based on gelatin (Gel) and BaG nanoparticles in the ternary SiO 2-CaO-P 2O 5 system were prepared. In vitro evaluations of the nanocomposite scaffolds were performed, and for investigating their bioactive capacity these scaffolds were soaked in a simulated body fluid (SBF) at different time intervals. The scaffolds showed significant enhancement in bioactivity within few days of immersion in SBF solution. The apatite formation at the surface of the nanocomposite samples confirmed by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray powder diffraction (XRD) analyses. In vitro experiments with osteoblast cells indicated an appropriate penetration of the cells into the scaffold's pores, and also the continuous increase in cell aggregation on the bioactive scaffolds with increase in the incubation time demonstrated the ability of the scaffolds to support cell growth. The SEM observations revealed that the prepared scaffolds were porous with three dimensional (3D) and interconnected microstructure, pore size was 200-500 μm and the porosity was 72-86%. The nanocomposite scaffold made from Gel and BaG nanoparticles could be considered as a highly bioactive and potential bone tissue engineering implant.

  12. Biomimetic formation of apatite on the surface of porous gelatin/bioactive glass nanocomposite scaffolds

    International Nuclear Information System (INIS)

    Mozafari, Masoud; Rabiee, Mohammad; Azami, Mahmoud; Maleknia, Saied

    2010-01-01

    There have been several attempts to combine bioactive glasses (BaGs) with biodegradable polymers to create a scaffold material with excellent biocompatibility, bioactivity, biodegradability and toughness. In the present study, the nanocomposite scaffolds with compositions based on gelatin (Gel) and BaG nanoparticles in the ternary SiO 2 -CaO-P 2 O 5 system were prepared. In vitro evaluations of the nanocomposite scaffolds were performed, and for investigating their bioactive capacity these scaffolds were soaked in a simulated body fluid (SBF) at different time intervals. The scaffolds showed significant enhancement in bioactivity within few days of immersion in SBF solution. The apatite formation at the surface of the nanocomposite samples confirmed by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray powder diffraction (XRD) analyses. In vitro experiments with osteoblast cells indicated an appropriate penetration of the cells into the scaffold's pores, and also the continuous increase in cell aggregation on the bioactive scaffolds with increase in the incubation time demonstrated the ability of the scaffolds to support cell growth. The SEM observations revealed that the prepared scaffolds were porous with three dimensional (3D) and interconnected microstructure, pore size was 200-500 μm and the porosity was 72-86%. The nanocomposite scaffold made from Gel and BaG nanoparticles could be considered as a highly bioactive and potential bone tissue engineering implant.

  13. Collagen/chitosan based two-compartment and bi-functional dermal scaffolds for skin regeneration

    International Nuclear Information System (INIS)

    Wang, Feng; Wang, Mingbo; She, Zhending; Fan, Kunwu; Xu, Cheng; Chu, Bin; Chen, Changsheng; Shi, Shengjun; Tan, Rongwei

    2015-01-01

    Inspired from the sophisticated bilayer structures of natural dermis, here, we reported collagen/chitosan based two-compartment and bi-functional dermal scaffolds. Two functions refer to mediating rapid angiogenesis based on recombinant human vascular endothelial growth factor (rhVEGF) and antibacterial from gentamicin, which were encapsulated in PLGA microspheres. The gentamicin and rhVEGF encapsulated PLGA microspheres were further combined with collagen/chitosan mixtures in low (lower layer) and high (upper layer) concentrations, and molded to generate the two-compartment and bi-functional scaffolds. Based on morphology and pore structure analyses, it was found that the scaffold has a distinct double layered porous and connective structure with PLGA microspheres encapsulated. Statistical analysis indicated that the pores in the upper layer and in the lower layer have great variations in diameter, indicative of a two-compartment structure. The release profiles of gentamicin and rhVEGF exceeded 28 and 49 days, respectively. In vitro culture of mouse fibroblasts showed that the scaffold can facilitate cell adhesion and proliferation. Moreover, the scaffold can obviously inhibit proliferation of Staphylococcus aureus and Serratia marcescens, exhibiting its unique antibacterial effect. The two-compartment and bi-functional dermal scaffolds can be a promising candidate for skin regeneration. - Highlights: • The dermal scaffold is inspired from the bilayer structures of natural dermis. • The dermal scaffold has two-compartment structures. • The dermal scaffold containing VEGF and gentamicin encapsulated PLGA microspheres • The dermal scaffold can facilitate cell adhesion and proliferation

  14. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage

    Directory of Open Access Journals (Sweden)

    Ziola Barry

    2009-09-01

    Full Text Available Abstract Background Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol. Use of antimicrobial compounds (e.g., hop-compounds, Penicillin by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Results Lactic acid bacteria susceptibility test broth medium (LSM used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Conclusion Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  15. Susceptibility of Pediococcus isolates to antimicrobial compounds in relation to hop-resistance and beer-spoilage.

    Science.gov (United States)

    Haakensen, Monique; Vickers, David M; Ziola, Barry

    2009-09-07

    Though important in the context of food microbiology and as potential pathogens in immuno-compromised humans, bacterial isolates belonging to the genus Pediococcus are best known for their association with contamination of ethanol fermentation processes (beer, wine, or fuel ethanol). Use of antimicrobial compounds (e.g., hop-compounds, Penicillin) by some industries to combat Pediococcus contaminants is long-standing, yet knowledge about the resistance of pediococci to antimicrobial agents is minimal. Here we examined Pediococcus isolates to determine whether antibiotic resistance is associated with resistance to hops, presence of genes known to correlate with beer spoilage, or with ability to grow in beer. Lactic acid bacteria susceptibility test broth medium (LSM) used in combination with commercially available GPN3F antimicrobial susceptibility plates was an effective method for assessing antimicrobial susceptibility of Pediococcus isolates. We report the finding of Vancomycin-susceptible Pediococcus isolates from four species. Interestingly, we found that hop-resistant, beer-spoilage, and beer-spoilage gene-harbouring isolates had a tendency to be more susceptible, rather than more resistant, to antimicrobial compounds. Our findings indicate that the mechanisms involved in conferring hop-resistance or ability to spoil beer by Pediococcus isolates are not associated with resistance to antibiotics commonly used for treatment of human infections. Also, Vancomycin-resistance was found to be isolate-specific and not intrinsic to the genus as previously believed.

  16. Preparation of biodegradable gelatin/PVA porous scaffolds for skin regeneration.

    Science.gov (United States)

    Mahnama, Hossein; Dadbin, Susan; Frounchi, Masoud; Rajabi, Sareh

    2017-08-01

    Porous scaffolds composed of gelatin/poly (vinyl alcohol), (Gel/PVA), were prepared using combination of freeze gelation and freeze drying methods. The effect of polymer concentration, gelatin/PVA ratio, and glutaraldehyde/gelatin ratio (GA/Gel) was investigated on morphology of pores, swelling ratio, biodegradation, and skin cell culture. At optimum preparation conditions the scaffolds had uniform pore size distributions showing high swelling ratio of 23.6. The scaffolds were of biodegradable nature and almost degraded in 28 days. Human dermal fibroblast cells (HDF) were cultured on the scaffolds and MTS assay was conducted to evaluate the influence of PVA on growth and proliferation of the cells.

  17. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    Science.gov (United States)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of

  18. Laser printing of cells into 3D scaffolds

    International Nuclear Information System (INIS)

    Ovsianikov, A; Gruene, M; Koch, L; Maiorana, F; Chichkov, B; Pflaum, M; Wilhelmi, M; Haverich, A

    2010-01-01

    One of the most promising approaches in tissue engineering is the application of 3D scaffolds, which provide cell support and guidance in the initial tissue formation stage. The porosity of the scaffold and internal pore organization influence cell migration and play a major role in its biodegradation dynamics, nutrient diffusion and mechanical stability. In order to control cell migration and cellular interactions within the scaffold, novel technologies capable of producing 3D structures in accordance with predefined design are required. The two-photon polymerization (2PP) technique, used in this report for the fabrication of scaffolds, allows the realization of arbitrary 3D structures with submicron spatial resolution. Highly porous 3D scaffolds, produced by 2PP of acrylated poly(ethylene glycol), are seeded with cells by means of laser-induced forward transfer (LIFT). In this laser printing approach, a propulsive force, resulting from laser-induced shock wave, is used to propel individual cells or cell groups from a donor substrate towards the receiver substrate. We demonstrate that with this technique printing of multiple cell types into 3D scaffolds is possible. Combination of LIFT and 2PP provides a route for the realization of 3D multicellular tissue constructs and artificial ECM engineered on the microscale.

  19. Electrospun gelatin/poly(ε-caprolactone) fibrous scaffold modified with calcium phosphate for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Rajzer, Izabella, E-mail: irajzer@ath.bielsko.pl [University of Bielsko-Biala (ATH), Department of Mechanical Engineering Fundamentals, Division of Materials Engineering, Willowa 2 Street, 43-309 Bielsko-Biała (Poland); Menaszek, Elżbieta [Jagiellonian University (UJ), Collegium Medicum, Department of Cytobiology, Medyczna 9 Street, 30-068 Cracow (Poland); Kwiatkowski, Ryszard [University of Bielsko-Biala (ATH), Faculty of Materials and Environmental Sciences, Institute of Textile Engineering and Polymer Materials, Willowa 2 Street, 43-309 Bielsko-Biała (Poland); Planell, Josep A.; Castano, Oscar [Institute for Bioengineering of Catalonia (IBEC), Biomaterials for Regenerative Therapies, Baldiri Reixac 15-21, 08028 Barcelona (Spain); Polytechnic University of Catalonia (UPC), Diagonal 647, 08028 Barcelona (Spain); CIBER-BBN The Biomedical Research Networking Center in Bioengineering, Biomaterials and Nanomedicine, Barcelona (Spain)

    2014-11-01

    In this study gelatin (Gel) modified with calcium phosphate nanoparticles (SG5) and polycaprolactone (PCL) were used to prepare a 3D bi-layer scaffold by collecting electrospun PCL and gelatin/SG5 fibers separately in the same collector. The objective of this study was to combine the desired properties of PCL and Gel/SG5 in the same scaffold in order to enhance mineralization, thus improving the ability of the scaffold to bond to the bone tissue. The scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR) and the wide angle X-ray diffraction (WAXD) measurements confirmed that SG5 nanoparticles were successfully incorporated into the fibrous gelatin matrix. The composite Gel/SG5/PCL scaffold exhibited more enhanced mechanical properties than individual Gel and Gel/SG5 scaffolds. The presence of SG5 nanoparticles accelerated the nucleation and growth of apatite crystals on the surface of the composite Gel/SG5/PCL scaffold in simulated body fluid (SBF). The osteoblast response in vitro to developed electrospun scaffolds (PCL and Gel/SG5/PCL) was investigated by using normal human primary NHOst cell lines. NHOst cell culture studies showed that higher alkaline phosphatase (ALP) activity and better mineralization were obtained in the case of composite materials than in pure PCL scaffolds. The mechanically strong PCL scaffold served as a skeleton, while the Gel/SG5 fibers facilitated cell spreading and mineralization of the scaffold. - Highlights: • Bi-layer scaffolds were produced by electrospinning method. • The addition of nanoparticles enhanced the bioactivity of scaffold. • Bi-layer scaffold enhanced ALP activity and NHOst cell mineralization.

  20. Fabrication and biocompatibility of poly(L-lactic acid) and chitosan composite scaffolds with hierarchical microstructures

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Tao, E-mail: taolou72@aliyun.com [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China); Wang, Xuejun [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China); Yan, Xu [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Miao, Yu [Department of Mechanical Engineering, Columbia University, New York, NY 10027 (United States); Long, Yun-Ze, E-mail: yunzelong@163.com [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Yin, Hai-Lei [Department of Osteology, No. 401 Hospital of P. L. A., Qingdao 266071 (China); Sun, Bin [College of Physics & Collaborative Innovation Center for Low-Dimensional Nanomaterials and Optoelectronic Devices, Qingdao University, Qingdao 266071 (China); Song, Guojun [College of Chemistry and Chemical Engineering, Qingdao University, Qingdao 266071 (China)

    2016-07-01

    The scaffold microstructure is crucial to reconstruct tissue normal functions. In this article, poly(L-lactic acid) and chitosan fiber (PLLA/CTSF) composite scaffolds with hierarchical microstructures both in fiber and pore sizes were successfully fabricated by combining thermal induced phase separation and salt leaching techniques. The composite scaffolds consisted of a nanofibrous PLLA matrix with diameter of 50–500 nm, and chitosan fibers with diameter of about 20 μm were homogenously distributed in the PLLA matrix as a microsized reinforcer. The composite scaffolds also had high porosity (> 94%) and hierarchical pore size, which were consisted of both micropores (50 nm–10 μm) and macropores (50–300 μm). By tailoring the microstructure and chemical composition, the mechanical property, pH buffer and protein adsorption capacity of the composite scaffold were improved significantly compared with those of PLLA scaffold. Cell culture results also revealed that the PLLA/CTSF composite scaffolds supported MG-63 osteoblast proliferation and penetration. - Highlights: • Composite scaffolds fabricated by combining thermal induced phase separation and salt leaching techniques • Hierarchical microstructure both in fiber and pore sizes • The scaffold microenvironment facilitates the protein adsorption, cell proliferation and penetration.

  1. Analysis and Relative Evaluation of Connectivity of a Mobile Multi-Hop Network

    Science.gov (United States)

    Nakano, Keisuke; Miyakita, Kazuyuki; Sengoku, Masakazu; Shinoda, Shoji

    In mobile multi-hop networks, a source node S and a destination node D sometimes encounter a situation where there is no multi-hop path between them when a message M, destined for D, arrives at S. In this situation, we cannot send M from S to D immediately; however, we can deliver M to D after waiting some time with the help of two capabilities of mobility. One of the capabilities is to construct a connected multi-hop path by changing the topology of the network during the waiting time (Capability 1), and the other is to move M closer to D during the waiting time (Capability 2). In this paper, we consider three methods to deliver M from S to D by using these capabilities in different ways. Method 1 uses Capability 1 and sends M from S to D after waiting until a connected multi-hop path appears between S and D. Method 2 uses Capability 2 and delivers M to D by allowing a mobile node to carry M from S to D. Method 3 is a combination of Methods 1 and 2 and minimizes the waiting time. We evaluate and compare these three methods in terms of the mean waiting time, from the time when M arrives at S to the time when D starts receiving M, as a new approach to connectivity evaluation. We consider a one-dimensional mobile multi-hop network consisting of mobile nodes flowing in opposite directions along a street. First, we derive some approximate equations and propose an estimation method to compute the mean waiting time of Method 1. Second, we theoretically analyze the mean waiting time of Method 2, and compute a lower bound of that of Method 3. By comparing the three methods under the same assumptions using results of the analyses and some simulation results, we show relations between the mean waiting times of these methods and show how Capabilities 1 and 2 differently affect the mean waiting time.

  2. Microscale versus nanoscale scaffold architecture for mesenchymal stem cell chondrogenesis.

    Science.gov (United States)

    Shanmugasundaram, Shobana; Chaudhry, Hans; Arinzeh, Treena Livingston

    2011-03-01

    Nanofiber scaffolds, produced by the electrospinning technique, have gained widespread attention in tissue engineering due to their morphological similarities to the native extracellular matrix. For cartilage repair, studies have examined their feasibility; however these studies have been limited, excluding the influence of other scaffold design features. This study evaluated the effect of scaffold design, specifically examining a range of nano to micron-sized fibers and resulting pore size and mechanical properties, on human mesenchymal stem cells (MSCs) derived from the adult bone marrow during chondrogenesis. MSC differentiation was examined on these scaffolds with an emphasis on temporal gene expression of chondrogenic markers and the pluripotent gene, Sox2, which has yet to be explored for MSCs during chondrogenesis and in combination with tissue engineering scaffolds. Chondrogenic markers of aggrecan, chondroadherin, sox9, and collagen type II were highest for cells on micron-sized fibers (5 and 9 μm) with pore sizes of 27 and 29 μm, respectively, in comparison to cells on nano-sized fibers (300 nm and 600 to 1400 nm) having pore sizes of 2 and 3 μm, respectively. Undifferentiated MSCs expressed high levels of the Sox2 gene but displayed negligible levels on all scaffolds with or without the presence of inductive factors, suggesting that the physical features of the scaffold play an important role in differentiation. Micron-sized fibers with large pore structures and mechanical properties comparable to the cartilage ECM enhanced chondrogenesis, demonstrating architectural features as well as mechanical properties of electrospun fibrous scaffolds enhance differentiation.

  3. Preparation and characterization of collagen/PLA, chitosan/PLA, and collagen/chitosan/PLA hybrid scaffolds for cartilage tissue engineering.

    Science.gov (United States)

    Haaparanta, Anne-Marie; Järvinen, Elina; Cengiz, Ibrahim Fatih; Ellä, Ville; Kokkonen, Harri T; Kiviranta, Ilkka; Kellomäki, Minna

    2014-04-01

    In this study, three-dimensional (3D) porous scaffolds were developed for the repair of articular cartilage defects. Novel collagen/polylactide (PLA), chitosan/PLA, and collagen/chitosan/PLA hybrid scaffolds were fabricated by combining freeze-dried natural components and synthetic PLA mesh, where the 3D PLA mesh gives mechanical strength, and the natural polymers, collagen and/or chitosan, mimic the natural cartilage tissue environment of chondrocytes. In total, eight scaffold types were studied: four hybrid structures containing collagen and/or chitosan with PLA, and four parallel plain scaffolds with only collagen and/or chitosan. The potential of these types of scaffolds for cartilage tissue engineering applications were determined by the analysis of the microstructure, water uptake, mechanical strength, and the viability and attachment of adult bovine chondrocytes to the scaffolds. The manufacturing method used was found to be applicable for the manufacturing of hybrid scaffolds with highly porous 3D structures. All the hybrid scaffolds showed a highly porous structure with open pores throughout the scaffold. Collagen was found to bind water inside the structure in all collagen-containing scaffolds better than the chitosan-containing scaffolds, and the plain collagen scaffolds had the highest water absorption. The stiffness of the scaffold was improved by the hybrid structure compared to plain scaffolds. The cell viability and attachment was good in all scaffolds, however, the collagen hybrid scaffolds showed the best penetration of cells into the scaffold. Our results show that from the studied scaffolds the collagen/PLA hybrids are the most promising scaffolds from this group for cartilage tissue engineering.

  4. Biological effects of functionalizing copolymer scaffolds with nanodiamond particles.

    Science.gov (United States)

    Xing, Zhe; Pedersen, Torbjorn O; Wu, Xujun; Xue, Ying; Sun, Yang; Finne-Wistrand, Anna; Kloss, Frank R; Waag, Thilo; Krueger, Anke; Steinmüller-Nethl, Doris; Mustafa, Kamal

    2013-08-01

    Significant evidence has indicated that poly(L-lactide)-co-(ɛ-caprolactone) [(poly(LLA-co-CL)] scaffolds could be one of the suitable candidates for bone tissue engineering. Oxygen-terminated nanodiamond particles (n-DP) were combined with poly(LLA-co-CL) and revealed to be positive for cell growth. In this study, we evaluated the influence of poly(LLA-co-CL) scaffolds modified by n-DP on attachment, proliferation, differentiation of bone marrow stromal cells (BMSCs) in vitro, and on bone formation using a sheep calvarial defect model. BMSCs were seeded on either poly(LLA-co-CL)- or n-DP-coated scaffolds and incubated for 1 h. Scanning electron microscopy (SEM) and fluorescence microscopy were used in addition to protein and DNA measurements to evaluate cellular attachment on the scaffolds. To determine the effect of n-DP on proliferation of BMSCs, cell/scaffold constructs were harvested after 3 days and evaluated by Bicinchoninic Acid (BCA) protein assay and SEM. In addition, the osteogenic differentiation of cells grown for 2 weeks on the various scaffolds and in a dynamic culture condition was evaluated by real-time RT-PCR. Unmodified and modified scaffolds were implanted into the calvaria of six-year-old sheep. The expression of collagen type I (COL I) and bone morphogenetic protein-2 (BMP-2) after 4 weeks as well as the formation of new bone after 12 and 24 weeks were analyzed by immunohistochemistry and histology. Scaffolds modified with n-DP supported increased cell attachment and the mRNA expression of osteopontin (OPN), bone sialoprotein (BSP), and BMP-2 were significantly increased after 2 weeks of culture. The BMSCs had spread well on the various scaffolds investigated after 3 days in the study with no significant difference in cell proliferation. Furthermore, the in vivo data revealed more positive staining of COL I and BMP-2 in relation to the n-DP-coated scaffolds after 4 weeks and presented more bone formation after 12 and 24 weeks. n

  5. Surface hopping simulation of vibrational predissociation of methanol dimer

    Science.gov (United States)

    Jiang, Ruomu; Sibert, Edwin L.

    2012-06-01

    The mixed quantum-classical surface hopping method is applied to the vibrational predissociation of methanol dimer, and the results are compared to more exact quantum calculations. Utilizing the vibrational SCF basis, the predissociation problem is cast into a curve crossing problem between dissociative and quasibound surfaces with different vibrational character. The varied features of the dissociative surfaces, arising from the large amplitude OH torsion, generate rich predissociation dynamics. The fewest switches surface hopping algorithm of Tully [J. Chem. Phys. 93, 1061 (1990), 10.1063/1.459170] is applied to both diabatic and adiabatic representations. The comparison affords new insight into the criterion for selecting the suitable representation. The adiabatic method's difficulty with low energy trajectories is highlighted. In the normal crossing case, the diabatic calculations yield good results, albeit showing its limitation in situations where tunneling is important. The quadratic scaling of the rates on coupling strength is confirmed. An interesting resonance behavior is identified and is dealt with using a simple decoherence scheme. For low lying dissociative surfaces that do not cross the quasibound surface, the diabatic method tends to overestimate the predissociation rate whereas the adiabatic method is qualitatively correct. Analysis reveals the major culprits involve Rabi-like oscillation, treatment of classically forbidden hops, and overcoherence. Improvements of the surface hopping results are achieved by adopting a few changes to the original surface hopping algorithms.

  6. Particle trapping and hopping in an optofluidic fishnet

    Science.gov (United States)

    Shi, Y. Z.; Xiong, S.; Zhang, Y.; Chin, L. K.; Wu, J. H.; Chen, T. N.; Liu, A. Q.

    2017-08-01

    Particle jumping between optical potentials has attracted much attention owing to its extensive involvement in many physical and biological experiments. In some circumstances, particle jumping indicates escaping from the optical trap, which is an issue people are trying to avoid. Nevertheless, particle jumping can facilitate the individual trap in each laser spot in the optical lattice and enable sorting and delivery of nanoparticles. Particle hopping has not been seen in fluid because Fluidic drag force dramatically reduce the dwell time of particle or break the potential well. Here, we observe particle hopping in the microchannel by three reasons, e.g., particle collision or aggregation, light disturbing by pretrapped particle and fake trapping position. We show that commonly ignored particle influence to the light could create a new isolated trapping position, where particle hops to the adjacent potential well. The hopping happens in an optofluidic fishnet which is comprised of discrete hotspots enabling 2D patterning of particles in the flow stream for the first time. We also achieve a 2D patterning of cryptosporidium in the microchannel. Our observed particle hopping in the flow stream completes the family of particle kinetics in potential wells and inspires new interests in the particle disturbed optical trapping. The 2D patterning of particles benefits the parallel study of biological samples in the flow stream and have potential on cell sorting and drug delivery.

  7. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Science.gov (United States)

    Bonny, Justin W; Lindberg, Jenna C; Pacampara, Marc C

    2017-01-01

    Expertise within gaming (e.g., chess, video games) and kinesthetic (e.g., sports, classical dance) activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM) disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  8. Hip Hop Dance Experience Linked to Sociocognitive Ability.

    Directory of Open Access Journals (Sweden)

    Justin W Bonny

    Full Text Available Expertise within gaming (e.g., chess, video games and kinesthetic (e.g., sports, classical dance activities has been found to be linked with specific cognitive skills. Some of these skills, working memory, mental rotation, problem solving, are linked to higher performance in science, technology, math, and engineering (STEM disciplines. In the present study, we examined whether experience in a different activity, hip hop dance, is also linked to cognitive abilities connected with STEM skills as well as social cognition ability. Dancers who varied in hip hop and other dance style experience were presented with a set of computerized tasks that assessed working memory capacity, mental rotation speed, problem solving efficiency, and theory of mind. We found that, when controlling for demographic factors and other dance style experience, those with greater hip hop dance experience were faster at mentally rotating images of hands at greater angle disparities and there was a trend for greater accuracy at identifying positive emotions displayed by cropped images of human faces. We suggest that hip hop dance, similar to other more technical activities such as video gameplay, tap some specific cognitive abilities that underlie STEM skills. Furthermore, we suggest that hip hop dance experience can be used to reach populations who may not otherwise be interested in other kinesthetic or gaming activities and potentially enhance select sociocognitive skills.

  9. Using Scaffolds in Problem-Based Hypermedia

    Science.gov (United States)

    Su, Yuyan; Klein, James D.

    2010-01-01

    This study investigated the use of scaffolds in problem-based hypermedia. Three hundred and twelve undergraduate students enrolled in a computer literacy course worked in project teams to use a hypermedia PBL program focused on designing a personal computer. The PBL program included content scaffolds, metacognitive scaffolds, or no scaffolds.…

  10. Fabrication of scaffolds in tissue engineering: A review

    Science.gov (United States)

    Zhao, Peng; Gu, Haibing; Mi, Haoyang; Rao, Chengchen; Fu, Jianzhong; Turng, Lih-sheng

    2018-03-01

    Tissue engineering (TE) is an integrated discipline that involves engineering and natural science in the development of biological materials to replace, repair, and improve the function of diseased or missing tissues. Traditional medical and surgical treatments have been reported to have side effects on patients caused by organ necrosis and tissue loss. However, engineered tissues and organs provide a new way to cure specific diseases. Scaffold fabrication is an important step in the TE process. This paper summarizes and reviews the widely used scaffold fabrication methods, including conventional methods, electrospinning, three-dimensional printing, and a combination of molding techniques. Furthermore, the differences among the properties of tissues, such as pore size and distribution, porosity, structure, and mechanical properties, are elucidated and critically reviewed. Some studies that combine two or more methods are also reviewed. Finally, this paper provides some guidance and suggestions for the future of scaffold fabrication.

  11. Tailored PVA/ECM Scaffolds for Cartilage Regeneration

    Directory of Open Access Journals (Sweden)

    Elena Stocco

    2014-01-01

    Full Text Available Articular cartilage lesions are a particular challenge for regenerative medicine due to cartilage low self-ability repair in case of damage. Hence, a significant goal of musculoskeletal tissue engineering is the development of suitable structures in virtue of their matrix composition and biomechanical properties. The objective of our study was to design in vitro a supporting structure for autologous chondrocyte growth. We realized a biohybrid composite scaffold combining a novel and nonspecific extracellular matrix (ECM, which is decellularized Wharton’s jelly ECM, with the biomechanical properties of the synthetic hydrogel polyvinyl alcohol (PVA. Wharton’s jelly ECM was tested for its ability in promoting scaffold colonization by chondrocytes and compared with polyvinyl alcohol itself and the more specific decellularized cartilage matrix. Our preliminary evidences highlighted the chance of using Wharton’s jelly ECM in combination with PVA hydrogels as an innovative and easily available scaffold for cartilage restoration.

  12. Evaluation of Estrogenic Activity of Licorice Species in Comparison with Hops Used in Botanicals for Menopausal Symptoms

    Science.gov (United States)

    Hajirahimkhan, Atieh; Simmler, Charlotte; Yuan, Yang; Anderson, Jeffrey R.; Chen, Shao-Nong; Nikolić, Dejan; Dietz, Birgit M.; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

    2013-01-01

    The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus) and licorice (Glycyrrhiza spec.) to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata) in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE)-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of botanical

  13. Evaluation of estrogenic activity of licorice species in comparison with hops used in botanicals for menopausal symptoms.

    Directory of Open Access Journals (Sweden)

    Atieh Hajirahimkhan

    Full Text Available The increased cancer risk associated with hormone therapies has encouraged many women to seek non-hormonal alternatives including botanical supplements such as hops (Humulus lupulus and licorice (Glycyrrhiza spec. to manage menopausal symptoms. Previous studies have shown estrogenic properties for hops, likely due to the presence of 8-prenylnarigenin, and chemopreventive effects mainly attributed to xanthohumol. Similarly, a combination of estrogenic and chemopreventive properties has been reported for various Glycyrrhiza species. The major goal of the current study was to evaluate the potential estrogenic effects of three licorice species (Glycyrrhiza glabra, G. uralensis, and G. inflata in comparison with hops. Extracts of Glycyrrhiza species and spent hops induced estrogen responsive alkaline phosphatase activity in endometrial cancer cells, estrogen responsive element (ERE-luciferase in MCF-7 cells, and Tff1 mRNA in T47D cells. The estrogenic activity decreased in the order H. lupulus > G. uralensis > G. inflata > G. glabra. Liquiritigenin was found to be the principle phytoestrogen of the licorice extracts; however, it exhibited lower estrogenic effects compared to 8-prenylnaringenin in functional assays. Isoliquiritigenin, the precursor chalcone of liquiritigenin, demonstrated significant estrogenic activities while xanthohumol, a metabolic precursor of 8-prenylnaringenin, was not estrogenic. Liquiritigenin showed ERβ selectivity in competitive binding assay and isoliquiritigenin was equipotent for ER subtypes. The estrogenic activity of isoliquiritigenin could be the result of its cyclization to liquiritigenin under physiological conditions. 8-Prenylnaringenin had nanomolar estrogenic potency without ER selectivity while xanthohumol did not bind ERs. These data demonstrated that Glycyrrhiza species with different contents of liquiritigenin have various levels of estrogenic activities, suggesting the importance of precise labeling of

  14. In Vitro Testing of Scaffolds for Mesenchymal Stem Cell-Based Meniscus Tissue Engineering—Introducing a New Biocompatibility Scoring System

    Directory of Open Access Journals (Sweden)

    Felix P. Achatz

    2016-04-01

    Full Text Available A combination of mesenchymal stem cells (MSCs and scaffolds seems to be a promising approach for meniscus repair. To facilitate the search for an appropriate scaffold material a reliable and objective in vitro testing system is essential. This paper introduces a new scoring for this purpose and analyzes a hyaluronic acid (HA gelatin composite scaffold and a polyurethane scaffold in combination with MSCs for tissue engineering of meniscus. The pore quality and interconnectivity of pores of a HA gelatin composite scaffold and a polyurethane scaffold were analyzed by surface photography and Berliner-Blau-BSA-solution vacuum filling. Further the two scaffold materials were vacuum-filled with human MSCs and analyzed by histology and immunohistochemistry after 21 days in chondrogenic media to determine cell distribution and cell survival as well as proteoglycan production, collagen type I and II content. The polyurethane scaffold showed better results than the hyaluronic acid gelatin composite scaffold, with signs of central necrosis in the HA gelatin composite scaffolds. The polyurethane scaffold showed good porosity, excellent pore interconnectivity, good cell distribution and cell survival, as well as an extensive content of proteoglycans and collagen type II. The polyurethane scaffold seems to be a promising biomaterial for a mesenchymal stem cell-based tissue engineering approach for meniscal repair. The new score could be applied as a new standard for in vitro scaffold testing.

  15. Hopping control channel MAC protocol for opportunistic spectrum access networks

    Institute of Scientific and Technical Information of China (English)

    FU Jing-tuan; JI Hong; MAO Xu

    2010-01-01

    Opportunistic spectrum access (OSA) is considered as a promising approach to mitigate spectrum scarcity by allowing unlicensed users to exploit spectrum opportunities in licensed frequency bands. Derived from the existing channel-hopping multiple access (CHMA) protocol,we introduce a hopping control channel medium access control (MAC) protocol in the context of OSA networks. In our proposed protocol,all nodes in the network follow a common channel-hopping sequence; every frequency channel can be used as control channel and data channel. Considering primary users' occupancy of the channel,we use a primary user (PU) detection model to calculate the channel availability for unlicensed users' access. Then,a discrete Markov chain analytical model is applied to describe the channel states and deduce the system throughput. Through simulation,we present numerical results to demonstrate the throughput performance of our protocol and thus validate our work.

  16. Comparison of Rheological Properties of Hopped Wort and Malt Wort

    Directory of Open Access Journals (Sweden)

    Petr Trávníček

    2015-01-01

    Full Text Available The aim of this work is determination rheological properties of hopped wort and malt wort and their comparison. In the paper following rheological properties has been described: the dependence of viscosity on a temperature of a sample and hysteresis loop test. The time dependence test was performed for a confirmation thixotropic behaviour. Based on measured values Arrhenius mathematical model has been applied. The activation energy was determined by using of this model. Tests have been carried out in the temperature range from 5 °C to 40 °C. Rheological tests proved that malt wort behaves as Newtonian fluid in all temperatures and hopped wort behaves as non-Newtonian fluid at low temperatures. Thixotropic behaviour is caused by the content of the rests of hops heads or malt scraps.

  17. Switched diversity strategies for dual-hop relaying systems

    KAUST Repository

    Gaaloul, Fakhreddine

    2011-04-29

    This paper investigates the effect of different switched diversity configurations on the implementation complexity and achieved performance of dual-hop amplify-and-forward (AF) relaying networks. A low-complexity model of the relay station is adopted, wherein single-input single-output antenna configuration is employed. Each of the transmitter and the receiver however employs multiple antennas to improve the overall link performance. Single-phase and two-phase based receive switching strategies are investigated assuming optimum first hop signal-to-noise ratio (SNR). Moreover, the simple scheme in which the switched diversity is applied independently over the two hops is studied using tight upper bounds. Thorough performance comparisons and switching thresholds optimization for the aforementioned strategies are presented. Simulation results are also provided to validate the mathematical development and to verify the numerical computations.

  18. Hopping magnetotransport via nonzero orbital momentum states and organic magnetoresistance.

    Science.gov (United States)

    Alexandrov, Alexandre S; Dediu, Valentin A; Kabanov, Victor V

    2012-05-04

    In hopping magnetoresistance of doped insulators, an applied magnetic field shrinks the electron (hole) s-wave function of a donor or an acceptor and this reduces the overlap between hopping sites resulting in the positive magnetoresistance quadratic in a weak magnetic field, B. We extend the theory of hopping magnetoresistance to states with nonzero orbital momenta. Different from s states, a weak magnetic field expands the electron (hole) wave functions with positive magnetic quantum numbers, m>0, and shrinks the states with negative m in a wide region outside the point defect. This together with a magnetic-field dependence of injection/ionization rates results in a negative weak-field magnetoresistance, which is linear in B when the orbital degeneracy is lifted. The theory provides a possible explanation of a large low-field magnetoresistance in disordered π-conjugated organic materials.

  19. Contribution of afferent feedback and descending drive to human hopping

    DEFF Research Database (Denmark)

    Zuur, Abraham T.; Lundbye-Jensen, Jesper; Leukel, Christian

    2010-01-01

    During hopping an early burst can be observed in the EMG from the soleus muscle starting about 45 ms after touch-down. It may be speculated that this early EMG burst is a stretch reflex response superimposed on activity from a supra-spinal origin. We hypothesised that if a stretch reflex indeed...... contributes to the early EMG burst, then advancing or delaying the touch-down without the subject's knowledge should similarly advance or delay the burst. This was indeed the case when touch-down was advanced or delayed by shifting the height of a programmable platform up or down between two hops...... and this resulted in a correspondent shift of the early EMG burst. Our second hypothesis was that the motor cortex contributes to the first EMG burst during hopping. If so, inhibition of the motor cortex would reduce the magnitude of the burst. By applying a low-intensity magnetic stimulus it was possible...

  20. A novel nano-structured porous polycaprolactone scaffold improves hyaline cartilage repair in a rabbit model compared to a collagen type I/III scaffold: in vitro and in vivo studies.

    Science.gov (United States)

    Christensen, Bjørn Borsøe; Foldager, Casper Bindzus; Hansen, Ole Møller; Kristiansen, Asger Albæk; Le, Dang Quang Svend; Nielsen, Agnete Desirée; Nygaard, Jens Vinge; Bünger, Cody Erik; Lind, Martin

    2012-06-01

    To develop a nano-structured porous polycaprolactone (NSP-PCL) scaffold and compare the articular cartilage repair potential with that of a commercially available collagen type I/III (Chondro-Gide) scaffold. By combining rapid prototyping and thermally induced phase separation, the NSP-PCL scaffold was produced for matrix-assisted autologous chondrocyte implantation. Lyophilizing a water-dioxane-PCL solution created micro and nano-pores. In vitro: The scaffolds were seeded with rabbit chondrocytes and cultured in hypoxia for 6 days. qRT-PCR was performed using primers for sox9, aggrecan, collagen type 1 and 2. In vivo: 15 New Zealand White Rabbits received bilateral osteochondral defects in the femoral intercondylar grooves. Autologous chondrocytes were harvested 4 weeks prior to surgery. There were 3 treatment groups: (1) NSP-PCL scaffold without cells. (2) The Chondro-Gide scaffold with autologous chondrocytes and (3) NSP-PCL scaffold with autologous chondrocytes. Observation period was 13 weeks. Histological evaluation was made using the O'Driscoll score. In vitro: The expressions of sox9 and aggrecan were higher in the NSP-PCL scaffold, while expression of collagen 1 was lower compared to the Chondro-Gide scaffold. In vivo: Both NSP-PCL scaffolds with and without cells scored significantly higher than the Chondro-Gide scaffold when looking at the structural integrity and the surface regularity of the repair tissue. No differences were found between the NSP-PCL scaffold with and without cells. The NSP-PCL scaffold demonstrated higher in vitro expression of chondrogenic markers and had higher in vivo histological scores compared to the Chondro-Gide scaffold. The improved chondrocytic differentiation can potentially produce more hyaline cartilage during clinical cartilage repair. It appears to be a suitable cell-free implant for hyaline cartilage repair and could provide a less costly and more effective treatment option than the Chondro-Gide scaffold with cells.

  1. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    Energy Technology Data Exchange (ETDEWEB)

    Kowalewski, Markus, E-mail: mkowalew@uci.edu; Mukamel, Shaul, E-mail: smukamel@uci.edu [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States)

    2015-07-28

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings.

  2. Stimulated Raman signals at conical intersections: Ab initio surface hopping simulation protocol with direct propagation of the nuclear wave function

    International Nuclear Information System (INIS)

    Kowalewski, Markus; Mukamel, Shaul

    2015-01-01

    Femtosecond Stimulated Raman Spectroscopy (FSRS) signals that monitor the excited state conical intersections dynamics of acrolein are simulated. An effective time dependent Hamiltonian for two C—H vibrational marker bands is constructed on the fly using a local mode expansion combined with a semi-classical surface hopping simulation protocol. The signals are obtained by a direct forward and backward propagation of the vibrational wave function on a numerical grid. Earlier work is extended to fully incorporate the anharmonicities and intermode couplings

  3. DNA-scaffolded nanoparticle structures

    Energy Technology Data Exchange (ETDEWEB)

    Hoegberg, Bjoern; Olin, Haakan [Department of Engineering Physics and Mathematics, Mid Sweden University, SE-851 70 Sundsvall, Sweden (Sweden)

    2007-03-15

    DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications.

  4. DNA-scaffolded nanoparticle structures

    International Nuclear Information System (INIS)

    Hoegberg, Bjoern; Olin, Haakan

    2007-01-01

    DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications

  5. Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

    KAUST Repository

    Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

    2017-01-01

    In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

  6. Nano-ceramic composite scaffolds for bioreactor-based bone engineering.

    Science.gov (United States)

    Lv, Qing; Deng, Meng; Ulery, Bret D; Nair, Lakshmi S; Laurencin, Cato T

    2013-08-01

    Composites of biodegradable polymers and bioactive ceramics are candidates for tissue-engineered scaffolds that closely match the properties of bone. We previously developed a porous, three-dimensional poly (D,L-lactide-co-glycolide) (PLAGA)/nanohydroxyapatite (n-HA) scaffold as a potential bone tissue engineering matrix suitable for high-aspect ratio vessel (HARV) bioreactor applications. However, the physical and cellular properties of this scaffold are unknown. The present study aims to evaluate the effect of n-HA in modulating PLAGA scaffold properties and human mesenchymal stem cell (HMSC) responses in a HARV bioreactor. By comparing PLAGA/n-HA and PLAGA scaffolds, we asked whether incorporation of n-HA (1) accelerates scaffold degradation and compromises mechanical integrity; (2) promotes HMSC proliferation and differentiation; and (3) enhances HMSC mineralization when cultured in HARV bioreactors. PLAGA/n-HA scaffolds (total number = 48) were loaded into HARV bioreactors for 6 weeks and monitored for mass, molecular weight, mechanical, and morphological changes. HMSCs were seeded on PLAGA/n-HA scaffolds (total number = 38) and cultured in HARV bioreactors for 28 days. Cell migration, proliferation, osteogenic differentiation, and mineralization were characterized at four selected time points. The same amount of PLAGA scaffolds were used as controls. The incorporation of n-HA did not alter the scaffold degradation pattern. PLAGA/n-HA scaffolds maintained their mechanical integrity throughout the 6 weeks in the dynamic culture environment. HMSCs seeded on PLAGA/n-HA scaffolds showed elevated proliferation, expression of osteogenic phenotypic markers, and mineral deposition as compared with cells seeded on PLAGA scaffolds. HMSCs migrated into the scaffold center with nearly uniform cell and extracellular matrix distribution in the scaffold interior. The combination of PLAGA/n-HA scaffolds with HMSCs in HARV bioreactors may allow for the generation of engineered

  7. From Broken Glass to Ruf Diamonds: Manchester Hip Hop

    OpenAIRE

    de Paor-Evans, Adam

    2018-01-01

    When one considers music culture in Manchester during the 1980s and 1990s, Hip Hop is not an obvious cultural arena for discussion. However, amidst the spectacle of The Haçienda, the pop boom of Factory Records and the evolution of rave subculture and form of dance music which produced the pop cultural phenomenon of Madchester; in the space of music between The Fall and The Charlatans where brief stardom was found by Inspiral Carpets, Northside and Candyflip, Mancunian Hip Hop was also evolvi...

  8. VEGF-incorporated biomimetic poly(lactide-co-glycolide) sintered microsphere scaffolds for bone tissue engineering.

    Science.gov (United States)

    Jabbarzadeh, Ehsan; Deng, Meng; Lv, Qing; Jiang, Tao; Khan, Yusuf M; Nair, Lakshmi S; Laurencin, Cato T

    2012-11-01

    Regenerative engineering approaches utilizing biomimetic synthetic scaffolds provide alternative strategies to repair and restore damaged bone. The efficacy of the scaffolds for functional bone regeneration critically depends on their ability to induce and support vascular infiltration. In the present study, three-dimensional (3D) biomimetic poly(lactide-co-glycolide) (PLAGA) sintered microsphere scaffolds were developed by sintering together PLAGA microspheres followed by nucleation of minerals in a simulated body fluid. Further, the angiogenic potential of vascular endothelial growth factor (VEGF)-incorporated mineralized PLAGA scaffolds were examined by monitoring the growth and phenotypic expression of endothelial cells on scaffolds. Scanning electron microscopy micrographs confirmed the growth of bone-like mineral layers on the surface of microspheres. The mineralized PLAGA scaffolds possessed interconnectivity and a compressive modulus of 402 ± 61 MPa and compressive strength of 14.6 ± 2.9 MPa. Mineralized scaffolds supported the attachment and growth and normal phenotypic expression of endothelial cells. Further, precipitation of apatite layer on PLAGA scaffolds resulted in an enhanced VEGF adsorption and prolonged release compared to nonmineralized PLAGA and, thus, a significant increase in endothelial cell proliferation. Together, these results demonstrated the potential of VEGF-incorporated biomimetic PLAGA sintered microsphere scaffolds for bone tissue engineering as they possess the combined effects of osteointegrativity and angiogenesis. Copyright © 2012 Wiley Periodicals, Inc.

  9. Design and fabrication of biomimetic multiphased scaffolds for ligament-to-bone fixation.

    Science.gov (United States)

    He, Jiankang; Zhang, Wenyou; Liu, Yaxiong; Li, Xiang; Li, Dichen; Jin, Zhongmin

    2015-05-01

    Conventional ligament grafts with single material composition cannot effectively integrate with the host bones due to mismatched properties and eventually affect their long-term function in vivo. Here we presented a multi-material strategy to design and fabricate composite scaffolds including ligament, interface and bone multiphased regions. The interface region consists of triphasic layers with varying material composition and porous structure to mimic native ligament-to-bone interface while the bone region contains polycaprolactone (PCL) anchor and microchanneled ceramic scaffolds to potentially provide combined mechanical and biological implant-bone fixation. Finite element analysis (FEA) demonstrated that the multiphased scaffolds with interference value smaller than 0.5 mm could avoid the fracture of ceramic scaffold during the implantation process, which was validated by in-vitro implanting the multiphased scaffolds into porcine joint bones. Pull-out experiment showed that the initial fixation between the multiphased scaffolds with 0.47 mm interference and the host bones could withstand the maximum force of 360.31±97.51 N, which can be improved by reinforcing the ceramic scaffolds with biopolymers. It is envisioned that the multiphased scaffold could potentially induce the regeneration of a new bone as well as interfacial tissue with the gradual degradation of the scaffold and subsequently realize long-term biological fixation of the implant with the host bone. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Bioactive glass-poly (ε-caprolactone) composite scaffolds with 3 dimensionally hierarchical pore networks

    International Nuclear Information System (INIS)

    Yun, Hui-suk; Kim, Seung-eon; Park, Eui Kyun

    2011-01-01

    Hierarchically mesoporous-macroporous-giant-porous bioactive glass/poly ε-caprolactone (PCL) composite scaffolds were prepared using a combination of the sol-gel method, evaporation-induced self-assembly process in the presence of nonionic triblock copolymer, EO 100 PO 65 EO 100 (F127), as template, salt leaching method, and rapid prototyping techniques. F127 acts as a template, inducing the formation of mesopores, NaCl with sizes between 25 and 33 μm provides macro-pores after leaching, and rapid prototyping produces giant-pores. The structure and morphology of the scaffolds were characterized by the field emission scanning electron microscopy, transmission electron microscopy, and Hg porosimetry. The mechanical properties of the scaffolds were examined by the dynamic mechanical analysis. Their in vitro bioactivities were confirmed by immersing the scaffolds in simulated body fluid. Their biocompatibilities were also evaluated by culturing human bone marrow stromal cells on the scaffolds. The scaffolds show good molding capabilities, mechanical properties, 3 dimensionally well-interconnected pore structures, bioactivities, and biocompatibilities in vitro. Depending on the amount of NaCl, the scaffolds also show unique sponge-like properties, but still retain better mechanical properties than general salt leaching derived PCL scaffolds. All of the data provide good evidence that the obtained scaffolds possess excellent potential for applications in the fields of tissue engineering and drug storage.

  11. Sol–gel method to fabricate CaP scaffolds by robocasting for tissue engineering

    Science.gov (United States)

    Fu, Qiang; Saiz, Eduardo; Tomsia, Antoni P.

    2012-01-01

    Highly porous calcium phosphate (CaP) scaffolds for bone-tissue engineering were fabricated by combining a robocasting process with a sol–gel synthesis that mixed Calcium Nitrate Tetrahydrate and Triethyl Phosphite precursors in an aqueous medium. The resulting gels were used to print scaffolds by robocasting without the use of binder to increase the viscosity of the paste. X-ray diffraction analysis confirmed that the process yielded hydroxyapatite and β-tricalcium phosphate biphasic composite powders. Thus, the scaffold composition after crystallization of the amorphous structure could be easily modified by varying the initial Ca/P ratio during synthesis. The compressive strengths of the scaffolds are ~6 MPa, which is in the range of human cancellous bone (2–12 MPa). These highly porous scaffolds (~73 vol% porosity) are composed of macro-pores of ~260 μm in size; such porosity is expected to enable bone ingrowth into the scaffold for bone repair applications. The chemistry, porosity, and surface topography of such scaffolds can also be modified by the process parameters to favor bone formation. The studied sol–gel process can be used to coat these scaffolds by dip-coating, which induces a significant enhancement of mechanical properties. This can adjust scaffold properties such as composition and surface morphology, which consequently may improve their performances. PMID:22311079

  12. Characterization of Three-Dimensional Printed Composite Scaffolds Prepared with Different Fabrication Methods

    Directory of Open Access Journals (Sweden)

    Szlązak K.

    2016-06-01

    Full Text Available An optimal method for composites preparation as an input to rapid prototyping fabrication of scaffolds with potential application in osteochondral tissue engineering is still needed. Scaffolds in tissue engineering applications play a role of constructs providing appropriate mechanical support with defined porosity to assist regeneration of tissue. The aim of the presented study was to analyze the influence of composite fabrication methods on scaffolds mechanical properties. The evaluation was performed on polycaprolactone (PCL with 5 wt% beta-tricalcium phosphate (TCP scaffolds fabricated using fused deposition modeling (FDM. Three different methods of PCL-TCP composite preparation: solution casting, particles milling, extrusion and injection were used to provide material for scaffold fabrication. The obtained scaffolds were investigated by means of scanning electron microscope, x-ray micro computed tomography, thermal gravimetric analysis and static material testing machine. All of the scaffolds had the same geometry (cylinder, 4×6 mm and fiber orientation (0/60/120°. There were some differences in the TCP distribution and formation of the ceramic agglomerates in the scaffolds. They depended on fabrication method. The use of composites prepared by solution casting method resulted in scaffolds with the best combination of compressive strength (5.7±0.2 MPa and porosity (48.5±2.7 %, both within the range of trabecular bone.

  13. Self-assembly model, hepatocytes attachment and inflammatory response for silk fibroin/chitosan scaffolds

    International Nuclear Information System (INIS)

    She Zhending; Feng Qingling; Liu Weiqiang

    2009-01-01

    Silk fibroin is an attractive natural fibrous protein for biomedical application due to its good biocompatibility and high tensile strength. Silk fibroin is apt to form a sheet-like structure during the freeze-drying process, which is not suitable for the scaffold of tissue engineering. In our former study, the adding of chitosan promoted the self-assembly of silk fibroin/chitosan (SFCS) into a three-dimensional (3D) homogeneous porous structure. In this study, a model of the self-assembly is proposed; furthermore, hepatocytes attachment and inflammatory response for the SFCS scaffold were examined. The rigid chain of chitosan may be used as a template for β-sheet formation of silk fibroin, and this may break the sheet structure of the silk fibroin scaffold and promote the formation of a 3D porous structure of the SFCS scaffold. Compared with the polylactic glycolic acid scaffold, the SFCS scaffold further facilitates the attachment of hepatocytes. To investigate the inflammatory response, SFCS scaffolds were implanted into the greater omentum of rats. From the results of implantation, we could demonstrate in vivo that the implantation of SFCS scaffolds resulted in only slight inflammation. Keeping the good histocompatibility and combining the advantages of both fibroin and chitosan, the SFCS scaffold could be a prominent candidate for soft tissue engineering, for example, in the liver.

  14. Self-assembly model, hepatocytes attachment and inflammatory response for silk fibroin/chitosan scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    She Zhending; Feng Qingling [State Key Laboratory of New Ceramics and Fine Processing, Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Liu Weiqiang, E-mail: biomater@mail.tsinghua.edu.c [Center for Advanced Materials and Biotechnology, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China)

    2009-08-15

    Silk fibroin is an attractive natural fibrous protein for biomedical application due to its good biocompatibility and high tensile strength. Silk fibroin is apt to form a sheet-like structure during the freeze-drying process, which is not suitable for the scaffold of tissue engineering. In our former study, the adding of chitosan promoted the self-assembly of silk fibroin/chitosan (SFCS) into a three-dimensional (3D) homogeneous porous structure. In this study, a model of the self-assembly is proposed; furthermore, hepatocytes attachment and inflammatory response for the SFCS scaffold were examined. The rigid chain of chitosan may be used as a template for beta-sheet formation of silk fibroin, and this may break the sheet structure of the silk fibroin scaffold and promote the formation of a 3D porous structure of the SFCS scaffold. Compared with the polylactic glycolic acid scaffold, the SFCS scaffold further facilitates the attachment of hepatocytes. To investigate the inflammatory response, SFCS scaffolds were implanted into the greater omentum of rats. From the results of implantation, we could demonstrate in vivo that the implantation of SFCS scaffolds resulted in only slight inflammation. Keeping the good histocompatibility and combining the advantages of both fibroin and chitosan, the SFCS scaffold could be a prominent candidate for soft tissue engineering, for example, in the liver.

  15. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    Science.gov (United States)

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  16. Boron containing poly-(lactide-co-glycolide) (PLGA) scaffolds for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Doğan, Ayşegül; Demirci, Selami [Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Yeditepe University 34755 Istanbul (Turkey); Bayir, Yasin [Department of Biochemistry, Faculty of Pharmacy, Ataturk University, 25240, Erzurum (Turkey); Halici, Zekai [Department of Pharmacology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Karakus, Emre [Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Ataturk University, 25240, Erzurum (Turkey); Aydin, Ali [Department of Orthopedics and Traumatology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Cadirci, Elif [Department of Pharmacology, Faculty of Pharmacy, Ataturk University, 25240, Erzurum (Turkey); Albayrak, Abdulmecit [Department of Pharmacology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Demirci, Elif [Department of Pathology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Karaman, Adem [Department of Radiology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Ayan, Arif Kursat [Department of Nuclear Medicine, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Gundogdu, Cemal [Department of Pathology, Faculty of Medicine, Ataturk University, 25240, Erzurum (Turkey); Şahin, Fikrettin, E-mail: fsahin@yeditepe.edu.tr [Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Yeditepe University 34755 Istanbul (Turkey)

    2014-11-01

    Scaffold-based bone defect reconstructions still face many challenges due to their inadequate osteoinductive and osteoconductive properties. Various biocompatible and biodegradable scaffolds, combined with proper cell type and biochemical signal molecules, have attracted significant interest in hard tissue engineering approaches. In the present study, we have evaluated the effects of boron incorporation into poly-(lactide-co-glycolide-acid) (PLGA) scaffolds, with or without rat adipose-derived stem cells (rADSCs), on bone healing in vitro and in vivo. The results revealed that boron containing scaffolds increased in vitro proliferation, attachment and calcium mineralization of rADSCs. In addition, boron containing scaffold application resulted in increased bone regeneration by enhancing osteocalcin, VEGF and collagen type I protein levels in a femur defect model. Bone mineralization density (BMD) and computed tomography (CT) analysis proved that boron incorporated scaffold administration increased the healing rate of bone defects. Transplanting stem cells into boron containing scaffolds was found to further improve bone-related outcomes compared to control groups. Additional studies are highly warranted for the investigation of the mechanical properties of these scaffolds in order to address their potential use in clinics. The study proposes that boron serves as a promising innovative approach in manufacturing scaffold systems for functional bone tissue engineering. - Highlights: • Boron containing PLGA scaffolds were developed for bone tissue engineering. • Boron incorporation increased cell viability and mineralization of stem cells. • Boron containing scaffolds increased bone-related protein expression in vivo. • Implantation of stem cells on boron containing scaffolds improved bone healing.

  17. Boron containing poly-(lactide-co-glycolide) (PLGA) scaffolds for bone tissue engineering

    International Nuclear Information System (INIS)

    Doğan, Ayşegül; Demirci, Selami; Bayir, Yasin; Halici, Zekai; Karakus, Emre; Aydin, Ali; Cadirci, Elif; Albayrak, Abdulmecit; Demirci, Elif; Karaman, Adem; Ayan, Arif Kursat; Gundogdu, Cemal; Şahin, Fikrettin

    2014-01-01

    Scaffold-based bone defect reconstructions still face many challenges due to their inadequate osteoinductive and osteoconductive properties. Various biocompatible and biodegradable scaffolds, combined with proper cell type and biochemical signal molecules, have attracted significant interest in hard tissue engineering approaches. In the present study, we have evaluated the effects of boron incorporation into poly-(lactide-co-glycolide-acid) (PLGA) scaffolds, with or without rat adipose-derived stem cells (rADSCs), on bone healing in vitro and in vivo. The results revealed that boron containing scaffolds increased in vitro proliferation, attachment and calcium mineralization of rADSCs. In addition, boron containing scaffold application resulted in increased bone regeneration by enhancing osteocalcin, VEGF and collagen type I protein levels in a femur defect model. Bone mineralization density (BMD) and computed tomography (CT) analysis proved that boron incorporated scaffold administration increased the healing rate of bone defects. Transplanting stem cells into boron containing scaffolds was found to further improve bone-related outcomes compared to control groups. Additional studies are highly warranted for the investigation of the mechanical properties of these scaffolds in order to address their potential use in clinics. The study proposes that boron serves as a promising innovative approach in manufacturing scaffold systems for functional bone tissue engineering. - Highlights: • Boron containing PLGA scaffolds were developed for bone tissue engineering. • Boron incorporation increased cell viability and mineralization of stem cells. • Boron containing scaffolds increased bone-related protein expression in vivo. • Implantation of stem cells on boron containing scaffolds improved bone healing

  18. Human-like collagen/nano-hydroxyapatite scaffolds for the culture of chondrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Liping; Duan, Zhiguang [Shaanxi Key Laboratory of Degradable Biomedical Materials, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Shaanxi R and D Center of Biomaterials and Fermentation Engineering, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Fan, Daidi, E-mail: fandaidi@nwu.edu.cn [Shaanxi Key Laboratory of Degradable Biomedical Materials, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Shaanxi R and D Center of Biomaterials and Fermentation Engineering, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Mi, Yu; Hui, Junfeng [Shaanxi Key Laboratory of Degradable Biomedical Materials, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Shaanxi R and D Center of Biomaterials and Fermentation Engineering, Northwest University, 229 Taibai North Road, Xi' an, Shaanxi 710069 (China); Chang, Le [School of Chemical Engineering, Northwest University, Xi' an, Shaanxi 710069 (China)

    2013-03-01

    Three dimensional (3D) biodegradable porous scaffolds play a key role in cartilage tissue repair. Freeze-drying and cross-linking techniques were used to fabricate a 3D composite scaffold that combined the excellent biological characteristics of human-like collagen (HLC) and the outstanding mechanical properties of nano-hydroxyapatite (nHA). The scaffolds were characterized by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and compression tests, using Relive Registered-Sign Artificial Bone (RAB) scaffolds as a control. HLC/nHA scaffolds displayed homogeneous interconnected macroporous structure and could withstand a compression stress of 2.67 {+-} 0.37 MPa, which was higher than that of the control group. Rabbit chondrocytes were seeded on the composite porous scaffolds and cultured for 21 days. Cell/scaffold constructs were examined using SEM, histological procedures, and biochemical assays for cell proliferation and the production of glycosaminoglycans (GAGs). The results indicated that HLC/nHA porous scaffolds were capable of encouraging cell adhesion, homogeneous distribution and abundant GAG synthesis, and maintaining natural chondrocyte morphology compared to RAB scaffolds. In conclusion, the presented data warrants the further exploration of HLC/nHA scaffolds as a potential biomimetic platform for chondrocytes in cartilage tissue engineering. - Highlights: Black-Right-Pointing-Pointer Human-like collagen was first used to prepare cartilage tissue engineering scaffold. Black-Right-Pointing-Pointer Genipin, a natural biological cross-linking agent, was introduced to treat scaffold. Black-Right-Pointing-Pointer We chose market product as a control.

  19. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Directory of Open Access Journals (Sweden)

    María Pilar Castañeda-Ojeda

    2017-05-01

    Full Text Available The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts.

  20. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    Science.gov (United States)

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  1. Mussel-inspired graphene oxide nanosheet-enwrapped Ti scaffolds with drug-encapsulated gelatin microspheres for bone regeneration.

    Science.gov (United States)

    Han, Lu; Sun, Honglong; Tang, Pengfei; Li, Pengfei; Xie, Chaoming; Wang, Menghao; Wang, Kefeng; Weng, Jie; Tan, Hui; Ren, Fuzeng; Lu, Xiong

    2018-02-27

    Graphene oxide (GO) attracts considerable attention for biomedical applications owing to its unique nanostructure and remarkable physicochemical characteristics. However, it is challenging to uniformly deposit GO on chemically inert Ti scaffolds, which have good biocompatibility and wide applications in bone engineering. In this study, a GO-functionalized Ti porous scaffold (GO/Ti scaffold) was prepared by depositing GO onto polydopamine (PDA) modified Ti scaffolds. The mussel-inspired PDA modification facilitated the interaction between GO and Ti surfaces, leading to a uniform coverage of GO on Ti scaffolds. BMP2 and vancomycin (Van) were separately encapsulated into gelatin microspheres (GelMS). Then, drug-containing GelMS were assembled on GO/Ti scaffolds and anchored by the functional groups of GO. The modified scaffold independently delivered multiple biomolecules with different physiochemical properties, without interfering with each other. Thus, the GO/Ti scaffold has the dual functions of inducing bone regeneration and preventing bacterial infection. In summary, this mussel-inspired GO/Ti hybrid scaffold combined the good mechanical properties of Ti scaffolds and the advantages of GO nanosheets. GO nanosheets with their unique nanostructure and functional groups, together with GelMS on Ti scaffolds, are suitable carriers for drug delivery and provide adhesive sites for cell adhesion and create nanostructured environments for bone regeneration.

  2. Post-Menopausal Vaginal Hemorrhage Related to the Use of a Hop-Containing Phytotherapeutic Product

    NARCIS (Netherlands)

    van Hunsel, Florence; van de Koppel, Sonja; van Puijenbroek, Eugène

    2015-01-01

    Two 54-year-old women developed abdominal cramps and vaginal hemorrhage as a result of endometrial hyperplasia during treatment with a hop-containing phytotherapeutic product (MenoCool®) for post-menopausal complaints. The women used the hop-containing phytotherapeutic product (418 mg of hop per

  3. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    Science.gov (United States)

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  4. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    Science.gov (United States)

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  5. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    Science.gov (United States)

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  6. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    Science.gov (United States)

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  7. Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

    Science.gov (United States)

    Hill, Marc Lamont

    2009-01-01

    For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

  8. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    Science.gov (United States)

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  9. Adjusting Sensing Range to Maximize Throughput on Ad-Hoc Multi-Hop Wireless Networks

    National Research Council Canada - National Science Library

    Roberts, Christopher

    2003-01-01

    .... Such a network is referred to as a multi-hop ad-hoc network, or simply a multi-hop network. Most multi-hop network protocols use some form of carrier sensing to determine if the wireless channel is in use...

  10. A 0.75V 523W 40dB-SFDR frequency-hopping synthesizer for wireless sensor networks in 90nm CMOS

    NARCIS (Netherlands)

    Lopelli, E.; Tang, van der J.D.; Philips, K.J.P.; Roermund, van A.H.M.; Gyselinckx, B.

    2009-01-01

    This paper presents a baseband Frequency-Hopping Synthesizer (FHS) architecture that achieves the above requirements, along with its circuit implementation. The system uses a combination of digital techniques, such as CMOS programmable dividers for scalability, low power and robustness, and analog

  11. Engineering bone grafts with enhanced bone marrow and native scaffolds.

    Science.gov (United States)

    Hung, Ben P; Salter, Erin K; Temple, Josh; Mundinger, Gerhard S; Brown, Emile N; Brazio, Philip; Rodriguez, Eduardo D; Grayson, Warren L

    2013-01-01

    The translation of tissue engineering approaches to the clinic has been hampered by the inability to find suitable multipotent cell sources requiring minimal in vitro expansion. Enhanced bone marrow (eBM), which is obtained by reaming long bone medullary canals and isolating the solid marrow putty, has large quantities of stem cells and demonstrates significant potential to regenerate bone tissues. eBM, however, cannot impart immediate load-bearing mechanical integrity or maintain the gross anatomical structure to guide bone healing. Yet, its putty-like consistency creates a challenge for obtaining the uniform seeding necessary to effectively combine it with porous scaffolds. In this study, we examined the potential for combining eBM with mechanically strong, osteoinductive trabecular bone scaffolds for bone regeneration by creating channels into scaffolds for seeding the eBM. eBM was extracted from the femurs of adult Yorkshire pigs using a Synthes reamer-irrigator-aspirator device, analyzed histologically, and digested to extract cells and characterize their differentiation potential. To evaluate bone tissue formation, eBM was seeded into the channels in collagen-coated or noncoated scaffolds, cultured in osteogenic conditions for 4 weeks, harvested and assessed for tissue distribution and bone formation. Our data demonstrates that eBM is a heterogenous tissue containing multipotent cell populations. Furthermore, coating scaffolds with a collagen hydrogel significantly enhanced cellular migration, promoted uniform tissue development and increased bone mineral deposition. These findings suggest the potential for generating customized autologous bone grafts for treating critical-sized bone defects by combining a readily available eBM cell source with decellularized trabecular bone scaffolds. © 2013 S. Karger AG, Basel

  12. Novel chitosan/collagen scaffold containing transforming growth factor-β1 DNA for periodontal tissue engineering

    International Nuclear Information System (INIS)

    Zhang Yufeng; Cheng Xiangrong; Wang Jiawei; Wang Yining; Shi Bin; Huang Cui; Yang Xuechao; Liu Tongjun

    2006-01-01

    The current rapid progression in tissue engineering and local gene delivery system has enhanced our applications to periodontal tissue engineering. In this study, porous chitosan/collagen scaffolds were prepared through a freeze-drying process, and loaded with plasmid and adenoviral vector encoding human transforming growth factor-β1 (TGF-β1). These scaffolds were evaluated in vitro by analysis of microscopic structure, porosity, and cytocompatibility. Human periodontal ligament cells (HPLCs) were seeded in this scaffold, and gene transfection could be traced by green fluorescent protein (GFP). The expression of type I and type III collagen was detected with RT-PCR, and then these scaffolds were implanted subcutaneously into athymic mice. Results indicated that the pore diameter of the gene-combined scaffolds was lower than that of pure chitosan/collagen scaffold. The scaffold containing Ad-TGF-β1 exhibited the highest proliferation rate, and the expression of type I and type III collagen up-regulated in Ad-TGF-β1 scaffold. After implanted in vivo, EGFP-transfected HPLCs not only proliferated but also recruited surrounding tissue to grow in the scaffold. This study demonstrated the potential of chitosan/collagen scaffold combined Ad-TGF-β1 as a good substrate candidate in periodontal tissue engineering

  13. MODEL SCAFFOLDING PEMBELAJARAN MENULIS DENGAN PENDEKATAN PROSES BAGI ANAK TUNARUNGU

    Directory of Open Access Journals (Sweden)

    Yuliyati Endang Purbaningrum Endang Purbaningrum

    2016-10-01

    Full Text Available The aim for this researach is (1 to describe the needs analysis and challenges and (2 to produce the scaffolding draft model in learning writing using process ap-proach combined with the reflective maternal method (MMR. This research develop-ment applies R2D2 model which emphasizes users’ need based on the context (teacher-student with difable  and developed collaboratively. Based on the needs analysis in the field in the first year, scaffolding draft model was produced using approach elaborated with the reflective maternal method (MMR.

  14. HapHop-Physio: a computer game to support cognitive therapies in children

    Directory of Open Access Journals (Sweden)

    Rico-Olarte C

    2017-07-01

    Full Text Available Carolina Rico-Olarte,1 Diego M López,1 Santiago Narváez,1 Charic D Farinango,1 Peter S Pharow2 1Faculty of Electronics and Telecommunications Engineering, Universidad del Cauca, Telematics Engineering Research Group, Popayán, Colombia; 2Fraunhofer Institute of Digital Media and Technology IDMT, Ilmenau, Germany Background: Care and support of children with physical or mental disabilities are accompanied with serious concerns for parents, families, healthcare institutions, schools, and their communities. Recent studies and technological innovations have demonstrated the feasibility of providing therapy and rehabilitation services to children supported by computer games. Objective: The aim of this paper is to present HapHop-Physio, an innovative computer game that combines exercise with fun and learning, developed to support cognitive therapies in children. Methods: Conventional software engineering methods such as the Scrum methodology, a functionality test and a related usability test, were part of the comprehensive methodology adapted to develop HapHop-Physio. Results: The game supports visual and auditory attention therapies, as well as visual and auditory memory activities. The game was developed by a multidisciplinary team, which was based on the Hopscotch® platform provided by Fraunhofer Institute for Digital Media Technology IDMT Institute in Germany, and designed in collaboration with a rehabilitation clinic in Colombia. HapHop-Physio was tested and evaluated to probe its functionality and user satisfaction. Conclusion: The results show the development of an easy-to-use and funny game by a multidisciplinary team using state-of-the-art videogame technologies and software methodologies. Children testing the game concluded that they would like to play again while undergoing rehabilitation therapies. Keywords: computer game, exer-games, cognitive therapies, rehabilitation

  15. Costs and returns of producing hops in established tree plantations

    Science.gov (United States)

    Kim Ha; Shadi Atallah; Tamara Benjamin; Lori Hoagland; Lenny Farlee; Keith. Woeste

    2017-01-01

    This article is the first of two publications that analyzes economic opportunities in forest farming for Indiana forest plantation owners. This study explores growing hops along the fence lines of newly established forest stands, while the second study investigates producing American ginseng in older (20- to 30-year-old) forests. The economic analysis presented in this...

  16. Wireless multi-hop networks with stealing : large buffer asymptotics

    NARCIS (Netherlands)

    Guillemin, F.; Knessl, C.; Leeuwaarden, van J.S.H.

    2010-01-01

    Wireless networks equipped with CSMA are scheduled in a fully distributed manner. A disadvantage of such distributed control in multi-hop networks is the hidden node problem that causes the effect of stealing, in which a downstream node steals the channel from an upstream node with probability p.

  17. Examining Hip-Hop as Culturally Relevant Pedagogy

    Science.gov (United States)

    Kim, Jung; Pulido, Isaura

    2015-01-01

    Culturally relevant pedagogy is a framework that conceptualizes the process of student learning as contingent upon educators' deep understanding of students' cultural backgrounds to co-construct knowledge and develop academic skills. Concurrently, there are a growing number of studies that explore hip-hop as a culturally relevant curriculum for…

  18. Crossing the Lexicon: Anglicisms in the German Hip Hop Community

    Science.gov (United States)

    Garley, Matthew E.

    2012-01-01

    The influence of English on German has been an ongoing subject of intense popular and academic interest in the German sphere. In order to better understand this language contact situation, this research project investigates anglicisms--instances of English language material in a German language context--in the German hip hop community, where the…

  19. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

    Science.gov (United States)

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  20. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz; Svensson, Tommy; Brandt-Pearce, Maite; Alouini, Mohamed-Slim

    2017-01-01

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking

  1. Correlated Hopping in the 1D Falicov--Kimball Model

    Science.gov (United States)

    Gajek, Z.; Lemanski, R.

    2001-10-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

  2. Correlated Hopping in the 1d Falicov-Kimball Model

    International Nuclear Information System (INIS)

    Gajek, Z.; Lemanski, R.

    2001-01-01

    Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle-hole symmetry. (author)

  3. Maroc-hop: music and youth identities in the Netherlands

    NARCIS (Netherlands)

    Gazzah, M.; Herrera, L.; Bayat, A.

    2010-01-01

    Two musical forms highly popular among youths of Moroccan origin in the Netherlands—Maroc-hop and Shaabi—permit youths to express specific and multiple identities in local contexts. Shaabi, a popular form of Moroccan folk music used to be found mainly in the private setting of family celebrations,

  4. Investigación a ritmo de hip-hop

    Directory of Open Access Journals (Sweden)

    Melisa Rivière

    2013-09-01

    Full Text Available Soñando se resiste. Hip-hop; en la calle y al parque. Varios autores. Alcaldía Mayor de Bogotá, Secretaría de Cultura, Recreación y Deporte, Orquesta Filarmónica de Bogotá, Bogotá, 2010, 180 págs.

  5. High Order Differential Frequency Hopping: Design and Analysis

    Directory of Open Access Journals (Sweden)

    Yong Li

    2015-01-01

    Full Text Available This paper considers spectrally efficient differential frequency hopping (DFH system design. Relying on time-frequency diversity over large spectrum and high speed frequency hopping, DFH systems are robust against hostile jamming interference. However, the spectral efficiency of conventional DFH systems is very low due to only using the frequency of each channel. To improve the system capacity, in this paper, we propose an innovative high order differential frequency hopping (HODFH scheme. Unlike in traditional DFH where the message is carried by the frequency relationship between the adjacent hops using one order differential coding, in HODFH, the message is carried by the frequency and phase relationship using two-order or higher order differential coding. As a result, system efficiency is increased significantly since the additional information transmission is achieved by the higher order differential coding at no extra cost on either bandwidth or power. Quantitative performance analysis on the proposed scheme demonstrates that transmission through the frequency and phase relationship using two-order or higher order differential coding essentially introduces another dimension to the signal space, and the corresponding coding gain can increase the system efficiency.

  6. Silk fibroin-chondroitin sulfate scaffold with immuno-inhibition property for articular cartilage repair.

    Science.gov (United States)

    Zhou, Feifei; Zhang, Xianzhu; Cai, Dandan; Li, Jun; Mu, Qin; Zhang, Wei; Zhu, Shouan; Jiang, Yangzi; Shen, Weiliang; Zhang, Shufang; Ouyang, Hong Wei

    2017-11-01

    The demand of favorable scaffolds has increased for the emerging cartilage tissue engineering. Chondroitin sulfate (CS) and silk fibroin have been investigated and reported with safety and excellent biocompatibility as tissue engineering scaffolds. However, the rapid degradation rate of pure CS scaffolds presents a challenge to effectively recreate neo-tissue similar to natural articular cartilage. Meanwhile the silk fibroin is well used as a structural constituent material because its remarkable mechanical properties, long-lasting in vivo stability and hypoimmunity. The application of composite silk fibroin and CS scaffolds for joint cartilage repair has not been well studied. Here we report that the combination of silk fibroin and CS could synergistically promote articular cartilage defect repair. The silk fibroin (silk) and silk fibroin/CS (silk-CS) scaffolds were fabricated with salt-leaching, freeze-drying and crosslinking methodologies. The biocompatibility of the scaffolds was investigated in vitro by cell adhesion, proliferation and migration with human articular chondrocytes. We found that silk-CS scaffold maintained better chondrocyte phenotype than silk scaffold; moreover, the silk-CS scaffolds reduced chondrocyte inflammatory response that was induced by interleukin (IL)-1β, which is in consistent with the well-documented anti-inflammatory activities of CS. The in vivo cartilage repair was evaluated with a rabbit osteochondral defect model. Silk-CS scaffold induced more neo-tissue formation and better structural restoration than silk scaffold after 6 and 12weeks of implantation in ICRS histological evaluations. In conclusion, we have developed a silk fibroin/ chondroitin sulfate scaffold for cartilage tissue engineering that exhibits immuno-inhibition property and can improve the self-repair capacity of cartilage. Severe cartilage defect such as osteoarthritis (OA) is difficult to self-repair because of its avascular, aneural and alymphatic nature

  7. Scaffolding in Assisted Instruction

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available On-The-Job Training, developed as direct instruction, is one of the earliest forms of training. This method is still widely in use today because it requires only a person who knows how to do the task, and the tools the person uses to do the task. This paper is intended to be a study of the methods used in education in Knowledge Society, with more specific aspects in training the trainers; as a result of this approach, it promotes scaffolding in assisted instruction as a reflection of the digital age for the learning process. Training the trainers in old environment with default techniques and designing the learning process in assisted instruction, as an application of the Vygotskian concept of the zone of proximal development (ZPD to the area of computer literacy for the younger users, generate diversity in educational communities and requires standards for technology infrastructure, standards for the content, developed as a concepts map, and applications for personalized in-struction, based on ZPD theory.

  8. THE EFFECTS OF SINGLE LEG HOP PROGRESSION AND DOUBLE LEGS HOP PROGRESSION EXERCISE TO INCREASE SPEED AND EXPLOSIVE POWER OF LEG MUSCLE

    Directory of Open Access Journals (Sweden)

    Nining W. Kusnanik

    2015-05-01

    Full Text Available The main purpose of this study was to determine the effect of single leg hop progression and double legs hop progression exercise to increase speed and explosive power of leg muscles. Plyometric is one of the training methods that can increase explosive power. There are many models of plyometric training including single leg hop progression and double leg hop progression. This research was experimental using match subject design techniques. The subjects of this study were 39 students who joined basketball school club. There were 3 groups in this study: Group 1 were 13 students who given sin¬gle leg hop progression exercise, Group 2 were 13 students who given double legs hop progression exercise, Group 3 were 13 students who given conventional exercise. The data was collected during pre test and post test by testing 30m speed running and vertical jump. The data was analyzed using Analysis of Varians (Anova. It was found that there were significantly increased on speed and explosive power of leg muscles of Group 1 and Group 2. It can be stated that single leg hop progression exercise was more effective than double leg hop progression exercise. The recent findings supported the hypothesis that single leg hop progression and double legs hop progression exercise can increase speed and explosive power of leg muscles. These finding were supported by some previous studies (Singh, et al, 2011; Shallaby, H.K., 2010. The single leg hop progression is more effective than double legs hop progression. This finding was consistent with some previous evidences (McCurdy, et al, 2005; Makaruk et al, 2011.

  9. Living bacterial sacrificial porogens to engineer decellularized porous scaffolds.

    Directory of Open Access Journals (Sweden)

    Feng Xu

    Full Text Available Decellularization and cellularization of organs have emerged as disruptive methods in tissue engineering and regenerative medicine. Porous hydrogel scaffolds have widespread applications in tissue engineering, regenerative medicine and drug discovery as viable tissue mimics. However, the existing hydrogel fabrication techniques suffer from limited control over pore interconnectivity, density and size, which leads to inefficient nutrient and oxygen transport to cells embedded in the scaffolds. Here, we demonstrated an innovative approach to develop a new platform for tissue engineered constructs using live bacteria as sacrificial porogens. E.coli were patterned and cultured in an interconnected three-dimensional (3D hydrogel network. The growing bacteria created interconnected micropores and microchannels. Then, the scafold was decellularized, and bacteria were eliminated from the scaffold through lysing and washing steps. This 3D porous network method combined with bioprinting has the potential to be broadly applicable and compatible with tissue specific applications allowing seeding of stem cells and other cell types.

  10. Osteochondral tissue engineering: scaffolds, stem cells and applications

    Science.gov (United States)

    Nooeaid, Patcharakamon; Salih, Vehid; Beier, Justus P; Boccaccini, Aldo R

    2012-01-01

    Osteochondral tissue engineering has shown an increasing development to provide suitable strategies for the regeneration of damaged cartilage and underlying subchondral bone tissue. For reasons of the limitation in the capacity of articular cartilage to self-repair, it is essential to develop approaches based on suitable scaffolds made of appropriate engineered biomaterials. The combination of biodegradable polymers and bioactive ceramics in a variety of composite structures is promising in this area, whereby the fabrication methods, associated cells and signalling factors determine the success of the strategies. The objective of this review is to present and discuss approaches being proposed in osteochondral tissue engineering, which are focused on the application of various materials forming bilayered composite scaffolds, including polymers and ceramics, discussing the variety of scaffold designs and fabrication methods being developed. Additionally, cell sources and biological protein incorporation methods are discussed, addressing their interaction with scaffolds and highlighting the potential for creating a new generation of bilayered composite scaffolds that can mimic the native interfacial tissue properties, and are able to adapt to the biological environment. PMID:22452848

  11. Computer aided design of architecture of degradable tissue engineering scaffolds.

    Science.gov (United States)

    Heljak, M K; Kurzydlowski, K J; Swieszkowski, W

    2017-11-01

    One important factor affecting the process of tissue regeneration is scaffold stiffness loss, which should be properly balanced with the rate of tissue regeneration. The aim of the research reported here was to develop a computer tool for designing the architecture of biodegradable scaffolds fabricated by melt-dissolution deposition systems (e.g. Fused Deposition Modeling) to provide the required scaffold stiffness at each stage of degradation/regeneration. The original idea presented in the paper is that the stiffness of a tissue engineering scaffold can be controlled during degradation by means of a proper selection of the diameter of the constituent fibers and the distances between them. This idea is based on the size-effect on degradation of aliphatic polyesters. The presented computer tool combines a genetic algorithm and a diffusion-reaction model of polymer hydrolytic degradation. In particular, we show how to design the architecture of scaffolds made of poly(DL-lactide-co-glycolide) with the required Young's modulus change during hydrolytic degradation.

  12. Hop pellets as an interesting source of antioxidant active compounds

    Directory of Open Access Journals (Sweden)

    Andrea Holubková

    2013-02-01

    Full Text Available Hop is a plant used by humankind for thousands of years. This plant is one of the main and indispensable raw materials for the beer production. It is used for various dishes preparation in the cuisine. Hop is also used to inhibit bacterial contamination. The hop extracts are used for its sedative, antiseptic and antioxidant properties in medicine, as a part of many phytopharmaceuticals. The present paper have focused on the extraction of polyphenolic compounds from 4 samples of hop pellets varieties of Aurora, Saaz, Lublin and Saphir, on the analyzing of bioactive substances (polyphenolics and flavonoids in prepared extracts and on the determination of antioxidant activity.  The highest content of polyphenolic substances was determined in the sample Lublin (153.06 mg gallic acid (GAE/g and Saaz (151.87 mg GAE/g. The amount of flavonoids in the samples  was descending order Saaz > Saphir > Aurora > Lublin. Hops, as plant, is known by high content of antioxidant active substances. Antioxidant activity was determined using three independent spectrofotometric methods, radical scavenging assays using 2,2′-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS and 1,1-diphenyl-2-picrylhydrazyl (DPPH radical and ferric reducing antioxidant power (FRAP. The sample Aurora showed the highest ability to scavenge of ABTS radical cation. Antioxidant activity continued to decline in a row Saphir> Lublin> Saaz. The same trend was also observed by using the FRAP assay. The most effective DPPH radical scavengering activity had the sample Saaz a Saphir (p>0.05.doi:10.5219/270 Normal 0 21 false false false SK X-NONE X-NONE

  13. Communication: Proper treatment of classically forbidden electronic transitions significantly improves detailed balance in surface hopping

    Energy Technology Data Exchange (ETDEWEB)

    Sifain, Andrew E. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Wang, Linjun [Department of Chemistry, Zhejiang University, Hangzhou 310027 (China); Prezhdo, Oleg V. [Department of Physics and Astronomy, University of Southern California, Los Angeles, California 90089-0485 (United States); Department of Chemistry, University of Southern California, Los Angeles, California 90089-1062 (United States)

    2016-06-07

    Surface hopping is the most popular method for nonadiabatic molecular dynamics. Many have reported that it does not rigorously attain detailed balance at thermal equilibrium, but does so approximately. We show that convergence to the Boltzmann populations is significantly improved when the nuclear velocity is reversed after a classically forbidden hop. The proposed prescription significantly reduces the total number of classically forbidden hops encountered along a trajectory, suggesting that some randomization in nuclear velocity is needed when classically forbidden hops constitute a large fraction of attempted hops. Our results are verified computationally using two- and three-level quantum subsystems, coupled to a classical bath undergoing Langevin dynamics.

  14. Secure Connectivity Probability of Multi‐hop Clustered Randomize‐and‐Forward Networks

    Directory of Open Access Journals (Sweden)

    Xiaowei Wang

    2017-10-01

    Full Text Available This work investigates secure cluster‐aided multi‐hop randomize‐and‐forward networks. We present a hop‐by‐hop multi‐hop transmission scheme with relay selection, which evaluates for each cluster the relays that can securely receive the message. We propose an analytical model to derive the secure connectivity probability (SCP of the hop‐by‐hop transmission scheme. For comparison, we also analyze SCPs of traditional end‐to‐end transmission schemes with two relay‐selection policies. We perform simulations, and our analytical results verify that the proposed hop‐by‐hop scheme is superior to end‐to‐end schemes, especially with a large number of hops or high eavesdropper channel quality. Numerical results also show that the proposed hop‐by‐hop scheme achieves near‐optimal performance in terms of the SCP.

  15. The content of vitamine E in hop cones of the Saaz variety

    Directory of Open Access Journals (Sweden)

    Helena Pluháčková

    2013-01-01

    Full Text Available The activity of vitamin E, total content of tocols and the content of individual isomers: α-tocopherols, β-tocopherols, γ-tocopherols and δ-tocopherols was monitored in samples of hop cones of the world-important Saaz variety. Hop cone samples originated from hop-breeding area Tršice, Czech Republic. The method used for the determination of vitamin E in barley was modified and used for this quantitative analysis. The results indicate that monitored characteristics are influenced by the year of harvest (2010 or 2011 but also by the age of hop-gardens (hop bucks. High values of vitamin E activity (up to 67.79 mg.kg−1 and total content of tocols (up to 76.31 mg.kg−1 in hop cones are worth further attention from the viewpoint of alternative use of hops.

  16. Scaffold engineering: a bridge to where?

    International Nuclear Information System (INIS)

    Hollister, Scott J

    2009-01-01

    A significant amount of federal research funding (over $4 billion) has gone into tissue engineering over the last 20 years. This has led to an exponential increase in research productivity as evidenced by the number of published papers referencing 'tissue engineering' and 'scaffold'. However, the number of tissue engineering products resulting from this research remains a paltry few, of which true tissue engineering products can be counted using the fingers of two hands. The fundamental question remains 'Why does such a gap exist between research and translation?'. This paper argues that such a gap exists in part due to the research paradigms followed in tissue engineering, in which a linear model is followed that assumed individual technical discovery can be bundled into model tissue engineering systems, followed by manufacturing scale up and regulatory approval. As such, most research funding follows this linear model with the vast majority of research spent on the discovery phase. This includes funding on both cell therapy and scaffold materials and engineering. It is assumed that therapy systems can readily be constructed by combining disparate technologies derived in different laboratories and that these therapies can readily achieve regulatory approval. Yet, most tissue engineering technologies fail to make it to clinical application because they simply have not been engineered for these specific applications or cannot be scaled to clinical level production. This paper argues that a different research paradigm is needed, essentially that of Pasteur's Quadrant proposed by Donald Stokes in the book of the same name. In this paradigm, research is pursued from the twin perspective of end use and the need for fundamental understanding. From this perspective, more funding emphasis should be placed on scalable manufacturing of systems that are designed for specific clinical applications that can attain regulatory approval. Funding of such scaffold/cell manufacturing

  17. Characterizing the macro and micro mechanical properties of scaffolds for rotator cuff repair.

    Science.gov (United States)

    Smith, Richard D J; Zargar, Nasim; Brown, Cameron P; Nagra, Navraj S; Dakin, Stephanie G; Snelling, Sarah J B; Hakimi, Osnat; Carr, Andrew

    2017-11-01

    Retearing after rotator cuff surgery is a major clinical problem. Numerous scaffolds are being used to try to reduce retear rates. However, few have demonstrated clinical efficacy. We hypothesize that this lack of efficacy is due to insufficient mechanical properties. Therefore, we compared the macro and nano/micro mechanical properties of 7 commercially available scaffolds to those of the human supraspinatus tendons, whose function they seek to restore. The clinically approved scaffolds tested were X-Repair, LARS ligament, Poly-Tape, BioFiber, GraftJacket, Permacol, and Conexa. Fresh frozen cadaveric human supraspinatus tendon samples were used. Macro mechanical properties were determined through tensile testing and rheometry. Scanning probe microscopy and scanning electron microscopy were performed to assess properties of materials at the nano/microscale (morphology, Young modulus, loss tangent). None of the scaffolds tested adequately approximated both the macro and micro mechanical properties of human supraspinatus tendon. Macroscale mechanical properties were insufficient to restore load-bearing function. The best-performing scaffolds on the macroscale (X-Repair, LARS ligament) had poor nano/microscale properties. Scaffolds approximating tendon properties on the nano/microscale (BioFiber, biologic scaffolds) had poor macroscale properties. Existing scaffolds failed to adequately approximate the mechanical properties of human supraspinatus tendons. Combining the macroscopic mechanical properties of a synthetic scaffold with the micro mechanical properties of biologic scaffold could better achieve this goal. Future work should focus on advancing techniques to create new scaffolds with more desirable mechanical properties. This may help improve outcomes for rotator cuff surgery patients. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  18. Hybrid Carbon-Based Scaffolds for Applications in Soft Tissue Reconstruction

    Science.gov (United States)

    Lafdi, Khalid; Joseph, Robert M.; Tsonis, Panagiotis A.

    2012-01-01

    Current biomedical scaffolds utilized in surgery to repair soft tissues commonly fail to meet the optimal combination of biomechanical and tissue regenerative properties. Carbon is a scaffold alternative that potentially optimizes the balance between mechanical strength, durability, and function as a cell and biologics delivery vehicle that is necessary to restore tissue function while promoting tissue repair. The goals of this study were to investigate the feasibility of fabricating hybrid fibrous carbon scaffolds modified with biopolymer, polycaprolactone and to analyze their mechanical properties and ability to support cell growth and proliferation. Environmental scanning electron microscopy, micro-computed tomography, and cell adhesion and cell proliferation studies were utilized to test scaffold suitability as a cell delivery vehicle. Mechanical properties were tested to examine load failure and elastic modulus. Results were compared to an acellular dermal matrix scaffold control (GraftJacket® [GJ] Matrix), selected for its common use in surgery for the repair of soft tissues. Results indicated that carbon scaffolds exhibited similar mechanical maximums and capacity to support fibroblast adhesion and proliferation in comparison with GJ. Fibroblast adhesion and proliferation was collinear with carbon fiber orientation in regions of sparsely distributed fibers and occurred in clusters in regions of higher fiber density and low porosity. Overall, fibroblast adhesion and proliferation was greatest in lower porosity carbon scaffolds with highly aligned fibers. Stepwise multivariate regression showed that the variability in maximum load of carbon scaffolds and controls were dependent on unique and separate sets of parameters. These finding suggested that there were significant differences in the functional implications of scaffold design and material properties between carbon and dermis derived scaffolds that affect scaffold utility as a tissue replacement

  19. Ornamenting 3D printed scaffolds with cell-laid extracellular matrix for bone tissue regeneration.

    Science.gov (United States)

    Pati, Falguni; Song, Tae-Ha; Rijal, Girdhari; Jang, Jinah; Kim, Sung Won; Cho, Dong-Woo

    2015-01-01

    3D printing technique is the most sophisticated technique to produce scaffolds with tailorable physical properties. But, these scaffolds often suffer from limited biological functionality as they are typically made from synthetic materials. Cell-laid mineralized ECM was shown to be potential for improving the cellular responses and drive osteogenesis of stem cells. Here, we intend to improve the biological functionality of 3D-printed synthetic scaffolds by ornamenting them with cell-laid mineralized extracellular matrix (ECM) that mimics a bony microenvironment. We developed bone graft substitutes by using 3D printed scaffolds made from a composite of polycaprolactone (PCL), poly(lactic-co-glycolic acid) (PLGA), and β-tricalcium phosphate (β-TCP) and mineralized ECM laid by human nasal inferior turbinate tissue-derived mesenchymal stromal cells (hTMSCs). A rotary flask bioreactor was used to culture hTMSCs on the scaffolds to foster formation of mineralized ECM. A freeze/thaw cycle in hypotonic buffer was used to efficiently decellularize (97% DNA reduction) the ECM-ornamented scaffolds while preserving its main organic and inorganic components. The ECM-ornamented 3D printed scaffolds supported osteoblastic differentiation of newly-seeded hTMSCs by upregulating four typical osteoblastic genes (4-fold higher RUNX2; 3-fold higher ALP; 4-fold higher osteocalcin; and 4-fold higher osteopontin) and increasing calcium deposition compared to bare 3D printed scaffolds. In vivo, in ectopic and orthotopic models in rats, ECM-ornamented scaffolds induced greater bone formation than that of bare scaffolds. These results suggest a valuable method to produce ECM-ornamented 3D printed scaffolds as off-the-shelf bone graft substitutes that combine tunable physical properties with physiological presentation of biological signals. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. 3D Printed Silicone–Hydrogel Scaffold with Enhanced Physicochemical Properties

    DEFF Research Database (Denmark)

    Mohanty, Soumyaranjan; Alm, Martin; Hemmingsen, Mette

    2016-01-01

    is currently a huge challenge. The goal of this work was to fabricate a tissue engineering scaffold from clinically approved materials with the capability of delivering biomolecules and direct cell fate. We have used a simple 3D printing approach, that combines polymer casting with supercritical fluid...... technology to produce 3D interpenetrating polymer network (IPN) scaffold of silicone-poly(2-hydroxyethyl methacrylate)-co-poly(ethylene glycol) methyl ether acrylate (pHEMA-co-PEGMEA). The pHEMA-co-PEGMEA IPN materials were employed to support growth of human mesenchymal stem cells (hMSC), resulting in high...... cell viability and metabolic activity over a 3 weeks period. In addition, the IPN scaffolds support 3D tissue formation inside the porous scaffold with well spread cell morphology on the surface of the scaffold. As a proof of concept, sustained doxycycline (DOX) release from pHEMA-co-PEGMEA IPN...

  1. 3D conductive nanocomposite scaffold for bone tissue engineering

    Directory of Open Access Journals (Sweden)

    Shahini A

    2013-12-01

    microscope. Increasing the concentration of the conductive polymer in the scaffold enhanced the cell viability, indicating the improved microstructure of the scaffolds or boosted electrical signaling among cells. These results show that these conductive scaffolds are not only structurally more favorable for bone tissue engineering, but also can be a step forward in combining the tissue engineering techniques with the method of enhancing the bone healing by electrical stimuli. Keywords: conductive polymers, bone scaffold, gelatin, bioactive glass nanoparticles, PEDOT:PSS, conductive scaffold

  2. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    Science.gov (United States)

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. Hip-Hop Guayaquil: culturas viajeras e identidades locales

    Directory of Open Access Journals (Sweden)

    1999-01-01

    Full Text Available HIP-HOP GUAYAQUIL: CULTURES ITINÉRANTES ET IDENTITES LOCALES. Le hip-hop est un style de musique contemporaine caractérisé par une orchestration d’œuvres lyriques rapées, la superposition de morceaux de musique enregistrés dans le passé par différents artistes, et une instrumentation électronique, tout cela sur des rythmes de basse réguliers et constants. Le hip-hop, musique accompagnée de ses propres danses et de sa mode, est le produit du déplacement et de la transformation d’une variété d’idéologies politiques de la communauté noire qui se constituent à partir de relations qui se modifient entre elles, et en relation avec les cultures dominantes contre lesquelles elles luttent quotidiennement. À l’origine, le hip-hop est lié à des mouvements d’identité de jeunes noirs. Dans cet article, il est intéressant d’étudier le rôle du hip-hop dans la formulation d’une identité entre jeunes métisses et noirs des secteurs populaires de Guayaquil. Cet exemple illustre la nécessité d’inclure dans l’analyse les dimensions politiques des processus de traduction du global au niveau local. El hip-hop es un género de música contemporánea caracterizado por la orquestación de líricas que son rapeadas, superposición de fragmentos de música grabada en el pasado por diferentes artistas, e instrumentación electrónica, todo ello sobre ritmos de bajo regulares y constantes. Como un tipo de música acompañado por sus propias formas de danza y moda, el hip-hop es producto del viaje y la transformación de una variedad de ideologías políticas de la comunidad negra que se constituyen a sí mismas en relaciones cambiantes entre sí y en relación a las culturas dominantes contra las cuales luchan cotidianamente. El hip-hop está ligado, en su contexto originario, a políticas de identidad defendidas por jóvenes negros. Lo que interesa explorar en este artículo es el papel del hip-hop en la formulación de una identidad

  4. Scaffolding for solving problem in static fluid: A case study

    Science.gov (United States)

    Koes-H, Supriyono; Muhardjito, Wijaya, Charisma P.

    2018-01-01

    Problem solving is one of the basic abilities that should be developed from learning physics. However, students still face difficulties in the process of non-routine problem-solving. Efforts are necessary to be taken in order to identify such difficulties and the solutions to solve them. An effort in the form of a diagnosis of students' performance in problem solving can be taken to identify their difficulties, and various instructional scaffolding supports can be utilized to eliminate the difficulties. This case study aimed to describe the students' difficulties in solving static fluid problems and the effort to overcome such difficulties through different scaffolding supports. The research subjects consisted of four 10-grade students of (Public Senior High School) SMAN 4 Malang selected by purposive sampling technique. The data of students' difficulties were collected via think-aloud protocol implemented on students' performance in solving non-routine static fluid problems. Subsequently, combined scaffolding supports were given to the students based on their particular difficulties. The research findings pointed out that there were several conceptual difficulties discovered from the students when solving static fluid problems, i.e. the use of buoyancy force formula, determination of all forces acting on a plane in a fluid, the resultant force on a plane in a fluid, and determination of a plane depth in a fluid. An effort that can be taken to overcome such conceptual difficulties is providing a combination of some appropriate scaffolding supports, namely question prompts with specific domains, simulation, and parallel modeling. The combination can solve students' lack of knowledge and improve their conceptual understanding, as well as help them to find solutions by linking the problems with their prior knowledge. According to the findings, teachers are suggested to diagnose the students' difficulties so that they can provide an appropriate combination of

  5. Bioactive polymeric–ceramic hybrid 3D scaffold for application in bone tissue regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Torres, A.L.; Gaspar, V.M.; Serra, I.R.; Diogo, G.S.; Fradique, R. [CICS-UBI — Health Sciences Research Centre, University of Beira Interior, Av. Infante D. Henrique, 6200-506 Covilhã (Portugal); Silva, A.P. [CAST-UBI — Centre for Aerospace Science and Technologies, University of Beira Interior, Calçada Fonte do Lameiro, 6201-001 Covilhã (Portugal); Correia, I.J., E-mail: icorreia@ubi.pt [CICS-UBI — Health Sciences Research Centre, University of Beira Interior, Av. Infante D. Henrique, 6200-506 Covilhã (Portugal)

    2013-10-01

    The regeneration of large bone defects remains a challenging scenario from a therapeutic point of view. In fact, the currently available bone substitutes are often limited by poor tissue integration and severe host inflammatory responses, which eventually lead to surgical removal. In an attempt to address these issues, herein we evaluated the importance of alginate incorporation in the production of improved and tunable β-tricalcium phosphate (β-TCP) and hydroxyapatite (HA) three-dimensional (3D) porous scaffolds to be used as temporary templates for bone regeneration. Different bioceramic combinations were tested in order to investigate optimal scaffold architectures. Additionally, 3D β-TCP/HA vacuum-coated with alginate, presented improved compressive strength, fracture toughness and Young's modulus, to values similar to those of native bone. The hybrid 3D polymeric–bioceramic scaffolds also supported osteoblast adhesion, maturation and proliferation, as demonstrated by fluorescence microscopy. To the best of our knowledge this is the first time that a 3D scaffold produced with this combination of biomaterials is described. Altogether, our results emphasize that this hybrid scaffold presents promising characteristics for its future application in bone regeneration. - Graphical abstract: B-TCP:HA–alginate hybrid 3D porous scaffolds for application in bone regeneration. - Highlights: • The produced hybrid 3D scaffolds are prone to be applied in bone tissue engineering. • Alginate coated 3D scaffolds present high mechanical and biological properties. • In vitro assays for evaluation of human osteoblast cell attachment in the presence of the scaffolds • The hybrid 3D scaffolds present suitable mechanical and biological properties for use in bone regenerative medicine.

  6. Bioactive polymeric–ceramic hybrid 3D scaffold for application in bone tissue regeneration

    International Nuclear Information System (INIS)

    Torres, A.L.; Gaspar, V.M.; Serra, I.R.; Diogo, G.S.; Fradique, R.; Silva, A.P.; Correia, I.J.

    2013-01-01

    The regeneration of large bone defects remains a challenging scenario from a therapeutic point of view. In fact, the currently available bone substitutes are often limited by poor tissue integration and severe host inflammatory responses, which eventually lead to surgical removal. In an attempt to address these issues, herein we evaluated the importance of alginate incorporation in the production of improved and tunable β-tricalcium phosphate (β-TCP) and hydroxyapatite (HA) three-dimensional (3D) porous scaffolds to be used as temporary templates for bone regeneration. Different bioceramic combinations were tested in order to investigate optimal scaffold architectures. Additionally, 3D β-TCP/HA vacuum-coated with alginate, presented improved compressive strength, fracture toughness and Young's modulus, to values similar to those of native bone. The hybrid 3D polymeric–bioceramic scaffolds also supported osteoblast adhesion, maturation and proliferation, as demonstrated by fluorescence microscopy. To the best of our knowledge this is the first time that a 3D scaffold produced with this combination of biomaterials is described. Altogether, our results emphasize that this hybrid scaffold presents promising characteristics for its future application in bone regeneration. - Graphical abstract: B-TCP:HA–alginate hybrid 3D porous scaffolds for application in bone regeneration. - Highlights: • The produced hybrid 3D scaffolds are prone to be applied in bone tissue engineering. • Alginate coated 3D scaffolds present high mechanical and biological properties. • In vitro assays for evaluation of human osteoblast cell attachment in the presence of the scaffolds • The hybrid 3D scaffolds present suitable mechanical and biological properties for use in bone regenerative medicine

  7. Porous allograft bone scaffolds: doping with strontium.

    Directory of Open Access Journals (Sweden)

    Yantao Zhao

    Full Text Available Strontium (Sr can promote the process of bone formation. To improve bioactivity, porous allograft bone scaffolds (ABS were doped with Sr and the mechanical strength and bioactivity of the scaffolds were evaluated. Sr-doped ABS were prepared using the ion exchange method. The density and distribution of Sr in bone scaffolds were investigated by inductively coupled plasma optical emission spectrometry (ICP-OES, X-ray photoelectron spectroscopy (XPS, and energy-dispersive X-ray spectroscopy (EDS. Controlled release of strontium ions was measured and mechanical strength was evaluated by a compressive strength test. The bioactivity of Sr-doped ABS was investigated by a simulated body fluid (SBF assay, cytotoxicity testing, and an in vivo implantation experiment. The Sr molar concentration [Sr/(Sr+Ca] in ABS surpassed 5% and Sr was distributed nearly evenly. XPS analyses suggest that Sr combined with oxygen and carbonate radicals. Released Sr ions were detected in the immersion solution at higher concentration than calcium ions until day 30. The compressive strength of the Sr-doped ABS did not change significantly. The bioactivity of Sr-doped material, as measured by the in vitro SBF immersion method, was superior to that of the Sr-free freeze-dried bone and the Sr-doped material did not show cytotoxicity compared with Sr-free culture medium. The rate of bone mineral deposition for Sr-doped ABS was faster than that of the control at 4 weeks (3.28 ± 0.23 µm/day vs. 2.60 ± 0.20 µm/day; p<0.05. Sr can be evenly doped into porous ABS at relevant concentrations to create highly active bone substitutes.

  8. Cardiomyocyte behavior on biodegradable polyurethane/gold nanocomposite scaffolds under electrical stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Ganji, Yasaman [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave, Tehran (Iran, Islamic Republic of); Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Li, Qian [Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Quabius, Elgar Susanne [Dept. of Otorhinolaryngology, Head and Neck Surgery, University of Kiel, Arnold-Heller-Str. 3, Building 27, D-24105 Kiel (Germany); Institute of Immunology, University of Kiel, Arnold-Heller-Str. 3, Building 17, D-24105 Kiel (Germany); Böttner, Martina [Department of Anatomy, University of Kiel, Otto-Hahn-Platz 8, 24118 Kiel (Germany); Selhuber-Unkel, Christine, E-mail: cse@tf.uni-kiel.de [Institute for Materials Science, Dept. Biocompatible Nanomaterials, University of Kiel, Kaiserstr. 2, D-24143 Kiel (Germany); Kasra, Mehran [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave, Tehran (Iran, Islamic Republic of)

    2016-02-01

    Following a myocardial infarction (MI), cardiomyocytes are replaced by scar tissue, which decreases ventricular contractile function. Tissue engineering is a promising approach to regenerate such damaged cardiomyocyte tissue. Engineered cardiac patches can be fabricated by seeding a high density of cardiac cells onto a synthetic or natural porous polymer. In this study, nanocomposite scaffolds made of gold nanotubes/nanowires incorporated into biodegradable castor oil-based polyurethane were employed to make micro-porous scaffolds. H9C2 cardiomyocyte cells were cultured on the scaffolds for one day, and electrical stimulation was applied to improve cell communication and interaction in neighboring pores. Cells on scaffolds were examined by fluorescence microscopy and scanning electron microscopy, revealing that the combination of scaffold design and electrical stimulation significantly increased cell confluency of H9C2 cells on the scaffolds. Furthermore, we showed that the gene expression levels of Nkx2.5, atrial natriuretic peptide (ANF) and natriuretic peptide precursor B (NPPB), which are functional genes of the myocardium, were up-regulated by the incorporation of gold nanotubes/nanowires into the polyurethane scaffolds, in particular after electrical stimulation. - Highlights: • Biodegradable polyurethane/gold nanocomposites for cardiomyocyte adhesion are proposed. • The nanocomposite scaffolds are porous and electrical stimulation enhances cell adhesion. • Expression levels of functional myocardium genes were upregulated after electrical stimulation.

  9. A Ternary Nanofibrous Scaffold Potential for Central Nerve System Tissue Engineering.

    Science.gov (United States)

    Saadatkish, Niloufar; Nouri Khorasani, Saied; Morshed, Mohammad; Allafchian, Ali-Reza; Beigi, Mohammad-Hossein; Masoudi Rad, Maryam; Nasr-Esfahani, Mohammad Hossein; Esmaeely Neisiany, Rasoul

    2018-04-10

    In the present research, a ternary Polycaprolactone (PCL)/gelatin/fibrinogen nanofibrous scaffold for tissue engineering application was developed. Through this combination, PCL improved the scaffold mechanical properties; meanwhile, gelatin and fibrinogen provided more hydrophilicity and cell proliferation. Three types of nanofibrous scaffolds containing different fibrinogen contents were prepared and characterized. Morphological study of the nanofibers showed that the prepared nanofibers were smooth, uniform without any formation of beads with a significant reduction in nanofiber diameter after incorporation of fibrinogen. The chemical characterization of the scaffolds confirmed that no chemical reaction occurred between the scaffold components. The tensile test results of the scaffolds showed that increasing in fibrinogen content led to a decrease in mechanical properties. Furthermore, Adipose-derived stem cells (ADSCs) were employed to evaluate cell-scaffold interaction. Cell culture results indicated that higher cell proliferation occurred for the higher amount of fibrinogen. Statistical analysis was also carried out to evaluate the significant difference for the obtained results of water droplet contact angle and cell culture. Therefore, the results confirmed that PCL/Gel/Fibrinogen scaffold has a good potential for tissue engineering applications including Central Nerve System (CNS) tissue engineering. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  10. Rhombicuboctahedron unit cell based scaffolds for bone regeneration: geometry optimization with a mechanobiology - driven algorithm.

    Science.gov (United States)

    Boccaccio, Antonio; Fiorentino, Michele; Uva, Antonio E; Laghetti, Luca N; Monno, Giuseppe

    2018-02-01

    In a context more and more oriented towards customized medical solutions, we propose a mechanobiology-driven algorithm to determine the optimal geometry of scaffolds for bone regeneration that is the most suited to specific boundary and loading conditions. In spite of the huge number of articles investigating different unit cells for porous biomaterials, no studies are reported in the literature that optimize the geometric parameters of such unit cells based on mechanobiological criteria. Parametric finite element models of scaffolds with rhombicuboctahedron unit cell were developed and incorporated into an optimization algorithm that combines them with a computational mechanobiological model. The algorithm perturbs iteratively the geometry of the unit cell until the best scaffold geometry is identified, i.e. the geometry that allows to maximize the formation of bone. Performances of scaffolds with rhombicuboctahedron unit cell were compared with those of other scaffolds with hexahedron unit cells. We found that scaffolds with rhombicuboctahedron unit cell are particularly suited for supporting medium-low loads, while, for higher loads, scaffolds with hexahedron unit cells are preferable. The proposed algorithm can guide the orthopaedic/surgeon in the choice of the best scaffold to be implanted in a patient-specific anatomic region. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review.

    Science.gov (United States)

    Chaudhari, Atul A; Vig, Komal; Baganizi, Dieudonné Radé; Sahu, Rajnish; Dixit, Saurabh; Dennis, Vida; Singh, Shree Ram; Pillai, Shreekumar R

    2016-11-25

    Over centuries, the field of regenerative skin tissue engineering has had several advancements to facilitate faster wound healing and thereby restoration of skin. Skin tissue regeneration is mainly based on the use of suitable scaffold matrices. There are several scaffold types, such as porous, fibrous, microsphere, hydrogel, composite and acellular, etc., with discrete advantages and disadvantages. These scaffolds are either made up of highly biocompatible natural biomaterials, such as collagen, chitosan, etc., or synthetic materials, such as polycaprolactone (PCL), and poly-ethylene-glycol (PEG), etc. Composite scaffolds, which are a combination of natural or synthetic biomaterials, are highly biocompatible with improved tensile strength for effective skin tissue regeneration. Appropriate knowledge of the properties, advantages and disadvantages of various biomaterials and scaffolds will accelerate the production of suitable scaffolds for skin tissue regeneration applications. At the same time, emphasis on some of the leading challenges in the field of skin tissue engineering, such as cell interaction with scaffolds, faster cellular proliferation/differentiation, and vascularization of engineered tissues, is inevitable. In this review, we discuss various types of scaffolding approaches and biomaterials used in the field of skin tissue engineering and more importantly their future prospects in skin tissue regeneration efforts.

  12. Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review

    Directory of Open Access Journals (Sweden)

    Atul A. Chaudhari

    2016-11-01

    Full Text Available Over centuries, the field of regenerative skin tissue engineering has had several advancements to facilitate faster wound healing and thereby restoration of skin. Skin tissue regeneration is mainly based on the use of suitable scaffold matrices. There are several scaffold types, such as porous, fibrous, microsphere, hydrogel, composite and acellular, etc., with discrete advantages and disadvantages. These scaffolds are either made up of highly biocompatible natural biomaterials, such as collagen, chitosan, etc., or synthetic materials, such as polycaprolactone (PCL, and poly-ethylene-glycol (PEG, etc. Composite scaffolds, which are a combination of natural or synthetic biomaterials, are highly biocompatible with improved tensile strength for effective skin tissue regeneration. Appropriate knowledge of the properties, advantages and disadvantages of various biomaterials and scaffolds will accelerate the production of suitable scaffolds for skin tissue regeneration applications. At the same time, emphasis on some of the leading challenges in the field of skin tissue engineering, such as cell interaction with scaffolds, faster cellular proliferation/differentiation, and vascularization of engineered tissues, is inevitable. In this review, we discuss various types of scaffolding approaches and biomaterials used in the field of skin tissue engineering and more importantly their future prospects in skin tissue regeneration efforts.

  13. 3D Powder Printed Bioglass and β-Tricalcium Phosphate Bone Scaffolds

    Directory of Open Access Journals (Sweden)

    Michael Seidenstuecker

    2017-12-01

    Full Text Available The use of both bioglass (BG and β tricalcium phosphate (β-TCP for bone replacement applications has been studied extensively due to the materials’ high biocompatibility and ability to resorb when implanted in the body. 3D printing has been explored as a fast and versatile technique for the fabrication of porous bone scaffolds. This project investigates the effects of using different combinations of a composite BG and β-TCP powder for 3D printing of porous bone scaffolds. Porous 3D powder printed bone scaffolds of BG, β-TCP, 50/50 BG/β-TCP and 70/30 BG/β-TCP compositions were subject to a variety of characterization and biocompatibility tests. The porosity characteristics, surface roughness, mechanical strength, viability for cell proliferation, material cytotoxicity and in vitro bioactivity were assessed. The results show that the scaffolds can support osteoblast-like MG-63 cells growth both on the surface of and within the scaffold material and do not show alarming cytotoxicity; the porosity and surface characteristics of the scaffolds are appropriate. Of the two tested composite materials, the 70/30 BG/β-TCP scaffold proved to be superior in terms of biocompatibility and mechanical strength. The mechanical strength of the scaffolds makes them unsuitable for load bearing applications. However, they can be useful for other applications such as bone fillers.

  14. Mechanical anisotropy of titanium scaffolds

    Directory of Open Access Journals (Sweden)

    Rüegg Jasmine

    2017-09-01

    Full Text Available The clinical performance of an implant, e.g. for the treatment of large bone defects, depends on the implant material, anchorage, surface topography and chemistry, but also on the mechanical properties, like the stiffness. The latter can be adapted by the porosity. Whereas foams show isotropic mechanical properties, digitally modelled scaffolds can be designed with anisotropic behaviour. In this study, we designed and produced 3D scaffolds based on an orthogonal architecture and studied its angle-dependent stiffness. The aim was to produce scaffolds with different orientations of the microarchitecture by selective laser melting and compare the angle-specific mechanical behaviour with an in-silico simulation. The anisotropic characteristics of open-porous implants and technical limitations of the production process were studied.

  15. A scaffold easy to decontaminate

    International Nuclear Information System (INIS)

    Mourek, D.

    1992-01-01

    The conventional scaffold used in the assembling work and in revisions of technological facilities at nuclear power plants has many drawbacks. The most serious of them are a high amount of radioactive waste arising from the decontamination (planing) of the floor timber and from the discarding of damaged irreparable parts, and a considerable corrosion of the carbon steel supporting structure after the decontamination. A detailed description is given of a novel scaffold assembly which can be decontaminated and which exhibits many assets, in particular a good mechanical resistance (also to bad weather), a lower weight, and the use of prepreg floor girders for the construction of service platforms or scaffold bridges which can readily be assembled from the pressed pieces in a modular way. (Z.S.). 4 figs., 4 refs

  16. Modeling and Reconstruction of Micro-structured 3D Chitosan/Gelatin Porous Scaffolds Using Micro-CT

    Science.gov (United States)

    Gong, Haibo; Li, Dichen; He, Jiankang; Liu, Yaxiong; Lian, Qin; Zhao, Jinna

    2008-09-01

    Three dimensional (3D) channel networks are the key to promise the uniform distribution of nutrients inside 3D hepatic tissue engineering scaffolds and prompt elimination of metabolic products out of the scaffolds. 3D chitosan/gelatin porous scaffolds with predefined internal channels were fabricated and a combination of light microscope, laser confocal microscopy and micro-CT were employed to characterize the structure of porous scaffolds. In order to evaluate the flow field distribution inside the micro-structured 3D scaffolds, a computer reconstructing method based on Micro-CT was proposed. According to this evaluating method, a contrast between 3D porous scaffolds with and without predefined internal channels was also performed to assess scaffolds' fluid characters. Results showed that the internal channel of the 3D scaffolds formed the 3D fluid channel network; the uniformity of flow field distribution of the scaffolds fabricated in this paper was better than the simple porous scaffold without micro-fluid channels.

  17. Anterior cruciate ligament reconstruction in a rabbit model using silk-collagen scaffold and comparison with autograft.

    Directory of Open Access Journals (Sweden)

    Fanggang Bi

    Full Text Available The objective of the present study was to perform an in vivo assessment of a novel silk-collagen scaffold for anterior cruciate ligament (ACL reconstruction. First, a silk-collagen scaffold was fabricated by combining sericin-extracted knitted silk fibroin mesh and type I collagen to mimic the components of the ligament. Scaffolds were electron-beam sterilized and rolled up to replace the ACL in 20 rabbits in the scaffold group, and autologous semitendinosus tendons were used to reconstruct the ACL in the autograft control group. At 4 and 16 weeks after surgery, grafts were retrieved and analyzed for neoligament regeneration and tendon-bone healing. To evaluate neoligament regeneration, H&E and immunohistochemical staining was performed, and to assess tendon-bone healing, micro-CT, biomechanical test, H&E and Russell-Movat pentachrome staining were performed. Cell infiltration increased over time in the scaffold group, and abundant fibroblast-like cells were found in the core of the scaffold graft at 16 weeks postoperatively. Tenascin-C was strongly positive in newly regenerated tissue at 4 and 16 weeks postoperatively in the scaffold group, similar to observations in the autograft group. Compared with the autograft group, tendon-bone healing was better in the scaffold group with trabecular bone growth into the scaffold. The results indicate that the silk-collagen scaffold has considerable potential for clinical application.

  18. Systematic Prediction of Scaffold Proteins Reveals New Design Principles in Scaffold-Mediated Signal Transduction

    Science.gov (United States)

    Hu, Jianfei; Neiswinger, Johnathan; Zhang, Jin; Zhu, Heng; Qian, Jiang

    2015-01-01

    Scaffold proteins play a crucial role in facilitating signal transduction in eukaryotes by bringing together multiple signaling components. In this study, we performed a systematic analysis of scaffold proteins in signal transduction by integrating protein-protein interaction and kinase-substrate relationship networks. We predicted 212 scaffold proteins that are involved in 605 distinct signaling pathways. The computational prediction was validated using a protein microarray-based approach. The predicted scaffold proteins showed several interesting characteristics, as we expected from the functionality of scaffold proteins. We found that the scaffold proteins are likely to interact with each other, which is consistent with previous finding that scaffold proteins tend to form homodimers and heterodimers. Interestingly, a single scaffold protein can be involved in multiple signaling pathways by interacting with other scaffold protein partners. Furthermore, we propose two possible regulatory mechanisms by which the activity of scaffold proteins is coordinated with their associated pathways through phosphorylation process. PMID:26393507

  19. Emerging Perspectives in Scaffold for Tissue Engineering in Oral Surgery.

    Science.gov (United States)

    Ceccarelli, Gabriele; Presta, Rossella; Benedetti, Laura; Cusella De Angelis, Maria Gabriella; Lupi, Saturnino Marco; Rodriguez Y Baena, Ruggero

    2017-01-01

    Bone regeneration is currently one of the most important and challenging tissue engineering approaches in regenerative medicine. Bone regeneration is a promising approach in dentistry and is considered an ideal clinical strategy in treating diseases, injuries, and defects of the maxillofacial region. Advances in tissue engineering have resulted in the development of innovative scaffold designs, complemented by the progress made in cell-based therapies. In vitro bone regeneration can be achieved by the combination of stem cells, scaffolds, and bioactive factors. The biomimetic approach to create an ideal bone substitute provides strategies for developing combined scaffolds composed of adult stem cells with mesenchymal phenotype and different organic biomaterials (such as collagen and hyaluronic acid derivatives) or inorganic biomaterials such as manufactured polymers (polyglycolic acid (PGA), polylactic acid (PLA), and polycaprolactone). This review focuses on different biomaterials currently used in dentistry as scaffolds for bone regeneration in treating bone defects or in surgical techniques, such as sinus lift, horizontal and vertical bone grafts, or socket preservation. Our review would be of particular interest to medical and surgical researchers at the interface of cell biology, materials science, and tissue engineering, as well as industry-related manufacturers and researchers in healthcare, prosthetics, and 3D printing, too.

  20. Emerging Perspectives in Scaffold for Tissue Engineering in Oral Surgery

    Directory of Open Access Journals (Sweden)

    Gabriele Ceccarelli

    2017-01-01

    Full Text Available Bone regeneration is currently one of the most important and challenging tissue engineering approaches in regenerative medicine. Bone regeneration is a promising approach in dentistry and is considered an ideal clinical strategy in treating diseases, injuries, and defects of the maxillofacial region. Advances in tissue engineering have resulted in the development of innovative scaffold designs, complemented by the progress made in cell-based therapies. In vitro bone regeneration can be achieved by the combination of stem cells, scaffolds, and bioactive factors. The biomimetic approach to create an ideal bone substitute provides strategies for developing combined scaffolds composed of adult stem cells with mesenchymal phenotype and different organic biomaterials (such as collagen and hyaluronic acid derivatives or inorganic biomaterials such as manufactured polymers (polyglycolic acid (PGA, polylactic acid (PLA, and polycaprolactone. This review focuses on different biomaterials currently used in dentistry as scaffolds for bone regeneration in treating bone defects or in surgical techniques, such as sinus lift, horizontal and vertical bone grafts, or socket preservation. Our review would be of particular interest to medical and surgical researchers at the interface of cell biology, materials science, and tissue engineering, as well as industry-related manufacturers and researchers in healthcare, prosthetics, and 3D printing, too.

  1. Mixed quantum-classical equilibrium in global flux surface hopping

    International Nuclear Information System (INIS)

    Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.

    2015-01-01

    Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors

  2. Fast frequency hopping codes applied to SAC optical CDMA network

    Science.gov (United States)

    Tseng, Shin-Pin

    2015-06-01

    This study designed a fast frequency hopping (FFH) code family suitable for application in spectral-amplitude-coding (SAC) optical code-division multiple-access (CDMA) networks. The FFH code family can effectively suppress the effects of multiuser interference and had its origin in the frequency hopping code family. Additional codes were developed as secure codewords for enhancing the security of the network. In considering the system cost and flexibility, simple optical encoders/decoders using fiber Bragg gratings (FBGs) and a set of optical securers using two arrayed-waveguide grating (AWG) demultiplexers (DeMUXs) were also constructed. Based on a Gaussian approximation, expressions for evaluating the bit error rate (BER) and spectral efficiency (SE) of SAC optical CDMA networks are presented. The results indicated that the proposed SAC optical CDMA network exhibited favorable performance.

  3. O CIRCUITO HIP HOP NA REGIÃO DE CAMPINAS

    Directory of Open Access Journals (Sweden)

    Cristiano Nunes Alves

    2013-01-01

    Full Text Available This paper examines the thickness of the circuit hip hop in the region of Campinas and it’s a part of an inventory made in fifteen cities of the region, between 2003 and 2005. The circuit hip hop growing in Campinas since the decade of 1980, and has been expanding in the context of urbanization and metropolis. We noticed some residual cultural component in places involves, among others, the alternative production involved by a technically and territorial division of labor spurred by circuits upside of information. The culture of the streets and these circuits, survive to the urban division and fragmentation. It is, therefore, a study of the region of Campinas as a place that houses technical, informational and communicational densities. We analyzed geographical conditions of contemporary life in this region, inquiring about the communication and the informational components in the use of the territory.

  4. Hopping mixed hybrid excitations in multiple composite quantum wire structures

    International Nuclear Information System (INIS)

    Nguyen Ba An; Tran Thai Hoa

    1995-10-01

    A structure consisting of N pairs of inorganic semiconductor and organic quantum wires is considered theoretically. In such an isolated pair of wires, while the intrawire coupling forms Wannier-Mott exciton in an inorganic semiconductor quantum wire and Frenkel exciton in an organic one, the interwire coupling gives rise to hybrid excitons residing within the pair. When N pairs of wires are packed together 2N new mixed hybrid modes appear that are the true elementary excitations and can hop throughout the whole structure. Energies and wave functions of such hopping mixed hybrid excitations are derived analytically in detail accounting for the global interwire coupling and the different polarization configurations. (author). 19 refs

  5. Rend og hop - Vi si´r stop

    DEFF Research Database (Denmark)

    Lund, Ole

    Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere dominere......Rapporten er en evaluering af projekt Rend og hop som foregik fra 2006 - 2008 i Varde kommune. Projektet bestod af en specifik del og en genrele del, som henholdsvist var et tilbud til overvægtige børn med henblik på at give dem et sundere liv, og et forsøg på at gøre sundhed til en mere...

  6. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    Science.gov (United States)

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  7. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  8. Tissue response of defined collagen-elastin scaffolds in young and adult rats with special attention to calcification

    NARCIS (Netherlands)

    Daamen, WF; Nillesen, STM; Hafmans, T; Veerkamp, JH; van Luyn, MJA; van Kuppevelt, TH

    Collagen-elastin scaffolds may be valuable biomaterials for tissue engineering because they combine tensile strength with elasticity. In this study, the tissue response to and the calcification of these scaffolds were evaluated. In particular, the hypothesis was tested that calcification, a common

  9. Cross-layer optimization of wireless multi-hop networks

    OpenAIRE

    Soldati, Pablo

    2007-01-01

    The interest in wireless communications has grown constantly for the past decades, leading to an enormous number of applications and services embraced by billions of users. In order to meet the increasing demand for mobile Internet access, several high data-rate radio networking technologies have been proposed to offer wide area high-speed wireless communications, eventually replacing fixed (wired) networks for many applications. This thesis considers cross-layer optimization of multi-hop rad...

  10. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  11. Electrospun nanofiber scaffolds: engineering soft tissues

    International Nuclear Information System (INIS)

    Kumbar, S G; Nukavarapu, S P; Laurencin, C T; James, R

    2008-01-01

    Electrospinning has emerged to be a simple, elegant and scalable technique to fabricate polymeric nanofibers. Pure polymers as well as blends and composites of both natural and synthetics have been successfully electrospun into nanofiber matrices. Physiochemical properties of nanofiber matrices can be controlled by manipulating electrospinning parameters to meet the requirements of a specific application. Such efforts include the fabrication of fiber matrices containing nanofibers, microfibers, combination of nano-microfibers and also different fiber orientation/alignments. Polymeric nanofiber matrices have been extensively investigated for diversified uses such as filtration, barrier fabrics, wipes, personal care, biomedical and pharmaceutical applications. Recently electrospun nanofiber matrices have gained a lot of attention, and are being explored as scaffolds in tissue engineering due to their properties that can modulate cellular behavior. Electrospun nanofiber matrices show morphological similarities to the natural extra-cellular matrix (ECM), characterized by ultrafine continuous fibers, high surface-to-volume ratio, high porosity and variable pore-size distribution. Efforts have been made to modify nanofiber surfaces with several bioactive molecules to provide cells with the necessary chemical cues and a more in vivo like environment. The current paper provides an overlook on such efforts in designing nanofiber matrices as scaffolds in the regeneration of various soft tissues including skin, blood vessel, tendon/ligament, cardiac patch, nerve and skeletal muscle

  12. Electrospun nanofiber scaffolds: engineering soft tissues

    Energy Technology Data Exchange (ETDEWEB)

    Kumbar, S G; Nukavarapu, S P; Laurencin, C T [Department of Orthopaedic Surgery, University of Virginia, VA 22908 (United States); James, R [Department of Biomedical Engineering, University of Virginia, VA 22908 (United States)], E-mail: laurencin@virginia.edu

    2008-09-01

    Electrospinning has emerged to be a simple, elegant and scalable technique to fabricate polymeric nanofibers. Pure polymers as well as blends and composites of both natural and synthetics have been successfully electrospun into nanofiber matrices. Physiochemical properties of nanofiber matrices can be controlled by manipulating electrospinning parameters to meet the requirements of a specific application. Such efforts include the fabrication of fiber matrices containing nanofibers, microfibers, combination of nano-microfibers and also different fiber orientation/alignments. Polymeric nanofiber matrices have been extensively investigated for diversified uses such as filtration, barrier fabrics, wipes, personal care, biomedical and pharmaceutical applications. Recently electrospun nanofiber matrices have gained a lot of attention, and are being explored as scaffolds in tissue engineering due to their properties that can modulate cellular behavior. Electrospun nanofiber matrices show morphological similarities to the natural extra-cellular matrix (ECM), characterized by ultrafine continuous fibers, high surface-to-volume ratio, high porosity and variable pore-size distribution. Efforts have been made to modify nanofiber surfaces with several bioactive molecules to provide cells with the necessary chemical cues and a more in vivo like environment. The current paper provides an overlook on such efforts in designing nanofiber matrices as scaffolds in the regeneration of various soft tissues including skin, blood vessel, tendon/ligament, cardiac patch, nerve and skeletal muscle.

  13. Engineered porous scaffolds for periprosthetic infection prevention

    Energy Technology Data Exchange (ETDEWEB)

    Iviglia, Giorgio, E-mail: giorgio.iviglia@polito.it [Nobil Bio Ricerche Srl, 14037 Portacomaro (Italy); Department of Applied Science and Technology, Institute of Materials Physics and Engineering, Politecnico di Torino, 10121 Torino (Italy); Cassinelli, Clara; Bollati, Daniele [Nobil Bio Ricerche Srl, 14037 Portacomaro (Italy); Baino, Francesco [Department of Applied Science and Technology, Institute of Materials Physics and Engineering, Politecnico di Torino, 10121 Torino (Italy); Torre, Elisa; Morra, Marco [Nobil Bio Ricerche Srl, 14037 Portacomaro (Italy); Vitale-Brovarone, Chiara [Department of Applied Science and Technology, Institute of Materials Physics and Engineering, Politecnico di Torino, 10121 Torino (Italy)

    2016-11-01

    Periprosthetic infection is a consequence of implant insertion procedures and strategies for its prevention involve either an increase in the rate of new bone formation or the release of antibiotics such as vancomycin. In this work we combined both strategies and developed a novel, multifunctional three-dimensional porous scaffold that was produced using hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP), coupled with a pectin (PEC)-chitosan (CHIT) polyelectrolyte (PEI), and loaded with vancomycin (VCA). By this approach, a controlled vancomycin release was achieved and serial bacterial dilution test demonstrated that, after 1 week, the engineered construct still inhibits the bacterial growth. Degradation tests show an excellent behavior in a physiological and acidic environment (< 10% of mass loss). Furthermore, the PEI coating shows an anti-inflammatory response, and good cell proliferation and migration were demonstrated in vitro using osteoblast SAOS-2 cell line. This new engineered construct exhibits excellent properties both as an antibacterial material and as a stimulator of bone formation, which makes it a good candidate to contrast periprosthetic infection. - Highlights: • A novel three-dimensional ceramic scaffold was developed for infection prevention. • Pectin/chitosan coating stabilizes the degradation behavior in acidic environment. • Polyelectrolyte complex allows sustained release of vancomycin. • Inhibition of bacterial proliferation and biofilm formation was assessed. • PEI coating elicits anti-inflammatory response.

  14. Engineered porous scaffolds for periprosthetic infection prevention

    International Nuclear Information System (INIS)

    Iviglia, Giorgio; Cassinelli, Clara; Bollati, Daniele; Baino, Francesco; Torre, Elisa; Morra, Marco; Vitale-Brovarone, Chiara

    2016-01-01

    Periprosthetic infection is a consequence of implant insertion procedures and strategies for its prevention involve either an increase in the rate of new bone formation or the release of antibiotics such as vancomycin. In this work we combined both strategies and developed a novel, multifunctional three-dimensional porous scaffold that was produced using hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP), coupled with a pectin (PEC)-chitosan (CHIT) polyelectrolyte (PEI), and loaded with vancomycin (VCA). By this approach, a controlled vancomycin release was achieved and serial bacterial dilution test demonstrated that, after 1 week, the engineered construct still inhibits the bacterial growth. Degradation tests show an excellent behavior in a physiological and acidic environment (< 10% of mass loss). Furthermore, the PEI coating shows an anti-inflammatory response, and good cell proliferation and migration were demonstrated in vitro using osteoblast SAOS-2 cell line. This new engineered construct exhibits excellent properties both as an antibacterial material and as a stimulator of bone formation, which makes it a good candidate to contrast periprosthetic infection. - Highlights: • A novel three-dimensional ceramic scaffold was developed for infection prevention. • Pectin/chitosan coating stabilizes the degradation behavior in acidic environment. • Polyelectrolyte complex allows sustained release of vancomycin. • Inhibition of bacterial proliferation and biofilm formation was assessed. • PEI coating elicits anti-inflammatory response.

  15. Design of a Novel Two-Component Hybrid Dermal Scaffold for the Treatment of Pressure Sores.

    Science.gov (United States)

    Sharma, Vaibhav; Kohli, Nupur; Moulding, Dale; Afolabi, Halimat; Hook, Lilian; Mason, Chris; García-Gareta, Elena

    2017-11-01

    The aim of this study is to design a novel two-component hybrid scaffold using the fibrin/alginate porous hydrogel Smart Matrix combined to a backing layer of plasma polymerized polydimethylsiloxane (Sil) membrane to make the fibrin-based dermal scaffold more robust for the treatment of the clinically challenging pressure sores. A design criteria are established, according to which the Sil membranes are punched to avoid collection of fluid underneath. Manual peel test shows that native silicone does not attach to the fibrin/alginate component while the plasma polymerized silicone membranes are firmly bound to fibrin/alginate. Structural characterization shows that the fibrin/alginate matrix is intact after the addition of the Sil membrane. By adding a Sil membrane to the original fibrin/alginate scaffold, the resulting two-component scaffolds have a significantly higher shear or storage modulus G'. In vitro cell studies show that dermal fibroblasts remain viable, proliferate, and infiltrate the two-component hybrid scaffolds during the culture period. These results show that the design of a novel two-component hybrid dermal scaffold is successful according to the proposed design criteria. To the best of the authors' knowledge, this is the first study that reports the combination of a fibrin-based scaffold with a plasma-polymerized silicone membrane. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Duplex Schemes in Multiple Antenna Two-Hop Relaying

    Directory of Open Access Journals (Sweden)

    Anja Klein

    2008-04-01

    Full Text Available A novel scheme for two-hop relaying defined as space division duplex (SDD relaying is proposed. In SDD relaying, multiple antenna beamforming techniques are applied at the intermediate relay station (RS in order to separate downlink and uplink signals of a bi-directional two-hop communication between two nodes, namely, S1 and S2. For conventional amplify-and-forward two-hop relaying, there appears a loss in spectral efficiency due to the fact that the RS cannot receive and transmit simultaneously on the same channel resource. In SDD relaying, this loss in spectral efficiency is circumvented by giving up the strict separation of downlink and uplink signals by either time division duplex or frequency division duplex. Two novel concepts for the derivation of the linear beamforming filters at the RS are proposed; they can be designed either by a three-step or a one-step concept. In SDD relaying, receive signals at S1 are interfered by transmit signals of S1, and receive signals at S2 are interfered by transmit signals of S2. An efficient method in order to combat this kind of interference is proposed in this paper. Furthermore, it is shown how the overall spectral efficiency of SDD relaying can be improved if the channels from S1 and S2 to the RS have different qualities.

  17. Performance Analysis of RF-FSO Multi-Hop Networks

    KAUST Repository

    Makki, Behrooz

    2017-05-12

    We study the performance of multi-hop networks composed of millimeter wave (MMW)-based radio frequency (RF) and free-space optical (FSO) links. The results are obtained in the cases with and without hybrid automatic repeat request (HARQ). Taking the MMW characteristics of the RF links into account, we derive closed-form expressions for the network outage probability. We also evaluate the effect of various parameters such as power amplifiers efficiency, number of antennas as well as different coherence times of the RF and the FSO links on the system performance. Finally, we present mappings between the performance of RF- FSO multi-hop networks and the ones using only the RF- or the FSO-based communication, in the sense that with appropriate parameter settings the same outage probability is achieved in these setups. The results show the efficiency of the RF-FSO setups in different conditions. Moreover, the HARQ can effectively improve the outage probability/energy efficiency, and compensate the effect of hardware impairments in RF-FSO networks. For common parameter settings of the RF-FSO dual- hop networks, outage probability 10^{-4} and code rate 3 nats-per-channel-use, the implementation of HARQ with a maximum of 2 and 3 retransmissions reduces the required power, compared to the cases with no HARQ, by 13 and 17 dB, respectively.

  18. Multi-scale osteointegration and neovascularization of biphasic calcium phosphate bone scaffolds

    Science.gov (United States)

    Lan, Sheeny K.

    undergoes in vivo modifications involving formation of a biological apatite layer within scaffold micropores and possibly co-precipitation of endogenous osteoinductive proteins. To further investigate the effects of scaffold osteoinductivity, BCP scaffolds were implanted in porcine mandibular defects with rhBMP-2, which was partially sequestered in the micropores. Cell migration into osteoinductive scaffold micropores can be enhanced through the delivery of exogenous rhBMP-2 further promoting multi-scale osteointegration. Finally, endothelial colony forming cells (ECFCs) isolated from human umbilical cord blood (UCB) were evaluated in terms of their in vivo vasculogenic potential in the context of bone formation. This work was completed to determine if ECFCs could be utilized in a bone tissue engineering construct to promote neovascularization. ECFCs were combined with a BCP scaffold and rhBMP-2 and implanted subcutaneously on the abdominal wall of NOD/SCID mice. The result was formation of perfused human vessels within BCP scaffold macropores that were present at 4 weeks. The high density and persistence of human vessels at four weeks indicates that human UCB ECFCs exceed their reported in vivo vasculogenic potential when combined with rhBMP-2 and a BCP scaffold. This shows a dual role for BMP-2 in the context of bone regeneration. Collectively, the thesis demonstrates that (1) the design of synthetic bone scaffolds should include controlled multi-scale porosity to promote multi-scale osteointegration, which may significantly improve scaffold mechanical properties and (2) human umbilical cord blood-derived endothelial colony forming cells have potential for promoting neovascularization in a bone defect when combined with rhBMP-2.

  19. A practice scaffolding interactive platform

    DEFF Research Database (Denmark)

    Bundsgaard, Jeppe

    2009-01-01

    A Practice Scaffolding Interactive Platform (PracSIP) is a social learning platform which supports students in collaborative project based learning by simulating a professional practice. A PracSIP puts the core tools of the simulated practice at the students' disposal, it organizes collaboration...

  20. Problem Solving, Scaffolding and Learning

    Science.gov (United States)

    Lin, Shih-Yin

    2012-01-01

    Helping students to construct robust understanding of physics concepts and develop good solving skills is a central goal in many physics classrooms. This thesis examine students' problem solving abilities from different perspectives and explores strategies to scaffold students' learning. In studies involving analogical problem solving…

  1. Multi-Hop Link Capacity of Multi-Route Multi-Hop MRC Diversity for a Virtual Cellular Network

    Science.gov (United States)

    Daou, Imane; Kudoh, Eisuke; Adachi, Fumiyuki

    In virtual cellular network (VCN), proposed for high-speed mobile communications, the signal transmitted from a mobile terminal is received by some wireless ports distributed in each virtual cell and relayed to the central port that acts as a gateway to the core network. In this paper, we apply the multi-route MHMRC diversity in order to decrease the transmit power and increase the multi-hop link capacity. The transmit power, the interference power and the link capacity are evaluated for DS-CDMA multi-hop VCN by computer simulation. The multi-route MHMRC diversity can be applied to not only DS-CDMA but also other access schemes (i. e. MC-CDMA, OFDM, etc.).

  2. Three-Dimensional Elastomeric Scaffolds Designed with Cardiac-Mimetic Structural and Mechanical Features

    Science.gov (United States)

    Neal, Rebekah A.; Jean, Aurélie; Park, Hyoungshin; Wu, Patrick B.; Hsiao, James; Engelmayr, George C.; Langer, Robert

    2013-01-01

    Tissue-engineered constructs, at the interface of material science, biology, engineering, and medicine, have the capacity to improve outcomes for cardiac patients by providing living cells and degradable biomaterials that can regenerate the native myocardium. With an ultimate goal of both delivering cells and providing mechanical support to the healing heart, we designed three-dimensional (3D) elastomeric scaffolds with (1) stiffnesses and anisotropy mimicking explanted myocardial specimens as predicted by finite-element (FE) modeling, (2) systematically varied combinations of rectangular pore pattern, pore aspect ratio, and strut width, and (3) structural features approaching tissue scale. Based on predicted mechanical properties, three scaffold designs were selected from eight candidates for fabrication from poly(glycerol sebacate) by micromolding from silicon wafers. Large 20×20 mm scaffolds with high aspect ratio features (5:1 strut height:strut width) were reproducibly cast, cured, and demolded at a relatively high throughput. Empirically measured mechanical properties demonstrated that scaffolds were cardiac mimetic and validated FE model predictions. Two-layered scaffolds providing fully interconnected pore networks were fabricated by layer-by-layer assembly. C2C12 myoblasts cultured on one-layered scaffolds exhibited specific patterns of cell elongation and interconnectivity that appeared to be guided by the scaffold pore pattern. Neonatal rat heart cells cultured on two-layered scaffolds for 1 week were contractile, both spontaneously and in response to electrical stimulation, and expressed sarcomeric α-actinin, a cardiac biomarker. This work not only demonstrated several scaffold designs that promoted functional assembly of rat heart cells, but also provided the foundation for further computational and empirical investigations of 3D elastomeric scaffolds for cardiac tissue engineering. PMID:23190320

  3. Development of a Micronized Meniscus Extracellular Matrix Scaffold for Potential Augmentation of Meniscal Repair and Regeneration.

    Science.gov (United States)

    Monibi, Farrah A; Bozynski, Chantelle C; Kuroki, Keiichi; Stoker, Aaron M; Pfeiffer, Ferris M; Sherman, Seth L; Cook, James L

    2016-12-01

    Decellularized scaffolds composed of extracellular matrix (ECM) hold promise for repair and regeneration of the meniscus, given the potential for ECM-based biomaterials to aid in stem cell recruitment, infiltration, and differentiation. The objectives of this study were to decellularize canine menisci to fabricate a micronized, ECM-derived scaffold and to determine the cytocompatibility and repair potential of the scaffold ex vivo. Menisci were decellularized with a combination of physical agitation and chemical treatments. For scaffold fabrication, decellularized menisci were cryoground into a powder and the size and morphology of the ECM particles were evaluated using scanning electron microscopy. Histologic and biochemical analyses of the scaffold confirmed effective decellularization with loss of proteoglycan from the tissue but no significant reduction in collagen content. When washed effectively, the decellularized scaffold was cytocompatible to meniscal fibrochondrocytes, synoviocytes, and whole meniscal tissue based on the resazurin reduction assay and histologic evaluation. In an ex vivo model for meniscal repair, radial tears were augmented with the scaffold delivered with platelet-rich plasma as a carrier, and compared to nonaugmented (standard-of-care) suture techniques. Histologically, there was no evidence of cellular migration or proliferation noted in any of the untreated or standard-of-care treatment groups after 40 days of culture. Conversely, cellular infiltration and proliferation were noted in scaffold-augmented repairs. These data suggest the potential for the scaffold to promote cellular survival, migration, and proliferation ex vivo. Further investigations are necessary to examine the potential for the scaffold to induce cellular differentiation and functional meniscal fibrochondrogenesis.

  4. Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank on hops in Spain

    Directory of Open Access Journals (Sweden)

    A. Lorenzana

    2013-04-01

    Full Text Available The hop aphid Phorodon humuli (Schrank (Hemiptera: Aphididae is a serious pest in most areas where hops are grown. A field trial was performed on a hop yard throughout 2002, 2003 and 2004 in León (Spain in order to analyse the population development of Phorodon humuli and its natural enemies, as well as to determine the most effective integrated program of insecticide treatments. The basic population development pattern of P. humuli was similar in the three years: the population peaked between mid to late June, and then decreased in late June/early July, rising again and reaching another peak in mid-July, after which it began to decline, rising once more in late August; this last rise is characteristic of Spain and has not been recorded in the rest of Europe. The hop aphid’s main natural enemy found on the leaves was Coccinella septempunctata (Coleoptera: Coccinellidae. The multiple regression analysis showed that aphids are positively related with the presence of beetle eggs and mean daily temperatures and negatively related with maximum daily temperature integral above 27ºC in plots without insecticide treatment. The most effective program of insecticide (imidacloprid treatments consisted of an initial treatment in June and a second treatment in the second half of July or at the beginning of August. However, a single treatment in June would be sufficient when in this last period the maximum daily temperatures were higher than 27ºC for at least 15 days, avoiding in this way the harmful effects of imidacloprid on predators.

  5. Chitin Scaffolds in Tissue Engineering

    Science.gov (United States)

    Jayakumar, Rangasamy; Chennazhi, Krishna Prasad; Srinivasan, Sowmya; Nair, Shantikumar V.; Furuike, Tetsuya; Tamura, Hiroshi

    2011-01-01

    Tissue engineering/regeneration is based on the hypothesis that healthy stem/progenitor cells either recruited or delivered to an injured site, can eventually regenerate lost or damaged tissue. Most of the researchers working in tissue engineering and regenerative technology attempt to create tissue replacements by culturing cells onto synthetic porous three-dimensional polymeric scaffolds, which is currently regarded as an ideal approach to enhance functional tissue regeneration by creating and maintaining channels that facilitate progenitor cell migration, proliferation and differentiation. The requirements that must be satisfied by such scaffolds include providing a space with the proper size, shape and porosity for tissue development and permitting cells from the surrounding tissue to migrate into the matrix. Recently, chitin scaffolds have been widely used in tissue engineering due to their non-toxic, biodegradable and biocompatible nature. The advantage of chitin as a tissue engineering biomaterial lies in that it can be easily processed into gel and scaffold forms for a variety of biomedical applications. Moreover, chitin has been shown to enhance some biological activities such as immunological, antibacterial, drug delivery and have been shown to promote better healing at a faster rate and exhibit greater compatibility with humans. This review provides an overview of the current status of tissue engineering/regenerative medicine research using chitin scaffolds for bone, cartilage and wound healing applications. We also outline the key challenges in this field and the most likely directions for future development and we hope that this review will be helpful to the researchers working in the field of tissue engineering and regenerative medicine. PMID:21673928

  6. Droppin’ Knowledge on Race: Hip-Hop, White Adolescents, and Anti-Racism Education

    Directory of Open Access Journals (Sweden)

    Steven Netcoh

    2013-10-01

    Full Text Available In this essay, the author examines how Hip-Hop can be mobilized in anti-racism educational initatives.  The author claims that existing research on Hip-Hop and white adolescents suggests a negative corrleation between white youths' engagement with Hip-Hop and their understanding of how race and racism function in American society.  In response to this research, the author argues Hip-Hop's diverse racial discourses and ideologies must be made the subject of direct and critical inquiry in secondary and post-secondary classrooms to maximize its democratic potential.  The author outlines specific approaches for how teachers can employ Hip-Hop in anti-racism curricula in secondary and post-secondary classrooms.  Collectively, the essay serves as a preliminary investigation of Hip-Hop pedagogies of race and whiteness.

  7. Blind Compressed Sensing Parameter Estimation of Non-cooperative Frequency Hopping Signal

    Directory of Open Access Journals (Sweden)

    Chen Ying

    2016-10-01

    Full Text Available To overcome the disadvantages of a non-cooperative frequency hopping communication system, such as a high sampling rate and inadequate prior information, parameter estimation based on Blind Compressed Sensing (BCS is proposed. The signal is precisely reconstructed by the alternating iteration of sparse coding and basis updating, and the hopping frequencies are directly estimated based on the results. Compared with conventional compressive sensing, blind compressed sensing does not require prior information of the frequency hopping signals; hence, it offers an effective solution to the inadequate prior information problem. In the proposed method, the signal is first modeled and then reconstructed by Orthonormal Block Diagonal Blind Compressed Sensing (OBD-BCS, and the hopping frequencies and hop period are finally estimated. The simulation results suggest that the proposed method can reconstruct and estimate the parameters of noncooperative frequency hopping signals with a low signal-to-noise ratio.

  8. A new method of hybrid frequency hopping signals selection and blind parameter estimation

    Science.gov (United States)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

    2018-04-01

    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  9. Mic Power? Connections and the hip hop nation in Kampala, Uganda

    DEFF Research Database (Denmark)

    Schneidermann, Nanna

    2014-01-01

    Hip hop culture has been celebrated in the media and scholarship as a universal youth language, part of a global hip hop nation, and a type of counter-public. This article examines the everyday meanings and practices of hip hop among hip hop activists in Kampala, Uganda, specifically within...... the Batuuze rap group. Rather than portraying hip hop as a counter-public of the disempowered, I argue that the Batuuze engagement is based on what I call moral economy that enables the negotiation of connections in social and cultural networks towards what is considered a good life. Here, the hip hop nation...... is less of an alternative public sphere and more a way of articulating and contextualizing the world in a specific locality, which produces connections and opportunities in the young rappers’ lives....

  10. Geometry Design Optimization of Functionally Graded Scaffolds for Bone Tissue Engineering: A Mechanobiological Approach.

    Directory of Open Access Journals (Sweden)

    Antonio Boccaccio

    Full Text Available Functionally Graded Scaffolds (FGSs are porous biomaterials where porosity changes in space with a specific gradient. In spite of their wide use in bone tissue engineering, possible models that relate the scaffold gradient to the mechanical and biological requirements for the regeneration of the bony tissue are currently missing. In this study we attempt to bridge the gap by developing a mechanobiology-based optimization algorithm aimed to determine the optimal graded porosity distribution in FGSs. The algorithm combines the parametric finite element model of a FGS, a computational mechano-regulation model and a numerical optimization routine. For assigned boundary and loading conditions, the algorithm builds iteratively different scaffold geometry configurations with different porosity distributions until the best microstructure geometry is reached, i.e. the geometry that allows the amount of bone formation to be maximized. We tested different porosity distribution laws, loading conditions and scaffold Young's modulus values. For each combination of these variables, the explicit equation of the porosity distribution law-i.e the law that describes the pore dimensions in function of the spatial coordinates-was determined that allows the highest amounts of bone to be generated. The results show that the loading conditions affect significantly the optimal porosity distribution. For a pure compression loading, it was found that the pore dimensions are almost constant throughout the entire scaffold and using a FGS allows the formation of amounts of bone slightly larger than those obtainable with a homogeneous porosity scaffold. For a pure shear loading, instead, FGSs allow to significantly increase the bone formation compared to a homogeneous porosity scaffolds. Although experimental data is still necessary to properly relate the mechanical/biological environment to the scaffold microstructure, this model represents an important step towards

  11. Method Development and Validation for UHPLC-MS-MS Determination of Hop Prenylflavonoids in Human Serum

    OpenAIRE

    Yuan, Yang; Qiu, Xi; Nikolic, Dejan; Dahl, Jeffrey H.; van Breemen, Richard B.

    2012-01-01

    Hops (Humulus lupulus L.) are used in the brewing of beer, and hop extracts containing prenylated compounds such as xanthohumol and 8-prenylnaringenin are under investigation as dietary supplements for cancer chemoprevention and for the management of hot flashes in menopausal women. To facilitate clinical studies of hop safety and efficacy, a selective, sensitive, and fast ultra-high pressure liquid chromatography tandem mass spectrometry (UHPLC-MS-MS) method was developed and validated for t...

  12. Savage Vernacular: Performing Race, Memory, and Hip Hop in Filipino America

    OpenAIRE

    Villegas, Mark

    2015-01-01

    By observing and analyzing live performances, music, visual art, interviews, television shows, and online discourse, this dissertation traces the ways in which Filipino American hip hop performance remembers the racialized histories of the Filipino body. Through both quotidian and spectacular performances in hip hop, Filipino Americans have been contributing to crucial forms of knowledge that help unpack the terms of Filipino and American culture. Hip hop culture, I argue, operates as a produ...

  13. Altered lower extremity joint mechanics occur during the star excursion balance test and single leg hop after ACL-reconstruction in a collegiate athlete.

    Science.gov (United States)

    Samaan, Michael A; Ringleb, Stacie I; Bawab, Sebastian Y; Greska, Eric K; Weinhandl, Joshua T

    2018-03-01

    The effects of ACL-reconstruction on lower extremity joint mechanics during performance of the Star Excursion Balance Test (SEBT) and Single Leg Hop (SLH) are limited. The purpose of this study was to determine if altered lower extremity mechanics occur during the SEBT and SLH after ACL-reconstruction. One female Division I collegiate athlete performed the SEBT and SLH tasks, bilaterally, both before ACL injury and 27 months after ACL-reconstruction. Maximal reach, hop distances, lower extremity joint kinematics and moments were compared between both time points. Musculoskeletal simulations were used to assess muscle force production during the SEBT and SLH at both time points. Compared to the pre-injury time point, SEBT reach distances were similar in both limbs after ACL-reconstruction except for the max anterior reach distance in the ipsilateral limb. The athlete demonstrated similar hop distances, bilaterally, after ACL-reconstruction compared to the pre-injury time point. Despite normal functional performance during the SEBT and SLH, the athlete exhibited altered lower extremity joint mechanics during both of these tasks. These results suggest that measuring the maximal reach and hop distances for these tasks, in combination with an analysis of the lower extremity joint mechanics that occur after ACL-reconstruction, may help clinicians and researchers to better understand the effects of ACL-reconstruction on the neuromuscular system during the SEBT and SLH.

  14. PERFORMANCE ANALYSIS OF ARQ AND HYBRID ARQ OVER SINGLE-HOP, DUAL-HOP, AND MULTIBRANCH DUAL-HOP NETWORKS

    KAUST Repository

    Hadjtaieb, Amir

    2014-05-01

    During the last decade, relay networks have attracted a lot of interest due to their numerous benefits. The relaying technique allows extending the coverage zone of wireless networks and offers a higher reliability for communication systems. The performance of relay networks can be improved further by the use of automatic repeat request (ARQ) and hybrid automatic repeat request (HARQ) techniques. ARQ and HARQ are retransmission mechanisms that ensure a good quality of service even in absence of channel state information at the transmitter. We, firstly, study the spectral and energy efficiency of ARQ in Nakagami-m block-fading channels. We maximize both spectral efficiency and energy efficiency with respect to the transmitted power. We derive exact expressions as well as compact and tight approximation for the solutions of these problems. Our analysis shows that the two problems of maximizing spectral efficiency and energy efficiency with respect to the transmitted power are completely different and give different solutions. Additionally, operating with a power that maximizes energy efficiency can lead to a significant drop in the spectral efficiency, and vice versa. Next, we consider a three node relay network comprising a source, a relay, and a destination. The source transmits the message to the destination using HARQ with incremental redundancy (IR). The relay overhears the transmitted message, amplifies it using a variable gain amplifier, and then forwards the message to the destination. This latter combines both the source and the relay message and tries to decode the information. In case of decoding failure, the destination sends a negative acknowledgement. A new replica of the message containing new parity bits is then transmitted in the subsequent HARQ round. This process continues until successful decoding occurs at the destination or a maximum number M of rounds is reached. We study the performance of HARQ-IR over the considered relay channel from an

  15. Hybrid 3D-2D printing for bone scaffolds fabrication

    Science.gov (United States)

    Seleznev, V. A.; Prinz, V. Ya

    2017-02-01

    It is a well-known fact that bone scaffold topography on micro- and nanometer scale influences the cellular behavior. Nano-scale surface modification of scaffolds allows the modulation of biological activity for enhanced cell differentiation. To date, there has been only a limited success in printing scaffolds with micro- and nano-scale features exposed on the surface. To improve on the currently available imperfect technologies, in our paper we introduce new hybrid technologies based on a combination of 2D (nano imprint) and 3D printing methods. The first method is based on using light projection 3D printing and simultaneous 2D nanostructuring of each of the layers during the formation of the 3D structure. The second method is based on the sequential integration of preliminarily created 2D nanostructured films into a 3D printed structure. The capabilities of the developed hybrid technologies are demonstrated with the example of forming 3D bone scaffolds. The proposed technologies can be used to fabricate complex 3D micro- and nanostructured products for various fields.

  16. Nanoengineered Carbon Scaffolds for Hydrogen Storage

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, A. D.; Hudson, J. L.; Fan, H.; Booker, R.; Simpson, L. J.; O' Neill, K. J.; Parilla, P. A.; Heben, M. J.; Pasquali, M.; Kittrell, C.; Tour, J. M.

    2009-01-01

    Single-walled carbon nanotube (SWCNT) fibers were engineered to become a scaffold for the storage of hydrogen. Carbon nanotube fibers were swollen in oleum (fuming sulfuric acid), and organic spacer groups were covalently linked between the nanotubes using diazonium functionalization chemistry to provide 3-dimensional (3-D) frameworks for the adsorption of hydrogen molecules. These 3-D nanoengineered fibers physisorb twice as much hydrogen per unit surface area as do typical macroporous carbon materials. These fiber-based systems can have high density, and combined with the outstanding thermal conductivity of carbon nanotubes, this points a way toward solving the volumetric and heat-transfer constraints that limit some other hydrogen-storage supports.

  17. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    Science.gov (United States)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-07-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

  18. Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

    International Nuclear Information System (INIS)

    Wu, Yahui; Deng, Su; Huang, Hongbin

    2013-01-01

    Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count. (paper)

  19. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    Science.gov (United States)

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  20. Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

    Science.gov (United States)

    He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

    2005-01-01

    Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

  1. Hip-hop as a resource for understanding the urban context

    Science.gov (United States)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  2. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    Science.gov (United States)

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2017-07-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  3. Bioactive polymeric scaffolds for tissue engineering

    Directory of Open Access Journals (Sweden)

    Scott Stratton

    2016-12-01

    Full Text Available A variety of engineered scaffolds have been created for tissue engineering using polymers, ceramics and their composites. Biomimicry has been adopted for majority of the three-dimensional (3D scaffold design both in terms of physicochemical properties, as well as bioactivity for superior tissue regeneration. Scaffolds fabricated via salt leaching, particle sintering, hydrogels and lithography have been successful in promoting cell growth in vitro and tissue regeneration in vivo. Scaffold systems derived from decellularization of whole organs or tissues has been popular due to their assured biocompatibility and bioactivity. Traditional scaffold fabrication techniques often failed to create intricate structures with greater resolution, not reproducible and involved multiple steps. The 3D printing technology overcome several limitations of the traditional techniques and made it easier to adopt several thermoplastics and hydrogels to create micro-nanostructured scaffolds and devices for tissue engineering and drug delivery. This review highlights scaffold fabrication methodologies with a focus on optimizing scaffold performance through the matrix pores, bioactivity and degradation rate to enable tissue regeneration. Review highlights few examples of bioactive scaffold mediated nerve, muscle, tendon/ligament and bone regeneration. Regardless of the efforts required for optimization, a shift in 3D scaffold uses from the laboratory into everyday life is expected in the near future as some of the methods discussed in this review become more streamlined.

  4. Alginate based scaffolds for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Valente, J.F.A.; Valente, T.A.M. [CICS-UBI - Centro de Investigacao em Ciencias da Saude, Faculdade de Ciencias da Saude, Universidade da Beira Interior, Covilha (Portugal); Alves, P.; Ferreira, P. [CIEPQPF, Departamento de Engenharia Quimica, Universidade de Coimbra, Polo II, Pinhal de Marrocos, 3030-290 Coimbra (Portugal); Silva, A. [Centro de Ciencia e Tecnologia Aeroespaciais, Universidade da Beira Interior, Covilha (Portugal); Correia, I.J., E-mail: icorreia@ubi.pt [CICS-UBI - Centro de Investigacao em Ciencias da Saude, Faculdade de Ciencias da Saude, Universidade da Beira Interior, Covilha (Portugal)

    2012-12-01

    The design and production of scaffolds for bone tissue regeneration is yet unable to completely reproduce the native bone properties. In the present study new alginate microparticle and microfiber aggregated scaffolds were produced to be applied in this area of regenerative medicine. The scaffolds' mechanical properties were characterized by thermo mechanical assays. Their morphological characteristics were evaluated by isothermal nitrogen adsorption and scanning electron microscopy. The density of both types of scaffolds was determined by helium pycnometry and mercury intrusion porosimetry. Furthermore, scaffolds' cytotoxic profiles were evaluated in vitro by seeding human osteoblast cells in their presence. The results obtained showed that scaffolds have good mechanical and morphological properties compatible with their application as bone substitutes. Moreover, scaffold's biocompatibility was confirmed by the observation of cell adhesion and proliferation after 5 days of being seeded in their presence and by non-radioactive assays. - Highlights: Black-Right-Pointing-Pointer Design and production of scaffolds for bone tissue regeneration. Black-Right-Pointing-Pointer Microparticle and microfiber alginate scaffolds were produced through a particle aggregation technique; Black-Right-Pointing-Pointer Scaffolds' mechanically and biologically properties were characterized through in vitro studies;.

  5. A multi-scale controlled tissue engineering scaffold prepared by 3D printing and NFES technology

    Directory of Open Access Journals (Sweden)

    Feifei Yan

    2014-03-01

    Full Text Available The current focus in the field of life science is the use of tissue engineering scaffolds to repair human organs, which has shown great potential in clinical applications. Extracellular matrix morphology and the performance and internal structure of natural organs are required to meet certain requirements. Therefore, integrating multiple processes can effectively overcome the limitations of the individual processes and can take into account the needs of scaffolds for the material, structure, mechanical properties and many other aspects. This study combined the biological 3D printing technology and the near-field electro-spinning (NFES process to prepare a multi-scale controlled tissue engineering scaffold. While using 3D printing technology to directly prepare the macro-scaffold, the compositing NFES process to build tissue micro-morphology ultimately formed a tissue engineering scaffold which has the specific extracellular matrix structure. This scaffold not only takes into account the material, structure, performance and many other requirements, but also focuses on resolving the controllability problems in macro- and micro-forming which further aim to induce cell directed differentiation, reproduction and, ultimately, the formation of target tissue organs. It has in-depth immeasurable significance to build ideal scaffolds and further promote the application of tissue engineering.

  6. Bone tissue engineering with a collagen–hydroxyapatite scaffold and culture expanded bone marrow stromal cells

    Science.gov (United States)

    Villa, Max M.; Wang, Liping; Huang, Jianping; Rowe, David W.; Wei, Mei

    2015-01-01

    Osteoprogenitor cells combined with supportive biomaterials represent a promising approach to advance the standard of care for bone grafting procedures. However, this approach faces challenges, including inconsistent bone formation, cell survival in the implant, and appropriate biomaterial degradation. We have developed a collagen–hydroxyapatite (HA) scaffold that supports consistent osteogenesis by donor derived osteoprogenitors, and is more easily degraded than a pure ceramic scaffold. Herein, the material properties are characterized as well as cell attachment, viability, and progenitor distribution in vitro. Furthermore, we examined the biological performance in vivo in a critical-size mouse calvarial defect. To aid in the evaluation of the in-house collagen–HA scaffold, the in vivo performance was compared with a commercial collagen–HA scaffold (Healos®, Depuy). The in-house collagen–HA scaffold supported consistent bone formation by predominantly donor-derived osteoblasts, nearly completely filling a 3.5 mm calvarial defect with bone in all samples (n=5) after 3 weeks of implantation. In terms of bone formation and donor cell retention at 3 weeks postimplantation, no statistical difference was found between the in-house and commercial scaffold following quantitative histomorphometry. The collagen–HA scaffold presented here is an open and well-defined platform that supports robust bone formation and should facilitate the further development of collagen–hydroxyapatite biomaterials for bone tissue engineering. PMID:24909953

  7. Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients

    Science.gov (United States)

    Trachtenberg, Jordan E.; Placone, Jesse K.; Smith, Brandon T.; Fisher, John P.; Mikos, Antonios G.

    2017-01-01

    The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (µCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications. PMID:28125380

  8. A collagen-based scaffold delivering exogenous microrna-29B to modulate extracellular matrix remodeling.

    Science.gov (United States)

    Monaghan, Michael; Browne, Shane; Schenke-Layland, Katja; Pandit, Abhay

    2014-04-01

    Directing appropriate extracellular matrix remodeling is a key aim of regenerative medicine strategies. Thus, antifibrotic interfering RNA (RNAi) therapy with exogenous microRNA (miR)-29B was proposed as a method to modulate extracellular matrix remodeling following cutaneous injury. It was hypothesized that delivery of miR-29B from a collagen scaffold will efficiently modulate the extracellular matrix remodeling response and reduce maladaptive remodeling such as aggressive deposition of collagen type I after injury. The release of RNA from the scaffold was assessed and its ability to silence collagen type I and collagen type III expression was evaluated in vitro. When primary fibroblasts were cultured with scaffolds doped with miR-29B, reduced levels of collagen type I and collagen type III mRNA expression were observed for up to 2 weeks of culture. When the scaffolds were applied to full thickness wounds in vivo, reduced wound contraction, improved collagen type III/I ratios and a significantly higher matrix metalloproteinase (MMP)-8: tissue inhibitor of metalloproteinase (TIMP)-1 ratio were detected when the scaffolds were functionalized with miR-29B. Furthermore, these effects were significantly influenced by the dose of miR-29B in the collagen scaffold (0.5 versus 5 μg). This study shows a potential of combining exogenous miRs with collagen scaffolds to improve extracellular matrix remodeling following injury.

  9. 3D-Printed ABS and PLA Scaffolds for Cartilage and Nucleus Pulposus Tissue Regeneration

    Directory of Open Access Journals (Sweden)

    Derek H. Rosenzweig

    2015-07-01

    Full Text Available Painful degeneration of soft tissues accounts for high socioeconomic costs. Tissue engineering aims to provide biomimetics recapitulating native tissues. Biocompatible thermoplastics for 3D printing can generate high-resolution structures resembling tissue extracellular matrix. Large-pore 3D-printed acrylonitrile butadiene styrene (ABS and polylactic acid (PLA scaffolds were compared for cell ingrowth, viability, and tissue generation. Primary articular chondrocytes and nucleus pulposus (NP cells were cultured on ABS and PLA scaffolds for three weeks. Both cell types proliferated well, showed high viability, and produced ample amounts of proteoglycan and collagen type II on both scaffolds. NP generated more matrix than chondrocytes; however, no difference was observed between scaffold types. Mechanical testing revealed sustained scaffold stability. This study demonstrates that chondrocytes and NP cells can proliferate on both ABS and PLA scaffolds printed with a simplistic, inexpensive desktop 3D printer. Moreover, NP cells produced more proteoglycan than chondrocytes, irrespective of thermoplastic type, indicating that cells maintain individual phenotype over the three-week culture period. Future scaffold designs covering larger pore sizes and better mimicking native tissue structure combined with more flexible or resorbable materials may provide implantable constructs with the proper structure, function, and cellularity necessary for potential cartilage and disc tissue repair in vivo.

  10. 3D-Printed ABS and PLA Scaffolds for Cartilage and Nucleus Pulposus Tissue Regeneration.

    Science.gov (United States)

    Rosenzweig, Derek H; Carelli, Eric; Steffen, Thomas; Jarzem, Peter; Haglund, Lisbet

    2015-07-03

    Painful degeneration of soft tissues accounts for high socioeconomic costs. Tissue engineering aims to provide biomimetics recapitulating native tissues. Biocompatible thermoplastics for 3D printing can generate high-resolution structures resembling tissue extracellular matrix. Large-pore 3D-printed acrylonitrile butadiene styrene (ABS) and polylactic acid (PLA) scaffolds were compared for cell ingrowth, viability, and tissue generation. Primary articular chondrocytes and nucleus pulposus (NP) cells were cultured on ABS and PLA scaffolds for three weeks. Both cell types proliferated well, showed high viability, and produced ample amounts of proteoglycan and collagen type II on both scaffolds. NP generated more matrix than chondrocytes; however, no difference was observed between scaffold types. Mechanical testing revealed sustained scaffold stability. This study demonstrates that chondrocytes and NP cells can proliferate on both ABS and PLA scaffolds printed with a simplistic, inexpensive desktop 3D printer. Moreover, NP cells produced more proteoglycan than chondrocytes, irrespective of thermoplastic type, indicating that cells maintain individual phenotype over the three-week culture period. Future scaffold designs covering larger pore sizes and better mimicking native tissue structure combined with more flexible or resorbable materials may provide implantable constructs with the proper structure, function, and cellularity necessary for potential cartilage and disc tissue repair in vivo.

  11. A review of evolution of electrospun tissue engineering scaffold: From two dimensions to three dimensions.

    Science.gov (United States)

    Ngadiman, Nor Hasrul Akhmal; Noordin, M Y; Idris, Ani; Kurniawan, Denni

    2017-07-01

    The potential of electrospinning process to fabricate ultrafine fibers as building blocks for tissue engineering scaffolds is well recognized. The scaffold construct produced by electrospinning process depends on the quality of the fibers. In electrospinning, material selection and parameter setting are among many factors that contribute to the quality of the ultrafine fibers, which eventually determine the performance of the tissue engineering scaffolds. The major challenge of conventional electrospun scaffolds is the nature of electrospinning process which can only produce two-dimensional electrospun mats, hence limiting their applications. Researchers have started to focus on overcoming this limitation by combining electrospinning with other techniques to fabricate three-dimensional scaffold constructs. This article reviews various polymeric materials and their composites/blends that have been successfully electrospun for tissue engineering scaffolds, their mechanical properties, and the various parameters settings that influence the fiber morphology. This review also highlights the secondary processes to electrospinning that have been used to develop three-dimensional tissue engineering scaffolds as well as the steps undertaken to overcome electrospinning limitations.

  12. Development and Characterization of Organic Electronic Scaffolds for Bone Tissue Engineering.

    Science.gov (United States)

    Iandolo, Donata; Ravichandran, Akhilandeshwari; Liu, Xianjie; Wen, Feng; Chan, Jerry K Y; Berggren, Magnus; Teoh, Swee-Hin; Simon, Daniel T

    2016-06-01

    Bones have been shown to exhibit piezoelectric properties, generating electrical potential upon mechanical deformation and responding to electrical stimulation with the generation of mechanical stress. Thus, the effects of electrical stimulation on bone tissue engineering have been extensively studied. However, in bone regeneration applications, only few studies have focused on the use of electroactive 3D biodegradable scaffolds at the interphase with stem cells. Here a method is described to combine the bone regeneration capabilities of 3D-printed macroporous medical grade polycaprolactone (PCL) scaffolds with the electrical and electrochemical capabilities of the conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT). PCL scaffolds have been highly effective in vivo as bone regeneration grafts, and PEDOT is a leading material in the field of organic bioelectronics, due to its stability, conformability, and biocompatibility. A protocol is reported for scaffolds functionalization with PEDOT, using vapor-phase polymerization, resulting in a conformal conducting layer. Scaffolds' porosity and mechanical stability, important for in vivo bone regeneration applications, are retained. Human fetal mesenchymal stem cells proliferation is assessed on the functionalized scaffolds, showing the cytocompatibility of the polymeric coating. Altogether, these results show the feasibility of the proposed approach to obtain electroactive scaffolds for electrical stimulation of stem cells for regenerative medicine. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Physical and degradation properties of PLGA scaffolds fabricated by salt fusion technique.

    Science.gov (United States)

    Mekala, Naveen Kumar; Baadhe, Rama Raju; Parcha, Sreenivasa Rao; Yalavarthy, Prameela Devi

    2013-07-01

    Tissue engineering scaffolds require a controlled pore size and interconnected pore structures to support the host tissue growth. In the present study, three dimensional (3D) hybrid scaffolds of poly lactic acid (PLA) and poly glycolic acid (PGA) were fabricated using solvent casting/particulate leaching. In this case, partially fused NaCl particles were used as porogen (200-300µ) to improve the overall porosity (≥90%) and internal texture of scaffolds. Differential scanning calorimeter (DSC) analysis of these porous scaffolds revealed a gradual reduction in glass transition temperature (Tg) (from 48°C to 42.5°C) with increase in hydrophilic PGA content. The potential applications of these scaffolds as implants were further tested for their biocompatibility and biodegradability in four simulated body fluid (SBF) types in vitro. Whereas, simulated body fluid (SBF) Type1 with the optimal amount of HCO3 (-) ions was found to be more appropriate and sensible for testing the bioactivity of scaffolds. Among three combinations of polymer scaffolds, sample B with a ratio of 75:25 of PLA: PGA showed greater stability in body fluids (pH 7.2) with an optimum degradation rate (9% to 12% approx). X-ray diffractogram also confirmed a thin layer of hydroxyapatite deposition over sample B with all SBF types in vitro.

  14. Developing bioactive composite scaffolds for bone tissue engineering

    Science.gov (United States)

    Chen, Yun

    Poly(L-lactic acid) (PLLA) films were fabricated using the method of dissolving and evaporation. PLLA scaffold was prepared by solid-liquid phase separation of polymer solutions and subsequent sublimation of solvent. Bonelike apatite coating was formed on PLLA films, PLLA scaffolds and poly(glycolic acid) (PGA) scaffolds in 24 hours through an accelerated biomimetic process. The ion concentrations in the simulated body fluid (SBF) were nearly 5 times of those in human blood plasma. The apatite formed was characterized using scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FTIR). The apatite formed in 5SBF was similar in morphology and composition to that formed in the classical biomimetic process employing SBF or 1.5SBF, and similar to that of natural bone. This indicated that the biomimetic apatite coating process could be accelerated by using concentrated simulated body fluid at 37°C. Besides saving time, the accelerated biomimetic process is particularly significant to biodegradable polymers. Some polymers which degrade too fast to be coated with apatite by a classical biomimetic process, for example PGA, could be coated with bone-like apatite in an accelerated biomimetic process. Collagen and apatite were co-precipitated as a composite coating on poly(L-lactic acid) (PLLA) in an accelerated biomimetic process. The incubation solution contained collagen (1g/L) and simulated body fluid (SBF) with 5 times inorganic ionic concentrations as human blood plasma. The coating formed on PLLA films and scaffolds after 24 hours incubation was characterized using EDX, XRD, FTIR, and SEM. It was shown that the coating contained carbonated bone-like apatite and collagen, the primary constituents of natural bone. SEM showed a complex composite coating of submicron bone-like apatite particulates combined with collagen fibrils. This work provided an efficient process to obtain

  15. Nanosized Mesoporous Bioactive Glass/Poly(lactic-co-glycolic Acid Composite-Coated CaSiO3 Scaffolds with Multifunctional Properties for Bone Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Mengchao Shi

    2014-01-01

    Full Text Available It is of great importance to prepare multifunctional scaffolds combining good mechanical strength, bioactivity, and drug delivery ability for bone tissue engineering. In this study, nanosized mesoporous bioglass/poly(lactic-co-glycolic acid composite-coated calcium silicate scaffolds, named NMBG-PLGA/CS, were successfully prepared. The morphology and structure of the prepared scaffolds were characterized by scanning electron microscopy and X-ray diffraction. The effects of NMBG on the apatite mineralization activity and mechanical strength of the scaffolds and the attachment, proliferation, and alkaline phosphatase activity of MC3T3 cells as well as drug ibuprofen delivery properties were systematically studied. Compared to pure CS scaffolds and PLGA/CS scaffolds, the prepared NMBG-PLGA/CS scaffolds had greatly improved apatite mineralization activity in simulated body fluids, much higher mechanical property, and supported the attachment of MC3T3 cells and enhanced the cell proliferation and ALP activity. Furthermore, the prepared NMBG-PLGA/CS scaffolds could be used for delivering ibuprofen with a sustained release profile. Our study suggests that the prepared NMBG-PLGA/CS scaffolds have improved physicochemical, biological, and drug-delivery property as compared to conventional CS scaffolds, indicating that the multifunctional property of the prepared scaffolds for the potential application of bone tissue engineering.

  16. Resource Allocation in a Frequency Hopping PCS1900/GSM/DCS1800 Type of Network

    DEFF Research Database (Denmark)

    Nielsen, Thomas Toftegaard; Wigard, Jeroen; Michaelsen, Per-Henrik

    1999-01-01

    Resource allocation in a frequency hopping network is even more problematic than in a traditional network. The combined effect from all serving frequencies has to be considered directly in the allocation process. An algorithm doing this for a PCS1900/GSM/DCS1800 type of network is presented. The ....... A graphical visualisation tool has been developed as well. This tool uses a network quality measure tightly linked to the FER rather than the traditional C/I or BER. Using these statistics an increase in network quality is shown...

  17. Strontium hydroxyapatite/chitosan nanohybrid scaffolds with enhanced osteoinductivity for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Yong [The Education Ministry Key Lab of Resource Chemistry and Shanghai Key Laboratory of Rare Earth Functional Materials, Shanghai Normal University, Shanghai 200234 (China); Xu, Zhengliang [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, 600 Yishan Road, Shanghai 200233 (China); Ke, Qinfei [The Education Ministry Key Lab of Resource Chemistry and Shanghai Key Laboratory of Rare Earth Functional Materials, Shanghai Normal University, Shanghai 200234 (China); Yin, Wenjing; Chen, Yixuan [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, 600 Yishan Road, Shanghai 200233 (China); Zhang, Changqing, E-mail: zhangcq@sjtu.edu.cn [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, 600 Yishan Road, Shanghai 200233 (China); Guo, Yaping, E-mail: ypguo@shnu.edu.cn [The Education Ministry Key Lab of Resource Chemistry and Shanghai Key Laboratory of Rare Earth Functional Materials, Shanghai Normal University, Shanghai 200234 (China)

    2017-03-01

    For the clinical application of bone tissue engineering with the combination of biomaterials and mesenchymal stem cells (MSCs), bone scaffolds should possess excellent biocompatibility and osteoinductivity to accelerate the repair of bone defects. Herein, strontium hydroxyapatite [SrHAP, Ca{sub 10−x}Sr{sub x}(PO{sub 4}){sub 6}(OH){sub 2}]/chitosan (CS) nanohybrid scaffolds were fabricated by a freeze-drying method. The SrHAP nanocrystals with the different x values of 0, 1, 5 and 10 are abbreviated to HAP, Sr1HAP, Sr5HAP and Sr10HAP, respectively. With increasing x values from 0 to 10, the crystal cell volumes and axial lengths of SrHAP become gradually large because of the greater ion radius of Sr{sup 2+} than Ca{sup 2+}, while the crystal sizes of SrHAP decrease from 70.4 nm to 46.7 nm. The SrHAP/CS nanohybrid scaffolds exhibits three-dimensional (3D) interconnected macropores with pore sizes of 100–400 μm, and the SrHAP nanocrystals are uniformly dispersed within the scaffolds. In vitro cell experiments reveal that all the HAP/CS, Sr1HAP/CS, Sr5HAP/CS and Sr10HAP/CS nanohybrid scaffolds possess excellent cytocompatibility with the favorable adhesion, spreading and proliferation of human bone marrow mesenchymal stem cells (hBMSCs). The Sr5HAP nanocrystals in the scaffolds do not affect the adhesion, spreading of hBMSCs, but they contribute remarkably to cell proliferation and osteogenic differentiation. As compared with the HAP/CS nanohybrid scaffold, the released Sr{sup 2+} ions from the SrHAP/CS nanohybrid scaffolds enhance alkaline phosphatase (ALP) activity, extracellular matrix (ECM) mineralization and osteogenic-related COL-1 and ALP expression levels. Especially, the Sr5HAP/CS nanohybrid scaffolds exhibit the best osteoinductivity among four groups because of the synergetic effect between Ca{sup 2+} and Sr{sup 2+} ions. Hence, the Sr5HAP/CS nanohybrid scaffolds with excellent cytocompatibility and osteogenic property have promising application for

  18. Strontium hydroxyapatite/chitosan nanohybrid scaffolds with enhanced osteoinductivity for bone tissue engineering

    International Nuclear Information System (INIS)

    Lei, Yong; Xu, Zhengliang; Ke, Qinfei; Yin, Wenjing; Chen, Yixuan; Zhang, Changqing; Guo, Yaping

    2017-01-01

    For the clinical application of bone tissue engineering with the combination of biomaterials and mesenchymal stem cells (MSCs), bone scaffolds should possess excellent biocompatibility and osteoinductivity to accelerate the repair of bone defects. Herein, strontium hydroxyapatite [SrHAP, Ca 10−x Sr x (PO 4 ) 6 (OH) 2 ]/chitosan (CS) nanohybrid scaffolds were fabricated by a freeze-drying method. The SrHAP nanocrystals with the different x values of 0, 1, 5 and 10 are abbreviated to HAP, Sr1HAP, Sr5HAP and Sr10HAP, respectively. With increasing x values from 0 to 10, the crystal cell volumes and axial lengths of SrHAP become gradually large because of the greater ion radius of Sr 2+ than Ca 2+ , while the crystal sizes of SrHAP decrease from 70.4 nm to 46.7 nm. The SrHAP/CS nanohybrid scaffolds exhibits three-dimensional (3D) interconnected macropores with pore sizes of 100–400 μm, and the SrHAP nanocrystals are uniformly dispersed within the scaffolds. In vitro cell experiments reveal that all the HAP/CS, Sr1HAP/CS, Sr5HAP/CS and Sr10HAP/CS nanohybrid scaffolds possess excellent cytocompatibility with the favorable adhesion, spreading and proliferation of human bone marrow mesenchymal stem cells (hBMSCs). The Sr5HAP nanocrystals in the scaffolds do not affect the adhesion, spreading of hBMSCs, but they contribute remarkably to cell proliferation and osteogenic differentiation. As compared with the HAP/CS nanohybrid scaffold, the released Sr 2+ ions from the SrHAP/CS nanohybrid scaffolds enhance alkaline phosphatase (ALP) activity, extracellular matrix (ECM) mineralization and osteogenic-related COL-1 and ALP expression levels. Especially, the Sr5HAP/CS nanohybrid scaffolds exhibit the best osteoinductivity among four groups because of the synergetic effect between Ca 2+ and Sr 2+ ions. Hence, the Sr5HAP/CS nanohybrid scaffolds with excellent cytocompatibility and osteogenic property have promising application for bone tissue engineering. - Highlights: • We

  19. Improving PEEK bioactivity for craniofacial reconstruction using a 3D printed scaffold embedded with mesenchymal stem cells.

    Science.gov (United States)

    Roskies, Michael; Jordan, Jack O; Fang, Dongdong; Abdallah, Mohamed-Nur; Hier, Michael P; Mlynarek, Alex; Tamimi, Faleh; Tran, Simon D

    2016-07-01

    Polyetheretherketone (PEEK) is a bioinert thermoplastic that has been investigated for its potential use in craniofacial reconstruction; however, its use in clinical practice is limited by a poor integration with adjacent bone upon implantation. To improve the bone-implant interface, two strategies have been employed: to modify its surface or to impregnate PEEK with bioactive materials. This study attempts to combine and improve upon the two approaches by modifying the internal structure into a trabecular network and to impregnate PEEK with mesenchymal stem cells. Furthermore, we compare the newly designed PEEK scaffolds' interactions with both bone-derived (BMSC) and adipose (ADSC) stem cells. Customized PEEK scaffolds were designed to incorporate a trabecular microstructure using a computer-aided design program and then printed via selective laser sintering (SLS), a 3D-printing process with exceptional accuracy. The scaffold structure was evaluated using microCT. Scanning electron microscopy (SEM) was used to evaluate scaffold morphology with and without mesenchymal stem cells (MSCs). Adipose and bone marrow mesenchymal cells were isolated from rats and cultured on scaffolds. Cell proliferation and differentiation were assessed using alamarBlue and alkaline phosphatase assays, respectively. Cell morphology after one week of co-culturing cells with PEEK scaffolds was evaluated using SEM. SLS 3D printing fabricated scaffolds with a porosity of 36.38% ± 6.66 and density of 1.309 g/cm(2). Cell morphology resembled viable fibroblasts attaching to the surface and micropores of the scaffold. PEEK scaffolds maintained the viability of both ADSCs and BMSCs; however, ADSCs demonstrated higher osteodifferentiation than BMSCs (p PEEK scaffolds that maintain the viability of adipose and bone marrow-derived MSCs and induce the osteodifferentiation of the adipose-derived MSCs. The combination of 3D printed PEEK scaffolds with MSCs could overcome some of the limitations

  20. Solution of the effective Hamiltonian of impurity hopping between two sites in a metal

    Science.gov (United States)

    Ye, Jinwu

    1997-07-01

    We analyze in detail all the possible fixed points of the effective Hamiltonian of a nonmagnetic impurity hopping between two sites in a metal obtained by Moustakas and Fisher (MF). We find a line of non-Fermi liquid fixed points which continuously interpolates between the two-channel Kondo fixed point (2CK) and the one-channel, two-impurity Kondo (2IK) fixed point. There is one relevant direction with scaling dimension 12 and one leading irrelevant operator with dimension 32. There is also one marginal operator in the spin sector moving along this line. The marginal operator, combined with the leading irrelevant operator, will generate the relevant operator. For the general position on this line, the leading low-temperature exponents of the specific heat, the hopping susceptibility and the electron conductivity Cimp,χhimp,σ(T) are the same as those of the 2CK, but the finite-size spectrum depends on the position on the line. No universal ratios can be formed from the amplitudes of the three quantities except at the 2CK point on this line where the universal ratios can be formed. At the 2IK point on this line, σ(T)~2σu(1+aT3/2), no universal ratio can be formed either. The additional non-Fermi-liquid fixed point found by MF has the same symmetry as the 2IK, it has two relevant directions with scaling dimension 12, and is therefore also unstable. The leading low-temperature behaviors are Cimp~T,χhimp~lnT,σ(T)~2σu(1+aT3/2) no universal ratios can be formed. The system is shown to flow to a line of Fermi-liquid fixed points which continuously interpolates between the noninteracting fixed point and the two-channel spin-flavor Kondo fixed point discussed by the author previously. The effect of particle-hole symmetry breaking is discussed. The effective Hamiltonian in the external magnetic field is analyzed. The scaling functions for the physical measurable quantities are derived in the different regimes; their predictions for the experiments are given. Finally

  1. Nano scaffolds and stem cell therapy in liver tissue engineering

    Science.gov (United States)

    Montaser, Laila M.; Fawzy, Sherin M.

    2015-08-01

    Tissue engineering and regenerative medicine have been constantly developing of late due to the major progress in cell and organ transplantation, as well as advances in materials science and engineering. Although stem cells hold great potential for the treatment of many injuries and degenerative diseases, several obstacles must be overcome before their therapeutic application can be realized. These include the development of advanced techniques to understand and control functions of micro environmental signals and novel methods to track and guide transplanted stem cells. A major complication encountered with stem cell therapies has been the failure of injected cells to engraft to target tissues. The application of nanotechnology to stem cell biology would be able to address those challenges. Combinations of stem cell therapy and nanotechnology in tissue engineering and regenerative medicine have achieved significant advances. These combinations allow nanotechnology to engineer scaffolds with various features to control stem cell fate decisions. Fabrication of Nano fiber cell scaffolds onto which stem cells can adhere and spread, forming a niche-like microenvironment which can guide stem cells to proceed to heal damaged tissues. In this paper, current and emergent approach based on stem cells in the field of liver tissue engineering is presented for specific application. The combination of stem cells and tissue engineering opens new perspectives in tissue regeneration for stem cell therapy because of the potential to control stem cell behavior with the physical and chemical characteristics of the engineered scaffold environment.

  2. Child-Mediated Stroke Communication: findings from Hip Hop Stroke.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Noble, James; Gerin, William

    2012-01-01

    Low thrombolysis rates for acute ischemic stroke are linked to delays in seeking immediate treatment due to low public stroke awareness. We aimed to assess whether "Child-Mediated Stroke Communication" could improve stroke literacy of parents of children enrolled in a school-based stroke literacy program called Hip Hop Stroke. Parents of children aged 9 to 12 years from 2 public schools in Harlem, New York City, were recruited to participate in stroke literacy questionnaires before and after their child's participation in Hip Hop Stroke, a novel Child-Mediated Stroke Communication intervention delivered in school auditoriums. Parental recall of stroke information communicated through their child was assessed 1-week after the intervention. Fifth and sixth grade students (n=182) were enrolled into Hip Hop Stroke. One hundred two parents were approached in person to participate; 75 opted to participate and 71 completed both the pretest and post-test (74% response rate and 95% retention rate). Parental stroke literacy improved after the program; before the program, 3 parents of 75 (3.9%) were able to identify the 5 cardinal stroke symptoms, distracting symptom (chest pains), and had an urgent action plan (calling 911) compared with 21 of 71 parents (29.6%) postintervention (P<0.001). The FAST mnemonic was known by 2 (2.7%) of participants before the program versus 29 (41%) after program completion (P<0.001). Knowledge of stroke signs and symptoms remains low among residents of this high-risk population. The use of Child-Mediated Stroke Communication suggests that school children aged 9 to 12 years may be effective conduits of critical stroke knowledge to their parents.

  3. Fabrication of a Highly Aligned Neural Scaffold via a Table Top Stereolithography 3D Printing and Electrospinning.

    Science.gov (United States)

    Lee, Se-Jun; Nowicki, Margaret; Harris, Brent; Zhang, Lijie Grace

    2017-06-01

    Three-dimensional (3D) bioprinting is a rapidly emerging technique in the field of tissue engineering to fabricate extremely intricate and complex biomimetic scaffolds in the range of micrometers. Such customized 3D printed constructs can be used for the regeneration of complex tissues such as cartilage, vessels, and nerves. However, the 3D printing techniques often offer limited control over the resolution and compromised mechanical properties due to short selection of printable inks. To address these limitations, we combined stereolithography and electrospinning techniques to fabricate a novel 3D biomimetic neural scaffold with a tunable porous structure and embedded aligned fibers. By employing two different types of biofabrication methods, we successfully utilized both synthetic and natural materials with varying chemical composition as bioink to enhance biocompatibilities and mechanical properties of the scaffold. The resulting microfibers composed of polycaprolactone (PCL) polymer and PCL mixed with gelatin were embedded in 3D printed hydrogel scaffold. Our results showed that 3D printed scaffolds with electrospun fibers significantly improve neural stem cell adhesion when compared to those without the fibers. Furthermore, 3D scaffolds embedded with aligned fibers showed an enhancement in cell proliferation relative to bare control scaffolds. More importantly, confocal microscopy images illustrated that the scaffold with PCL/gelatin fibers greatly increased the average neurite length and directed neurite extension of primary cortical neurons along the fiber. The results of this study demonstrate the potential to create unique 3D neural tissue constructs by combining 3D bioprinting and electrospinning techniques.

  4. Anisotropy of hopping conductivity in TIGaSe2, crystal

    International Nuclear Information System (INIS)

    Nadjafov, A.I.; Sardarli, R.M.; Samedov, O. A.; Abdullayev, A.P.; Zeynalova, E.A.; Jabbarov, J.H.

    2005-01-01

    Full Text: The temperature dependences of electrical conductivity of a chained semiconductor crystal TIGaTe 2 in a direction of chains and perpendicularly have been investigated. It was established that in a constant electrical field in both crystallographic directions took place hopping conductivity with variable length of a jump on located near Fermi level. The energy activation of conductivity has been determined. It was appreciated density of a condition in a vicinity of a Fermi level, their disorder, radius of localization, average distance of jumps of carriers

  5. Semiclassical quantization of nonadiabatic systems with hopping periodic orbits

    International Nuclear Information System (INIS)

    Fujii, Mikiya; Yamashita, Koichi

    2015-01-01

    We present a semiclassical quantization condition, i.e., quantum–classical correspondence, for steady states of nonadiabatic systems consisting of fast and slow degrees of freedom (DOFs) by extending Gutzwiller’s trace formula to a nonadiabatic form. The quantum–classical correspondence indicates that a set of primitive hopping periodic orbits, which are invariant under time evolution in the phase space of the slow DOF, should be quantized. The semiclassical quantization is then applied to a simple nonadiabatic model and accurately reproduces exact quantum energy levels. In addition to the semiclassical quantization condition, we also discuss chaotic dynamics involved in the classical limit of nonadiabatic dynamics

  6. Electron hopping and optic phonons in Eu3S4

    International Nuclear Information System (INIS)

    Guentherodt, G.

    1981-01-01

    Raman scattering on single crystals of Eu 3 S 4 does not show the allowed q=o phonon modes in the cubic phase and exhibits no new modes in the distorted low temperature phase (T 2- ions. This mode does not show any anomaly near the charge order -disorder phase transition Tsub(t)=186 K. Temperature tunable spin fluctuations associated with the temperature activated Eu 2+ → Eu 3+ electron hopping are detected in the scattering intensity, superimposed on the usual thermal spin disorder. (author)

  7. High-Speed On-Board Data Processing for Science Instruments: HOPS

    Science.gov (United States)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  8. Improved resolution of 3D printed scaffolds by shrinking.

    Science.gov (United States)

    Chia, Helena N; Wu, Benjamin M

    2015-10-01

    Three-dimensional printing (3DP) uses inkjet printheads to selectively deposit liquid binder to adjoin powder particles in a layer-by-layer fashion to create a computer-modeled 3D object. Two general approaches for 3DP have been described for biomedical applications (direct and indirect 3DP). The two approaches offer competing advantages, and both are limited by print resolution. This study describes a materials processing strategy to enhance 3DP resolution by controlled shrinking net-shape scaffolds. Briefly, porogen preforms are printed and infused with the desired monomer or polymer solution. After solidification or polymerization, the porogen is leached and the polymer is allowed to shrink by controlled drying. Heat treatment is performed to retain the dimensions against swelling forces. The main objective of this study is to determine the effects of polymer content and post-processing on dimension, microstructure, and thermomechanical properties of the scaffold. For polyethylene glycol diacrylate (PEG-DA), reducing polymer content corresponded with greater shrinkage with maximum shrinkage of ∼80 vol% at 20% vol% PEG-DA. The secondary heat treatment retains the microarchitecture and new dimensions of the scaffolds, even when the heat-treated scaffolds are immersed into water. To demonstrate shrinkage predictability, 3D components with interlocking positive and negative features were printed, processed, and fitted. This material processing strategy provides an alternative method to enhance the resolution of 3D scaffolds, for a wide range of polymers, without optimizing the binder-powder interaction physics to print each material combination. © 2014 Wiley Periodicals, Inc.

  9. * Hierarchically Structured Electrospun Scaffolds with Chemically Conjugated Growth Factor for Ligament Tissue Engineering.

    Science.gov (United States)

    Pauly, Hannah M; Sathy, Binulal N; Olvera, Dinorath; McCarthy, Helen O; Kelly, Daniel J; Popat, Ketul C; Dunne, Nicholas J; Haut Donahue, Tammy Lynn

    2017-08-01

    The anterior cruciate ligament (ACL) of the knee is vital for proper joint function and is commonly ruptured during sports injuries or car accidents. Due to a lack of intrinsic healing capacity and drawbacks with allografts and autografts, there is a need for a tissue-engineered ACL replacement. Our group has previously used aligned sheets of electrospun polycaprolactone nanofibers to develop solid cylindrical bundles of longitudinally aligned nanofibers. We have shown that these nanofiber bundles support cell proliferation and elongation and the hierarchical structure and material properties are similar to the native human ACL. It is possible to combine multiple nanofiber bundles to create a scaffold that attempts to mimic the macroscale structure of the ACL. The goal of this work was to develop a hierarchical bioactive scaffold for ligament tissue engineering using connective tissue growth factor (CTGF)-conjugated nanofiber bundles and evaluate the behavior of mesenchymal stem cells (MSCs) on these scaffolds in vitro and in vivo. CTGF was immobilized onto the surface of individual nanofiber bundles or scaffolds consisting of multiple nanofiber bundles. The conjugation efficiency and the release of conjugated CTGF were assessed using X-ray photoelectron spectroscopy, assays, and immunofluorescence staining. Scaffolds were seeded with MSCs and maintained in vitro for 7 days (individual nanofiber bundles), in vitro for 21 days (scaled-up scaffolds of 20 nanofiber bundles), or in vivo for 6 weeks (small scaffolds of 4 nanofiber bundles), and ligament-specific tissue formation was assessed in comparison to non-CTGF-conjugated control scaffolds. Results showed that CTGF conjugation encouraged cell proliferation and ligament-specific tissue formation in vitro and in vivo. The results suggest that hierarchical electrospun nanofiber bundles conjugated with CTGF are a scalable and bioactive scaffold for ACL tissue engineering.

  10. 3D-printed bioceramic scaffolds with antibacterial and osteogenic activity.

    Science.gov (United States)

    Zhang, Yongliang; Zhai, Dong; Xu, Mengchi; Yao, Qingqiang; Zhu, Huiying; Chang, Jiang; Wu, Chengtie

    2017-06-20

    Bacterial infection poses a significant risk with the wide application of bone graft materials. Designing bone grafts with good antibacterial performance and excellent bone-forming activity is of particular significance for bone tissue engineering. In our study, a 3D printing method was used to prepare β-tricalcium phosphate (β-TCP) bioceramic scaffolds. Silver (Ag) nanoparticles were uniformly dispersed on graphene oxide (GO) to form a homogeneous nanocomposite (named Ag@GO) with different Ag-to-graphene oxide mass ratios, with this being synthesized via the liquid chemical reduction approach. Ag@GO nanocomposites were successfully modified on the β-TCP scaffolds by a simple soaking method to achieve bifunctional biomaterials with antibacterial and osteogenic activity. The prepared scaffolds possessed a connected network with triangle pore morphology and the surfaces of the β-TCP scaffolds were uniformly modified by the Ag@GO nanocomposite layers. The Ag content in the scaffolds was controlled by changing the coating times and concentration of the Ag@GO nanocomposites. The antibacterial activity of the scaffolds was assessed with Gram-negative bacteria (Escherichia coli, E. coli). The results demonstrated that the scaffolds with Ag@GO nanocomposites presented excellent antibacterial activity. In addition, the scaffolds coated with Ag@GO nanocomposites conspicuously accelerated the osteogenic differentiation of rabbit bone marrow stromal cells by improving their alkaline phosphatase activity and bone-related gene expression (osteopontin, runt-related transcription factor 2, osteocalcin and bone sialoprotein). This study demonstrates that bifunctional scaffolds with a combination of antibacterial and osteogenic activity can be achieved for the reconstruction of large-bone defects while preventing or treating infections.

  11. Biofunctional Ionic-Doped Calcium Phosphates: Silk Fibroin Composites for Bone Tissue Engineering Scaffolding.

    Science.gov (United States)

    Pina, S; Canadas, R F; Jiménez, G; Perán, M; Marchal, J A; Reis, R L; Oliveira, J M

    2017-01-01

    The treatment and regeneration of bone defects caused by traumatism or diseases have not been completely addressed by current therapies. Lately, advanced tools and technologies have been successfully developed for bone tissue regeneration. Functional scaffolding materials such as biopolymers and bioresorbable fillers have gained particular attention, owing to their ability to promote cell adhesion, proliferation, and extracellular matrix production, which promote new bone growth. Here, we present novel biofunctional scaffolds for bone regeneration composed of silk fibroin (SF) and β-tricalcium phosphate (β-TCP) and incorporating Sr, Zn, and Mn, which were successfully developed using salt-leaching followed by a freeze-drying technique. The scaffolds presented a suitable pore size, porosity, and high interconnectivity, adequate for promoting cell attachment and proliferation. The degradation behavior and compressive mechanical strengths showed that SF/ionic-doped TCP scaffolds exhibit improved characteristics for bone tissue engineering when compared with SF scaffolds alone. The in vitro bioactivity assays using a simulated body fluid showed the growth of an apatite layer. Furthermore, in vitro assays using human adipose-derived stem cells presented different effects on cell proliferation/differentiation when varying the doping agents in the biofunctional scaffolds. The incorporation of Zn into the scaffolds led to improved proliferation, while the Sr- and Mn-doped scaffolds presented higher osteogenic potential as demonstrated by DNA quantification and alkaline phosphatase activity. The combination of Sr with Zn led to an influence on cell proliferation and osteogenesis when compared with single ions. Our results indicate that biofunctional ionic-doped composite scaffolds are good candidates for further in vivo studies on bone tissue regeneration. © 2017 S. Karger AG, Basel.

  12. Silk scaffolds in bone tissue engineering: An overview.

    Science.gov (United States)

    Bhattacharjee, Promita; Kundu, Banani; Naskar, Deboki; Kim, Hae-Won; Maiti, Tapas K; Bhattacharya, Debasis; Kundu, Subhas C

    2017-11-01

    applications as cell scaffolding matrices to micro-nano carriers for delivering bone growth factors and therapeutic molecules to diseased or damaged sites to facilitate bone regeneration, is emphasized here. The review rationalizes that the choice of silk protein as a biomaterial is not only because of its natural polymeric nature, mechanical robustness, flexibility and wide range of cell compatibility but also because of its ability to template the growth of hydroxyapatite, the chief inorganic component of bone mineral matrix, resulting in improved osteointegration. The discussion extends to the role of inorganic ions such as Si and Ca as matrix components in combination with silk to influence bone regrowth. The effect of ions or growth factor-loaded vehicle incorporation into regenerative matrix, nanotopography is also considered. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  13. Antimicrobial Cu-bearing stainless steel scaffolds

    International Nuclear Information System (INIS)

    Wang, Qiang; Ren, Ling; Li, Xiaopeng; Zhang, Shuyuan; Sercombe, Timothy B.; Yang, Ke

    2016-01-01

    Copper-bearing stainless steel scaffolds with two different structures (Body Centered Cubic and Gyroid labyrinth) at two solid fractions (25% and 40%) were fabricated from both 316L powder and a mixture of 316L and elemental Cu powder using selective laser melting, and relative 316L scaffolds were served as control group. After processing, the antimicrobial testing demonstrated that the 316L-Cu scaffolds presented excellent antimicrobial activity against Escherichia coli and Staphylococcus aureus, and the cell viability assay indicated that there was no cytotoxic effect of 316L-Cu scaffolds on rat marrow mesenchymal stem cells. As such, these have the potential to reduce implant-associated infections. The Cu was also found to homogeneously distribute within the microstructure by scanning electronic microcopy. The addition of Cu would not significantly affect its strength and stiffness compared to 316L scaffold, and the stiffness of all the scaffolds (3-20GPa) is similar to that of bone and much less than that of bulk stainless steel. Consequently, fabrication of such low stiffness porous structures, especially coupled with the addition of antimicrobial Cu, may provide a new direction for medical stainless steels. - Highlights: • 316L-Cu scaffolds were fabricated by using selective laser melting (SLM). • 316L-Cu scaffolds showed satisfied antimicrobial activities. • 316L-Cu scaffolds have no cytotoxic effect on normal cells. • Other properties of 316L-Cu scaffolds were similar to 316L scaffolds. • 316L-Cu scaffolds have the potential to be used in orthopedic applications.

  14. Antimicrobial Cu-bearing stainless steel scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Qiang, E-mail: mfqwang@163.com [School of Stomatology, China Medical University, Shenyang 110002 (China); Ren, Ling [Institute of Metal Research, Chinese Academy of Sciences (China); Li, Xiaopeng [School of Mechanical and Chemical Engineering, The University of Western Australia (Australia); Zhang, Shuyuan [Institute of Metal Research, Chinese Academy of Sciences (China); Sercombe, Timothy B., E-mail: tim.sercombe@uwa.edu.au [School of Mechanical and Chemical Engineering, The University of Western Australia (Australia); Yang, Ke, E-mail: kyang@imr.ac.cn [Institute of Metal Research, Chinese Academy of Sciences (China)

    2016-11-01

    Copper-bearing stainless steel scaffolds with two different structures (Body Centered Cubic and Gyroid labyrinth) at two solid fractions (25% and 40%) were fabricated from both 316L powder and a mixture of 316L and elemental Cu powder using selective laser melting, and relative 316L scaffolds were served as control group. After processing, the antimicrobial testing demonstrated that the 316L-Cu scaffolds presented excellent antimicrobial activity against Escherichia coli and Staphylococcus aureus, and the cell viability assay indicated that there was no cytotoxic effect of 316L-Cu scaffolds on rat marrow mesenchymal stem cells. As such, these have the potential to reduce implant-associated infections. The Cu was also found to homogeneously distribute within the microstructure by scanning electronic microcopy. The addition of Cu would not significantly affect its strength and stiffness compared to 316L scaffold, and the stiffness of all the scaffolds (3-20GPa) is similar to that of bone and much less than that of bulk stainless steel. Consequently, fabrication of such low stiffness porous structures, especially coupled with the addition of antimicrobial Cu, may provide a new direction for medical stainless steels. - Highlights: • 316L-Cu scaffolds were fabricated by using selective laser melting (SLM). • 316L-Cu scaffolds showed satisfied antimicrobial activities. • 316L-Cu scaffolds have no cytotoxic effect on normal cells. • Other properties of 316L-Cu scaffolds were similar to 316L scaffolds. • 316L-Cu scaffolds have the potential to be used in orthopedic applications.

  15. Enhanced bioactive scaffolds for bone tissue regeneration

    Science.gov (United States)

    Karnik, Sonali

    Bone injuries are commonly termed as fractures and they vary in their severity and causes. If the fracture is severe and there is loss of bone, implant surgery is prescribed. The response to the implant depends on the patient's physiology and implant material. Sometimes, the compromised physiology and undesired implant reactions lead to post-surgical complications. [4, 5, 20, 28] Efforts have been directed towards the development of efficient implant materials to tackle the problem of post-surgical implant failure. [ 15, 19, 24, 28, 32]. The field of tissue engineering and regenerative medicine involves the use of cells to form a new tissue on bio-absorbable or inert scaffolds. [2, 32] One of the applications of this field is to regenerate the damaged or lost bone by using stem cells or osteoprogenitor cells on scaffolds that can integrate in the host tissue without causing any harmful side effects. [2, 32] A variety of natural, synthetic materials and their combinations have been used to regenerate the damaged bone tissue. [2, 19, 30, 32, 43]. Growth factors have been supplied to progenitor cells to trigger a sequence of metabolic pathways leading to cellular proliferation, differentiation and to enhance their functionality. [56, 57] The challenge persists to supply these proteins, in the range of nano or even picograms, and in a sustained fashion over a period of time. A delivery system has yet to be developed that would mimic the body's inherent mechanism of delivering the growth factor molecules in the required amount to the target organ or tissue. Titanium is the most preferred metal for orthopedic and orthodontic implants. [28, 46, 48] Even though it has better osteogenic properties as compared to other metals and alloys, it still has drawbacks like poor integration into the surrounding host tissue leading to bone resorption and implant failure. [20, 28, 35] It also faces the problem of postsurgical infections that contributes to the implant failure. [26, 37

  16. Effects of a foot placement constraint on use of motor equivalence during human hopping.

    Directory of Open Access Journals (Sweden)

    Arick G Auyang

    Full Text Available Humans can robustly locomote over complex terrains even while simultaneously attending to other tasks such as accurate foot placement on the ground. We investigated whether subjects would exploit motor redundancy across the joints of the leg to stabilize overall limb kinematics when presented with a hopping task that constrained foot placement position. Subjects hopped in place on one leg (2.2 Hz while having to place their foot into one of three target sizes upon landing (0.250, 0.063, 0.010 m(2. As takeoff and landing angles are critical to this task performance, we hypothesized smaller target sizes would increase the need to stabilize (i.e., make more consistent the leg orientation through motor equivalent combinations of segment angles. As it was not critical to the targeting task, we hypothesized no changes for leg length stabilization across target size. With smaller target sizes, we saw total segment angle variance increase due to greater signal-dependent noise associated with an increased activation of leg extensor muscles (medial and lateral gastrocnemius, vastus medialis, vastus lateralis and rectus femoris. At smaller target sizes, more segment angle variance was aligned to kinematic deviations with the goal of maintaining leg orientation trajectory. We also observed a decrease in the variance structure for stabilizing leg length at the smallest target conditions. This trade-off effect is explained by the nearly orthogonal relationship between the two goal-equivalent manifolds for leg length vs. leg orientation stabilization. Our results suggest humans increasingly rely on kinematic redundancy in their legs to achieve robust, consistent locomotion when faced with novel conditions that constrain performance requirements. These principles may generalize to other human locomotor gaits and provide important insights into the control of the legs during human walking and running.

  17. Mesenchymal stem cell cultivation in electrospun scaffolds: mechanistic modeling for tissue engineering.

    Science.gov (United States)

    Paim, Ágata; Tessaro, Isabel C; Cardozo, Nilo S M; Pranke, Patricia

    2018-03-05

    Tissue engineering is a multidisciplinary field of research in which the cells, biomaterials, and processes can be optimized to develop a tissue substitute. Three-dimensional (3D) architectural features from electrospun scaffolds, such as porosity, tortuosity, fiber diameter, pore size, and interconnectivity have a great impact on cell behavior. Regarding tissue development in vitro, culture conditions such as pH, osmolality, temperature, nutrient, and metabolite concentrations dictate cell viability inside the constructs. The effect of different electrospun scaffold properties, bioreactor designs, mesenchymal stem cell culture parameters, and seeding techniques on cell behavior can be studied individually or combined with phenomenological modeling techniques. This work reviews the main culture and scaffold factors that affect tissue development in vitro regarding the culture of cells inside 3D matrices. The mathematical modeling of the relationship between these factors and cell behavior inside 3D constructs has also been critically reviewed, focusing on mesenchymal stem cell culture in electrospun scaffolds.

  18. Cartilage constructs from human cord blood stem cells seeded in structurally-graded polycaprolactone scaffolds

    DEFF Research Database (Denmark)

    Munir, Samir; Koch, Thomas Gadegaard; Foldager, Casper Bindzus

    Cartilage is an avascular tissue incapable of regeneration. Current treatment modalities for joint cartilage injuries are inefficient in regenerating hyaline cartilage and often leads to the formation of fibrocartilage with undesirable mechanical properties. There is an increasing interest...... in investigating alternative treatments such as tissue engineering, which combines stem cells with scaffolds to produce cartilage in vitro for subsequent transplant. Previous studies have shown that chondrogenesis of induced stem cells is influenced by various growth factors, oxygen tensions and mechanical...... this novel SGS-PCL scaffold supports the chondrogenic differentiation of MLPCs will be interesting to evaluate since this scaffold possesses mechanical properties absent from other “soft” scaffolds currently being investigated for cartilage regeneration and implantation....

  19. Platelet lysate embedded scaffolds for skin regeneration.

    Science.gov (United States)

    Sandri, Giuseppina; Bonferoni, Maria Cristina; Rossi, Silvia; Ferrari, Franca; Mori, Michela; Cervio, Marila; Riva, Federica; Liakos, Ioannis; Athanassiou, Athanassia; Saporito, Francesca; Marini, Lara; Caramella, Carla

    2015-04-01

    The work presents the development of acellular scaffolds extemporaneously embedded with platelet lysate (PL), as an innovative approach in the field of tissue regeneration/reparation. PL embedded scaffolds should have a tridimensional architecture to support cell migration and growth, in order to restore skin integrity. For this reason, chondroitin sulfate (CS) was associated with sodium alginate (SA) to prepare highly porous systems. The developed scaffolds were characterized for chemical stability to γ-radiation, morphology, hydration and mechanical properties. Moreover, the capability of fibroblasts and endothelial cells to populate the scaffold was evaluated by means of proliferation test 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and confocal laser scanning microscopy study. The scaffolds, not altered by sterilization, were characterized by limited swelling and high flexibility, by foam-like structure with bubbles that formed a high surface area and irregular texture suitable for cell adhesion. Cell growth and scaffold population were evident on the bubble surface, where the cells appeared anchored to the scaffold structure. Scaffold network based on CS and SA demonstrated to be an effective support to enhance and to allow fibroblasts and endothelial cells (human umbilical vein endothelial cells, HUVEC) adhesion and proliferation. In particular, it could be hypothesized that cell adhesion was facilitated by the synergic effect of PL and CS. Although further in vivo evaluation is needed, on the basis of in vitro results, PL embedded scaffolds seem promising systems for skin wound healing.

  20. Effect of storage on the brewing properties of tropical hop substitutes

    African Journals Online (AJOL)

    SERVER

    2007-06-18

    Jun 18, 2007 ... Conclusively, tropical hop substitutes stored at 5 ± 1oC to 27 ± 1oC can still be used for brewing even after three to six months storage. .... which is associated with the oxidative depreciation of the soft resins to hard resins ... Changes in the soft resin levels of hop substitutes with storage. Soft resin levels (%).

  1. Hegemony, Hope, and the Harlem Renaissance: Taking Hip Hop Culture Seriously

    Science.gov (United States)

    Price, Robert J., Jr.

    2005-01-01

    Adult education instructors and administrators, who typically are not members of the hip hop generation, often have little knowledge and understanding of rap music (also known as gangsta rap) and hip hop culture, and consequently do not take the black popular cultural phenomenon seriously as it relates to adult education. Adult educators,…

  2. Empowerment in Context: Lessons from Hip-Hop Culture for Social Work Practice

    Science.gov (United States)

    Travis, Raphael, Jr.; Deepak, Anne

    2011-01-01

    Hip-hop culture can be used as a conduit to enhanced cultural competence and practice skills through the individual and community empowerment framework. This framework is introduced as a tool for direct practice that allows social workers to understand the competing messages within hip-hop culture and how they may impact youths by promoting or…

  3. Teaching Controversal Topics in Contemporary German Culture through Hip-Hop

    Science.gov (United States)

    Putnam, Michael

    2006-01-01

    This article discusses the rich cultural resources embedded with German hip-hop music and its potential impact on the foreign language classroom. In particular, this article suggests methods and materials for integrating German hip-hop music in the discussion of recent controversial cultural events and attitudes in German after the "Wende."

  4. Hop/STI1 modulates retinal proliferation and cell death independent of PrPC

    International Nuclear Information System (INIS)

    Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.; Linden, Rafael; Chiarini, Luciana B.

    2007-01-01

    Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP C ). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP C dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 (α-STI1) blocked both ganglion cell and NBL cell death independent of PrP C . cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while α-STI1 increased proliferation in the developing retina, both independent of PrP C . We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP C

  5. Hip-Hop Culture in College Students' Lives: Elements, Embodiment, and Higher Edutainment

    Science.gov (United States)

    Petchauer, Emery

    2011-01-01

    College campuses have become rich sites of hip-hop culture and knowledge production. Despite the attention that campus personnel and researchers have paid to student life, the field of higher education has often misunderstood the ways that hip-hop culture exists in college students' lives. Based upon in-depth interviews, observations of…

  6. Hip-Hop's Influence on the Identity Development of Black Female College Students: A Literature Review

    Science.gov (United States)

    Henry, Wilma J.; West, Nicole M.; Jackson, Andrea

    2010-01-01

    This article explores unique issues regarding the effects of hip-hop culture on the identity development of young Black female college students. Through the lenses of womanist and Black feminist perspectives, the intersecting impact of race and gender are reviewed within the context of the competing influences of hip-hop on Black female identity.…

  7. Polish Hip Hop as a Form of Multiliteracies and Situated Learning

    Science.gov (United States)

    Torrence, Michael L.

    2009-01-01

    The purpose of this ethnographic study was to examine Hip Hop in Poland through the lens of multiliteracies and situated learning. This analysis is concerned with the transmission of Hip Hop to and within Wroclaw, Poland, and its acculturation and assimilation in Wroclaw, Poland. Further, this study seeks to illustrate how professional Polish Hip…

  8. Simple Models for the Performance Evaluation of a Class of Two-Hop Relay Protocols

    NARCIS (Netherlands)

    Al Hanbali, Ahmad; Kherani, Arzad A.; Nain, Philippe

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  9. Simple models for the performance evaluation of a class of two-hop relay protocols

    NARCIS (Netherlands)

    Al Hanbali, A.; Kherani, A.A.; Nain, P.; Akyildiz, I.F.; Sivakumar, R.; Ekici, E.; Cavalcante de Oliveira, J.; McNair, J.

    2007-01-01

    We evaluate the performance of a class of two-hop relay protocols for mobile ad hoc networks. The interest is on the multicopy two-hop relay (MTR) protocol, where the source may generate multiple copies of a packet and use relay nodes to deliver the packet (or a copy) to its destination, and on the

  10. Hip-Hop, Social Justice, and Environmental Education: Toward a Critical Ecological Literacy

    Science.gov (United States)

    Cermak, Michael J.

    2012-01-01

    This essay describes an educational initiative that used environmentally themed (green) hip-hop to stimulate learning in an environmental science classroom. Students were then challenged to compose their own green hip-hop and their lyrics demonstrated skills that have thematic consistency around what is called a Critical Ecological Literacy (CEL).…

  11. Muziki wa Hip Hop na Haki Za Kijamii: Dhima, Changamoto na ...

    African Journals Online (AJOL)

    Ni dhahiri kuwa haki za kijamii zinaweza kuwasilishwa kwa jamii pana kupitia sanaa ya hip hop. Makala haya basi, yanabainisha dhima na mchango wa muziki wa hip hop katika masuala ya haki za kijamii, yanafafanua changamoto za muziki huu katika kuwasilisha haki za kijamii na kutoa mapendekezo kwa makundi ...

  12. Hop acid-rich spent craft brewer's yeast modulates gut bacterial growth

    Science.gov (United States)

    Alpha and beta hop acids (humulones and lupulones) from Humulus lupulus are inhibitors of Gram-positive organisms and important natural antibiotics for beer fermentation and carbohydrate feed stocks for biofuel production. Recent observations (Bryant and Cohen) of high levels of hop acids in spent ...

  13. Connectivity model for Inter-working multi-hop wireless networks

    CSIR Research Space (South Africa)

    Salami, O

    2009-08-01

    Full Text Available pairs in inter-working multi-hop wireless networks can be evaluated based on the availability of radio links and communication routes. This paper presents an analytical study of the link and route availability in inter-working multi-hop wireless networks....

  14. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    Science.gov (United States)

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  15. QTL analysis of resistance to powdery mildew in Hop (Humulus lupulus L.)

    Science.gov (United States)

    Powdery mildew infection of hop results in significant production losses on an annual basis by reducing yields as well as cone quality. One of the best means to increase yield and quality is the production of resistant hop lines. Breeding for resistance can be significantly improved and accelerate...

  16. Membrane-bound ATPase contributes to hop resistance of Lactobacillus brevis

    NARCIS (Netherlands)

    Sakamoto, K; van Veen, HW; Saito, H; Kobayashi, H; Konings, WN

    2002-01-01

    The activity of the membrane-bound H+-ATPase of the beer spoilage bacterium Lactobacillus brevis ABBC45 increased upon adaptation to bacteriostatic hop compounds. The ATPase activity was optimal around pH 5.6 and increased up to fourfold when L. brevis was exposed to 666 muM hop compounds. The

  17. Trends in German Hip Hop Music and Its Usefulness for the Classroom

    Science.gov (United States)

    Schmidt, Johannes

    2008-01-01

    German hip hop music has proved productive, especially since 2000 when rap in Germany experienced something like a first crisis. As a response, German hip hop artists and record labels have ventured off in several different directions including other musical genres, different topics, and new approaches to German rap. This article discusses the…

  18. Hip-Hop and a Hybrid Text in a Postsecondary English Class

    Science.gov (United States)

    Sanchez, Deborah M.

    2010-01-01

    This study explores the epistemology present in hip-hop music and its reflection in the writing of one African American student in a postsecondary transitional English class. An integration of hip-hop and academic literacy practices in the student's essay challenges the supremacy of a "standard" academic English and deficit perspectives about…

  19. We Got Next: Hip-Hop Pedagogy and the Next Generation of Democratic Education

    Science.gov (United States)

    Dando, Michael

    2017-01-01

    Using daily experiences and existing identities as the subject matter, a hip-hop-centered class encourages students to develop a critical lens so that they can "envision a social order which supports their full humanity" (Shor, 1987, p. 48) and embraces the idea that hip-hop culture provides context for students to develop critical…

  20. Supporting Communication and Argumentation in Urban Science Education: Hip-Hop, the Battle, and the Cypher

    Science.gov (United States)

    Emdin, Christopher

    2011-01-01

    This paper is based on an exploration of communication and argumentation in urban science classrooms, and provides a description of the role that Hip-hop based education plays in supporting these major components of science education. The paper is intended to both support, and critique conventional uses of hip-hop based education, and provide…

  1. Affiliation and Alienation: Hip-Hop, Rap, and Urban Science Education

    Science.gov (United States)

    Emdin, Christopher

    2010-01-01

    The critiques of rap artists and other participants in hip-hop culture provide data for teachers and researchers to investigate the attitudes of US urban youth towards schooling. This study explores the complex relationships between hip-hop and science education by examining how rap lyrics project beliefs about schooling, the relevance of existing…

  2. Sampling Practices and Social Spaces: Exploring a Hip-Hop Approach to Higher Education

    Science.gov (United States)

    Petchauer, Emery

    2010-01-01

    Much more than a musical genre, hip-hop culture exists as an animating force in the lives of many young adults. This article looks beyond the moral concerns often associated with rap music to explore how hip-hop as a larger set of expressions and practices implicates the educational experiences, activities, and approaches for students. The article…

  3. Student Perceptions of the Hip Hop Culture's Influence on the Undergraduate Experience

    Science.gov (United States)

    Wessel, Roger D.; Wallaert, Kerry A.

    2011-01-01

    This study sought to determine how identification and engagement with the hip hop culture influenced the educational experiences of undergraduate students at a Midwestern, predominately White university by interviewing 11 students who self-identified as being immersed in the hip hop culture. Through a qualitative, phenomenological investigation,…

  4. Don't Believe the Hype: Hip-Hop Literacies and English Education

    Science.gov (United States)

    Belle, Crystal

    2016-01-01

    Current scholarship suggests that many youths identify with hip-hop, especially youths of color. Study of this artistic form has been suggested as a means of helping youths acquire and become fluent in literacy practices. This article explores how the use of a hip-hop literacies curriculum addressed the literacy skills of urban ninth-grade English…

  5. Deal with It We Must: Education, Social Justice, and the Curriculum of Hip Hop Culture

    Science.gov (United States)

    Baszile, Denise Taliaferro

    2009-01-01

    Although hip hop culture has been one of the most significant urban youth movements over the last three decades, it has only recently gained attention within the educational literature as a force to be reckoned with. And even then, much of the literature seeks to understand how hip hop can be used to engage students in the official school…

  6. Contributions to the quality control of two crops of economic importance : hops and yerba mate

    NARCIS (Netherlands)

    Wilson, Erica Georgina

    2012-01-01

    Quality control of plants is essential and at the same time very challenging.In this thesis, studies involving quality issues of two plants used in the production of two popular beverages, hops (in beer) and Ilex paraguariensis (yerba mate) were undertaken. Hops are used as bittering agents and to

  7. System optimization for peer-to-peer multi hop video broadcasting in wireless ad hoc networks

    NARCIS (Netherlands)

    Dedeoglu, V.; Atici, C.; Salman, F.S.; Sunay, M.O.

    2008-01-01

    We consider peer-to-peer video broadcasting using cooperation among peers in an ad hoc wireless network. As opposed to the traditional single hop broadcasting, multiple hops cause an increase in broadcast video quality while creating interference and increasing transmission delay. We develop

  8. Generalization of fewest-switches surface hopping for coherences

    Science.gov (United States)

    Tempelaar, Roel; Reichman, David R.

    2018-03-01

    Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

  9. Robust hopping based on virtual pendulum posture control

    International Nuclear Information System (INIS)

    Sharbafi, Maziar A; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Maufroy, Christophe; Seyfarth, Andre

    2013-01-01

    A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved. (paper)

  10. A decentralized scheduling algorithm for time synchronized channel hopping

    Directory of Open Access Journals (Sweden)

    Andrew Tinka

    2011-09-01

    Full Text Available Time Synchronized Channel Hopping (TSCH is an existing Medium Access Control scheme which enables robust communication through channel hopping and high data rates through synchronization. It is based on a time-slotted architecture, and its correct functioning depends on a schedule which is typically computed by a central node. This paper presents, to our knowledge, the first scheduling algorithm for TSCH networks which both is distributed and which copes with mobile nodes. Two variations on scheduling algorithms are presented. Aloha-based scheduling allocates one channel for broadcasting advertisements for new neighbors. Reservation- based scheduling augments Aloha-based scheduling with a dedicated timeslot for targeted advertisements based on gossip information. A mobile ad hoc motorized sensor network with frequent connectivity changes is studied, and the performance of the two proposed algorithms is assessed. This performance analysis uses both simulation results and the results of a field deployment of floating wireless sensors in an estuarial canal environment. Reservation-based scheduling performs significantly better than Aloha-based scheduling, suggesting that the improved network reactivity is worth the increased algorithmic complexity and resource consumption.

  11. Asynchronous Channel-Hopping Scheme under Jamming Attacks

    Directory of Open Access Journals (Sweden)

    Yongchul Kim

    2018-01-01

    Full Text Available Cognitive radio networks (CRNs are considered an attractive technology to mitigate inefficiency in the usage of licensed spectrum. CRNs allow the secondary users (SUs to access the unused licensed spectrum and use a blind rendezvous process to establish communication links between SUs. In particular, quorum-based channel-hopping (CH schemes have been studied recently to provide guaranteed blind rendezvous in decentralized CRNs without using global time synchronization. However, these schemes remain vulnerable to jamming attacks. In this paper, we first analyze the limitations of quorum-based rendezvous schemes called asynchronous channel hopping (ACH. Then, we introduce a novel sequence sensing jamming attack (SSJA model in which a sophisticated jammer can dramatically reduce the rendezvous success rates of ACH schemes. In addition, we propose a fast and robust asynchronous rendezvous scheme (FRARS that can significantly enhance robustness under jamming attacks. Our numerical results demonstrate that the performance of the proposed scheme vastly outperforms the ACH scheme when there are security concerns about a sequence sensing jammer.

  12. Effects of compositional defects on small polaron hopping in micas.

    Science.gov (United States)

    Rosso, Kevin M; Ilton, Eugene S

    2005-06-22

    Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

  13. Hip-Hop to Health Jr. for Latino preschool children.

    Science.gov (United States)

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  14. Interaction between hopping and static spins in a discrete network

    Energy Technology Data Exchange (ETDEWEB)

    Ciccarello, Francesco, E-mail: francesco.ciccarello@sns.it [CNISM and Dipartimento di Fisica, Universita' degli Studi di Palermo, Viale delle Scienze, Edificio 18, I-90128 Palermo (Italy); NEST, Scuola Normale Superiore and Istituto Nanoscienze-CNR, Piazza dei Cavalieri 7, I-56126 Pisa (Italy)

    2011-06-27

    We consider a process where a spin hops across a discrete network and at certain sites couples to static spins. While this setting is implementable in various scenarios (e.g. quantum dots or coupled cavities) the physics of such processes is still basically unknown. Here, we take a first step along this line by scrutinizing a two-site and a three-site lattices, each with two static spins. Despite a generally complex dynamics occurs, we show a regime such that the spin dynamics is described by an effective three-spin chain. Tasks such as entanglement generation and quantum state transfer can be achieved accordingly. -- Highlights: → We study mobile spins hopping in a discrete network and coupled to static spins. → This setting can be implemented in various scenarios. → We address a two-site and a three-site lattice, each with two static spins. → We show a regime where the setup can be described by an effective three-spin chain. → Accordingly, it is prone to be exploited for some QIP applications.

  15. HOPS 383: AN OUTBURSTING CLASS 0 PROTOSTAR IN ORION

    Energy Technology Data Exchange (ETDEWEB)

    Safron, Emily J.; Megeath, S. Thomas; Booker, Joseph [Ritter Astrophysical Observatory, Department of Physics and Astronomy, University of Toledo, Toledo, OH (United States); Fischer, William J. [NASA Goddard Space Flight Center, Greenbelt, MD (United States); Furlan, Elise; Rebull, Luisa M. [Infrared Processing and Analysis Center, Caltech, Pasadena, CA (United States); Stutz, Amelia M. [Max-Planck-Institut für Astronomie, Heidelberg (Germany); Stanke, Thomas [European Southern Observatory, Garching bei München (Germany); Billot, Nicolas [Instituto de Radio Astronomía Milimétrica, Granada (Spain); Tobin, John J. [Leiden Observatory, Leiden (Netherlands); Ali, Babar [Space Science Institute, Boulder, CO (United States); Allen, Lori E. [National Optical Astronomy Observatory, Tucson, AZ (United States); Watson, Dan M. [Department of Physics and Astronomy, University of Rochester, Rochester, NY (United States); Wilson, T. L., E-mail: wjfischer@gmail.com [Naval Research Laboratory, Washington, DC (United States)

    2015-02-10

    We report the dramatic mid-infrared brightening between 2004 and 2006 of Herschel Orion Protostar Survey (HOPS) 383, a deeply embedded protostar adjacent to NGC 1977 in Orion. By 2008, the source became a factor of 35 brighter at 24 μm with a brightness increase also apparent at 4.5 μm. The outburst is also detected in the submillimeter by comparing APEX/SABOCA to SCUBA data, and a scattered-light nebula appeared in NEWFIRM K{sub s} imaging. The post-outburst spectral energy distribution indicates a Class 0 source with a dense envelope and a luminosity between 6 and 14 L{sub ⊙}. Post-outburst time-series mid- and far-infrared photometry show no long-term fading and variability at the 18% level between 2009 and 2012. HOPS 383 is the first outbursting Class 0 object discovered, pointing to the importance of episodic accretion at early stages in the star formation process. Its dramatic rise and lack of fading over a 6 year period hint that it may be similar to FU Ori outbursts, although the luminosity appears to be significantly smaller than the canonical luminosities of such objects.

  16. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    Science.gov (United States)

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  17. Hopping system control with an approximated dynamics model and upper-body motion

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyang Jun; Oh, Jun Ho [KAIST, Daejeon (Korea, Republic of)

    2015-11-15

    A hopping system is highly non-linear due to the nature of its dynamics, which has alternating phases in a cycle, flight and stance phases and related transitions. Every control method that stabilizes the hopping system satisfies the Poincaré stability condition. At the Poincaré section, a hopping system cycle is considered as discrete sectional data set. By controlling the sectional data in a discrete control form, we can generate a stable hopping cycle. We utilize phase-mapping matrices to build a Poincaré return map by approximating the dynamics of the hopping system with SLIP model. We can generate various Poincaré stable gait patterns with the approximated discrete control form which uses upper-body motions as inputs.

  18. Backoff-stage synchronization in three-hop string-topology wireless networks with hidden nodes

    Science.gov (United States)

    Sanada, Kosuke; Sekiya, Hiroo; Komuro, Nobuyoshi; Sakata, Shiro

    In IEEE 802.11 wireless multi-hop networks, each node works individually and their individual operations generate entire network dynamics. It is important to clarify the network dynamics in wireless multi-hop networks for designing and constructing multi-hop communication networks. This paper presents the network-dynamics investigations for three-hop string-topology wireless network in detail. From the investigations, a “backoff-stage synchronization” phenomenon, which is mutuality between hidden nodes, is found. The mechanism of the backoff-stage synchronization is expressed and the sufficient conditions for the synchronization occurrence are given. This phenomenon gives some impacts on the IEEE 802.11 multi-hop-network communications.

  19. Throw Yo' Voice Out: Disability as a Desirable Practice in Hip-Hop Vocal Performance

    Directory of Open Access Journals (Sweden)

    Alex S. Porco

    2014-12-01

    Full Text Available Disabled bodies and disabling spaces— especially the recording studio— shape the sound iconicity of hip-hop vocal performances. The disabled voice is the audible sign by which hip-hop artists trouble cultural definitions of the self and other; exceptionalism and failure; the natural and techno-mediated; comedy and tragedy; and aesthetic play and seriousness. Hip-hop vocal performances also function as self-conscious acts of transvaluation that challenge the discursive dominance of ableism. A materialist approach to vocal performance resists reducing voice to a silent metaphor for race, oppositionality, or liberation; and it emphasizes, instead, the physiological and social processes that render hip-hop voices unique, particular, and audible. It emphasizes the agency hip-hop artists possess in seeking out disabled bodies and assuming disabled identities for aesthetic and political ends. Thus, the body is returned to the analysis of style.

  20. WiseScaffolder: an algorithm for the semi-automatic scaffolding of Next Generation Sequencing data.

    Science.gov (United States)

    Farrant, Gregory K; Hoebeke, Mark; Partensky, Frédéric; Andres, Gwendoline; Corre, Erwan; Garczarek, Laurence

    2015-09-03

    The sequencing depth provided by high-throughput sequencing technologies has allowed a rise in the number of de novo sequenced genomes that could potentially be closed without further sequencing. However, genome scaffolding and closure require costly human supervision that often results in genomes being published as drafts. A number of automatic scaffolders were recently released, which improved the global quality of genomes published in the last few years. Yet, none of them reach the efficiency of manual scaffolding. Here, we present an innovative semi-automatic scaffolder that additionally helps with chimerae resolution and generates valuable contig maps and outputs for manual improvement of the automatic scaffolding. This software was tested on the newly sequenced marine cyanobacterium Synechococcus sp. WH8103 as well as two reference datasets used in previous studies, Rhodobacter sphaeroides and Homo sapiens chromosome 14 (http://gage.cbcb.umd.edu/). The quality of resulting scaffolds was compared to that of three other stand-alone scaffolders: SSPACE, SOPRA and SCARPA. For all three model organisms, WiseScaffolder produced better results than other scaffolders in terms of contiguity statistics (number of genome fragments, N50, LG50, etc.) and, in the case of WH8103, the reliability of the scaffolds was confirmed by whole genome alignment against a closely related reference genome. We also propose an efficient computer-assisted strategy for manual improvement of the scaffolding, using outputs generated by WiseScaffolder, as well as for genome finishing that in our hands led to the circularization of the WH8103 genome. Altogether, WiseScaffolder proved more efficient than three other scaffolders for both prokaryotic and eukaryotic genomes and is thus likely applicable to most genome projects. The scaffolding pipeline described here should be of particular interest to biologists wishing to take advantage of the high added value of complete genomes.

  1. A comparison study of different physical treatments on cartilage matrix derived porous scaffolds for tissue engineering applications

    International Nuclear Information System (INIS)

    Moradi, Ali; Pramanik, Sumit; Ataollahi, Forough; Pingguan-Murphy, Belinda; Abdul Khalil, Alizan; Kamarul, Tunku

    2014-01-01

    Native cartilage matrix derived (CMD) scaffolds from various animal and human sources have drawn attention in cartilage tissue engineering due to the demonstrable presence of bioactive components. Different chemical and physical treatments have been employed to enhance the micro-architecture of CMD scaffolds. In this study we have assessed the typical effects of physical cross-linking methods, namely ultraviolet (UV) light, dehydrothermal (DHT) treatment, and combinations of them on bovine articular CMD porous scaffolds with three different matrix concentrations (5%, 15% and 30%) to assess the relative strengths of each treatment. Our findings suggest that UV and UV–DHT treatments on 15% CMD scaffolds can yield architecturally optimal scaffolds for cartilage tissue engineering. (paper)

  2. Novel preparation of controlled porosity particle/fibre loaded scaffolds using a hybrid micro-fluidic and electrohydrodynamic technique.

    Science.gov (United States)

    Parhizkar, Maryam; Sofokleous, Panagiotis; Stride, Eleanor; Edirisinghe, Mohan

    2014-11-27

    The purpose of this research was to produce multi-dimensional scaffolds containing biocompatible particles and fibres. To achieve this, two techniques were combined and used: T-Junction microfluidics and electrohydrodynamic (EHD) processing. The former was used to form layers of monodispersed bovine serum albumin (BSA) bubbles, which upon drying formed porous scaffolds. By altering the T-Junction processing parameters, bubbles with different diameters were produced and hence the scaffold porosity could be controlled. EHD processing was used to spray or spin poly(lactic-co-glycolic) (PLGA), polymethysilsesquioxane (PMSQ) and collagen particles/fibres onto the scaffolds during their production and after drying. As a result, multifunctional BSA scaffolds with controlled porosity containing PLGA, PMSQ and collagen particles/fibres were obtained. Product morphology was studied by optical and scanning electron microscopy. These products have potential applications in many advanced biomedical, pharmaceutical and cosmetic fields e.g. bone regeneration, drug delivery, cosmetic cream lathers, facial scrubbing creams etc.

  3. RNAi knockdown of Hop (Hsp70/Hsp90 organising protein) decreases invasion via MMP-2 down regulation.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2011-07-28

    We previously identified Hop as over expressed in invasive pancreatic cancer cell lines and malignant tissues of pancreatic cancer patients, suggesting an important role for Hop in the biology of invasive pancreatic cancer. Hop is a co-chaperone protein that binds to both Hsp70\\/Hsp90. We hypothesised that by targeting Hop, signalling pathways modulating invasion and client protein stabilisation involving Hsp90-dependent complexes may be altered. In this study, we show that Hop knockdown by small interfering (si)RNA reduces the invasion of pancreatic cancer cells, resulting in decreased expression of the downstream target gene, matrix metalloproteinases-2 (MMP-2). Hop in conditioned media co-immunoprecipitates with MMP-2, implicating a possible extracellular function for Hop. Knockdown of Hop expression also reduced expression levels of Hsp90 client proteins, HER2, Bcr-Abl, c-MET and v-Src. Furthermore, Hop is strongly expressed in high grade PanINs compared to lower PanIN grades, displaying differential localisation in invasive ductal pancreatic cancer, indicating that the localisation of Hop is an important factor in pancreatic tumours. Our data suggests that the attenuation of Hop expression inactivates key signal transduction proteins which may decrease the invasiveness of pancreatic cancer cells possibly through the modulation of Hsp90 activity. Therefore, targeting Hop in pancreatic cancer may constitute a viable strategy for targeted cancer therapy.

  4. Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

    Science.gov (United States)

    Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

    2013-01-01

    Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

  5. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    Science.gov (United States)

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  6. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-?-Acids

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop -acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso--acids have hitherto been restricted to lactic acid bacteria.

  7. Acceleration of segmental bone regeneration in a rabbit model by strontium-doped calcium polyphosphate scaffold through stimulating VEGF and bFGF secretion from osteoblasts

    International Nuclear Information System (INIS)

    Gu, Zhipeng; Zhang, Xu; Li, Li; Wang, Qiguang; Yu, Xixun; Feng, Ting

    2013-01-01

    The development of suitable bioactive three-dimensional scaffold for the promotion of bone regeneration is critical in bone tissue engineering. The purpose of this study was to investigate in vivo osteogenesis of the porous strontium-doped calcium polyphosphate (SCPP) scaffolds for bone repair, as well as the relationship between osteogenic properties of SCPP scaffolds and the secretion of bFGF and VEGF from osteoblasts stimulated by SCPP. Besides, the advantages of scaffolds seeded with mesenchymal stem cells (MSCs) for bone repair were also studied. Firstly, the bone repair evaluation of scaffolds was performed on a rabbit segmental bony defects model over a period of 16 weeks by histology combined with X-ray microradiography. And then, in order to avoid the influence from the other factors such as hypoxia which emerge in vivo study and affect the secretion of VEGF and bFGF from host cells, human osteoblast-like cells (MG63) were seeded to SCPP, CPP and HA scaffolds in vitro to determine the ability of these scaffolds to stimulate the secretion of angiogenic growth factors (VEGF and bFGF) from MG63 and further explore the reason for the better osteogenic properties of SCPP scaffolds. The histological and X-ray microradiographic results showed that the SCPP scaffolds presented better osteogenic potential than CPP and HA scaffolds, when combined with MSCs, the SCPP scaffolds could further accelerate the bone repair. And the amounts of VEGF measured by ELISA assay in SCPP, CPP and HA groups after cultured for 7 days were about 364.989 pg/mL, 244.035 pg/mL and 232.785 pg/mL, respectively. Accordingly, the amounts of bFGF were about 27.085 pg/mL, 15.727 pg/mL and 8.326 pg/mL. The results revealed that the SCPP scaffolds significantly enhanced the bFGF and VEGF secretion compared with other scaffolds. The results presented in vivo and in vitro study demonstrated that the SCPP could accelerate bone formation through stimulating the secretion of VEGF and bFGF from

  8. A new bi-layered scaffold for osteochondral tissue regeneration: In vitro and in vivo preclinical investigations

    Energy Technology Data Exchange (ETDEWEB)

    Sartori, M. [Laboratory of Biocompatibility, Technological Innovations and Advanced Therapies, Rizzoli Orthopedic Institute, Bologna (Italy); Pagani, S., E-mail: stefania.pagani@ior.it [Laboratory of Preclinical and Surgical Studies, Rizzoli Orthopedic Institute, Bologna (Italy); Ferrari, A. [Laboratory of Preclinical and Surgical Studies, Rizzoli Orthopedic Institute, Bologna (Italy); Department of Medical and Surgical Sciences (DIMEC), University of Bologna, Bologna (Italy); Costa, V.; Carina, V. [Innovative Technology Platform for Tissue Engineering, Theranostic and Oncology, Rizzoli Orthopedic Institute, Palermo (Italy); Figallo, E. [Fin-Ceramica Faenza SpA, Faenza, Ravenna (Italy); Maltarello, M.C. [Laboratory of Musculoskeletal Cell Biology, Rizzoli Orthopedic Institute, Bologna (Italy); Martini, L.; Fini, M. [Laboratory of Preclinical and Surgical Studies, Rizzoli Orthopedic Institute, Bologna (Italy); Giavaresi, G. [Innovative Technology Platform for Tissue Engineering, Theranostic and Oncology, Rizzoli Orthopedic Institute, Palermo (Italy)

    2017-01-01

    of nutrients and oxygen, as also suggested by the presence of a neo-angiogenesis process, especially at 4 weeks. Moreover, the in vivo results further confirmed the great potential of the scaffold in tissue engineering, as it was able to support the initial formation of new bone and chondral tissue, confirming the importance of combined and innovative strategies to improve the available therapeutic strategies for chondral and osteochondral regeneration. - Highlights: • Osteochondral lesions are still lacking of definitive and satisfactory solutions. • A new bilayered scaffold able to support bone and cartilage regeneration is proposed. • Type I collagen, Mg-doped hydroxyapatite and adequate crosslinking as novelty • In vitro and in vivo (heterotopic implant in nude mice) assessments are reported.

  9. Hydroxyapatite-silver nanoparticles coatings on porous polyurethane scaffold

    International Nuclear Information System (INIS)

    Ciobanu, Gabriela; Ilisei, Simona; Luca, Constantin

    2014-01-01

    The present paper is focused on a study regarding the possibility of obtaining hydroxyapatite-silver nanoparticle coatings on porous polyurethane scaffold. The method applied is based on a combined strategy involving hydroxyapatite biomimetic deposition on polyurethane surface using a Supersaturated Calcification Solution (SCS), combined with silver ions reduction and in-situ crystallization processes on hydroxyapatite-polyurethane surface by sample immersing in AgNO 3 solution. The morphology, composition and phase structure of the prepared samples were characterized by scanning electron microscopy coupled with energy dispersive X-ray spectroscopy (SEM-EDX), X-ray diffraction (XRD), UV-Vis spectroscopy and X-ray photoelectron spectroscopy (XPS) measurements. The data obtained show that a layer of hydroxyapatite was deposited on porous polyurethane support and the silver nanoparticles (average size 34.71 nm) were dispersed among and even on the hydroxyapatite crystals. Hydroxyapatite/polyurethane surface acts as a reducer and a stabilizing agent for silver ions. The surface plasmon resonance peak in UV-Vis absorption spectra showed an absorption maximum at 415 nm, indicating formation of silver nanoparticles. The hydroxyapatite-silver polyurethane scaffolds were tested against Staphylococcus aureus and Escherichia coli and the obtained data were indicative of good antibacterial properties of the materials. - Highlights: • The hydroxyapatite and silver nanoparticles were grown on the polyurethane scaffold • The hydroxyapatite/polyurethane acts as reducing agent, stabilizer and matrix for Ag • The samples were well characterized by SEM-EDX, XRD, XPS, UV-visible spectroscopy • The hydroxyapatite/silver polyurethane scaffold shows antibacterial property

  10. Cell penetration to nanofibrous scaffolds

    Czech Academy of Sciences Publication Activity Database

    Rampichová, Michala; Buzgo, Matej; Chvojka, J.; Prosecká, Eva; Kofroňová, Olga; Amler, Evžen

    2014-01-01

    Roč. 8, č. 1 (2014), s. 36-41 ISSN 1933-6918 Grant - others:GA UK(CZ) 384311; GA UK(CZ) 626012; GA UK(CZ) 270513; GA UK(CZ) 330611; GA UK(CZ) 648112; GA MZd(CZ) NT12156; GA MŠk(CZ) project IPv6 Institutional support: RVO:68378041 ; RVO:61388971 Keywords : fibrous scaffold * mesenchymal stem cells * Forcespinning (R) Subject RIV: FP - Other Medical Disciplines Impact factor: 4.505, year: 2014

  11. Osteoconductivity and Biodegradability of Collagen Scaffold Coated with Nano-β-TCP and Fibroblast Growth Factor 2

    Directory of Open Access Journals (Sweden)

    Asako Ibara

    2013-01-01

    Full Text Available Nanoparticle bioceramics have become anticipated for biomedical applications. Highly bioactive and biodegradable scaffolds would be developed using nanoparticles of β-tricalcium phosphate (β-TCP. We prepared collagen scaffolds coated by nano-β-TCP and fibroblast growth factor 2 (FGF2 and evaluated the effects on new bone augmentation and biodegradation. The collagen sponge was coated with the nano-TCP dispersion and freeze-dried. Scaffold was characterized by SEM, TEM, XRD, compressive testing and cell seeding. Subsequently, the nano-β-TCP/collagen scaffold, collagen sponge, and each material loaded with FGF2 were implanted on rat cranial bone. As a control, no implantation was performed. Nano-TCP particles were found to be attached to the fibers of the collagen sponge by SEM and TEM observations. Scaffold coated with nano-TCP showed higher compressive strength and cytocompatibility. In histological evaluations at 10 days, inflammatory cells were rarely seen around the residual scaffold, suggesting that the nano-TCP material possesses good tissue compatibility. At 35 days, bone augmentation and scaffold degradation in histological samples receiving nano-β-TCP scaffold were significantly greater than those in the control. By loading of FGF2, advanced bone formation is facilitated, indicating that a combination with FGF2 would be effective for bone tissue engineering.

  12. Use of lecithin to control fiber morphology in electrospun poly (ɛ-caprolactone) scaffolds for improved tissue engineering applications.

    Science.gov (United States)

    Coverdale, Benjamin D M; Gough, Julie E; Sampson, William W; Hoyland, Judith A

    2017-10-01

    We elucidate the effects of incorporating surfactants into electrospun poly (ɛ-caprolactone) (PCL) scaffolds on network homogeneity, cellular adherence and osteogenic differentiation. Lecithin was added with a range of concentrations to PCL solutions, which were electrospun to yield functionalized scaffolds. Addition of lecithin yielded a dose-dependent reduction in scaffold hydrophobicity, whilst reducing fiber width and hence increasing specific surface area. These changes in scaffold morphology were associated with increased cellular attachment of Saos-2 osteoblasts 3-h postseeding. Furthermore, cells on scaffolds showed comparable proliferation over 14 days of incubation to TCP controls. Through model-based interpretation of image analysis combined with gravimetric estimates of porosity, lecithin is shown to reduce scaffold porosity and mean pore size. Additionally, lecithin incorporation is found to reduce fiber curvature, resulting in increased scaffold specific elastic modulus. Low concentrations of lecithin were found to induce upregulation of several genes associated with osteogenesis in primary mesenchymal stem cells. The results demonstrate that functionalization of electrospun PCL scaffolds with lecithin can increase the biocompatibility and regenerative potential of these networks for bone tissue engineering applications. © 2017 The Authors Journal of Biomedical Materials Research Part A Published by Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2865-2874, 2017. © 2017 The Authors Journal of Biomedical Materials Research Part A Published by Wiley Periodicals, Inc.

  13. Fabrication of triple-layered bifurcated vascular scaffold with a certain degree of three-dimensional structure

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Weijian; Yang, Yang; Pu, Huayan; Peng, Yan; Xin, Liming; Zhang, Yi; Sun, Yu

    2018-01-01

    Constructing vascular scaffolds is important in tissue engineering. However, scaffolds with characteristics such as multiple layers and a certain degree of spatial morphology still cannot be readily constructed by current vascular scaffolds fabrication techniques. This paper presents a three-layered bifurcated vascular scaffold with a curved structure. The technique combines 3D printed molds and casting hydrogel and fugitive ink to create vessel-mimicking constructs with customizable structural parameters. Compared with other fabrication methods, the technique can create more native-like 3D geometries. The diameter and wall thickness of the fabricated constructs can be independently controlled, providing a feasible approach for vascular scaffold construction. Enzymatically-crosslinked gelatin was used as the scaffold material. The morphology and mechanical properties were evaluated. Human umbilical cord derived endothelial cells (HUVECs) were seeded on the scaffolds and cultured for 72 h. Cell viability and morphology were assessed. The results showed that the proposed process had good application potentials, and will hopefully provide a feasible approach for constructing vascular scaffolds.

  14. Neural stem cell proliferation and differentiation in the conductive PEDOT-HA/Cs/Gel scaffold for neural tissue engineering.

    Science.gov (United States)

    Wang, Shuping; Guan, Shui; Xu, Jianqiang; Li, Wenfang; Ge, Dan; Sun, Changkai; Liu, Tianqing; Ma, Xuehu

    2017-09-26

    Engineering scaffolds with excellent electro-activity is increasingly important in tissue engineering and regenerative medicine. Herein, conductive poly(3,4-ethylenedioxythiophene) doped with hyaluronic acid (PEDOT-HA) nanoparticles were firstly synthesized via chemical oxidant polymerization. A three-dimensional (3D) PEDOT-HA/Cs/Gel scaffold was then developed by introducing PEDOT-HA nanoparticles into a chitosan/gelatin (Cs/Gel) matrix. HA, as a bridge, not only was used as a dopant, but also combined PEDOT into the Cs/Gel via chemical crosslinking. The PEDOT-HA/Cs/Gel scaffold was used as a conductive substrate for neural stem cell (NSC) culture in vitro. The results demonstrated that the PEDOT-HA/Cs/Gel scaffold had excellent biocompatibility for NSC proliferation and differentiation. 3D confocal fluorescence images showed cells attached on the channel surface of Cs/Gel and PEDOT-HA/Cs/Gel scaffolds with a normal neuronal morphology. Compared to the Cs/Gel scaffold, the PEDOT-HA/Cs/Gel scaffold not only promoted NSC proliferation with up-regulated expression of Ki67, but also enhanced NSC differentiation into neurons and astrocytes with up-regulated expression of β tubulin-III and GFAP, respectively. It is expected that this electro-active and bio-active PEDOT-HA/Cs/Gel scaffold will be used as a conductive platform to regulate NSC behavior for neural tissue engineering.

  15. PHBV/PLLA-based composite scaffolds fabricated using an emulsion freezing/freeze-drying technique for bone tissue engineering: surface modification and in vitro biological evaluation

    International Nuclear Information System (INIS)

    Sultana, Naznin; Wang Min

    2012-01-01

    Tissue engineering combines living cells with biodegradable materials and/or bioactive components. Composite scaffolds containing biodegradable polymers and nanosized osteoconductive bioceramic with suitable properties are promising for bone tissue regeneration. In this paper, based on blending two biodegradable and biocompatible polymers, namely poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV) and poly(l-lactic acid) (PLLA) with incorporated nano hydroxyapatite (HA), three-dimensional composite scaffolds with controlled microstructures and an interconnected porous structure, together with high porosity, were fabricated using an emulsion freezing/freeze-drying technique. The influence of various parameters involved in the emulsion freezing/freeze-drying technique was studied for the fabrication of good-quality polymer scaffolds based on PHBV polymers. The morphology, mechanical properties and crystallinity of PHBV/PLLA and HA in PHBV/PLLA composite scaffolds and PHBV polymer scaffolds were studied. The scaffolds were coated with collagen in order to improve wettability. During in vitro biological evaluation study, it was observed that SaOS-2 cells had high attachment on collagen-coated scaffolds. Significant improvement in cell proliferation and alkaline phosphatase activity for HA-incorporated composite scaffolds was observed due to the incorporation of HA. After 3 and 7 days of culture on all scaffolds, SaOS-2 cells also had normal morphology and growth. These results indicated that PHBV/PLLA-based scaffolds fabricated via an emulsion freezing/freeze-drying technique were favorable sites for osteoblastic cells and are promising for the applications of bone tissue engineering.

  16. Scaffolding Mathematical Modelling with a Solution Plan

    Science.gov (United States)

    Schukajlow, Stanislaw; Kolter, Jana; Blum, Werner

    2015-01-01

    In the study presented in this paper, we examined the possibility to scaffold mathematical modelling with strategies. The strategies were prompted using an instrument called "solution plan" as a scaffold. The effects of this step by step instrument on mathematical modelling competency and on self-reported strategies were tested using…

  17. Scaffolding proteins: not such innocent bystanders.

    Science.gov (United States)

    Smith, F Donelson; Scott, John D

    2013-06-17

    Sequential transfer of information from one enzyme to the next within the confines of a protein kinase scaffold enhances signal transduction. Though frequently considered to be inert organizational elements, two recent reports implicate kinase-scaffolding proteins as active participants in signal relay. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Scaffolding Proteins: Not Such Innocent Bystanders

    OpenAIRE

    Smith, F. Donelson; Scott, John D.

    2013-01-01

    Sequential transfer of information from one enzyme to the next within the confines of a protein kinase scaffold enhances signal transduction. Though frequently considered to be inert organizational elements, two recent reports implicate kinase-scaffolding proteins as active participants in signal relay.

  19. Metacognitive Scaffolding in an Innovative Learning Arrangement

    Science.gov (United States)

    Molenaar, Inge; van Boxtel, Carla A. M.; Sleegers, Peter J. C.

    2011-01-01

    This study examined the effects of metacognitive scaffolds on learning outcomes of collaborating students in an innovative learning arrangement. The triads were supported by computerized scaffolds, which were dynamically integrated into the learning process and took a structuring or problematizing form. In an experimental design the two…

  20. Teaching language teachers scaffolding professional learning

    CERN Document Server

    Maggioli, Gabriel Diaz

    2012-01-01

    Teaching Language Teachers: Scaffolding Professional Learning provides an updated view of as well as a reader-friendly introduction to the field of Teaching Teachers, with special reference to language teaching. By taking a decidedly Sociocultural perspective, the book addresses the main role of the Teacher of Teachers (ToT) as that of scaffolding the professional learning of aspiring teachers.

  1. Synthesis and characterization of nanocrystalline forsterite coated poly(L-lactide-co-β-malic acid) scaffolds for bone tissue engineering applications.

    Science.gov (United States)

    Mozafari, M; Gholipourmalekabadi, M; Chauhan, N P S; Jalali, N; Asgari, S; Caicedoa, J C; Hamlekhan, A; Urbanska, A M

    2015-05-01

    In this research, after synthesizing poly(L-lactide-co-β-malic acid) (PLMA) copolymer, hybrid particles of ice and nanocrystalline forsterite (NF) as coating carriers were used to prepare NF-coated PLMA scaffolds. The porous NF-coated scaffolds were directly fabricated by a combined technique using porogen leaching and freeze-drying methods. The obtained results indicate that the scaffolds were structurally porous with NF particles on their surfaces. When compared to the uncoated scaffolds, the NF coating improved both mechanical properties as well as enhanced bioactivity of the scaffolds. In addition, in vitro biological response of the rat bone marrow stromal cells indicated that NF significantly increased the biocompatibility of NF-coated scaffolds compared with PLMA. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Fabrication of computationally designed scaffolds by low temperature 3D printing

    International Nuclear Information System (INIS)

    Castilho, Miguel; Dias, Marta; Fernandes, Paulo; Pires, Inês; Gouveia, Barbara; Rodrigues, Jorge; Gbureck, Uwe; Groll, Jürgen; Vorndran, Elke

    2013-01-01

    The development of artificial bone substitutes that mimic the properties of bone and simultaneously promote the desired tissue regeneration is a current issue in bone tissue engineering research. An approach to create scaffolds with such characteristics is based on the combination of novel design and additive manufacturing processes. The objective of this work is to characterize the microstructural and the mechanical properties of scaffolds developed by coupling both topology optimization and a low temperature 3D printing process. The scaffold design was obtained using a topology optimization approach to maximize the permeability with constraints on the mechanical properties. This procedure was studied to be suitable for the fabrication of a cage prototype for tibial tuberosity advancement application, which is one of the most recent and promising techniques to treat cruciate ligament rupture in dogs. The microstructural and mechanical properties of the scaffolds manufactured by reacting α/β-tricalcium phosphate with diluted phosphoric acid were then assessed experimentally and the scaffolds strength reliability was determined. The results demonstrate that the low temperature 3D printing process is a reliable option to create synthetic scaffolds with tailored properties, and when coupled with topology optimization design it can be a powerful tool for the fabrication of patient-specific bone implants. (paper)

  3. Enhancing students' higher order thinking skills through computer-based scaffolding in problem-based learning

    Science.gov (United States)

    Kim, Nam Ju

    This multiple paper dissertation addressed several issues in Problem-based learning (PBL) through conceptual analysis, meta-analysis, and empirical research. PBL is characterized by ill-structured tasks, self-directed learning process, and a combination of individual and cooperative learning activities. Students who lack content knowledge and problem-solving skills may struggle to address associated tasks that are beyond their current ability levels in PBL. This dissertation addressed a) scaffolding characteristics (i.e., scaffolding types, delivery method, customization) and their effects on students' perception of optimal challenge in PBL, b) the possibility of virtual learning environments for PBL, and c) the importance of information literacy for successful PBL learning. Specifically, this dissertation demonstrated the effectiveness of scaffolding customization (i.e., fading, adding, and fading/adding) to enhance students' self-directed learning in PBL. Moreover, the effectiveness of scaffolding was greatest when scaffolding customization is self-selected than based on fixed-time interval and their performance. This suggests that it might be important for students to take responsibility for their learning in PBL and individualized and just-in-time scaffolding can be one of the solutions to address K-12 students' difficulties in improving problem-solving skills and adjusting to PBL.

  4. Implementation of surface hopping molecular dynamics using semiempirical methods

    International Nuclear Information System (INIS)

    Fabiano, E.; Keal, T.W.; Thiel, W.

    2008-01-01

    A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

  5. SDN-Based Double Hopping Communication against Sniffer Attack

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2016-01-01

    Full Text Available Sniffer attack has been a severe threat to network communication security. Traditional network usually uses static network configuration, which provides convenience to sniffer attack. In this paper, an SDN-based double hopping communication (DHC approach is proposed to solve this problem. In DHC, ends in communication packets as well as the routing paths are changed dynamically. Therefore, the traffic will be distributed to multiple flows and transmitted along different paths. Moreover, the data from multiple users will be mixed, bringing difficulty for attackers in obtaining and recovering the communication data, so that sniffer attack will be prevented effectively. It is concluded that DHC is able to increase the overhead of sniffer attack, as well as the difficulty of communication data recovery.

  6. Mode competition and hopping in optomechanical nano-oscillators

    Science.gov (United States)

    Zhang, Xingwang; Lin, Tong; Tian, Feng; Du, Han; Zou, Yongchao; Chau, Fook Siong; Zhou, Guangya

    2018-04-01

    We investigate the inter-mode nonlinear interaction in the multi-mode optomechanical nano-oscillator which consists of coupled silicon nanocantilevers, where the integrated photonic crystal nanocavities provide the coupling between the optical and mechanical modes. Due to the self-saturation and cross-saturation of the mechanical gain, the inter-mode competition is observed, which leads to the bistable operation of the optomechanical nano-oscillator: only one of the mechanical modes can oscillate at any one time, and the oscillation of one mode extremely suppresses that of the other with a side mode suppression ratio (SMSR) up to 40 dB. In the meantime, mode hopping, i.e., the optomechanical oscillation switches from one mode to the other, is also observed and found to be able to be provoked by excitation laser fluctuations.

  7. 3D printed hyperelastic "bone" scaffolds and regional gene therapy: A novel approach to bone healing.

    Science.gov (United States)

    Alluri, Ram; Jakus, Adam; Bougioukli, Sofia; Pannell, William; Sugiyama, Osamu; Tang, Amy; Shah, Ramille; Lieberman, Jay R

    2018-04-01

    The purpose of this study was to evaluate the viability of human adipose-derived stem cells (ADSCs) transduced with a lentiviral (LV) vector to overexpress bone morphogenetic protein-2 (BMP-2) loaded onto a novel 3D printed scaffold. Human ADSCs were transduced with a LV vector carrying the cDNA for BMP-2. The transduced cells were loaded onto a 3D printed Hyperelastic "Bone" (HB) scaffold. In vitro BMP-2 production was assessed using enzyme-linked immunosorbent assay analysis. The ability of ADSCs loaded on the HB scaffold to induce in vivo bone formation in a hind limb muscle pouch model was assessed in the following groups: ADSCs transduced with LV-BMP-2, LV-green fluorescent protein, ADSCs alone, and empty HB scaffolds. Bone formation was assessed using radiographs, histology and histomorphometry. Transduced ADSCs BMP-2 production on the HB scaffold at 24 hours was similar on 3D printed HB scaffolds versus control wells with transduced cells alone, and continued to increase after 1 and 2 weeks of culture. Bone formation was noted in LV-BMP-2 animals on plain radiographs at 2 and 4 weeks after implantation; no bone formation was noted in the other groups. Histology demonstrated that the LV-BMP-2 group was the only group that formed woven bone and the mean bone area/tissue area was significantly greater when compared with the other groups. 3D printed HB scaffolds are effective carriers for transduced ADSCs to promote bone repair. The combination of gene therapy and tissue engineered scaffolds is a promising multidisciplinary approach to bone repair with significant clinical potential. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 1104-1110, 2018. © 2018 Wiley Periodicals, Inc.

  8. Three-dimensional electrospun polycaprolactone (PCL)/alginate hybrid composite scaffolds.

    Science.gov (United States)

    Kim, Min Seong; Kim, GeunHyung

    2014-12-19

    Micro/nanofibrous scaffolds have been used widely in biomedical applications because the micro/nano-scale fibres resemble natural extracellular matrix and the high surface-to-volume ratio encourages cellular activities (attachment and proliferation). However, poor mechanical properties, low controllability of various shapes and difficulties in obtaining controllable pore structure have been obstacles to their use in hard-tissue regeneration. To overcome these shortcomings, we suggest a new composite system, which uses a combination method of wet electrospinning, rapid prototyping and a physical punching process. Using the process, we obtained polycaprolactone (PCL)/alginate composite scaffolds, consisting of electrospun PCL/alginate fibres and micro-sized PCL struts, with mean pore sizes of 821 ± 55 μm. To show the feasibility of the scaffolds for hard-tissue regeneration, the scaffolds were assessed not only for physical properties, including hydrophilicity, water absorption, and tensile and compressive strength, but also in vitro cellular responses (cell viability and proliferation) and osteogenic differentiation (alkaline phosphatase (ALP) activity, and mineralisation) by culturing with pre-osteoblasts (MC3T3-E1 cells). With the reinforcing micro-sized PCL struts, the elastic modulus of the PCL/alginate scaffold was significantly improved versus a pure PCL scaffold. Additionally, due to the alginate component in the fibrous scaffold, they showed significantly enhanced hydrophilic behaviour, water absorption (∼8-fold) and significant biological activities (∼1.6-fold for cell viability at 7 days, ∼2.3-fold for ALP activity at 14 days and ∼6.4-fold for calcium mineralisation at 14 days) compared with those of a pure PCL fibrous scaffold. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Fabrication of a biomimetic elastic intervertebral disk scaffold using additive manufacturing

    International Nuclear Information System (INIS)

    Whatley, Benjamin R; Kuo, Jonathan; Shuai, Cijun; Wen Xuejun; Damon, Brooke J

    2011-01-01

    A custom-designed three-dimensional additive manufacturing device was developed to fabricate scaffolds for intervertebral disk (IVD) regeneration. This technique integrated a computer with a device capable of 3D movement allowing for precise motion and control over the polymer scaffold resolution. IVD scaffold structures were designed using computer-aided design to resemble the natural IVD structure. Degradable polyurethane (PU) was used as an elastic scaffold construct to mimic the elastic nature of the native IVD tissue and was deposited at a controlled rate using ultra-fine micropipettes connected to a syringe pump. The elastic PU was extruded directly onto a collecting substrate placed on a freezing stage. The three-dimensional movement of the computer-controlled device combined with the freezing stage enabled precise control of polymer deposition using extrusion. The addition of the freezing stage increased the polymer solution viscosity and hardened the polymer solution as it was extruded out of the micropipette tip. This technique created scaffolds with excellent control over macro- and micro-structure to influence cell behavior, specifically for cell adhesion, proliferation, and alignment. Concentric lamellae were printed at a high resolution to mimic the native shape and structure of the IVD. Seeded cells aligned along the concentric lamellae and acquired cell morphology similar to native tissue in the outer portion of the IVD. The fabricated scaffolds exhibited elastic behavior during compressive and shear testing, proving that the scaffolds could support loads with proper fatigue resistance without permanent deformation. Additionally, the mechanical properties of the scaffolds were comparable to those of native IVD tissue.

  10. Fabrication of a biomimetic elastic intervertebral disk scaffold using additive manufacturing.

    Science.gov (United States)

    Whatley, Benjamin R; Kuo, Jonathan; Shuai, Cijun; Damon, Brooke J; Wen, Xuejun

    2011-03-01

    A custom-designed three-dimensional additive manufacturing device was developed to fabricate scaffolds for intervertebral disk (IVD) regeneration. This technique integrated a computer with a device capable of 3D movement allowing for precise motion and control over the polymer scaffold resolution. IVD scaffold structures were designed using computer-aided design to resemble the natural IVD structure. Degradable polyurethane (PU) was used as an elastic scaffold construct to mimic the elastic nature of the native IVD tissue and was deposited at a controlled rate using ultra-fine micropipettes connected to a syringe pump. The elastic PU was extruded directly onto a collecting substrate placed on a freezing stage. The three-dimensional movement of the computer-controlled device combined with the freezing stage enabled precise control of polymer deposition using extrusion. The addition of the freezing stage increased the polymer solution viscosity and hardened the polymer solution as it was extruded out of the micropipette tip. This technique created scaffolds with excellent control over macro- and micro-structure to influence cell behavior, specifically for cell adhesion, proliferation, and alignment. Concentric lamellae were printed at a high resolution to mimic the native shape and structure of the IVD. Seeded cells aligned along the concentric lamellae and acquired cell morphology similar to native tissue in the outer portion of the IVD. The fabricated scaffolds exhibited elastic behavior during compressive and shear testing, proving that the scaffolds could support loads with proper fatigue resistance without permanent deformation. Additionally, the mechanical properties of the scaffolds were comparable to those of native IVD tissue.

  11. Textile-templated electrospun anisotropic scaffolds for regenerative cardiac tissue engineering.

    Science.gov (United States)

    Şenel Ayaz, H Gözde; Perets, Anat; Ayaz, Hasan; Gilroy, Kyle D; Govindaraj, Muthu; Brookstein, David; Lelkes, Peter I

    2014-10-01

    For patients with end-stage heart disease, the access to heart transplantation is limited due to the shortage of donor organs and to the potential for rejection of the donated organ. Therefore, current studies focus on bioengineering approaches for creating biomimetic cardiac patches that will assist in restoring cardiac function, by repairing and/or regenerating the intrinsically anisotropic myocardium. In this paper we present a simplified, straightforward approach for creating bioactive anisotropic cardiac patches, based on a combination of bioengineering and textile-manufacturing techniques in concert with nano-biotechnology based tissue-engineering stratagems. Using knitted conventional textiles, made of cotton or polyester yarns as template targets, we successfully electrospun anisotropic three-dimensional scaffolds from poly(lactic-co-glycolic) acid (PLGA), and thermoplastic polycarbonate-urethane (PCU, Bionate(®)). The surface topography and mechanical properties of textile-templated anisotropic scaffolds significantly differed from those of scaffolds electrospun from the same materials onto conventional 2-D flat-target electrospun scaffolds. Anisotropic textile-templated scaffolds electrospun from both PLGA and PCU, supported the adhesion and proliferation of H9C2 cardiac myoblasts cell line, and guided the cardiac tissue-like anisotropic organization of these cells in vitro. All cell-seeded PCU scaffolds exhibited mechanical properties comparable to those of a human heart, but only the cells on the polyester-templated scaffolds exhibited prolonged spontaneous synchronous contractility on the entire engineered construct for 10 days in vitro at a near physiologic frequency of ∼120 bpm. Taken together, the methods described here take advantage of straightforward established textile manufacturing strategies as an efficient and cost-effective approach to engineering 3D anisotropic, elastomeric PCU scaffolds that can serve as a cardiac patch. Copyright

  12. Distribution and viability of fetal and adult human bone marrow stromal cells in a biaxial rotating vessel bioreactor after seeding on polymeric 3D additive manufactured scaffolds

    NARCIS (Netherlands)

    Leferink, Anne Marijke; Chng, Yhee-Cheng; van Blitterswijk, Clemens; Moroni, Lorenzo

    2015-01-01

    One of the conventional approaches in tissue engineering is the use of scaffolds in combination with cells to obtain mechanically stable tissue constructs in vitro prior to implantation. Additive manufacturing by fused deposition modeling is a widely used technique to produce porous scaffolds with

  13. Vibrational spectroscopy and chemometrics for rapid, quantitative analysis of bitter acids in hops (Humulus lupulus).

    Science.gov (United States)

    Killeen, Daniel P; Andersen, David H; Beatson, Ron A; Gordon, Keith C; Perry, Nigel B

    2014-12-31

    Hops, Humulus lupulus, are grown worldwide for use in the brewing industry to impart characteristic flavor and aroma to finished beer. Breeders produce many varietal crosses with the aim of improving and diversifying commercial hops varieties. The large number of crosses critical to a successful breeding program imposes high demands on the supporting chemical analytical laboratories. With the aim of reducing the analysis time associated with hops breeding, quantitative partial least-squares regression (PLS-R) models have been produced, relating reference data acquired by the industrial standard HPLC and UV methods, to vibrational spectra of the same, chemically diverse hops sample set. These models, produced from rapidly acquired infrared (IR), near-infrared (NIR), and Raman spectra, were appraised using standard statistical metrics. Results demonstrated that all three spectroscopic methods could be used for screening hops for α-acid, total bitter acids, and cohumulone concentrations in powdered hops. Models generated from Raman and IR spectra also showed potential for use in screening hops varieties for xanthohumol concentrations. NIR analysis was performed using both a standard benchtop spectrometer and a portable NIR spectrometer, with comparable results obtained by both instruments. Finally, some important vibrational features of cohumulone, colupulone, and xanthohumol were assigned using DFT calculations, which allow more insightful interpretation of PLS-R latent variable plots.

  14. Coupled catastrophes: sudden shifts cascade and hop among interdependent systems

    Science.gov (United States)

    Barnett, George; D'Souza, Raissa M.

    2015-01-01

    An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684

  15. Photometric evidence of electron precipitation induced by first hop whistlers

    International Nuclear Information System (INIS)

    Doolittle, J.H.; Carpenter, D.L.

    1983-01-01

    Electron precipitation events induced by discrete VLF whistler mode waves have previously been detected by photometers at Siple Station, Antarctica. This paper presents the first observations of ionospheric optical emissions correlated with VLF waves at the conjugate location, near Roberval, Quebec. Since most whistlers recorded at Siple or Roberval originate in the north, Roberval affords a clear perspective on the direct precipitation induced during the first pass of the wave as it propagates southward. For such a wave the direct precipitation and that induced in the ''mirrored mode'' by the returning two-hop wave should differ in arrival time by roughly twice the wave propagation time between hemispheres, while at Siple the effects of the direct and mirrored modes may overlap in time. A well defined series of observations of structured lambda4278 optical emissions was observed on August 30, 1979 in the aftermath of an intense magnetic storm. The optical emissions were found to lead the arrival time of the two-hop waves by about 0.7 s instead of lagging the local waves by about 1--2 s as had been previously observed for whistler driven events at Siple. The observed arrival time relationships are consistent with the predictions of a cyclotron resonance interaction model, and thus support previous observations of x-rays at Roberval. The importance of the first pass of the wave is further emphasized by an approximate proportionality between the amplitude of the VLF waves recorded at Siple and the intensity of the optical emission bursts at Roberval. Although structured optical emissions correlated with wave bursts can clearly be detected at Roberval, relatively large magnetospheric particle fluxes may be required to produce such events

  16. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    Science.gov (United States)

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  17. Agronomic performance and beer quality assessment of twenty hop cultivars grown in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Rossini

    2016-08-01

    Full Text Available Hop market and beer industry have always been of secondary relevance in Italy as compared to grape and wine sector. Hence, hop cultivars and the information for growing hops have been generated almost entirely from the major hop production countries. Identifying cultivars that perform well in Mediterranean environments is therefore essential to successfully start hop cultivation and breeding activity in this new growing region. To evaluate the intraspecific diversity of hop in Central Italy, 20 female hop genotypes with different origin were screened during three growing seasons (2013-2015 in an experimental hop yard. Cones yield, plant height and crop phenology were evaluated to determine which cultivars were best suited to the Mediterranean climate. Moreover, given the rising interest for the development of local beers with distinguishing aroma, a sensory analysis was performed and beers flavoured with locally produced and imported cones were compared. A significant diversity among cultivars was found for all parameters investigated. The results indicated that weather condition during flowering and development of cones markedly affected yield and plant height. Cones yield was negatively correlated with thermal time (r=–0.5, P<0.05 to harvest and positively with plant height (r=0.56, P<0.05. Cascade, Hallertauer Magnum, Hersbrucker Spat and Yeoman showed the best adaptability to the Mediterranean growing conditions as they were the top-performing cultivars across the three years. Sensory analysis evidenced the importance of cultivar selection as determining factor for flavouring properties of beers. In general, results showed that the origin of cones strongly affected the mouth feel of beers. More complex and appreciated aroma profiles were identified for beers flavoured with local cones than those hopped with commercial products.

  18. A functionally gradient variational porosity architecture for hollowed scaffolds fabrication

    Energy Technology Data Exchange (ETDEWEB)

    Khoda, A K M [Department of Industrial Engineering, University at Buffalo, Buffalo, NY 14260 (United States); Ozbolat, Ibrahim T [Department of Mechanical and Industrial Engineering, Center for Computer Aided Design, University of Iowa, Iowa City, IA 52242-1527 (United States); Koc, Bahattin, E-mail: bahattinkoc@sabanciuniv.edu [Faculty of Engineering and Natural Sciences, Sabanci University, Istanbul 34956 (Turkey)

    2011-09-15

    This paper presents a novel continuous tool-path planning methodology for hollowed scaffold fabrication in tissue engineering. A new functionally gradient porous architecture is proposed with a continuous material deposition planning scheme. A controllable variational pore size and hence the porosity have been achieved with a combination of two geometrically oriented consecutive layers. The desired porosity has been achieved with consecutive layers by geometrically partitioning each layer into sub-regions based on the area and the tissue scaffold design constraints. A continuous, interconnected and optimized tool-path for layers has been generated for a three-dimensional biomaterial deposition/printing process. A zigzag pattern tool-path has been proposed for an accumulated sub-region layer, and a concentric spiral-like optimal tool-path pattern has been generated for the successive layer to ensure continuity along the structure. Three-dimensional layers, formed by the proposed tool-path plan, vary the pore size and the porosity based on the biological and mechanical requirements. Several examples demonstrate the proposed methodology along with illustrative results. Also a comparative study between the proposed design and conventional Cartesian coordinate scaffolds has been performed. The results demonstrate a significant reduction in design error with the proposed method. Moreover, sample examples have been fabricated using a micro-nozzle biomaterial deposition system, and characterized for validation.

  19. A functionally gradient variational porosity architecture for hollowed scaffolds fabrication

    International Nuclear Information System (INIS)

    Khoda, A K M; Ozbolat, Ibrahim T; Koc, Bahattin

    2011-01-01

    This paper presents a novel continuous tool-path planning methodology for hollowed scaffold fabrication in tissue engineering. A new functionally gradient porous architecture is proposed with a continuous material deposition planning scheme. A controllable variational pore size and hence the porosity have been achieved with a combination of two geometrically oriented consecutive layers. The desired porosity has been achieved with consecutive layers by geometrically partitioning each layer into sub-regions based on the area and the tissue scaffold design constraints. A continuous, interconnected and optimized tool-path for layers has been generated for a three-dimensional biomaterial deposition/printing process. A zigzag pattern tool-path has been proposed for an accumulated sub-region layer, and a concentric spiral-like optimal tool-path pattern has been generated for the successive layer to ensure continuity along the structure. Three-dimensional layers, formed by the proposed tool-path plan, vary the pore size and the porosity based on the biological and mechanical requirements. Several examples demonstrate the proposed methodology along with illustrative results. Also a comparative study between the proposed design and conventional Cartesian coordinate scaffolds has been performed. The results demonstrate a significant reduction in design error with the proposed method. Moreover, sample examples have been fabricated using a micro-nozzle biomaterial deposition system, and characterized for validation.

  20. A functionally gradient variational porosity architecture for hollowed scaffolds fabrication.

    Science.gov (United States)

    Khoda, A K M; Ozbolat, Ibrahim T; Koc, Bahattin

    2011-09-01

    This paper presents a novel continuous tool-path planning methodology for hollowed scaffold fabrication in tissue engineering. A new functionally gradient porous architecture is proposed with a continuous material deposition planning scheme. A controllable variational pore size and hence the porosity have been achieved with a combination of two geometrically oriented consecutive layers. The desired porosity has been achieved with consecutive layers by geometrically partitioning each layer into sub-regions based on the area and the tissue scaffold design constraints. A continuous, interconnected and optimized tool-path for layers has been generated for a three-dimensional biomaterial deposition/printing process. A zigzag pattern tool-path has been proposed for an accumulated sub-region layer, and a concentric spiral-like optimal tool-path pattern has been generated for the successive layer to ensure continuity along the structure. Three-dimensional layers, formed by the proposed tool-path plan, vary the pore size and the porosity based on the biological and mechanical requirements. Several examples demonstrate the proposed methodology along with illustrative results. Also a comparative study between the proposed design and conventional Cartesian coordinate scaffolds has been performed. The results demonstrate a significant reduction in design error with the proposed method. Moreover, sample examples have been fabricated using a micro-nozzle biomaterial deposition system, and characterized for validation.

  1. Promiscuous 2-aminothiazoles (PrATs): a frequent hitting scaffold.

    Science.gov (United States)

    Devine, Shane M; Mulcair, Mark D; Debono, Cael O; Leung, Eleanor W W; Nissink, J Willem M; Lim, San Sui; Chandrashekaran, Indu R; Vazirani, Mansha; Mohanty, Biswaranjan; Simpson, Jamie S; Baell, Jonathan B; Scammells, Peter J; Norton, Raymond S; Scanlon, Martin J

    2015-02-12

    We have identified a class of molecules, known as 2-aminothiazoles (2-ATs), as frequent-hitting fragments in biophysical binding assays. This was exemplified by 4-phenylthiazol-2-amine being identified as a hit in 14/14 screens against a diverse range of protein targets, suggesting that this scaffold is a poor starting point for fragment-based drug discovery. This prompted us to analyze this scaffold in the context of an academic fragment library used for fragment-based drug discovery (FBDD) and two larger compound libraries used for high-throughput screening (HTS). This analysis revealed that such "promiscuous 2-aminothiazoles" (PrATs) behaved as frequent hitters under both FBDD and HTS settings, although the problem was more pronounced in the fragment-based studies. As 2-ATs are present in known drugs, they cannot necessarily be deemed undesirable, but the combination of their promiscuity and difficulties associated with optimizing them into a lead compound makes them, in our opinion, poor scaffolds for fragment libraries.

  2. Exploring the role of conceptual scaffolding in solving synthesis problems

    Directory of Open Access Journals (Sweden)

    Lin Ding1,*

    2011-10-01

    Full Text Available It is well documented that when solving problems experts first search for underlying concepts while students tend to look for equations and previously worked examples. The overwhelming majority of end-of-chapter (EOC problems in most introductory physics textbooks contain only material and examples discussed in a single chapter, rarely requiring a solver to conduct a general search for underlying concepts. Hypothesizing that complete reliance on EOC problems trains students to rely on a nonexpert approach, we designed and implemented “synthesis” problems, each combining two major concepts that are broadly separated in the teaching timeline. To provide students with guided conceptual scaffolding, we encapsulated each synthesis problem into a sequence with two preceding conceptually based multiple-choice questions. Each question contained one of the major concepts covered in the subsequent synthesis problem. Results from a small-scale interview study and two large-scale written tests showed that the scaffolding encouraged students to search for and apply appropriate fundamental principles in solving synthesis problems, and that repeated training using scaffolded synthesis problems also helped students to make cross-topic transfers.

  3. Optimal Design of Dual-Hop VLC/RF Communication System With Energy Harvesting

    KAUST Repository

    Rakia, Tamer

    2016-07-28

    In this letter, we consider a dual-hop heterogeneous visible light communication (VLC)/radio frequency (RF) communication system to extend the coverage of VLC systems. Besides detecting the information over VLC link, the relay is able to harvest energy from the first-hop VLC link, by extracting the direct current component of the received optical signal, and uses the harvested energy to retransmit the data to a mobile terminal over the second-hop RF link. We investigate the optimal design of the hybrid system in terms of data rate maximization.

  4. Fabrication and characterization of PCL/gelatin composite nanofibrous scaffold for tissue engineering applications by electrospinning method

    International Nuclear Information System (INIS)

    Gautam, Sneh; Dinda, Amit Kumar; Mishra, Narayan Chandra

    2013-01-01

    In the present study, composite nanofibrous tissue engineering-scaffold consisting of polycaprolactone and gelatin, was fabricated by electrospinning method, using a new cost-effective solvent mixture: chloroform/methanol for polycaprolactone (PCL) and acetic acid for gelatin. The morphology of the nanofibrous scaffold was investigated by using field emission scanning electron microscopy (FE-SEM) which clearly indicates that the morphology of nanofibers was influenced by the weight ratio of PCL to gelatin in the solution. Uniform fibers were produced only when the weight ratio of PCL/gelatin is sufficiently high (10:1). The scaffold was further characterized by Fourier transform infrared (FT-IR) spectroscopy, thermogravimetric (TG) analysis, and X-ray diffraction (XRD). FT-IR and TG analysis indicated some interactions between PCL and gelatin molecules within the scaffold, while XRD results demonstrated crystalline nature of PCL/gelatin composite scaffold. Cytotoxicity effect of scaffold on L929 mouse fibroblast cells was evaluated by MTT assay and cell proliferation on the scaffold was confirmed by DNA quantification. Positive results of MTT assay and DNA quantification L929 mouse fibroblast cells indicated that the scaffold made from the combination of natural polymer (gelatin) and synthetic polymer (PCL) may serve as a good candidate for tissue engineering applications. - Highlights: ► PCL/Gelatin scaffold was successfully fabricated by electrospinning method. ► PCL in CHCl 3 /CH 3 OH and gelatin in acetic acid: a novel polymer-solvent system. ► The morphology of nanofibers was influenced by the weight ratio of PCL/gelatin. ► Chemical interactions between PCL and gelatin molecules enhanced cell growth. ► Cell culture studies indicate the suitability of scaffold for tissue regeneration

  5. Chitosan scaffolds induce human dental pulp stem cells to neural differentiation: potential roles for spinal cord injury therapy.

    Science.gov (United States)

    Zhang, Jinlong; Lu, Xiaohui; Feng, Guijuan; Gu, Zhifeng; Sun, Yuyu; Bao, Guofeng; Xu, Guanhua; Lu, Yuanzhou; Chen, Jiajia; Xu, Lingfeng; Feng, Xingmei; Cui, Zhiming

    2016-10-01

    Cell-based transplantation strategies hold great potential for spinal cord injury (SCI) repair. Chitosan scaffolds have therapeutic benefits for spinal cord regeneration. Human dental pulp stem cells (DPSCs) are abundant available stem cells with low immunological incompatibility and can be considered for cell replacement therapy. The purpose of this study is to investigate the role of chitosan scaffolds in the neural differentiation of DPSCs in vitro and to assess the supportive effects of chitosan scaffolds in an animal model of SCI. DPSCs were incubated with chitosan scaffolds. Cell viability and the secretion of neurotrophic factors were analyzed. DPSCs incubated with chitosan scaffolds were treated with neural differentiation medium for 14 days and then neural genes and protein markers were analyzed by Western blot and reverse transcription plus the polymerase chain reaction. Our study revealed a higher cell viability and neural differentiation in the DPSC/chitosan-scaffold group. Compared with the control group, the levels of BDNF, GDNF, b-NGF, and NT-3 were significantly increased in the DPSC/chitosan-scaffold group. The Wnt/β-catenin signaling pathway played a key role in the neural differentiation of DPSCs combined with chitosan scaffolds. Transplantation of DPSCs together with chitosan scaffolds into an SCI rat model resulted in the marked recovery of hind limb locomotor functions. Thus, chitosan scaffolds were non-cytotoxic and provided a conducive and favorable microenvironment for the survival and neural differentiation of DPSCs. Transplantation of DPSCs might therefore be a suitable candidate for treating SCI and other neuronal degenerative diseases.

  6. Teenaged Internet Tutors' Use of Scaffolding with Older Learners

    Science.gov (United States)

    Tambaum, Tiina

    2017-01-01

    This study analyses how teenaged instructors paired with older learners make use of scaffolding. Video data were categorised according to 15 types of direct scaffolding tactics, indirect scaffolding, and unused scaffolding opportunities. The results show that a teenager who is unprepared for the role of an instructor of Internet skills for older…

  7. Effect of oxidative stress on homer scaffolding proteins.

    Directory of Open Access Journals (Sweden)

    Igor Nepliouev

    Full Text Available Homer proteins are a family of multifaceted scaffolding proteins that participate in the organization of signaling complexes at the post-synaptic density and in a variety of tissues including striated muscle. Homer isoforms form multimers via their C-terminal coiled coil domains, which allows for the formation of a polymeric network in combination with other scaffolding proteins. We hypothesized that the ability of Homer isoforms to serve as scaffolds would be influenced by oxidative stress. We have found by standard SDS-PAGE of lysates from adult mouse skeletal muscle exposed to air oxidation that Homer migrates as both a dimer and monomer in the absence of reducing agents and solely as a monomer in the presence of a reducing agent, suggesting that Homer dimers exposed to oxidation could be modified by the presence of an inter-molecular disulfide bond. Analysis of the peptide sequence of Homer 1b revealed the presence of only two cysteine residues located adjacent to the C-terminal coiled-coil domain. HEK 293 cells were transfected with wild-type and cysteine mutant forms of Homer 1b and exposed to oxidative stress by addition of menadione, which resulted in the formation of disulfide bonds except in the double mutant (C246G, C365G. Exposure of myofibers from adult mice to oxidative stress resulted in decreased solubility of endogenous Homer isoforms. This change in solubility was dependent on disulfide bond formation. In vitro binding assays revealed that cross-linking of Homer dimers enhanced the ability of Homer 1b to bind Drebrin, a known interacting partner. Our results show that oxidative stress results in disulfide cross-linking of Homer isoforms and loss of solubility of Homer scaffolds. This suggests that disulfide cross-linking of a Homer polymeric network may contribute to the pathophysiology seen in neurodegenerative diseases and myopathies characterized by oxidative stress.

  8. Titanate nanotube coatings on biodegradable photopolymer scaffolds

    Energy Technology Data Exchange (ETDEWEB)

    Beke, S., E-mail: szabolcs.beke@iit.it [Department of Nanophysics, Istituto Italiano di Tecnologia, via Morego 30, 16163 Genova (Italy); Kőrösi, L. [Department of Biotechnology, Nanophage Therapy Center, Enviroinvest Corporation, Kertváros u. 2, H-7632, Pécs (Hungary); Scarpellini, A. [Department of Nanochemistry, Istituto Italiano di Tecnologia, via Morego 30, 16163 Genova (Italy); Anjum, F.; Brandi, F. [Department of Nanophysics, Istituto Italiano di Tecnologia, via Morego 30, 16163 Genova (Italy)

    2013-05-01

    Rigid, biodegradable photopolymer scaffolds were coated with titanate nanotubes (TNTs) by using a spin-coating method. TNTs were synthesized by a hydrothermal process at 150 °C under 4.7 bar ambient pressure. The biodegradable photopolymer scaffolds were produced by mask-assisted excimer laser photocuring at 308 nm. For scaffold coating, a stable ethanolic TNT sol was prepared by a simple colloid chemical route without the use of any binding compounds or additives. Scanning electron microscopy along with elemental analysis revealed that the scaffolds were homogenously coated by TNTs. The developed TNT coating can further improve the surface geometry of fabricated scaffolds, and therefore it can further increase the cell adhesion. Highlights: ► Biodegradable scaffolds were produced by mask-assisted UV laser photocuring. ► Titanate nanotube deposition was carried out without binding compounds or additives. ► The titanate nanotube coating can further improve the surface geometry of scaffolds. ► These reproducible platforms will be of high importance for biological applications.

  9. Scaffold translation: barriers between concept and clinic.

    Science.gov (United States)

    Hollister, Scott J; Murphy, William L

    2011-12-01

    Translation of scaffold-based bone tissue engineering (BTE) therapies to clinical use remains, bluntly, a failure. This dearth of translated tissue engineering therapies (including scaffolds) remains despite 25 years of research, research funding totaling hundreds of millions of dollars, over 12,000 papers on BTE and over 2000 papers on BTE scaffolds alone in the past 10 years (PubMed search). Enabling scaffold translation requires first an understanding of the challenges, and second, addressing the complete range of these challenges. There are the obvious technical challenges of designing, manufacturing, and functionalizing scaffolds to fill the Form, Fixation, Function, and Formation needs of bone defect repair. However, these technical solutions should be targeted to specific clinical indications (e.g., mandibular defects, spine fusion, long bone defects, etc.). Further, technical solutions should also address business challenges, including the need to obtain regulatory approval, meet specific market needs, and obtain private investment to develop products, again for specific clinical indications. Finally, these business and technical challenges present a much different model than the typical research paradigm, presenting the field with philosophical challenges in terms of publishing and funding priorities that should be addressed as well. In this article, we review in detail the technical, business, and philosophical barriers of translating scaffolds from Concept to Clinic. We argue that envisioning and engineering scaffolds as modular systems with a sliding scale of complexity offers the best path to addressing these translational challenges. © Mary Ann Liebert, Inc.

  10. Inverse Opal Scaffolds and Their Biomedical Applications.

    Science.gov (United States)

    Zhang, Yu Shrike; Zhu, Chunlei; Xia, Younan

    2017-09-01

    Three-dimensional porous scaffolds play a pivotal role in tissue engineering and regenerative medicine by functioning as biomimetic substrates to manipulate cellular behaviors. While many techniques have been developed to fabricate porous scaffolds, most of them rely on stochastic processes that typically result in scaffolds with pores uncontrolled in terms of size, structure, and interconnectivity, greatly limiting their use in tissue regeneration. Inverse opal scaffolds, in contrast, possess uniform pores inheriting from the template comprised of a closely packed lattice of monodispersed microspheres. The key parameters of such scaffolds, including architecture, pore structure, porosity, and interconnectivity, can all be made uniform across the same sample and among different samples. In conjunction with a tight control over pore sizes, inverse opal scaffolds have found widespread use in biomedical applications. In this review, we provide a detailed discussion on this new class of advanced materials. After a brief introduction to their history and fabrication, we highlight the unique advantages of inverse opal scaffolds over their non-uniform counterparts. We then showcase their broad applications in tissue engineering and regenerative medicine, followed by a summary and perspective on future directions. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Multilayer scaffolds in orthopaedic tissue engineering.

    Science.gov (United States)

    Atesok, Kivanc; Doral, M Nedim; Karlsson, Jon; Egol, Kenneth A; Jazrawi, Laith M; Coelho, Paulo G; Martinez, Amaury; Matsumoto, Tomoyuki; Owens, Brett D; Ochi, Mitsuo; Hurwitz, Shepard R; Atala, Anthony; Fu, Freddie H; Lu, Helen H; Rodeo, Scott A

    2016-07-01

    The purpose of this study was to summarize the recent developments in the field of tissue engineering as they relate to multilayer scaffold designs in musculoskeletal regeneration. Clinical and basic research studies that highlight the current knowledge and potential future applications of the multilayer scaffolds in orthopaedic tissue engineering were evaluated and the best evidence collected. Studies were divided into three main categories based on tissue types and interfaces for which multilayer scaffolds were used to regenerate: bone, osteochondral junction and tendon-to-bone interfaces. In vitro and in vivo studies indicate that the use of stratified scaffolds composed of multiple layers with distinct compositions for regeneration of distinct tissue types within the same scaffold and anatomic location is feasible. This emerging tissue engineering approach has potential applications in regeneration of bone defects, osteochondral lesions and tendon-to-bone interfaces with successful basic research findings that encourage clinical applications. Present data supporting the advantages of the use of multilayer scaffolds as an emerging strategy in musculoskeletal tissue engineering are promising, however, still limited. Positive impacts of the use of next generation scaffolds in orthopaedic tissue engineering can be expected in terms of decreasing the invasiveness of current grafting techniques used for reconstruction of bone and osteochondral defects, and tendon-to-bone interfaces in near future.

  12. Evaluation of PLC Channel Capacity and ABER Performances for OFDM-Based Two-Hop Relaying Transmission

    Directory of Open Access Journals (Sweden)

    Sana Ezzine

    2017-01-01

    Full Text Available Powerline network is recognized as a favorable infrastructure for Smart Grid to transmit information in the network thanks to its broad coverage and low cost deployment. The existing works are trying to improve and adapt transmission techniques to reduce Powerline Communication (PLC channel attenuation and exploit the limited bandwidth to support high data rate over long distances. Two-hop relaying BroadBand PLC (BB-PLC system, in which Orthogonal Frequency Division Multiplexing (OFDM is used, is considered in this paper. We derive and compare the PLC channel capacity and the end-to-end Average BER (ABER for OFDM-based direct link (DL BB-PLC system and for OFDM-based two-hop relaying BB-PLC system for Amplify and Forward (AF and Decode and Forward (DF protocols. We analyze the improvements when we consider the direct link in a cooperative communication when the relay node only transmits the correctly decoded signal. Maximum ratio combining is employed at the destination node to detect the transmitted signal. In addition, in this paper, we highlight the impact of the relay location on the channel capacity and ABER for AF and DF transmission protocols. Moreover, an efficient use of the direct link was also investigated in this paper.

  13. Scaffolding With and Through Videos

    DEFF Research Database (Denmark)

    Otrel-Cass, Kathrin; Khoo, Elaine; Cowie, Bronwen

    2012-01-01

    In New Zealand and internationally claims are being made about the potential for information and communication technologies (ICTs) to transform teaching and learning. However, the theoretical underpinnings explaining the complex interplay between the content, pedagogy and technology a teacher needs...... to scaffold learning. It showcases the intricate interplay between teachers’ knowledge about content, digital video technology, and students’ learning needs based on a qualitative study of two science teachers and their students in a New Zealand primary school....... to consider must be expanded. This article explicates theoretical and practical ideas related to teachers’ application of their ICT technology, pedagogy, and content knowledge (TPACK) in science. The article unpacks the social and technological dimensions of teachers’ use of TPACK when they use digital videos...

  14. Semiotic Scaffolding in Living Systems

    DEFF Research Database (Denmark)

    Hoffmeyer, Jesper

    2008-01-01

    The apparently purposeful nature of living systems is obtained through a sophisticated network of semiotic controls whereby biochemical, physiological and behavioral processes become tuned to the needs of the system. The operation of these semiotic controls takes place and is enabled across...... a diversity of levels. Such semiotic controls may be distinguished from ordinary deterministic control mechanisms through an inbuilt anticipatory capacity based on a distinct kind of causation that I call here "semiotic causation" to denote the bringing about of changes under the guidance of interpretation...... in a local .context. Anticipation through the skilled interpretation of indicators of temporal relations in the context of a particular survival project (or life strategy) guides organismic behavior towards local ends. This network of semiotic controls establishes an enormously complex semiotic scaffolding...

  15. Computational Exploration of Molecular Scaffolds in Medicinal Chemistry.

    Science.gov (United States)

    Hu, Ye; Stumpfe, Dagmar; Bajorath, Jürgen

    2016-05-12

    The scaffold concept is widely applied in medicinal chemistry. Scaffolds are mostly used to represent core structures of bioactive compounds. Although the scaffold concept has limitations and is often viewed differently from a chemical and computational perspective, it has provided a basis for systematic investigations of molecular cores and building blocks, going far beyond the consideration of individual compound series. Over the past 2 decades, alternative scaffold definitions and organization schemes have been introduced and scaffolds have been studied in a variety of ways and increasingly on a large scale. Major applications of the scaffold concept include the generation of molecular hierarchies, structural classification, association of scaffolds with biological activities, and activity prediction. This contribution discusses computational approaches for scaffold generation and analysis, with emphasis on recent developments impacting medicinal chemistry. A variety of scaffold-based studies are discussed, and a perspective on scaffold methods is provided.

  16. Fabrication of tissue engineering scaffolds through solid-state foaming of immiscible polymer blends

    International Nuclear Information System (INIS)

    Zhou Changchun; Li Wei; Ma Liang; Yao Donggang

    2011-01-01

    In scaffold-based tissue engineering, the fabrication process is important for producing suitable microstructures for seeded cells to grow and reformulate. In this paper, we present a new approach to scaffold fabrication by combining the solid-state foaming and the immiscible polymer-blending method. The proposed approach has the advantage of being versatile and able to create a wide range of pore size and porosity. The proposed method is studied with polylactic acid (PLA) and polystyrene (PS) blends. The interconnected porous structure was created by first foaming the PLA/PS blend and then extracting the PS phase. The solid-state foaming experiments were conducted under various conditions to achieve the desired pore sizes. It is shown that the PS phase of the PLA/PS blend can be extracted much faster in the foamed samples and the pore size of the scaffolds can be easily controlled with proper gas foaming parameters. The average pore size achieved in the foaming process ranged from 20 to 70 μm. After PS extraction, both pore size and porosity can be further improved. For example, the pore size and porosity increased from 48 μm and 49% to 59 μm and 67%, respectively, after the PS extraction process. The fabricated porous scaffolds were used to culture human osteoblast cells. Cells grew well and gradually formed a fibrous structure. The combined solid-state foaming and immiscible polymer blending method provides a new technique for fabricating tissue-engineering scaffolds.

  17. 3D polylactide-based scaffolds for studying human hepatocarcinoma processes in vitro

    International Nuclear Information System (INIS)

    Scaffaro, Roberto; Lo Re, Giada; Rigogliuso, Salvatrice; Ghersi, Giulio

    2012-01-01

    We evaluated the combination of leaching techniques and melt blending of polymers and particles for the preparation of highly interconnected three-dimensional polymeric porous scaffolds for in vitro studies of human hepatocarcinoma processes. More specifically, sodium chloride and poly(ethylene glycol) (PEG) were used as water-soluble porogens to form porous and solvent-free poly(L,D-lactide) (PLA)-based scaffolds. Several characterization techniques, including porosimetry, image analysis and thermogravimetry, were combined to improve the reliability of measurements and mapping of the size, distribution and microarchitecture of pores. We also investigated the effect of processing, in PLA-based blends, on the simultaneous bulk/surface modifications and pore architectures in the scaffolds, and assessed the effects on human hepatocarcinoma viability and cell adhesion. The influence of PEG molecular weight on the scaffold morphology and cell viability and adhesion were also investigated. Morphological studies indicated that it was possible to obtain scaffolds with well-interconnected pores of assorted sizes. The analysis confirmed that SK-Hep1 cells adhered well to the polymeric support and emitted surface protrusions necessary to grow and differentiate three-dimensional systems. PEGs with higher molecular weight showed the best results in terms of cell adhesion and viability. (paper)

  18. 3D polylactide-based scaffolds for studying human hepatocarcinoma processes in vitro

    Science.gov (United States)

    Scaffaro, Roberto; Lo Re, Giada; Rigogliuso, Salvatrice; Ghersi, Giulio

    2012-08-01

    We evaluated the combination of leaching techniques and melt blending of polymers and particles for the preparation of highly interconnected three-dimensional polymeric porous scaffolds for in vitro studies of human hepatocarcinoma processes. More specifically, sodium chloride and poly(ethylene glycol) (PEG) were used as water-soluble porogens to form porous and solvent-free poly(L,D-lactide) (PLA)-based scaffolds. Several characterization techniques, including porosimetry, image analysis and thermogravimetry, were combined to improve the reliability of measurements and mapping of the size, distribution and microarchitecture of pores. We also investigated the effect of processing, in PLA-based blends, on the simultaneous bulk/surface modifications and pore architectures in the scaffolds, and assessed the effects on human hepatocarcinoma viability and cell adhesion. The influence of PEG molecular weight on the scaffold morphology and cell viability and adhesion were also investigated. Morphological studies indicated that it was possible to obtain scaffolds with well-interconnected pores of assorted sizes. The analysis confirmed that SK-Hep1 cells adhered well to the polymeric support and emitted surface protrusions necessary to grow and differentiate three-dimensional systems. PEGs with higher molecular weight showed the best results in terms of cell adhesion and viability.

  19. Plasmodium falciparum Hop (PfHop Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    Directory of Open Access Journals (Sweden)

    Tawanda Zininga

    Full Text Available Heat shock proteins (Hsps play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70 is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90 facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop. We previously characterised the Hop protein from Plasmodium falciparum (PfHop. We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we

  20. Analog series-based scaffolds: computational design and exploration of a new type of molecular scaffolds for medicinal chemistry

    Science.gov (United States)

    Dimova, Dilyana; Stumpfe, Dagmar; Hu, Ye; Bajorath, Jürgen

    2016-01-01

    Aim: Computational design of and systematic search for a new type of molecular scaffolds termed analog series-based scaffolds. Materials & methods: From currently available bioactive compounds, analog series were systematically extracted, key compounds identified and new scaffolds isolated from them. Results: Using our computational approach, more than 12,000 scaffolds were extracted from bioactive compounds. Conclusion: A new scaffold definition is introduced and a computational methodology developed to systematically identify such scaffolds, yielding a large freely available scaffold knowledge base. PMID:28116132