WorldWideScience

Sample records for sarawak eastern malaysia

  1. Liquid hydrocarbon generation potential from Tertiary Nyalau Formation coals in the onshore Sarawak, Eastern Malaysia

    Science.gov (United States)

    Hakimi, Mohammed Hail; Abdullah, Wan Hasiah

    2013-01-01

    Tertiary coals exposed in the north-central part of onshore Sarawak are evaluated, and their depositional environments are interpreted. Total organic carbon contents (TOC) of the coals range from 58.1 to 80.9 wt. % and yield hydrogen index values ranging from 282 to 510 mg HC/g TOC with low oxygen index values, consistent with Type II and mixed Type II-III kerogens. The coal samples have vitrinite reflectance values in the range of 0.47-0.67 Ro %, indicating immature to early mature (initial oil window). T max values range from 428 to 436 °C, which are good in agreement with vitrinite reflectance data. The Tertiary coals are humic and generally dominated by vitrinite, with significant amounts of liptinite and low amounts of inertinite macerals. Good liquid hydrocarbons generation potential can be expected from the coals with rich liptinitic content (>35 %). This is supported by their high hydrogen index of up to 300 mg HC/g TOC and Py-GC ( S 2) pyrograms with n-alkane/alkene doublets extending beyond C30. The Tertiary coals are characterised by dominant odd carbon numbered n-alkanes ( n-C23 to n-C33), high Pr/Ph ratio (6-8), high T m / T s ratio (8-16), and predominant regular sterane C29. All biomarkers parameters clearly indicate that the organic matter was derived from terrestrial inputs and the deposited under oxic condition.

  2. Odonata of Maludam National Park, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Rory A. Dow

    2015-01-01

    Full Text Available This paper presents records of Odonata collected in July 2012 in Maludam National Park, Sarawak, Malaysia. A total of 48 species from nine families were collected. Three species were new to science, one of which has already been described as Prodasineura yulan Dow & Ngiam, which may be endemic to Maludam. In addition, Maludam is only the second locality recorded in Sarawak for four poorly known species: Pachycypha aurea, Macrogomphus decemlineatus, Brachygonia ophelia and Brachygonia puella. Two of these species, Macrogomphus decemlineatus and Brachygonia ophelia, are recorded for the first time in Sarawak in more than 100 years. 

  3. Publications on Borneo from Universiti Malaysia Sarawak, 2001-2002

    OpenAIRE

    Sellato, Bernard

    2013-01-01

    The Institute of East Asian Studies (IEAS) was created at the Universiti Malaysia Sarawak (UNIMAS) in 1998 with Professor Michael Leigh as its inaugural Director. Michael Leigh is a long-time scholar of Sarawak. His earlier publications include: The Chinese Community of Sarawak: a Study of Communal Relations (1964), The Rising Moon: Political Change in Sarawak (1974), and Council Negri Sarawak, Malaysia’s Oldest Legislature (1992). It was after a long career in Australia (University of Sydney...

  4. English Teaching Profile: Sarawak--Malaysia.

    Science.gov (United States)

    British Council, London (England). English Language and Literature Div.

    This review of the status of English language instruction in Sarawak, Malaysia, provides an overview of the role of English in the society in general and outlines the status of English use and instruction in the educational system at all levels (preprimary, elementary, secondary, higher, vocational, adult, and teacher education). Topics covered…

  5. Cardiff acne disability index in Sarawak, Malaysia.

    Science.gov (United States)

    Yap, Felix Boon-Bin

    2012-05-01

    Acne is considered a cosmetic nuisance in Malaysia since no insurance coverage is provided for its treatment. Its psychological impact is unknown. The aim of this study is to determine the impact of acne on quality of life and its relationship with severity. A cross-sectional study using the Cardiff acne disability index (CADI) and Global Acne Grading System for acne severity grading was done in three government-run dermatology clinics in Sarawak, Malaysia. The study cohort of 200 patients had a mean CADI score of 5.1. Most of the patients (59.5%) had mild CADI impairment, with the domain of feelings most affected. Patients with a family income 0.05). The correlation between CADI and mild acne severity was low (Pearson correlation coefficient=0.35; pSarawak was moderate and must be addressed. It should be viewed as a psychologically disabling disease requiring optimal management and resource allocation.

  6. Students Awareness towards Traditional Cultural Dances in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Ahmad R. Albattat

    2016-07-01

    Full Text Available Malaysia has many ethnic groups, and each ethnic group has own custom and tradition that most Malaysians are not aware, especially traditional dances. Among the Malaysian states, Sabah and Sarawak, situated in the Borneo Island have the most diverse ethnic groups in Sarawak. It has more than 30 ethnic groups. Each of the ethnic groups has its own language, cultures and lifestyle. In this regards, this research focuses on the main ethnic groups of Sarawak which are Orang Ulu, Malays, Melanau, Bidayuh, Chinese and Ibans. The aim of this study is to investigate the level of awareness among the Management and Science University (MSU students regarding their level of awareness and knowledge about traditional dances of Sarawak. The data were gathered by distributing questionnaires among MSU students. The data were then analysed using SPSS system version 18.0. Results concluded that, most of MSU students have limited knowledge about Sarawak traditional dances. Interests, internet, performing arts clubs and family background are the independent variable factors to learn and gain knowledge about Sarawak traditional dances. The level of awareness among MSU students towards Sarawak traditional dances can be enhanced through events and special occasions to increase level of awareness towards Sarawak cultures. The government plays a major role in introducing Sarawak cultures to the whole of Malaysia. Future studies could focus on factors that influence the level of awareness towards Sarawak traditional dances, and the contribution of Sarawak’s traditional dances to Malaysia’s cultural and heritage tourism.

  7. Environmental Management Systems (EMS Adoption in Sarawak (Malaysia: Implementation Motivations

    Directory of Open Access Journals (Sweden)

    Lee Lee Ho

    2017-09-01

    Full Text Available Environmental management has been in the process of evolution since Industrial Revolutions of 18th and 19th centuries. And the more recent is the development of international environmental management standards and guidelines to facilitate global trade. These environmental management standards and guidelines are usually known as Environmental Management Systems (EMS. This research investigates the implementation motivations in relation to EMS adoption in Sarawak, Malaysia organizations. Empirical findings of a survey on the above in Sarawak organizations are presented. About 112 survey questionnaires invitations were forwarded to various organizations in Sarawak and a total of 47 responses were received. The results of this research show that among the Sarawak organizations, the top three implementation motivations or benefits from implementing EMS according to their importance by the Sarawak EMS user’s organizations are 1 Legal compliance as the top benefit of EMS implementation; 2 Improvement in operational environmental protection; and 3 Corporate image advantages.

  8. Iodine deficiency disorders in Sarawak, Malaysia.

    Science.gov (United States)

    Kiyu, A; Tambi, Z; Ahmad, Y

    1998-12-01

    The state of Sarawak in Malaysia has a high prevalence of iodine deficiency disorders (IDD). This has been revealed through a review of goitre surveys that were carried out in the State from the early 1970s to the 1990s. The primary cause was low iodine intake. Contributory factors were low iodine content in the soil and water as well as high cassava consumption. Virtual elimination of IDD is one of the nutritional goals of the IDD prevention and control programs. The strategies adopted include the iodination of coarse salt, which is sold in the market by shopkeepers and also provided free from government health clinics; legislation requiring that salt sold in IDD-gazetted areas must be iodised; and the use of iodinators to iodise water supplied by the gravity-feed system to villages and boarding schools in rural areas. The indicators used in the monitoring and evaluation of the program include the availability of iodised salt in the market and households, iodine levels in water supply that had been fitted with iodinators, goitre volume measured by ultrasound, and urinary iodine excretion among school children.

  9. Soil carbon stocks in Sarawak, Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Padmanabhan, E., E-mail: Eswaran_padmanabhan@petronas.com.my [Department of Geosciences, Faculty of Geosciences and Petroleum Engineering, Universiti Teknologi PETRONAS, Tronoh, 31750, Perak (Malaysia); Eswaran, H.; Reich, P.F. [USDA-Natural Resources Conservation Service, Washington, DC 20250 (United States)

    2013-11-01

    The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO{sub 2}, CH{sub 4}, and N{sub 2}O have an anthropic source and of these CO{sub 2} is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m{sup −2} m{sup −1}), while Oxisols and Ultisols rate second (about 10–15 kg m{sup −2} m{sup −1}). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1 m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m{sup −2} m{sup −1}. Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. - Highlights: • Soil carbon stocks in different soils in Sarawak • In depth discussion of

  10. Soil carbon stocks in Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Padmanabhan, E.; Eswaran, H.; Reich, P.F.

    2013-01-01

    The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO 2 , CH 4 , and N 2 O have an anthropic source and of these CO 2 is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m −2 m −1 ), while Oxisols and Ultisols rate second (about 10–15 kg m −2 m −1 ). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1 m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m −2 m −1 . Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. - Highlights: • Soil carbon stocks in different soils in Sarawak • In depth discussion of soil carbon pools in Histosols • Strategies

  11. Pediatric melioidosis in Sarawak, Malaysia: Epidemiological, clinical and microbiological characteristics.

    Science.gov (United States)

    Mohan, Anand; Podin, Yuwana; Tai, Nickson; Chieng, Chae-Hee; Rigas, Vanessa; Machunter, Barbara; Mayo, Mark; Wong, Desiree; Chien, Su-Lin; Tan, Lee-See; Goh, Charles; Bantin, Reginal; Mijen, Alexander; Chua, Wen-Yi; Hii, King-Ching; Wong, See-Chang; Ngian, Hie-Ung; Wong, Jin-Shyan; Hashim, Jamilah; Currie, Bart J; Ooi, Mong-How

    2017-06-01

    Melioidosis is a serious, and potentially fatal community-acquired infection endemic to northern Australia and Southeast Asia, including Sarawak, Malaysia. The disease, caused by the usually intrinsically aminoglycoside-resistant Burkholderia pseudomallei, most commonly affects adults with predisposing risk factors. There are limited data on pediatric melioidosis in Sarawak. A part prospective, part retrospective study of children aged Sarawak between 2009 and 2014. We examined epidemiological, clinical and microbiological characteristics. Forty-two patients were recruited during the 6-year study period. The overall annual incidence was estimated to be 4.1 per 100,000 children Sarawak has a very high incidence of pediatric melioidosis, caused predominantly by gentamicin-susceptible B. pseudomallei strains. Children frequently presented with disseminated disease and had an alarmingly high death rate, despite the absence of any apparent predisposing risk factor.

  12. Sarawak state elections 2016: revisiting federalism in Malaysia

    OpenAIRE

    Ali, Rashaad; Osman, Mohamed Nawab Mohamed

    2017-01-01

    The recent state elections in the Eastern Malaysian state of Sarawak in 2016 saw the ruling coalition, the Barisan Nasional, secure a comfortable victory through its component party, the Parti Pesaka Bumiputera Bersatu, led by the late Adenan Satem, who passed away suddenly on 11 January 2017. A key theme of Adenan’s election cam-paign was greater autonomy for the state of Sarawak, while he also distanced himself from the troubles of the Najib Razak administration and the federal government. ...

  13. Soil carbon stocks in Sarawak, Malaysia.

    Science.gov (United States)

    Padmanabhan, E; Eswaran, H; Reich, P F

    2013-11-01

    The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO2, CH4, and N2O have an anthropic source and of these CO2 is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m(-2) m(-1)), while Oxisols and Ultisols rate second (about 10-15 kg m(-2) m(-1)). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m(-2) m(-1). Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Population and economic development in Sarawak, Malaysia

    OpenAIRE

    Furuoka, Fumitaka

    2014-01-01

    This paper chooses a Malaysian state in Borneo Island, Sarawak, as the case study to examine the relationship between population growth and economic development. The findings imply that there is no statistically significant long-run relationship, but a causal relationship between population growth and economic development in Sarawak. In other words, the empirical findings indicate that population can have neither positive nor negative impact on economic development. The findings also indicate...

  15. Clinical presentation of nasopharyngeal carcinoma in Sarawak Malaysia.

    Science.gov (United States)

    Tiong, T S; Selva, K S

    2005-12-01

    Nasopharyngeal carcinoma (NPC) is a common cancer in Malaysia. The clinical presentation in Sarawak has not been well documented. A retrospective review of 213 selected NPC cases was undertaken on the clinical records in Sarawak General Hospital, Sarawak, from June 1999 to June 2003. There were 116 patients in Kuching and 97 in Serian. There were twice as many males as females. The youngest patient was 16 and the oldest 88 years old with a mean age of 51 years. The four most common symptoms in order of frequencies were cervical lymphadenopathy, epistaxis, hearing loss and diplopia. 80.8% of the patients presented with cervical lymphadenopathy and about 85% of the patients presented in the advanced stages. Very small percentages of the patients were found to have single presenting symptoms of epistaxis (2.4%) and hearing loss (0.5%).

  16. Comparison of termite assemblages along a landuse gradient on peat areas in Sarawak, Malaysia.

    NARCIS (Netherlands)

    Vaessen, T.; Verwer, C.; Demies, M.; Kaliang, H.; Meer, van der P.J.

    2011-01-01

    VAESSEN T, VERWER C, DEMIES M, KALIANG H & VAN DER MEER PJ. 2011. Comparison of termite assemblages along a landuse gradient on peat areas in Sarawak, Malaysia. In this study we assessed the species density and relative abundance of termites in peat land in Sarawak, Malaysia. Termites were

  17. Pediatric melioidosis in Sarawak, Malaysia: Epidemiological, clinical and microbiological characteristics.

    Directory of Open Access Journals (Sweden)

    Anand Mohan

    2017-06-01

    Full Text Available Melioidosis is a serious, and potentially fatal community-acquired infection endemic to northern Australia and Southeast Asia, including Sarawak, Malaysia. The disease, caused by the usually intrinsically aminoglycoside-resistant Burkholderia pseudomallei, most commonly affects adults with predisposing risk factors. There are limited data on pediatric melioidosis in Sarawak.A part prospective, part retrospective study of children aged <15 years with culture-confirmed melioidosis was conducted in the 3 major public hospitals in Central Sarawak between 2009 and 2014. We examined epidemiological, clinical and microbiological characteristics.Forty-two patients were recruited during the 6-year study period. The overall annual incidence was estimated to be 4.1 per 100,000 children <15 years, with marked variation between districts. No children had pre-existing medical conditions. Twenty-three (55% had disseminated disease, 10 (43% of whom died. The commonest site of infection was the lungs, which occurred in 21 (50% children. Other important sites of infection included lymph nodes, spleen, joints and lacrimal glands. Seven (17% children had bacteremia with no overt focus of infection. Delays in diagnosis and in melioidosis-appropriate antibiotic treatment were observed in nearly 90% of children. Of the clinical isolates tested, 35/36 (97% were susceptible to gentamicin. Of these, all 11 isolates that were genotyped were of a single multi-locus sequence type, ST881, and possessed the putative B. pseudomallei virulence determinants bimABp, fhaB3, and the YLF gene cluster.Central Sarawak has a very high incidence of pediatric melioidosis, caused predominantly by gentamicin-susceptible B. pseudomallei strains. Children frequently presented with disseminated disease and had an alarmingly high death rate, despite the absence of any apparent predisposing risk factor.

  18. PAEDIATRIC OCULAR TRAUMA IN KUCHING, SARAWAK, MALAYSIA

    Directory of Open Access Journals (Sweden)

    INTAN G

    2011-01-01

    Full Text Available Purpose: To evaluate the demography, aetiology, type and outcome of paediatric ocular trauma in tertiary centre in Malaysia. Method: We retrospectively studied 118 eyes from 117 patients over a period of 36 months (January 2006 to December 2008. All ocular injuries in patients aged 12 and below seen in the Ophthalmology Department for the first time were included in thisstudy. Results: Mean age of patients was 6.1±3.0 years. 68 cases (58.2% occurred in pre-school children, whereas 49 (41.9% in school-aged children. Boys accounted for 65.8% of cases. There was no predilection for either right or the left eye. 47% of cases (56 patients occurred in Malay. Most of the injuries took place at home when the children were alone (p<0.05. Sharp objects were the commonest cause (45 cases, 38.1%. The majority of cases (103, 87.3% were considered preventable. The frequency of open and closed globe injury was similar. Hyphema was more common in closed globe injury compared to open globe injury (p<0.05. Other associated injuries such as cataract, vitreous hemorrhage and retinal hemorrhage are similar between the two groups. Visual outcome is generally poor with only 34 eyes (28.8% had no visual impairment. Conclusion: Ocular trauma in children is an important cause of visual loss. Most cases occurred at home and were preventable. Prevention through education is the best approach.

  19. An Experimental Investigation of Karanja Biodiesel Production in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Dewi Harreh

    2018-01-01

    Full Text Available The application of nonedible feedstock for the production of biodiesel has become an area of research interest among clean energy experts in the past few years. This research is aimed at the utilization of Pongamia pinnata (karanja, a nonedible feedstock from the state of Sarawak, Malaysia, to produce biodiesel to be known as crude karanja oil (CKO. A one-step transesterification process utilizing 7 : 1–10 : 1 wt% methanol (CH3OH and 0.5–1.2 wt% sodium hydroxide (NaOH at 65°C for 1.5 hrs has been used for the biodiesel production yielding 84% conversion. The physiochemical properties of the CKO produced revealed that it conforms with EN14214 standards for brake power (BP, brake specific fuel consumption (BSFC, and brake thermal efficiency (BTE as they are all noted be optimal at B40.

  20. The Distribution and Population Density of Bornean Tarsier, "Tarsius Bancanus Borneanus (Elliot)" in Secondary and Rehabilitated Forests of Universiti Putra Malaysia, Bintulu Sarawak Campus, Sarawak, Malaysia.

    Science.gov (United States)

    Sahimi, Hani Nabilia Muhd; Chubo, John Keen; Top Mohd Tah, Marina Mohd; Saripuddin, Noor Bahiah; Ab Rahim, Siti Sarah

    2018-03-01

    Tarsius bancanus borneanus was first reported by Elliot in 1990 which an endemic species that can be found on the Island of Borneo consisting of Sabah and Sarawak of Malaysia, Brunei Darussalam and Kalimantan, Indonesia. This sub-species has been listed as a totally protected animal under the Sarawak Wild Life Protection Ordinance (1998) and vulnerable by the International Union for Conservation of Nature (IUCN). The present study was conducted at Universiti Putra Malaysia Bintulu Campus (UPMKB), Sarawak from October 2014 till March 2015. Through mark and recapture sampling covering an area of 37 ha of secondary forest patches and 7.13 ha of rehabilitated forest, a total of 16 tarsiers were captured using mist nets while one tarsier was recapture. The population density was 38 individuals/km 2 was captured using mist nets in the secondary forest while 28 individuals/km 2 was recorded for the rehabilitated forest. Using the catch per unit effort (net hour) method, the average time for capturing tarsiers in the secondary forest patches was 26.6 net hour per animal and 30.0 net hour per animal in the rehabilitated forest. The presented results provides information on the presence of tarsiers in both the secondary and rehabilitated forests of UPMKB, Sarawak, Malaysia which underlines the conservation value of these forested areas.

  1. Bioefficacy of Insect Growth Regulators Against Aedes albopictus (Diptera: Culicidea) From Sarawak, Malaysia: A Statewide Survey.

    Science.gov (United States)

    Lau, Koon Weng; Chen, Chee Dhang; Lee, Han Lim; Low, Van Lun; Sofian-Azirun, Mohd

    2018-05-28

    The susceptibility status of Aedes albopictus (Skuse; Diptera: Culicidea) larvae collected from 13 districts in Sarawak state, Malaysia was evaluated against five insect growth regulators (IGRs) namely, methoprene, pyriproxyfen, diflubenzuron, cyromazine, and novaluron. Field populations of Ae. albopictus were susceptible to methoprene, pyriproxyfen, cyromazine and novaluron with resistance ratios (RRs) ranging from 0.19-0.38, 0.05-0.14, 0.50-0.95, and 0.75-1.00, respectively. Nevertheless, tolerance towards diflubenzuron (0.33-1.33) was observed in this study. In general, these IGRs exhibited promising results and can be used as alternative control agents against field populations of Ae. albopictus in Sarawak, Malaysia.

  2. The menopausal experience among indigenous women of Sarawak, Malaysia.

    Science.gov (United States)

    Syed Alwi, S A R; Lee, P Y; Awi, I; Mallik, P S; Md Haizal, M N

    2009-12-01

    To document the common menopausal symptoms and quality of life in indigenous women of Sarawak in Malaysia. A face-to-face interview using the Menopause-specific Quality of Life questionnaire was conducted with 276 indigenous Sarawakian women aged 40-65 years to determine the mean age of menopause and common symptoms (divided into vasomotor, psychosocial, physical and sexual domains) associated with menopause. The mean age at menopause of postmenopausal women was 50.78 +/- 2.47 years (range 47.3-58.2 years). The most common symptoms reported were aching in muscles and joints (82.6%), lack of energy (77.5%) and low backache (77.2%). The typical menopausal symptoms of hot flushes, night sweats, sweating and vaginal dryness were experienced by 42.4%, 34.8%, 29.7% and 49.3%, respectively of the women studied. Perimenopausal women (n = 114) experienced the most physical and psychosocial symptoms, while postmenopausal women (n = 102) experienced most sexual symptoms. Perimenopausal and postmenopausal women were reported to suffer more than premenopausal women (p < 0.001) within the four domains of symptoms (vasomotor, psychosocial, physical and sexual). The menopausal symptoms in this study correspond to those in other studies on Asian women but the prevalence of typical and classical menopausal symptoms was lower compared to studies on Caucasian women. The perimenopausal women had the most significant decrease in quality of life, followed by postmenopausal women and premenopausal women. Vasomotor symptoms had a predominant influence on the quality of life.

  3. Public Awareness Program and Development of Education Toolkit for Green Sea Turtle Conservation in Sarawak, Malaysia

    Science.gov (United States)

    Hassan, Ruhana; Yahya, Nurhartini Kamalia; Ong, Leh Mui; Kheng, Lim Kian; Abidin, Zulkalnain Zainal; Ayob, Anuar; Jainal, Aslina Mohd

    2017-01-01

    Nobody knows exactly what happened during "the lost years" of the turtles in the wild, thus a green turtle headstarting project was carried out at Pantai Pandan, Lundu, Sarawak, Malaysia from June 2014 until December 2015 to shed some lights on the growth of hatchlings during a small part of their "lost years". As a consequent,…

  4. Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak)

    OpenAIRE

    Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

    2010-01-01

    There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presen...

  5. Temporal and spatial mapping of hand, foot and mouth disease in Sarawak, Malaysia.

    Science.gov (United States)

    Sham, Noraishah M; Krishnarajah, Isthrinayagy; Ibrahim, Noor Akma; Lye, Munn-Sann

    2014-05-01

    Hand, foot and mouth disease (HFMD) is endemic in Sarawak, Malaysia. In this study, a geographical information system (GIS) was used to investigate the relationship between the reported HFMD cases and the spatial patterns in 11 districts of Sarawak from 2006 to 2012. Within this 7-years period, the highest number of reported HFMD cases occurred in 2006, followed by 2012, 2008, 2009, 2007, 2010 and 2011, in descending order. However, while there was no significant distribution pattern or clustering in the first part of the study period (2006 to 2011) based on Moran's I statistic, spatial autocorrelation (P = 0.068) was observed in 2012.

  6. Haplotype diversity of 17 Y-chromosomal STRs in three native Sarawak populations (Iban, Bidayuh and Melanau) in East Malaysia.

    Science.gov (United States)

    Chang, Yuet Meng; Swaran, Yuvaneswari; Phoon, Yoong Keat; Sothirasan, Kavin; Sim, Hang Thiew; Lim, Kong Boon; Kuehn, Daniel

    2009-06-01

    17 Y-STRs (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) have been analyzed in 320 male individuals from Sarawak, an eastern state of Malaysia on the Borneo island using the AmpFlSTR Y-filer (Applied Biosystems, Foster City, CA). These individuals were from three indigenous ethnic groups in Sarawak comprising of 103 Ibans, 113 Bidayuhs and 104 Melanaus. The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three groups. Analysis of molecular variance (AMOVA) indicated that 87.6% of the haplotypic variation was found within population and 12.4% between populations (fixation index F(ST)=0.124, p=0.000). This study has revealed that the indigenous populations in Sarawak are distinctly different to each other, and to the three major ethnic groups in Malaysia (Malays, Chinese and Indians), with the Melanaus having a strikingly high degree of shared haplotypes within. There are rare unusual variants and microvariants that were not present in Malaysian Malay, Chinese or Indian groups. In addition, occurrences of DYS385 duplications which were only noticeably present in Chinese group previously was also observed in the Iban group whilst null alleles were detected at several Y-loci (namely DYS19, DYS392, DYS389II and DYS448) in the Iban and Melanau groups.

  7. Distribution of Linear Alkylbenzenes (LABs in Sediments of Sarawak and Sembulan Rivers, Malaysia

    Directory of Open Access Journals (Sweden)

    Sami Muhsen Magam

    2012-01-01

    Full Text Available The current study is one of the first studies evaluating the levels of linear alkylbenzenes (LABs in surface sediments of Sarawak and Sembulan rivers which are located in the east coast of Malaysia. The LABs, which are molecular tracers of sewage contamination, were measured in 15 surface sediment samples collected from these rivers. The samples were extracted, fractioned and analyzed by gas chromatography mass spectrometry (GC-MS. The findings revealed that the concentrations of ∑LABs ranged from 156.47 to 7386.19 ng/g dry weight (dw in the sediments of Sarawak River and from 643.18 to 5567.12 ng/g dw in the sediments of Sembulan River. The highest LABs levels were detected in the sediments collected from the sampling location SS9 in Sembulan River whereas the lowest levels were observed in the SS1 sampling location in Sarawak River. The I/E ratios (ratio of internal to external isomers of LABs for Sarawak River sediments ranged from 0.52 to 0.98 while for Sembulan River they fell within the range 0.87-1.79. The I/E ratio at the sampling station SS4 was much lower than the I/E ratios at the other stations, thus indicating that the wastewater discharged into Sarawak River from the areas surrounding station SS4 was poorly treated.

  8. Rodent Species Distribution and Hantavirus Seroprevalence in Residential and Forested areas of Sarawak, Malaysia.

    Science.gov (United States)

    Hamdan, Nur Elfieyra Syazana; Ng, Yee Ling; Lee, Wei Bin; Tan, Cheng Siang; Khan, Faisal Ali Anwarali; Chong, Yee Ling

    2017-01-01

    Rodents belong to the order Rodentia, which consists of three families in Borneo (i.e., Muridae, Sciuridae and Hystricidae). These include rats, mice, squirrels, and porcupines. They are widespread throughout the world and considered pests that harm humans and livestock. Some rodent species are natural reservoirs of hantaviruses (Family: Bunyaviridae) that can cause zoonotic diseases in humans. Although hantavirus seropositive human sera were reported in Peninsular Malaysia in the early 1980s, information on their infection in rodent species in Malaysia is still lacking. The rodent populations in residential and forested areas in Sarawak were sampled. A total of 108 individuals from 15 species of rodents were collected in residential ( n = 44) and forested ( n = 64) areas. The species diversity of rodents in forested areas was significantly higher (H = 2.2342) compared to rodents in residential areas (H = 0.64715) ( p Sarawak, East Malaysia. The results suggested that hantavirus was not circulating in the studied rodent populations in Sarawak, or it was otherwise at a low prevalence that is below the detection threshold. It is important to remain vigilant because of the zoonotic potential of this virus and its severe disease outcome. Further studies, such as molecular detection of viral genetic materials, are needed to fully assess the risk of hantavirus infection in rodents and humans in this region of Malaysia.

  9. Seroepidemiological study of leptospirosis among the communities living in periurban areas of Sarawak, Malaysia.

    Science.gov (United States)

    Thayaparan, S; Robertson, I D; Fairuz, A; Suut, L; Gunasekera, U C; Abdullah, M T

    2015-10-01

    Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Malaysia. the purpose of this particular study was to determine the common leptospiral serovars present in human communities living around wildlife reserves/disturbed forest habitats. the objective of this study was to estimate the seroprevalence of leptospirosis and finding infecting serovars in villages surrounded habitats where wildlife lives in Sarawak, Malaysia. A cross-sectional serological survey of 198 humans was conducted in four villages around Kuching, Sarawak between January 2011 and March 2012. A seroprevalence of 35.9% (95%cI 29.2-43.0) to the MAt was detected in the tested humans. Antibodies to serovar Lepto 175 Sarawak were most commonly detected (31.3%; 95%cI 24.9-38.3) and were detected in individuals at all four locations. the presence of skin wounds (Or 3.1), farm animals (Or 2.5) and rats (Or 11.2) were all significantly associated with seropositivity in a multivariable logistic regression model. the results of the current study are important as wildlife may act as reservoirs of leptospires for humans. Health authorities should expand disease control measures to minimise the spill-over from wildlife to humans visiting, living or working in the sampled locations. the pathogenic status of serovar Lepto 175 Sarawak also requires further investigation.

  10. Knowledge of cervical cancer and acceptance of HPV vaccination among secondary school students in Sarawak, Malaysia.

    Science.gov (United States)

    Rashwan, Hesham; Lubis, Syarif Husin; Ni, Kiat Aun

    2011-01-01

    Cervical cancer is the third most common cancer in women in peninsular Malaysia and very prevalent worldwide. HPV vaccination and routine Pap smear testing are the best preventive measures. The objective of this study was to determine the knowledge level of secondary school students from Sarawak, East Malaysia regarding cervical cancer and its prevention. Multistage random sampling with various methods in each step was employed to select the sample of 76 students. Results showed that 61.8% had poor knowledge level of cervical cancer and its prevention. There were 60.5% of students who were aware of cervical cancer with Chinese and form four students showing significantly the highest awareness (pSarawak. This in turn will enhance the practice of prevention against cervical cancer among students.

  11. Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak).

    Science.gov (United States)

    Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

    2010-12-01

    There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presence of the Sunda colugo throughout Malaysia. The various ethnic groups of Malaysia adopted 37 different vernacular names to describe the Sunda colugo. This baseline data can be useful for the management authorities in conducting periodic monitoring and will enhance our knowledge of the population dynamics of the Sunda colugo in Malaysia.

  12. Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

    OpenAIRE

    Pui, Chai Fung; Bilung, Lesley Maurice; Apun, Kasing; Su’ut, Lela

    2017-01-01

    Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil...

  13. Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia

    OpenAIRE

    Sim, Siong Fong; Ling, Teck Yee; Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu; Bakeh, Tomy

    2014-01-01

    This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota sample...

  14. Simulium hiroyukii, a new species of the subgenus Gomphostilbia (Diptera: Simuliidae) from Mount Murud, Sarawak, Malaysia.

    Science.gov (United States)

    Ya'cob, Zubaidah; Takaoka, Hiroyuki; Sofian-Azirun, Mohd

    2015-01-20

    Simulium (Gomphostilbia) hiroyukii is described based on females, males, pupae and larvae collected in Mount Murud, Sarawak, Malaysia. This new species is assigned to the Simulium darjeelingense species-group of the subgenus Gomphostilbia, and is characterized by the darkened fore coxae and the pupal gill with eight long filaments, of which middle and dorsal triplets have elongated primary and secondary stalks, respectively. 

  15. Begonia hosensis (sect. Reichenheimia, Begoniaceae, a new species from Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Che-Wei Lin

    2014-12-01

    Full Text Available Begonia hosensis, a new species of sect. Reichenheimia from Sarawak, Malaysia is here described and illustrated. Begonia hosensis resembles B. andersonii, differing in the stipule prominently keeled and female flower 5- (vs. 4- tepaled. Ecologically, the two species are also separable: B. hosensis occurs on granitic cliffs ca. 400 km east of Kuching, the only known locality of B. andersonii, a limestone species.

  16. Distributional changes in rainfall and river flow in Sarawak, Malaysia

    Science.gov (United States)

    Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun

    2017-11-01

    Climate change may not change the rainfall mean, but the variability and extremes. Therefore, it is required to explore the possible distributional changes of rainfall characteristics over time. The objective of present study is to assess the distributional changes in annual and northeast monsoon rainfall (November-January) and river flow in Sarawak where small changes in rainfall or river flow variability/distribution may have severe implications on ecology and agriculture. A quantile regression-based approach was used to assess the changes of scale and location of empirical probability density function over the period 1980-2014 at 31 observational stations. The results indicate that diverse variation patterns exist at all stations for annual rainfall but mainly increasing quantile trend at the lowers, and higher quantiles for the month of January and December. The significant increase in annual rainfall is found mostly in the north and central-coastal region and monsoon month rainfalls in the interior and north of Sarawak. Trends in river flow data show that changes in rainfall distribution have affected higher quantiles of river flow in monsoon months at some of the basins and therefore more flooding. The study reveals that quantile trend can provide more information of rainfall change which may be useful for climate change mitigation and adaptation planning.

  17. Two new Species of Simulium (Simulium) (Diptera: Simuliidae) From Mount Murud, Sarawak, Malaysia.

    Science.gov (United States)

    Takaoka, Hiroyuki; Ya'cob, Zubaidah; Sofian-Azirun, Mohd

    2015-01-01

    Two new species of black flies, Simulium (Simulium) murudense and Simulium (Simulium) cheedhangi, are described on the basis of females, males, pupae, and larvae collected in Mount Murud, Sarawak, Malaysia. Both species belong to the Simulium melanopus Edwards species group. S. (S.) murudense sp. nov. is distinguished from most known species by a combination of the haired basal portion of the radial vein and the darkened fore coxae, and S. (S.) cheedhangi sp. nov. is characterized in the female by having a medium-sized claw tooth and in the pupa by six somewhat inflated gill filaments. Notes are given on the S. melanopus species-group in Sarawak and Sabah. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Seaweed composition from Bintulu coast of Sarawak, Malaysia.

    Science.gov (United States)

    Zawawi, Mohd Hafizbillah; Idris, Mohd Hanafi; Kamal, Abu Hena Mustafa; King, Wong Sing

    2014-08-01

    Species composition of seaweed and distribution were investigated in the coastal waters of Bintulu, Sarawak. The seaweed samples were collected during low tide between May 2011 and May 2012 from the six different stations. In total 54 species of seaweeds were identified from study areas of Bintulu coastal waters. Among them, 23 species were from Rhodophyta with 11 families, 15 species were from Phaeophyta with 2 families and 16 species were from Chlorophyta with 10 families: Seventeen species of seaweeds were recorded from the Tanjung Batu, while 23 species from Pantai Telekom, 14 species from Golden Beach, 26 species from Kuala Similajau, 12 species from Kuala Nyalau and 21 species from Batu Mandi. Seaweeds abundance was high in rocky substrate and Rhodophyta (11 families and 23 species) was the common and highest group of seaweeds in this coastal areas. Present study recorded high diversified seaweed species at the rocky shore area compare to reef area.

  19. Reproductive Cycle of Hard Clam, Meretrix lyrata Sowerby, 1851 (Bivalvia: Veneridae) from Sarawak, Malaysia.

    Science.gov (United States)

    Hamli, Hadi; Idris, Mohd Hanafi; Rajaee, Amy Halimah; Kamal, Abu Hena Mustafa

    2015-12-01

    A study of the reproductive cycle of the hard clam, Meretrix lyrata, was documented based on histological observation and Gonad Index (GI). Samples were taken from estuarine waters of the Buntal River in Sarawak, Malaysia. The gonad of M. lyrata started to develop in September 2013. Gametogenesis continued to develop until the maturation and spawning stage from February to April 2014. The GI pattern for a one-year cycle showed a significant correlation with chlorophyll a. The corresponding GI with chlorophyll a suggested that the development of the reproductive cycle of M. lyrata required a high amount of food to increase gametogenesis.

  20. Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

    Science.gov (United States)

    Pui, Chai Fung; Apun, Kasing; Su'ut, Lela

    2017-01-01

    Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii, intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri, respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak. PMID:28348601

  1. Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia.

    Science.gov (United States)

    Pui, Chai Fung; Bilung, Lesley Maurice; Apun, Kasing; Su'ut, Lela

    2017-01-01

    Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii , intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri , respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak.

  2. Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Chai Fung Pui

    2017-01-01

    Full Text Available Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107 of rats, 11.6% (34/292 of soil samples, and 1.9% (6/324 of water samples. Intermediate Leptospira was present in 2.7% (8/292 of soil samples and 1.9% (6/324 of water samples. Saprophytic Leptospira was present in 10.3% (11/107 of rats, 1.4% (4/292 of soil samples, and 0.3% (1/324 of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii, intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri, respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak.

  3. Peat-accumulating depositional systems of Sarawak, East Malaysia

    Science.gov (United States)

    Staub, James R.; Esterle, Joan S.

    1994-02-01

    Many coal deposits originate in deltaic, estuarine, and coastal plain settings and a knowledge of interrelationships between the tectonic and depositional elements active at the time of sediment deposition is necessary to formulate basin scale models. The prograding coastal depositional systems of Sarawak all contain domed peat-accumulating environments in which low-ash, low-sulfur peats are being deposited in areas of active clastic siliciclastic sedimentation. These depositional systems are as large as 11,400 km 2 and individual peat deposits within systems are in excess of 20 m thick and 1000 km 2 in area. The geographic positions and drainage basin areas of each depositional system are controlled by fault and fold systems. Although prograding into the same receiving basin, individual system geomorphology is variable and ranges from a wave-dominated microtidal delta, to a wave-dominated meso- to macro-tidal delta/coastal plain system, to a tide-dominated macrotidal estuarine embayment along a 450 km stretch of coastline. System variation is a function of sediment supply, shelf and embayment geometry, wave climate, and tidal range. These factors, which control depositional system geomorphology, also control the resulting long axis orientation of the thick, domed peat deposits. The surface vegetation and internal characteristics of most domed peat deposits, however, are similar. Internal characteristics consist of basal high-ash, high-sulfur, degraded peats overlain by low-ash, low-sulfur, well preserved peats in vertical profile. These systems demonstrate variable responses to late Pleistocene/Holocene sea-level rise and, in these instances, the variation is most attributable to local differences in siliciclastic sediment supply, which is a function of the drainage basin area.

  4. Architecture and growth history of a Miocene carbonate platform from 3D seismic reflection data; Luconia province, offshore Sarawak, Malaysia

    NARCIS (Netherlands)

    Zampetti, V.; Schlager, W.; van Konijnenburg, J.H; Everts, A.J.

    2004-01-01

    Using 3D seismic reflection data and wireline logs we reconstruct in detail the architecture and growth history of a Miocene carbonate platform in the Luconia province, offshore Sarawak, Malaysia. Platform growth started in the Late Oligocene to Early Miocene, by coalescence of isolated patch reefs.

  5. Pronominal Differences in Languages of Sabah and Sarawak and the Effect on the Acquisition of Bahasa Malaysia.

    Science.gov (United States)

    Lee, Eileen Yen Ee; Boutin, Michael E.

    Bilingual education programs must be based on a sound understanding of the linguistic, social, psychological, and cultural factors affecting students. This paper is concerned with linguistic factors that affect the acquisition of Bahasa Malaysia (BM) pronouns by non-native speakers from Sabah and Sarawak. Properties in the personal pronoun systems…

  6. Effects of System's and User's Characteristics on E-Learning Use: A Study at Universiti Malaysia Sarawak

    Science.gov (United States)

    Hong, Kian-Sam; Cheng, Julia Lee Ai; Liau, Tet-Loke

    2005-01-01

    The benefits of an e-learning system will not be maximised if learners do not use the system. This study was conducted with 26 postgraduate students at a faculty in Universiti Malaysia Sarawak taking an on-campus course supplemented with an e-learning system. The purpose of the study was to determine which factors were related to intention to use…

  7. The Distribution and Population Density of Bornean Tarsier, “Tarsius Bancanus Borneanus (Elliot)” in Secondary and Rehabilitated Forests of Universiti Putra Malaysia, Bintulu Sarawak Campus, Sarawak, Malaysia

    Science.gov (United States)

    Sahimi, Hani Nabilia Muhd; Chubo, John Keen; Top @ Mohd. Tah, Marina Mohd.; Saripuddin, Noor Bahiah; Ab Rahim, Siti Sarah

    2018-01-01

    Tarsius bancanus borneanus was first reported by Elliot in 1990 which an endemic species that can be found on the Island of Borneo consisting of Sabah and Sarawak of Malaysia, Brunei Darussalam and Kalimantan, Indonesia. This sub-species has been listed as a totally protected animal under the Sarawak Wild Life Protection Ordinance (1998) and vulnerable by the International Union for Conservation of Nature (IUCN). The present study was conducted at Universiti Putra Malaysia Bintulu Campus (UPMKB), Sarawak from October 2014 till March 2015. Through mark and recapture sampling covering an area of 37 ha of secondary forest patches and 7.13 ha of rehabilitated forest, a total of 16 tarsiers were captured using mist nets while one tarsier was recapture. The population density was 38 individuals/km2 was captured using mist nets in the secondary forest while 28 individuals/km2 was recorded for the rehabilitated forest. Using the catch per unit effort (net hour) method, the average time for capturing tarsiers in the secondary forest patches was 26.6 net hour per animal and 30.0 net hour per animal in the rehabilitated forest. The presented results provides information on the presence of tarsiers in both the secondary and rehabilitated forests of UPMKB, Sarawak, Malaysia which underlines the conservation value of these forested areas. PMID:29644021

  8. The effect of vaccination coverage and climate on Japanese encephalitis in Sarawak, Malaysia.

    Directory of Open Access Journals (Sweden)

    Daniel E Impoinvil

    Full Text Available Japanese encephalitis (JE is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control.Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month, minimum temperature (lag 6-months and SOI (lag 6-months were positively associated with JE cases.This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects are ignored.

  9. Trends analysis of rainfall and rainfall extremes in Sarawak, Malaysia using modified Mann-Kendall test

    Science.gov (United States)

    Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun

    2017-11-01

    This study assesses the spatial pattern of changes in rainfall extremes of Sarawak in recent years (1980-2014). The Mann-Kendall (MK) test along with modified Mann-Kendall (m-MK) test, which can discriminate multi-scale variability of unidirectional trend, was used to analyze the changes at 31 stations. Taking account of the scaling effect through eliminating the effect of autocorrelation, m-MK was employed to discriminate multi-scale variability of the unidirectional trends of the annual rainfall in Sarawak. It can confirm the significance of the MK test. The annual rainfall trend from MK test showed significant changes at 95% confidence level at five stations. The seasonal trends from MK test indicate an increasing rate of rainfall during the Northeast monsoon and a decreasing trend during the Southwest monsoon in some region of Sarawak. However, the m-MK test detected an increasing trend in annual rainfall only at one station and no significant trend in seasonal rainfall at any stations. The significant increasing trends of the 1-h maximum rainfall from the MK test are detected mainly at the stations located in the urban area giving concern to the occurrence of the flash flood. On the other hand, the m-MK test detected no significant trend in 1- and 3-h maximum rainfalls at any location. On the contrary, it detected significant trends in 6- and 72-h maximum rainfalls at a station located in the Lower Rajang basin area which is an extensive low-lying agricultural area and prone to stagnant flood. These results indicate that the trends in rainfall and rainfall extremes reported in Malaysia and surrounding region should be verified with m-MK test as most of the trends may result from scaling effect.

  10. The effect of vaccination coverage and climate on Japanese encephalitis in Sarawak, Malaysia.

    Science.gov (United States)

    Impoinvil, Daniel E; Ooi, Mong How; Diggle, Peter J; Caminade, Cyril; Cardosa, Mary Jane; Morse, Andrew P; Baylis, Matthew; Solomon, Tom

    2013-01-01

    Japanese encephalitis (JE) is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE) cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control. Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years) and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI) were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month), minimum temperature (lag 6-months) and SOI (lag 6-months) were positively associated with JE cases. This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects are ignored.

  11. Immobilised Sarawak Malaysia yeast cells for production of bioethanol.

    Science.gov (United States)

    Zain, Masniroszaime Mohd; Kofli, Noorhisham Tan; Rozaimah, Siti; Abdullah, Sheikh

    2011-05-01

    Bioethanol production using yeast has become a popular topic due to worrying depleting worldwide fuel reserve. The aim of the study was to investigate the capability of Malaysia yeast strains isolated from starter culture used in traditional fermented food and alcoholic beverages in producing Bioethanol using alginate beads entrapment method. The starter yeast consists of groups of microbes, thus the yeasts were grown in Sabouraud agar to obtain single colony called ST1 (tuak) and ST3 (tapai). The growth in Yeast Potatoes Dextrose (YPD) resulted in specific growth of ST1 at micro = 0.396 h-1 and ST3 at micro = 0.38 h-1, with maximum ethanol production of 7.36 g L-1 observed using ST1 strain. The two strains were then immobilized using calcium alginate entrapment method producing average alginate beads size of 0.51 cm and were grown in different substrates; YPD medium and Local Brown Sugar (LBS) for 8 h in flask. The maximum ethanol concentration measured after 7 h were at 6.63 and 6.59 g L-1 in YPD media and 1.54 and 1.39 g L-1in LBS media for ST1 and ST3, respectively. The use of LBS as carbon source showed higher yield of product (Yp/s), 0.59 g g-1 compared to YPD, 0.25 g g-1 in ST1 and (Yp/s), 0.54 g g-1 compared to YPD, 0.24 g g-1 in ST3 . This study indicated the possibility of using local strains (STI and ST3) to produce bioethanol via immobilization technique with local materials as substrate.

  12. Biomass and Habitat Characteristics of Epiphytic Macroalgae in the Sibuti Mangroves, Sarawak, Malaysia.

    Science.gov (United States)

    Isa, Hasmidah Md; Kamal, Abu Hena Mustafa; Idris, Mohd Hanafi; Rosli, Zamri; Ismail, Johan

    2017-01-01

    Mangroves support diverse macroalgal assemblages as epibionts on their roots and tree trunks. These algae provide nutrients to the primary consumers in the aquatic food web and have been reported to be substantial contributors to marine ecosystems. The species diversity, biomass, and habitat characteristics of mangrove macroalgae were investigated at three stations in the Sibuti mangrove estuary, Sarawak, Malaysia, from November 2012 to October 2013. Three groups of macroalgae were recorded and were found to be growing on mangrove prop roots, namely Rhodophyta ( Caloglossa ogasawaraensis , Caloglossa adhaerens , Caloglossa stipitata , Bostrychia anomala, and Hypnea sp.), Chlorophyta ( Chaetomorpha minima and Chaetomorpha sp.), and Phaeophyta ( Dictyota sp.). The biomass of macroalgae was not influenced ( p >0.05) by the season in this mangrove forest habitat. The macroalgal species Hypnea sp. contributed the highest biomass at both Station 1 (210.56 mg/cm 2 ) and Station 2 (141.72 mg/cm 2 ), while the highest biomass was contributed by B. anomala (185.89 mg/cm 2 ) at Station 3. This study shows that the species distribution and assemblages of mangrove macroalgae were influenced by environmental parameters such as water nutrients, dissolved solids, and salinity in the estuarine mangrove habitats of Sibuti, Sarawak.

  13. Statistical analysis of trends in monthly precipitation at the Limbang River Basin, Sarawak (NW Borneo), Malaysia

    Science.gov (United States)

    Krishnan, M. V. Ninu; Prasanna, M. V.; Vijith, H.

    2018-05-01

    Effect of climate change in a region can be characterised by the analysis of rainfall trends. In the present research, monthly rainfall trends at Limbang River Basin (LRB) in Sarawak, Malaysia for a period of 45 years (1970-2015) were characterised through the non-parametric Mann-Kendall and Spearman's Rho tests and relative seasonality index. Statistically processed monthly rainfall of 12 well distributed rain gauging stations in LRB shows almost equal amount of rainfall in all months. Mann-Kendall and Spearman's Rho tests revealed a specific pattern of rainfall trend with a definite boundary marked in the months of January and August with positive trends in all stations. Among the stations, Limbang DID, Long Napir and Ukong showed positive (increasing) trends in all months with a maximum increase of 4.06 mm/year (p = 0.01) in November. All other stations showed varying trends (both increasing and decreasing). Significant (p = 0.05) decreasing trend was noticed in Ulu Medalam and Setuan during September (- 1.67 and - 1.79 mm/year) and October (- 1.59 and - 1.68 mm/year) in Mann-Kendall and Spearman's Rho tests. Spatial pattern of monthly rainfall trends showed two clusters of increasing rainfalls (maximas) in upper and lower part of the river basin separated with a dominant decreasing rainfall corridor. The results indicate a generally increasing trend of rainfall in Sarawak, Borneo.

  14. Exploring strategies to overcome extra-organisational challenges faced by community pharmacies in Sarawak, Malaysia.

    Science.gov (United States)

    Kho, Boon Phiaw; Hassali, Mohamed Azmi; Lim, Ching Jou; Saleem, Fahad

    2018-03-15

    The aims of this research were to determine extra-organisational challenges (e.g. market competition, governing policies) faced by community pharmacies in Sarawak, the coping strategies employed to deal with these challenges and explore potential legislative changes that can attenuate the intensity of these challenges. Survey questionnaires (n = 184) were posted to all eligible community pharmacies in Sarawak, Malaysia. The questionnaire included sections on participants' demographic data, extra-organisational challenges faced, coping strategies employed and proposals to improve community pharmacy legislations. Items were constructed based on the findings of a prior qualitative research supplemented with relevant literature about these issues. High levels of homogeneity in responses were recorded on various extra-organisational challenges faced, particularly those economy-oriented. Strategic changes to counter these challenges were focused on pricing and product stocked, rather than services provision. Highly rated strategies included increasing discounts for customers (n = 54; 68%) and finding cheaper suppliers (n = 70; 88%). Legislative changes proposed that might increase their share of the pharmaceutical market were strongly supported by respondents, particularly about making it compulsory for general practitioners to provide patients the option to have their medicines dispensed in community pharmacies (n = 72; 90%). Current legislative conditions and Malaysian consumer mindset may have constrained the strategic choices of community pharmacies to deal with the strong extra-organisational challenges. A long-term multipronged approach to address these issues and increased involvement of community pharmacists themselves in this agenda are required to influence practice change. © 2018 Royal Pharmaceutical Society.

  15. Clinical characteristics of basal cell carcinoma in a tertiary hospital in Sarawak, Malaysia.

    Science.gov (United States)

    Yap, Felix Boon Bin

    2010-02-01

    Basal cell carcinoma (BCC) is the most common skin cancer among Orientals. Data on this malignancy is lacking in Malaysia, prompting a retrospective study to determine the clinical characteristics in the skin clinic, Sarawak General Hospital between 2000 and 2008. Demographic data and clinical features of 64 histopathologically proven BCC from 43 patients were retrieved. Statistical analysis was performed comparing the clinical characteristics based on the region of involvement and gender. The mean age of presentation was 60.9 years. Male to female ratio was 1.05. Majority of the patients were Chinese (44.2%) followed by Malays (32.6%), Bidayuhs (14.0%) and Ibans (6.9%). Nodular BCC accounted for 95.3% of cases while 4.7% were superficial BCC. All the nodular BCC were pigmented. Ulceration was noted in 18%. There were 82.8% of BCC on the head and neck region and 17.2% on the trunk and limb region. BCC on the latter region were larger (mean 35.0 cf. 14.4 mm, p Sarawak were similar to other Asian studies. Additionally, BCC on the trunk and limbs and in men were larger, ulcerative and long standing warranting better efforts for earlier detection.

  16. Cadmium and lead in blood cockle (Anadara granosa) from Asajaya, Sarawak, Malaysia.

    Science.gov (United States)

    Hossen, Md Faruk; Hamdan, Sinin; Rahman, Md Rezaur

    2014-01-01

    The concentrations were ranged from 1.35 ± 0.16 to 2.22 ± 0.34 µg/g (dry weight) and 2.65 ± 0.34 to 4.36 ± 0.53 µg/g (dry weight) for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985). It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation.

  17. Soil erosion from shifting cultivation and other smallholder land use in Sarawak, Malaysia

    DEFF Research Database (Denmark)

    Neergaard, Andreas de; Magid, Jakob; Mertz, Ole

    2008-01-01

    to compare soil erosion from three land use types in a shifting cultivation system, namely upland rice, pepper gardens and native forest. We used two sample sites within the humid tropical lowland zone in Sarawak, Malaysia. Both areas had steep slopes between 25° and 50°, and were characterised by a mosaic...... land use of native forest, secondary re-growth, upland rice fields and pepper gardens. Soil samples were collected to 90 cm depth from all three land use types, and analysed for various chemical parameters, including texture, total organic matter and 137Cs content. 137Cs is a radioactive isotope...... in the upper soil layers, are unlikely to change the carbon inventory dramatically. 137Cs content in the soil profile indicated largest retention of original topsoil in the native forest plots, and a loss of 18 and 35% of topsoil from upland rice and pepper gardens, respectively, over the past 40 years. When...

  18. Cost estimation of a standalone photovoltaic power system in remote areas of Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Jakhrani, A.Q.; Othman, A.K.; Rigit, A.R.H.; Samo, S.R.

    2012-01-01

    This paper aims to estimate the anticipated costs incurred from a standalone solar photovoltaic power system for the supply of electricity to the rural community in Sarawak, Malaysia. The life cycle cost analysis with net present value technique was employed for the evaluation of cost system. It was found that purchasing of solar photovoltaic components and the system installation cost will contribute 63% of the total investment and future anticipated costs will add to the remaining. Recurring cost will make 25% and components replacements 75% of future anticipated costs. It was discovered that the power generated from the solar photovoltaic system would be 38 times more expensive than electricity produced from the conventional sources. However, its installation in remote areas could be favourable where the grid-connected power supply is not accessible. (author)

  19. Cadmium and Lead in Blood Cockle (Anadara granosa from Asajaya, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Md. Faruk Hossen

    2014-01-01

    Full Text Available The concentrations were ranged from 1.35±0.16 to 2.22±0.34 µg/g (dry weight and 2.65±0.34 to 4.36±0.53 µg/g (dry weight for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985. It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation.

  20. Detection of Cryptosporidium and Cyclospora Oocysts from Environmental Water for Drinking and Recreational Activities in Sarawak, Malaysia.

    Science.gov (United States)

    Bilung, Lesley Maurice; Tahar, Ahmad Syatir; Yunos, Nur Emyliana; Apun, Kasing; Lim, Yvonne Ai-Lian; Nillian, Elexson; Hashim, Hashimatul Fatma

    2017-01-01

    Cryptosporidiosis and cyclosporiasis are caused by waterborne coccidian protozoan parasites of the genera Cryptosporidium and Cyclospora, respectively. This study was conducted to detect Cryptosporidium and Cyclospora oocysts from environmental water abstracted by drinking water treatment plants and recreational activities in Sarawak, Malaysia. Water samples (12 each) were collected from Sungai Sarawak Kanan in Bau and Sungai Sarawak Kiri in Batu Kitang, respectively. In addition, 6 water samples each were collected from Ranchan Recreational Park and UNIMAS Lake at Universiti Malaysia Sarawak, Kota Samarahan, respectively. Water physicochemical parameters were also recorded. All samples were concentrated by the iron sulfate flocculation method followed by the sucrose floatation technique. Cryptosporidium and Cyclospora were detected by modified Ziehl-Neelsen technique. Correlation of the parasites distribution with water physicochemical parameters was analysed using bivariate Pearson correlation. Based on the 24 total samples of environmental water abstracted by drinking water treatment plants, all the samples (24/24; 100%) were positive with Cryptosporidium , and only 2 samples (2/24; 8.33%) were positive with Cyclospora . Based on the 12 total samples of water for recreational activities, 4 samples (4/12; 33%) were positive with Cryptosporidium , while 2 samples (2/12; 17%) were positive with Cyclospora . Cryptosporidium oocysts were negatively correlated with dissolved oxygen (DO).

  1. A new species of troglobitic crab of the genus Stygothelphusa Ng, 1989, from Sarawak, Malaysia (Crustacea: Decapoda: Brachyura: Gecarcinucidae).

    Science.gov (United States)

    Ng, Peter K L; Grinang, Jongkar

    2014-03-04

    A new species of cave crab, Stygothelphusa antu new species, is described from limestone formations in Temurang, Sarawak, Malaysia. The new species is the most highly adapted to a cavericolous lifestyle among the four known species of Stygothelphusa, having a pale body pigmentation, reduced eyes and elongated pereopods. In contrast, the other three species have normal eyes that almost completely fill the orbits. The new species also differs from its congeners by a number of carapace, pereopod and gonopod characters.

  2. A new species of Leptolalax (Anura: Megophryidae) from Gunung Mulu National Park, Sarawak, East Malaysia (Borneo).

    Science.gov (United States)

    Dehling, J Maximilian; Matsui, Masafumi

    2013-01-01

    We describe a new species of Leptolalax from Gunung Mulu National Park in eastern Sarawak, Malaysian Borneo. The new species had been assigned to Leptolalax dringi and Leptolalax gracilis in the past. It is shown to differ from both these species and from all other species of the genus by a unique combination of morphological characters including large body size, rounded snout, interorbital distance being smaller than width of upper eyelid, bipartite subgular vocal sac in males, basal toe webbing, shagreened skin with tiny tubercles on dorsum and dorsal side of head, angled supratympanic fold, small pectoral glands, absence of supraaxillary glands and ventrolateral glandular ridges, spotted venter, advertisement call consisting of long series of 8-289 notes, each composed of three or four pulses, and dominant frequency at 7225-9190 Hz, with prominent frequency modulation.

  3. Applicability of the stages of change and Weight Efficacy Lifestyle Questionnaire with natives of Sarawak, Malaysia.

    Science.gov (United States)

    Chang, C T

    2007-01-01

    There is an increase in the prevalence of overweight and obesity in Malaysia. Besides prevalence studies, not much is known about either overweight or obese individuals. The objective of this study was to determine the stages of change in losing weight and the self-efficacy in eating control of three indigenous groups of overweight and obese adults in Sarawak, Malaysia. A cross-sectional study was conducted in one rural region in Sarawak using a purposive sample. A structured questionnaire, which included two scales: (1) Weight: Stages of change (SOC) to assess readiness to change; and (2) Weight Efficacy Lifestyle Questionnaire (WEL) (both adopted from the transtheoretical model of change); and a set of pre-tested questionnaires on socio-demographic data, the presence of health problems and self-assessment of weight appropriateness, was used to interview respondents. The stage distribution for weight loss of these adults respondents (n = 271) showed that 60.5% (n = 164) were in the pre-contemplation stage, 20.7% (n = 56) were in the contemplation stage, 8.5% (n = 23) were in the preparation stage, and 8.9% (n = 24) were in the action stage, while only 1.5% (n = 4) were in the maintenance stage. Except for education, the stage differences were generally stable across age, sex, race, household income, presence or absence of health problem, self-perceived weight and presence of overweight or obesity. Respondents were least able to control their eating under social pressure and food availability, according to their WEL score. A large proportion of the overweight or obese adults was not intending to lose weight. The factor structure of the two WEL original subscales enabled partial differentiation between respondents who were able or unable to resist eating in situations where there were availability of food and experienced physical discomfort. The study results indicate the importance of assessing individuals' SOC score in order to implement stage-matched intervention

  4. Importation and co-circulation of multiple serotypes of dengue virus in Sarawak, Malaysia.

    Science.gov (United States)

    Holmes, Edward C; Tio, Phaik-Hooi; Perera, David; Muhi, Jamail; Cardosa, Jane

    2009-07-01

    Although dengue is a common disease in South-East Asia, there is a marked absence of virological data from the Malaysian state of Sarawak located on the island of Borneo. From 1997 to 2002 we noted the co-circulation of DENV-2, DENV-3 and DENV-4 in Sarawak. To determine the origins of these Sarawak viruses we obtained the complete E gene sequences of 21 isolates. A phylogenetic analysis revealed multiple entries of DENV-2 and DENV-4 into Sarawak, such that multiple lineages co-circulate, yet with little exportation from Sarawak. Notably, all viral isolates were most closely related to those circulating in different localities in South-East Asia. In sum, our analysis reveals a frequent traffic of DENV in South-East Asia, with Sarawak representing a local sink population.

  5. Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia.

    Science.gov (United States)

    Sim, Siong Fong; Ling, Teck Yee; Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu; Bakeh, Tomy

    2014-01-01

    This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota samples more susceptible to metal accumulation. The distributions of heavy metals in water specifically Se, Sn, and As could have associated with the input of fish feed, boating, and construction activities. The accumulation of heavy metals in sediment, macroalgae, and aquatic plant on the other hand might be largely influenced by the redox conditions in the aquatic environment. According to the contamination factor and the geoaccumulation index, sediment in Batang Ai Reservoir possesses low risk of contamination. The average metal contents in sediment and river water are consistently lower than the literature values reported and well below the limit of various guidelines. For fishes, trace element Hg was detected; however, the concentration was below the permissible level suggested by the Food and Agriculture Organization.

  6. Borderlands and Tourism Development in Kalimantan Island: Kalimantan Barat, Indonesia - Sarawak, Malaysia 'Head to Head'

    Directory of Open Access Journals (Sweden)

    Syaiful Muazir

    2013-12-01

    Full Text Available As part of the regions that share lands and boundaries, Sarawak-Malaysia and Kalimantan Barat-Indonesia have respective characteristics in the borderlands treatment. This paper aims to explore and compare the border areas between two nations, ranging from the borderlands profiles, (tourism development and planning, and their opportunities. Besides, this paper also wants to highlight tourism development as one of the strategies. This paper uses documentary research to seek 'text and context' by narratively describing and compiling the documents. From the discussion, it can be seen that both regions have different characteristics of conditions and problems. For tourism development, different approaches are also 'colored' with timing, momentum, and priorities; as influenced and supported by the national plans. Tourism in the borderlands is the impetus in which each regions has already been aware of this potential because of the traction of informal flow, accessibility, supply, and demand. Furthermore, we argue that if tourism has exist at the first place, in the future, by its backward linkages, it will encourage more physical and economic development and cooperation between nations.

  7. Leptospiral agglutinins in captive and free ranging non-human primates in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    S. Thayaparan

    2014-06-01

    Full Text Available Aim: The proposed study was carried out to determine the extent of exposure to leptospirosis in non-human primates. Materials and Methods: Trapping of non-human primates was carried out opportunistically around the Bako National Park and the Matang Wildlife Center in the vicinity of human settlements and tourism areas of Sarawak. Blood samples were obtained from the saphenous vein to determine the presence of antibodies by the Microscopic Agglutination Test (MAT to 17 serovars of Leptospira commonly found in Malaysia. Results: This study reports the screening of twelve primates (eight captive and four free ranging for leptospirosis. Eight of the 12 monkeys (66.6%; 95% CI 34.9-90.1 reacted against one or two serovars of Leptospira (Lai and Leptospira Lepto175. The serovar Lai is considered pathogenic for different mammals, including humans. Leptospira Lepto 175 has been identified as an intermediate strain and further studies are being undertaken on this serovar. Conclusion: These results are important as primates may act as reservoirs of Leptospira spp. for humans, which may potentially affect tourism (economic loss, conservation efforts and public health.

  8. Taxonomic assessment of seaweed community from the coastal areas of Bintulu, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Mohd Hafizbillah Zawawi

    2015-04-01

    Full Text Available Basic taxonomic information forms the important basis for the documentation, resource management and utilization of marine biodiversity such as seaweeds. A taxonomic assessment of seaweeds in the coastal areas of Bintulu, Sarawak, East Malaysia, was conducted monthly from May 2011 to May 2012. Species composition was recorded following NaGISA protocols, direct observation, and SCUBA and snorkeling techniques. A total of 54 species were identified, classified into Rhodophyta (23 species, Chlorophyta (16 species and Phaeophyta (15 species. The highest abundance was recorded at Kuala Similajau (25 species while the lowest was recorded at Kuala Nyalau (12 species. As the present study was conducted by examining species collected from both rocky shores and the reef area for the first time, a higher number of species was documented compared to previous studies conducted in the same general area but focusing only on particular habitats. Thirty species found in the current survey represent new records for the locality including some with economic potentials.

  9. Net ecosystem CO2 exchange of a primary tropical peat swamp forest in Sarawak, Malaysia

    Science.gov (United States)

    Tang Che Ing, A.; Stoy, P. C.; Melling, L.

    2014-12-01

    Tropical peat swamp forests are widely recognized as one of the world's most efficient ecosystems for the sequestration and storage of carbon through both their aboveground biomass and underlying thick deposits of peat. As the peat characteristics exhibit high spatial and temporal variability as well as the structural and functional complexity of forests, tropical peat ecosystems can act naturally as both carbon sinks and sources over their life cycles. Nonetheless, few reports of studies on the ecosystem-scale CO2 exchange of tropical peat swamp forests are available to-date and their present roles in the global carbon cycle remain uncertain. To quantify CO2 exchange and unravel the prevailing factors and potential underlying mechanism regulating net CO2 fluxes, an eddy covariance tower was erected in a tropical peat swamp forest in Sarawak, Malaysia. We observed that the diurnal and seasonal patterns of net ecosystem CO2 exchange (NEE) and its components (gross primary productivity (GPP) and ecosystem respiration (RE)) varied between seasons and years. Rates of NEE declined in the wet season relative to the dry season. Conversely, both the gross primary productivity (GPP) and ecosystem respiration (RE) were found to be higher during the wet season than the dry season, in which GPP was strongly negatively correlated with NEE. The average annual NEE was 385 ± 74 g C m-2 yr-1, indicating the primary peat swamp forest functioned as net source of CO2 to the atmosphere over the observation period.

  10. Growth and reproductive performance of sambar deer in Sabal Forest Reserve of Sarawak, Malaysia.

    Science.gov (United States)

    Dahlan, Ismail; Dawend, Jiwan

    2013-10-01

    We examined the growth, reproduction, rutting behavior, and health status of sambar deer (Cervus unicolor brookei) in secondary Acacia mangium plantation. The data were collected over 11 years from a breeding herd of 21 stags and 33 hinds in Sabal Forest Reserve, Sarawak, Malaysia. Brody's growth model of the pooled data is Y t  = 148.56 (1 - 0.98e(-0.023t)), which estimates that maximum weights of adults are 184 and 115 kg for males and females respectively. Sambar deer are nonseasonal breeders with the breeding peak in February. Although the earliest age at which a female reached sexual maturity was 11 months, the mean age was 23 ± 7 months. Mean age of first fawning was 32 ± 8 months. Mean gestation period was 259 ± 12 days (n = 82). Stags shed antlers mostly between March and July. Velvet hardens at 103 ± 27 days (n = 23), and velvet harvesting is best at 7-9 weeks when antler length is 25-30 cm. Sambar deer are suitable as a farm species in forest plantations and have a vast potential to uplift rural living standards.

  11. Metal concentrations in sediments from tourist beaches of Miri City, Sarawak, Malaysia (Borneo Island).

    Science.gov (United States)

    Nagarajan, R; Jonathan, M P; Roy, Priyadarsi D; Wai-Hwa, L; Prasanna, M V; Sarkar, S K; Navarrete-López, M

    2013-08-15

    Forty-three sediment samples were collected from the beaches of Miri City, Sarawak, Malaysia to identify the enrichment of partially leached trace metals (PLTMs) from six different tourist beaches. The samples were analyzed for PLTMs Fe, Mn, Cr, Co, Cu, Ni, Pb, Sr and Zn. The concentration pattern suggest that the southern side of the study area is enriched with Fe (1821-6097 μg g(-1)), Mn (11.57-90.22 μg g(-1)), Cr (51.50-311 μg g(-1)), Ni (18-51 μg g(-1)), Pb (8.81-84.05 μg g(-1)), Sr (25.95-140.49 μg g(-1)) and Zn (12.46-35.04 μg g(-1)). Compared to the eco-toxicological values, Cr>Effects range low (ERL), Lowest effect level (LEL), Severe effect level (SEL); Cu>Unpolluted sediments, ERL, LEL; Pb>Unpolluted sediments and Ni>ERL and LEL. Comparative results with other regions indicate that Co, Cr, Cu, Ni and Zn are higher, indicating an external input rather than natural process. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Serological Prevalence of Leptospirosis Among Rural Communities in the Rejang Basin, Sarawak, Malaysia.

    Science.gov (United States)

    Suut, Lela; Mazlan, Mohamad Nur-Azim; Arif, Mohamad Taha; Yusoff, Haironi; Abdul Rahim, Nor-Aliza; Safii, Razitasham; Suhaili, Mohamad Raili

    2016-07-01

    Leptospirosis is an important zoonotic disease globally and is endemic in Malaysia. A study was conducted in the Rejang basin of Sarawak from June 2011 to May 2013 to determine the seroprevalence of leptospirosis among the communities and dominant infecting Leptospira serovars. A total of 508 human sera were analyzed using ELISA and the microscopic agglutination test (MAT). The seroprevalence of leptospirosis in the study area was 37.4%, with the highest prevalence in Kapit division. More women were positive for leptospirosis (59.5%), and the mean age of seropositive individuals was 42.2 (SD = 18.7) years. Antibody titers between 1:50 and 1:1600 were reported, and serovars djasiman (22.1%), shermani (13.2%), and pomona (7.9%) predominated, with varied distribution between geographical locations. This study highlighted the endemicity and diversity of existing Leptospira serovars within the community. This information should be communicated to local health personnel and communities at risk, and rapid diagnostic capability should be made available to local health facilities. © 2016 APJPH.

  13. Soil CO2 flux from three ecosystems in tropical peatland of Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Melling, Lulie; Hatano, Ryusuke

    2005-01-01

    Soil CO 2 flux was measured monthly over a year from tropical peatland of Sarawak, Malaysia using a closed-chamber technique. The soil CO 2 flux ranged from 100 to 533 mg C/m 2 /h for the forest ecosystem, 63 to 245 mg C/m 2 /h for the sago and 46 to 335 mg C/m 2 /h for the oil palm. Based on principal component analysis (PCA), the environmental variables over all sites could be classified into three components, namely, climate, soil moisture and soil bulk density, which accounted for 86% of the seasonal variability. A regression tree approach showed that CO 2 flux in each ecosystem was related to different underlying environmental factors. They were relative humidity for forest, soil temperature at 5 cm for sago and water-filled pore space for oil palm. On an annual basis, the soil CO 2 flux was highest in the forest ecosystem with an estimated production of 2.1 kg C/m 2 /yr followed by oil palm at 1.5 kg C/m 2 /yr and sago at 1.1 kg C/m 2 /yr. The different dominant controlling factors in CO 2 flux among the studied ecosystems suggested that land use affected the exchange of CO 2 between tropical peatland and the atmosphere

  14. Correlation between soil physicochemical properties and vegetation parameters in secondary tropical forest in Sabal, Sarawak, Malaysia

    Science.gov (United States)

    Karyati, K.; Ipor, I. B.; Jusoh, I.; Wasli, M. E.

    2018-04-01

    The tree growth is influenced by soil morphological and physicochemical properties in the site. The purpose of this study was to describe correlation between soil properties under various stage secondary forests and vegetation parameters, such as floristic structure parameters and floristic diversity indices. The vegetation surveys were conducted in 5, 10, and 20 years old at secondary tropical forests in Sarawak, Malaysia. Nine sub plots sized 20 m × 20 m were established within each study site. The Pearson analysis showed that soil physicochemical properties were significantly correlated to floristic structure parameters and floristic diversity indices. The result of PCA clarified the correlation among most important soil properties, floristic structure parameters, and floristic diversity indices. The PC1 represented cation retention capacity and soil texture which were little affected by the fallow age and its also were correlated by floristic structure and diversity. The PC2 was linked to the levels of soil acidity. This property reflected the remnant effects of ash addition and fallow duration, and the significant correlation were showed among pH (H2O), floristic structure and diversity. The PC3 represented the soil compactness. The soil hardness could be influenced by fallow period and it was also correlated by floristic structure.

  15. Alteration mineral mapping using ETM+ and hyperion remote sensing data at Bau Gold Field, Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Pour, A B; Hashim, M

    2014-01-01

    The area under investigation is the Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo. It has tropical climate with limited bedrock exposures. Bau is a gold field similar to Carlin style gold deposits. Geological analyses coupled with remote sensing data were used to detect hydrothermally altered rocks associated with gold mineralization. The Landsat Enhanced Thematic Mapper + (ETM + ) and Hyperion data were used to carry out mineral mapping of mineralized zones in the study area and surrounding terrain. Directed Principal Components Analysis (DPCA) transformation of four appropriate ETM+ band ratios were applied to produce DPC images, allowing the removal of the effects of vegetation from ETM+ data and the detection of separate mineral images at a regional scale. Linear Spectral Unmixing (LSU) was used to produce image maps of hydroxyl-bearing minerals using Hyperion data at a district scale. Results derived from the visible and near infrared and shortwave infrared bands of Hyperion represented iron oxide/hydroxide and clay minerals rich zones associated with the known gold prospects in the Bau district. The results show that the known gold prospects and potentially interesting areas are recognizable by the methods used, despite limited bedrock exposure in this region and the constraints imposed by the tropical environment. The approach used in this study can be more broadly applicable to provide an opportunity for detecting potentially interesting areas of gold mineralization using the ETM + and Hyperion data in the tropical/sub-tropical regions

  16. Alteration mineral mapping using ETM+ and hyperion remote sensing data at Bau Gold Field, Sarawak, Malaysia

    Science.gov (United States)

    Pour, A. B.; Hashim, M.

    2014-02-01

    The area under investigation is the Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo. It has tropical climate with limited bedrock exposures. Bau is a gold field similar to Carlin style gold deposits. Geological analyses coupled with remote sensing data were used to detect hydrothermally altered rocks associated with gold mineralization. The Landsat Enhanced Thematic Mapper+ (ETM+) and Hyperion data were used to carry out mineral mapping of mineralized zones in the study area and surrounding terrain. Directed Principal Components Analysis (DPCA) transformation of four appropriate ETM+ band ratios were applied to produce DPC images, allowing the removal of the effects of vegetation from ETM+ data and the detection of separate mineral images at a regional scale. Linear Spectral Unmixing (LSU) was used to produce image maps of hydroxyl-bearing minerals using Hyperion data at a district scale. Results derived from the visible and near infrared and shortwave infrared bands of Hyperion represented iron oxide/hydroxide and clay minerals rich zones associated with the known gold prospects in the Bau district. The results show that the known gold prospects and potentially interesting areas are recognizable by the methods used, despite limited bedrock exposure in this region and the constraints imposed by the tropical environment. The approach used in this study can be more broadly applicable to provide an opportunity for detecting potentially interesting areas of gold mineralization using the ETM+ and Hyperion data in the tropical/sub-tropical regions.

  17. Optimization of a large integrated area development of gas fields offshore Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Inyang, S.E.; Tak, A.N.H.; Costello, G.

    1995-01-01

    Optimizations of field development plans are routine in the industry. The size, schedule and nature of the upstream gas supply project to the second Malaysia LNG (MLNG Dua) plant in Bintulu, Sarawak made the need for extensive optimizations critical to realizing a robust and cost effective development scheme, and makes the work of more general interest. The project comprises the upstream development of 11 offshore fields for gas supply to MLNG Dua plant at an initial plateau production of 7.8 million tons per year of LNG. The gas fields span a large geographical area in medium water depths (up to 440 ft), and contain gas reserves of a distinctly variable gas quality. This paper describes the project optimization efforts aimed to ensure an upstream gas supply system effectiveness of over 99% throughout the project life while maintaining high safety and environmental standards and also achieving an economic development in an era of low hydrocarbon prices. Fifty percent of the first of the three phases of this gas supply project has already been completed and the first gas from these fields is scheduled to be available by the end of 1995

  18. Differences in Prokaryotic Species Between Primary and Logged-Over Deep Peat Forest in Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Mohd Shawal Thakib Maidin; Sakinah Safari; Nur Aziemah Ghani; Sharifah Azura Syed Ibrahim; Shamsilawani Ahamed Bakeri; Mohamed Mazmira Mohd Masri; Siti Ramlah Ahmad Ali

    2016-01-01

    Peat land has an important role in environmental sustainability which can be used for agricultural purposes. However, deforestation in the logged-over forest may disrupt the diversity of microbial population in peat soil. Therefore, this study focuses on the differences of microbial populations in Maludam primary forest and Cermat Ceria logged-over forest in Sarawak, Malaysia. The prokaryotic 16S rDNA region was amplified followed by denaturing gradient gel electrophoresis (16S PCR-DGGE) analysis. Berger-Parker and Shannon-Weaver Biodiversity Index showed that Maludam (0.11, 7.75) was more diverse compared to Cermat Ceria (0.19, 7.63). Sequence analysis showed that the bacterial community in Maludam and Cermat Ceria were dominated by unclassified bacteria, followed by Acidobacteria, Actinobacteria, Firmicutes and a-Proteobacteria. Based on the findings, the distinct species that can be found in Maludam were Acidobacterium capsulatum, Solibacter sp., Mycobacterium intracellulare, Rhodoplanes sp., Clostridia bacterium, Exiguobacterium sp. and Lysinibacillus fusiformis. While, the distinct species that can be found in Cermat Ceria were Telmatobacter, Mycobacterium tuberculosis and Bacillus tequilensis. Overall, the findings showed that microbial population in the logged-over forest are less diverse compared to primary forest. Higher prokaryotic diversity identified in the primary forest compared to logged-over forest showed that deforestation might cause prokaryotic population changes to both ecosystems. (author)

  19. Methane emissions from paddy cultivation and livestock farming in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Peng E.K.

    2017-01-01

    Full Text Available In this study, implementation of Tier 1 methodology of 2006 IPCC (Intergovernmental Panel on Climate Change Guidelines in paddy cultivation and livestock farming has been applied to estimate methane emissions in Sarawak, Malaysia within the years from 1998 to 2009. Methane emission inventory has been developed in this study, based on volume 4, 2006 IPCC Guidelines. Based on cultivation area and livestock population data as input to Tier 1 methodology, variations in paddy cultivation area and amount of livestock has been identified as the main contributor to emissions of methane. Methane emissions increased from 1.61 to 1.72 Gg CH4/year during 1998 to 1999. Based on results obtained, the outcomes show that there would be a significant drop of methane emission from buffalo and sheep. Although there are gain and loss in emissions from enteric fermentation, drastic reduction is observed from 0.65 Gg CH4/year in 1998 to 0.44 Gg CH4/year in 2009 as well as 0.05 Gg CH4/year to 0.02 Gg CH4/year for buffalo and sheep respectively. Simultaneously, methane emissions from manure management of buffalo has decreased from 0.024 Gg CH4/year in 1998 to 0.016 Gg CH4/year in 2009 while for sheep, its emission from manure management dropped from 0.002 Gg CH4/year in 1998 to 0.0007 Gg CH4/year in 2009. Overall emission from paddy cultivation can be considered in upward trend due to gain from 1998 at 1.61 Gg CH4/year to 1.67 Gg CH4/year in 2009. As an addition, significant rise in methane emission by 0.24 Gg CH4/year from 2000 to 2006 as well as 0.1 Gg CH4/year from 2007 to 2009 show momentum gaining in enteric fermentation of cattle. It also indicates future increment in methane emission from cattle which coherently affects the state’s emission level. As for emissions from manure management, emissions from cattle, goat and deer are gaining momentum in Sarawak.

  20. Comparative analysis of JKR Sarawak form of contract and Malaysia Standard form of building contract (PWD203A)

    Science.gov (United States)

    Yunus, A. I. A.; Muhammad, W. M. N. W.; Saaid, M. N. F.

    2018-04-01

    Standard form of contract is normally being used in Malaysia construction industry in establishing legal relation between contracting parties. Generally, most of Malaysia federal government construction project used PWD203A which is a standard form of contract to be used where Bills of Quantities Form Part of the Contract and it is issued by Public Works Department (PWD/JKR). On the other hand in Sarawak, the largest state in Malaysia, the state government has issued their own standard form of contract namely JKR Sarawak Form of Contract 2006. Even both forms have been used widely in construction industry; there is still lack of understanding on both forms. The aim of this paper is to identify significant provision on both forms of contract. Document analysis has been adopted in conducting an in-depth review on both forms. It is found that, both forms of contracts have differences and similarities on several provisions specifically matters to definitions and general; execution of the works; payments, completion and final account; and delay, dispute resolution and determination.

  1. Monitoring of Waterborne Parasites in Two Drinking Water Treatment Plants: A Study in Sarawak, Malaysia.

    Science.gov (United States)

    Richard, Reena Leeba; Ithoi, Init; Abd Majid, Mohamad Azlan; Wan Sulaiman, Wan Yusoff; Tan, Tian Chye; Nissapatorn, Veeranoot; Lim, Yvonne Ai Lian

    2016-06-28

    The occurrence of waterborne parasites coupled with water parameters at various processing sites of two drinking water treatment plants (A and B) and seven distribution system (DS) sites in Sarawak, Malaysia were studied. Ten liters of water underwent immunomagnetic separation (IMS) technique to detect the presence of Giardia and Cryptosporidium (oo)cysts. The remaining supernatant was used to detect other parasites whilst 50 mL of water sample was each used in the detection of free-living amoebae and fecal coliforms. Sampled water was positive for Giardia (32.9%; 28/85), Cryptosporidium (18.8%; 16/85) followed by Spirometra ova-like (25.9%; 22/85), Blastocystis-like (25.9%; 22/85), nematode larvae-like (8.2%; 7/85) and Taenia ova-like (1.2%; 1/85). Meanwhile, 90.2% (55/61) samples were positive for Acanthamoeba and Naegleria via cultivation and of these, 11 isolates were confirmed as Acanthamoeba genotype T3 (5/7) and T4 (2/7) followed by Naegleria sp. (4/11), Naegleria italica (2/11), Naegleria australiensis (1/11), Naegleria angularis (1/11) and Vahlkampfia sp. (3/11). Cryptosporidium, Acanthamoeba and Naegleria were also detected in one of the seven tested DS sites. Only Giardia and Cryptosporidium showed significant correlations with fluoride and fecal coliforms. These results describe the occurrence of waterborne parasites that will assist key stakeholders in mitigating contamination at the specific sites.

  2. Bleeding events and associated factors in a cohort of adult patients taking warfarin in Sarawak, Malaysia.

    Science.gov (United States)

    Edwards, Frances; Arkell, Paul; Fong; Roberts, Lesley M; Gendy, David; Wong, Christina Siew-Hie; Ngu, Joanna Chee Yien; Tiong, Lee Len; Bibi, Faridha Mohd Salleh; Lai, Lana Yin Hui; Ong, Tiong Kiam; Abouyannis, Michael

    2014-01-01

    Evidence is emerging that rates of adverse events in patients taking warfarin may vary with ethnicity. This study investigated the rates of bleeds and thromboembolic events, the international normalised ratio (INR) status and the relationship between INR and bleeding events in Malaysia. Patients attending INR clinic at the Heart Centre, Sarawak General Hospital were enrolled on an ad hoc basis from May 2010 and followed up for 1 year. At each routine visit, INR was recorded and screening for bleeding or thromboembolism occurred. Variables relating to INR control were used as predictors of bleeds in logistic regression models. 125 patients contributed to 140 person-years of follow-up. The rates of major bleed, thromboembolic event and minor bleed per 100 person-years of follow-up were 1.4, 0.75 and 34.3. The median time at target range calculated using the Rosendaal method was 61.6% (IQR 44.6–74.1%). Of the out-of-range readings, 30.0% were below range and 15.4% were above. INR variability, (standard deviation of individuals’ mean INR), was the best predictor of bleeding events, with an odds ratio of 3.21 (95% CI 1.10–9.38). Low rates of both major bleeds and thromboembolic events were recorded, in addition to a substantial number of INR readings under the recommended target range. This may suggest that the recommended INR ranges may not represent the optimal warfarin intensity for this population and that a lower intensity of therapy, as observed in this cohort, could be beneficial in preventing adverse events.

  3. Structural geology mapping using PALSAR data in the Bau gold mining district, Sarawak, Malaysia

    Science.gov (United States)

    Pour, Amin Beiranvand; Hashim, Mazlan

    2014-08-01

    The application of optical remote sensing data for geological mapping is difficult in the tropical environment. The persistent cloud coverage, dominated vegetation in the landscape and limited bedrock exposures are constraints imposed by the tropical climate. Structural geology investigations that are searching for epithermal or polymetallic vein-type ore deposits can be developed using Synthetic Aperture Radar (SAR) remote sensing data in tropical/sub-tropical regions. The Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo has been selected for this study. The Bau is a gold field similar to Carlin style gold deposits, but gold mineralization at Bau is much more structurally controlled. Geological analyses coupled with the Phased Array type L-band Synthetic Aperture Radar (PALSAR) remote sensing data were used to detect structural elements associated with gold mineralization. The PALSAR data were used to perform lithological-structural mapping of mineralized zones in the study area and surrounding terrain. Structural elements were detected along the SSW to NNE trend of the Tuban fault zone and Tai Parit fault that corresponds to the areas of occurrence of the gold mineralization in the Bau Limestone. Most of quartz-gold bearing veins occur in high-angle faults, fractures and joints within massive units of the Bau Limestone. The results show that four deformation events (D1-D4) in the structures of the Bau district and structurally controlled gold mineralization indicators, including faults, joints and fractures are detectable using PALSAR data at both regional and district scales. The approach used in this study can be more broadly applicable to provide preliminary information for exploration potentially interesting areas of epithermal or polymetallic vein-type mineralization using the PALSAR data in the tropical/sub-tropical regions.

  4. On one new genus and three new species of freshwater crabs (Crustacea: Decapoda: Brachyura: Potamidae and Grapsidae) from Lanjak-Entimau, Sarawak, East Malaysia, Borneo

    NARCIS (Netherlands)

    Ng, P.K.L.

    1995-01-01

    The freshwater crabs obtained from the Lanjak-Entimau area in Sarawak, East Malaysia, Borneo, are reported upon. One new genus (Ibanum) and two new species of Potamidae (Ibanum aethes and Isolapotamon stuebingi) and a new species of Grapsidae (Geosesarma katibas) are described. The identity of

  5. Red hot chili pepper. A new Calluella stoliczka, 1872 (Lissamphibia: Anura: Microhylidae) from Sarawak, East Malaysia (Borneo).

    Science.gov (United States)

    Das, Indraneil; Min, Pui Yong; Hsu, Wayne W; Hertwig, Stefan T; Haas, Alexander

    2014-04-07

    A new brightly-coloured (olive and red) species of microhylid frog of the genus Calluella Stoliczka 1872 is described from the upper elevations of Gunung Penrissen and the Matang Range, Sarawak, East Malaysia (Borneo). Calluella capsa, new species, is diagnosable in showing the following combination of characters: SVL up to 36.0 mm; dorsum weakly granular; a faint dermal fold across forehead; toe tips obtuse; webbing on toes basal; lateral fringes on toes present; outer metatarsal tubercle present; and dorsum greyish-olive, with red spots; half of venter bright red, the rest with large white and dark areas. The new species is the eighth species of Calluella to be described, and the fourth known from Borneo. A preliminary phylogeny of Calluella and its relatives is presented, and the new taxon compared with congeners from Malaysia and other parts of south-east Asia. 

  6. Estimation of stature from hand and handprint measurements in Iban population in Sarawak, Malaysia and its applications in forensic investigation.

    Science.gov (United States)

    Zulkifly, Nuranis-Raihan; Wahab, Roswanira Abd; Layang, Elizabeth; Ismail, Dzulkiflee; Desa, Wan Nur Syuhaila Mat; Hisham, Salina; Mahat, Naji A

    2018-01-01

    Handprints and dismembered hands are commonly found during crime scene investigations and disaster victim identifications, respectively. It has been indicated that the accuracy of handprint and hand measurements for estimating stature maybe population specific. Since Iban is the largest ethnic population in Sarawak, Malaysia and because the application of anthropometry of hand and handprint within this population as well as other populations within the Southeast Asian countries remain unreported, this present study that investigated the reliability and accuracy of these two anthropometric aspects acquires forensic significance. Upon measuring the height, 21 measurements were recorded on each hand and the corresponding handprint of 50 male and 52 female consented adult Iban subjects. Using univariate statistics as well as simple and multiple regression analyses, interpretation of the measurements examined here was attempted. Results revealed that lengths of hand and handprint are the more reliable traits for estimating stature in both the male and female Iban subjects (p Sarawak that may prove useful for crime scene investigations and disaster victim identifications in Malaysia. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  7. The structure and stratigraphy of deepwater Sarawak, Malaysia: Implications for tectonic evolution

    Science.gov (United States)

    Madon, Mazlan; Kim, Cheng Ly; Wong, Robert

    2013-10-01

    The structural-stratigraphic history of the North Luconia Province, Sarawak deepwater area, is related to the tectonic history of the South China Sea. The Sarawak Basin initiated as a foreland basin as a result of the collision of the Luconia continental block with Sarawak (Sarawak Orogeny). The foreland basin was later overridden by and buried under the prograding Oligocene-Recent shelf-slope system. The basin had evolved through a deep foreland basin ('flysch') phase during late Eocene-Oligocene times, followed by post-Oligocene ('molasse') phase of shallow marine shelf progradation to present day. Seismic interpretation reveals a regional Early Miocene Unconformity (EMU) separating pre-Oligocene to Miocene rifted basement from overlying undeformed Upper Miocene-Pliocene bathyal sediments. Seismic, well data and subsidence analysis indicate that the EMU was caused by relative uplift and predominantly submarine erosion between ˜19 and 17 Ma ago. The subsidence history suggests a rift-like subsidence pattern, probably with a foreland basin overprint during the last 10 Ma. Modelling results indicate that the EMU represents a major hiatus in the sedimentation history, with an estimated 500-2600 m of missing section, equivalent to a time gap of 8-10 Ma. The EMU is known to extend over the entire NW Borneo margin and is probably related to the Sabah Orogeny which marks the cessation of sea-floor spreading in the South China Sea and collision of Dangerous Grounds block with Sabah. Gravity modelling indicates a thinned continental crust underneath the Sarawak shelf and slope and supports the seismic and well data interpretation. There is a probable presence of an overthrust wedge beneath the Sarawak shelf, which could be interpreted as a sliver of the Rajang Group accretionary prism. Alternatively, magmatic underplating beneath the Sarawak shelf could equally explain the free-air gravity anomaly. The Sarawak basin was part of a remnant ocean basin that was closed by

  8. A new montane species of Philautus (Amphibia: Anura: Rhacophoridae) from western Sarawak, Malaysia, Borneo.

    Science.gov (United States)

    Dehling, J Maximilian; Dehling, Matthias

    2013-01-01

    A new species of Philautus is described from western Sarawak. The new species was collected in lower montane forest in two national parks in Sarawak and recorded from another park. It differs from its congeners by a unique combination of morphological characters, including a long, acuminate snout, long legs, and comparatively extensive toe webbing. The advertisement call of the new species differs from all calls of other species that have been analyzed so far. Comparison of the mitochondrial 16S rRNA gene sequence corroborates its distinct specific status.

  9. Unrealized diversity in an urban rainforest: A new species of Lygosoma (Squamata: Scincidae) from western Sarawak, Malaysia (Borneo).

    Science.gov (United States)

    Karin, Benjamin R; Freitas, Elyse S; Shonleben, Samuel; Grismer, L Lee; Bauer, Aaron M; Das, Indraneil

    2018-01-12

    We collected two specimens of an undescribed species of Lygosoma from pitfall traps in an urban rainforest in Kuching and from the base of a forested hill in western Sarawak, East Malaysia. The new species is diagnosable from all south-east Asian congeners by morphological characters, and most closely resembles Lygosoma herberti from the Thai-Malay Peninsula. The new species shows substantial molecular divergence from its closest relatives in two protein-coding genes, one mitochondrial (ND1) and one nuclear (R35) that we sequenced for several south-east Asian congeners. We describe the new species on the basis of this distinct morphology and genetic divergence. It is the third species of Lygosoma known from Borneo, and highlights the continuing rise in lizard species diversity on the island. In addition, the discovery of this species from a small urban rainforest underscores the importance of preserving intact rainforest areas of any size in maintaining species diversity.

  10. Dressed in black. A New Ansonia Stoliczka, 1870 (Lissamphibia: Anura: Bufonidae) from Gunung Murud, Sarawak, East Malaysia (Borneo).

    Science.gov (United States)

    Hertwig, Stefan T; Min, Pui Yong; Haas, Alexander; Das, Indraneil

    2014-06-10

    A new species of stream toad of the genus Ansonia is described from Gunung Murud, Pulong Tau National Park, of northern Sarawak, Malaysia, Borneo. Ansonia vidua, sp. nov., is morphologically distinguished from its Bornean congeners by the following combination of characters: medium size (SVL of adult females 33.5-34.4 mm); body uniformly black-brown in life; absence of a visible pattern on dorsum or limbs; presence of two low interorbital ridges; shagreened skin on dorsum, sides and upper surfaces of the limbs with numerous homogeneously small, rounded warts; first finger shorter than second; reduced webbing between the toes and an absence of a sharp tarsal ridge. Uncorrected genetic distances between related taxa of > 4.3% in 16S rRNA gene support its status as a hitherto undescribed species.

  11. A new species of Tropidophorus Duméril & Bibron, 1839 (Squamata: Sauria: Scincidae) from Sarawak, East Malaysia (Borneo).

    Science.gov (United States)

    Pui, Yong Min; Karin, Benjamin R; Bauer, Aaron M; Das, Indraneil

    2017-05-03

    A new species of the genus Tropidophorus is described from Putai, upper Baleh, Kapit districts, Sarawak, East Malaysia (Borneo). Tropidophorus sebi sp. nov. is diagnosable from congeners from Borneo by the combination of the following characters: head shields present, dorsal and lateral scales smooth; parietal scales in two pairs; supraciliaries eight; supraoculars four; supralabials seven; infralabials four; postmental undivided; longitudinal scale rows 58; ventrals 53; transverse scale rows at midbody 34; subcaudals 98; preanals enlarged, single; and subdigital lamellae of Toe IV 19. In addition, we determine the phylogenetic position of this species within the Tropidophorus group based on mitochondrial markers, and present a key to identification of the known Bornean species in the genus.

  12. Language Choices of CEOs of Chinese Family Business in Sarawak, Malaysia

    Science.gov (United States)

    Ting, Su-Hie

    2017-01-01

    The study investigated the language choices of Chief Executive Officers (CEOs) of Chinese family business and the factors guiding their choices. Interviews were conducted with 17 CEOs of family businesses located in Sarawak, some of whom are the sons and grandsons of the founder of the business. The results showed that all the CEOs can speak their…

  13. Language Use and Sustainability Status of Indigenous Languages in Sarawak, Malaysia

    Science.gov (United States)

    Ting, Su-Hie; Ling, Teck-Yee

    2013-01-01

    The study examines the sustainability status of Sarawak indigenous languages through a survey on adolescents' language use using the Expanded Graded Intergenerational Disruption Scale (EGIDS). The specific aspects examined were: the presence of ethnic languages in relation to other languages in selected domains of language use; the adolescents'…

  14. Effectiveness of pictorial health warning on cigarette packages: A cross-sectional study in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Md Mizanur Rahman

    2015-07-01

    Full Text Available Specific health warning placed on the tobacco product packages is considered as an effective and low-cost method for increasing the knowledge and awareness among the community. Thus, a study was conducted to assess the perception of pictorial health warnings (PHWs against smoking among the adult rural population of Sarawak.

  15. U-Th dating of speleothems to investigate the evolution of limestone caves in the Gunung Mulu National Park, Sarawak, Malaysia

    OpenAIRE

    Moseley, Gina E.; Richards, David A.; Smith, Christopher; Smart, Peter L.; Hoffmann, Dirk L.; Farrant, Andrew R.

    2013-01-01

    The Gunung Mulu National Park, Sarawak, Malaysia has been a focus of scientific research and exploration for several decades. Previous work investigated the relationship between fluvial incision into the limestone massif and the chronological evolution of the 500m-deep network of cave passages. This study involved analyses of newly available speleothem material using state-of-the-art U-Th dating methods and assessment of the potential for extension of the chronological record using U-Pb datin...

  16. The identity of the semiterrestrial crab Terrathelphusa kuchingensis (Nobili, 1901) (Crustacea: Decapoda: Brachyura: Gecarcinucidae), with descriptions of four new species from southwestern Sarawak, Borneo, Malaysia.

    Science.gov (United States)

    Grinang, Jongkar; Ng, Peter K L

    2015-04-10

    Four new species of semiterrestrial gecarcinucid crabs are described from limestone and sandstone habitats in southwestern Sarawak, Malaysia: Terrathelphusa aglaia n. sp., T. cerina n. sp., T. kundong n. sp., and T. mas n. sp. The taxonomy of T. kuchingensis (Nobili, 1901) is discussed, its precise identity ascertained from fresh material, and its actual distribution determined. This increases the number of Terrathelphusa species in Borneo to eight.

  17. Checklist of Gastropods from the Exclusive Economic Zone (EEZ), Sarawak, Malaysia.

    Science.gov (United States)

    Morni, Wan Zabidii Wan; Rahim, Siti Akmar Khadijah Ab; Rumpet, Richard; Musel, Jamil; Hassan, Ruhana

    2017-01-01

    This study provides the first marine gastropod checklist from the Sarawak Exclusive Economic Zone (EEZ). Gastropod samples were collected from selected stations in the Sarawak EEZ using an otter trawl net with a stretched mesh size of 38 mm at the cod end. The trawling operations were conducted more than 12 nautical miles from the coast, and the area was divided into three depth strata: I) 20-50 m, II) 50-100 m and III) 100-200 m. A total of 23 gastropod species were identified during the two-month sampling period from 16 August until 6 October 2015, representing 8 superfamilies, 15 families and 20 genera. Superfamily Tonnoidea was represented by 7 species, followed by Muricoidea (5 species), Cypraeoidea (4 species), and Buccinoidea and Conoidea (both with 2 species). Other superfamilies were represented by a single species. Only 3 species were obtained in 2 depth strata, namely Melo melo , Murex aduncospinosus and Tonna galea . In addition, 9, 13 and 4 species of gastropods were found in strata I, II and III, respectively. The information on gastropod distributions at different depth strata in the Sarawak EEZ could be useful in updating the Malaysian species diversity database.

  18. Age and provenance of Triassic to Cenozoic sediments of West and Central Sarawak, Malaysia

    Science.gov (United States)

    Breitfeld, H. Tim; Galin, Thomson; Hall, Robert

    2015-04-01

    Sarawak is located on the northern edge of Sundaland in NW Borneo. West and Central Sarawak include parts of the Kuching and Sibu Zones. These contain remnants of several sedimentary basins with ages from Triassic to Cenozoic. New light mineral, heavy mineral and U-Pb detrital zircon ages show differences in provenance reflecting the tectonic evolution of the region. The oldest clastic sediments are Triassic (Sadong Formation and its deep marine equivalent Kuching Formation). They were sourced by a Triassic (Carnian to Norian) volcanic arc and reworked Paleoproterozoic detritus derived from Cathaysialand. The Upper Jurassic to Cretaceous Pedawan Formation is interpreted as forearc basin fill with distinctive zircon populations indicating subduction beneath present-day West Sarawak which initiated in the Late Jurassic. Subsequent subduction until the early Late Cretaceous formed the Schwaner Mountains magmatic arc. After collision of SW Borneo and other microcontinental fragments with Sundaland in the early Late Cretaceous, deep marine sedimentation (Pedawan Formation) ceased, and there was uplift forming the regional Pedawan-Kayan unconformity. Two episodes of extension followed and were responsible for basin development on land in West Sarawak from the latest Cretaceous onwards, probably in a pull-apart setting. The first episode is associated with sediments of the Kayan Group, deposited in the Latest Cretaceous (Maastrichtian) to Eocene, and the second episode with Upper Eocene sediments of the Ketungau Basin. Zircon ages indicate volcanic activity throughout the Early Cenozoic in NW Borneo, and inherited zircon ages indicate reworking of Triassic and Cretaceous rocks. A large deep marine basin, the Rajang Basin, was north of the Lupar Line Fault in Central Sarawak (Sibu Zone) from the Late Cretaceous to the Late Eocene. Zircons from sediments of the Rajang Basin indicate they have similar ages and provenance to contemporaneous terrestrial sediments of the Kayan

  19. Malaysia

    International Nuclear Information System (INIS)

    1992-01-01

    Malaysia's oil reserves are found in 56 fields, 32 of which are in production. Gas is found in 54 fields, four of which are in production three off Sarawak and one off Terengganu. Oil reserves stand at 3.6 billion barrels and gas at 59 trillion cubic feet respectively. Malaysia's oil reserves are expected to last 12.5 years and gas reserves 73.8 years at current rates of production and consumption. Malaysia's production of crude oil increased in 1991 to 623,100 bpd, from 600,700 bpd in 1990 in response to both increased production capacity and demand. Condensates contribute an additional estimated 22,100 bpd to total output. 57% of the crude comes from 13 oil fields off Terengganu, 20% from nine fields off Sabah and 23% from 10 fields off Sarawak. (Author)

  20. Assessment of the Water and Sediment Quality of Tropical Forest Streams in Upper Reaches of the Baleh River, Sarawak, Malaysia, Subjected to Logging Activities

    Directory of Open Access Journals (Sweden)

    Teck-Yee Ling

    2016-01-01

    Full Text Available The study of the impact of logging activities on water and sediment quality of Sarawak forest streams is still scarce despite Sarawak being the largest exporter of timber in Malaysia. This study was aimed at determining the water and sediment quality of forest streams in Sarawak and the potential impact of logging activities. In situ parameters were measured, and water and sediment samples were collected at six stations before rain. Additionally, water quality was investigated at three stations after rain. The results showed that canopy removal resulted in large temperature variation and sedimentation in the forest streams. Lower suspended solids were found at stations with inactive logging (<2 mg/L compared to active logging (10–16 mg/L activities. The highest concentration of total nitrogen and total phosphorus in water and sediment was 4.4 mg/L, 77.6 μg/L, 0.17%, and 0.01%, respectively. Besides, significantly negative correlation of sediment nitrogen and water total ammonia nitrogen indicated the loss of nitrogen from sediment to water. Water quality of the streams deteriorated after rain, in particular, suspended solids which increased from 8.3 mg/L to 104.1 mg/L. This study reveals that logging activities have an impact on the water quality of Sarawak forest streams particularly in rainfall events.

  1. Aspergillus species isolated from mangrove forests in Borneo Island, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    J.S.S. Seelan

    2009-06-01

    Full Text Available A study on the occurrence of Aspergillus spp. on selected mangrove forests in Sarawak was conducted to find out their diversity and distribution. Samples were obtained from mangrove soils and leaf litters at different locations, i.e. Sematan, Lundu, Kampung Bako, Bako in Sarawak. Soil and leaf litter samples were taken randomly at different locations with five replicates from each area. A total of 138 isolates of Aspergillus species were obtained from the soil and leaf litter samples by using direct plating and Warcup method. Based on both macroscopic and microscopic observations, using an identification key, individual isolates were classified within the genus Aspergillus, belonging to three subgenera, four sections and five species. The fungi isolates were identified as A. terreus, A. flavipes, A. carneus, A. fumigatus and A. clavatus. The most frequent isolated species was A. flavipes (63.04%, followed by A. fumigatus (16.7%, A. terreus (13.04%, A. carneus (5.8% and A. clavatus (1.44%. All of the isolated Aspergillus species grew well on MEA and CYA at 25°C. A. carneus produced reddish sclerotia on MEA after seven days and this could be used as an important characteristic in this species identification. A. clavatus from mangrove soil in Kampung Bako has shown long conidiophores (ranging from 3-5 cm with swollen hyphal structures, while A. clavatus from Sematan area has shorter conidiophores (ranging from 2.5-3.5 cm on MEA.

  2. Determinant Factors of Poor Visual Outcome After Ocular Trauma: A Retrospective Study in Central Sarawak, Malaysia.

    Science.gov (United States)

    Yong, Geng-Yi; Pan, Shin-Wei; Humayun Akhter, Faisal; Law, Thomas Ngo-Hieng; Toh, Teck-Hock

    2016-01-01

    To study the demographic characteristics of ocular trauma in Central Sarawak and identify the determinant factors of poor visual outcome. A retrospective study of ocular trauma cases presenting at the referral hospital in 2013. Patients were identified and recruited from hospital records. Those presenting for follow-up review were excluded. Case records were retrieved and reviewed after recruitment. We studied 168 patients with 179 ocular injuries, of which 44% were work related. Compared with non-work-related cases, work-related cases were more likely to be male [odds ratio (OR), 19.7; 95% confidence interval (CI), 2.6-150.9] and foreign (OR, 18.0; 95% CI, 2.3-142.0). Open globe injuries constituted a higher percentage of impaired visual acuity (VA) during the first visit: 84.6% compared with 18.1% for closed globe injuries (OR, 25.0; 95% CI, 5.3-118.4; P Sarawak were predominantly work related, occurring at industrial premises, and involving males and foreigners. Both open globe injuries and a delay in seeking treatment resulted in significantly poorer visual outcomes.

  3. Factor associated with tobacco use among the adult population in Sarawak, Malaysia: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Mizanur Rahman

    2015-01-01

    Full Text Available Introduction: Consumption of tobacco in any form is one of the leading causes of preventable mortality. The World Health Organization recommends that it should be monitored regularly.  This study was designed to estimate the prevalence of tobacco use among the rural adult population in Sarawak and factors associated with it.Methods: This was a cross-sectional study conducted among the adult population in Sarawak. Data were collected from ten villages in Kota Samarahan and Kuching Division by face to face interview using modified Global Adult Tobacco Survey questionnaire. Non-probability sampling method was adopted to select the villages. All the households of the villages were visited and an adult member was selected randomly from each house irrespective of the sex. After missing value imputation, 1000 data were analysed using statistical software SPSS 19.0 version.Results: Analysis showed that 30.9% of the respondents were current tobacco users and 11% were past tobacco users. The mean age (SD at starting tobacco was 18.1 (6.48 years. The frequency of tobacco use was 14 times per day.  Hierarchical Logistic regression analysis revealed that age with male sex (OR=1. 064, 95% CI: 1.052, 1.076, secondary education (OR=-2.712; 95% CI: 1.122, 6.555, higher secondary and above (OR=3. 571; 95% CI: 1.641,7.774, occupation as business (OR=3. 152; 95% CI: 1.732, 5.735 and environmental exposure such as smoking at working place (OR=2. 754;95% CI: 1.895,4.002, coffee house (OR=2. 274;95% CI: 1.32,3.919 and at home (OR=1. 827;95% CI: 1.242,2.687 appeared to be  important predictors of tobacco use (p<0.05.Conclusion: A large proportion of males use tobacco products. Though tobacco use was negligible among females, but they would be potential users. Environmental exposure to tobacco appeared to be important predictors. Tobacco control campaigns should target banning of tobacco use in closed and open areas and also to intensify the monitoring of all forms

  4. Prevalence, isolation and characterization of Bacillus cereus strains from rice of local cultivators of Sabah, Sarawak, and Peninsular Malaysia

    Science.gov (United States)

    Sawei, Jelin; Sani, Norrakiah Abdullah

    2016-11-01

    Bacillus cereus is a spore-forming, facultative anaerobic, motile microorganism that has been identified as a causative agent of two types of gastrointestinal diseases such as emetic and diarrhea. This foodborne pathogen is found in both vegetative cells and endospores form in foods such as rice either raw or cooked. The aim of this study is to investigate and determine the prevalence, characterize and identify the isolation of vegetative cells and endospores of B. cereus in thirty varieties (n=3) of raw rice from Sabah, Sarawak and Peninsular Malaysia. A total of 90 (n=90) raw rice were examined and 84 (93.33%) samples were positive to vegetative cells of B. cereus. However, only 32 (35.56%) samples were positive for endospore cells that able to germinate after samples were heated at 75°C for 15 mins. The mean log cfu/g for vegetative cells were higher range (0.00 - 4.1533) than visible endospores (0.00 - 3.7533 mean log cfu/g). Sample of raw red rice (UKMRC9) had significantly higher contamination by both vegetative cells and endospores at p<0.05, than the other raw rice samples.

  5. Development of Tropical Lowland Peat Forest Phasic Community Zonations in the Kota Samarahan-Asajaya area, West Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Mohamad Tarmizi Mohamad

    2016-01-01

    Full Text Available Logging observations of auger profiles (Tarmizi, 2014 indicate a vertical, downwards, general decrease of peat humification levels with depth in a tropical lowland peat forest in the Kota Samarahan-Asajaya area in the region of West Sarawak (Malaysia. Based on pollen analyses and field observations, the studied peat profiles can be interpreted as part of a progradation deltaic succession. Continued regression of sea levels, gave rise to the development of peat in a transitional mangrove to floodplain/floodbasin environment, followed by a shallow, topogenic peat depositional environment with riparian influence at approximately 2420 ± 30 years B.P. (until present time. The inferred peat vegetational succession reached Phasic Community I at approximately 2380 ± 30 years B.P. and followed by Phasic Community II at approximately 1780 ± 30 years B.P., towards the upper part of the present, ombrogenic, peat profile. Observations of the presence of large, hollow, Shorea type trees, supports that successive vegetational zonation of the tropical lowland peat dome may have reached Phasic Community II. Some pollen types were found that are also known to occur in the inferred vegetational zonation of Phasic Community III and IV or higher. Pollen analyses indicate that estuarine and deltaic, brackish to saline water influence may have gradually ceased at approximately 0.5 m below the lithological boundary between peat and underlying soil (floodplain deposit in the tropical lowland peat basin.

  6. Drug utilization review of potassium chloride injection formulations available in a private hospital in kuching, sarawak, malaysia.

    Science.gov (United States)

    Melissa, Mohammad Hirman; Azmi, Sarriff

    2013-07-01

    The concentrated potassium chloride injection is a high-alert medication and replacing it with a pre-mixed formulation can reduce the risks associated with its use. The aim of this study was to determine the clinical characteristics of patients receiving different potassium chloride formulations available at a private institution. The study also assessed the effectiveness and safety of pre-mixed formulations in the correction of hypokalaemia. This was a retrospective observational study consisting of 296 cases using concentrated and pre-mixed potassium chloride injections in 2011 in a private hospital in Kuching, Sarawak, Malaysia. There were 135 (45.6%) cases that received concentrated potassium chloride, and 161 (54.4%) cases that received pre-mixed formulations. The patients' clinical characteristics that were significantly related to the utilization of the different formulations were diagnosis (P < 0.001), potassium serum blood concentration (P < 0.05), and fluid overload risk (P < 0.05). The difference observed for the cases that achieved or maintained normokalaemia was statistically insignificant (P = 0.172). Infusion-related adverse effects were seen more in pre-mixes compared to concentrated formulations (6.8% versus 2.2%, P < 0.05). This study provides insight into the utilization of potassium chloride injections at this specific institution. The results support current recommendations to use pre-mixed formulations whenever possible.

  7. The prevalence of cardiovascular risk factors in the young and middle-aged rural population in Sarawak, Malaysia.

    Science.gov (United States)

    Chang, Ching Thon; Lee, Ping Yein; Cheah, Whye Lian

    2012-04-01

    Coronary heart disease (CHD) was the second leading cause of death in Malaysia in 2006. CHD has known risk factors including hypertension, diabetes mellitus, and obesity. This cross-sectional study examined the prevalence of cardiovascular risk factors among 260 participants aged 20 to 65 years in a rural community in Sarawak. The prevalences of overweight and obesity in this study were 39.6% and 11.9%, respectively. Approximately 13% of participants had hypertension, and 1.5% had a random blood sugar greater than 11.1 mmol/L. Chi-square tests showed significant associations between obesity and gender (P = 0.007), low high-density lipoprotein cholesterol and race (P = 0.05), high total cholesterol and age (P = 0.007), age and hypertension (P = 0.011), smoking and gender (P 45 years) were 0.395 times more likely to have high cholesterol and that those with a higher monthly household income (> RM830) were 2.471 times more likely to smoke. These findings indicate that we should be concerned about the high rates of overweight in this rural community to prevent obesity.

  8. Description of the tadpoles of three rare species of megophryid frogs (Amphibia: Anura: Megophryidae) from Gunung Mulu, Sarawak, Malaysia.

    Science.gov (United States)

    Oberhummer, Evelyne; Barten, Catherin; Schweizer, Manuel; Das, Indraneil; Haas, Alexander; Hertwig, Stefan T

    2014-07-09

    The megophryid frogs Leptobrachella brevicrus, Leptolalax dringi and Megophrys dringi are species exclusively known  from highly localised areas in isolated mountain ranges on Borneo. The tadpoles and adults in this study were collected at the shared type locality for the three species in Gunung Mulu National Park, Sarawak, Malaysia (Borneo). The species identities of larvae were determined via comparison to syntopic adults using DNA barcoding techniques based on partial 16S rRNA mitochondrial gene sequences. The genetic data supported the status of the three taxa as valid species. Descriptions of colouration in life and after preservation, external morphological features, morphometric measurements and ecological notes in comparison to congeneric species are supplied. The tadpoles of L. brevicrus and L. dringi show similar adaptations to a fossorial lifestyle. These include an elongated, vermiform body, a relatively long tail and small eyes. Both were found in the gravel beds of a small mountain stream. In contrast, the larvae of M. dringi are adapted to occupying and feeding at the surface of pools within the stream. 

  9. Gender differences in body mass index, body weight perception and weight loss strategies among undergraduates in Universiti Malaysia Sarawak.

    Science.gov (United States)

    Kuan, P X; Ho, H L; Shuhaili, M S; Siti, A A; Gudum, H R

    2011-04-01

    This study was carried out among undergraduate students in Universiti Malaysia Sarawak with the objective of examining gender differences in body mass index (BMI), body weight perception, eating attitudes and weightloss strategies. Subjects consisted of 600 undergraduates (300 males and 300 females) recruited from the various faculties between September 2008 until mid-November 2008. The Original Figure Rating Scale: Body Weight Perception, Body Shape Questionnaire (BSQ) and Eating Attitudes Test-26 (EAT-26) were used as assessment tools. Overall, 52.8% of students had normal BMI, with approximately an equal number of both sexes. More males than females were overweight (33.7%), while more females were underweight (25.3%). Males were more likely to perceive themselves as overweight, and fail to see themselves as underweight. More than half of the females preferred their ideal figure to be underweight, whereas about 30% males chose an overweight figure as their ideal model. Females were generally more concerned about body weight, body shape and eating than males. They diet more frequently, had self-induced vomiting, and used laxatives and exercise as their weight-loss strategies. Issues pertaining to body weight perception, eating attitudes and weight-loss strategies exist with differences among male and female undergraduates. Thus, in order to correct misperceptions among young adults, a more tailored intervention programme and more in-depth studies into the various factors involved are required.

  10. A new species of Rock Gecko genus Cnemaspis (Squamata: Gekkonidae) from Western Sarawak, Malaysia.

    Science.gov (United States)

    Kurita, Takaki; Nishikawa, Kanto; Matsui, Masafumi; Hikida, Tsutomu

    2017-05-03

    A new species of Asian rock gecko, genus Cnemaspis, is described from Padawan, western Sarawak, Malaysian Borneo. The new species forms a clade with C. paripari and C. nigridia of the C. nigridia group in a mitochondrial DNA phylogeny and is similar to them morphologically in some characters such as caudal scalation. It differs from the other Asian Cnemaspis species in its unique combination of snout-vent length (up to 62.7 mm), 4-9 precloacal pores in males, keeled subcaudals with an enlarged, smooth, median row, presence of ventrolateral caudal tubercles, and coloration (head and upper flanks dark-yellow; anterior portion of tail black; posterior portion of tail white with black, paravertebral blob). Phylogenetic relationships within the C. nigridia group and the distributional ranges of species within the group suggest allopatric speciation by geographic isolation.

  11. Above Ground Biomass-carbon Partitioning, Storage and Sequestration in a Rehabilitated Forest, Bintulu, Sarawak, Malaysia

    International Nuclear Information System (INIS)

    Kueh, J.H.R.; Majid, N.M.A.; Seca, G.; Ahmed, O.H.

    2013-01-01

    Forest degradation and deforestation are some of the major global concerns as it can reduce forest carbon storage and sequestration capacity. Forest rehabilitation on degraded forest areas has the potential to improve carbon stock, hence mitigate greenhouse gases emission. However, the carbon storage and sequestration potential in a rehabilitated tropical forest remains unclear due to the lack of information. This paper reports an initiative to estimate biomass-carbon partitioning, storage and sequestration in a rehabilitated forest. The study site was at the UPM-Mitsubishi Corporation Forest Rehabilitation Project, UPM Bintulu Sarawak Campus, Bintulu, Sarawak. A plot of 20 x 20 m 2 was established each in site 1991 (Plot 1991), 1999 (Plot 1999) and 2008 (Plot 2008). An adjacent natural regenerating secondary forest plot (Plot NF) was also established for comparison purposes. The results showed that the contribution of tree component biomass/ carbon to total biomass/ carbon was in the order of main stem > branch > leaf. As most of the trees were concentrated in diameter size class = 10 cm for younger rehabilitated forests, the total above ground biomass/ carbon was from this class. These observations suggest that the forests are in the early successional stage. The total above ground biomass obtained for the rehabilitated forest ranged from 4.3 to 4,192.3 kg compared to natural regenerating secondary forest of 3,942.3 kg while total above ground carbon ranged from 1.9 to 1,927.9 kg and 1,820.4 kg, respectively. The mean total above ground biomass accumulated ranged from 1.3 x 10 -2 to 20.5 kg/ 0.04 ha and mean total carbon storage ranged from 5.9 x 10 -3 to 9.4 kg/ 0.04 ha. The total CO 2 sequestrated in rehabilitated forest ranged from 6.9 to 7,069.1 kg CO 2 / 0.04 ha. After 19 years, the rehabilitated forest had total above ground biomass and carbon storage comparable to the natural regeneration secondary forest. The forest rehabilitated activities have the

  12. Factors affecting satisfaction on antenatal care services in Sarawak, Malaysia: evidence from a cross sectional study.

    Science.gov (United States)

    Rahman, Md Mizanur; Ngadan, Deburra Peak; Arif, Mohammad Taha

    2016-01-01

    High levels of satisfaction among women with the antenatal care services will increase the compliance of antenatal visits during pregnancy. Thus, this study was done to assess the level of satisfaction among women on the quality of antenatal care received and the factors influencing thereof. This was a cross-sectional study conducted in the three zones of Sarawak. Women aged 18 years and above, irrespective of ethnic groups, having children aged 3 years and below were included in the study. Data was collected by face-to-face interview using interview schedule. A validated Patient Satisfaction Questionnaire (PSQ-18) was used to assess the satisfaction with antenatal care. A total of 1236 data was analysed using IBM SPSS version 22.0. A p value <0.05 was considered as statistically significant. A multinomial logistic regression analysis revealed that Bidayuh 17.4 % was less likely to be highly satisfied with antenatal care. Similarly, respondents with secondary level of education 29.9 % were less likely to be highly satisfied, whereas, respondents having primary level of education, 1.6 % were less likely to be highly satisfied. However, those who did not spend any money as out of pocket expenses were 1.935 times more likely to be highly satisfied with antenatal care. Overall the studied women were satisfied with the antenatal care services. Ethnicity, level of education and out of pocket expenses appeared to be important predictors of satisfaction with antenatal care. The finding recommends the community-based and language-specific interventions should be implemented to sustain the satisfaction of maternal care.

  13. Effectiveness of pictorial health warning on cigarette packages: A cross-sectional study in Sarawak, Malaysia.

    Science.gov (United States)

    Rahman, M M; Arif, M T; Abd, Razak Mf; Suhaili, M R; Tambi, Z; Akoi, C; Gabriel Bain, M; Hussain, H

    2015-01-01

    Specific health warning placed on the tobacco product packages is considered as an effective and low-cost method for increasing the knowledge and awareness among the community. Thus, a study was conducted to assess the perception of pictorial health warnings (PHWs) against smoking among the adult rural population of Sarawak. Cross-sectional data were collected from 10 villages in Kota Samarahan and Kuching Division by face to face interview using modified Global Adult Tobacco Survey questionnaire. Nonprobability sampling method was adopted to select the villages. All the households of the selected villages were visited and an adult member was selected randomly from each house irrespective of the sex. After missing value imputation, 1000 data were analysed using statistical software IBM SPSS 20.0 version. Analysis showed that 28.8% of the respondents were current smokers, 7.8% were past smokers and the rest were non-smokers. Six items of pictorial health warnings were evaluated with five point Likert's scales for attractiveness, fearfulness and adequacy of the information. Analysis revealed that the majority of the respondents had perceived awareness on PHWs, but the smokers believed that this was not adequate to make them quit smoking. Only one-fifth (19.7%) of them reported that current pictorial health warnings were sufficient to motivate people to quit smoking. Though the PHWs on cigarette packages are appealing, it is not sufficient as a reason to stop smoking. Thus, an approach using an integrated anti-tobacco public health programme should be focused into the specific targeted community.

  14. Causes and predictors of mortality in hospitalized lupus patient in Sarawak General Hospital, Malaysia.

    Science.gov (United States)

    Teh, C L; Ling, G R

    2013-01-01

    Systemic lupus erythematosus (SLE) is a serious autoimmune disease that can be life threatening and fatal if left untreated. Causes and prognostic indicators of death in SLE have been well studied in developed countries but lacking in developing countries. We aimed to investigate the causes of mortality in hospitalized patients with SLE and determine the prognostic indicators of mortality during hospitalization in our center. All SLE patients who were admitted to Sarawak General Hospital from January 1, 2006 to December 31, 2010, were followed up in a prospective study using a standard protocol. Demographic data, clinical features, disease activities and damage indices were collected. Logistic regression and Cox regression analysis were used to determine the prognostic indicators of mortality in our patients. There were a total of 251 patients in our study, with the female to male ratio 10 to 1. Our study patients were of multiethnic origins. They had a mean age of 30.5 ± 12.2 years and a mean duration of illness of 36.5 ± 51.6 months. The main involvements were hematologic (73.3%), renal (70.9%) and mucocutaneous (67.3%). There were 26 deaths (10.4%), with the main causes being: infection and flare (50%), infection alone (19%), flare alone (19%) and others (12%). Independent predictors of mortality in our cohort of SLE patients were the presence of both infection and flare of disease (hazard ratio (HR) 5.56) and high damage indices at the time of admission (HR 1.91). Infection and flare were the main causes of death in hospitalized Asian patients with SLE. The presence of infection with flare and high damage indices at the time of admission were independent prognostic indicators of mortality.

  15. Malaysia

    International Nuclear Information System (INIS)

    2002-10-01

    This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

  16. The moderating effect of tourism by-products on the relationship between tourism core products and destination image (Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Zahari Mohd Salehuddin Mohd

    2017-01-01

    Full Text Available This paper reports an empirical investigation on the moderating effects of the tourism by- products in building Sarawak destination image. Using causal research design through a quantitative method, self-reported and self-administered questionnaire, this study surveyed international tourists who had visited Sarawak and experienced the state core tourism products which include purchasing the local tourism by-products. Through the descriptive and inferential statistics, some useful insights about the issue investigated were significantly obtained. It's interesting to note that besides experiencing the tourism core products, the Sarawak Tourism by-products are also catching the international tourist's attention. The moderating effect of tourism by-products on the relationship between tourism core products (culture, adventure, and nature and Sarawak destination image was empirically confirmed. In fact, in addition to the core culture, adventure and nature product, the local tourism by- products undeniably building and strengthening the image of Sarawak as a tourist destination. This promising indication is, therefore, should not be ignored by the state government, tourism authority, tour operators, the local government, hotels and other related local authorities.

  17. Morphological Characteristics and Habitats of Red Seaweed Gracilaria spp. (Gracilariaceae, Rhodophyta) in Santubong and Asajaya, Sarawak, Malaysia.

    Science.gov (United States)

    Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md

    2018-03-01

    Red seaweed Gracilaria , one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii , G. blodgettii and G. coronopifolia , attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed ( Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya's mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress.

  18. Burkholderia vietnamiensis isolated from root tissues of Nipa Palm (Nypa fruticans) in Sarawak, Malaysia, proved to be its major endophytic nitrogen-fixing bacterium.

    Science.gov (United States)

    Tang, Sui-Yan; Hara, Shintaro; Melling, Lulie; Goh, Kah-Joo; Hashidoko, Yasuyuki

    2010-01-01

    Root-associating bacteria of the nipa palm (Nypa fruticans), preferring brackish-water affected mud in Sarawak, Malaysia, were investigated. In a comparison of rhizobacterial microbiota between the nipa and the sago (Metroxylon sagu) palm, it was found that the nipa palm possessed a group of Burkholderia vietnamiensis as its main active nitrogen-fixing endophytic bacterium. Acetylene reduction by the various isolates of B. vietnamiensis was constant (44 to 68 nmol h(-1) in ethylene production rate) in soft gel medium containing 0.2% sucrose as sole carbon source, and the bacterium also showed motility and biofilm-forming capacity. This is the first report of endophytic nitrogen-fixing bacteria from nipa palm.

  19. Two new species of diminutive leaf-litter skinks (Squamata: Scincidae: Tytthoscincus) from Gunung Penrissen, Sarawak, Malaysia (northern Borneo).

    Science.gov (United States)

    Karin, Benjamin R; Das, Indraneil; Bauer, Aaron M

    2016-03-22

    We describe two new species of skinks from Gunung Penrissen, Sarawak, Malaysia, in northern Borneo, Tytthoscincus batupanggah sp. nov. and T. leproauricularis sp. nov. Morphological and molecular analyses both corroborate the two new species as unique compared to all other Tytthoscincus and additional Sphenomorphus that are candidates for taxonomic placement in the genus Tytthoscincus. Despite their phenotypic similarity and sympatric distribution, a molecular analysis shows that the new species are not sister taxa and exhibit a deep genetic divergence between each of their respective sister taxa. We discuss how historical climatic and geographic processes may have led to the co-distribution of two relatively distantly related phenotypically similar species. In light of these discoveries, we also emphasize the importance of conserving primary montane tropical rainforest for maintaining species diversity.

  20. Assessment of Near-Bottom Water Quality of Southwestern Coast of Sarawak, Borneo, Malaysia: A Multivariate Statistical Approach

    Directory of Open Access Journals (Sweden)

    Chen-Lin Soo

    2017-01-01

    Full Text Available The study on Sarawak coastal water quality is scarce, not to mention the application of the multivariate statistical approach to investigate the spatial variation of water quality and to identify the pollution source in Sarawak coastal water. Hence, the present study aimed to evaluate the spatial variation of water quality along the coastline of the southwestern region of Sarawak using multivariate statistical techniques. Seventeen physicochemical parameters were measured at 11 stations along the coastline with approximately 225 km length. The coastal water quality showed spatial heterogeneity where the cluster analysis grouped the 11 stations into four different clusters. Deterioration in coastal water quality has been observed in different regions of Sarawak corresponding to land use patterns in the region. Nevertheless, nitrate-nitrogen exceeded the guideline value at all sampling stations along the coastline. The principal component analysis (PCA has determined a reduced number of five principal components that explained 89.0% of the data set variance. The first PC indicated that the nutrients were the dominant polluting factors, which is attributed to the domestic, agricultural, and aquaculture activities, followed by the suspended solids in the second PC which are related to the logging activities.

  1. Setting up home-based palliative care in countries with limited resources: a model from Sarawak, Malaysia.

    Science.gov (United States)

    Devi, B C R; Tang, T S; Corbex, M

    2008-12-01

    The provision of palliative care (PC) and opioids is difficult to ensure in remote areas in low- and middle-income countries. We describe here the set up of a home-care program in Sarawak (the Malaysian part of the Borneo Island), where half the population lives in villages that are difficult to access. The establishment of this program, initiated in 1994 by the Department of Radiotherapy of Sarawak General Hospital, consisted of training, empowering nurses, simplifying referral, facilitating access to medication, and increasing awareness among public and health professionals about PC. The program has been sustainable and cost efficient, serving 936 patients in 2006. The total morphine usage in the program increased from 1400 g in 2006. The results show that pain medication can be provided even in remote areas with effective organization and empowerment of nurses, who were the most important determinants for the set up of this program. Education of family was also a key aspect. The authors believe that the experience gained in Sarawak may help other regions with low or middle resources in the set up of their PC program especially for their remote rural population.

  2. Morphological Characteristics and Habitats of Red Seaweed Gracilaria spp. (Gracilariaceae, Rhodophyta) in Santubong and Asajaya, Sarawak, Malaysia

    Science.gov (United States)

    Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md

    2018-01-01

    Red seaweed Gracilaria, one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii, G. blodgettii and G. coronopifolia, attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed (Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya’s mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress. PMID:29644017

  3. Neglected Intestinal Parasites, Malnutrition and Associated Key Factors: A Population Based Cross-Sectional Study among Indigenous Communities in Sarawak, Malaysia.

    Directory of Open Access Journals (Sweden)

    Yamuna Rajoo

    Full Text Available Intestinal parasitic infections (IPIs have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1-2.7; p = 0.002 and close contact with animals (OR = 1.8; 95% CI = 1.3-2.9; p = 0.027 as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2-3.0; p = 0.006 was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9-1.7; p = 0.024. Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8-22.2; p = 0.001 and underweight (OR = 1.9; 95% CI = 5.6-18.7; p = 0.037, respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous

  4. Neglected Intestinal Parasites, Malnutrition and Associated Key Factors: A Population Based Cross-Sectional Study among Indigenous Communities in Sarawak, Malaysia.

    Science.gov (United States)

    Rajoo, Yamuna; Ambu, Stephen; Lim, Yvonne Ai Lian; Rajoo, Komalaveni; Tey, Siew Chang; Lu, Chan Woon; Ngui, Romano

    2017-01-01

    Intestinal parasitic infections (IPIs) have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting) was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1-2.7; p = 0.002) and close contact with animals (OR = 1.8; 95% CI = 1.3-2.9; p = 0.027) as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2-3.0; p = 0.006) was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9-1.7; p = 0.024). Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8-22.2; p = 0.001) and underweight (OR = 1.9; 95% CI = 5.6-18.7; p = 0.037), respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous community

  5. Prevalence and spectrum of germline rare variants in BRCA1/2 and PALB2 among breast cancer cases in Sarawak, Malaysia.

    Science.gov (United States)

    Yang, Xiaohong R; Devi, Beena C R; Sung, Hyuna; Guida, Jennifer; Mucaki, Eliseos J; Xiao, Yanzi; Best, Ana; Garland, Lisa; Xie, Yi; Hu, Nan; Rodriguez-Herrera, Maria; Wang, Chaoyu; Jones, Kristine; Luo, Wen; Hicks, Belynda; Tang, Tieng Swee; Moitra, Karobi; Rogan, Peter K; Dean, Michael

    2017-10-01

    To characterize the spectrum of germline mutations in BRCA1, BRCA2, and PALB2 in population-based unselected breast cancer cases in an Asian population. Germline DNA from 467 breast cancer patients in Sarawak General Hospital, Malaysia, where 93% of the breast cancer patients in Sarawak are treated, was sequenced for the entire coding region of BRCA1; BRCA2; PALB2; Exons 6, 7, and 8 of TP53; and Exons 7 and 8 of PTEN. Pathogenic variants included known pathogenic variants in ClinVar, loss of function variants, and variants that disrupt splice site. We found 27 pathogenic variants (11 BRCA1, 10 BRCA2, 4 PALB2, and 2 TP53) in 34 patients, which gave a prevalence of germline mutations of 2.8, 3.23, and 0.86% for BRCA1, BRCA2, and PALB2, respectively. Compared to mutation non-carriers, BRCA1 mutation carriers were more likely to have an earlier age at onset, triple-negative subtype, and lower body mass index, whereas BRCA2 mutation carriers were more likely to have a positive family history. Mutation carrier cases had worse survival compared to non-carriers; however, the association was mostly driven by stage and tumor subtype. We also identified 19 variants of unknown significance, and some of them were predicted to alter splicing or transcription factor binding sites. Our data provide insight into the genetics of breast cancer in this understudied group and suggest the need for modifying genetic testing guidelines for this population with a much younger age at diagnosis and more limited resources compared with Caucasian populations.

  6. Reproductive biology of Nemipterus japonicus (Bloch, 1791) from the coastal waters of Bintulu (South China Sea), Sarawak, Malaysia.

    Science.gov (United States)

    Nettely, T; Rajaee, A H; Denil, N A; Idris, M H; Nesarul, M H; Amin, S M Nurul; Hena, M K Abu

    2016-07-01

    Samples of threadfin breams Nemipterus japonicus were collected from a village in Kuala Nyalau and a fish landing centre at Bintulu from April 2013 to March 2014. A total of 360 individuals of N. japonicus (214 male and 146 female) were used in this reproductive study.? The total length (TL) of individuals were measured to the nearest 0.1 cm and body weight (BW) was recorded to the nearest 0.1 g. Month-wise distribution of the sexes was significantly higher for males in September and March, while in the month of May the number of females was significantly higher (X(2) = 6.53; P Sarawak.

  7. Extracting Features of Acacia Plantation and Natural Forest in the Mountainous Region of Sarawak, Malaysia by ALOS/AVNIR2 Image

    Science.gov (United States)

    Fadaei, H.; Ishii, R.; Suzuki, R.; Kendawang, J.

    2013-12-01

    The remote sensing technique has provided useful information to detect spatio-temporal changes in the land cover of tropical forests. Land cover characteristics derived from satellite image can be applied to the estimation of ecosystem services and biodiversity over an extensive area, and such land cover information would provide valuable information to global and local people to understand the significance of the tropical ecosystem. This study was conducted in the Acacia plantations and natural forest situated in the mountainous region which has different ecological characteristic from that in flat and low land area in Sarawak, Malaysia. The main objective of this study is to compare extract the characteristic of them by analyzing the ALOS/AVNIR2 images and ground truthing obtained by the forest survey. We implemented a ground-based forest survey at Aacia plantations and natural forest in the mountainous region in Sarawak, Malaysia in June, 2013 and acquired the forest structure data (tree height, diameter at breast height (DBH), crown diameter, tree spacing) and spectral reflectance data at the three sample plots of Acacia plantation that has 10 x 10m area. As for the spectral reflectance data, we measured the spectral reflectance of the end members of forest such as leaves, stems, road surface, and forest floor by the spectro-radiometer. Such forest structure and spectral data were incorporated into the image analysis by support vector machine (SVM) and object-base/texture analysis. Consequently, land covers on the AVNIR2 image were classified into three forest types (natural forest, oil palm plantation and acacia mangium plantation), then the characteristic of each category was examined. We additionally used the tree age data of acacia plantation for the classification. A unique feature was found in vegetation spectral reflectance of Acacia plantations. The curve of the spectral reflectance shows two peaks around 0.3μm and 0.6 - 0.8μm that can be assumed to

  8. Malaysia.

    Science.gov (United States)

    1988-08-01

    In this discussion of Malaysia, attention is directed to the following: geography; the people; history; government; political conditions; the economy; defense; foreign relations; and relations between the US and Malaysia. In 1987 Malaysia's population was estimated to be 16.5 million with an annual growth rate of 2.6%. The infant mortality rate is 25/1000 with a life expectancy of 66 years. Peninsular Malaysia borders Thailand in the north and is separated from Singapore in the south by the narrow Johore Strait. About 50% of the area is covered by tropical jungle. The population distribution is uneven, with some 13.5 of the 16.5 million residents concentrated on the Peninsular Malaysia lowlands. The Malays, the largest population group, make up 49%. Nearly 1/3 of the Malaysians are Chinese, and Malaysians of Indian descent comprise slightly over 9% of the population. The early Buddhist Malay kingdom of Srivijaya, based at what currently is Palembang, Sumatra, dominated much of the Malay Peninsula from the 9th to the 13th centuries A.D. Full European control over the sultanates of the Malay Peninsula, Sabah, and Sarawak was not achieved until the latter half of the 19th century. During British control, a well-ordered system of public administration was created, public services were extended, and large-scale rubber and tin production was developed. Colonial rule was interrupted by the Japanese invasion and occupation from 1942-45. Malaysia achieved independence on August 31, 1957, and is a constitutional monarchy, nominally headed by the Yang di-Pertuan Agong, or paramount ruler. The ruler also is the leader of the Islamic faith in Malaysia. Executive power is vested in the Cabinet, led by the prime minister. The Malaysian legal system is based on English common law. The currently ruling Barisan Nasional, formed in 1973, includes 13 parties, among them the chief components of the former Alliance, a coalition of community-based parties. Malaysia's economic record is 1

  9. An Exploration Study of RimbaIlmu: A Qualitative Evaluation of Shared Single Display Groupware in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Cheah Waishiang

    2015-02-01

    Full Text Available Shared single display groupware that enables collaboration among people from different cultures and social practices encourages peer learning and teaching, whilst strengthening communication skills. It has been successfully evaluated in remote schools in China and India. Due to this, the question arises whether it can be deployed in rural schools or semi-urban schools in Sarawak? What are the issues and challenges? What are the impact of this technology among the students and teachers? This paper investigates the deployment of shared single display groupware in rural and semi-urban schools in Sarawak (one of the Malaysian states. We introduce a shared single display application, RimbaIlmu, in one semi-urban school and one rural school and conduct qualitative analysis from the observations among the participants. Observational data has shown that RimbaIlmu is able to stimulate collaboration between different genders; an engaging technology among students; a tool for group and individual assessment; a tool to facilitate leadership skills; fun to play with; allows ease of lab management and control; enabling novices to learn computers; promoting membership in collaboration learning and finally provide environment for task accomplishment with minimum teacher intervention.

  10. Gender and Racial Differences in the Cardiovascular Risk Factors among Overweight and Obese Rural Adults, Kuching and Samarahan Division, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Whye Lian Cheah

    2016-01-01

    Full Text Available Objective. This study aimed to determine whether gender and ethnic differences had an effect on cardiovascular risk factors in overweight and obese rural adults in Sarawak. Design and Setting. This was a cross-sectional study conducted in rural communities in Kuching and Samarahan division, Malaysia. Data was obtained using a set of questionnaire (sociodemographic data and physical activity, measurement of blood pressure, height, weight (body mass index, BMI, body fat percentage, fasting blood sugar, and lipid profile from three ethnic groups—Iban, Malay, and Bidayuh. Analysis of data was done using SPSS version 23.0. Results. A total of 155 respondents participated in the study (81.6% response rate. The levels of physical activity, BMI status, body fat, hypercholesterolemia, and hyperglycemia were similar across the three ethnic groups and both females and males. Iban and Bidayuh had significant higher Atherogenic Index of Plasma (AIP when compared to the Malay (Bidayuh OR = 0.30, 95% CI 0.12, 0.78; Iban OR = 0.29, 95% CI 0.12, 0.69. Conclusions. The relationship between cardiovascular risk factors varied according to ethnic groups and gender. A better understanding of these differences would help in the design and implementation of intervention programme for the prevention of cardiovascular disease.

  11. Gender and Racial Differences in the Cardiovascular Risk Factors among Overweight and Obese Rural Adults, Kuching and Samarahan Division, Sarawak, Malaysia.

    Science.gov (United States)

    Cheah, Whye Lian; Chang, Ching Thon; Hazmi, Helmy; Wan Muda, Wan Manan

    2016-01-01

    Objective . This study aimed to determine whether gender and ethnic differences had an effect on cardiovascular risk factors in overweight and obese rural adults in Sarawak. Design and Setting . This was a cross-sectional study conducted in rural communities in Kuching and Samarahan division, Malaysia. Data was obtained using a set of questionnaire (sociodemographic data and physical activity), measurement of blood pressure, height, weight (body mass index, BMI), body fat percentage, fasting blood sugar, and lipid profile from three ethnic groups-Iban, Malay, and Bidayuh. Analysis of data was done using SPSS version 23.0. Results . A total of 155 respondents participated in the study (81.6% response rate). The levels of physical activity, BMI status, body fat, hypercholesterolemia, and hyperglycemia were similar across the three ethnic groups and both females and males. Iban and Bidayuh had significant higher Atherogenic Index of Plasma (AIP) when compared to the Malay (Bidayuh OR = 0.30, 95% CI 0.12, 0.78; Iban OR = 0.29, 95% CI 0.12, 0.69). Conclusions. The relationship between cardiovascular risk factors varied according to ethnic groups and gender. A better understanding of these differences would help in the design and implementation of intervention programme for the prevention of cardiovascular disease.

  12. Documenting pain as the fifth vital sign: a feasibility study in an oncology ward in Sarawak, Malaysia.

    Science.gov (United States)

    Devi, B C R; Tang, T S

    2008-01-01

    Monitoring acute postoperative pain as the fifth vital sign is currently practiced in many developed countries. In Sarawak, pain is an important symptom as 70% of cancer patients present with advanced disease. As the existing validated pain assessment tools were found to be difficult to use, we studied the feasibility of modifying the use of a pain assessment tool, consisting of the short form of the Brief Pain Inventory and the Wong-Baker Faces Scale. This tool was used to document pain in all 169 patients who were admitted for pain control to the oncology ward between July 2000 and June 2001. Nurses were trained in the use of the modified scale before the start of the study. The method was easy to use, and the mean number of days to reduce pain was found to be 3.1 days (SD: 2.9; median: 2 days; range: 1-31 days). At discharge, none in the group with initially mild pain had pain, and the severity of pain for 98% of patients with moderate pain and 61% with severe pain was downgraded to mild pain. The staff found that the tool allowed continuous pain assessment in an objective manner. Copyright 2008 S. Karger AG, Basel.

  13. Incidence and risk factors for breast cancer subtypes in three distinct South-East Asian ethnic groups: Chinese, Malay and natives of Sarawak, Malaysia.

    Science.gov (United States)

    Devi, C R Beena; Tang, Tieng Swee; Corbex, Marilys

    2012-12-15

    We determined the incidences of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) subtypes among breast cancer cases in Sarawak, Malaysia and their correlation with various risk factors in the three ethnic groups: Chinese, Malay and native. Subtype status was ascertained for 1,034 cases of female breast cancer (93% of all cases diagnosed since 2003), and the age-standardized incidence rates (ASRs) of each subtype were inferred. Case-case comparisons across subtypes were performed for reproductive risk factors. We found 48% luminal A (ER+/PR+/HER2-), 29% triple-negative (ER-/PR-/HER2-), 12% triple-positive (ER+/PR+/HER2+) and 11% HER2-overexpressing (ER-/PR-/HER2+) subtypes, with ASRs of 10.6, 6.0, 2.8 and 2.8 per 100,000, respectively. The proportions of subtypes and ASRs differed significantly by ethnic groups: HER2-positive cases were more frequent in Malays (29%; 95% CI [23;35]) than Chinese (22%; [19;26] and natives (21%; [16;26]); triple-negative cases were less frequent among Chinese (23%; [20;27]) than Malays (33%; [27;39]) and natives (37%; [31;43]). The results of the case-case comparison were in accordance with those observed in western case series. Some uncommon associations, such as between triple-negative subtype and older age at menopause (OR, 1.59; p < 0.05), were found. The triple-negative and HER2+ subtypes predominate in our region, with significant differences among ethnic groups. Our results support the idea that the risk factors for different subtypes vary markedly. Westernized populations are more likely to have factors that increase the risk for the luminal A type, while risk factors for the triple-negative type are more frequent in local populations. Copyright © 2012 UICC.

  14. Baseline trace metals in water and sediment of the Baleh River-a tropical river in Sarawak, Malaysia.

    Science.gov (United States)

    Sim, Siong Fong; Chai, Hui Ping; Nyanti, Lee; Ling, Teck Yee; Grinang, Jongkar

    2016-09-01

    Quantitative indices are classically employed to evaluate the contamination status of metals with reference to the baseline concentrations. The baselines vary considerably across different geographical zones. It is imperative to determine the local geochemical baseline to evaluate the contamination status. No study has been done to establish the background concentrations in tropical rivers of this region. This paper reports the background concentrations of metals in water and sediment of the Baleh River, Sarawak, derived based on the statistical methods where the areas possibly disturbed are distinguished from the undisturbed area. The baseline levels of six elements in water determined were Al (0.34 mg/L), Fe (0.51 mg/L), Mn (0.12 mg/L), Cu (0.01 mg/L), Pb (0.03 mg/L), and Zn (0.05 mg/L). Arsenic and selenium were below the detection limit. For sediment, the background values were established according to statistical methods including (mean + 2σ), iterative 2σ, cumulative distribution frequency, interquartile, and calculation distribution function. The background values derived using the iterative 2σ algorithm and calculated distribution function were relatively lower. The baseline levels calculated were within the range reported in the literatures mainly from tropical and sub-tropical regions. The upper limits proposed for nine elements in sediment were Al (100,879 mg/kg), Cr (75.45 mg/kg), Cu (34.59 mg/kg), Fe (37,823 mg/kg), Mn (793 mg/kg), Ni (22.88 mg/kg), Pb (27.26 mg/kg), Zn (70.64 mg/kg), and Hg (0.33 mg/kg). Quantitative indices calculated suggest low risk of contamination at the Baleh River.

  15. Disordered eating and body image issues and their associated factors among adolescents in urban secondary schools in Sarawak, Malaysia.

    Science.gov (United States)

    Cheah, Whye Lian; Hazmi, Helmy; Chang, Ching Thon

    2017-04-01

    Eating disorders are common health issues among the adolescents. The objective of this study was to determine the prevalence of eating disorders and their relationship with body mass index, body part satisfaction and perception on body weight among urban secondary school children. It was a cross-sectional study conducted in Kuching, Sarawak. Data was collected using a self-administered questionnaire that consist of the Eating Attitude Test-26 (EAT-26), perception on body part satisfaction and body weight, and anthropometric measurement. Data was entered and analysed using SPSS version 22. A total of 329 respondents participated in this study with 59% females and 60.5% Malays. There were 14.3% of the respondents overweight and obese, with higher percentage among males (19.3%). About 18.5% of the respondents were found to be at risk of eating disorders with higher prevalence among males (19.3%). More females reported to have higher prevalence of body part dissatisfaction (46.9%) and body weight (37.6%) compared to males (40%, 28.1%). The statistical results indicated there were significant associations between EAT-26 and body mass index (BMI) (p=0.039), body part satisfaction (p=0.004), and perception of body weight (p=0.038). Eating disorders are becoming more prevalent amongst adolescents, particularly among males. As eating disorder are strongly associated with adolescent mental and physical health, intervention programme on their developmental challenges and issues for both males and females should be in place particularly in the school education syllabus.

  16. Effect of K-N-humates on dry matter production and nutrient use efficiency of maize in Sarawak, Malaysia.

    Science.gov (United States)

    Petrus, Auldry Chaddy; Ahmed, Osumanu Haruna; Muhamad, Ab Majid Nik; Nasir, Hassan Mohammad; Jiwan, Make

    2010-07-06

    Agricultural waste, such as sago waste (SW), is one of the sources of pollution to streams and rivers in Sarawak, particularly those situated near sago processing plants. In addition, unbalanced and excessive use of chemical fertilizers can cause soil and water pollution. Humic substances can be used as organic fertilizers, which reduce pollution. The objectives of this study were to produce K- and ammonium-based organic fertilizer from composted SW and to determine the efficiency of the organic-based fertilizer produced. Humic substances were isolated using standard procedures. Liquid fertilizers were formulated except for T2 (NPK fertilizer), which was in solid form. There were six treatments with three replications. Organic fertilizers were applied to soil in pots on the 10th day after sowing (DAS), but on the 28th DAS, only plants of T2 were fertilized. The plant samples were harvested on the 57th DAS during the tassel stage. The dry matter of plant parts (leaves, stems, and roots) were determined and analyzed for N, P, and K using standard procedures. Soil of every treatment was also analyzed for exchangeable K, Ca, Mg, and Na, organic matter, organic carbon, available P, pH, total N, P, nitrate and ammonium contents using standard procedures. Treatments with humin (T5 and T6) showed remarkable results on dry matter production; N, P, and K contents; their uptake; as well as their use efficiency by maize. The inclusion of humin might have loosened the soil and increased the soil porosity, hence the better growth of the plants. Humin plus inorganic fertilizer provided additional nutrients for the plants. The addition of inorganic fertilizer into compost is a combination of quick and slow release sources, which supplies N throughout the crop growth period. Common fertilization by surface application of T2 without any additives (acidic and high CEC materials) causes N and K to be easily lost. High Ca in the soil may have reacted with phosphate from fertilizer to

  17. Effect of K-N-Humates on Dry Matter Production and Nutrient Use Efficiency of Maize in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Auldry Chaddy Petrus

    2010-01-01

    Full Text Available Agricultural waste, such as sago waste (SW, is one of the sources of pollution to streams and rivers in Sarawak, particularly those situated near sago processing plants. In addition, unbalanced and excessive use of chemical fertilizers can cause soil and water pollution. Humic substances can be used as organic fertilizers, which reduce pollution. The objectives of this study were to produce K- and ammonium-based organic fertilizer from composted SW and to determine the efficiency of the organic-based fertilizer produced. Humic substances were isolated using standard procedures. Liquid fertilizers were formulated except for T2 (NPK fertilizer, which was in solid form. There were six treatments with three replications. Organic fertilizers were applied to soil in pots on the 10th day after sowing (DAS, but on the 28th DAS, only plants of T2 were fertilized. The plant samples were harvested on the 57th DAS during the tassel stage. The dry matter of plant parts (leaves, stems, and roots were determined and analyzed for N, P, and K using standard procedures. Soil of every treatment was also analyzed for exchangeable K, Ca, Mg, and Na, organic matter, organic carbon, available P, pH, total N, P, nitrate and ammonium contents using standard procedures. Treatments with humin (T5 and T6 showed remarkable results on dry matter production; N, P, and K contents; their uptake; as well as their use efficiency by maize. The inclusion of humin might have loosened the soil and increased the soil porosity, hence the better growth of the plants. Humin plus inorganic fertilizer provided additional nutrients for the plants. The addition of inorganic fertilizer into compost is a combination of quick and slow release sources, which supplies N throughout the crop growth period. Common fertilization by surface application of T2 without any additives (acidic and high CEC materials causes N and K to be easily lost. High Ca in the soil may have reacted with phosphate from

  18. Variable impact of Malaysia's national language planning on non-Malay speakers in Sarawak Impacto variável do planejamento linguístico nacional da Malásia sobre não falantes do Malaio em Sarawak

    Directory of Open Access Journals (Sweden)

    Su-Hie Ting

    2012-06-01

    Full Text Available The study examined the impact of the national language policy on the language use of three main ethnic groups in the Malaysian state of Sarawak. The data analyzed was based on a sociolinguistic survey on language use in six domains that involved 937 Malay, Chinese and Iban adolescents from three major towns in Sarawak. The results showed that the use of Bahasa Malaysia exceeded English usage for all three ethnic groups, showing the success of compulsory education in the national language. However, the language planning has greater impact on the Iban than on the Chinese who are shifting away from the ethnic languages of the Chinese sub-groups to Mandarin Chinese. The availability of an alternative standard language with international standing which also functions as a symbol of cultural solidarity compromises the impact of the national language policy.Este estudo examinou o impacto da política de ensino da língua nacional de três principais grupos étnicos no estado malaio de Sarawak. Os dados analisados basearam-se em uma pesquisa sociolinguística sobre o uso da língua em seis domínios e envolveu 937 adolescentes malaios, chineses e Iban de três grandes cidades de Sarawak. Os resultados mostraram que o uso da língua Bahasa da Malásia superou o uso do inglês para todos os três grupos étnicos, comprovando o sucesso da escolaridade obrigatória em língua nacional. No entanto, o planejamento do estudo da língua tem maior impacto sobre o Iban do que sobre os chineses. Estes estão se afastando das línguas étnicas dos subgrupos chineses para o chinês Mandarim. A disponibilidade de uma língua alternativa padrão, com prestígio internacional, que também funciona como um símbolo de solidariedade cultural, compromete o impacto da política de ensino da língua nacional.

  19. Four Simple Questions: Evaluating the Effectiveness of Half-Day Community Workshops Designed to Increase Awareness of Coastal Cetacean Conservation Issues in Sarawak, Malaysia

    Science.gov (United States)

    Minton, Gianna; Poh, Anna Norliza Zulkifli; Ngeian, Jenny; Peter, Cindy; Tuen, Andrew Alek

    2012-01-01

    Community workshops were held in coastal locations in Sarawak to raise awareness of cetacean conservation. Interviews were conducted up to 2 years later in four "workshop communities" as well as four villages where workshops were not conducted. Comparison of responses between respondents who had attended workshops (n = 127) versus those…

  20. The consumption of alcohol among men in rural Sarawak

    OpenAIRE

    Amit, Noh

    2017-01-01

    This research examined sociocultural factors associated with alcohol use among men in rural Sarawak, Malaysia. A mixed methods design was used to explore the phenomenon of alcohol use among young men in rural villages in Kuching and Samarahan Districts, Sarawak. A questionnaire (161 participants), semi structured individual interviews (50 participants), and eight focus group discussions (46 participants) were conducted with men from Iban, Bidayuh, and Malay ethnicities, aged 18-30 years. ...

  1. Duration of detection of anti-BmR1 IgG4 antibodies after mass-drug administration (MDA) in Sarawak, Malaysia.

    Science.gov (United States)

    Noordin, R; Muhi, J; Md Idris, Z; Arifin, N; Kiyu, A

    2012-03-01

    The detection rates of brugian filariasis in three regions of Sarawak namely Central, North and South after three courses of mass drug administration (MDA) from year 2004 to 2006 was investigated. A recombinant BmR1 antigen-based IgG4 detection test, named Brugia Rapid and night blood smear for microfilaria (mf) detection were used. All three regions recorded a sharp fall in mf positive rates after a year post-MDA. Meanwhile Brugia Rapid positive rates declined more gradually to 3.8% and 5.6% of the pre-MDA levels in the Central and North regions, respectively. This study showed that in filariasis endemic areas in Sarawak, anti-filarial IgG4 antibodies to BmR1, as detected by the Brugia Rapid test, were positive for one to two years after mf disappearance.

  2. Systematic studies of Bornean Zingiberaceae V. Zingiberoideae of Lambir Hills, Sarawak

    NARCIS (Netherlands)

    Sakai, S.; Nagamasu, H.

    2006-01-01

    This paper reports the subfamily Zingiberoideae (Zingiberaceae) of Lambir Hills National Park, Sarawak, Malaysia. Twelve species representing Boesenbergia, Globba, and Zingiber are recorded. Systematic and ecological notes are provided, and the key to the Bornean species of Boesenbergia is updated.

  3. Environmental Education in a Region of Rapid Economic Development: The Case of Sarawak.

    Science.gov (United States)

    Gough, Stephen.

    1995-01-01

    Discusses an innovative approach to environmental education that takes into account the interactions between cultural diversity and environmental controversy. Examines the situation in Sarawak, a State of East Malaysia, in the light of existing theoretical work. Contains 21 references. (JRH)

  4. Benefits and Issues of Open-Cut Coal Mining on the Socio-Economic Environment - The Iban Community in Mukah, Sarawak, Malaysia

    OpenAIRE

    Edward Lim

    2007-01-01

    This paper deals principally with the socio-economic impact on the local Iban community in Mukah Division, Sarawak; with the commencement of the open-cut coal mining industry since 2003. To-date there are no actual studies being carried out by either the public or private sector to truly analyze how the Iban community is coping with the advent of a large influx of cash into their society. The Iban community has traditionally been practicing shifting cultivation and farming of domesticated ani...

  5. Reducing by half the percentage of late-stage presentation for breast and cervix cancer over 4 years: a pilot study of clinical downstaging in Sarawak, Malaysia.

    Science.gov (United States)

    Devi, B C R; Tang, T S; Corbex, M

    2007-07-01

    The registry of the Oncology Departmental in Sarawak General Hospital showed that 79% of nasopharyngeal, 77% of breast and 70% of cervix cancer patients were diagnosed at an advanced stage (stages III and IV) for year 1993. Hence, a low cost Early Cancer Surveillance Program was started in 1994, with the intent of downstaging these three most common cancers in Sarawak. The program consisted of (i) training health staff in hospital and rural clinics to improve their skills in early cancer detection, (ii) raising public awareness through pamphlets, posters and sensitization by health staff. Data analysis revealed that the program achieved downstaging in two of the cancers. Breast cancer in stage III and IV was reduced from 60% (1994) to 35% (1998) (P < 0.0001) and cervical cancer in stage III and IV from 60% (1994) to 26% (1998) (P < 0.0001). No reduction was observed for nasopharyngeal cancer at 88% (1994) to 91% (1998). The overall cost of this program was

  6. The Sarawak lupus cohort: clinical features and disease patterns of 633 SLE patients in a single tertiary centre from East Malaysia.

    Science.gov (United States)

    Teh, C L; Ling, G R; Aishah, Wan Sharifah

    2015-01-01

    Systemic lupus erythematosus (SLE) has been well studied in West Malaysian populations but lacking in East Malaysian populations. The aim of this study was to examine the clinical features and disease patterns of patients with SLE in a multiethnic East Malaysian population in Sarawak. All SLE patients who were treated in Sarawak General Hospital were reviewed in a retrospective longitudinal study using a standard protocol from 1 January 2006 to 31 December 2013. There were a total of 633 patients in our study with the female to male ratio of 12:1. Our study patients were of multiethnic origins with predominant Chinese ethnic group. They had a mean age of 36.9 ± 13.2 years and a mean duration of illness of 7.2 ± 6.0 years. The main involvements were haematological (74.2 %), malar rash (64.0 %) and renal (58.6 %). Chinese patients were less likely to have discoid lupus, pleuritis and pericarditis, while Malay patients were more likely to have arthritis. Bidayuh patients were more likely to have oral ulcer. Secondary antiphospholipid syndrome was more common in Chinese. The majority of patients were in clinical remission with low SDI. There were 58 deaths (9.2 %) during 2006-2013 with the main causes of death being flare of disease and infection.

  7. Natural Radioactivity of Soil in Sabah and Sarawak

    International Nuclear Information System (INIS)

    Ismail Sulaiman; Muhamat Omar; Mohd Suhaimi Elias

    2015-01-01

    Soil samples were collected from 40 locations throughout Sabah and Sarawak and were analysed for natural radionuclides concentration. The mean soil concentrations of "2"3"8U, "2"3"2Th, "2"2"6Ra and "4"0K in Sabah were 22, 18, 24 and 216 Bq kg"-"1 respectively while corresponding values in Sarawak were 25, 25, 38 and 305 Bq kg"-"1 respectively. This study showed that the concentration of natural radionuclides (except "4"0K) in soil in Sabah and Sarawak were about one third of the respective values in Peninsular Malaysia. The results of the study can be used as baseline data of natural radioactivity for East Malaysia. (Author)

  8. Unravelling the stratigraphy and sedimentation history of the uppermost Cretaceous to Eocene sediments of the Kuching Zone in West Sarawak (Malaysia), Borneo

    Science.gov (United States)

    Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; BouDagher-Fadel, Marcelle K.

    2018-07-01

    The Kuching Zone in West Sarawak consists of two different sedimentary basins, the Kayan and Ketungau Basins. The sedimentary successions in the basins are part of the Kuching Supergroup that extends into Kalimantan. The uppermost Cretaceous (Maastrichtian) to Lower Eocene Kayan Group forms the sedimentary deposits directly above a major unconformity, the Pedawan Unconformity, which marks the cessation of subduction-related magmatism beneath SW Borneo and the Schwaner Mountains, due to termination of the Paleo-Pacific subduction. The successions consist of the Kayan and Penrissen Sandstones and are dominated by fluvial channels, alluvial fans and floodplain deposits with some deltaic to tidally-influenced sections in the Kayan Sandstone. In the late Early or early Middle Eocene, sedimentation in this basin ceased and a new basin, the Ketungau Basin, developed to the east. This change is marked by the Kayan Unconformity. Sedimentation resumed in the Middle Eocene (Lutetian) with the marginal marine, tidal to deltaic Ngili Sandstone and Silantek Formation. Upsequence, the Silantek Formation is dominated by floodplain and subsidiary fluvial deposits. The Bako-Mintu Sandstone, a potential lateral equivalent of the Silantek Formation, is formed of major fluvial channels. The top of the Ketungau Group in West Sarawak is formed by the fluvially-dominated Tutoop Sandstone. This shows a transition of the Ketungau Group in time towards terrestrial/fluvially-dominated deposits. Paleocurrent measurements show river systems were complex, but reveal a dominant southern source. This suggests uplift of southern Borneo initiated in the region of the present-day Schwaner Mountains from the latest Cretaceous onwards. Additional sources were local sources in the West Borneo province, Mesozoic melanges to the east and potentially the Malay Peninsula. The Ketungau Group also includes reworked deposits of the Kayan Group. The sediments of the Kuching Supergroup are predominantly

  9. Analysis of three polymorphisms in Bidayuh ethnic of Sarawak ...

    African Journals Online (AJOL)

    Insertion/deletion polymorphism of YAP (DYS287), M96 and M120 polymorphisms in Bidayuh ethnic populations of Sarawak, Malaysia were analyzed in this study. Genomic DNA was extracted from 180 buccal samples and amplified by Hot-Start PCR method. The amplified PCR products were separated by using 2% ...

  10. Sense of Efficacy among Beginning Teachers in Sarawak

    Science.gov (United States)

    Murshidi, Rahmah; Konting, Mohd Majid; Elias, Habibah; Fooi, Foo Say

    2006-01-01

    This study examined the level of teachers' sense of efficacy among beginning teachers in Sarawak, Malaysia. It also sought to investigate whether there is any difference in beginning teachers' sense of efficacy in relation to gender, race and types of teacher preparation program. The study was conducted by using the teacher sense of efficacy…

  11. Tsunami run-up and inundation along the coast of Sabah and Sarawak, Malaysia due to a potential Brunei submarine mass failure.

    Science.gov (United States)

    Tan, Wai Kiat; Teh, Su Yean; Koh, Hock Lye

    2017-07-01

    Submarine landslides, also known as submarine mass failures (SMFs), are major natural marine disasters that could critically damage coastal facilities such as nuclear power plants and oil and gas platforms. It is therefore essential to investigate submarine landslides for potential tsunami hazard assessment. Three-dimensional seismic data from offshore Brunei have revealed a giant seabed mass deposited by a previous SMF. The submarine mass extends over 120 km from the continental slope of the Baram Canyon at 200 m water depth to the deep basin floor of the Northwest Borneo Trough. A suite of in-house two-dimensional depth-averaged tsunami simulation model TUNA (Tsunami-tracking Utilities and Application) is developed to assess the vulnerability of coastal communities in Sabah and Sarawak subject to potential SMF tsunami. The submarine slide is modeled as a rigid body moving along a planar slope with the center of mass motion parallel to the planar slope and subject to external forces due to added mass, gravity, and dissipation. The nonlinear shallow water equations are utilized to simulate tsunami propagation from deepwater up to the shallow offshore areas. A wetting-drying algorithm is used when a tsunami wave reaches the shoreline to compute run up of tsunami along the shoreline. Run-up wave height and inundation maps are provided for seven densely populated locations in Sabah and Sarawak to highlight potential risks at each location, subject to two scenarios of slide slopes: 2° and 4°. The first wave may arrive at Kudat as early as 0.4 h after the SMF, giving local communities little time to evacuate. Over a small area, maximum inundated depths reaching 20.3 m at Kudat, 26.1 m at Kota Kinabalu, and 15.5 m at Miri are projected, while the maximum inundation distance of 4.86 km is expected at Miri due to its low-lying coast. In view of the vulnerability of some locations to the SMF tsunami, it is important to develop and implement community resilience

  12. Price convergence and market integration: evidence from Malaysia

    OpenAIRE

    Lee, Chin; Habibullah, Muzafar Shah

    2008-01-01

    The purpose of this study is to assess the markets integration within Malaysia by examine the price convergence across Peninsular Malaysia, Sabah and Sarawak. Disaggregate monthly price data for various types of goods or services in Peninsular Malaysia, Sabah and Sarawak were utilized. Levin and Lin (1993) panel unit root test was employed to test whether the price of various types of goods among 3 provinces/states in Malaysia are stationary. The result of panel unit roots test showed that in...

  13. Disclosure of Traditional and Complementary Medicine Use and Its Associated Factors to Medical Doctor in Primary Care Clinics in Kuching Division, Sarawak, Malaysia.

    Science.gov (United States)

    Johny, Anak Kelak; Cheah, Whye Lian; Razitasham, Safii

    2017-01-01

    The decision by the patients to disclose traditional and complementary medicine (TCM) use to their doctor is an important area to be explored. This study aimed to determine the disclosure of TCM use and its associated factors to medical doctor among primary care clinic attendees in Kuching Division, Sarawak. It was a cross-sectional study using questionnaire, interviewer administered questionnaire. A total of 1130 patients were screened with 80.2% reporting using TCM. Logistic regression analysis revealed that being female (AOR = 3.219, 95% CI: 1.385, 7.481), perceived benefits that TCM can prevent complication of illness (AOR = 3.999, 95% CI: 1.850, 8.644) and that TCM is more gentle and safer (AOR = 4.537, 95% CI: 2.332, 8.828), perceived barriers of not having enough knowledge about TCM (AOR = 0.530, 95% CI: 0.309, 0.910), patient dissatisfaction towards healthcare providers being too business-like and impersonal (AOR = 0.365, 95% CI: 0.199, 0.669) and paying more for healthcare than one can afford (AOR = 0.413, 95% CI: 0.250, 0.680), and accessibility of doctors (AOR = 3.971, 95% CI: 2.245, 7.023) are the predictors of disclosure of TCM use. An open communication between patients and doctor is important to ensure safe implementation and integration of both TCM and medical treatment.

  14. Childhood obesity, self-esteem and health-related quality of life among urban primary schools children in Kuching, Sarawak, Malaysia.

    Science.gov (United States)

    Lee, P Y; Cheah, W l; Chang, C T; Siti Raudzah, G

    2012-08-01

    There is limited data on childhood obesity and its impact on children from diverse cultural backgrounds. This study is aimed at determining the association between obesity, self-esteem and health-related quality of life (HRQOL) among Malaysian urban primary school children of different ethnicity. A cross-sectional study was conducted involving 311 children aged 11-13 years from primary schools in Kuching, Sarawak. Self-esteem and health-related quality of life (HRQOL) were measured using the Lawrence Self-esteem Questionnaire (LAWSEQ) questionnaire and the Paediatric Quality of Life Inventory (PedsQL), respectively. Body weight and height were taken and body mass index for age calculated. The prevalence of overweight and obesity among the children were 18.2% and 15.2% respectively. Parent-proxy and child self-reported PedsQL scores were higher for normal weight children compared to thin and obese children, but lower than overweight children. At the subscale level, only parent-proxy PedsQL scores in psychosocial health and emotional component were significantly different between overweight and obese children (p=0.019, p=0.02). The Self-esteem score was significantly correlated with parent and child PedsQL scores. Although obesity was associated with lower HRQOL among children, both parent and child PedsQL scores among the overweight group were higher than that for the normal weight group. Overweight and obesity did affect quality of life and self-esteem of children in this study, particularly in the areas of psychosocial and emotional health. Policy makers and programme managers should take into consideration the impact of obesity on children and parents in designing intervention programmes.

  15. Malaysia; Malaisie

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-10-01

    This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

  16. Fracture Analysis of basement rock: A case example of the Eastern Part of the Peninsular Malaysia

    International Nuclear Information System (INIS)

    Shamsuddin, A; Ghosh, D

    2015-01-01

    In general, reservoir rocks can be defined into carbonates, tight elastics and basement rocks. Basement rocks came to be highlighted as their characteristics are quite complicated and remained as a significant challenge in exploration and production area. Motivation of this research is to solve the problem in some area in the Malay Basin which consist fractured basement reservoirs. Thus, in order to increase understanding about their characteristic, a study was conducted in the Eastern part of the Peninsular Malaysia. The study includes the main rock types that resemble the offshore rocks and analysis on the factors that give some effect on fracture characteristic that influence fracture systems and fracture networks. This study will allow better fracture prediction which will be beneficial for future hydrocarbon prediction in this region

  17. Malaysia.

    Science.gov (United States)

    Van Niel, Eloise Smith; Schelander, Bjorn

    This book provides an overview of Malaysia's history and culture. The book begins with a prehistoric times and continues through nationhood. Each chapter provides background information along with student activities and project suggestions. Chapters include: (1) "Introduction"; (2) "Early Trade and Civilization"; (3) "The…

  18. Malaysia power

    Energy Technology Data Exchange (ETDEWEB)

    Husin, Z.A. (Tenaga Nasional Berhad (Malaysia))

    1994-09-01

    Describes the organisation of the Malaysian electric power industry and the role of natural gas and coal in power generation in the country. At present, electricity is produced by three utilities: Tenaga Nasional Berhad (TNB) which was fully privatised in May 1992 with the Government holding about 73% of the equity, Sarawak Electricity Supply Corporation (SESCO) which the Government plans to privatise soon, and Sabah Electricity Board (SEB). These have installed capacities of 7000 MW, 400 MW and 350 MW, respectively. Five independent power producers have been given licences to build, own and operate power plants with a total installed capacity of 4000 MW. Natural gas is expected to account for about 72% of Malaysia's power generating fuel by the year 2010, compared to about 50% at present. Malaysia currently has only one coal-fired plant, but its expansion is in the final stage of contract awards. A number of small capacity coal-fired plants are being planned for Sabah and Sarawak where the bulk of Malaysia's coal resources are located. 3 figs., 1 photo.

  19. Malaysia

    International Nuclear Information System (INIS)

    2007-01-01

    Full text: Malaysia's transition from a production-based economy to a knowledge-based economy is a vital step towards achieving a developed nation status by the year 2020. A large pool of skilled labor force including those with tertiary level education is critical for Malaysia's transition to a knowledge-based economy. Malaysia's policies related to education and training emphasize the need to address the shortage and to enhance the quality of human resources, in particular human resources in science and technology. In this regard, a target has been set for a ratio of 60:40 science to arts students at the secondary school and tertiary level education institutions. The total number of post-graduate enrollment in universities will be increased to 25 per cent of total enrollment by the year 2010. Human resource with tertiary level education, especially at the post-graduate level is essential for upgrading capability in research and development (R and D). The target is to enlarge the pool of researchers from 15.6 researchers per 10,000 labor force in the year 2000 to 60 researchers per 10,000 labor force by the year 2010. The Malaysian Institute for Nuclear Technology Research (MINT), previously known as the Tun Ismail Atomic Research Centre (PUSPATI) was established in 1972 to promote nuclear science and technology development and application. Since nuclear energy is not included as one of Malaysia's energy options, MINT's programs focus on the development and application of nuclear science and technology in medicine, agriculture, industry and environment. MINT operates a 1 MW TRIGA MKII research reactor and several radiation facilities. As the largest employer of nuclear science and technology graduates, MINT has a major role in ensuring the sustainable supply of nuclear workforce and the preservation of nuclear knowledge. In this connection, MINT collaborates with institutions of higher education in the development of human resource in nuclear science and

  20. Refining clinical phenotypes by contrasting ethnically different populations with schizophrenia from Australia, India and Sarawak.

    Science.gov (United States)

    McLean, Duncan; John, Sujit; Barrett, Robert; McGrath, John; Loa, Peter; Thara, Rangaswamy; Mowry, Bryan

    2012-04-30

    We contrasted demographic and clinical characteristics in transethnic schizophrenia populations from Australia (n=821), India (n=520) and Sarawak, Malaysia (n=298) and proposed cultural explanations for identified site differences. From these we aimed to identify candidate variables free from significant cultural confounding that are hence suitable for inclusion in genetic analyses. We observed five phenomena: (1) more individuals were living alone in Australia than India or Sarawak; (2) drug use was lower in India than Australia or Sarawak; (3) duration of untreated psychosis (DUP) was longer in India than Australia or Sarawak; (4) the rate of schizoaffective disorder was lower in India than Australia or Sarawak; and (5) age at psychosis onset (AAO) was older in Sarawak than Australia or India. We suggest that site differences for living arrangements, drug use and DUP are culturally confounded. The schizoaffective site difference likely results from measurement bias. The AAO site difference, however, has no obvious cultural or measurement bias explanation. Therefore, this may be an ideal candidate for use in genetic studies, given that genetic variants affecting AAO have already been proposed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  1. Remote community electrification in Sarawak, Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Anyi, Martin; Kirke, Brian [Sustainable Energy Centre, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, South Australia 5095 (Australia); Ali, Sam [School of Electrical and Information Engineering, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, South Australia 5095 (Australia)

    2010-07-15

    It is usually uneconomic to provide mains power to small remote communities even when high voltage lines pass by a village. Local authorities normally resort to diesel-powered generators which require expensive fuel which is difficult to bring into remote areas. Furthermore they are noisy and require frequent maintenance which is often neglected in remote areas due to limited resources and know-how. Neither wind nor sun provides reliable power in humid tropical regions where there is a lot of still and overcast weather. Towers are found to attract lightning strikes which can destroy electronic controls, fungus grows on solar panels, and the multiple electrical connections on photovoltaic arrays corrode away in hot, humid climates. Micro hydro is an attractive option in mountainous areas, and a 30 kW high head and a 3 kW low head plant have been built, using village labour and surplus and discarded materials. Both are operating satisfactorily. However conventional micro hydro is not possible in flat country where there is little elevation, and work is now in progress to evaluate suitable hydrokinetic turbines on rivers in the humid tropics. Numerous companies around the world are now developing hydrokinetic turbines to harvest tidal and river flows, but a major problem with most designs is clogging by floating debris, especially in tropical rivers. (author)

  2. Over two decades of Plasmodium knowlesi infections in Sarawak: Trend and forecast.

    Science.gov (United States)

    Ooi, Choo Huck; Bujang, Mohamad Adam; Tg Abu Bakar Sidik, Tg Mohd Ikhwan; Ngui, Romano; Lim, Yvonne Ai-Lian

    2017-12-01

    Malaria is still of great public health concern, especially in Malaysian Borneo. The aim of this study was to determine the trends of P. knowlesi infection in Sarawak, Malaysia and to forecast the incidence of P. knowlesi until the year 2040. Data on P. knowlesi malaria cases from 1992 to the year 2014 were obtained from the Sarawak Health Department, Malaysia. ARIMA model was applied to forecast the future incidence of P. knowlesi infection. The data for the whole of Sarawak and subsequently the selected six districts which have high incidence rates of P. knowlesi infection were analyzed. Results of the analysis showed that there was an increasing trend of P. knowlesi cases from the year 1992-2014 (p<0.001). The trend in the incidence started to increase in the year 2008 (p=0.029). The incidence rate per 100,000 populations was between 4.15 in the year 1992 and 42.03 in the year 2014. High incidence of P. knowlesi infections has been detected in the districts adjacent to each other within the interior region of Sarawak. The forecasted incidence and incidence rate per 100,000 populations in the year 2020 were 1229 and 44.04, respectively, while those in the year 2040 were 2056 and 62.91, respectively. The forecasted incidence showed an upward trend highlighting an urgent need to draw up strategic and holistic prevention plans to limit further the increase in P. knowlesi morbidity and mortality in Sarawak. It is imperative that these measures are customized taking into consideration the challenges faced in the interior areas of Sarawak and the behavior of the main vector of P. knowlesi (i.e., An. latens) in Sarawak. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Child Care Services in Malaysia

    Science.gov (United States)

    Pheng, Liew Sau

    2007-01-01

    Malaysia is a multi-ethnic, multi-racial, and multi-religious country with a population of more than 25 million people who live in the Peninsular and the States of Sabah and Sarawak on Borneo Island. It is a harmonious and peaceful nation comprised of Malays, who are the ethnic majority, followed by Chinese, Indians, Ibans, Kadazandusuns, and…

  4. A study of palm biomass processing strategy in Sarawak

    Science.gov (United States)

    Lee, S. J. Y.; Ng, W. P. Q.; Law, K. H.

    2017-06-01

    In the past decades, palm industry is booming due to its profitable nature. An environmental concern regarding on the palm industry is the enormous amount of waste produced from palm industry. The waste produced or palm biomass is one significant renewable energy source and raw material for value-added products like fiber mats, activated carbon, dried fiber, bio-fertilizer and et cetera in Malaysia. There is a need to establish the palm biomass industry for the recovery of palm biomass for efficient utilization and waste reduction. The development of the industry is strongly depending on the two reasons, the availability and supply consistency of palm biomass as well as the availability of palm biomass processing facilities. In Malaysia, the development of palm biomass industry is lagging due to the lack of mature commercial technology and difficult logistic planning as a result of scattered locality of palm oil mill, where palm biomass is generated. Two main studies have been carried out in this research work: i) industrial study of the feasibility of decentralized and centralized palm biomass processing in Sarawak and ii) development of a systematic and optimized palm biomass processing planning for the development of palm biomass industry in Sarawak, Malaysia. Mathematical optimization technique is used in this work to model the above case scenario for biomass processing to achieve maximum economic potential and resource feasibility. An industrial study of palm biomass processing strategy in Sarawak has been carried out to evaluate the optimality of centralized processing and decentralize processing of the local biomass industry. An optimal biomass processing strategy is achieved.

  5. Malaysia

    Directory of Open Access Journals (Sweden)

    Normi Idris Azrul

    2017-01-01

    Full Text Available Numerical models are capable of simulating various groundwater scenarios and relate it towards groundwater management. A mesh based density dependent flow model, FEFLOW is used to simulate groundwater flow and transport for a coastal island aquifer in Kg. Salang, Tioman Island, Malaysia. FEFLOW is designed to simulate 2D and 3D, variable density groundwater flow and multi-species transport. The impacts of pumping and recharge rates represented by three different groundwater scenarios, which were investigated by means of hydraulic heads, TDS concentrations and water balance components. Scenario A showed the standard saturated groundwater flow and the steady state fluid flow. Over pumping and inconsistency in recharge rate are the stresses shown in Scenarios B and C. Scenario B involved in the maximum pumping rate of 96m3 per day and recharge rate of 300mm per year has shown a drawdown of 1.5 m. Scenario C showed the extreme pumping rate of 1000m3 per day and without recharge has shown a decrease in groundwater levels of 6.3 m.and groundwater storage (50%. Scenario B presented the most promising finding compared with Scenario C. Highest hydraulic heads, lowest mass concentration and positive groundwater storage (2578.6m3/day were obtained in Scenario B. Additionally, and further progress is needed in obtaining the water usage data from each part to determine the best pumping rate. A sustainable groundwater management plan is crucial to maintain the natural resources and social benefits as well as to protect the ecological balance.

  6. Peat in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Ambak, K. [MARDI - Integrated Peat Research Station, Johor (Malaysia); Ah Chye, L. [MARDI Jalan Kebun, Selangor (Malaysia). Vegetable Research Centre

    1996-12-31

    Malaysian peatlands occur mostly in the water-saturated basins of the coastal lowlands. They are approximately 25 000 km{sup 2} in extent, of which about 10 000 km{sup 2} are in Peninsular Malaysia and another 15 000 km{sup 2} are distributed in Sarawak and Sabah. In Peninsular Malaysia, peatland classification is based mainly on peat depth and loss on ignition. In Sarawak, a more comprehensive approach is adopted, based on peat depth and the type of underlying mineral materials. As for Sabah, the classification follows FAD/UNESCO guidelines. Malaysian peatland is utilised mainly for agriculture. At present, about 32 % of the peatland area in Peninsular Malaysia is used for this purpose. In Sarawak, a much smaller percentage is used for agriculture. The main crops grown are oil-palm, rubber, coconut, padi and pineapple. Based on {sup 14}C datings, it has been estimated that peat in this region began to form between 4 000 and 5 000 years ago. The overall rate of accumulation of the peat since its initial formation has been about 2.81 mm ye` whereas the average rate during the early stages of formation ( 12-10 m) was 4.76 mm ye. In the intermediate stage (10-5 m), the average annual accumulation rate decreased to 3.14 mm, and to 2.22 mm in the final phase (5 m to the surface). (orig.) (17 refs.)

  7. A solar power plant for Curtin University Malaysia

    Science.gov (United States)

    Palanichamy, C.

    2016-03-01

    The Curtin University, Sarawak Malaysia (Curtin Sarawak) is the first and largest offshore campus of Curtin University in Perth, Western Australia, and the first foreign university to be established in East Malaysia in partnership with the Sarawak State Government. Today's major concern of Curtin is its monthly electrical energy consumption and the electricity bill since its monthly energy consumption exceeds 0.3 Million kWh, and the corresponding electricity bill surpasses RM 95000. Such a situation necessitates Curtin to curtail the heavy energy consumption with immediate effect. Introducing Renewable Energy Source such as PV Solar Systems is a cost-effective and environmental friendly solution to reduce the exponential increase in energy consumption charges of Curtin. Hence, this paper proposes a 90 kW solar power plant for Curtin Sarawak.

  8. A solar power plant for Curtin University Malaysia

    International Nuclear Information System (INIS)

    Palanichamy, C

    2016-01-01

    The Curtin University, Sarawak Malaysia (Curtin Sarawak) is the first and largest offshore campus of Curtin University in Perth, Western Australia, and the first foreign university to be established in East Malaysia in partnership with the Sarawak State Government. Today's major concern of Curtin is its monthly electrical energy consumption and the electricity bill since its monthly energy consumption exceeds 0.3 Million kWh, and the corresponding electricity bill surpasses RM 95000. Such a situation necessitates Curtin to curtail the heavy energy consumption with immediate effect. Introducing Renewable Energy Source such as PV Solar Systems is a cost-effective and environmental friendly solution to reduce the exponential increase in energy consumption charges of Curtin. Hence, this paper proposes a 90 kW solar power plant for Curtin Sarawak. (paper)

  9. A Study of Logistics Development In The Malaysia Eastern Region: A Descriptive Analysis

    Directory of Open Access Journals (Sweden)

    Abdul Aziz Zuraimi

    2013-07-01

    Full Text Available This study investigated the current logistics development in The East Coast Region of Pennisular Malaysia. Logistics development is paramount important to the country in supporting economic and growth and enhancing competitiveness. Malaysia as well as many developing countries are still at the moderate stage in developing logistics systems and often face considerable challenges and constraints to provide efficient and effective logistics service. The respondents were from the different logistics players and there were 41 usable questionnaires were analyzed. This study found that the existing logistics infrastructures at the average level in this region. Amongst the constraints and challenges were professionalism in supporting the development, skill of manpower and financial issues in organization. Albeit all the constraints, most respondents were satisfied with the services rendered by logistics service providers.

  10. Activities concentration of 239+240Pu in sediment in Sabah and Sarawak coastal area

    International Nuclear Information System (INIS)

    Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Ahmad Sanadi Abu Bakar; Norfaizal Mohamed; Kamarozaman Ishak; Zulkifli Daud

    2008-08-01

    The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal area of the Sabah and Sarawak have been performed using alpha spectrometry counting system. The sampling coastal sediment for this study was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. This results show that the distribution of Plutonium, 239+240 Pu radionuclides in coastal sediment is consistent, their activities are depending on the sampling locations. Generally, the 239+240 Pu activities measured in Sabah and Sarawak coastal sediment are in the range of BDL - 1.83 Bq/kg and 0.11 - 0.841 Bq/kg dry weights, respectively. The sampling stations, Persisiran Lubok Sabanan, SB 15 and Sungai Similajau, SR 13 showed the highest plutonium, 239+240 Pu radionuclides isotopes activity in Sabah and Sarawak. Meanwhile, these two stations shows higher activity compare to West Coast of Peninsular of Malaysia station for the Marine Radioactivity Database Development Project for Malaysia. (Author)

  11. Chigger (Acarina:Trombiculidae) surveys of the west coast beaches of Sabah and Sarawak.

    Science.gov (United States)

    Dohany, A L; Phang, O W; Rapmund, G

    1977-06-01

    Leptotrombidium (Leptotrombidium) arenicola Traub, a vector of scrub typhus, had previously been found to occur in the coastal vegetation behind the edge of open sand along the beaches of Peninsular Malaysia. Surveys of the west coast beaches of Sabah and Sarawak were conducted to determine if this species occurs in similar habitat in East Malaysia on the island of Borneo. Leptotrombidium (L.) arenicola was not collected from the eighteen sites studied. Of the 11,982 mite larvae collected, 55 per cent were L.(L.) deliense (Walch), a well-known, widespread vector of scrub typhus.

  12. Effectiveness and sustainability of a structured group-based educational program (MEDIHEALTH) in improving medication adherence among Malay patients with underlying type 2 diabetes mellitus in Sarawak State of Malaysia: study protocol of a randomized controlled trial.

    Science.gov (United States)

    Ting, Chuo Yew; Ahmad Zaidi Adruce, Shahren; Hassali, Mohamed Azmi; Ting, Hiram; Lim, Chien Joo; Ting, Rachel Sing-Kiat; Abd Jabar, Abu Hassan Alshaari; Osman, Nor Anizah; Shuib, Izzul Syazwan; Loo, Shing Chyi; Sim, Sui Theng; Lim, Su Ee; Morisky, Donald E

    2018-06-05

    Amidst the high disease burden, non-adherence to medications among patients with type 2 diabetes mellitus (T2DM) has been reported to be common and devastating. Sarawak Pharmaceutical Services Division has formulated a pharmacist-led, multiple-theoretical-grounding, culturally sensitive and structured group-based program, namely "Know Your Medicine - Take if for Health" (MEDIHEALTH), to improve medication adherence among Malay patients with T2DM. However, to date, little is known about the effectiveness and sustainability of the Program. This is a prospective, parallel-design, two-treatment-group randomized controlled trial to evaluate the effectiveness and sustainability of MEDIHEALTH in improving medication adherence. Malay patients who have underlying T2DM, who obtain medication therapy at Petra Jaya Health Clinic and Kota Samarahan Health Clinic, and who have a moderate to low adherence level (8-item Morisky Medication Adherence Scale, Malaysian specific, score sustainability of the Program will be triangulated by findings from semi-structured interviews with five selected participants conducted 1 month after the intervention and in-depth interviews with two main facilitators and two managerial officers in charge of the Program 12 months after the intervention. Statistical analyses of quantitative data were conducted using SPSS version 22 and Stata version 14. Thematic analysis for qualitative data were conducted with the assistance of ATLAS.ti 8. This study provides evidence on the effectiveness and sustainability of a structured group-based educational program that employs multiple theoretical grounding and a culturally sensitive approach in promoting medication adherence among Malays with underlying T2DM. Both the quantitative and qualitative findings of this study could assist in the future development of the Program. National Medical Research Register, NMRR-17-925-35875 (IIR). Registered on 19 May 2017. ClinicalTrials.gov, NCT03228706 . Registered on 25

  13. Glycaemic control of diabetic patients in an urban primary health care setting in Sarawak: the Tanah Puteh Health Centre experience.

    Science.gov (United States)

    Wong, J S; Rahimah, N

    2004-08-01

    Achieving glycaemic goals in diabetics has always been a problem, especially in a developing country with inadequate facilities such as in Sarawak in Malaysia. There are no reported studies on the control of diabetes mellitus in a diabetic clinic in the primary health care setting in Sarawak. This paper describes the profile of 1031 patients treated in Klinik Kesihatan Tanah Puteh Health Centre. The mean age was 59 years, the mean BMI 27 kg/m2. There was a female preponderance and mainly type-2 diabetes. Mean HbA1c was 7.4%. Glycaemic control was optimal in 28% (HbA1c 7.5%). Reasonable glycaemic control can be achieved in the primary health care setting in Sarawak.

  14. Comparing schizophrenia symptoms in the Iban of Sarawak with other populations to elucidate clinical heterogeneity.

    Science.gov (United States)

    McLean, Duncan; Barrett, Robert; Loa, Peter; Thara, Rangaswamy; John, Sujit; McGrath, John; Gratten, Jake; Mowry, Bryan

    2015-03-01

    The symptom profile of schizophrenia can vary between ethnic groups. We explored selected symptom variables previously reported to be characteristic of schizophrenia in the Iban of Sarawak in transethnic populations from Australia, India, and Sarawak, Malaysia. We tested site differences to confirm previous research, and to explore implications of differences across populations for future investigations. We recruited schizophrenia samples in Australia (n = 609), India (n = 310) and Sarawak (n = 205) primarily for the purposes of genetic studies. We analyzed seven identified variables and their relationship to site using logistic regression, including: global delusions, bizarre delusions, thought broadcast/insertion/withdrawal delusions, global hallucinations, auditory hallucinations, disorganized behavior, and prodromal duration. We identified a distinct symptom profile in our Sarawak sample. Specifically, the Iban exhibit: low frequency of thought broadcast/insertion/withdrawal delusions, high frequency of auditory hallucinations and disorganized behavior, with a comparatively short prodrome when compared with Australian and Indian populations. Understanding between-site variation in symptom profile may complement future transethnic genetic studies, and provide important clues as to the nature of differing schizophrenia expression across ethnically distinct groups. A comprehensive approach to subtyping schizophrenia is warranted, utilizing comprehensively ascertained transethnic samples to inform both schizophrenia genetics and nosology. Copyright © 2013 Wiley Publishing Asia Pty Ltd.

  15. Introduction to recent systematic studies on amphibians of Sarawak by JRCTS and Forest Research Department Sarawak

    OpenAIRE

    Eto, Koshiro; Matsui, Masafumi; Nishikawa, Kanto

    2016-01-01

    This proceeding is a compilation of findings and progress activities of research collaboration between the Forest Department Sarawak (FDS) and the Japan Research Consortium for Tropical Forests in Sarawak (JRCTS). To highlight the research findings, An International Symposium entitled "Frontier in Tropical Forest Research: Progress in Joint Projects between the Forest Department Sarawak and the Japan Research Consortium for Tropical Forests in Sarawak" was ii held in Kuching, Sarawak on 21-22...

  16. Japanese Encephalitis in Malaysia: An Overview and Timeline.

    Science.gov (United States)

    Kumar, Kiven; Arshad, Siti Suri; Selvarajah, Gayathri Thevi; Abu, Jalila; Toung, Ooi Peck; Abba, Yusuf; Yasmin, A R; Bande, Faruku; Sharma, Reuben; Ong, Bee Lee

    2018-05-29

    Japanese encephalitis (JE) is a vector-borne zoonotic disease caused by the Japanese encephalitis virus (JEV). It causes encephalitis in human and horses, and may lead to reproductive failure in sows. The first human encephalitis case in Malaya (now Malaysia) was reported during World War II in a British prison in 1942. Later, encephalitis was observed among race horses in Singapore. In 1951, the first JEV was isolated from the brain of an encephalitis patient. The true storyline of JE exposure among humans and animals has not been documented in Malaysia. In some places such as Sarawak, JEV has been isolated from mosquitoes before an outbreak in 1992. JE is an epidemic in Malaysia except Sarawak. There are four major outbreaks reported in Pulau Langkawi (1974), Penang (1988), Perak and Negeri Sembilan (1998-1999), and Sarawak (1992). JE is considered endemic only in Sarawak. Initially, both adults and children were victims of JE in Malaysia, however, according to the current reports; JE infection is only lethal to children in Malaysia. This paper describes a timeline of JE cases (background of each case) from first detection to current status, vaccination programs against JE, diagnostic methods used in hospitals and factors which may contribute to the transmission of JE among humans and animals in Malaysia. Copyright © 2018. Published by Elsevier B.V.

  17. Simulation of heavy precipitation episode over eastern Peninsular Malaysia using MM5: sensitivity to cumulus parameterization schemes

    Science.gov (United States)

    Salimun, Ester; Tangang, Fredolin; Juneng, Liew

    2010-06-01

    A comparative study has been conducted to investigate the skill of four convection parameterization schemes, namely the Anthes-Kuo (AK), the Betts-Miller (BM), the Kain-Fritsch (KF), and the Grell (GR) schemes in the numerical simulation of an extreme precipitation episode over eastern Peninsular Malaysia using the Pennsylvania State University—National Center for Atmospheric Research Center (PSU-NCAR) Fifth Generation Mesoscale Model (MM5). The event is a commonly occurring westward propagating tropical depression weather system during a boreal winter resulting from an interaction between a cold surge and the quasi-stationary Borneo vortex. The model setup and other physical parameterizations are identical in all experiments and hence any difference in the simulation performance could be associated with the cumulus parameterization scheme used. From the predicted rainfall and structure of the storm, it is clear that the BM scheme has an edge over the other schemes. The rainfall intensity and spatial distribution were reasonably well simulated compared to observations. The BM scheme was also better in resolving the horizontal and vertical structures of the storm. Most of the rainfall simulated by the BM simulation was of the convective type. The failure of other schemes (AK, GR and KF) in simulating the event may be attributed to the trigger function, closure assumption, and precipitation scheme. On the other hand, the appropriateness of the BM scheme for this episode may not be generalized for other episodes or convective environments.

  18. Prevalence of Clostridium difficile infection and colonization in a tertiary hospital and elderly community of North-Eastern Peninsular Malaysia.

    Science.gov (United States)

    Zainul, N H; Ma, Z F; Besari, A; Siti Asma, H; Rahman, R A; Collins, D A; Hamid, N; Riley, T V; Lee, Y Y

    2017-10-01

    Little is known about Clostridium difficile infection (CDI) in Asia. The aims of our study were to explore (i) the prevalence, risk factors and molecular epidemiology of CDI and colonization in a tertiary academic hospital in North-Eastern Peninsular Malaysia; (ii) the rate of carriage of C. difficile among the elderly in the region; (iii) the awareness level of this infection among the hospital staffs and students. For stool samples collected from hospital inpatients with diarrhea (n = 76) and healthy community members (n = 138), C. difficile antigen and toxins were tested by enzyme immunoassay. Stool samples were subsequently analyzed by culture and molecular detection of toxin genes, and PCR ribotyping of isolates. To examine awareness among hospital staff and students, participants were asked to complete a self-administered questionnaire. For the hospital and community studies, the prevalence of non-toxigenic C. difficile colonization was 16% and 2%, respectively. The prevalence of CDI among hospital inpatients with diarrhea was 13%. Out of 22 C. difficile strains from hospital inpatients, the toxigenic ribotypes 043 and 017 were most common (both 14%). In univariate analysis, C. difficile colonization in hospital inpatients was significantly associated with greater duration of hospitalization and use of penicillin (both P difficile colonization is prevalent in a Malaysian hospital setting but not in the elderly community with little or no contact with hospitals. Awareness of CDI is alarmingly poor.

  19. Activity concentrations of 239+240 Pu in sediment at Sabah and Sarawak coastal areas

    International Nuclear Information System (INIS)

    Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Hidayah Shahar

    2009-01-01

    The coastal sediment sampling was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal areas of Sabah and Sarawak was by the alpha spectrometry counting system. Prior to counting, the radionuclides were isolated from the samples using radiochemical separation technique and mounted on a stainless steel disc by using electro-deposition. The results show that the distribution of 239+240 Pu activity concentration in coastal sediment is consistent, ranging from BDL - 1.83 Bq/kg and 0.11 - 0.84 Bq/kg dry weight, respectively. Lubok Sabanan, SB 15, in Sabah and Sungai Similajau, SR 13, in Sarawak were sampling stations that gave highest 239+240 Pu activity concentration. Overall, the 239+240 Pu activity concentration of Sabah and Sarawak are slightly higher in comparison the West Coast coastal stations of Peninsular Malaysia, and can be used as database. (Author)

  20. Climatic variability of east Malaysia

    International Nuclear Information System (INIS)

    Camerlengo, A.L.; Saadon, M.N.; Awang, M.; Somchit, H.; Rang, L.Y.

    2001-01-01

    The objective of this paper is to learn the variability of atmospheric pressure, relative humidity and insolation in East Malaysia. The main results of our study are: (1) a gentle pressure gradient is observed at the east coast in the boreal winter, (2) smaller atmospheric pressure values are noted during the first inter-monsoon period all across East Malaysia, (3) lesser insolation values are observed in Sarawak and at the east coast during the boreal winter as compared to the boreal summer, and (4) a poleward increase of insolation is registered. (author)

  1. Critical factors of implementing Industrialised Building System in Sarawak: A research on SMEs

    Science.gov (United States)

    Hadi, N. A.; Muhamad, W. M. N. W.; Othman, M. K. F.

    2017-05-01

    Industrialised Building System (IBS) have been adopted in Malaysia for over five decades and is expected to grow consistent with Malaysia's economic development. In promoting the adoption of IBS in construction projects, the government has taken several steps such as levy exemption for contractors and developers. Despite its numerous advantages and efforts pulled by the government, the implementation and adoption of IBS are still below the expected figure. Many researchers investigated readiness, setbacks and issues related to the implementation of IBS in Malaysia's construction projects. However, most of the research mainly for projects located in urban areas of West Malaysia. Therefore, this paper aims to close the gap on factors affecting the implementation of IBS for SMEs in Sarawak, where the level urbanisation is low. A semi-structured interview was conducted with 10 SME's contractors to get better insight view. The study found that logistics and infrastructure problems, a limited number of the manufacturer, lack of incentive, conventional payment methods, lack of financial supports are among critical factors affecting the implementation of IBS. Therefore, it was concluded that government plays major role in providing supports, incentives and facilitating the improvement of infrastructure to successfully implementing IBS in Sarawak.

  2. A preliminary field survey of ectoparasites of rodents in urban park, Sarawak, Malaysian Borneo.

    Science.gov (United States)

    Madinah, A; Mariana, A; Fatimah, A; Abdullah, M T

    2013-09-01

    A survey of ectoparasites was carried out during Eco-Zoonoses Expedition in Bukit Aup Jubilee Park (BAJP), Sibu, Sarawak, Malaysian Borneo from 5(th) to 9(th) June 2008. A total of nine individuals comprising two species of rodents were captured. The species of rodents screened for ectoparasites were Sundamys muelleri and Callosciurus notatus. Four genera and six species of ectoparasites were collected, namely, Ixodes granulatus, Ixodes sp., Laelaps sedlaceki, Laelaps nuttalli, Hoplopleura dissicula and Listrophoroides sp. Three species of the ectoparasites are known to have potential health risk. The species were Ixodes granulatus, Laelaps nuttalli and Hoplopleura dissicula. This survey produced the first list of ectoparasites in Bukit Aup Jubilee Park, Sarawak, Malaysia.

  3. Care demands on mothers caring for a child with Down syndrome: Malaysian (Sarawak) mothers' perspectives.

    Science.gov (United States)

    Chan, Kim Geok; Lim, Khatijah Abdullah; Ling, How Kee

    2015-10-01

    This paper examines the experiences of mothers caring for a child with Down syndrome in the Malaysian (Sarawak) context. Qualitative interviews were conducted with 26 biological mothers of children with Down syndrome aged 18 years and below. They were accessed through selected child health clinics, community-based rehabilitation centres and schools using purposive sampling within two regions in Sarawak, one of the two Borneo States of Malaysia. Major themes emerging within the context of care demands were children's health, developmental delays, daily needs and behaviour issues. The insights obtained into the care demands experienced by mothers of children with Down syndrome have several implications for practice by care professionals. © 2014 Wiley Publishing Asia Pty Ltd.

  4. Case study of the Sarawak River Basin

    African Journals Online (AJOL)

    2012-12-20

    Dec 20, 2012 ... the high cost of this flood mapping technique has motivated the development of an advanced ..... (2011) Historical flood events recorded in Sarawak from 1946- ... HII CP, PUTUHENA FJ and SAID SB (2009) Adaptive Logical.

  5. Report of Sarawak Council for Further Education.

    Science.gov (United States)

    Sarawak Council for Further Education, Kuching (Malaysia).

    The 1972 report of the Sarawak Council for Further Education and the minutes of its 31 March 1973 meetings are provided. Information regarding committee memberships, staff, education centers, yearly examinations, and finances is provided. (KM)

  6. TOURIST ARRIVALS AND ECONOMIC GROWTH IN SARAWAK

    OpenAIRE

    Lau, Evan; Oh, Swee-Ling; Hu, Sing-Sing

    2008-01-01

    This study empirically investigates the comovements and the causality relationship between tourist arrivals and economic growth in Sarawak during the period of 1972 to 2004. The empirical evidence clearly shows that the long run causality running from tourist arrivals to economic growth in the estimation period. As one of the income generator for Sarawak, the findings are consistent with economic theory and proffer important policy conclusions.

  7. Spatial patterns of seaweed distribution in Malaysia using GIS

    Science.gov (United States)

    Lian, Du Hai; Sim, Jillian Ooi Lean; Fauzi, Rosmadi; Moi, Phang Siew

    2008-10-01

    The objective of this article is to represent spatial patterns of seaweed distribution in Malaysia. Seaweeds have been collected since 1984 along coastlines of 4675 km of peninsular Malaysia, Sabah, and Sarawak. However, there is no seaweed database and they cannot be displayed in a geographic view. Therefore, a database with 805 georeferenced observations was setup and GIS is used to analyze seaweed diversity based on this database. The highest number of observations is 94 which occur along east coastline of peninsular Malaysia. The highest number of species richness is 82 which are also along east coastline of peninsular Malaysia. Rhodophyta has the highest species richness while Chlorophyta has the least species richness.

  8. Noise-induced hearing loss among quarry workers in a north-eastern state of malaysia: a study on knowledge, attitude and practice.

    Science.gov (United States)

    Ismail, Ahmad Filza; Daud, Aziah; Ismail, Zaliha; Abdullah, Baharudin

    2013-09-01

    Noise is known to be one of the environmental and occupational hazards listed in the Factory and Machinery Act 1967. Quarries with loud deafening sounds from trucks and machineries pose the risk of noise-induced hearing loss to workers. This study was designed to assess the knowledge, attitude and practice towards noise-induced hearing loss and to determine the prevalence of noise-induced hearing loss and its associated factors among quarry workers in a north-eastern state of Malaysia. A cross-sectional study was conducted at six quarries in a north-eastern state of Malaysia, with 97 consented respondents who answered a validated version of a questionnaire and underwent pure tone audiogram. The respondents were male, aged between 18 to 50 years, working in the quarry area for at least 6-months duration with no family history of ear diseases. The mean percentage scores of knowledge, attitude and practice were 44 (11), 70 (10) and 28 (16) percent, respectively. The prevalence of noise-induced hearing loss was found to be 57 (95% CI: 47, 67) with 46 (84%) having mild and moderate noise-induced hearing loss, and 34 (62%) involved both ears. Multiple logistic regressions showed that age and practice score were the associated factors with odd ratios of 1.1 (95% CI: 1.1, 1.2; phearing loss was contributed by factors such as poor practice and old age.

  9. Enhancing Visitor Experiences Using Thematic Interpretation in Park Guiding Service in Sarawak National Parks

    Directory of Open Access Journals (Sweden)

    Amin Victor Luna

    2014-01-01

    Full Text Available Enhancing visitor experiences is arguably the primary and most important goal for interpretation by many protected area managers and tourism business. However, little research has been conducted in Sarawak, Malaysia to directly quantify the effects of thematic interpretation has on tourist experiences. Drawing on the TORE-model of interpretation and through the inception of Park Guiding Training and Licensing System in Sarawak since 2007, this quantitative study examines the effectiveness of thematic interpretive guided tours delivered by park guides at Bako National Park, Sarawak, with the assumption that it will further enhance visitor experiences. A descriptive analysis and Pearson's product-moment correlation analysis of sub-indicators of the global evaluation of interpretation of site, and sub-indicators of elaboration surveyed from visitors of purposively sampled park guides revealed a strong measurement and correlation coefficients of visitors’ overall quality of thematic intepretive guided tours effecting visitor satisfaction and experiences. These findings provide empirical evidence that good thematic interpretive guided tour makes a positive impacts on visitor experiences, thus making training of tourism businesses' employees as park guides as a good investment. The suggestions for further research in influencing visitor attitude and shaping visitor behaviour are offered.

  10. An Investigation of Sustainable Power Generation from Oil Palm Biomass: A Case Study in Sarawak

    Directory of Open Access Journals (Sweden)

    Nasrin Aghamohammadi

    2016-04-01

    Full Text Available Sarawak is the largest state in Malaysia, with 22% of the nation's oil palm plantation area, making it the second largest contributor to palm biomass production. Despite the enormous amount of palm biomass in the state, the use of biomass as fuel for power generation remains low. This study is designed to investigate the sustainability of power generation from palm biomass specifically in Sarawak by conducting a survey among the palm oil mill developers. To conduct this investigation, several key sustainability factors were identified: the security of the biomass supply, the efficiency of conversion technology, the existing network system, challenges and future prospects for power generation from palm biomass. These factors were assessed through a set of questionnaires. The returned questionnaires were then analysed using statistical tools. The results of this study demonstrate that Sarawak has biomass in abundance, and that it is ready to be exploited for large scale power generation. The key challenge to achieving the renewable energy target is the inadequate grid infrastructure that inhibits palm oil developers from benefiting from the Feed-in-Tariff payment scheme. One way forward, a strategic partnership between government and industrial players, offers a promising outcome, depending on an economic feasibility study. The decentralization of electricity generation to support rural electrification is another feasible alternative for renewable energy development in the state.

  11. IDENTIFYING MOTIVATION FACTOR INVOLVEMENT OF SARAWAK MALAY WOMEN ENTREPRENEUR

    Directory of Open Access Journals (Sweden)

    Masyantie Mohamad

    2016-03-01

    Full Text Available Sarawak multilayered cake among Sarawak product signature famous among the local as well as international tourist visiting Sarawak. In fact, Sarawak Malay women entrepreneurs have become very necessary players in the entrepreneurial field specifically in this cottage industries from the early introduction of this business, they have facing various problem in this businesses. Thus, this research aims to build an understanding of motivational factor that encourage Sarawak Malay women entrepreneurial experiences especially in multilayered cake businesses. Using qualitative methods, this research aims to identify the entrepreneurial motivations factors; with regards to start-up motivation by Sarawak Malay women. The finding shows that the motivations that influence Malay women within Kuching, Sarawak areas to start and grow their business are involve self-driven and context driven that motivate them involve in multilayered cakes businesses.

  12. Molecular epidemiology of tuberculosis in Malaysia.

    Science.gov (United States)

    Dale, J W; Nor, R M; Ramayah, S; Tang, T H; Zainuddin, Z F

    1999-05-01

    Molecular typing with IS6110 was applied to Mycobacterium tuberculosis isolates from all parts of Malaysia. The degree of clustering increased with patient age, suggesting that reactivation may contribute to clustering. Identical banding patterns were also obtained for isolates from widely separate regions. Therefore, the use of clustering as a measure of recent transmission must be treated with caution. Strains related to the Beijing family were common in Peninsular Malaysia but were less common in Sabah and Sarawak, while a distinct group of strains comprised nearly 40% of isolates from East Malaysia but such strains were rare in Peninsular Malaysia. Single-copy strains, common in South and Southeastern Asia, constituted nearly 20% of isolates from the peninsula but were virtually absent in East Malaysia. The marked geographical difference in the prevailing strains indicates not only a restricted dissemination of M. tuberculosis but also a considerable degree of stability in the banding patterns.

  13. Occupational health in sawmills of Sarawak.

    Science.gov (United States)

    Tan, C C; Cheu, K T; Hardin, S

    1991-09-01

    A self-administered questionnaire survey was conducted among sawmill managers in Sarawak to explore certain health and safety aspects of workers in this industry. The survey reveals that many sawmills are lacking in the provision of occupational health facilities and activities for their employees.

  14. Assessment of Gravity Field and Steady State Ocean Circulation Explorer (GOCE) geoid model using GPS levelling over Sabah and Sarawak

    Science.gov (United States)

    Othman, A. H.; Omar, K. M.; Din, A. H. M.; Som, Z. A. M.; Yahaya, N. A. Z.; Pa'suya, M. F.

    2016-06-01

    The GOCE satellite mission has significantly contributed to various applications such as solid earth physics, oceanography and geodesy. Some substantial applications of geodesy are to improve the gravity field knowledge and the precise geoid modelling towards realising global height unification. This paper aims to evaluate GOCE geoid model based on the recent GOCE Global Geopotential Model (GGM), as well as EGM2008, using GPS levelling data over East Malaysia, i.e. Sabah and Sarawak. The satellite GGMs selected in this study are the GOCE GGM models which include GOCE04S, TIM_R5 and SPW_R4, and the EGM2008 model. To assess these models, the geoid heights from these GGMs are compared to the local geometric geoid height. The GGM geoid heights was derived using EGMLAB1 software and the geometric geoid height was computed by available GPS levelling information obtained from the Department Survey and Mapping Malaysia. Generally, the GOCE models performed better than EGM2008 over East Malaysia and the best fit GOCE model for this region is the TIM_R5 model. The TIM_R5 GOCE model demonstrated the lowest R.M.S. of ± 16.5 cm over Sarawak, comparatively. For further improvement, this model should be combined with the local gravity data for optimum geoid modelling over East Malaysia.

  15. Distribution and taxonomy of Rafflesia R. Br. (Rafflesiaceae) in Peninsular Malaysia

    Science.gov (United States)

    Wahab, Nor Azilah Abdul; Talip, Noraini; Adam, Jumaat

    2018-04-01

    Distribution of Rafflesia spesies are only endemic to tropical rainforest in Southeast Asia. Malaysia is among the country that is blessed with Rafflesia species and reported can be found in Peninsular Malaysia, Sabah and Sarawak. Not all state in Peninsular Malaysia are reported to have this magnificent flower. Only states of Perak, Pahang, Kelantan, Terengganu and Kedah that are reported to have the distribution of Rafflesia species in Peninsular Malaysia. There are seven species of Rafflesia that have been reported and daescribed in Peninsular Malaysia, which namely R. cantleyi, R. kerrii, R. azlanii, R. su-meiae, R. sharifah-hapsahiae, R. parvimaculata and R. tuanku-halimii.

  16. Common efforts in the development of rural Sarawak, Malaysia

    NARCIS (Netherlands)

    Grijpstra, B.G.

    1976-01-01

    The subject of research was whether it is possible to establish modern cooperative societies in traditionally integrated communities. Views of laymen, politicians and sociologists are presented. The characteristics of tribal societies and loosely structured societies are discussed. An

  17. Predicted equations for ventilatory function among Kuching (Sarawak, Malaysia) population.

    Science.gov (United States)

    Djojodibroto, R D; Pratibha, G; Kamaluddin, B; Manjit, S S; Sumitabha, G; Kumar, A Deva; Hashami, B

    2009-12-01

    Spirometry data of 869 individuals (males and females) between the ages of 10 to 60 years were analyzed. The analysis yielded the following conclusions: 1. The pattern of Forced Vital Capacity (FVC) and Forced Expiratory Volume in One Second (FEV1) for the selected subgroups seems to be gender dependant: in males, the highest values were seen in the Chinese, followed by the Malay, and then the Dayak; in females, the highest values were seen in the Chinese, followed by the Dayak, and then the Malay. 2. Smoking that did not produce respiratory symptom was not associated with a decline in lung function, in fact we noted higher values in smokers as compared to nonsmokers. 3. Prediction formulae (54 in total) are worked out for FVC & FEV1 for the respective gender and each of the selected subgroups.

  18. River Plumes in Sunglint, Sarawak, Borneo

    Science.gov (United States)

    1991-01-01

    The sunglint pattern along the coast of Sarawak (3.0N, 111.5E) delineates the boundry of fresh water river plumes as they flow into the South China Sea. The fresh water lens (boundry between fresh and sea water) overides the saline and more dense sea water and oils, both natural and man made, collect along the convergence zones and dampen wave action. As a result, the smoother sea surface appears bright in the sunglint pattern.

  19. A pilot study on the functional performance and acceptability of an innovative female condom (Wondaleaf®) in Malaysia

    OpenAIRE

    Ting,Rachel Sing-Kiat; Wong,Ee Lynn; Tnay,Jessie Koh-Sing

    2018-01-01

    Rachel Sing-Kiat Ting,1 Ee-Lynn Wong,2 Jessie Koh-Sing Tnay3 1School of Sociology, China University of Political Sciences and Law, Beijing, China; 2InPsych Psychological and Counselling Services, Kuala Lumpur, 3Institute of Borneo Studies, Universiti Malaysia Sarawak, Sarawak, Malaysia Background: Female condom (FC) has been available for over 30 years, but it still lacks wide acceptability. To overcome misdirection and invagination occurring in FC and to provide a wider area of protection, W...

  20. Cavernicolous And Terrestrial Decapod Crustacea From Northern Sarawak, Borneo

    NARCIS (Netherlands)

    Holthuis, L.B.

    1979-01-01

    During the 1977-1978 Royal Geographical Society Mulu (Sarawak) Expedition a number of Decapod Crustacea was obtained. Some were collected by Mr. Philip Chapman in the course of studies of the invertebrates of the limestone caves in the Gunong Mulu National Park, 4th Division of Sarawak, and the Niah

  1. Mercury pollution in Malaysia.

    Science.gov (United States)

    Hajeb, Parvaneh; Jinap, S; Ismail, Ahmad; Mahyudin, Nor Ainy

    2012-01-01

    Although several studies have been published on levels of mercury contamination of the environment, and of food and human tissues in Peninsular Malaysia, there is a serious dearth of research that has been performed in East Malaysia (Sabah and Sarawak). Industry is rapidly developing in East Malaysia, and, hence, there is a need for establishing baseline levels of mercury contamination in environmental media in that part of the country by performing monitoring studies. Residues of total mercury and inorganic in food samples have been determined in nearly all previous studies that have been conducted; however, few researchers have analyzed samples for the presence of methlymercury residues. Because methylmercury is the most toxic form of mercury, and because there is a growing public awareness of the risk posed by methylmercury exposure that is associated with fish and seafood consumption, further monitoring studies on methylmercury in food are also essential. From the results of previous studies, it is obvious that the economic development in Malaysia, in recent years, has affected the aquatic environment of the country. Primary areas of environmental concern are centered on the rivers of the west Peninsular Malaysian coast, and the coastal waters of the Straits of Malacca, wherein industrial activities are rapidly expanding. The sources of existing mercury input to both of these areas of Malaysia should be studied and identified. Considering the high levels of mercury that now exists in human tissues, efforts should be continued, and accelerated in the future, if possible, to monitor mercury contamination levels in the coastal states, and particularly along the west Peninsular Malaysian coast. Most studies that have been carried out on mercury residues in environmental samples are dated, having been conducted 20-30 years ago; therefore, the need to collect much more and more current data is urgent. Furthermore, establishing baseline levels of mercury exposure to

  2. Characterization of the coal derived humic acids from Mukah, Sarawak as soil conditioner

    Directory of Open Access Journals (Sweden)

    Fong Sim Siong

    2006-01-01

    Full Text Available In Malaysia, abundant coal resources were found in Sarawak and Sabah. The utilization of coal resources, to date, is emphasized on the energy productions. The non-energy utilization as soil conditioner is unexplored. Therefore, this study attempted to characterize the coal humic acids extracted from Mukah coal and to evaluate its properties as soil conditioner. The coal humic acids from the regenerated sample were also assessed. The results revealed that different extractants and concentrations influenced the properties of humic acids. The extraction with KOH at 0.5 mol L-1 produced humic acids with low ash content and high acidic functional groups, which are substantial as soil conditioner. However, the yield was low. Regeneration of coal sample with 10% nitric acids improved the yield to an average of 83.45%. The acidic functional groups of nitrohumic acids were improved with the ash content remained at a low level.

  3. Sarawak Bamboo Craft: Symbolism and Phenomenon

    Directory of Open Access Journals (Sweden)

    Arshad Mohd Zaihidee

    2014-04-01

    Full Text Available The relationship between human beings and their environment has stirred reactions between nature and the development of mind and actions that can be discussed using interdisciplinary approaches such as psychology, sociology, anthropology and history, in understanding human thinking and behavior. A psychological approach is intended to evaluate the individual choices and needs in society. A sociological approach details the various patterns in the social organization. An anthropological approach is tied with culture and belief to fulfil human needs which are based on their habitat, while a historical approach looks at the development which is related to the past. Dimensions of experiences, order and logic, selective elaboration and expressions are used to analyze the bamboo craft of Iban, Melanau and Bidayuh societies in Sarawak long-houses. The existence of constitutive, moral, expressive and cognitive symbols has been interpreted based on a theoretical framework that has been developed by Langer Art Theory, Parsons Social Theory and Kaplan Culture Theory. The values and meaning formed are interpreted to understand matters related to the lives of villagers and the finding suggests that bamboo craft expresses the multi-ethnic mind and character in the socio-culture of long- houses in Sarawak.

  4. Nepenthes Vogelii (Nepenthaceae): a new species from Sarawak

    NARCIS (Netherlands)

    Schuiteman, A.; Vogel, de E.F.

    2002-01-01

    Nepenthes vogelii Schuit. & de Vogel is described as a new species from Sarawak. It is compared with N. fusca Danser, from which it differs e.g. in the much smaller pitchers, of which the lid lacks appendages.

  5. Effects of light and soil flooding on the growth and photosynthesis of ramin (Gonystylus bancanus) seedlings in Malaysia

    NARCIS (Netherlands)

    Jans, W.W.P.; Dibor, L.; Verwer, C.C.; Kruijt, B.; Tan, S.; Meer, van der P.J.

    2012-01-01

    We studied the ecophysiology of ramin (Gonystylus bancanus) seedlings in an experimental set up at the Forest Research Centre in Kuching, Sarawak, Malaysia. Ramin seedlings were grown on flooded and drained peat soil under 100, 76, 46 and 23% sunlight, thus simulating effects of different light

  6. International Uranium Resources Evaluation Project (IUREP) national favourability studies: Malaysia

    International Nuclear Information System (INIS)

    1977-12-01

    Malaysia is a country of 330,000 square kilometers and a population of 11.9 million. The country is divided into two parts 640 kilometers apart. West Malaysia consists of the Malay Peninsula, and East Malaysia of the provinces of Sarawak and Sabah, formerly North Borneo. The country is the world's leading producer of tin and rubber. Geologic descriptions in detail are difficult to find although maps are available. Uranium exploration, chiefly by the Malaysian Geological Survey, has been carried out without discovery of commercial quantities. Based on possible recovery of uranium from deeply weathered granites on the Malay Peninsula, and possible discoveries in East Malaysia, a uranium potential of 1,000 to 10,000 tonnes U (category 2) is assigned. (author)

  7. Marine sampling in Malaysia coastal area: the challenge, problems and solution

    International Nuclear Information System (INIS)

    Norfaizal Mohamed; Khairul Nizam Razali; Mohd Rafaie Mohd Murtadza; Muhammad Amin Abdul Ghani; Zaharudin Ahmad; Abdul Kadir Ishak

    2005-01-01

    Malaysia Marine Radioactivity Database Development Project is one of the five research contracts that was signed between MINT and AELB. Three marine sampling expeditions had been carried out using K.L. PAUS vessel owned by Malaysian Fisheries Institute, Chendering, Terengganu. The first marine sampling expedition was taken place at East Coast Peninsular Malaysia waters on August 2003, followed on February 2004 at West Coast Peninsular Malaysia waters, and lastly at Sarawak-Sabah waters on July 2004. Many challenges and problems were faced when collecting sediment, water, biota and plankton sample during this marine sampling. (Author)

  8. Malaysia: World Oil Report 1991

    International Nuclear Information System (INIS)

    Khin, J.A.

    1991-01-01

    This paper reports that the Malaysian government announced tax incentives for fiscal year 1991/92 by cutting export duties on crude oil to encourage companies to develop more oil fields. The export duty exemption on cost recovery oil was increased from the current 20% to 50% on April 1, 1991. Nearly 115,200 sq mi of shallow-water acreage off Malaysia has been awarded to PS contractors, leaving only about five blocks remaining. Therefore, Petronas plans to award deeper water blocks (water depths of 655 ft or more) in the second half of this year, once terms are finalized. It is understood that these areas will be offshore of Sarawak and Sabah, covering in excess of 38,000 sq mi. Petronas the that there would be some improvement in the PSC terms for the deep-water areas

  9. Studies of lagoon ash from Sarawak to assess the impact on the environment

    Energy Technology Data Exchange (ETDEWEB)

    Prabir Kumar Kolay; Harwant Singh [University Malaysia Sarawak, Sarawak (Malaysia). Dept. of Civil Engineering

    2010-02-15

    Coal utilization, mainly in thermal power plants, has increased significantly from 4.2 to 13 million tonnes within 2000 to 2005, which resulted in the production of approximately 2 million tonnes of coal ash in Malaysia. Of this only a small percentage is used as a cement ingredient, in concrete industry, as a fill material, etc. and with the rest of the amount being disposed in ash ponds or lagoons. If the lagoons are not properly designed with a landfill liner or if there is spillage from the ash pond, the toxic heavy metal present in coal ash can result in the contamination of the subsurface soil and the ground water. The concentration of heavy metals or trace elements in coal residues depends on the composition of a particular parent coal and the bulk utilization of lagoon ash for various purposes requires a complete characterization of the ash. Hence, this paper analyzes the coal ash for its trace element content and characterizes mainly physical, chemical, mineralogical, morphological and thermal properties of the lagoon ash from a local coal based thermal power plant from Sarawak, Malaysia. The results also indicated that, the concentration of some trace elements is quite high from the environmental perspective in this particular lagoon ash. 43 refs., 4 figs., 4 tabs.

  10. Indo-Pacific Humpback Dolphins in Borneo: A Review of Current Knowledge with Emphasis on Sarawak.

    Science.gov (United States)

    Minton, Gianna; Zulkifli Poh, Anna Norliza; Peter, Cindy; Porter, Lindsay; Kreb, Danielle

    2016-01-01

    Indo-Pacific humpback dolphins (Sousa chinensis) are documented from various locations along Borneo's coast, including three sites in Sarawak, Malaysia, three sites in Sabah, Malaysia, three locations in Kalimantan, Indonesia and the limited coastal waters of the Sultanate of Brunei. Observations in all these areas indicate a similar external morphology, which seems to fall somewhere between that documented for Chinese populations known as S. chinensis, and that of Sousa sahulensis in Australia and Papua New Guinea. Sightings occur in shallow nearshore waters, often near estuaries and river mouths, and associations with Irrawaddy dolphins (Orcaella brevirostris) are frequently documented. Population estimates exist for only two locations and sightings information throughout Borneo indicates that frequency of occurrence is rare and group size is usually small. Threats from fisheries by-catch and coastal development are present in many locations and there are concerns over the ability of these small and fragmented populations to survive. The conservation and taxonomic status of humpback dolphins in Borneo remain unclear, and there are intriguing questions as to where these populations fit in our evolving understanding of the taxonomy of the genus. © 2016 Elsevier Ltd. All rights reserved.

  11. Elevated blood pressure and its predictors among secondary school students in Sarawak: a cross-sectional study.

    Science.gov (United States)

    Grace Kho, Woei Feng; Cheah, Whye Lian; Hazmi, Helmy

    2018-03-01

    Hypertension is a health issue affecting adolescents. Accumulating evidence affirms that elevated blood pressure begins in childhood and tracks into adulthood. This cross-sectional study was conducted to determine the prevalence of elevated blood pressure and its predictors among secondary school students in Sarawak, Malaysia. A total of 2,461 secondary school students aged 12-17 years from 19 schools in Sarawak participated in the study. Questionnaire was used to obtain socio-demographic data, parental history of hypertension, and self-reported physical activity. Anthropometric and blood pressure measurements were taken. Data was entered and analysed using SPSS version 23.0. The prevalence of adolescents with elevated blood pressure, overweight, central obesity, and overfat were 30.1%, 24.3%, 13.5%, and 6.7%, respectively. Multivariate logistic regression demonstrated the predictors significantly associated with elevated blood pressure among respondents: overweight (adjusted odds ratio=3.144), being male (adjusted odds ratio=3.073), being Chinese (adjusted odds ratio=2.321) or Iban (adjusted odds ratio=1.578), central obesity (adjusted odds ratio=2.145), being overfat (adjusted odds ratio=1.885), and being an older adolescent (adjusted odds ratio=1.109). Parental history of hypertension, locality, and physical activity showed no significant associations. The obesity epidemic must be tackled at community and school levels by health education and regulation of school canteen foods. Copyright© by the National Institute of Public Health, Prague 2018.

  12. Continental Shelf Sediments of Sarawak, Malaysian Borneo

    Science.gov (United States)

    Masron, Tarmiji; Rumpet, Richard; Musel, Jamil

    2017-01-01

    Sediment distributions in deep sea influence the benthic community structure and thus play an important role in shaping the marine ecosystem. Several studies on sediment characteristics had been conducted in South China Sea (SCS), but only limited to coastal areas of regions within SCS territories. Therefore, this study was carried out to analyze the benthic sediment profile in an area beyond 12 nautical miles off the coast of Sarawak, southern SCS. Sediment samples were collected from 31 stations, comprising three depth ranges: (I) 20–50 m, (II) 50–100 m, and (III) 100–200 m. The total organic matter (TOM) contents were determined and subjected to dry and wet sieving methods for particle size analysis. TOM contents in the deep area (>50 m) were significantly higher (p = 0.05) and positively correlated (r = 0.73) with silt-clay fraction. About 55% and 82% of stations in strata II and III, respectively, were dominated by silt-clay fractions (50 m) tend to be poorly sorted, very fine skewed, and platykurtic. Unlike data obtained 20 years ago which reported high content of silt-clay (58%), this study recorded a lower content (35%); therefore, changes in sediment load had been observed in southern SCS. PMID:29075660

  13. Estimated harvesting on jellyfish in Sarawak

    Science.gov (United States)

    Bujang, Noriham; Hassan, Aimi Nuraida Ali

    2017-04-01

    There are three species of jellyfish recorded in Sarawak which are the Lobonema smithii (white jellyfish), Rhopilema esculenta (red jellyfish) and Mastigias papua. This study focused on two particular species which are L.smithii and R.esculenta. This study was done to estimate the highest carrying capacity and the population growth rate of both species by using logistic growth model. The maximum sustainable yield for the harvesting of this species was also determined. The unknown parameters in the logistic model were estimated using center finite different method. As for the results, it was found that the carrying capacity for L.smithii and R.esculenta were 4594.9246456819 tons and 5855.9894242086 tons respectively. Whereas, the population growth rate for both L.smithii and R.esculenta were estimated at 2.1800463754 and 1.144864086 respectively. Hence, the estimated maximum sustainable yield for harvesting for L.smithii and R.esculenta were 2504.2872047638 tons and 1676.0779949431 tons per year.

  14. The impact of A. R. Wallace's Sarawak Law paper reassessed.

    Science.gov (United States)

    van Wyhe, John

    2016-12-01

    This article examines six main elements in the modern story of the impact of Alfred Russel Wallace's 1855 Sarawak Law paper, particularly in the many accounts of Charles Darwin's life and work. These elements are: Each of these are very frequently repeated as straightforward facts in the popular and scholarly literature. It is here argued that each of these is erroneous and that the role of the Sarawak Law paper in the historiography of Darwin and Wallace needs to be revised. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.

  15. 226Ra, 228Ra and 228Ra/226Ra in surface marine sediment of Malaysia

    International Nuclear Information System (INIS)

    Mei-Wo Yii; Zal Uyun Wan-Mahmood

    2013-01-01

    Surface sediment samples were collected at the West (east coast and west coast of Peninsular Malaysia) and East (Sabah and Sarawak) Malaysia in several expeditions within August 2003 until June 2008 for determining the level of natural radium isotopes. Activity concentrations of 226 Ra and 228 Ra in surface marine sediment at 176 sampling stations were measured. The activity concentrations of both radionuclides in Malaysia (East and West Malaysia) display varied with the range from 9 to 158 Bq/kg dry wt. and 13 to 104 Bq/kg dry wt., respectively. Meanwhile, the ratio distributions of 228 Ra/ 226 Ra were ranged from 0.62 to 3.75. This indicated that the ratios were slightly high at west coast of Peninsular Malaysia compared to other regions (east coast of Peninsular Malaysia, Sabah and Sarawak). The variation of activity concentrations of 226 Ra and 228 Ra and its ratios were also supported by the statistical analyses of one-way ANOVA and t test at 95 % confidence level, whereby there were proved that the measured values were different between the regions. These different were strictly related to their half-life, potential input sources (included their parents, 238 U and 232 Th), parent's characteristic, the geological setting/formation of the study area, environment origin and behavior. (author)

  16. Power sector development in Malaysia and energy concerned policy

    Energy Technology Data Exchange (ETDEWEB)

    Husin, Z.A. (Tenaga Nasional Berhad, Kuala Lumpur (Malaysia). Connaught Bridge Power Station)

    1994-03-01

    Discusses privatisation of the Malaysian electric power industry, the role of natural gas and coal in the power sector, and intra-ASEAN power development. At present Malaysia has only one coal-fired power plant - the Sultan Salahuddin Abdul Aziz (SSAA) power station in Kapar - consisting of 2 x 300 MW units. Expansion of the plant by the addition of 2 x 500 MW units is in the final stage of contract awards. Apart from this there are no immediate plans for other coal-fired power plants in Peninsular Malaysia. A number of small capacity coal-fired units are being planned for Sabah and Sarawak, where the bulk of Malaysia's coal resources are located.

  17. Malaysia (country/area statements).

    Science.gov (United States)

    1985-09-01

    According to this statement presented to the Committee on Population of the UN Economic and Social Commission for Asia and the Pacific, Malaysia by 1984 achieved a crude death rate of 5.3/1000, an infant mortality rate of 17/1000 live births, and a 1983 life expectancy at birth of 67.6 for males and 72.3 for females due primarily to socioeconomic development, better nutrition, and a health system covering 95% of the rural population. Substantial mortality differentials still exist between Peninsular Malaysia, Sabah, and Sarawak, between urban and rural areas, and among ethnic groups. Differences in the coverage and quality of mortality statistics also exist. 83.2% of Malaysia's total population of 15.5 million is in Peninsular Malaysia, 7.3% in Sabah, and 9.5% in Sarawak. In Peninsular Malaysia, 55.1% are Malays, 33.9% Chinese, and 10.3% Indians. About 40% of the population is urban, and 39% is under age 15. The average annual rate of growth declined from 2.6% in the 1960s to 2.3% in the 1970s. The total fertility rate fell from 5.1 children in 1970 to 4.1 in 1980. A rise in age at 1st marriage and reduction in marital fertility have been partly offset by an increase in the proportion of women of childbearing age. The population is projected to grow to about 22 million by the year 2000. Chinese and Indians are expected to approach replacement level fertility by that year, but Malay fertility is expected to remain high for some time. Internal migration, 45% of which is intrarural, increased markedly in the 1970s, probably due to rapid modernization, industrialization, land development, and regional imbalances in economic development. In absolute terms a total of 410,000 persons moved from rural to urban areas during the 1970s. Important progress has been made in regional development programs, but further regional development requires resolution of problems related to internal migration and greater efforts to relocate industries in the less developed areas. The

  18. Mapania sapuaniana (Cyperaceae), a new sedge species from Sarawak

    NARCIS (Netherlands)

    Shabdin, Z.; Culham, A.; Simpson, D.A.; Meekiong, K.

    2013-01-01

    Mapania sapuaniana, a spectacular new sedge species from Lanjak Entimau, Sarawak, is described and illustrated. It is closely related to M. richardsii and M. borneensis but differs in having broad leaves with a distinct pseudopetiole, reddish purple or maroon coloration on the underside of the leaf

  19. The Unified Levelling Network of Sarawak and its Adjustment

    Science.gov (United States)

    Som, Z. A. M.; Yazid, A. M.; Ming, T. K.; Yazid, N. M.

    2016-09-01

    The height reference network of Sarawak has seen major improvement in over the past two decades. The most significant improvement was the establishment of extended precise leveling network of which is now able to connect all three major datum points at Pulau Lakei, Original and Bintulu. Datum by following the major accessible routes across Sarawak. This means the leveling network in Sarawak has now been inter-connected and unified. By having such a unified network leads to the possibility of having a common single least squares adjustment been performed for the first time. The least squares adjustment of this unified levelling network was attempted in order to compute the height of all Bench Marks established in the entire levelling network. The adjustment was done by using MoreFix levelling adjustment package developed at FGHT UTM. The computational procedure adopted is linear parametric adjustment by minimum constraint. Since Sarawak has three separate datums therefore three separate adjustments were implemented by utilizing datum at Pulau Lakei, Original Miri and Bintulu Datum respectively. Results of the MoreFix unified adjustment agreed very well with adjustment repeated using Starnet. Further the results were compared with solution given by Jupem and they are in good agreement as well. The difference in height analysed were within 10mm for the case of minimum constraint at Pulau Lakei datum and with much better agreement in the case of Original Miri Datum.

  20. The Communicative Ability of Universiti Teknologi MARA Sarawak's Graduates

    Science.gov (United States)

    Hassan, Sharifah Zakiah Wan; Hakim, Simon Faizal; Rahim, Mahdalela; Noyem, John Francis; Ibrahim, Sueb; Ahmad, Johnny; Jusoff, Kamaruzaman

    2009-01-01

    This study explores Universiti Teknologi MARA (UiTM) Sarawak graduating students' oral proficiency, focusing on grammatical accuracy. Oral proficiency in English has always been the benchmark of language proficiency, and in the context of UiTM's language teaching curriculum, efforts to enhance students' oral proficiency are implemented through…

  1. THE UNIFIED LEVELLING NETWORK OF SARAWAK AND ITS ADJUSTMENT

    Directory of Open Access Journals (Sweden)

    Z. A. M. Som

    2016-09-01

    Full Text Available The height reference network of Sarawak has seen major improvement in over the past two decades. The most significant improvement was the establishment of extended precise leveling network of which is now able to connect all three major datum points at Pulau Lakei, Original and Bintulu. Datum by following the major accessible routes across Sarawak. This means the leveling network in Sarawak has now been inter-connected and unified. By having such a unified network leads to the possibility of having a common single least squares adjustment been performed for the first time. The least squares adjustment of this unified levelling network was attempted in order to compute the height of all Bench Marks established in the entire levelling network. The adjustment was done by using MoreFix levelling adjustment package developed at FGHT UTM. The computational procedure adopted is linear parametric adjustment by minimum constraint. Since Sarawak has three separate datums therefore three separate adjustments were implemented by utilizing datum at Pulau Lakei, Original Miri and Bintulu Datum respectively. Results of the MoreFix unified adjustment agreed very well with adjustment repeated using Starnet. Further the results were compared with solution given by Jupem and they are in good agreement as well. The difference in height analysed were within 10mm for the case of minimum constraint at Pulau Lakei datum and with much better agreement in the case of Original Miri Datum.

  2. Variability of temperature, evaporation, insolation and sea level pressure in East Malaysia

    International Nuclear Information System (INIS)

    Camerlengo, A.L.; Mohd Nasir Saadon; Lim You Rang; Nhakhorn Somchit; Mohd Mahatir Osman

    1999-01-01

    The interrelation between global warming and certain meteorological parameters - temperature, evaporation, sea level pressure and isolation (hours of sunshine) - in East Malaysia is addressed in this study. The inter-annual climatic variability mainly due to ENSO warm events, is also investigated. The study of the monthly distribution of both evaporation and insolation in East Malaysia (i.e., the Malaysian states of Sabah and Sarawak, both of them situated in the northern part of the island of Borneo) is also covered in this paper (author)

  3. Soil Fungal Community Associated with Peat in Sarawak Identified Using 18S rDNA Marker

    International Nuclear Information System (INIS)

    Siti Ramlah Ahmad Ali; Sakinah Safari; Mohd Shawal Thakib; Shamsilawani Ahamed Bakeri; Nur Aziemah Ab Ghani

    2016-01-01

    Fungi are principal decomposing microorganisms in acidic environment of peat lands. A useful tool for molecular screening of soil fungal communities using the 18S ribosomal DNA primer has been proven capable of identifying a broad range of fungi species within Ascomycota, Basidiomycota, Zygomycota and Chytridiomycota. Currently, very little information is available on fungal communities in deep peat of Sarawak, Malaysia. In this study, we have isolated the fungi from soil samples taken in deep peat forests and oil palm cultivated areas. The fungal identity was undertaken using 18S ribosomal DNA primer which is EF4-F/ fung5-R. The microscopic structures were conducted to confirm the identity of the isolates. Based on this study, the fungal division most commonly found in deep peat is the Ascomycota. Aspergillus fumigatus was the most common species and more dominant in oil palm cultivated areas and logged-over forest than in primary forest. In the primary forest, the dominant species was the A. flavus, while Hypocrea atroviridis was commonly associated with oil palm cultivated areas and logged-over forest. Other species of fungi isolated in peat primary forests were Penicillium chrysogenum, Trichoderma sp., Phanerochaete sp., Mortierella chlamydospora, A. niger, A. alliaceus, etc. The in-depth difference in the fungal communities for the different sites will be further investigated using the next generation sequencing technology. (author)

  4. Beyond hydrology in the sustainability assessment of dams: A planners perspective - The Sarawak experience

    Science.gov (United States)

    Andre, Edward

    2012-01-01

    SummaryThere is increasing concern about the availability of water supplies in developing countries to provide clean drinking water and sanitation as well as providing for irrigation for food security. This has led to hydrologically led investigation to establish the feasibility and storage capacity of potentially new dam sites. This task has become more difficult for hydrologists and others with the uncertainties created by climate change and the measurement of the hydrological, geographical and ecological footprint of new dams. The questions asked by hydrologists are increasingly likely to be required to be cast in terms of the four pillars of sustainability; environmental, economic, social and institutional. Similarly, regional planners have to be more cognisant of the social outcomes of dam development while understanding the wider hydrological context at a watershed and basin level. The paper defines the concept of sustainability assessment in the context of resettlement and analyses its implications for the Bakun Hydro-electric project in Sarawak, Malaysia. Specifically it attempts to address the question of what social sustainability would really mean in the context of communities affected by dam projects, and their catchments using hermeneutics, tradeoffs and offsets. The findings of this question were presented at a hydrological conference held in Santiago in October 2010, based on the outcome of specific questionnaire responses received from indigenous peoples affected by the Bakun Dam hydroelectric project. The paper also offers some insights pertaining to the social sustainability assessment aspects of dams and their catchments.

  5. Stable isotope stratigraphy and larger benthic foraminiferal extinctions in the Melinau Limestone, Sarawak

    Science.gov (United States)

    Cotton, Laura J.; Pearson, Paul N.; Renema, Willem

    2014-01-01

    Important long-ranging groups of larger benthic foraminifera (LBF) are known to have become extinct during a period of global cooling and climate disruption at the Eocene-Oligocene transition (EOT) but the precise timing and mechanisms are uncertain. Recent study showed unexpectedly that the LBF extinction in Tanzania occurs very close to the Eocene/Oligocene boundary, as recognised by the extinction of the planktonic foraminiferal Family Hantkeninidae, rather than at the later period of maximum global ice growth and sea-level fall, as previously thought. Here we investigate the same phase of extinction in the Melinau Limestone of Sarawak, on the island of Borneo, Malaysia one of the most complete carbonate successions spanning the Eocene to Lower Miocene. Assemblages of LBF from the Melinau Limestone were studied extensively by Geoffrey Adams during the 1960s-80s, confirming a major extinction during the EOT, but the section lacked independent means of correlation. By analysing rock samples originally studied by Adams and now in the Natural History Museum, London, we provide new bulk stable isotope (δ13C and δ18O) records. This enables us to identify, albeit tentatively, the level of maximum stable isotope excursion and show that the LBF extinction event in the Melinau Limestone occurs below this isotope excursion, supporting the results from Tanzania and indicating that the extinction of LBF close to the Eocene/Oligocene boundary may be a global phenomenon.

  6. Clustering and genetic differentiation of the normocyte binding protein (nbpxa) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia and Malaysia Borneo.

    Science.gov (United States)

    Ahmed, Md Atique; Fong, Mun Yik; Lau, Yee Ling; Yusof, Ruhani

    2016-04-26

    The zoonotic malaria parasite Plasmodium knowlesi has become an emerging threat to South East Asian countries particular in Malaysia. A recent study from Sarawak (Malaysian Borneo) discovered two distinct normocyte binding protein xa (Pknbpxa) types of P. knowlesi. In the present study, the Pknbpxa of clinical isolates from Peninsular Malaysia and Sabah (Malaysian Borneo) were investigated for the presence of Pknbpxa types and natural selection force acting on the gene. Blood samples were collected from 47 clinical samples from Peninsular Malaysia (n = 35) and Sabah (Malaysian Borneo, n = 12) were used in the study. The Pknbpxa gene was successfully amplified and directly sequenced from 38 of the samples (n = 31, Peninsular Malaysia and n = 7, Sabah, Malaysian Borneo). The Pknbpxa sequences of P. knowlesi isolates from Sarawak (Malaysian Borneo) were retrieved from GenBank and included in the analysis. Polymorphism, genetic diversity and natural selection of Pknbpxa sequences were analysed using DNAsp v 5.10, MEGA5. Phylogentics of Pknbpxa sequences was analysed using MrBayes v3.2 and Splits Tree v4.13.1. The pairwise F ST indices were used to determine the genetic differentiation between the Pknbpxa types and was calculated using Arlequin 3.5.1.3. Analyses of the sequences revealed Pknbpxa dimorphism throughout Malaysia indicating co-existence of the two types (Type-1 and Type-2) of Pknbpxa. More importantly, a third type (Type 3) closely related to Type 2 Pknbpxa was also detected. This third type was found only in the isolates originating from Peninsular Malaysia. Negative natural selection was observed, suggesting functional constrains within the Pknbpxa types. This study revealed the existence of three Pknbpxa types in Malaysia. Types 1 and 2 were found not only in Malaysian Borneo (Sarawak and Sabah) but also in Peninsular Malaysia. A third type which was specific only to samples originating from Peninsular Malaysia was discovered. Further genetic

  7. PREVALENCE OF SMOKING AMONG SECONDARY SCHOOL STUDENTS IN SARAWAK

    Directory of Open Access Journals (Sweden)

    IRYANI T

    2011-01-01

    Full Text Available Adolescent smoking is an emerging health concern in the developing countries. A cross-sectional study is conducted to determine the prevalence and smoking behaviour of adolescents in Sarawak. The prevalence of smoking is 32.8% with mean age of initiation at 12.8±1.9 years. Most (67.2% adolescents are experimental smokers and the majority (67.9% did not smoke on adaily basis. Branded cigarettes are preferred (83.1% and the cigarettes are obtained either from friends (49.1% or selfpurchased (43.6%. Students prefer to smoke at their friend’s house (31.0% or at school (25.3%. Smoking prevalence among adolescents in Sarawak is high and begins early. Early intervention on smoking prevention and risk awareness is perhaps more effective if initiated before the age of 12 years.

  8. Solar and wind energy utilization at Sarawak Southern national parks

    International Nuclear Information System (INIS)

    Abdul Rahman, N.; Kolot, A.

    2006-01-01

    The intentions of renewable energy utilization in Sarawak national parks were to reduce the environmental impacts to the protected surrounding and to overcome fuel transportation problem, as most national parks in Sarawak are not viable for the state electricity grid connection. The study was conducted at three national parks in southern Sarawak; viz. Samusan, Tanjung Datu and Pulau Talang-Talang Besar National Park. The study focused on the effectiveness of the system implementation, energy load and associated problems. Both Samusan and Tanjung Datu National systems are hybrids, which consist of solar photovoltaic panels, wind turbine and diesel generators, whereas, Pulau Talang-Talang Besar National Park is a stand alone system of solar photovoltaic panels only. In addition, the inefficient energy usage was observed at Samusan National Park. The study have identified that lack of local expertise, spare parts availability, transportation and inefficient energy management as the major problems associated to the solar and wind energy system in all national parks studied. Albeit the problems mentioned, the study discovered that the systems were acceptably reliable and satisfactorily supply fraction of the energy requirements to the national parks communities

  9. Tree Flora of Sabah and Sarawak project – progress and future activities

    NARCIS (Netherlands)

    Tan, H.S.; Nadiah, I.; Eryani, S.S.

    2009-01-01

    Tropical forests in Borneo (Brunei Darussalam, Kalimantan, Sabah and Sarawak) are considered as one of the twelve mega biodiversity centres in the world. However, until now, there is no up-to-date or complete documentation on the flora of the island. The Tree Flora of Sabah and Sarawak Project,

  10. The epidemiology and clinical spectrum of melioidosis in a teaching hospital in a North-Eastern state of Malaysia: a fifteen-year review.

    Science.gov (United States)

    Zueter, AbdelRahman; Yean, Chan Yean; Abumarzouq, Mahmoud; Rahman, Zaidah Abdul; Deris, Zakuan Z; Harun, Azian

    2016-07-16

    Over the last two decades, many epidemiological studies were performed to describe risks and clinical presentations of melioidosis in endemic countries. We performed a retrospective analysis of 158 confirmed cases of melioidosis collected from medical records from 2001 to 2015 in Hospital Universiti Sains Malaysia, Kubang Kerian, Kelantan, Malaysia, in order to update the current status of melioidosis clinical epidemiology in this putatively high risk region of the country. Principal presentations in patients were lung infection in 65 (41.1 %), skin infection in 44 (27.8 %), septic arthritis/osteomyelitis in 20 (12.7 %) and liver infection in 19 (12.0 %). Bacteremic melioidosis was seen in most of patients (n = 121, 76.6 %). Focal melioidosis was seen in 124 (78.5 %) of patients and multi-focal melioidosis was reported in 45 (28.5 %) cases. Melioidosis with no evident focus was in 34 (21.5 %) patients. Fifty-four (34.2 %) patients developed septic shock. Internal organ abscesses and secondary foci in lungs and/or soft tissue were common. A total of 67 (41 %) cases presented during the monsoonal wet season. Death due to melioidosis was reported in 52 (32.9 %) patients, while relapses were occurred in 11 (7.0 %). Twelve fatal melioidosis cases seen in this study were directly attributed to the absence of prompt acute-phase treatment. Predisposing risk factors were reported in most of patients (n = 133, 84.2 %) and included diabetes (74.7 %), immune disturbances (9.5 %), cancer (4.4 %) and chronic kidney disease (11.4 %). On multivariate analysis, the only independent predictors of mortality were the presence of at least one co-morbid factor (OR 3.0; 95 % CI 1.1-8.4), the happening of septic shock (OR 16.5; 95 % CI 6.1-44.9) and age > 40 years (OR 6.47; 95 % CI 1.7-23.8). Melioidosis should be recognized as an opportunistic nonfatal infection for healthy person. Prompt early diagnosis and appropriate antibiotics administration and

  11. Review of ear, nose and throat foreign bodies in Sarawak General Hospital. A five year experience.

    Science.gov (United States)

    Chiun, Kian Chai; Tang, Ing Ping; Tan, Tee Yong; Jong, Doris Evelyn Yah Hui

    2012-02-01

    Ear, nose and throat foreign bodies are common in ENT clinical practice. This study was designed to establish the local data of otorhinolaryngeal foreign bodies in term of prevalence among paediatric and adult groups, the clinical features, types of foreign body at different sites, and laterality of foreign bodies. This study was carried out at ENT department, Sarawak General Hospital, Malaysia, from 1st January 2005 to 31st December 2009. A total of 1084 cases were included and statistically analyzed. Ear foreign bodies showed the highest incidence which was consisted of 480 (44.3%) cases, followed by nose in 270 (24.9%) cases, pharynx in 251 (23.2%) cases, esophagus in 57 (5.3%) cases and laryngo-tracheobronchial tree in 26 (2.4%) cases. Otorhinolaryngeal foreign bodies occurred more frequently in 0-10 year old age group which constituted 651 (60.1%) cases. The descending order of frequency for foreign body sites in adult was pharynx (17.2%), ear (12.8%), esophagus (3.1%), nose (1.7%) and laryngo-tracheobronchial tree (1.1%). The type of foreign bodies varies with age group and site of foreign body lodgement. In general, common foreign bodies in both adult and children were food related, with the additional of small objects such as plastic toy in paediatric group. Otorhinolaryngeal foreign bodies were found more frequently in children. The types of foreign body were different from age group and sites of foreign body lodgement. The local food constituted the highest incidence of ear, nose, and throat foreign bodies with additional of plastic toys in paediatric group.

  12. Characteristic of root decomposition in a tropical rainforest in Sarawak, Malaysi

    Science.gov (United States)

    Ohashi, Mizue; Makita, Naoki; Katayam, Ayumi; Kume, Tomonori; Matsumoto, Kazuho; Khoon Kho, L.

    2016-04-01

    Woody roots play a significant role in forest carbon cycling, as up to 60 percent of tree photosynthetic production can be allocated to belowground. Root decay is one of the main processes of soil C dynamics and potentially relates to soil C sequestration. However, much less attention has been paid for root litter decomposition compared to the studies of leaf litter because roots are hidden from view. Previous studies have revealed that physico-chemical quality of roots, climate, and soil organisms affect root decomposition significantly. However, patterns and mechanisms of root decomposition are still poorly understood because of the high variability of root properties, field environment and potential decomposers. For example, root size would be a factor controlling decomposition rates, but general understanding of the difference between coarse and fine root decompositions is still lacking. Also, it is known that root decomposition is performed by soil animals, fungi and bacteria, but their relative importance is poorly understood. In this study, therefore, we aimed to characterize the root decomposition in a tropical rainforest in Sarawak, Malaysia, and clarify the impact of soil living organisms and root sizes on root litter decomposition. We buried soil cores with fine and coarse root litter bags in soil in Lambir Hills National Park. Three different types of soil cores that are covered by 1.5 cm plastic mesh, root-impermeable sheet (50um) and fungi-impermeable sheet (1um) were prepared. The soil cores were buried in February 2013 and collected 4 times, 134 days, 226 days, 786 days and 1151 days after the installation. We found that nearly 80 percent of the coarse root litter was decomposed after two years, whereas only 60 percent of the fine root litter was decomposed. Our results also showed significantly different ratio of decomposition between different cores, suggesting the different contribution of soil living organisms to decomposition process.

  13. Impacts of Horticultural Mineral Oils and Two Insecticide Practices on Population Fluctuation of Diaphorina citri and Spread of Huanglongbing in a Citrus Orchard in Sarawak

    Directory of Open Access Journals (Sweden)

    Stephen Chan Teck Leong

    2012-01-01

    Full Text Available Aspects of the incidence and spread of the citrus disease huanglongbing (HLB in relation to the vector Diaphorina citri population fluctuation were studied from January 1999 to December 2001 seasons in a 0.8 ha citrus orchard at Jemukan (1° 33′N, 110° 41′E, Southwest Sarawak in Malaysia. In relation to insecticide and horticultural mineral oils (HMOs use, levels of HLB infection rose quite rapidly over the next 3 years in the unsprayed control and less rapidly in the other treatments such as imidacloprid, nC24HMO, and triazophos/cypermethrin/chlorpyrifos. Levels of HLB as determined by Polymerase Chain Reaction (PCR were 42.2%, 9.4%, 11.4%, and 22.7%, respectively. The effects of nC24HMO and conventional pesticides on the citrus psyllid population and parasitoids in citrus orchard were also determined.

  14. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  15. Spotlight: Malaysia.

    Science.gov (United States)

    Patriquin, W

    1988-03-01

    Focus is on Malaysia -- its population and land area, its total fertility rate and mortality rate, economic development, contraceptive usage, and population policy. In 1987 Malaysia's population was estimated to be 16.1 million with births 31/1000 population and deaths 7/1000 population. The rate of natural increase is 2.4%, the total fertility rate 3.9 children/woman, and the infant mortality rate 30/1000 live births. Ethnically, Malaysia is made up of several distinct groups. Indigenous Malays are the most numerous -- about 50% of the population. Their unique characteristics include that they are Moslem, rural, and usually of lower economic status. Chinese make up the 2nd largest group of Malaysians, nearly 1/3 of the population. This group is active in trade, business, and finance and possesses considerable economic power. About 10% of the population is of Indian descent. Malaysia has experienced much economic growth. Traditional exports grew in volume and value during the 1970; the petroleum sector expanded so rapidly it accounts for 1/4 of all exports. One reason for Malaysia's rapid economic growth is the government's promotion of industrialization and foreign investment. According to the 1982 contraceptive prevalence survey, 42% of currently married women 15-44 years were using contraception. The government considers the current rate of national increase to be satisfactory, but in 1984 it adopted a population policy to more than quadruple its population in 2100 to 70 million. It intends to accomplish this by instituting pronatalist incentives to help the fall in the national growth rate. The government's rationale for more population growth is that a larger domestic population could better support industrial growth that otherwise might be stymied by "protectionist policies practiced by developed countries." Incentives to encourage fertility include income-tax deductions and maternity benefits for women who have up to 5 children.

  16. Trends and outlook of coal energy in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Zainal Abidin Husin (Tenaga Nasional Berhad, Kuala Lumpur (Malaysia). Fuel and Materials Management Dept.)

    1993-03-01

    Current energy policy in Malaysia is directed towards development of natural gas resources although there is a strategy to diversify energy sources to gas, hydro, coal and oil. By the year 2000, however, coal could emerge as a major energy source. The author advocates the need for a policy direction for the coal industry - for exploration, mine planning, mixing methods, transport and regulations to ensure occupational health and safety. Malaysia has abundant coal resources but most are in Sarawak and Sabah whereas the bulk of energy demand is in the Peninsula Malaysia. A table defines known coal resources in Malaysia and a map shows their location. To ensure successful development of the coal industry, technologies must be developed to meet environmental requirements and global market competition. Several emerging technologies are mentioned: production of process-derived fuel and coal-derived liquid from sub-bituminous coal, coal liquefaction, manufacture of coal water mixture, coal beneficiation, and fluidised bed combustion. 1 fig., 1 tab.

  17. Time series analysis of gold production in Malaysia

    Science.gov (United States)

    Muda, Nora; Hoon, Lee Yuen

    2012-05-01

    Gold is a soft, malleable, bright yellow metallic element and unaffected by air or most reagents. It is highly valued as an asset or investment commodity and is extensively used in jewellery, industrial application, dentistry and medical applications. In Malaysia, gold mining is limited in several areas such as Pahang, Kelantan, Terengganu, Johor and Sarawak. The main purpose of this case study is to obtain a suitable model for the production of gold in Malaysia. The model can also be used to predict the data of Malaysia's gold production in the future. Box-Jenkins time series method was used to perform time series analysis with the following steps: identification, estimation, diagnostic checking and forecasting. In addition, the accuracy of prediction is tested using mean absolute percentage error (MAPE). From the analysis, the ARIMA (3,1,1) model was found to be the best fitted model with MAPE equals to 3.704%, indicating the prediction is very accurate. Hence, this model can be used for forecasting. This study is expected to help the private and public sectors to understand the gold production scenario and later plan the gold mining activities in Malaysia.

  18. Drepanosticta adenani sp. nov., from the Lanjak Entimau Wildlife Sanctuary in Sarawak (Odonata: Zygoptera: Platystictidae).

    Science.gov (United States)

    Dow, Rory A; Reels, Graham T

    2018-02-15

    Drepanosticta adenani sp. nov. (holotype ♂, from a tributary of Sungai Jela, Nanga Segerak area, Lanjak Entimau Wildlife Sanctuary, Sri Aman Division, Sarawak, Malaysian Borneo, 18 vii 2016, deposited in the Natural History Museum, London) is described from both sexes.

  19. Towards understanding the low prevalence of Helicobacter pylori in Malays: genetic variants among Helicobacter pylori-negative ethnic Malays in the north-eastern region of Peninsular Malaysia and Han Chinese and South Indians.

    Science.gov (United States)

    Maran, Sathiya; Lee, Yeong Yeh; Xu, Shu Hua; Raj, Mahendra Sundramoorthy; Abdul Majid, Noorizan; Choo, Keng Ee; Zilfalil, Bin Alwi; Graham, David Y

    2013-04-01

    To identify gene polymorphisms that differ between Malays, Han Chinese and South Indians, and to identify candidate genes for the investigation of their role in protecting Malays from Helicobacter pylori (H. pylori) infection. Malay participants born and residing in Kelantan with a documented absence of H. pylori infection were studied. Venous blood was used for genotyping using the Affymetrix 50K Xba I kit. CEL files from 141 Han Chinese and 76 South Indians were analyzed to compare their allele frequency with that of the Malays using fixation index (FST ) calculation. The single nucleotide polymorphisms (SNPs) with the highest allele frequency (outliers) were then examined for their functional characteristics using F-SNP software and the Entrez Gene database. In all, 37 Malays were enrolled in the study; of whom 7 were excluded for low genotyping call rates. The average FST estimated from the genome-wide data were 0.038 (Malays in Kelantan vs the South Indians), 0.015 (Malays in Kelantan vs Han Chinese) and 0.066 (Han Chinese vs South Indians), respectively. The outlier gene variants present in Malays with functional characteristics were C7orf10 (FST  0.29988), TSTD2 (FST  0.43278), SMG7 (FST  0.29877) and XPA (FST  0.43393 and 0.43644). Genetic variants possibly related to protection against H. pylori infection in ethnic Malays from the north-eastern region of Peninsular Malaysia were identified for testing in subsequent trials among infected and uninfected Malays. © 2012 The Authors. Journal of Digestive Diseases © 2012 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  20. Research for the development of sago palm (Metroxylon sagu Rottb.) cultivation in Sarawak, Malaysia

    NARCIS (Netherlands)

    Jong, F.S.

    1995-01-01

    General introduction (Chapter 1)

    This chapter contains an overview of knowledge with respect to the cultivation of the true sago palm (Metroxylon sagu). The palm flowers once and forms suckers or tillers. Seedlings grow into a rosette stage of leaves

  1. Towards Homogeneity in Home Languages: Malay, Chinese Foochow and Indian Tamil Families in Kuching, Sarawak, Malaysia

    Science.gov (United States)

    Ting, Su-Hie; Mahadhir, Mahanita

    2009-01-01

    This preliminary study examines the languages used by parents with their children in Malay, Chinese Foochow and Indian Tamil families to find out how the similarity or dissimilarity in parents' ethnic language influenced the choice of language transmitted to children and how far standard languages have permeated the family domain in Kuching City…

  2. Preliminary findings on lifetime trauma prevalence and PTSD symptoms among adolescents in Sarawak Malaysia.

    Science.gov (United States)

    Ghazali, Siti Raudzah; Elklit, Ask; Balang, Rekaya Vincent; Sultan, M Ameenudeen; Kana, Kamarudin

    2014-10-01

    The objective of this study is to determine the prevalence of lifetime exposure to traumatic events and its relation to PTSD symptoms. Participants were randomly selected from several schools located in the city of Kuching. There were 85 adolescents participating in this study, with ages ranging from 13 to 14 years old, of whom 31% (n=26) were males and 69% (n=59) females. The Child Posttraumatic Stress Index-Revised, The Harvard Trauma Questionnaire and a lifetime trauma checklist were used in this study. Results showed that 77.6% of participants were exposed to at least one lifetime trauma. The most frequently reported traumas were road accident (20.1%), death of a family member (19.7%), and almost drowning (10%). There was more indirect trauma than direct trauma exposure. Males were more likely to be involved in traumatic events than females. Results showed that 7.1% (6) exhibited PTSD symptoms. There was no significant difference in the mean score of CPTS-RI between genders and among ethnic groups. Total exposure to traumatic events was significantly correlated with PTSD symptoms. Findings suggest that number of lifetime traumatic events was quite high and multiple exposures to traumatic events were significantly related to PTSD symptoms. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Ohcratoxin producing Aspergillus spp. Isolated from tropical soils in Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    J.S.S. Seelan

    2010-03-01

    Full Text Available Aspergillus strains isolated from tropical soils were selected for additional characterization and for ochratoxin analysis, which was determined by ELISA method and high performance liquid chromatography (HPLC profiles. Because of its great morphological variability and mycotoxin production availability, 18 isolates of Aspergillus species were selected for this study. Only two isolates of these tropical soils, A. sulphureus and A. carbonarius, showed positive results for ohcratoxin (OA in lower concentration (0.05-0.10 µg/ml. Ochratoxin production by these species was confirmed by high performance liquid chromatography. HPLC analysis for ochratoxin producing A. sulphureus and A. carbonarius showed retention time, Rt value = 4.417 and Rt value = 4.081 respectively.

  4. The Impacts of Personal Qualities on Online Learning Readiness at Curtin Sarawak Malaysia (CSM)

    Science.gov (United States)

    Lau, Chun Yun; Shaikh, Junaid M.

    2012-01-01

    Nowadays many educational institutions have embraced online education to cater for flexible and student-centered learning. Through online education, students have an opportunity to gain education at their own convenience, in terms of time and place. However, it is argued that students are less satisfied with online learning than with traditional…

  5. Nutrient Contents of the Freshwater Crab, Isolapotamon bauense from Sarawak, Malaysia (Borneo).

    Science.gov (United States)

    Grinang, Jongkar; Tyan, Pang Sing; Tuen, Andrew Alek; Das, Indraneil

    2017-07-01

    Data on nutrient contents of freshwater crabs are important for ecological studies and species conservation assessments, especially when the species concerned is threatened among others by habitat destruction and uncontrolled resources utilisation. Indeed comprehensive biological information is required to reconcile the needs between sustainable resources utilisation and conservation of the species. This study documents the nutrient contents of a freshwater crab, Isolapotamon bauense which is listed as 'Vulnerable' in the IUCN Red List of Threatened Species and also being harvested by local community for dietary supplement. Results show that muscles of the freshwater crab contain a substantial amount of nutrients in particular water content (male = 79.31 ± 2.30 %, female = 77.63 ± 0.56 %), protein (male = 77.47 ± 6.11 %, female = 63.28 ± 3.62 %), magnesium (male = 51.48 ± 16.10 mg/g, female = 39.73 ± 6.99 mg/g) and calcium (male = 25.50 ± 6.98 mg/g, female = 39.73 ± 6.99 mg/g). Means of nutrient contents between male and female crabs are not significantly different. It is estimated that an individual of I. bauense with weight range of 56-139 g contained on average of 0.35 ± 0.15 g of protein. Our estimation also shows that the number of individuals of the freshwater crab required to meet the recommended daily protein intakes of the community concerned is in the range 35-96 individuals for children, 130-188 individuals for adolescents, 171-179 individuals for men and 149-159 individuals for women. The results imply that harvesting of wild I. bauense as a source of protein supplement naturally may not be practical because of its relatively low population abundance, and conservation of the species for its ecological roles may thus be preferred.

  6. Informal heritage-making at the Sarawak Cultural Village, East Malaysia

    NARCIS (Netherlands)

    Muzaini, Hamzah

    2017-01-01

    Scholars have always been fascinated with cultural theme parks as tourism attractions or as vehicles for identity formations. With respect to the latter, the focus has been on how these consumption landscapes also portend spaces of representation that mobilize certain attributes of ethnic groups

  7. Negotiating development narratives within large-scale oil palm projects on village lands in Sarawak, Malaysia

    DEFF Research Database (Denmark)

    Andersen, Astrid Oberborbeck; Bruun, Thilde Bech; Egay, Kelvin

    2016-01-01

    the narratives that suggest that large-scale land development projects ‘bring development to the people’, utilising ‘idle lands’ and ‘creating employment’ to lift them out of poverty, we argue that political and economic processes related to cultivation of oil palm intersect with local community differences...

  8. KELAS MENENGAH, UMNO DAN INTELIGENSIA: TENTANGAN DOMINASI POLITIK BUMIPUTERA ISLAM DI SARAWAK (MIDDLE CLASS, UMNO AND INTELLIGENTSIA: CONTESTING THE MUSLIM BUMIPUTERA'S POLITICAL DOMINATION IN SARAWAK

    Directory of Open Access Journals (Sweden)

    Faisal S. Hazis

    2011-01-01

    Full Text Available Barisan Nasional mulai mendominasi politik Sarawak setelah pemimpin bumiputera Islam mengambil alih tampuk pemerintahan negeri daripada pemimpin Iban selepas pilihan raya 1970. Di bawah teraju pemimpin bumiputera Islam ini, Barisan Nasional berjaya menguasai setiap pilihan raya negeri dan parlimen yang diadakan sejak tahun 1970 hingga 2008. Walaupun parti pembangkang melancarkan tentangan sengit pada lewat 1970-an dan pertengahan 1980-an, pemimpin bumiputera Islam ini berjaya mengatasinya untuk terus mengekalkan dominasi parti pemerintah di negeri yang mempunyai bilangan kerusi negeri dan parlimen yang terbanyak. Makalah ini menyusuri dominasi politik pemimpin bumiputera Islam Sarawak dan faktor-faktor yang menyumbang kepada kekuatan mereka yang menjangkau lebih empat dekad. Walaupun kuasa politik pemimpin bumiputera Islam masih bertahan sehingga ke hari ini, beberapa sumber baharu mulai muncul untuk memberikan tentangan terhadap kuasa politik golongan minoriti ini. Sumber tentangan baharu yang dimaksudkan ialah golongan kelas menengah, United Malays National Organisation (UMNO dan inteligensia. Makalah ini mengupas tentangan yang diberikan kelompok ini dan impaknya terhadap politik Sarawak khususnya kepimpinan bumiputera Islam.The ruling Barisan Nasional started to dominate Sarawak politics after the Muslim bumiputera took over the state leadership from the Iban after the 1970 elections. Under the stewardship of the Muslim bumiputera, Barisan Nasional had successfully dominated every state and parliamentary elections held since 1970 to 2008. Although the opposition parties launched a strong challenge towards the Muslim bumiputera's dominance in the late 1970s and middle 1980s, the latter was able to fend off this challenge and continued to uphold the ruling party's grip on the state with the largest number of state and parliamentary seats. This article analyses the Muslim bumiputera's dominance in Sarawak politics and the factors that had

  9. A sociological examination of international placement learning by British social work students in children’s services in Malaysia

    Directory of Open Access Journals (Sweden)

    Sara Ashencaen Crabtree

    2014-06-01

    Full Text Available This paper discusses research findings into a study of UK student learning on international social work placements in Malaysia in collaboration with two Malaysian universities: Universiti Sains Malaysia and Universiti Malaysia Sarawak. The discussion focuses on those placements taking place in children’s services: residential care and community-based support programmes. The aim of the study was to explore how social work students adapt to unfamiliar learning situations in new cultural contexts with the goal of increasing cultural competence. Data were drawn from formal but anonymised student learning exercises as a non-assessed requirement of this particular placement. Findings indicated a wide range of responses towards social work practice with vulnerable children in the Malaysian context in terms of student constructions of care and abuse. Subject to an analytical schema, the collision or adaptation of otherwise normative professional and personal values are examined in detail.

  10. Optimal configuration assessment of renewable energy in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Haidar, Ahmed M.A.; John, Priscilla N.; Shawal, Mohd [Faculty of Electrical and Electronics Engineering, University Malaysia Pahang, Lebuhraya Tun Razak, 26300 Gambang, Pahang (Malaysia)

    2011-02-15

    This paper proposes the use of a PV-wind-diesel generator hybrid system in order to determine the optimal configuration of renewable energy in Malaysia and to compare the production cost of solar and wind power with its annual yield relevant to different regions in Malaysia namely, Johor, Sarawak, Penang and Selangor. The configuration of optimal hybrid system is selected based on the best components and sizing with appropriate operating strategy to provide a cheap, efficient, reliable and cost-effective system. The various renewable energy sources and their applicability in terms of cost and performance are analyzed. Moreover, the annual yield and cost of energy production of solar and wind energy are evaluated. The Simulations were carried out using the HOMER program based on data obtained from the Malaysian Meteorological Centre. Results show that, for Malaysia, a PV-diesel generator hybrid system is the most suitable solution in terms of economic performance and pollution. However, the cost of production of solar and wind energy proved to be cheaper and more environmentally friendly than the energy produced from diesel generators. (author)

  11. Climate Based Predictability of Oil Palm Tree Yield in Malaysia.

    Science.gov (United States)

    Oettli, Pascal; Behera, Swadhin K; Yamagata, Toshio

    2018-02-02

    The influence of local conditions and remote climate modes on the interannual variability of oil palm fresh fruit bunches (FFB) total yields in Malaysia and two major regions (Peninsular Malaysia and Sabah/Sarawak) is explored. On a country scale, the state of sea-surface temperatures (SST) in the tropical Pacific Ocean during the previous boreal winter is found to influence the regional climate. When El Niño occurs in the Pacific Ocean, rainfall in Malaysia reduces but air temperature increases, generating a high level of water stress for palm trees. As a result, the yearly production of FFB becomes lower than that of a normal year since the water stress during the boreal spring has an important impact on the total annual yields of FFB. Conversely, La Niña sets favorable conditions for palm trees to produce more FFB by reducing chances of water stress risk. The region of the Leeuwin current also seems to play a secondary role through the Ningaloo Niño/ Niña in the interannual variability of FFB yields. Based on these findings, a linear model is constructed and its ability to reproduce the interannual signal is assessed. This model has shown some skills in predicting the total FFB yield.

  12. Fluvial organic carbon losses from oil palm plantations on tropical peat, Sarawak, Southeast Asia

    Science.gov (United States)

    Cook, Sarah; Page, Susan; Evans, Chris; Whelan, Mick; Gauci, Vincent; Lip Khoon, Kho

    2017-04-01

    Tropical peatlands are valuable stores of carbon. However, tropical peat swamp forests (TPSFs) in Southeast Asia have increasingly been converted to other land-uses. For example, more than 25% of TPSFs are now under oil palm plantations. This conversion - requiring felling and burning of trees and drainage of the peat - can enhance carbon mineralization, dissolved organic carbon (DOC) losses and can contribute significantly to global anthropogenic greenhouse gas emissions, changing these natural carbon sinks into carbon sources. At present, relatively few scientifically sound studies provide dependable estimates of gaseous and fluvial carbon losses from oil palm plantations or from drained tropical peat in general. Here we present an annual (54 week) estimate of the export of dissolved and particulate organic carbon in water draining two oil palm estates and nearby stands of TPSF in Sarawak, Malaysia, subjected to varying degrees of past anthropogenic disturbance. Spectrophotometric techniques including SUVA254 (Specific Ultra-Violet Absorption) were used to gain insight into the aromaticity and subsequent bioavailability of the exported DOC. Water draining plantation and deforested land had a higher proportion of labile carbon compared to water draining forested areas. Preliminary data suggest a total fluvial DOC flux from plantations of ca. 190 g C m-2 year-1; nearly three times estimates from intact TPSFs (63 g C m-2 year-1). DOC accounted for between 86 % - 94 % of the total organic carbon lost (most of which was bioavailable). Wit et al. (2015) estimates that an average of 53 % of peat-derived DOC is decomposed and emitted as CO2, on a monthly basis. Based on these estimates our data suggests an additional 101 g CO2 m-2 may be emitted indirectly from fluvial organic carbon in degraded TPSFs per year. Overall, these findings emphasize the importance of including fluvial organic carbon fluxes when quantifying the impact of anthropogenic disturbance on the

  13. A Survey on the Usage of Biomass Wastes from Palm Oil Mills on Sustainable Development of Oil Palm Plantations in Sarawak

    Science.gov (United States)

    Phang, K. Y.; Lau, S. W.

    2017-06-01

    As one of the world’s largest palm oil producers and exporters, Malaysia is committed to sustainable management of this industry to address the emerging environmental challenges. This descriptive study aims to evaluate the oil palm planters’ opinions regarding the usage of biomass wastes from palm oil mills and its impact on sustainable development of oil palm plantations in Sarawak. 253 planters across Sarawak were approached for their opinions about the usage of empty fruit bunch (EFB), palm oil mill effluent (POME), mesocarp fibre (MF), and palm kernel shell (PKS). This study revealed that the planters had generally higher agreement on the beneficial application of EFB and POME in oil palm plantations. This could be seen from the higher means of agreement rating of 3.64 - 4.22 for EFB and POME, compared with the rating of 3.19 - 3.41 for MF and PKS in the 5-point Likert scale (with 5 being the strongest agreement). Besides, 94.7 percent of the planters’ companies were found to comply with the Environmental Impact Assessment (EIA) requirements where nearly 38 percent carried out the EIA practice twice a year. Therefore high means of agreement were correlated to the compliance of environmental regulations, recording a Likert rating of 3.89 to 4.31. Lastly, the usage of EFB and POME also gained higher Likert scale point of 3.76 to 4.17 against MF and PKS of 3.34 to 3.49 in the evaluation of the impact of sustainability in oil palm plantations. The planters agreed that the usage of EFB and POME has reduced the environmental impact and improved the sustainable development, and its application has been improved and increased by research and development. However the planters were uncertain of the impact of usage of biomass wastes with respect to the contribution to social responsibility and company image in terms of transparency in waste management.

  14. Distribution and origin sources of Polycyclic Aromatic Hydrocarbons (PAHs) pollution in sediment of Sarawak coastal area

    International Nuclear Information System (INIS)

    Mohd Shuhaimi Elias; Abdul Khalik Wood; Zaleha Hashim; Mohd Suhaimi Hamzah; Shamsiah Abdul Rahman; Nazaratul Ashifa Abdullah Salim

    2010-01-01

    Alkyl and parent Polycyclic Aromatic Hydrocarbons (PAHs) compounds in marine sediment sample collected from ten locations along Sarawak coastal areas were extracted and analyzed by using gas chromatography-mass spectrometry. The source identification of PAH pollution in marine sediment of Sarawak coastal areas were identify by ratios technique of An/ An+phen, Fl/ Fl +Py, B[a]A/ (B[a]A+Chry) and total Methyl Phen/ Phen. The total alkyl and parent PAHs concentration varies from 36.5 - 277.4 ng/ g dry weight (d.w.) with a mean concentration of 138.2 ng/ g d.w. The ratio values of PAHs pollution in marine sediment of Sarawak coastal areas are clearly indicating the PAHs pollutions are originated from petroleum (petrogenic) and petroleum combustion (pyrolytic). However, the origin sources of PAHs pollution in a few stations were uncertain due to mixing sources of PAHs. (author)

  15. The supportive care needs for prostate cancer patients in Sarawak.

    Science.gov (United States)

    Cheah, Whye Lian; Ling, Ngok Chuo; Chang, Kam Hock

    2016-02-01

    This cross-sectional study aimed to determine the prevalence of unmet supportive care needs among prostate cancer patients. The cross-sectional study was conducted among all prostate cancer patients at the Sarawak General Hospital. Interview was done using the Supportive Care Needs Survey-Short Form (SCNS-SF) and the Health Service Utilization Questionnaires (HSUQ). Data were analysed using Statistical Package for the Social Sciences (SPSS) 20. A total of ninety-five patients participated, with majority were aged 65 and above and of primary educational level. The two most frequently reported unmet supportive care needs were "informed about cancer which is under control or diminishing" and "informed about things you can do to help yourself to get well" under the domain Health System and Information. Respondents who were older (65 years and above) had significant lower unmet needs in psychology (P<0.01), and sexuality compared to the younger group below 65 years (P<0.01). Except for physical and daily living, respondents with primary school level had significant lower unmet needs in all domains compared to secondary school level. Respondents with known stages of cancer had higher unmet needs in all domains compared to those who did not know. Healthcare providers should provide more responsive, emotionally sensitive and client-centered care to patients with prostate cancer, particularly in the area of Health System and Information, and psychological support.

  16. Terrestrial Gamma Radiation Dose Rate of West Sarawak

    Science.gov (United States)

    Izham, A.; Ramli, A. T.; Saridan Wan Hassan, W. M.; Idris, H. N.; Basri, N. A.

    2017-10-01

    A study of terrestrial gamma radiation (TGR) dose rate was conducted in west of Sarawak, covering Kuching, Samarahan, Serian, Sri Aman, and Betong divisions to construct a baseline TGR dose rate level data of the areas. The total area covered was 20,259.2 km2, where in-situ measurements of TGR dose rate were taken using NaI(Tl) scintillation detector Ludlum 19 micro R meter NaI(Tl) approximately 1 meter above ground level. Twenty-nine soil samples were taken across the 5 divisions covering 26 pairings of 9 geological formations and 7 soil types. A hyperpure Germanium detector was then used to find the samples' 238U, 232Th, and 40K radionuclides concentrations producing a correction factor Cf = 0.544. A total of239 measured data were corrected with Cf resulting in a mean Dm of 47 ± 1 nGy h-1, with a range between 5 nGy h-1 - 103 nGy h-1. A multiple regression analysis was conducted between geological means and soil types means against the corrected TGR dose rate Dm, generating Dg,s= 0.847Dg+ 0.637Ds- 22.313 prediction model with a normalized Beta equation of Dg,s= 0.605Dg+ 0.395Ds. The model has an 84.6% acceptance of Whitney- Mann test null hypothesis when tested against the corrected TGR dose rates.

  17. Diversity in Education Using Blended Learning in Sarawak

    Science.gov (United States)

    Ling, Siew-Eng; Ariffin, Siti Rahayah Bt; Rahman, Saemah Bt; Lai, Kim-Leong

    2010-01-01

    One of the objectives of Malaysia Ministry of Education is to provide educational opportunities for all Malaysians. Are education opportunities given fairly to all Malaysians who come from two big regions and divided by the South China Sea? The web infancy era, where the World Wide Web (WWW) is blooming fast, has changed the new millennium…

  18. Situation Report--Hong Kong, Malawi, Pakistan, Panama, Philippines, Ryukyu Islands (Okinawa), Sabah, Sarawak.

    Science.gov (United States)

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in eight foreign countries are presented in these situation reports. Countries included are Hong Kong, Malawi, Pakistan, Panama, Philippines, Ryukyu Islands (Okinawa), Sabah, and Sarawak. Information is provided where appropriate and available, under two topics, general background and family planning…

  19. Extreme differences in forest degradation in Borneo: comparing practices in Sarawak, Sabah, and Brunei.

    Directory of Open Access Journals (Sweden)

    Jane E Bryan

    Full Text Available The Malaysian states of Sabah and Sarawak are global hotspots of forest loss and degradation due to timber and oil palm industries; however, the rates and patterns of change have remained poorly measured by conventional field or satellite approaches. Using 30 m resolution optical imagery acquired since 1990, forest cover and logging roads were mapped throughout Malaysian Borneo and Brunei using the Carnegie Landsat Analysis System. We uncovered ∼364,000 km of roads constructed through the forests of this region. We estimated that in 2009 there were at most 45,400 km(2 of intact forest ecosystems in Malaysian Borneo and Brunei. Critically, we found that nearly 80% of the land surface of Sabah and Sarawak was impacted by previously undocumented, high-impact logging or clearing operations from 1990 to 2009. This contrasted strongly with neighbouring Brunei, where 54% of the land area remained covered by unlogged forest. Overall, only 8% and 3% of land area in Sabah and Sarawak, respectively, was covered by intact forests under designated protected areas. Our assessment shows that very few forest ecosystems remain intact in Sabah or Sarawak, but that Brunei, by largely excluding industrial logging from its borders, has been comparatively successful in protecting its forests.

  20. Foliar diagnosis, nutrition and yield stability of black pepper (Piper nigrum L.) in Sarawak

    NARCIS (Netherlands)

    Waard, de P.W.F.

    1969-01-01

    Until 1942 cultivation of pepper P. nigrum L. in Sarawak produced relatively small but regular yields. High demands after 1945 and restricted use of "burnt earth" compelled farmers to abandon the application of this traditional fertilizer. Instead, "fool proof" manufactured fertilizers

  1. The ecology and forest types of the peat swamp forests of Sarawak and Brunei

    NARCIS (Netherlands)

    Anderson, J.A.R.

    1961-01-01

    The following is an author’s summary of the (as yet unpublished) thesis by Dr. J.A.R. Anderson of Kuching, Sarawak (see III. Personal news). Both the author and botanical science are to be congratulated with the completion of this important work, which we hope before long to see in print. The thesis

  2. A new cavernicolous freshwater crab, Thelphusula styx sp. nov. (Crustacea: Decapoda: Brachyura: Gecarcinucidae), from Gunong Mulu, Sarawak, Borneo

    NARCIS (Netherlands)

    Ng, P.K.L.

    1989-01-01

    A new species of gecarcinucid freshwater crab, Thelphusula styx spec. nov., is described from Gunong Mulu National Park in Sarawak, Borneo. This is the third species of Thelphusula reported from the area.

  3. Standardized morbidity ratio for leptospirosis mapping in Malaysia

    Science.gov (United States)

    Awang, Aznida Che; Samat, Nor Azah

    2017-05-01

    Leptospirosis is a worldwide zoonotic disease that affects human health in many parts of the world including Malaysia. Leptospirosis is a disease caused by the infection of pathogenic Leptospira genus called Spirochaetes. Leptospirosis can be transmitted directly or indirectly from rats to human. The human infection is usually caused by human contact with urine or tissues of infected animal. This disease can be spread through mucus membrane such as mouth, nose and eyes, ingestion of contaminated food and water and also exposed injured skin to contaminated water or soil. There is still no vaccine currently available for the prevention or treatment of leptospirosis disease but this disease can be treated if it is diagnosed early. Therefore, the aim of this study is to estimate the relative risk for leptospirosis disease based initially on the most common statistic used in the study of disease mapping called Standardized Morbidity Ratio (SMR). We then apply SMR to leptospirosis data obtained in Malaysia. The results show that the states of Melaka have very high risk areas. The states of Kedah, Terengganu and Kelantan are identified as high risk areas. The states of Perak, Perlis, Sabah and Sarawak showed medium risk areas. This is followed by low risk by other states except Pahang, Johor and Labuan with very low risk areas. In conclusion, SMR method is the best method for mapping leptospirosis because by referring to the relative risk maps, the states that deserve closer look and disease prevention can be identified.

  4. Modeling of Flood Mitigation Structures for Sarawak River Sub-basin Using Info Works River Simulation (RS)

    OpenAIRE

    Rosmina Bustami; Charles Bong; Darrien Mah; Afnie Hamzah; Marina Patrick

    2009-01-01

    The distressing flood scenarios that occur in recent years at the surrounding areas of Sarawak River have left damages of properties and indirectly caused disruptions of productive activities. This study is meant to reconstruct a 100-year flood event that took place in this river basin. Sarawak River Subbasin was chosen and modeled using the one-dimensional hydrodynamic modeling approach using InfoWorks River Simulation (RS), in combination with Geographical Information S...

  5. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  6. Impact of socio-economic class on colorectal cancer patient outcomes in Kuala Lumpur and Kuching, Malaysia.

    Science.gov (United States)

    Kong, Chee-Kwan; Roslani, April Camilla; Law, Chee-Wei; Law, Suk-Chin Diana; Arumugam, Kulenthran

    2010-01-01

    Research over the past several decades has indicated that low socioeconomic class has a direct effect on health outcomes. In Malaysia, class distribution may differ with the region. The objective of this study was to compare the presentation and survival of colorectal cancer patients in two dissimilar cities, Kuala Lumpur and Kuching, Sarawak. All patients diagnosed with a malignancy of the colon or rectum in Sarawak General Hospital and University of Malaya Medical Center from 1st Jan 2000-31st Dec 2006 were recruited. Data on presentation, socio-economic class and survival were obtained. The survival duration was categorized into more than three years or three years and less. Testing for significance was performed using the chi-square test, with p values less than 0.05 considered statistically significant. A total of 565 patients in UMMC and 642 patients in SGH had a new diagnosis of colorectal carcinoma. Patients in Kuching had a longer duration of symptoms and more advanced stage at presentation, but this was not statistically significant. Lower socio-economic class was a significant factor for late and more advanced stage at diagnosis, as well as poorer three and five year survival rates. However, survival was lower for patients in Kuching compared to Kuala Lumpur, even after matching for socio-economic class. There is near-zero awareness of colorectal cancer screening in Malaysia. These findings support reaching out to communities of lower socioeconomic backgrounds to improve the colorectal cancer survival rates.

  7. Competition Law In Malaysia

    OpenAIRE

    Hussein, Safinaz Mohd

    2012-01-01

    Meningkatnya kesadaran akan pentingnya persaingan usaha menimbulkan munculnya regulasi tertentu di tingkat nasional dan hal inilah yang terjadi di Malaysia, yakni dengan berlakunya Undang-Undang Persaingan Usaha Malaysia 2010. Disahkannya hukum persaingan umum seperti Undang-Undang Persaingan Usaha Malaysia 2010 pasti akan berdampak pada undang-undang sektoral seperti ketentuan dalam Peraturan Ekonomi CMA 1998. Biasanya hukum persaingan usaha memang di atas undangundang sektoral, kecuali j...

  8. A new species of Alphonsea (Annonaceae) from Peninsular Malaysia

    NARCIS (Netherlands)

    Turner, I.M.; Utteridge, T.M.A.

    2015-01-01

    Alphonsea rugosa sp. nov. is described from eastern Peninsular Malaysia. It is similar to Alphonsea elliptica but has fruits that are dry wrinkled and glabrous rather than smooth and tomentose. A conservation assessment of Vulnerable based on collections from four locations is made.

  9. Burkholderia pseudomallei isolates from Sarawak, Malaysian Borneo, are predominantly susceptible to aminoglycosides and macrolides.

    Science.gov (United States)

    Podin, Yuwana; Sarovich, Derek S; Price, Erin P; Kaestli, Mirjam; Mayo, Mark; Hii, KingChing; Ngian, Hieung; Wong, SeeChang; Wong, IngTien; Wong, JinShyan; Mohan, Anand; Ooi, MongHow; Fam, TemLom; Wong, Jack; Tuanyok, Apichai; Keim, Paul; Giffard, Philip M; Currie, Bart J

    2014-01-01

    Melioidosis is a potentially fatal disease caused by the saprophytic bacterium Burkholderia pseudomallei. Resistance to gentamicin is generally a hallmark of B. pseudomallei, and gentamicin is a selective agent in media used for diagnosis of melioidosis. In this study, we determined the prevalence and mechanism of gentamicin susceptibility found in B. pseudomallei isolates from Sarawak, Malaysian Borneo. We performed multilocus sequence typing and antibiotic susceptibility testing on 44 B. pseudomallei clinical isolates from melioidosis patients in Sarawak district hospitals. Whole-genome sequencing was used to identify the mechanism of gentamicin susceptibility. A novel allelic-specific PCR was designed to differentiate gentamicin-sensitive isolates from wild-type B. pseudomallei. A reversion assay was performed to confirm the involvement of this mechanism in gentamicin susceptibility. A substantial proportion (86%) of B. pseudomallei clinical isolates in Sarawak, Malaysian Borneo, were found to be susceptible to the aminoglycoside gentamicin, a rare occurrence in other regions where B. pseudomallei is endemic. Gentamicin sensitivity was restricted to genetically related strains belonging to sequence type 881 or its single-locus variant, sequence type 997. Whole-genome sequencing identified a novel nonsynonymous mutation within amrB, encoding an essential component of the AmrAB-OprA multidrug efflux pump. We confirmed the role of this mutation in conferring aminoglycoside and macrolide sensitivity by reversion of this mutation to the wild-type sequence. Our study demonstrates that alternative B. pseudomallei selective media without gentamicin are needed for accurate melioidosis laboratory diagnosis in Sarawak. This finding may also have implications for environmental sampling of other locations to test for B. pseudomallei endemicity.

  10. Une Cyathura cavernicole nouvelle de Sarawak – Kalimantan du Nord (Isopoda, Anthuridae)

    NARCIS (Netherlands)

    Andreev, Stoitze

    1982-01-01

    A l’occasion d’une expédition spéléologique effectuée en 1978 à Sarawak et organisée par la Royal Geographical Society, le biospéléologue anglais Dr. Ph. Chapman a recueilli quelques exemplaires d’un Isopode des eaux douces souterraines, appartenant à une nouvelle espèce du genre Cyathura. La

  11. The Headmaster-as-a-mentor: a Mentoring Model for Rural Primary School of Sarawak

    OpenAIRE

    Tuah, Adi Badiozaman

    2015-01-01

    : This paper attempts to present an alternative approach to training and improving the quality of teachers serving in rural schools of Sarawak. Based on the understanding that teacher training places are quite limited and that there are limited opportunities for meaningful interaction between school personnel and the central office or the teacher training institutions, it is argued that the overall quality of the teaching learning processes can be achieved through a systematic and properly st...

  12. Malaysia and forced migration

    Directory of Open Access Journals (Sweden)

    Arzura Idris

    2012-06-01

    Full Text Available This paper analyzes the phenomenon of “forced migration” in Malaysia. It examines the nature of forced migration, the challenges faced by Malaysia, the policy responses and their impact on the country and upon the forced migrants. It considers forced migration as an event hosting multifaceted issues related and relevant to forced migrants and suggests that Malaysia has been preoccupied with the issue of forced migration movements. This is largely seen in various responses invoked from Malaysia due to “south-south forced migration movements.” These responses are, however, inadequate in terms of commitment to the international refugee regime. While Malaysia did respond to economic and migration challenges, the paper asserts that such efforts are futile if she ignores issues critical to forced migrants.

  13. Abundance and distribution of sylvatic dengue virus vectors in three different land cover types in Sarawak, Malaysian Borneo.

    Science.gov (United States)

    Young, Katherine I; Mundis, Stephanie; Widen, Steven G; Wood, Thomas G; Tesh, Robert B; Cardosa, Jane; Vasilakis, Nikos; Perera, David; Hanley, Kathryn A

    2017-08-31

    Mosquito-borne dengue virus (DENV) is maintained in a sylvatic, enzootic cycle of transmission between canopy-dwelling non-human primates and Aedes mosquitoes in Borneo. Sylvatic DENV can spill over into humans living in proximity to forest foci of transmission, in some cases resulting in severe dengue disease. The most likely vectors of such spillover (bridge vectors) in Borneo are Ae. albopictus and Ae. niveus. Borneo is currently experiencing extensive forest clearance. To gauge the effect of this change in forest cover on the likelihood of sylvatic DENV spillover, it is first necessary to characterize the distribution of bridge vectors in different land cover types. In the current study, we hypothesized that Ae. niveus and Ae. albopictus would show significantly different distributions in different land cover types; specifically, we predicted that Ae. niveus would be most abundant in forests whereas Ae. albopictus would have a more even distribution in the landscape. Mosquitoes were collected from a total of 15 sites using gravid traps and a backpack aspirator around Kampong Puruh Karu, Sarawak, Malaysian Borneo, where sylvatic DENV spillover has been documented. A total of 2447 mosquitoes comprising 10 genera and 4 species of Aedes, were collected over the three years, 2013, 2014 and 2016, in the three major land cover types in the area, homestead, agriculture and forest. Mosquitoes were identified morphologically, pooled by species and gender, homogenized, and subject to DNA barcoding of each Aedes species and to arbovirus screening. As predicted, Ae. niveus was found almost exclusively in forests whereas Ae. albopictus was collected in all land cover types. Aedes albopictus was significantly (P = 0.04) more abundant in agricultural fields than forests. Sylvatic DENV was not detected in any Aedes mosquito pools, however genomes of 14 viruses were detected using next generation sequencing. Land cover type affects the abundance and distribution of the most

  14. A Study on Energy Security for Electricity Generation in Peninsular Malaysia

    International Nuclear Information System (INIS)

    Fairuz Suzana Mohd Chachuli

    2013-01-01

    The study was analyzed 12 case studies comprises of energy strategies proposed by the Government for electricity generation in Peninsular Malaysia using the simulation by Model for Energy Supply System Alternatives and their General Environmental Impacts (MESSAGE) software for period of year 2009 until 2030. From this study it was found that the appropriate and efficient case study to overcome the energy security issues in Peninsular Malaysia is integrated energy strategies particularly on nuclear energy, electricity import from Sarawak and the development of renewable energy resources. The total expansion cost for the case study is RM19.489 billion with the increament only 3.27 % compared with reference case. The total CO 2 emission for this scenario is 1.825 M tonne with declination up to 27.16 % compared with reference case. Due to limited time and crucial problem on domestic natural gas supply to the power generation industry, the Government should formulate a comprehensive energy strategy to support the mission of Malaysia to become one of the developed country and high income country by year 2020. (author)

  15. Body Weight Determination from Foot Outline Length among the Iban Population in Malaysia

    Directory of Open Access Journals (Sweden)

    Hairunnisa Bt Mohd Anas K

    2017-12-01

    Full Text Available Foot impressions form a valuable physical evidence to solve crime. Foot impression measurements provide valuable information in estimating stature, weight, gender and age in crime scene investigation. In Asian countries, many people living in rural places walk without footwear. The aim of this research is to generate regression equations to determine living body weight from foot outline length among the Iban population of Malaysia. The study involved 200 (100 males, 100 females adult Ibans, mostly living in Sarawak, a state in   Malaysia. Following the standard procedure, the foot outlines were collected followed by body weight measurements and were recorded for analysis. The collected data were analysed with PASW 20 computer software. The correlation coefficient (R between the foot outline lengths and body weight was determined for males, females and pooled sample. Based on the foot outline and body weight, 30 regression equations were generated, 10 for males, 10 for females and 10 for pooled samples/unknown gender. The correlation coefficient (R values were positive and statistically significant. It is concluded that the present investigation provided regression equations to determine body weight from foot outline anthropometry. These equations can be used to determine body weight even when partial foot impressions are available at crime scenes.   Keywords: Forensic Science, Body Weight, Foot Outline, Iban Population, Malaysia

  16. Design and Analysis of Photovoltaic (PV) Power Plant at Different Locations in Malaysia

    Science.gov (United States)

    Islam, M. A.; Hasanuzzaman, M.; Rahim, N. A.

    2018-05-01

    Power generation from sun oriented vitality through a photovoltaic (PV) system is ended up prevalent over the world due to clean innovation. Geographical location of Malaysia is very favorable for PV power generation system. The Malaysian government has also taken different steps to increase the use of solar energy especially by emphasizing on building integrated PV (BIPV) system. Comparative study on the feasibility of BIPV installation at the different location of Malaysia is rarely found. On the other hand, solar cell temperature has a negative impact on the electricity generation. So in this study cost effectiveness and initial investment cost of building integrated grid connected solar PV power plant in different regions of Malaysia have been carried. The effect of PV solar cell temperature on the payback period (PBP) is also investigated. Highest PBP is 12.38 years at Selangor and lowest PBP is 9.70 years at Sabah (Kota Kinabalu). Solar cell temperature significantly increases the PBP of PV plant and highest 14.64% and lowest 13.20% raise of PBP are encountered at Penang and Sarawak respectively.

  17. Malaysia: oil, gas, petrochemicals

    International Nuclear Information System (INIS)

    1990-01-01

    Petronas or Petroliam Nasional Berhad was established on 17 August 1974 as the national petroleum corporation of Malaysia. The Petroleum Development Act, passed by the Malaysian Parliament in October of that same year, vested in Petronas the entire ownership of all oil and natural gas resources in the country. These resources are considerable and Malaysia is poised to become one of the major petrochemical producers in the region. This report outlines the extent of oil, gas and petrochemicals production in Malaysia, lists companies holding licences and contracts from Petronas and provides a directory of the Malaysian oil industry. (Author)

  18. Possible conservation units of the sun bear (Helarctos malayanus) in Sarawak based on variation of mtDNA control region.

    Science.gov (United States)

    Onuma, Manabu; Suzuki, Masatsugu; Ohtaishi, Noriyuki

    2006-11-01

    The mitochondrial DNA control region of the sun bear (Helarctos malayanus) was sequenced using 21 DNA samples collected from confiscated sun bears to identify conservation units, such as evolutionarily significant units and management units, in Sarawak, Borneo Island. A total of 10 haplotypes were observed, indicating the presence of at least two lineages in the sun bear population in Sarawak. Presumably, these two lineages could represent evolutionarily significant units. However, the geographical distributions of the two lineages remained unknown due to the lack of information regarding the exact capture locations of the confiscated sun bears. It is essential to elucidate the geographical distributions of these lineages in order to create a proper conservation plan for the sun bears in Sarawak. Therefore, further studies examining the haplotype distributions using DNA samples from known localities are essential.

  19. Informed Questions on Malaysia

    National Research Council Canada - National Science Library

    Heng, Lim; Tay, BG

    2003-01-01

    .... This is despite the vitriolic, anti-west outbursts of Dr Mahathir, its controversial Prime Minister of 22 years, who has set the objective of Malaysia becoming a fully developed country by the year 2020...

  20. Informed Questions on Malaysia

    National Research Council Canada - National Science Library

    Heng, Lim; Tay, BG

    2003-01-01

    While Indonesia gets the attention of policy makers on South East (SE) Asia because of its size and population, Malaysia has increasingly been courted as an example of an Islamic country that is moderate and progressive...

  1. Competition Policy in Malaysia

    OpenAIRE

    Lee, Cassey

    2004-01-01

    Malaysia does not have a national competition law. Competition is regulated at the sectoral level in the country. Two economic sectors have legal provisions for competition law but these have been relatively ineffectively enforced. The benefits of Malaysia's industrial policy as well as the policy reforms in regulation and trade have been compromised by the lack of a formal institution to address competition related issues. Hence, the future priority and direction of regulatory reform is obvi...

  2. Older Consumers in Malaysia

    OpenAIRE

    David R. Phillips; Fon Sim Ong

    2007-01-01

    The main objective of this study was to understand the concerns and problems faced by older people in an industrializing middle-income country, Malaysia, in their process of acquiring products to meet their everyday needs. Respondents aged 55 and over were interviewed in eight states throughout Peninsular Malaysia providing 1356 usable questionnaires; two-thirds from urban and one-third from rural areas. Education, health status, and life satisfaction were recorded. Service patronage behaviou...

  3. Albedo and land surface temperature shift in hydrocarbon seepage potential area, case study in Miri Sarawak Malaysia

    Science.gov (United States)

    Suherman, A.; Rahman, M. Z. A.; Busu, I.

    2014-02-01

    The presence of hydrocarbon seepage is generally associated with rock or mineral alteration product exposures, and changes of soil properties which manifest with bare development and stress vegetation. This alters the surface thermodynamic properties, changes the energy balance related to the surface reflection, absorption and emission, and leads to shift in albedo and LST. Those phenomena may provide a guide for seepage detection which can be recognized inexpensively by remote sensing method. District of Miri is used for study area. Available topographic maps of Miri and LANDSAT ETM+ were used for boundary construction and determination albedo and LST. Three land use classification methods, namely fixed, supervised and NDVI base classifications were employed for this study. By the intensive land use classification and corresponding statistical comparison was found a clearly shift on albedo and land surface temperature between internal and external seepage potential area. The shift shows a regular pattern related to vegetation density or NDVI value. In the low vegetation density or low NDVI value, albedo of internal area turned to lower value than external area. Conversely in the high vegetation density or high NDVI value, albedo of internal area turned to higher value than external area. Land surface temperature of internal seepage potential was generally shifted to higher value than external area in all of land use classes. In dense vegetation area tend to shift the temperature more than poor vegetation area.

  4. Assessment of menopausal symptoms using modified Menopause Rating Scale (MRS among middle age women in Kuching, Sarawak, Malaysia

    Directory of Open Access Journals (Sweden)

    Rahman Syed

    2010-02-01

    Full Text Available Abstract Background Menopausal symptoms can be assessed by several tools, and can be influenced by various socio-demographic factors. Objectives To determine the commonly reported menopausal symptoms among Sarawakian women using a modified Menopause Rating Scale (MRS. Methods By using modified MRS questionnaire, 356 Sarawakian women aged 40-65 years were interview to document of 11 symptoms (divided into somatic, psychological and urogenital domain commonly associated with menopause. Results The mean age of menopause was 51.3 years (range 47 - 56 years. The most prevalent symptoms reported were joint and muscular discomfort (80.1%; physical and mental exhaustion (67.1%; and sleeping problems (52.2%. Followed by symptoms of hot flushes and sweating (41.6%; irritability (37.9%; dryness of vagina (37.9%; anxiety (36.5%; depressive mood (32.6%. Other complaints noted were sexual problem (30.9%; bladder problem (13.8% and heart discomfort (18.3%. Perimenopausal women (n = 141 experienced higher prevalence of somatic and psychological symptoms compared to premenopausal (n = 82 and postmenopausal (n = 133 women. However urogenital symptoms mostly occur in the postmenopausal group of women. Conclusions The prevalence of menopausal symptoms using modified MRS in this study correspond to other studies on Asian women however the prevalence of classical menopausal symptoms of hot flushes, sweating was lower compared to studies on Caucasian women.

  5. The Relationship between Media Use and Body Mass Index among Secondary Students in Kuching South City, Sarawak, Malaysia.

    Science.gov (United States)

    Cheah, Whye Lian; Chang, Ching Thon; Rosalia, Saimon; Charles, Lai Dekun; Yii, Sze Lin; Tiong, Pik Hoong; Yeap, Kim Pey

    2011-07-01

    Overweight and obesity rates among adolescents have increased substantially over the years. This study aimed to determine the body mass index (BMI) of students and parents and the relationship among media use, BMI, socio-demographic profiles, and snacking behaviour during television watching of secondary school students in Kuching South City. In accordance with the two-stage sampling method, a total of 316 adolescents aged 13-17 years from 7 secondary schools participated. Data were collected using questionnaire and anthropometric measurement. Independent t test, one-way ANOVA, Mann-Whitney U test, and chi-square test were performed. The mean BMI was 20.56 kg/m(2) (SD 4.33) for boys and 20.15 kg/m(2) (SD 3.91) for girls. No significant difference in terms of z score for BMI-for-age or socio-demographic factors was found. The mean duration of time devoted to media use was 4.69 hours (SD 2.93) on weekdays and 5.69 hours (SD 2.87) on weekends. Boys were found to spend more hours on media use than did the girls (t = 4.293, P < 0.01). Respondents were reported to consume more cereal compared with soft drinks and junk foods. Respondents whose fathers worked in the private sector devoted the fewest hours to media use, whereas those with self-employed fathers devoted the most time to media use. Respondents with mothers who were employed spent more time on media use than did respondents whose mothers were housewives (F = 4.067, P < 0.01). No significant difference was found between BMI and media time or snacking habits. This finding indicated that media time has no effect on body weight, because respondents were found to have normal weight and to consume less unhealthy food.

  6. Albedo and land surface temperature shift in hydrocarbon seepage potential area, case study in Miri Sarawak Malaysia

    International Nuclear Information System (INIS)

    Suherman, A; Rahman, M Z A; Busu, I

    2014-01-01

    The presence of hydrocarbon seepage is generally associated with rock or mineral alteration product exposures, and changes of soil properties which manifest with bare development and stress vegetation. This alters the surface thermodynamic properties, changes the energy balance related to the surface reflection, absorption and emission, and leads to shift in albedo and LST. Those phenomena may provide a guide for seepage detection which can be recognized inexpensively by remote sensing method. District of Miri is used for study area. Available topographic maps of Miri and LANDSAT ETM+ were used for boundary construction and determination albedo and LST. Three land use classification methods, namely fixed, supervised and NDVI base classifications were employed for this study. By the intensive land use classification and corresponding statistical comparison was found a clearly shift on albedo and land surface temperature between internal and external seepage potential area. The shift shows a regular pattern related to vegetation density or NDVI value. In the low vegetation density or low NDVI value, albedo of internal area turned to lower value than external area. Conversely in the high vegetation density or high NDVI value, albedo of internal area turned to higher value than external area. Land surface temperature of internal seepage potential was generally shifted to higher value than external area in all of land use classes. In dense vegetation area tend to shift the temperature more than poor vegetation area

  7. A First Survey on the Abundance of Plastics Fragments and Particles on Two Sandy Beaches in Kuching, Sarawak, Malaysia

    Science.gov (United States)

    Noik, V. James; Mohd Tuah, P.

    2015-04-01

    Plastic fragments and particles as an emerging environmental contaminant and pollutant are gaining scientific attention in the recent decades due to the potential threats on biota. This study aims to elucidate the presence, abundance and temporal change of plastic fragments and particles from two selected beaches, namely Santubong and Trombol in Kuching on two sampling times. Morphological and polymer identification assessment on the recovered plastics was also conducted. Overall comparison statistical analysis revealed that the abundance of plastic fragments/debris on both of sampling stations were insignificantly different (p>0.05). Likewise, statistical analysis on the temporal changes on the abundance yielded no significant difference for most of the sampling sites on each respective station, except STB-S2. Morphological studies revealed physical features of plastic fragments and debris were diverse in shapes, sizes, colors and surface fatigues. FTIR fingerprinting analysis shows that polypropylene and polyethylene were the dominant plastic polymers debris on both beaches.

  8. Assessment of the characteristic of nutrients, total metals, and fecal coliform in Sibu Laut River, Sarawak, Malaysia

    Science.gov (United States)

    Soo, Chen-Lin; Ling, Teck-Yee; Lee, Nyanti; Apun, Kasing

    2016-03-01

    The concentrations of nutrients (nitrogen and phosphorus), total metals, and fecal coliform (FC) coupling with chlorophyll- a (chl- a), 5-day biochemical oxygen demand (BOD5) and other general environmental parameters were evaluated at the sub-surface and near-bottom water columns of 13 stations in the Sibu Laut River during low and high slack waters. The results indicated that inorganic nitrogen (mainly nitrate) was the primary form of nitrogen whereas organic phosphorus was the major form of phosphorus. The abundance of total heavy metals in Sibu Laut River and its tributaries was in the order of Pb < Cu < Zn < Cd. Fecal coliform concentration was relatively low along Sibu Laut River. The shrimp farm effluents contributed a substantial amount of chl- a, BOD5, nutrients, and FC to the receiving creek except for total metals. Nevertheless, the influence was merely noticeable in the intake creek and amended rapidly along Selang Sibu River and brought minimal effects on the Sibu Laut River. Besides, the domestic sewage effluents from villages nearby also contributed a substantial amount of pollutants.

  9. Unveiling topographical changes using LiDAR mapping capability: case study of Belaga in Sarawak, East-Malaysia

    Science.gov (United States)

    Ganendra, T. R.; Khan, N. M.; Razak, W. J.; Kouame, Y.; Mobarakeh, E. T.

    2016-06-01

    The use of Light Detection and Ranging (LiDAR) remote sensing technology to scan and map landscapes has proven to be one of the most popular techniques to accurately map topography. Thus, LiDAR technology is the ultimate method of unveiling the surface feature under dense vegetation, and, this paper intends to emphasize the diverse techniques that can be utilized to elucidate topographical changes over the study area, using multi-temporal airborne full waveform LiDAR datasets collected in 2012 and 2014. Full waveform LiDAR data offers access to an almost unlimited number of returns per shot, which enables the user to explore in detail topographical changes, such as vegetation growth measurement. The study also found out topography changes at the study area due to earthwork activities contributing to soil consolidation, soil erosion and runoff, requiring cautious monitoring. The implications of this study not only concurs with numerous investigations undertaken by prominent researchers to improve decision making, but also corroborates once again that investigations employing multi-temporal LiDAR data to unveil topography changes in vegetated terrains, produce more detailed and accurate results than most other remote sensing data.

  10. Development of Solar Energy in Sabah Malaysia: The Case of Trudgill’s Perception

    OpenAIRE

    Jamalludin Sulaiman; Azlinda Azman; Behnaz Saboori

    2014-01-01

    Solar energy in Malaysia was first introduced as one of the five fuels in electricity generation through the Fifth Fuel Policy in 2001. However, the current real harnessing of available solar sources is still below its actual potential. This study examined the non-technical barriers towards solar energy implementation in Sabah located on the Borneo Island on eastern part of Malaysia. Following the theoretical framework, the proposed non-technical barriers are agreement, knowledge, technologic...

  11. A Triassic to Cretaceous Sundaland-Pacific subduction margin in West Sarawak, Borneo

    Science.gov (United States)

    Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; Forster, Margaret A.; BouDagher-Fadel, Marcelle K.

    2017-01-01

    Metamorphic rocks in West Sarawak are poorly exposed and studied. They were previously assumed to be pre-Carboniferous basement but had never been dated. New 40Ar/39Ar ages from white mica in quartz-mica schists reveal metamorphism between c. 216 to 220 Ma. The metamorphic rocks are associated with Triassic acid and basic igneous rocks, which indicate widespread magmatism. New U-Pb dating of zircons from the Jagoi Granodiorite indicates Triassic magmatism at c. 208 Ma and c. 240 Ma. U-Pb dating of zircons from volcaniclastic sediments of the Sadong and Kuching Formations confirms contemporaneous volcanism. The magmatic activity is interpreted to represent a Triassic subduction margin in westernmost West Sarawak with sediments deposited in a forearc basin derived from the magmatic arc at the Sundaland-Pacific margin. West Sarawak and NW Kalimantan are underlain by continental crust that was already part of Sundaland or accreted to Sundaland in the Triassic. One metabasite sample, also previously assumed to be pre-Carboniferous basement, yielded Early Cretaceous 40Ar/39Ar ages. They are interpreted to indicate resumption of subduction which led to deposition of volcaniclastic sediments and widespread magmatism. U-Pb ages from detrital zircons in the Cretaceous Pedawan Formation are similar to those from the Schwaner granites of NW Kalimantan, and the Pedawan Formation is interpreted as part of a Cretaceous forearc basin containing material eroded from a magmatic arc that extended from Vietnam to west Borneo. The youngest U-Pb ages from zircons in a tuff layer from the uppermost part of the Pedawan Formation indicate that volcanic activity continued until c. 86 to 88 Ma when subduction terminated.

  12. Solar power for energy sustainability and environmental friendliness of Curtin University Sarawak

    Science.gov (United States)

    Palanichamy, C.; Goh, Alvin

    2016-03-01

    The demand on electrical energy is rapidly increasing. Everything around us requires electrical energy either during its production or usage stage. Sustainability has become the main concern nowadays as the availability of fossil fuels is limited. As renewable energy is the path-way to energy sustainability and environmental friendly environment, this paper proposes a solar power system for Curtin University Sarawak to reduce its electricity consumption and greenhouse gas emissions. The proposed 208 kW solar system saves an energy consumption of more than 380,000 kWh per year, and a CO2 offset by 285 Tons per year

  13. Three new species of Begonia (Begoniaceae from Limestone Hills in southwestern Sarawak, Borneo

    Directory of Open Access Journals (Sweden)

    Che-Wei Lin

    2017-04-01

    Full Text Available Most species of Begonia in Borneo, like those of other areas, are narrowly distributed and site-specific. In this study we report three new species of Begonia, namely B. felis C. W. Lin & C.-I Peng, B. kuchingensis C. W. Lin & C.-I Peng (sect. Petermannia and B. serianensis C. W. Lin & C.-I Peng (sect. Reichenheimia from the Padawan-Serian limestone hills in southwestern Sarawak. In addition to the taxonomic account, color plates, line drawings, a distribution map, and comparisons with phenetically similar species are provided to aid in identification.

  14. Solar power for energy sustainability and environmental friendliness of Curtin University Sarawak

    International Nuclear Information System (INIS)

    Palanichamy, C; Goh, Alvin

    2016-01-01

    The demand on electrical energy is rapidly increasing. Everything around us requires electrical energy either during its production or usage stage. Sustainability has become the main concern nowadays as the availability of fossil fuels is limited. As renewable energy is the path-way to energy sustainability and environmental friendly environment, this paper proposes a solar power system for Curtin University Sarawak to reduce its electricity consumption and greenhouse gas emissions. The proposed 208 kW solar system saves an energy consumption of more than 380,000 kWh per year, and a CO 2 offset by 285 Tons per year (paper)

  15. Human-Oriented Leadership and Organizational Commitment in US Subsidiary Company Based in Sarawak

    Directory of Open Access Journals (Sweden)

    Azman Ismail

    2016-11-01

    Full Text Available This article was conducted to examine the relationship between human-oriented leadership (HOL and organizational commitment. A survey method was employed to obtain data from the employees of one US subsidiary companybased in Sarawak. Results of the Partial Least Squares (SmartPLS model analysis confirmed that participative leadership, supportive leadership, and empowerment act as important antecedents of organizational commitment.These findings reveal that the capability of managers practicing HOL styles (supportive, participative, and empowerment has enhanced employees’ commitment to the organization.

  16. Rates of treated schizophrenia and its clinical and cultural features in the population isolate of the Iban of Sarawak: a tri-diagnostic approach.

    Science.gov (United States)

    Barrett, Robert; Loa, Peter; Jerah, Edward; Nancarrow, Derek; Chant, David; Mowry, Bryan

    2005-02-01

    We present results of a study of treated rates of schizophrenia among the Iban of Sarawak, Malaysia. Most Iban live in longhouses, each comprising a kindred group of up to 300 individuals. Cultural practices such as minimal intermarriage with members of adjacent ethnic groups and in-depth genealogical knowledge make them a population suitable for genetic investigation. Iban culture is conducive to a focus on symptoms and illness, and to patterns of treatment-seeking behaviour that are enthusiastic and persistent. We identified all known cases of psychotic disorder within a defined catchment area based on an exhaustive survey of available medical records. From corresponding Malaysian census data (91,056 persons), we report rates of treated schizophrenia in the Iban population, using three diagnostic systems, as well as the demographic and clinical characteristics of these individuals. The most frequent presenting complaints were insomnia and aggression. We found higher treated rates for narrowly defined schizophrenia among males, but no significant gender difference for age of onset. Estimates of treated rates to age 55 years (per 10,000) for narrow schizophrenia were 41.9 (ICD-10), 56.5 (DSM-IV), and 83 (RDC), while the rates for broad schizophrenia were 105.5, 103.2, and 107.5 respectively. Treated rates of schizophrenia were higher than the reported prevalence for many populations at risk, including many small-scale societies, although different methodological approaches may partly explain these findings. Given the cultural patterns of Iban treatment-seeking behaviour, treated rates of schizophrenia reported here may closely approximate the population prevalence of this disorder.

  17. Private sector financing of projects - implementation of the BAKUN hydroelectric project in Malaysia; Private Projektfinanzierung - Errichtung der Wasserkraftanlage Bakun in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Failer, E. [Lahmeyer International GmbH, Frankfurt am Main (Germany)

    1998-07-01

    The BAKUN Hydroelectric Power Project in Malaysia represents, alongside the Three Gorges Project in China, one of today's most closely observed hydropower projects. The Bakun Project features a generating capacity of 2 520 MW, a 205 m high concrete face rockfill dam and a 1 320 km long power transmission system from Sarawak (Borneo) to West Malaysia. Implementation costs are estimated at around DM 10 000 million. In December 1996 the concession to construct and operate the Bakun Project for a period of 30 years on a BOT (build-operate-transfer) basis was granted to the Bakun Hydro-Electric Corporation, a private project development company. A US-Dollar million contract was awarded one year prior to this concession, to construct the river diversion works in advance. Completion of the three concrete-lined diversion tunnels, each with an inner diameter of 12 m, is scheduled for the end of 1998. After a brief overview of the Bakun Project, the paper describes a typical structure of the parties involved and the legal framework for BOT project finance. The most important features of the concession agreement, the power purchase agreement (PPA) and the engineering, procurement and construction (EPC) contract are explained. Finally, the paper emphasizes that in future the water resources engineer will have to be more involved with topics such as fixed-price contracts, risk management, turnkey solutions and project finance. (orig.) [German] Mit einer geplanten installierten Leistung von 2 520 MW, einem 205 m hohen Steinschuettdamm mit Betonoberflaechendichtung, einem 1 320 km langen Energieuebertragungssystem von Sarawak (Borneo) nach Westmalaysia und mit Projektkosten von ca. 10 Mrd. DM stellt das BAKUN-Wasserprojekt in Malaysia, neben dem Dreischluchtenprojekt in China, eines der meist beachteten Wasserkraftprojekte der Gegenwart dar. Im Dezember 1996 erhielt die private Projektentwicklungsgesellschaft 'Bakun Hydro-Electric Corporation' die Konzession, das

  18. Malaysia; Financial Sector Stability Assessment

    OpenAIRE

    International Monetary Fund

    2013-01-01

    This assessment is a review of the financial environment of Malaysia. Like many other Asian countries, Malaysia experienced financial distress in the late 1990s, but the country’s policy reforms have moved it to a successful economy. A ten-year financial plan (2001–10) by Bank Negara Malaysia restructured the financial sector. Banks were well capitalized, household debts were strengthened, and securities and insurances were developed. Malaysia thus became the global center for Islamic finance...

  19. Sustainable management of peat swamp forest of Sarawak with special reference to ramin (Gonystylus bancanus); development of a monitoring system

    NARCIS (Netherlands)

    Wijdeven, S.M.J.; Meer, van der P.J.; Chai, F.Y.C.; Tan, S.; Mohizah, M.; Liam, D.

    2004-01-01

    Peat swamp forests in Sarawak are valuable in terms of timber and biodiversity, but heavily degraded. In order to assess the current status, potential developments and possible management interventions, an adequate monitoring system is necessary. In this study a new monitoring system is proposed,

  20. Water quality monitoring: A comparative case study of municipal and Curtin Sarawak's lake samples

    Science.gov (United States)

    Anand Kumar, A.; Jaison, J.; Prabakaran, K.; Nagarajan, R.; Chan, Y. S.

    2016-03-01

    In this study, particle size distribution and zeta potential of the suspended particles in municipal water and lake surface water of Curtin Sarawak's lake were compared and the samples were analysed using dynamic light scattering method. High concentration of suspended particles affects the water quality as well as suppresses the aquatic photosynthetic systems. A new approach has been carried out in the current work to determine the particle size distribution and zeta potential of the suspended particles present in the water samples. The results for the lake samples showed that the particle size ranges from 180nm to 1345nm and the zeta potential values ranges from -8.58 mV to -26.1 mV. High zeta potential value was observed in the surface water samples of Curtin Sarawak's lake compared to the municipal water. The zeta potential values represent that the suspended particles are stable and chances of agglomeration is lower in lake water samples. Moreover, the effects of physico-chemical parameters on zeta potential of the water samples were also discussed.

  1. Radioactivity distribution of thorium in sediment core of the Sabah-Sarawak coast

    International Nuclear Information System (INIS)

    Zal U'yun Wan Mahmood; Zaharudin Ahmad; Adziz, M.I.A.; Abdul Kadir Ishak; Che Abd Rahim Mohamed

    2010-01-01

    Thorium activity concentrations were measured in seven marine sediment cores taken from Sabah-Sarawak coast on 2004 by using a gravity box corer. Collected sediments were generally homogenous mud which contained much more mixture of silt and clay compared to sand and relatively low content of organic carbon (i.e. less than 5% at all sampling stations). The results found that activity concentrations of 230 Th, 232 Th and ratios of 230 Th/ 232 Th were ranged from 6.5-20.4 Bq/kg dry wt., 6.8-27.8 Bq/kg dry wt. and 0.69-0.92, respectively. It seem that, 232 Th activity concentrations are slightly higher than 230 Th at all sampling stations and both radionuclides were generally high at Sabah compared to Sarawak coastal waters. 230 Th activity concentrations in sediment core appear to be correlated with the activity concentrations of 232 Th at some sampling station. These indicating both radionuclides were supplied from the same of environment and source origin of detrital from terrestrial and shallower water. The low 230 Th/ 232 Th activity ratio which is less than unity suggesting that 232 Th was actively and rapidly regenerated compared to 230 Th from 234 U. It also can be attributed to less efficiently scavenge of 230 Th onto particles prior deposited at the marine sediment bed. (author)

  2. Food irradiation in Malaysia

    International Nuclear Information System (INIS)

    Mohd Ghazali Hj Abd Rahman.

    1985-01-01

    Food irradiation has recently been visited as a technology that can contribute to the solution of problems associated with food preservation of Malaysia's agriculture produce and products thereby improving the economic status of the rural sector. However, the history of food irradiation in Malaysia is very recent. Research carried out on food irradiation only began in 1974 as a result of the installation of a 60 Co facility (initially 10,000 Ci) at the National University of Malaysia. Since its installation several studies have been carried out pertaining to the food irradiation. Presently its development has been slow. Research in this area has been confined to laboratory scale and purely academic. This limitation is due to a number of reasons, among others are: a) limited number of facilities; b) lack of expertise to conduct its research; c) other preservation methods can be improved with lower capital output. An important step towards its development was made when Malaysia actively participated in the RCA/IAEA food irradiation project, viz. the irradiation of pepper which was carried out at the National University of Malaysia in the 80's. As a result of this venture, research and development activities in food irradiation have been geared toward semi-plot scale with the view ot commercialization in the future. In 1982, a group of researchers was formed to conduct feasibility studies using irradiation techniques in trying to overcome several problems associated with our local paddy and rice. Another group is being organized by the National University of Malaysia to look into the problems associated with the preservation of frozen shrimps. (author)

  3. Pattern of suicides in 2009: data from the National Suicide Registry Malaysia.

    Science.gov (United States)

    Ali, Nor Hayati; Zainun, Khairul Anuar; Bahar, Norharlina; Haniff, Jamaiyah; Hamid, Abdul Muneer; Bujang, Mohamad Adam Hj; Mahmood, Mohd Shah

    2014-06-01

    The National Suicide Registry Malaysia (NSRM) is a nationwide system that captures data on completed suicides in Malaysia from all forensic departments under the purview of the Ministry of Health Malaysia. This paper examines all suicidal deaths reported to the NSRM from 1 January 2009 to 31 December 2009. The relevant variables were recorded in the paper-based Case Report Form (CRF) and then entered into the online reporting system for analysis. The overall suicide rate for 2009 was 1.18 per 100,000 population (n = 328). The age range was 14-94 years, with a median of 37 (IQR 24) years. There were more men than women, the gender ratio being 2.9:1 (males : females), and the majority (89% or 293/328) were Malaysian citizens. Ethnicity-wise, Indians had the highest suicide rate of 3.67 per 100,000. The Malays and Bumiputera of Sabah and Sarawak had lower rates of 0.32 to 0.37 per 100,000. Mental illness was reported in 22% (72/328) of the cases and physical illnesses in 20.4% (67/328). Previous suicide attempts were reported in 15.5% (51/328) of cases. History of substance abuse was present in 28.7% (83/328). Life events were positive in 41.2% (135/328) of cases. Malaysia is able to generate statistics on suicide by enhancing the collaboration between forensic, psychiatry and clinical research agencies. These trends should be monitored to gain a better understanding of suicide trends. Copyright © 2012 Wiley Publishing Asia Pty Ltd.

  4. Prevalence of snake bites in Kangar District Hospital, Perlis, west Malaysia: a retrospective study (January 1999-December 2000).

    Science.gov (United States)

    Jamaiah, I; Rohela, M; Roshalina, R; Undan, R C

    2004-12-01

    The records of 284 snake bite cases presenting to the Kangar District Hospital, Perlis, west Malaysia, from January 1999 till December 2000 were carefully reviewed. Data on prevalence and types of snake bites, were recorded. The majority of the cases were among Malays (60.2%), followed by Chinese (16.9%), Indians (13%), and others which include Thai nationals, army personnel from Sabah and Sarawak, and foreign tourists (9.8%). A higher incidence was found in males (60.2%) and most cases were seen in the age group of 10-19 years (33%). Snake bites were more common between 2 PM and 9 PM (47.6%) and from 7 AM to 2 PM (33.4%). The snakes were positively identified in 68 cases, of which 50 were common cobras (Naja naja) (73%), 16 were Malayan pit vipers (Agkistrodon rhodostoma) (24%) and two were sea-snakes (3%).

  5. 6th COSTAM/SFRR (ASEAN/Malaysia) International Workshop on Micronutrients, Oxidative Stress, and the Environment.

    Science.gov (United States)

    Nesaretnam, Kalanithi; Sies, Helmut

    2006-01-01

    The 6(th) COSTAM/SFRR (ASEAN/Malaysia) workshop, "Micronutrients, Oxidative Stress, and the Environment," was held from June 29 to July 2 at Holiday Inn Damai Beach Resort in Kuching, Sarawak. Two hundred twenty participants from 17 countries presented recent advances on natural antioxidants in the area of oxidative stress and molecular aspects of nutrition. Natural products and research are an important program in academic institutions and are experiencing unprecedented interest and growth by the scientific community and public health authorities. Progress is being driven by better understanding of the molecular mechanisms of the relation between oxidative stress and micronutrient action. The gathering of scientists from around the world was fruitful, and we hope that future work will be developed by the formal and informal interactions that took place in this beautiful tropical setting.

  6. Print Advertisements in Malaysia

    Science.gov (United States)

    Hashim, Azirah

    2010-01-01

    This paper examines print advertisements in Malaysia to determine how advertisers seek to achieve their primary goal of persuading or influencing an audience by the use of both language and visuals. It describes the main component moves and rhetorical strategies used by writers to articulate the communicative purpose of the genre and the language…

  7. Education Reforms in Malaysia.

    Science.gov (United States)

    Yunus, Aida Suraya Muhammad

    Malaysia's agenda in the late 1990s involved making the transition from an industrial economy to a knowledge-based economy. Thus, the more traditional purpose of education, that is, to produce an educated person, needs to be reevaluated. If the nation's Vision 2020 is to become a reality, the educational program needs to make a fundamental shift…

  8. Competition Law in Malaysia

    OpenAIRE

    Anand Raj; Cynthia Lian; Wen-Ly Chin

    2015-01-01

    There is still some way for Malaysia to go and the lack of merger control (for the foreseeable future) remains a significant shortcoming in the Malaysian competition law regime at this stage. Anand Raj, Cynthia Lian, & Wen-Ly Chin (Shearn Delamore & Co., Kuala Lumpur)

  9. Country Profiles, Malaysia.

    Science.gov (United States)

    Marzuki, Ariffin Bin; Peng, J. Y.

    A profile of Malaysia is sketched in this paper. Emphasis is placed on the nature, scope, and accomplishments of population activities in the country. Topics and sub-topics include: location and description of the country; population (size, growth patterns, age structure, urban/rural distribution, ethnic and religious composition, migration,…

  10. IDRC in Malaysia

    International Development Research Centre (IDRC) Digital Library (Canada)

    Malaysia was one of the first. Southeast Asian countries in which IDRC supported research, in 1971. Over the following two decades, more than 100 IDRC- funded activities contributed to better policies, technologies, and research capacity in sectors such as agriculture, fisheries, education, health, and science.

  11. Education in Malaysia: 1980.

    Science.gov (United States)

    Ministry of Education, Kuala Lumpur (Malaysia).

    Malaysia's education system has experienced a variety of situations and circumstances since May 1956, when the Razak Education Committee laid the foundation for a national system of education. Discussed in this publication are the history of educational development; educational organization and administration; the structure of education;…

  12. Eastern Europe

    International Nuclear Information System (INIS)

    Baret, J.P.; Corcuff, A.; Jousten, M.; Cherie, J.B.; Gorge, X.; Augustin, X.; Belime, F.

    1999-01-01

    By its economical and political impact, nuclear energy has an important contribution the countries of Eastern Europe that goes beyond simple energy source. The most important challenge is to gain a safety culture. Improvements have been noted but the reactors safety must stay a priority of the international cooperation in Eastern Europe. The plan for the completion and improvement of Mochovce nuclear plant is described, the situation of Chernobyl and how to make the sarcophagus in safe is discussed, the experience of a french P.M.E. ( small and medium size firm) called Corys Tess that has chosen to position itself on the Eastern Europe nuclear market is related. (N.C.)

  13. Prevalence of potentially pathogenic Vibrio species in the seafood marketed in Malaysia.

    Science.gov (United States)

    Elhadi, Nasreldin; Radu, Son; Chen, Chien-Hsien; Nishibuchi, Mitsuaki

    2004-07-01

    Seafood samples obtained in seafood markets and supermarkets at 11 sites selected from four states in Malaysia were examined for the presence of nine potentially pathogenic species from the genus Vibrio between July 1998 and June 1999. We examined 768 sample sets that included shrimp, squid, crab, cockles, and mussels. We extensively examined shrimp samples from Selangor State to determine seasonal variation of Vibrio populations. Eight potentially pathogenic Vibrio species were detected, with overall incidence in the samples at 4.6% for V. cholerae, 4.7% for V. parahaemolyticus, 6.0% for V. vulnificus, 11% for V. alginolyticus, 9.9% for V. metschnikovii, 1.3% for V. mimicus, 13% for V. damsela, 7.6% for V. fluvialis, and 52% for a combined population of all of the above. As many as eight Vibrio species were detected in shrimp and only four in squid and peel mussels. The overall percent incidence of any of the eight vibrios was highest (82%) in cockles (Anadara granosa) among the seafoods examined and was highest (100%) in Kuching, Sarawak State, and lowest (25%) in Penang, Pulau Penang State, among the sampling sites. Of 97 strains of V. cholerae isolated, one strain belonged to the O1 serotype and 14 to the O139 serotype. The results indicate that the various seafood markets in Malaysia are contaminated with potentially pathogenic Vibrio species regardless of the season and suggest that there is a need for adequate consumer protection measures.

  14. Neural tube defects in Malaysia: data from the Malaysian National Neonatal Registry.

    Science.gov (United States)

    Boo, Nem-Yun; Cheah, Irene G S; Thong, Meow-Keong

    2013-10-01

    This study aimed to determine the prevalence and early outcome of neural tube defects (NTDs) in Malaysia. This prospective study included all neonates with NTDs (spina bifida, anencephaly, encephalocoele) born in 2009 in 32 Malaysian hospitals in the Malaysian National Neonatal Network. The prevalence of NTDs was 0.42 per 1000 live births, being highest among the indigenous people of Sarawak (1.09 per 1000 live births) and lowest among Malaysians of Chinese descent (0.09 per 1000 live births). The most common type of NTDs was anencephaly (0.19 per 1000 live births), followed by spina bifida (0.11 per 1000 live births) and encephalocoele (0.07 per 1000 live births). Majority of the infants with anencephaly (94.5%, n = 51), 45.8% (n = 11) with encephalocoele and 9.5% (n = 4) with spina bifida died. The median duration of hospital stay was 4 (range: 0-161) days. NTDs were common in Malaysia. Mortality was high. Long-term monitoring of NTD prevalence following folic fortification of food is recommended.

  15. Alcohol consumption and risky drinking patterns in Malaysia: findings from NHMS 2011.

    Science.gov (United States)

    Mutalip, Mohd Hatta B Abdul; Kamarudin, Rozanim Bt; Manickam, Mala; Abd Hamid, Hamizatul Akmal Bt; Saari, Riyanti Bt

    2014-01-01

    To identify the characteristics of current drinker and risky alcohol-drinking pattern by profiles in Malaysia. We analyzed data from the National Health and Morbidity Survey 2011. It was a cross-sectional population-based with two stages stratified random sampling design. A validated Alcohol Use Disorder Identification Test Malay questionnaire was used to assess the alcohol consumption and its alcohol related harms. Analysis of complex survey data using Stata Version 12 was done for descriptive analysis on alcohol use and risky drinking by socio-demography profiles. Logistic regression analysis was used to measure the association of risky drinking status with the socio-demography characteristics. The prevalence of current alcohol use was 11.6% [95% confidence interval (CI): 10.5, 12.7], among them 23.6% (95% CI: 21.0, 26.4) practiced risky drinking. The onset for alcohol drinking was 21 years old (standard deviation 7.44) and majority preferred Beer. Males significantly consumed more alcohol and practiced risky drinking. Current alcohol use was more prevalent among urbanites, Chinese, those with high household income, and high education. Conversely, risky drinking was more prevalent among rural drinkers, Bumiputera Sabah and Sarawak, low education and low household income. The estimated odds of risky drinking increased by a factor of 3.5 among Males while a factor of 2.7 among Bumiputera Sabah and Sarawak. Education status and household income was not a significant predictor to risky drinking. There was an inverse drinking pattern between current drinker and risky drinking by the socio-demography profiles. Initiating early screening and focused intervention might avert further alcohol related harms and dependence among the risky drinkers. © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  16. Heavy metal concentrations in the razor clams (Solen spp.) from Muara Tebas, Sarawak

    International Nuclear Information System (INIS)

    Devagi Kanakaraju; Connie Jios; Shabdin Mohd Long

    2008-01-01

    The razor clams (Solen spp) or locally known as ambal in Sarawak collected from Muara Tebas were studied for their heavy metals contents in tissues and shells. Sediment samples were also tested for their metal contents. Concentrations of Pb, Fe, Zn, Cu, Cd and Mn were determined by using Flame Atomic Absorption Spectrophotometer (FAAS). Tissues of razor clams showed highest concentrations of Fe and Zn, while shells accumulated highest concentrations of Pb and Mn. The lowest metal concentrations found were Cu and Cd. In general, the levels of metals in ambal were within the permissible limit recommended by international standard, the Food and Agricultural Organization (FAO). However, the study revealed that the sediments at Muara Tebas fall under the category of slightly polluted (for Pb) when compared to the guidelines suggested by United States Environment Protection Agency (USEPA). (author)

  17. Intercomparison of techniques for estimation of sedimentation rate in the Sabah and Sarawak coastal waters

    International Nuclear Information System (INIS)

    Zal U'yun Wan Mahmood; Zaharudin Ahmad; Abdul Kadir Ishak; Che Abd Rahim Mohamed

    2011-01-01

    A total of eight sediment cores with 50 cm length were taken in the Sabah and Sarawak coastal waters using a gravity corer in 2004 to estimate sedimentation rates using four mathematical models of CIC, Shukla-CIC, CRS and ADE. The average of sedimentation rate ranged from 0.24 to 0.48 cm year -1 , which is calculated based on the vertical profile of 210 Pbex in sediment core. The finding also showed that the sedimentation rates derived from four models were generally shown in good agreement with similar or comparable value at some stations. However, based on statistical analysis of paired sample t-test indicated that CIC model was the most accurate, reliable and suitable technique to determine the sedimentation rate in the coastal area. (author)

  18. A Preliminary Survey of Species Composition of Termites (Insecta: Isoptera) in Samunsam Wildlife Sanctuary, Sarawak.

    Science.gov (United States)

    Jamil, Norsyarizan; Ismail, Wan Nurainie Wan; Abidin, Siti Shamimi; Amaran, Mazdan Ali; Hazali, Ratnawati

    2017-07-01

    A survey on termite species composition was conducted in Samunsam Wildlife Sanctuary, Sarawak in February 2015. Overall 19 species of termite belonging to 13 genera and 8 subfamilies was found in the sanctuary. It was recorded the subfamily of Termitinae had the highest number of species (6 species, equal to 31.58% of total species), followed by Nasutermitinae (3 species, 15.79%), Macrotermitinae, Amitermitinae, Rhinotermitinae, Coptotermitinae, (2 species, 10.53% respectively), and Heterotermitinae, Termitogetoninae (1 species, 5.26% respectively). Since this rapid survey is the first termite assemblage representation in Samunsam Wildlife Sanctuary, the preliminary result may serve as the baseline data for termite composition in the area. Therefore, a whole coverage for the area within this sanctuary would definitely increase the number of termite species found in the sanctuary.

  19. Corporate Governance Disclosure in Malaysia

    OpenAIRE

    ONG, Wei Jiin

    2006-01-01

    This research provides evidence on corporate governance disclosure in Malaysia based on a sample of 25 Malaysian public listed companies on the Kuala Lumpur Composite Index (KLCI) in the year 1998 and 2005 that are listed on the Bursa Malaysia. The purpose of this dissertation is to examine whether after the launch of the Malaysian Code on Corporate Governance (HLFC, 2000) following the 1997/98 financial crisis, corporate governance in Malaysia has improved in terms of disclosure information ...

  20. Assessment of metals pollution in sediment cores from the Sabah-Sarawak coastal waters

    International Nuclear Information System (INIS)

    Zal Uyun Wan Mahmood; Zaharudin Ahmad; Che Abdul Rahim Mohamed; Abdul Kadir Ishak; Norfaizal Mohammed

    2011-01-01

    The distribution, enrichment and pollution status of metals in sediment cores from the Sabah-Sarawak coastal waters were studied. Seven sediment cores were taken in July 2004 using a gravity box corer. The metals of Cu, Zn and Pb were analyzed by ICP-MS to assess the pollution status of the sediments. The sediment fine fraction and organic carbon content was also analyzed. Enrichment Factor (EF), Geo accumulation Index (Igeo) and Pollution Load Index (PLI) was calculated as criteria of possible contamination. The results showed that collected sediments were composed with clay, silt and sand as 12 - 74 %, 27 - 72 % and 0 - 20 %, respectively. Meanwhile, organic carbon contents were relatively low and constant over time, based on sediment depth profiles, and it did not exceed 5 % at any sampling station. The average metal concentrations in sediment cores at all sampling station were distributed in the ranges of 1.66 ± 1.36 - 6.61 ± 0.12 μgg -1 for Cu, 26.55 ± 1.04 - 57.94 ± 1.58 μgg -1 for Zn and 3.99 ± 0.10 - 14.48 ± 0.32 μgg -1 for Pb. According to calculations of EF, I geo and PLI, it can be concluded that concentrations of Cu, Zn and Pb were not significantly affected by pollution from anthropogenic sources at the seven sampling locations. Thus, the metal content of Cu, Zn and Pb in sediment should not cause pollution problem to the marine environment of Sabah-Sarawak coastal waters and further response measures are not needed. (author)

  1. "Serving Two Masters"--Academics' Perspectives on Working at an Offshore Campus in Malaysia

    Science.gov (United States)

    Dobos, Katalin

    2011-01-01

    This paper explores the effects of the internationalisation of higher education on the working lives of academics at an offshore campus in eastern Malaysia. Using the interpretivist paradigm and grounded theory methods it investigates their perspectives on various themes as those emerge during a series of interviews. These emerging themes are:…

  2. Malaysia country overview

    International Nuclear Information System (INIS)

    Look, Chong Ah.

    1998-01-01

    The threat of global warming and climate change caused by escalating anthropogenic emissions of carbon dioxide and other greenhouse gases into the atmosphere calls for deliberate efforts by the global community to address this issue. Article 2 of the Framwork Convention on Climate Change (FCCC) sets the objective of the Convention to stabilize greenhouse gas concentrations in the atmosphere at a level that would prevent dangerous anthropogenic interference with the climate system. Malaysia signed the Convention on 9 June 1993 and ratified it on 17 July 1994. As a party to the Convention, Malaysia is committed to fulfilling its obligations including the communication of information to the Conference of the Parties (COP) in accordance with Articles 4 and 12 of the FCCC. (au)

  3. Advantages and Setbacks of Industrialized Building System (IBS) Implementation: A Case Study in Sarawak

    OpenAIRE

    Sing Sing Wong; Ling Kung Lau

    2015-01-01

    Industrialized Building System (IBS) is an innovative technique adopted to increase the efficiency, quality and productivity of projects. However, these advantages are proven mainly for projects located in urban areas only. IBS is not a common practice for projects located in rural areas. Although there were studies about IBS in Malaysia about its advantages and setbacks, these studies were focusing on projects located in urban areas located in West Malaysia only. Hence, this paper aids to cl...

  4. Malaysia; Selected Issues

    OpenAIRE

    International Monetary Fund

    1998-01-01

    This Selected Issues paper on Malaysia highlights quantitative assessment of additional measures required during the medium term to achieve fiscal targets. The authorities aim to lower the budget deficit to about 3 percent of GDP by 2015, down from 4.0 percent in 2013, and to balance the budget by 2020. It suggests that ranking fiscal instruments under different fiscal policy goals can help policymakers identify the composition of fiscal adjustment based on their preferences. By combining ran...

  5. Internetcensur i Malaysia

    OpenAIRE

    Rask, Kasper; Bach, Katinka

    2013-01-01

    This project examines the background of the implementation of the Internet censorship legislation in Malaysia in 2012 by the Malaysian government. This is illustrated by an empirical analysis of the two largest pro-government Malaysian newspapers New Straits Times and The Stars coverage of the need for Internet censorship between the two parliamentary elections in 2008 and the recent one in 2013. The government suffered its worst-ever election performance in these elections, and this project ...

  6. Eastern promises

    International Nuclear Information System (INIS)

    Sharp, Tim

    1999-01-01

    This article examines Asia's power markets and comments on China's over capacity; and the overhaul of its power sector with the upgrading of old plant; India's under-capacity and political aspects which hamper the correction of the problem, deregulation of Japan's power sector, and the opening of the market by the Electric Utility Industry Council's Basic Policy Committee to independent power producers. The blocking of hydro projects that would benefit India, Bangladesh, and Nepal, and the impact of the recession on Thailand, Indonesia, Malaysia and the Philippines are considered. (UK)

  7. Older Consumers in Malaysia

    Directory of Open Access Journals (Sweden)

    David R. Phillips

    2007-07-01

    Full Text Available The main objective of this study was to understand the concerns and problems faced by older people in an industrializing middle-income country, Malaysia, in their process of acquiring products to meet their everyday needs. Respondents aged 55 and over were interviewed in eight states throughout Peninsular Malaysia providing 1356 usable questionnaires; two-thirds from urban and one-third from rural areas. Education, health status, and life satisfaction were recorded. Service patronage behaviour was examined for four main categories of commonly-sought consumer goods: groceries, health supplements, apparel, eating outlets, plus selected services (public transport, vacation packages and financial services. The findings showed that older adults in Malaysia are rather discerning consumers. Many respondents are price conscious and have developed consumer attitudes with regard to attitude of staff and assistance rendered. Many display a good ability to discriminate and to select, especially on the basis of price and durability of products and many appear to be acting as effectively as consumers in any other age group.

  8. The Convolvulaceae of Malaysia, VII

    NARCIS (Netherlands)

    Ooststroom, van S.J.

    1952-01-01

    In addition to my papers on the genus Argyreia in Malaysia I can here give a few descriptions of new species, mainly from Sumatra and Borneo, and some critical notes on others. A revision of the species of Malaysia as a whole, including those of the Malay Peninsula and the Philippine Islands will be

  9. Daphniphyllum (Daphniphyllaceae) in Peninsular Malaysia

    OpenAIRE

    Kiew, R.; Rafidah, A.R.

    2008-01-01

    Three species of Daphniphyllum occur in Peninsular Malaysia: D. glaucescens Blume var. lancifolium (Hook.f.) T.C.Huang, D. laurinum (Benth.) Baill. and D. scortechinii Hook.f. Daphniphyllum glaucescens var. glaucescens and var. blumeanum (Baill. ex Müll.Arg.) J.J.Sm. do not occur in Peninsular Malaysia and specimens identified as such belong to D. glaucescens var. lancifolium.

  10. Spatial Interpolation of Historical Seasonal Rainfall Indices over Peninsular Malaysia

    Directory of Open Access Journals (Sweden)

    Hassan Zulkarnain

    2018-01-01

    Full Text Available The inconsistency in inter-seasonal rainfall due to climate change will cause a different pattern in the rainfall characteristics and distribution. Peninsular Malaysia is not an exception for this inconsistency, in which it is resulting extreme events such as flood and water scarcity. This study evaluates the seasonal patterns in rainfall indices such as total amount of rainfall, the frequency of wet days, rainfall intensity, extreme frequency, and extreme intensity in Peninsular Malaysia. 40 years (1975-2015 data records have been interpolated using Inverse Distance Weighted method. The results show that the formation of rainfall characteristics are significance during the Northeast monsoon (NEM, as compared to Southwest monsoon (SWM. Also, there is a high rainfall intensity and frequency related to extreme over eastern coasts of Peninsula during the NEM season.

  11. Spatial Interpolation of Historical Seasonal Rainfall Indices over Peninsular Malaysia

    Science.gov (United States)

    Hassan, Zulkarnain; Haidir, Ahmad; Saad, Farah Naemah Mohd; Ayob, Afizah; Rahim, Mustaqqim Abdul; Ghazaly, Zuhayr Md.

    2018-03-01

    The inconsistency in inter-seasonal rainfall due to climate change will cause a different pattern in the rainfall characteristics and distribution. Peninsular Malaysia is not an exception for this inconsistency, in which it is resulting extreme events such as flood and water scarcity. This study evaluates the seasonal patterns in rainfall indices such as total amount of rainfall, the frequency of wet days, rainfall intensity, extreme frequency, and extreme intensity in Peninsular Malaysia. 40 years (1975-2015) data records have been interpolated using Inverse Distance Weighted method. The results show that the formation of rainfall characteristics are significance during the Northeast monsoon (NEM), as compared to Southwest monsoon (SWM). Also, there is a high rainfall intensity and frequency related to extreme over eastern coasts of Peninsula during the NEM season.

  12. Long term strategy for electricity generation in Peninsular Malaysia – Analysis of cost and carbon footprint using MESSAGE

    International Nuclear Information System (INIS)

    Fairuz, S.M.C.; Sulaiman, M.Y.; Lim, C.H.; Mat, S.; Ali, B.; Saadatian, O.; Ruslan, M.H.; Salleh, E.; Sopian, K.

    2013-01-01

    Malaysia envisages becoming a developed nation by 2020. To sustain industrial expansion and attract investments Malaysia must introduce new energy strategies. These strategies should also moderate carbon footprint. The new energy strategies introduced by the government are (i) installation of nuclear power plant by 2021, (ii) import of Sarawak hydropower from 2015 and (iii) enhancement of use of renewable energy from 2015. In this paper we analyze the cost and resulting carbon footprint of energy expansion for 12 energy scenes (inclusive of new strategies) to produce electricity for Peninsular Malaysia for the period 2009–2030. We use a computer model MESSAGE to provide optimization. The best strategy is for the following accumulated percentage of energy resource in the fuel mix: 49.3% (natural gas), 28.4% (coal), 4.06% (nuclear), 2.98% (hydropower), 4.45% (renewable), 10.82% (import hydropower). The minimum cost of expanding this strategy from 2009 until 2030 is USD6.090B. The CO 2 emission index of this strategy is 0.329 t/MWh. The accumulated carbon dioxide emission for this period is 1825.96 Mton CO 2 eq. -- Highlights: •We analyzed the cost of energy expansion and resulting carbon emission using software MESSAGE. •We studied the energy situation for the next 20 years beginning 2009 for Peninsular Malaysia. •We maintained the present energy resources of natural gas, coal and internal hydropower. •We included nuclear, hydropower import and renewable energy as new strategies

  13. The Malaysia LNG experience

    International Nuclear Information System (INIS)

    Muhammed, M.

    1991-01-01

    This paper summarizes the nature of the LNG trade, the essential components and characteristics of an LNG project, and relates the Malaysia LNG experience to project realization with some emphasis on the financial aspects of the project. Twelve offshore lending institutions were involved in the total project loop providing U.S. dollar equivalents of 4.0 billions with interest rates ranging from 5% to 8%. The total project was completed on schedule and within budget except for the ships which got caught in the political development of the Malaysian petroleum industry at that time

  14. Malaysia; Background Paper

    OpenAIRE

    International Monetary Fund

    1996-01-01

    This Background Paper on Malaysia examines developments and trends in the labor market since the mid-1980s. The paper describes the changes in the employment structure and the labor force. It reviews wages and productivity trends and their effects on unit labor cost. The paper highlights that Malaysia’s rapid growth, sustained since 1987, has had a major impact on the labor market. The paper outlines the major policy measures to address the labor constraints. It also analyzes Malaysia’s recen...

  15. Malaysia in international regional relationships

    International Nuclear Information System (INIS)

    Kamarulnizam Abdullah

    2010-01-01

    The changes in the international system saw the structure and survival issues that grip the country will also change. The main challenge to the nation is how to adapt these changes that running quite rapidly and outside the country's ability to cope alone. Issues and global structural changes also affect the international system of East Asia region that contains two important sub-Southeast Asia and Northeast Asia. Changes inherent in both these sub certainly affect the foreign policy and diplomacy, security and bilateral relations between Malaysia and other countries. Malaysia is not a global power capable of changing the international system. However, Malaysia is an important country in East Asia that has contributed to the prosperity of this region. The big question is how to adapt these changes into the Malaysia international regional policy and bilateral relations? What extent international issues affecting the regional survival of the country? What is the contribution to regional stability of Malaysia? This book explores the impact of selective regional issues to Malaysia, while also discussing the role and response to changes in regional Malaysia since the country gained independence. (author)

  16. Childhood drowning in Malaysia.

    Science.gov (United States)

    Hss, Amar-Singh; Tan, Pui San; Hashim, Lina

    2014-01-01

    This study aimed to collate data on childhood drowning in Malaysia and review existing drowning prevention measures. This study used secondary data from governmental and non-governmental agencies. All reported fatal drownings from 2000 to 2007 and all reported non-fatal drownings from 2000 to 2008 were included. Data were analysed to provide understanding of the epidemiology of drowning incidents, risk factors and available preventive efforts. On average 286 (range 248-344) children died yearly due to drowning with a death rate of 3.05 per 100,000 annually. An additional average of 207 children drowned but survived annually (1.99 per 100,000). The estimated burden of drowning in children (death and non-death) is 5 per 100,000. There was no reduction in annual drowning fatalities over time. Most drowning took place in east coast regions during the annual monsoon season. It was 3.52 (2.80-4.41) times more common in boys and most prevalent among 10-14 years. Most prevalent sites of all-age drowning were seas and rivers. Limited water safety regulations are currently available in the country. This is the first comprehensive national study in Malaysia on paediatric drowning and highlights the magnitude of the problem. It calls for concerted effort to devise effective national drowning prevention measures.

  17. A pilot study on the functional performance and acceptability of an innovative female condom (Wondaleaf® in Malaysia

    Directory of Open Access Journals (Sweden)

    Ting RS

    2018-01-01

    Full Text Available Rachel Sing-Kiat Ting,1 Ee-Lynn Wong,2 Jessie Koh-Sing Tnay3 1School of Sociology, China University of Political Sciences and Law, Beijing, China; 2InPsych Psychological and Counselling Services, Kuala Lumpur, 3Institute of Borneo Studies, Universiti Malaysia Sarawak, Sarawak, Malaysia Background: Female condom (FC has been available for over 30 years, but it still lacks wide acceptability. To overcome misdirection and invagination occurring in FC and to provide a wider area of protection, Wondaleaf® (WL, a new-generation adhesive FC, was recently invented. This pioneering study sought to assess the acceptability and functional performance of WL among Malaysian women. Methods: A mixed method survey was conducted in three cities of Malaysia, recruiting sexually active heterosexual women, aged 18–50, by snowball sampling method. Participants were provided with WL and initially surveyed to rate its performance in five coital usages over 2 months. After that, the participants underwent a second survey to rate their satisfaction and acceptability toward WL. Descriptive statistics on clinical failure rates were tabulated with correlational analysis performed to identify major variables contributing to WL’s functional performance and acceptability. Results: Out of the 51 enrolled participants, 31 women completed the required surveys. WL’s total clinical failure rate was 2.60% (out of 155 condom uses with above-average ratings of functional performance. The ease of use significantly correlated with ratings of no slippage and no misdirection. The confidence in WL’s safety features significantly correlated with a sense of empowerment and protection. Conclusion: WL has a relatively low risk of clinical failures and an overall favorable acceptability among Malaysian women. However, this study also showed that its future usage largely depends on partner acceptability. It may have the potential of complementing the existing barrier toward

  18. Information and Communications Technology in Asia Pacific Countries: implications for small and medium enterprises in Malaysia

    Directory of Open Access Journals (Sweden)

    Tim Beal

    2002-11-01

    Full Text Available Information communications and technology (ICT is transforming the environment in which SMEs operate and changing the paradigms of value creation, customer satisfaction and business effectiveness. This paper attempts to explore global and Asia Pacific ICT usage and the major factors influencing SMEs. It focuses particularly on Malaysia where the development of ICT usage amongst SMEs is one of the main policy items in the agenda of the Malaysian government. It describes a survey of SMEs in north and eastern peninsula Malaysia 1999-2000.

  19. Aliphatic hydrocarbons in surface sediments from South China Sea off Kuching Division, Sarawak

    International Nuclear Information System (INIS)

    Hafidz Yusoff; Zaini Assim; Samsur Mohamad

    2012-01-01

    Eighteen surface sediment samples collected from South China Sea off Kuching Division, Sarawak were analyzed for aliphatic hydrocarbons. These hydrocarbons were recovered from sediment by Soxhlet extraction method and then analyzed using gas chromatography equipped with mass spectrometer (GC/ MS). Total concentrations of aliphatic hydrocarbons in surface sediments from South China Sea off Kuching division are ranged from 35.6 μg/ g to 1466.1 μg/ g dry weights. The sediments collected from Bako Bay, Kuching showed high concentrations of total aliphatic hydrocarbons. Several molecular indices were used to predict the predominant sources of hydrocarbons. Carbon preference index (CPI) value revealed widespread anthropogenic input in this study area (CPI= 0 to 4.1). The ratio of C 31 / C 19 and C 29 / C 31 indicated that major input of aliphatic hydrocarbon mostly transfer by lateral input to the marine environment than atmospheric movements. Generally, the concentrations of aliphatic hydrocarbons in sediment from South China Sea off Kuching division are generally higher compare to other area in the world. (author)

  20. Concentrations of Mn and Fe in the Sediment Cores of Sarawak and Sabah Coastal Waters

    International Nuclear Information System (INIS)

    Zal Uyun Wan Mahmood; Zaharudin Ahmad; Che Abdul Rahim Mohamed

    2010-01-01

    Sediment cores were taken at eight stations along Sarawak and Sabah coastal waters using a gravity box corer on July 2004. The sediment cores were cut into 2 cm interval for measurement of Mn and Fe concentration using the Inductive Couple Plasma-Mass Spectrometer (ICP-MS). Overall, the sediment cores contained much mud which include a mixture of silt (46 - 67 %) and clay (18 - 53 %) compared to sand (0.4 - 16 %). The concentrations of Mn and Fe were in the range of 154 - 366 μg/ g and 0.9 - 3.4 %, respectively. The variation was studied by ANOVA, which showed a significant difference (p = 0.000) for both of Mn and Fe concentrations at all sampling stations. In those ranges, Fe concentration was higher compared to Mn. It is believed that dissolving and diluting process influenced the concentration of Mn in the water column and sediment. Fe showed a significant correlation (r > 0.5, p geo < 1 and classification 0 - 1. (author)

  1. Malaysia-China Friendship Evening 2009”Held

    Institute of Scientific and Technical Information of China (English)

    Our Staff Reporter

    2009-01-01

    <正>The CPAFFC, the Embassy of Malaysia in China, the Malaysia-China Friendship Association and the Malaysia-China Business Council jointly hosted the "Malaysia-China Friendship Evening 2009"at the Conference Hall of the Chi-

  2. Manufacturing halal in Malaysia

    DEFF Research Database (Denmark)

    Fischer, Johan

    2016-01-01

    In Arabic, halal literally means ‘permissible’ or ‘lawful’. Halal is no longer an expression of an esoteric form of production, trade and consumption, but part of a huge and expanding globalized market in which certification, standards and technoscience play important roles. Over the past three...... production, trade and consumption. Based on fieldwork in Malaysia, this article explores how manufacturing companies understand and practise halal certification, standards and technoscience. I argue that while existing studies of halal overwhelmingly explore micro-social aspects such as the everyday...... consumption among Muslim groups, ‘the bigger institutional picture’ that frames such consumption production and regulation are not well understood. By studying halal production, I provide an ethnography of the overlapping technologies and techniques of production and regulation that together warrant a product...

  3. Radioisotope production in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Wan Awang, Wan Anuar [Medical Technology Div., Malaysian Inst. for Nuclear Technology Research (MINT) (Malaysia)

    1998-10-01

    Production of Mo-99 by neutron activation of Mo-99 in Malaysia began as early as 1984. Regular supply of the Tc-99m extracted from it to the hospitals began in early 1988 after going through formal registration with the Malaysian Ministry of Health. Initially, the weekly demand was about 1.2 Ci of Mo-99 which catered the needs of 3 nuclear medicine centres. Sensitive to the increasing demand of Tc-99m, we have producing our own Tc-99m generator from imported TeO{sub 2} because irradiation TeO{sub 2} with our reactor give low yield of I-131. We have established the production of radioisotope for industrial use. By next year, Sm-153 EDTMP will be produce after we have license from our competent authority. (author)

  4. Telecommunication Value Network in Malaysia

    OpenAIRE

    Ong, Li Chien

    2009-01-01

    Business network is believed to offer a superior way of managing the challenges related to the uncertainty and complexity of the contemporary business environment in Malaysia telecommunication industry. This study strives to analyze the value business network in Malaysia telecommunication industry with emphasize on the market leader, Maxis Communication Bhd in its mobile content services. The business network represents the form of organization where the focal company focuses on certain key a...

  5. Different techniques of excess 210Pb for sedimentation rate estimation in the Sarawak and Sabah coastal waters

    International Nuclear Information System (INIS)

    Zal Uyun Wan Mahmood; Zaharudin Ahmad; Abdul Kadir Ishak; Che Abdul Rahim Mohamed

    2010-01-01

    Sediment core samples were collected at eight stations in the Sarawak and Sabah coastal waters using a gravity box corer to estimate sedimentation rates based on the activity of excess 210 Pb. The sedimentation rates derived from four mathematical models of CIC, Shukla-CIC, CRS and ADE were generally shown in good agreement with similar or comparable value at all stations. However, based on statistical analysis of independent sample t-test indicated that Shukla-CIC model was the most accurate, reliable and suitable technique to determine the sedimentation rate in the study area. (author)

  6. Building a discovery partnership with Sarawak Biodiversity Centre: a gateway to access natural products from the rainforests.

    Science.gov (United States)

    Yeo, Tiong Chia; Naming, Margarita; Manurung, Rita

    2014-03-01

    The Sarawak Biodiversity Centre (SBC) is a state government agency which regulates research and promotes the sustainable use of biodiversity. It has a program on documentation of traditional knowledge (TK) and is well-equipped with facilities for natural product research. SBC maintains a Natural Product Library (NPL) consisting of local plant and microbial extracts for bioprospecting. The NPL is a core discovery platform for screening of bioactive compounds by researchers through a formal agreement with clear benefit sharing obligations. SBC aims to develop partnerships with leading institutions and the industries to explore the benefits of biodiversity.

  7. PERAN INTERNATIONAL CIVIL AVIATION ORGANIZATION ATAS PENERBANGAN SIPIL KOMERSIAL INTERNASIONAL DIATAS WILAYAH KONFLIK (STUDI KASUS ATAS PENEMBAKAN PESAWAT MALAYSIA AIRLANES MH17 DI RUANG UDARA UKRAINA 2014)

    OpenAIRE

    Nopansyah, Jaka

    2015-01-01

    This research entitled"The role of the international civil aviation organization on international commercial civil aviation over the area of conflict" (A case study on Malaysia Airlines MH17 flight shooting in the air space of Eastern Ukraine in 2014) The research method used is Normative Research, Library Research at Atmajaya University Yogyakarta, And Internet Media. MH17 Malaysian plane crash in Ukraine 2014, All 298 people on board a Malaysia Airlines plane died after th...

  8. Health Information in Malay (Bahasa Malaysia)

    Science.gov (United States)

    ... You Are Here: Home → Multiple Languages → Malay (Bahasa Malaysia) URL of this page: https://medlineplus.gov/languages/malay.html Health Information in Malay (Bahasa Malaysia) To use the sharing features on this page, ...

  9. Situation Report--Australia, Burundi, Cambodia, Mexico, Montserrat, Nicaragua, Papua & New Guinea, Republic of Vietnam, Sabah, Sarawak, Sierra Leone, Tahiti, Tonga.

    Science.gov (United States)

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in fourteen foreign countries are presented in these situation reports. Countries included are Australia, Burundi, Cambodia, Mexico, Montserrat, Nicaragua, Papua and New Guines, Republic of Vietnam, Sabah, Sarawak, Sierra Leone, Tahiti (French Polynesia), and Tonga. Information is provided under two…

  10. Variation of 210Po and 210Pb Profile in the Sediment Core of Sarawak Coastal Waters

    International Nuclear Information System (INIS)

    Zal U'yun Wan Mahmood; Che Abd Rahim Mohamed; Zaharudin Ahmad; Abdul Kadir Ishak

    2008-01-01

    This study was performed to observe the variation in the distribution of 210 Po and 210 Pb through their activity vertical profile and 210 Po/ 210 Pb activity ratio in the sediment cores that were taken at some sampling stations in the Sarawak coastal waters. It was found that the distribution profile of those radionuclide in the sediment cores varied depending on the sampling location and ANOVA analysis shows significant difference at 95% confidence level for activities of 210 Po (p = 0.000), 210 Pb (p = 0.035) and 210 Po/ 210 Pb (p = 0.000) at all study locations. Generally, the measured activity of 210 Po and 210 Pb ranged from 337 to 2460 Bq/ kg, 11 to 84 Bq/ kg at SR 01; 224 to 2008 Bq/ kg, 6 to 80 Bq/ kg at SR 02; 119 to 1595 Bq/ kg, 6 to 84 Bq/ kg at SR 03; 241 to 2294 Bq/ kg, 5 to 82 Bq/ kg at SR 04 and 175 to 1340 Bq/ kg, 4 to 44 Bq/ kg at SR 05, respectively. In those range it was found that 210 Po activities were higher than 210 Pb with average of 210 Po/ 210 Pb ratios at all stations were from 20 to 35. The variation in the distribution profile for the radionuclides are believed to be influenced by some environmental factors and have strong correlation between the radionuclide distribution and the sediment composition of silt ( 210 Po: r = 0.701 and 210 Pb: r = 0.648), water depth ( 210 Po: r = -0.647) and the distance from the sampling station to the main land ( 210 Po: r = 0.746 and 210 Pb: r = 0.975). Those factors are a major contributions on the variation of 210 Po and 210 Pb in the samples. (author)

  11. Problem Etnisitas India Dalam Cerita Pendek Malaysia

    OpenAIRE

    M. Shoim Anwar

    2015-01-01

    Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998), terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara histori...

  12. Water quality monitoring: A comparative case study of municipal and Curtin Sarawak's lake samples

    International Nuclear Information System (INIS)

    Kumar, A Anand; Prabakaran, K; Nagarajan, R; Jaison, J; Chan, Y S

    2016-01-01

    In this study, particle size distribution and zeta potential of the suspended particles in municipal water and lake surface water of Curtin Sarawak's lake were compared and the samples were analysed using dynamic light scattering method. High concentration of suspended particles affects the water quality as well as suppresses the aquatic photosynthetic systems. A new approach has been carried out in the current work to determine the particle size distribution and zeta potential of the suspended particles present in the water samples. The results for the lake samples showed that the particle size ranges from 180nm to 1345nm and the zeta potential values ranges from -8.58 mV to -26.1 mV. High zeta potential value was observed in the surface water samples of Curtin Sarawak's lake compared to the municipal water. The zeta potential values represent that the suspended particles are stable and chances of agglomeration is lower in lake water samples. Moreover, the effects of physico-chemical parameters on zeta potential of the water samples were also discussed. (paper)

  13. Pore Type Classification on Carbonate Reservoir in Offshore Sarawak using Rock Physics Model and Rock Digital Images

    International Nuclear Information System (INIS)

    Lubis, L A; Harith, Z Z T

    2014-01-01

    It has been recognized that carbonate reservoirs are one of the biggest sources of hydrocarbon. Clearly, the evaluation of these reservoirs is important and critical. For rigorous reservoir characterization and performance prediction from geophysical measurements, the exact interpretation of geophysical response of different carbonate pore types is crucial. Yet, the characterization of carbonate reservoir rocks is difficult due to their complex pore systems. The significant diagenesis process and complex depositional environment makes pore systems in carbonates far more complicated than in clastics. Therefore, it is difficult to establish rock physics model for carbonate rock type. In this paper, we evaluate the possible rock physics model of 20 core plugs of a Miocene carbonate platform in Central Luconia, Sarawak. The published laboratory data of this area were used as an input to create the carbonate rock physics models. The elastic properties were analyzed to examine the validity of an existing analytical carbonate rock physics model. We integrate the Xu-Payne Differential Effective Medium (DEM) Model and the elastic modulus which was simulated from a digital carbonate rock image using Finite Element Modeling. The results of this integration matched well for the separation of carbonate pore types and sonic P-wave velocity obtained from laboratory measurement. Thus, the results of this study show that the integration of rock digital image and theoretical rock physics might improve the elastic properties prediction and useful for more advance geophysical techniques (e.g. Seismic Inversion) of carbonate reservoir in Sarawak

  14. International Atomic Energy Agency: activities in Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Hayati, Ainul [Nuclear Energy Unit, Bangi, Selangor (Malaysia)

    1994-12-31

    The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989.

  15. International Atomic Energy Agency: activities in Malaysia

    International Nuclear Information System (INIS)

    Ainul Hayati

    1994-01-01

    The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989

  16. Focus on Malaysia.

    Science.gov (United States)

    Forman, L T

    1979-01-01

    Prospects for a stable, prospering economy in Malaysia appear threatened by an uneven distribution of wealth among non-Malay, particularly Chinese, residents. Native Malays, Bumiputra, have benefitted from the government's 20 year New Economic Policy, a system of subsidies to correct economic imbalances among the races. Malay corporate ownership has increased from 2.4% in 1970 to 28% in 1979. However, equity must increase by 26% annually to meet NEP targets. Without the GNP expanding 7-8% yearly, the government will be tempted to acquire assets at low prices. 70% of the total Malay ownership was held by public enterprises holding equity in trust. An elite group of Bumiputra will own a fair number of shares reserved by 1970. 1/5 of the population of Kuala Lumpur are squatters. Among these groups, communal tension is high. The Chinese businessmen are most resistant to native management. Since they control private domestic investment, they have political power. The Industrial Coordination Act (ICA), which gives power to civil servants through a licensing system, protects the system. The Asian Foundation supports management training, business development, and university demonstration projects in legal aid, solar energy, and community psychiatry. Malaysian competence in English enables widespread distribution of the Books for Asia program.

  17. MIGRASI INTERNASIONAL PERILAKU PEKERJA MIGRAN DI MALAYSIA DAN PEREMPUAN DITINGGAL MIGRASI DI LOMBOK TIMUR

    OpenAIRE

    Hadi Sabari Yunus, dan Sri Rum Giyarsih, Lalu Tajuddin, R. Rijanta,

    2016-01-01

    The goal of the research is to examine the behavior of migrant workers and PADMI. The research is located in Eastern Malaysia and East Lombok Regency by using case study method to explore the objects deeply, detailed and complete. Data were collected through observation and in-depth interview with the migrant workers and PADMI. The research showed that Ringgit or Malaysian currency contribute significant influence to the migrant workers’ behavior, which showed by the change of the...

  18. History of Neurosurgery in Malaysia.

    Science.gov (United States)

    Raffiq, Azman; Abdullah, Jafri Malin; Haspani, Saffari; Adnan, Johari Siregar

    2015-12-01

    The development of neurosurgical services and training in Malaysia began in 1963, with the first centre established in its capital city at Hospital Kuala Lumpur, aimed to provide much needed neurosurgical services and training in the field of neurology and neurosurgery. This center subsequently expanded in 1975 with the establishment of the Tunku Abdul Rahman Neuroscience Institute (IKTAR); which integrated the three allied interdependent disciplines of neurosurgery, neurology and psychiatry. The establishment of this institute catalysed the rapid expansion of neurosurgical services in Malaysia and paved the way for development of comprehensive training for doctors, nurses, and paramedics. This culminated in the establishments of a local comprehensive neurosurgery training program for doctors in 2001; followed by a training program for nurses and paramedics in 2006. To date, there are more than 60 neurosurgeons providing expert care in 11 centers across Malaysia, along with trained personnel in the field of neurosciences.

  19. Developing a Malaysia flood model

    Science.gov (United States)

    Haseldine, Lucy; Baxter, Stephen; Wheeler, Phil; Thomson, Tina

    2014-05-01

    Faced with growing exposures in Malaysia, insurers have a need for models to help them assess their exposure to flood losses. The need for an improved management of flood risks has been further highlighted by the 2011 floods in Thailand and recent events in Malaysia. The increasing demand for loss accumulation tools in Malaysia has lead to the development of the first nationwide probabilistic Malaysia flood model, which we present here. The model is multi-peril, including river flooding for thousands of kilometres of river and rainfall-driven surface water flooding in major cities, which may cause losses equivalent to river flood in some high-density urban areas. The underlying hazard maps are based on a 30m digital surface model (DSM) and 1D/2D hydraulic modelling in JFlow and RFlow. Key mitigation schemes such as the SMART tunnel and drainage capacities are also considered in the model. The probabilistic element of the model is driven by a stochastic event set based on rainfall data, hence enabling per-event and annual figures to be calculated for a specific insurance portfolio and a range of return periods. Losses are estimated via depth-damage vulnerability functions which link the insured damage to water depths for different property types in Malaysia. The model provides a unique insight into Malaysian flood risk profiles and provides insurers with return period estimates of flood damage and loss to property portfolios through loss exceedance curve outputs. It has been successfully validated against historic flood events in Malaysia and is now being successfully used by insurance companies in the Malaysian market to obtain reinsurance cover.

  20. Taking Sides: The Frames of Online Media on the Bilateral Relationship Between Indonesia and Malaysia

    Directory of Open Access Journals (Sweden)

    Gatut Priyowidodo

    2014-08-01

    Full Text Available The relations between Indonesia and Malaysia are always full of dynamics. Indonesia is always known as old brother of Malaysia since it has similar history, religion also socio cultural background. Some decades show that the decline of relationship of both countries. Another time, as ASEAN members, the two countries devote their nationalities to purify their collective identities as Eastern nations. The objective of the research is to extricate the construction of Kompas online and Utusan online toward news coverage of the borders dispute between Indonesia- Malaysia in 2010. This research is proposed to examine central issues which reported by Kompas online and Utusan online consistently. As a media, Kompas coverage dominates circulation nationally. Kompas.com was the pioneer of online news in Indonesia and was born in reformation era. Utusan is a prominent media industry in Malaysia that was conducted by UMNO as the ruling party in Malaysia for some periods. The method used in this research is framing method by Robert N. Entman’s which consists of four steps identification: defining problem, diagnosing causes, moral judgment and a treatment recommendation. This research found that Kompas news covered the border dispute must be negotiated as recognition of Indonesia dignity. On the contrary, Utusan’s spectacle focused on the Indonesian demonstrators anarchism during the dispute. Keywords: Online Media, media construction, the border dispute, Indonesia-Malaysia’s Bilateral Relations

  1. Proton - Malaysia's national car project

    DEFF Research Database (Denmark)

    Fleming, Daniel; Søborg, Henrik

    2017-01-01

    The rise and development of the Malaysian national car project. How this project has become an esential part of the industrial development in Malaysia and how it has underpinned a growing middle class consumption culture with house and car as it pivotal goods.......The rise and development of the Malaysian national car project. How this project has become an esential part of the industrial development in Malaysia and how it has underpinned a growing middle class consumption culture with house and car as it pivotal goods....

  2. Norm waste management in Malaysia

    International Nuclear Information System (INIS)

    Muhamat Omar

    2000-01-01

    There are a number of industries generating NORM wastes in Malaysia. These include oil and gas and minerals/ores processing industries. A safe management of radioactive wastes is required. The existing guidelines are insufficient to help the management of oil and gas wastes. More guidelines are required to deal with NORM wastes from minerals/ores processing industries. To ensure that radioactive wastes are safely managed and disposed of, a National Policy on the Safe Management of Radioactive Waste is being developed which also include NORM waste. This paper describes the current status of NORM waste management in Malaysia. (author)

  3. Evaluation of cadmium bioaccumulation and translocation by Hopea ...

    African Journals Online (AJOL)

    parisa

    2012-04-10

    Apr 10, 2012 ... 6Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Sarawak, Malaysia. Accepted 19 December, 2011. Cadmium (Cd) contamination has an adverse effect on soil productivity and ...... J. Food, Agric.

  4. Methane and CO2 fluxes from peat soil, palm stems and field drains in two oil palm plantations in Sarawak, Borneo, on different tropical peat soil types.

    Science.gov (United States)

    Manning, Frances; Lip Khoon, Kho; Hill, Tim; Arn Teh, Yit

    2017-04-01

    Oil palm plantations have been expanding rapidly on tropical peat soils in the last 20 years, with 50 % of SE Asian peatlands now managed as industrial or small-holder plantations, up from 11% in 1990. Tropical peat soils are an important carbon (C) store, containing an estimated 17 % of total peatland C. There are large uncertainties as to the soil C dynamics in oil palm plantations on peat due to a shortage of available data. It is therefore essential to understand the soil C cycle in order to promote effective management strategies that optimise yields, whilst maintaining the high C storage capacity of the soil. Here we present CO2 and CH4 fluxes from two oil palm plantations in Sarawak, Malaysia on peat soils. Data were collected from different surface microforms within each plantation that experienced different surface management practices. These included the area next to the palm, in bare soil harvest paths, beneath frond piles, underneath cover crops, from the surface of drains, and from palm stems. Data were collected continuously over one year and analysed with different environmental variables, including soil temperature, WTD, O2, soil moisture and weather data in order to best determine the constraints on the dataset. Total soil respiration (Rtot) varied between 0.09 and 1.59 g C m-2 hr-1. The largest fluxes (0.59 - 1.59 g C m-2 hr-1) were measured next to the palms. Larger CO2 fluxes were observed beneath the cover crops than in the bare soil. This trend was attributed to priming effects from the input of fresh plant litter and exudates. Peat soil type was shown to have significantly different fluxes. The different plantations also had different environmental drivers best explaining the variation in Rtot - with soil moisture being the most significant variable on Sabaju series soil and soil temperature being the most significant environmental variable in the plantation with the Teraja series soil. Rtot was shown to reduce significantly with increasing

  5. Assessment Profile of Malaysia: High-Stakes External Examinations Dominate

    Science.gov (United States)

    Ong, Saw Lan

    2010-01-01

    Malaysia is a federation of 13 states located in South-east Asia. The country consists of two geographical regions; Peninsular Malaysia (also known as West Malaysia) and Malaysian Borneo (also known as East Malaysia) separated by the South China Sea. The educational administration in Malaysia is highly centralised with four hierarchical levels;…

  6. The Convolvulaceae of Malaysia, I

    NARCIS (Netherlands)

    Ooststroom, van S.J.

    1938-01-01

    This is the first contribution to a series of papers dealing with the Convolvulaceae of Malaysia (Malay Peninsula and Archipelago, Philippines and New Guinea). As far as possible the contributions will be published in accordance with the systematical arrangement of the genera. For a survey on this

  7. Anurans Collected in West Malaysia

    DEFF Research Database (Denmark)

    Cedhagen, Tomas

    1997-01-01

    Distributional records and natural history noles are given for anurans collected in West Malaysia 1976. Rano baramica was observed when it was caught by an Ahaetulfa nasula (Serpentes: Colubridae). Rhacophorus leucomystax, Limnonectes limnociulris and Microhyla heymonsi were all found al night on...

  8. The Mountaineer-Malaysia Connection.

    Science.gov (United States)

    Young, Jeff

    1997-01-01

    A 26-day summer field course of West Virginia University's (WVU) Recreation and Parks Department took students to Malaysia's mountains and rainforests to observe how Malaysians are managing national parks, problem elephants, and population pressures on parks. The adventure provided powerful learning experiences. Further exchanges between WVU and…

  9. Review of sarcocystosis in Malaysia.

    Science.gov (United States)

    Kan, S P; Pathmanathan, R

    1991-12-01

    Sarcocystis is a tissue coccidian with an obligatory two-host life cycle. The sexual generations of gametogony and sporogony occur in the lamina propria of the small intestine of definitive hosts which shed infective sporocysts in their stools and present with intestinal sarcocystosis. Asexual multiplication occurs in the skeletal and cardiac muscles of intermediate hosts which harbor Sarcocystis cysts in their muscles and present with muscular sarcocystosis. In Malaysia, Sarcocystis cysts have been reported from many domestic and wild animals, including domestic and field rats, moonrats, bandicoots, slow loris, buffalo, and monkey, and man. The known definitive hosts for some species of Sarcocystis are the domestic cat, dog and the reticulated python. Human muscular sarcocystosis in Malaysia is a zoonotic infection acquired by contamination of food or drink with sporocysts shed by definitive hosts. The cysts reported in human muscle resembled those seen in the moonrat, Echinosorex gymnurus, and the long-tailed monkey, Macaca fascicularis. While human intestinal sarcocystosis has not been reported in Malaysia so far, it can be assumed that such cases may not be infrequent in view of the occurrence of Sarcocystis cysts in meat animals, such as buffalo. The overall seroprevalence of 19.8% reported among the main racial groups in Malaysia indicates that sarcocystosis (both the intestinal and muscular forms) may be emerging as a significant food-borne zoonotic infection in the country.

  10. Primary Teacher Education in Malaysia

    Science.gov (United States)

    Ching, Chin Phoi; Yee, Chin Peng

    2012-01-01

    In Malaysia the training of primary school teachers is solely carried out by teacher training institutes which offer the Bachelor of Teaching with Honors (Primary education) program and was first launched in 2007. This program prepares primary school teachers specializing in various subjects or major and is carried out in 27 teacher training…

  11. Imported yaws in Johor, Malaysia.

    Science.gov (United States)

    Mohamed, K N

    1988-12-01

    Yaws was detected in a six-member family in the southern Malaysia state of Johor. This stresses the need to be vigilant against a long-forgotten disease of childhood which was of great public health concern in the past.

  12. Malaysia Economic Monitor, June 2013

    OpenAIRE

    World Bank

    2013-01-01

    Following a strong performance in 2012, Malaysia's economy hit a soft patch in the first quarter of 2013. Economic growth has been supported by the strong, broad-based performance of domestic consumption and investment from public and private sources. The acceleration of investment growth has been a key feature of the recent growth trend. Public and private consumption has also underpinned...

  13. Daphniphyllum (Daphniphyllaceae) in Peninsular Malaysia

    NARCIS (Netherlands)

    Kiew, R.; Rafidah, A.R.

    2008-01-01

    Three species of Daphniphyllum occur in Peninsular Malaysia: D. glaucescens Blume var. lancifolium (Hook.f.) T.C.Huang, D. laurinum (Benth.) Baill. and D. scortechinii Hook.f. Daphniphyllum glaucescens var. glaucescens and var. blumeanum (Baill. ex Müll.Arg.) J.J.Sm. do not occur in Peninsular

  14. Nuclear energy in Malaysia

    International Nuclear Information System (INIS)

    Jacob, F.X.

    1996-01-01

    The Malaysian Vision 2020 envisages doubling of the its economy every ten years for the next three decades. The Second Outline Perspective plan 1991-2000 (OPP2), also known as the National Development Policy (NDP) will set the pace to enable Malaysia to become a fully developed nation by the year 2020. The Malaysian economy is targeted to grow at 7 percent per annum in the decade of OPP2. In view of the targets set under Vision 2020, it is important to ensure that energy does not become a constraint to growth, and this sector develops in a least cost basis. Energy is crucial for industrialization and no modern industrial state can function without it. The paper presents a description of the main utilities in the country. Their installed capacities, maximum demand, generation mix and customers served are discussed. The electricity demand forecast till the year 2020 is presented. The paper presents this for 4 scenarios - a low growth, business as usual scenario, a moderate growth, business as usual scenario, a moderate growth, energy efficient scenario and a targeted growth, energy efficient scenario. The energy resources in the country is described together with its energy policy. The country's four-fuel policy is elaborated with the various options discussed. The environmental and pricing policies with regards to energy is also briefly given. Finally the nuclear option is presented in this context of the country's energy policy. The country had undertaken various studies for the nuclear option. These studies are given in the paper. The purpose of these studies and what the government decided is also discussed. Finally the prospects for the nuclear option in the future for the country is discussed. It is concluded that while, for the present, the nuclear option is not considered by the government, this may not be so in the future. The various reasons for this is given and the paper concludes that it may be prudent to keep this option under constant review. (J.P.N.)

  15. An integrated study of geochemistry and mineralogy of the Upper Tukau Formation, Borneo Island (East Malaysia): Sediment provenance, depositional setting and tectonic implications

    Science.gov (United States)

    Nagarajan, Ramasamy; Roy, Priyadarsi D.; Kessler, Franz L.; Jong, John; Dayong, Vivian; Jonathan, M. P.

    2017-08-01

    An integrated study using bulk chemical composition, mineralogy and mineral chemistry of sedimentary rocks from the Tukau Formation of Borneo Island (Sarawak, Malaysia) is presented in order to understand the depositional and tectonic settings during the Neogene. Sedimentary rocks are chemically classified as shale, wacke, arkose, litharenite and quartz arenite and consist of quartz, illite, feldspar, rutile and anatase, zircon, tourmaline, chromite and monazite. All of them are highly matured and were derived from a moderate to intensively weathered source. Bulk and mineral chemistries suggest that these rocks were recycled from sedimentary to metasedimentary source regions with some input from granitoids and mafic-ultramafic rocks. The chondrite normalized REE signature indicates the presence of felsic rocks in the source region. Zircon geochronology shows that the samples were of Cretaceous and Triassic age. Comparable ages of zircon from the Tukau Formation sedimentary rocks, granitoids of the Schwaner Mountains (southern Borneo) and Tin Belt of the Malaysia Peninsular suggest that the principal provenance for the Rajang Group were further uplifted and eroded during the Neogene. Additionally, presence of chromian spinels and their chemistry indicate a minor influence of mafic and ultramafic rocks present in the Rajang Group. From a tectonic standpoint, the Tukau Formation sedimentary rocks were deposited in a passive margin with passive collisional and rift settings. Our key geochemical observation on tectonic setting is comparable to the regional geological setting of northwestern Borneo as described in the literature.

  16. A preliminary checklist of the freshwater snails of Sabah (Malaysian Borneo) deposited in the BORNEENSIS collection, Universiti Malaysia Sabah

    Science.gov (United States)

    Ng, Ting Hui; Dulipat, Jasrul; Foon, Junn Kitt; Lopes-Lima, Manuel; Alexandra Zieritz; Liew, Thor-Seng

    2017-01-01

    Abstract Sabah, a Malaysian state at the north-eastern tip of Borneo, is situated in one of the Earth’s biodiversity hotspots yet its freshwater gastropod diversity remains poorly known. An annotated checklist of the freshwater gastropods is presented, based on specimens deposited in the BORNEENSIS collection of the Institute for Tropical Biology and Conservation at Universiti Malaysia Sabah, Malaysia. A KMZ file is also provided, which acts as a repository of digital images and complete collection data of all examined material, so that it can be shared and adapted to facilitate future research. PMID:28769673

  17. A preliminary checklist of the freshwater snails of Sabah (Malaysian Borneo deposited in the BORNEENSIS collection, Universiti Malaysia Sabah

    Directory of Open Access Journals (Sweden)

    Ting Hui Ng

    2017-05-01

    Full Text Available Sabah, a Malaysian state at the north-eastern tip of Borneo, is situated in one of the Earth’s biodiversity hotspots yet its freshwater gastropod diversity remains poorly known. An annotated checklist of the freshwater gastropods is presented, based on specimens deposited in the BORNEENSIS collection of the Institute for Tropical Biology and Conservation at Universiti Malaysia Sabah, Malaysia. A KMZ file is also provided, which acts as a repository of digital images and complete collection data of all examined material, so that it can be shared and adapted to facilitate future research.

  18. Old age mortality in Eastern and South-Eastern Asia

    Directory of Open Access Journals (Sweden)

    Danan Gu

    2013-11-01

    Full Text Available Background: Eastern and South-Eastern Asian countries have witnessed a marked decline in old age mortality in recent decades. Yet no studies have investigated the trends and patterns in old age morality and cause-of-death in the region. Objective: We reviewed the trends and patterns of old age mortality and cause-of-death for countries in the region. Methods: We examined data on old age mortality in terms of life expectancy at age 65 and age-specific death rates from the 2012 Revision of the World Population Prospects for 14 countries in the region (China, Hong Kong, Democratic People's Republic of Korea, Indonesia, Japan, Lao People's Democratic Republic, Myanmar, Malaysia, Mongolia, Philippines, Republic of Korea, Singapore, Thailand, and Viet Nam and data on cause-of-death from the WHO for five countries (China, Hong Kong, Japan, Republic of Korea, and Singapore from 1980 to 2010. Results: While mortality transitions in these populations took place in different times, and at different levels of socioeconomic development and living environment, changes in their age patterns and sex differentials in mortality showed certain similarities: women witnessed a similar decline to men in spite of their lower mortality, and young elders had a larger decline than the oldest-old. In all five countries examined for cause-of-death, most of the increases in life expectancy at age 65 in both men and women were attributable to declines in mortality from stroke and heart disease. GDP per capita, educational level, and urbanization explained much of the variations in life expectancy and cause-specific mortality, indicating critical contributions of these basic socioeconomic development indicators to the mortality decline over time in the region. Conclusions: These findings shed light on the relationship between epidemiological transition, changing age patterns of mortality, and improving life expectancy in these populations.

  19. The age, palaeoclimate, palaeovegetation, coal seam architecture/mire types, paleodepositional environments and thermal maturity of syn-collision paralic coal from Mukah, Sarawak, Malaysia

    Science.gov (United States)

    Sia, Say-Gee; Abdullah, Wan Hasiah; Konjing, Zainey; Koraini, Ahmad Munif

    2014-02-01

    The Mukah coal accumulated in the Balingian Formation where the time-stratigraphic position is poorly defined by fauna, though a probable Late Miocene age has always been assigned to this formation. Samples collected in the present study that yielded an abundance of Casuarina pollen associated with occurrences of Dacrydium, Stenochlaena palustris, Florschuetzia levipoli and also Stenochlaena areolaris spores, compare closely to zone PR9 of the palynological zonation of the Malay Basin, and can be tied to depositional sequences of Malay Basin Seismic sequences I2000/I3000, indicating an Early Miocene age for the studied coal. The Early Miocene age shows that the Mukah coal was formed during the collision between Luconia Block-Dangerous Grounds with the Borneo that lasted from Late Eocene to late Early Miocene. The rapid increase of deposition base-level caused by the collision is clearly reflected by the architecture of the Mukah coal seams that were generally thin, and also by the reverse order of the paleo-peat bodies.

  20. Distribution, classification, petrological and related gochemical (SRA) characteristics of a tropical lowland peat dome in the Kota Samarahan-Asajaya area, West Sarawak, Malaysia

    Science.gov (United States)

    Zulkifley, Mohamad Tarmizi Mohamad; Fatt, Ng Tham; Abdullah, Wan Hasiah; Raj, John Kuna; Paramanathan Param, S.; Hashim, Roslan; Ashraf, Muhammad Aqeel

    2013-06-01

    Petrographic studies indicate that lateral variations in the decomposition levels of peat are associated with the predominantly occurring peat macerals. Source Rock Analyzer (SRA) results indicate lateral variation in peat organic matter types from type II to III and back again to type II, occurring laterally within the top 0-m to 0.5-m layer at the basin margin to the midsection and further towards the near-center areas of the peat dome. This variation is most likely caused by a combination of factors: (a) Horizontal zonation and lateral variation of the dominant species of plant assemblages (b) Fibric (marginal) peats and hemic to sapric peats associated with type II organic matter (kerogen). Sample organic matter (coal-equivalent kerogen) typing indicates that the relative abundance of phytoclasts and palynomorphs generally supports the organic matter classification obtained by the SRA method. Lateral variations in the peat organic matter types may support the lateral vegetation variation concept. The classification of peat organic matter types (interpreted from visual analyses of palynological slides) occurring from the basin periphery to the mid-section and further towards the basin center yields organic matter of type II to type III and mixed types II to III (coal kerogen-equivalent), respectively.

  1. Facies associations, depositional environments and stratigraphic framework of the Early Miocene-Pleistocene successions of the Mukah-Balingian Area, Sarawak, Malaysia

    Science.gov (United States)

    Murtaza, Muhammad; Rahman, Abdul Hadi Abdul; Sum, Chow Weng; Konjing, Zainey

    2018-02-01

    Thirty-five stratigraphic section exposed along the Mukah-Selangau road in the Mukah-Balingian area have been studied. Sedimentological and palynological data have been integrated to gain a better insight into the depositional architecture of the area. Broadly, the Mukah-Balingian area is dominated by fluvial, floodplain and estuarine related coal-bearing deposits. The Balingian, Begrih and Liang formations have been described and interpreted in terms of seven facies association. These are: FA1 - Fluvial-dominated channel facies association; FA2 - Tide-influenced channel facies association; FA3 - Tide-dominated channel facies association; FA4 - Floodplain facies association; FA5 - Estuarine central basin-mud flats facies association; FA6 - Tidal flat facies association and FA7 - Coastal swamps and marshes facies association. The Balingian Formation is characterised by the transgressive phase in the base, followed by a regressive phase in the upper part. On the basis of the occurrence of Florscheutzia trilobata with Florscheutzia levipoli, the Early to Middle Miocene age has been assigned to the Balingian Formation. The distinct facies pattern and foraminifera species found from the samples taken from the Begrih outcrop imply deposition in the intertidal flats having pronounced fluvio-tidal interactions along the paleo-margin. Foraminiferal data combined with the pronounced occurrence of Stenochlaena laurifolia suggest at least the Late Miocene age for the Begrih Formation. The internal stratigraphic architecture of the Liang Formation is a function of a combination of sea level, stable tectonic and autogenic control. Based on stratigraphic position, the Middle Pliocene to Pleistocene age for the Liang Formation is probable. The Balingian, Begrih and Liang formations display deposits of multiple regressive-transgressive cycles while the sediments were derived from the uplifted Penian high and Rajang group.

  2. A study of ecological sanitation as an integrated urban water supply system: case study of sustainable strategy for Kuching City, Sarawak, Malaysia.

    Science.gov (United States)

    Seng, Darrien Mah Yau; Putuhena, Frederik Josep; Said, Salim; Ling, Law Puong

    2009-03-01

    A city consumes a large amount of water. Urban planning and development are becoming more compelling due to the fact of growing competition for water, which has lead to an increasing and conflicting demand. As such, investments in water supply, sanitation and water resources management is a strong potential for a solid return. A pilot project of greywater ecological treatment has been established in Kuching city since 2003. Such a treatment facility opens up an opportunity of wastewater reclamation for reuse as secondary sources of water for non-consumptive purposes. This paper aims to explore the potential of the intended purposes in the newly developed ecological treatment project. By utilizing the Wallingford Software model, InfoWorks WS (Water Supply) is employed to carry out a hydraulic modeling of a hypothetical greywater recycling system as an integrated part of the Kuching urban water supply, where the greywater is treated, recycled and reused in the domestic environment. The modeling efforts have shown water savings of about 40% from the investigated system reinstating that the system presents an alternative water source worth exploring in an urban environment.

  3. Heavy metals in emergent trees and pioneers from tropical forest with special reference to forest fires and local pollution sources in Sarawak, Malaysia.

    Science.gov (United States)

    Breulman, G; Markert, B; Weckert, V; Herpin, U; Yoneda, R; Ogino, K

    2002-02-21

    Leaf samples of tropical trees, i.e. Dryobalanops lanceolata (Kapur paji), Dipterocarpaceae and Macaranga spp. (Mahang), Euphorbiaceae were analyzed for 21 chemical elements. The pioneer Macaranga spp. exhibited higher concentrations for the majority of elements compared to the emergent species of Dryobalanops lanceolata, which was attributed to the higher physiological activity of the fast growing pioneer species compared to emergent trees. Lead showed rather high concentrations in several samples from the Bakam re-forestation site. This is suggested to be caused by emissions through brick manufacturing and related activities in the vicinity. A comparison of Dryobalanops lanceolata samples collected in 1993, 1995 and 1997 in the Lambir Hills National Park revealed that certain heavy metals, i.e. Co, Cu, Mn, Ni, Pb and Ti showed higher values in 1997 compared to the previous years, which could indicate an atmospheric input from the haze caused by the extensive forest fires raging in Borneo and other parts of Southeast Asia.

  4. Improving Thin Bed Identification in Sarawak Basin Field using Short Time Fourier Transform Half Cepstrum (STFTHC) method

    Science.gov (United States)

    Nizarul, O.; Hermana, M.; Bashir, Y.; Ghosh, D. P.

    2016-02-01

    In delineating complex subsurface geological feature, broad band of frequencies are needed to unveil the often hidden features of hydrocarbon basin such as thin bedding. The ability to resolve thin geological horizon on seismic data is recognized to be a fundamental importance for hydrocarbon exploration, seismic interpretation and reserve prediction. For thin bedding, high frequency content is needed to enable tuning, which can be done by applying the band width extension technique. This paper shows an application of Short Time Fourier Transform Half Cepstrum (STFTHC) method, a frequency bandwidth expansion technique for non-stationary seismic signal in increasing the temporal resolution to uncover thin beds and improve characterization of the basin. A wedge model and synthetic seismic data is used to quantify the algorithm as well as real data from Sarawak basin were used to show the effectiveness of this method in enhancing the resolution.

  5. Numerical Analysis Study of Sarawak Barrage River Bed Erosion and Scouring by Using Smooth Particle Hydrodynamic (SPH)

    Science.gov (United States)

    Zainol, M. R. R. M. A.; Kamaruddin, M. A.; Zawawi, M. H.; Wahab, K. A.

    2017-11-01

    Smooth Particle Hydrodynamic is the three-dimensional (3D) model. In this research work, three cases and one validation have been simulate using DualSPHysics. Study area of this research work was at Sarawak Barrage. The cases have different water level at the downstream. This study actually to simulate riverbed erosion and scouring properties by using multi-phases cases which use sand as sediment and water. The velocity and the scouring profile have been recorded as the result and shown in the result chapter. The result of the validation is acceptable where the scouring profile and the velocity were slightly different between laboratory experiment and simulation. Hence, it can be concluded that the simulation by using SPH can be used as the alternative to simulate the real cases.

  6. Sea level rise and variability around Peninsular Malaysia

    Science.gov (United States)

    Tkalich, Pavel; Luu, Quang-Hung; Tay, Tze-Wei

    2014-05-01

    Peninsular Malaysia is bounded from the west by Malacca Strait and the Andaman Sea, both connected to the Indian Ocean, and from the east by South China Sea being largest marginal sea in the Pacific Basin. As a result, sea level along Peninsular Malaysia coast is assumed to be governed by various regional phenomena associated with the adjacent parts of the Indian and Pacific Oceans. At annual scale, sea level anomalies (SLAs) are generated by the Asian monsoon; interannual sea level variability is determined by the El Niño-Southern Oscillation (ENSO) and the Indian Ocean Dipole (IOD); whilst long term sea level trend is coordinated by the global climate change. To quantify the relative impacts of these multi-scale phenomena on sea level trend and variability surrounding the Peninsular Malaysia, long-term tide gauge record and satellite altimetry are used. During 1984-2011, relative sea level rise (SLR) rates in waters of Malacca Strait and eastern Peninsular Malaysia are found to be 2.4 ± 0.8 mm/yr and 2.7 ± 0.6 mm/yr, respectively. Discounting for their vertical land movements (0.8 ± 2.6 mm/yr and 0.9 ± 2.2 mm/yr, respectively), their pure SLR rates are 1.6 ± 3.4 mm/yr and 1.8 ± 2.8 mm/yr, respectively, which are lower than the global tendency. At interannual scale, ENSO affects sea level over the Malaysian east coast in the range of ± 5 cm with very high correlation coefficient. Meanwhile, IOD modulates sea level anomalies in the Malacca Strait in the range of ± 2 cm with high correlation coefficient. Interannual regional sea level drops are associated with El Niño events and positive phases of the IOD index; while the rises are correlated with La Niña episodes and the negative periods of the IOD index. Seasonally, SLAs are mainly monsoon-driven, in the order of 10-25 cm. Geographically, sea level responds differently to the monsoon: two cycles per year are observed in the Malacca Strait, presumably due to South Asian - Indian Monsoon; while single

  7. Malaysia's contributions towards global climate change concerns

    International Nuclear Information System (INIS)

    Yuzlaini Mohd Yusop; Yvonne Lunsong; Norhayati Kamaruddin

    2000-01-01

    Concerns about Green House Gas (GHG) emissions and global climate change were voiced by the scientific community as far back as the International Geophysical year in 1957 when climate changes scenarios and impacts were analysed. More recently, the United Nations Framework Convention on climate change (UNFCCC) was adopted in 1992, renewing a global acknowledgement and commitment towards curbing GHG emissions. Little progress was made until the adoption of Kyoto Protocol in December 1997, over 5 years later. Basically, developed countries would not commit to strong measures if there were no global effort (i. e. corresponding efforts by developing countries) while developing countries are waiting for developed countries to show concrete results first. Since 1950, developed countries cumulatively produced more than 80% of worldwide GHG emissions. Between 1950 and 1990, North America alone contributed 40 billion tons of carbon while Western and Eastern Europe contributed 57 billion tons. Developing countries produced only 24 billion tons of carbon emissions during the same period. At present, per capita emission in developed countries are also about ten times higher than those of developing countries. This imbalance has caused most developing countries to adopt a wait till others do it stance and justifiably so. Nonetheless, curbing GHG emissions should be a larger community effort (which includes business and the public) and not just the efforts of Governments and officials. Thus, the deciding factors should make more business or economic sense. It is likely that business and the general public would listen and contribute positively if they are made aware of potential cost savings and international competitiveness to be derived from these efforts. During the current economic slowdown, especially in East Asia, it makes business sense to defer the capital investment in new electricity generating capacity and related energy supply infrastructure. Pusat Tenaga Malaysia

  8. Geochemical characterization of Neogene sediments from onshore West Baram Delta Province, Sarawak: paleoenvironment, source input and thermal maturity

    Directory of Open Access Journals (Sweden)

    Togunwa Olayinka S.

    2017-08-01

    Full Text Available The Neogene strata of the onshore West Baram Province of NW Borneo contain organic rich rock formations particularly within the Sarawak basin. This basin is a proven prolific oil and gas province, thus has been a subject of great interest to characterise the nature of the organic source input and depositional environment conditions as well as thermal maturation. This study is performed on outcrop samples of Lambir, Miri and Tukau formations, which are of stratigraphic equivalence to the petroleum bearing cycles of the offshore West Baram delta province in Sarawak. The investigated mudstone samples are organic rich with a total organic carbon (TOC content of more than 1.0 wt.%. The integration of elemental and molecular analyses indicates that there is no significant variation in the source input between these formations. The investigated biomarkers parameters achieved from acyclic isoprenoids, terpanes and steranes biomarkers of a saturated hydrocarbon biomarkers revealed that these sediments contain high contribution of land plants with minor marine organic matter input that was deposited and preserved under relatively oxic to suboxic conditions. This is further supported by low total sulphur (TS, high TOC/TN ratios, source and redox sensitive trace elements (V, Ni, Cr, Co and Mo concentrations and their ratios, which suggest terrigenous source input deposited under oxic to suboxic conditions. Based on the analysed biomarker thermal maturity indicators, it may be deduced that the studied sediments are yet to enter the maturity stage for hydrocarbon generation, which is also supported by measured vitrinite reflectance values of 0.39-0.48% Ro.

  9. Geochemical characterization of Neogene sediments from onshore West Baram Delta Province, Sarawak: paleoenvironment, source input and thermal maturity

    Science.gov (United States)

    Togunwa, Olayinka S.; Abdullah, Wan H.

    2017-08-01

    The Neogene strata of the onshore West Baram Province of NW Borneo contain organic rich rock formations particularly within the Sarawak basin. This basin is a proven prolific oil and gas province, thus has been a subject of great interest to characterise the nature of the organic source input and depositional environment conditions as well as thermal maturation. This study is performed on outcrop samples of Lambir, Miri and Tukau formations, which are of stratigraphic equivalence to the petroleum bearing cycles of the offshore West Baram delta province in Sarawak. The investigated mudstone samples are organic rich with a total organic carbon (TOC) content of more than 1.0 wt.%. The integration of elemental and molecular analyses indicates that there is no significant variation in the source input between these formations. The investigated biomarkers parameters achieved from acyclic isoprenoids, terpanes and steranes biomarkers of a saturated hydrocarbon biomarkers revealed that these sediments contain high contribution of land plants with minor marine organic matter input that was deposited and preserved under relatively oxic to suboxic conditions. This is further supported by low total sulphur (TS), high TOC/TN ratios, source and redox sensitive trace elements (V, Ni, Cr, Co and Mo) concentrations and their ratios, which suggest terrigenous source input deposited under oxic to suboxic conditions. Based on the analysed biomarker thermal maturity indicators, it may be deduced that the studied sediments are yet to enter the maturity stage for hydrocarbon generation, which is also supported by measured vitrinite reflectance values of 0.39-0.48% Ro.

  10. U-Pb Detrital Zircon Ages from Sarawak: Changes in Provenance Reflecting the Tectonic Evolution of Southeast Asia

    Science.gov (United States)

    Breitfeld, H. T.; Galin, T.; Hall, R.

    2014-12-01

    Sarawak is located on the northern edge of Sundaland in NW Borneo. Five sedimentary basins are distinguished with ages from Triassic to Cenozoic. New light mineral, heavy mineral and U-Pb detrital zircon ages show differences in provenance reflecting the tectonic evolution of the region. The oldest clastic sediments are Triassic of the Sadong-Kuching Basin and were sourced by a Carnian to Norian volcanic arc and erosion of Cathaysian rocks containing zircons of Paleoproterozoic age. Sandstones of the Upper Jurassic to Cretaceous Bau-Pedawan Basin have distinctive zircon populations indicating a major change of tectonic setting, including initiation of subduction below present-day West Sarawak in the Late Jurassic. A wide range of inherited zircon ages indicates various Cathaysian fragments as major source areas and the arrival of the SW Borneo Block following subduction beneath the Schwaner Mountains in the early Late Cretaceous. After collision of the SW Borneo Block and the microcontinental fragments with Sundaland in the early Late Cretaceous, deep marine sedimentation (Pedawan Formation) ceased, and there was uplift forming the regional Pedawan-Kayan unconformity. Two episodes of extension were responsible for basin development on land from the latest Cretaceous onwards, probably in a strike-slip setting. The first episode formed the Kayan Basin in the Latest Cretaceous (Maastrichtian) to Early Paleocene, and the second formed the Ketungau Basin and the Penrissen Sandstone in the Middle to Late Eocene. Zircons indicate nearby volcanic activity throughout the Early Cenozoic in NW Borneo. Inherited zircon ages indicate an alternation between Borneo and Tin Belt source rocks. A large deep marine basin, the Rajang Basin, formed north of the Lupar Line fault. Zircons from sediments of the Rajang Basin indicate they are of similar age and provenance as the contemporaneous terrestrial sediments to the south suggesting a narrow steep continental Sundaland margin at the

  11. Projection of spatial and temporal changes of rainfall in Sarawak of Borneo Island using statistical downscaling of CMIP5 models

    Science.gov (United States)

    Sa'adi, Zulfaqar; Shahid, Shamsuddin; Chung, Eun-Sung; Ismail, Tarmizi bin

    2017-11-01

    This study assesses the possible changes in rainfall patterns of Sarawak in Borneo Island due to climate change through statistical downscaling of General Circulation Models (GCM) projections. Available in-situ observed rainfall data were used to downscale the future rainfall from ensembles of 20 GCMs of Coupled Model Intercomparison Project phase 5 (CMIP5) for four Representative Concentration Pathways (RCP) scenarios, namely, RCP2.6, RCP4.5, RCP6.0 and RCP8.5. Model Output Statistics (MOS) based downscaling models were developed using two data mining approaches known as Random Forest (RF) and Support Vector Machine (SVM). The SVM was found to downscale all GCMs with normalized mean square error (NMSE) of 48.2-75.2 and skill score (SS) of 0.94-0.98 during validation. The results show that the future projection of the annual rainfalls is increasing and decreasing on the region-based and catchment-based basis due to the influence of the monsoon season affecting the coast of Sarawak. The ensemble mean of GCMs projections reveals the increased and decreased mean of annual precipitations at 33 stations with the rate of 0.1% to 19.6% and one station with the rate of - 7.9% to - 3.1%, respectively under all RCP scenarios. The remaining 15 stations showed inconsistency neither increasing nor decreasing at the rate of - 5.6% to 5.2%, but mainly showing a trend of decreasing rainfall during the first period (2010-2039) followed by increasing rainfall for the period of 2070-2099.

  12. Obesity in Malaysia.

    Science.gov (United States)

    Ismail, M N; Chee, S S; Nawawi, H; Yusoff, K; Lim, T O; James, W P T

    2002-08-01

    significantly higher in Chinese and urban subjects. Men were moderately active with the exception of the Dayaks. Chinese women were considerably less active than Chinese men. Chinese and Dayak women were less active than Malay and Indian women. In both men and women, Indians recorded the highest PALs. Hence, current nutrition and health surveys reveal that Malaysians are already affected by western health problems. The escalation of obesity, once thought to be an urban phenomenon, has now spread to the rural population at an alarming rate. As Malaysia proceeds rapidly towards a developed economy status, the health of its population will probably continue to deteriorate. Therefore, a national strategy needs to be developed to tackle both dietary and activity contributors to the excess weight gain of the Malaysian population.

  13. Population trends in Malaysia: 1970-2010

    Science.gov (United States)

    Rashid, Saharani Abdul; Ghani, Puzziawati Ab; Daud, Noorizam

    2014-12-01

    The size of population in Malaysia had reached 28.3 million in 2010 and is expected to increase to 38.6 million in the next 30 years. This demographic milestone that is causing renewed attention to the challenges caused by population growth. This paper looks at the last 40 years of changes in Malaysia population structure due to the changes in demographic phenomenon using data obtained from the Department of Statistics Malaysia. The principal finding of this research indicates that population structure in Malaysia had changed dramatically from the year 1970 to 2010. At the same time, Malaysia has completed its demographic transition in less than four decades. The fall in fertility and mortality rates have led to an improvement in the life expectancy of the population which has resulted an ageing population in Malaysia.

  14. Report on the FY 1993 basic survey for industrialization related to the survey of overseas geological structure (Tebulan East area, Malaysia); 1993 nendo kaigai chishitsu kozo nado chosa ni kakawaru kigyoka kiso chosa (Malaysia Tebulan higashi chiku) hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-03-01

    The survey was conducted based on 'Scope of work for detailed coal exploration in the Tebulan East block of the Merit Pila coal field, Sarawak, Malaysia' concluded on June 19, 1993 between NEDO and Global Mineral which owns the mining right. The field survey was for the geological survey, survey of conditions of open pit mining, and infrastructure survey. The confirmed/estimated coal amount totaled 22,65 million tons in 4 coal seams. The all sulfur content is low, approximately 0.12%. The heating value is 5,820 kcal/kg. As to the infrastructure, various conditions are good for transportation, shipping facilities, etc. from mine site to truck transport/barge transport/external route shipping. The drilling was planned to be made by open pit mining by the truck and shovel system, and the scale of the planned production was 0.3 million tons. The ash is low in amount, and there was no coal preparation. Clean coal is produced by crushing, sieving and washing. Attached were the borehole log (JN9940782), route map, and trench sketch (JN9940783). (NEDO)

  15. Microbial keratitis in West and East Malaysia

    OpenAIRE

    Vanitha Ratnalingam; Thiageswari Umapathy; Kala Sumugam; Hanida Hanafi; Shamala Retnasabapathy

    2017-01-01

    AIM: To evaluate the epidemiological and etiological factors of microbial keratitis seen in tertiary hospitals in West and East Malaysia.METHODS: A total of 207 patients were enrolled. Patients referred for microbial keratitis to Sungai Buloh Hospital and Kuala Lumpur Hospital in West Malaysia and Queen Elizabeth Hospital and Kuching General Hospital in East Malaysia were recruited. Risk factors were documented. Corneal scrapings for microscopy and culture were performed.RESULTS: The most com...

  16. Seremban Urban Park, Malaysia: a Preference Study

    OpenAIRE

    Maulan, Suhardi

    2002-01-01

    Unlike the West, where many studies have explored how peopleâ s needs are fulfilled by urban parks, Malaysia has received very little attention from researchers. One reason for this is the fact that Malaysia has only a short public park tradition. Although folk art and stories have chronicled a long history of gardens and other parks, these spaces were only accessible to royal family members and autocrats. In Malaysia, the concept of free public parks is relatively recent, having been introd...

  17. Development of Consumer Credit Laws in Malaysia

    OpenAIRE

    Rahman, Ahmad Saufi Abdul

    2007-01-01

    Consumer Credit is a branch of Commercial Law, which has been developing in recent years inMalaysia. The purpose of this paper is to summarize the latest amendments in the consumer credit laws inMalaysia and to highlight its significance. The discussion will be limited to the three most important laws ofconsumer credit in Malaysia: the hire-purchase, money lending and pawn broking laws.

  18. Malaysia : the lucky man of Asia?

    OpenAIRE

    Kind, Hans Jarle; Ismail, Mohd Nazari

    2001-01-01

    Malaysia has been labelled the Lucky Man of Asia due to its wealth of natural resources, such as tin, rubber, palm oil, pepper, tropical timber, petroleum and a very fertile soil. There is no doubt that this richness has helped Malaysia to achieve impressive growth rates over the last decades, but history has taught us that large endowments of natural resources by far are sufficient to generate development. Since the early 1970s Malaysia has led a relatively successful racial integration poli...

  19. Combating Smuggling in Persons: A Malaysia Experience

    OpenAIRE

    Rahim Rohani Abdul; Ahmad Tajuddin Muhammad Afiq bin; Abu Bakar Kamaruddin bin Hj.; Abdul Rahim Mohammad Nizamuddin Bin

    2015-01-01

    Malaysia continues to face various challenges derived from the widespread of international migratory movement because of various economic reasons. Malaysia strategic geographical location, in the center of the South East Asian region made the country an attractive destination for human smuggling and trafficking in persons activities. Some of the smuggled persons may end up being trafficked victims base on the definition adopted by Malaysian laws on “trafficked victims”. Malaysia Anti-Traffick...

  20. Malaysia commercial energy flow: status and structure

    International Nuclear Information System (INIS)

    Ridzuan Abdul Mutalib; Maragatham Kumar; Nik Arlina Nik Ali; Abi Muttaqin Jalal Bayar; Aisya Raihan Abdul Kadir; Muhammed Zulfakar Zolkaffly; Azlinda Aziz; Jamal Khaer Ibrahim

    2008-08-01

    With further growth of Malaysia economy, future development of the energy sector in Malaysia is vital to ensure targeted growth. Commercial Energy continues to play a major role in ensuring a balanced energy mix for power generation due to a potential increase in energy demand from various sectors, especially the industrial sector. This paper presents the status and structure of Malaysia Commercial Energy Flow, which gives an overview of the flow of all types of energy sources from primary energy supply to final energy use, and also the potential for nuclear power in electricity generation in Malaysia. (Author)

  1. Malaysia implements the integrated approach.

    Science.gov (United States)

    1977-01-01

    Malaysia has implemented an integrated approach in providing family planning services to eligible couples. In 1964 the government of Malaysia adopted a national family planning program, and implementation began in the urban areas and extended into the rural areas. Other agencies are involved in providing family planning services and information including the Federation of Family Planning Associations, the Ministry of Health, the National Family Planning Board, and the Federal Land Development Authority. The number of women practicing contraception has increased from 20,726 in 1967 to 533,646 by 1976. and other methods, 3.9%, respectively. There has been an increase in the percentage of acceptors between ages 15-29 from 56% in 1968 to 71.3% in 1975. The 2nd Malaysian national plan will use a multidisciplinary approach to the problem.

  2. THE POSSIBILITY OF SAGO STARCH MARKETING IN JAPAN FROM SAGO PRODUCING AREAS IN THE EASTERN PART OF INDONESIA

    OpenAIRE

    Datu, Diyah Yumeina R.; Katsuya, Osozawa

    2011-01-01

    Sago palm (Metroxylon sp.) is distributed and grows naturally in almost every island throughout Indonesia, especially in swampy coastal areas along rivers. After the World War II, the sago cultivation in the regions that surround Malaysia and the Western Indonesia, have been consolidated by the investors while farmers in the eastern Indonesia continue their conventional practice. Recently, these farmers in the eastern part have been shifting from sago production to others crops such as corn a...

  3. Electricity energy outlook in Malaysia

    International Nuclear Information System (INIS)

    Tan, C S; Leong, Y P; Maragatham, K

    2013-01-01

    Population and income growth are the key drivers behind the growing demand for energy. Demand for electricity in Malaysia is always growing in tandem with its Gross Domestic Product (GDP) growth. The growth for electricity in Malaysia forecasted by Economic Planning Unit (EPU) has shown an increase of 3.52% in 2012 compared to 3.48% in 2011. This growth has been driven by strong demand growth from commercial and domestic sectors. The share of electricity consumption to total energy consumption has increased from 17.4% in 2007 to 21.7% in 2012. The total electricity production was reported at 122.12TWh in 2012, where gas is still the major fuel source contributing to 52.7% of the total generation fuel mix of electricity followed by Coal, 38.9%, hydro, 7.3%, oil, 1% and others, 0.2%. This paper aims to discuss the energy outlook particularly the electricity production and ways toward greener environment in electricity production in Malaysia

  4. Electricity energy outlook in Malaysia

    Science.gov (United States)

    Tan, C. S.; Maragatham, K.; Leong, Y. P.

    2013-06-01

    Population and income growth are the key drivers behind the growing demand for energy. Demand for electricity in Malaysia is always growing in tandem with its Gross Domestic Product (GDP) growth. The growth for electricity in Malaysia forecasted by Economic Planning Unit (EPU) has shown an increase of 3.52% in 2012 compared to 3.48% in 2011. This growth has been driven by strong demand growth from commercial and domestic sectors. The share of electricity consumption to total energy consumption has increased from 17.4% in 2007 to 21.7% in 2012. The total electricity production was reported at 122.12TWh in 2012, where gas is still the major fuel source contributing to 52.7% of the total generation fuel mix of electricity followed by Coal, 38.9%, hydro, 7.3%, oil, 1% and others, 0.2%. This paper aims to discuss the energy outlook particularly the electricity production and ways toward greener environment in electricity production in Malaysia

  5. Solid waste management in Malaysia

    International Nuclear Information System (INIS)

    Nadzri Yahaya

    2010-01-01

    All of the countries over the world have their own policies about how waste were managed. Malaysia as one of the developing country also faces this problems. So, the government was established Department of National Solid Waste Management under Ministry of Housing and Local Government to control and make sure all of these problem on waste will managed systematically. Guiding principle on these issues was mentioned in 3rd Outline Perspective Plan (2000 until 2010), National Policy on Solid Waste Management, National Strategic Plan on Solid Waste Management and also 10th Malaysian Plan. In 10th Malaysian Plan, the government will complete restructuring efforts in this Solid Waste Management sector with the federalization of solid waste management and public cleansing and full enforcement of the Solid Waste and Public Cleansing Management Act 2007. The key outcomes of these efforts will include providing support to local authorities, delivering comprehensive and sanitary services and ensuring that waste is managed in a sustainable manner. These presentations cover all aspect of solid waste management in Malaysia. What are guiding principle, paradigm shift, strategies approach, monitoring and enforcement and also mention about some issues and constraint that appear in Solid waste management in Malaysia.

  6. The Kuznets process in Malaysia.

    Science.gov (United States)

    Randolph, S

    1990-10-01

    This study looks at how the Kuznets process, the structural determinants of the aggregate inequality trend during the course of economic development, is transpiring in Malaysia. A time-series test of Kuznets's hypothesis concerning the trend in participation income in the course of economic growth and its underlying structural components is conducted using data from the Malaysian Family Life Survey. The study covers the period 1968-76 during which the equalizing phase of growth was expected to take hold. Analysis determined that while many of the underlying processes which Kuznets speculated combined to generate the aggregate trend in participation income are at work in Malaysia, others are either absent or their phasing has been altered. The equalizing phase in the course of development has been delayed in arriving. Inequality in the nonagricultural sector exceeded that in the agricultural sector, and the wage gap which opened during the early phase of development declined with further development. These findings conform with Kuznets's expectations. Available time-series evidence from other currently developing countries suggests that inequality is typically higher in the nonagricultural sector during the early phase of development and that an increasing and subsequently decreasing between-sector wage gap is a broadly shared experience. This study's findings also support Kuznets's expectation that inequality within the agricultural sector can worsen in the face of dualistic agricultural development. Finally, Malaysia's trend in inequality within the nonagricultural sector exerted the greatest influence upon the aggregate trend in inequality per Kuznets's hypothesis.

  7. Sea level trend and variability around the Peninsular Malaysia

    Science.gov (United States)

    Luu, Q. H.; Tkalich, P.; Tay, T. W.

    2014-06-01

    Peninsular Malaysia is bounded from the west by Malacca Strait and the Andaman Sea both connected to the Indian Ocean, and from the east by South China Sea being largest marginal sea in the Pacific Basin. Resulting sea level along Peninsular Malaysia coast is assumed to be governed by various regional phenomena associated with the adjacent parts of the Indian and Pacific Oceans. At annual scale, sea level anomalies (SLAs) are generated by the Asian monsoon; interannual sea level variability is determined by the El Niño-Southern Oscillation (ENSO) and the Indian Ocean Dipole (IOD); while long-term sea level trend is related to global climate change. To quantify the relative impacts of these multi-scale phenomena on sea level trend and variability around the Peninsular Malaysia, long-term tide gauge record and satellite altimetry are used. During 1984-2011, relative sea level rise (SLR) rates in waters of Malacca Strait and eastern Peninsular Malaysia are found to be 2.4 ± 1.6 mm yr-1 and 2.7 ± 1.0 mm yr-1, respectively. Allowing for corresponding vertical land movements (VLM; 0.8 ± 2.6 mm yr-1 and 0.9 ± 2.2 mm yr-1), their absolute SLR rates are 3.2 ± 4.2 mm yr-1 and 3.6 ± 3.2 mm yr-1, respectively. For the common period 1993-2009, absolute SLR rates obtained from both tide gauge and satellite altimetry in Peninsular Malaysia are similar; and they are slightly higher than the global tendency. It further underlines that VLM should be taken into account to get better estimates of SLR observations. At interannual scale, ENSO affects sea level over the Malaysian coast in the range of ±5 cm with a very high correlation. Meanwhile, IOD modulates sea level anomalies mainly in the Malacca Strait in the range of ±2 cm with a high correlation coefficient. Interannual regional sea level drops are associated with El Niño events and positive phases of the IOD index; while the rises are correlated with La Niña episodes and the negative periods of the IOD index

  8. International Nuclear Information System in Malaysia

    International Nuclear Information System (INIS)

    Samsurdin Ahamad

    1984-01-01

    Practice of the International Nuclear Information System (INIS) in Malaysia is reviewed. The Nuclear Energy Unit, a participating representative of Malaysia, holds the responsibilities of disseminating information through this system. Its available services relevant to the aims of INIS are discussed

  9. An Exploration of African Students in Malaysia

    Science.gov (United States)

    Lian, Irene Tan Ai

    2011-01-01

    The exploratory study is an attempt to understand the reasons that prompted African students to study in Malaysia, the challenges encountered and the coping strategies used. The research on such topics among international students is well documented, but studies on international students in Malaysia are scarce. The sample included 155 African…

  10. The Evolution of Special Education in Malaysia

    Science.gov (United States)

    Lee, Lay Wah; Low, Hui Min

    2014-01-01

    This article traces the evolution of special education in Malaysia across four chronological stages: before and during the early colonial period (before 1900), pre-independence (1900-1957), post-independence (1957-1990) and modern Malaysia (1990 to the present), through document analysis. By placing current issues and trends within a historical…

  11. Homeschool in Malaysia: A Foresight Study

    Science.gov (United States)

    Kim-Soon, Ng; Rahman Bin Ahmad, Abd; Bin Sulaiman, Muhammad Ibrahim; Sirisa, Ng Mei Xin

    2015-01-01

    Homeschooling in Malaysia is a form of alternative education that emphasizes quality education based on moral values and beliefs while strengthening family bonds. This alternative form of education is being practiced by a growing number of families in Malaysia. As such, the Ministry of Education has given the green light for intending parents who…

  12. Partners for development: Expert assistant in Malaysia

    International Nuclear Information System (INIS)

    Daud, A.H.

    1996-01-01

    This report reviews the expert assignments received by Malaysia under the TC programme over the 1980-95 time period. It provides data about the type of assignments and expert services, the institutions receiving the experts, and duration of the assignment. Also reviewed is the process of requesting and implementing an expert assignment in Malaysia, as well as the country's related objectives and plans

  13. Workplace Learning in Malaysia: The Learner's Perspective

    Science.gov (United States)

    Muhamad, Mazanah; Idris, Khairuddin

    2005-01-01

    This paper offers a scenario of workplace learning as practiced in Malaysia. Based on survey research, the article describes learner profiles, learning provision and pattern. The analysis shows that Malaysians participate in formal workplace learning as part of their employment activities. Workplace learning in Malaysia is contextual, promoted by…

  14. Selected Malaysia air quality pollutants assessment using ...

    African Journals Online (AJOL)

    Analysis of PCA, FA, KMO and Bartlett's test were done on five main air quality pollutants (O3, NO2, SO2, CO and PM10) from all around Malaysia. From the data analysis obtained, the concentrations of air quality pollutants all around Malaysia starting from 2008 to 2011 were acceptable and the most dominant major ...

  15. Economic Education in Malaysia: A Brief Report.

    Science.gov (United States)

    Rao, C. A.

    1978-01-01

    This report provides a brief description of economic education in Malaysia and indicates interest, on the part of various Asian countries, i.e., Malaysia, Singapore, Indonesia, Thailand, and the Philippines, in the establishment of economic education programs. (Editor/RK)

  16. Notes on the Lecythidaceae of Peninsular Malaysia

    NARCIS (Netherlands)

    Prance, G.T.

    2010-01-01

    In preparation for the account of Lecythidaceae for the Flora of Peninsular Malaysia some changes involving new names are needed. The genus Abdulmajidia is reduced to synonymy with Barringtonia and the necessary new combinations are made. Three new species of Barringtonia from Malaysia are

  17. Notes on the Lecythidaceae of Peninsular Malaysia

    OpenAIRE

    Prance, G.T.

    2010-01-01

    In preparation for the account of Lecythidaceae for the Flora of Peninsular Malaysia some changes involving new names are needed. The genus Abdulmajidia is reduced to synonymy with Barringtonia and the necessary new combinations are made. Three new species of Barringtonia from Malaysia are described, B. badia, B. glomerata and B. norshamii.

  18. Preparing for Molybdenum-99 Production In Malaysia [Country report: Malaysia

    International Nuclear Information System (INIS)

    Dahalan, Rehir; Masood, Zarina; Zulkifli, Mohd Hashim; Yusof, Mohd Abd Wahab

    2015-01-01

    The research reactor at Nuclear Malaysia, which has been in operation since June 1982, has a maximum flux of 1x10 13 n/cm 2 /s at its central position, has been utilized in production of neutron activated molybdenum-99 ( 99 Mo) and may be suitable for the new initiative for producing fission 99 Mo from low enriched uranium (LEU) targets if an upgrade involving its power and neutron flux were done. Currently, there is no fission 99 Mo production in place in Malaysia; however, there is an existing weekly 99 Mo/ 99m Tc generator production utilizing imported fission 99 Mo. Malaysia’s current demand for fission 99 Mo is relatively small but is still affected by the recent supply turmoil. At the request of the Malaysia Nuclear Agency, the IAEA organized a fact-finding mission to assess currently available infrastructure against that necessary to produce fission 99 Mo sufficient for domestic needs or additionally to contribute to regional fission 99 Mo supply security. During the mission, 99 Mo production from LEU and the alternative neutron activation method were considered. Taking into consideration sufficient upgrade of the current research reactor power and neutron flux, neutron activation could satisfy current national demand but offers little excess capacity to accommodate future growth or participation in the regional 99 Mo market. Also at a higher reactor power and neutron flux, LEU fission based technologies could produce adequate quantities for domestic and regional supply, but require significantly greater resource commitment than neutron activation production technologies particularly with respect to the management and ultimate disposition of all waste streams. In addition to the completion of the reactor power and flux upgrade, revising the operating mode to continuous operation is a prerequisite to fission 99 Mo production together with additional equipment for handling and transferring higher radiation dose target capsules from the reactor to the hot

  19. Malaysia Economic Monitor, June 2016 : Leveraging Trade Agreements

    OpenAIRE

    World Bank

    2016-01-01

    The MEM is the World Bank's biannual flagship publication on Malaysia. It provides analysis of recent economic developments and the near-term outlook for Malaysia. Each publication also focuses on a special topic related to Malaysia's transformation into a high-income economy. Malaysia is at the forefront of a "new generation" of trade agreements that will shape trade and investment over t...

  20. Distribution, relative abundance and occupancy of selected mammals along paved road in Kubah National Park, Sarawak, Borneo

    Directory of Open Access Journals (Sweden)

    Jayasilan Mohd-Azlan

    2018-06-01

    Full Text Available Research on ecological impacts of roads has seldom been studied on Borneo. This includes information on their influence on wildlife dynamic in National Parks and other areas harbouring biodiversity. This knowledge is important to prescribe best management practices, by avoiding, minimising and compensating for adverse impacts such structures may have on individuals, populations and communities. In order to understand the effects of a paved road, located within a protected area (Kubah National Park, Sarawak, western Borneo, on the local mammal species, we set up an array of 20 camera traps using stratified sampling, along a spatial gradient of five distance categories from the road. This ranged from the edge of the road to the interior part of the forests, in the following manner: A 0–5 m at the edge, B 5–100 m, C 100–200 m, D 200–300 m, and E 300–400 m. We explored the relationships between the distance to the road with mammalian species richness, and subsequently, for carnivores, ungulates, and Viverridae sp. (civets and finally, attempted to estimate the density of these animal groups. Camera trap surveys accumulated 2161 camera days, which resulted in 1938 independent animal photos that consisted of19 species of wild mammals, six species of birds and one reptile species along the gradient. This study suggests that areas close to the road (0–5 m are used significantly less than other areas (n = 8, while cameras located within the distance range from 5–100 m and 100–200 m detected the highest number of species (n = 18. The highest numbers of ungulates and members of the family Viverridae (civets were recorded at 5–100 m, while the distance category 100–200 m recorded the most numbers of carnivores. Several species that could be tolerant to some level of disturbance, such as the leopard cat (Prionailurus bengalensis, banded palm civet (Hemigalus derbyanus, long-tailed porcupine (Trichys fasciculata, and lesser mousedeer

  1. Malaysia mental health country profile.

    Science.gov (United States)

    Parameshvara Deva, M

    2004-01-01

    Malaysia is a tropical country in the heart of south east Asia with a population of 24 million people of diverse ethnic, cultural and religious backgrounds living in harmony in 330,000 km(2) of land on the Asian mainland and Borneo. Malaysia, which lies on the crossroads of trade between east and west Asia, has an ancient history as a centre of trading attracting commerce between Europe, west Asia, India and China. It has had influences from major powers that dominated the region throughout its history. Today the country, after independence in 1957, has embarked on an ambitious development project to make it a developed country by 2020. In this effort the economy has changed from one producing raw material to one manufacturing consumer goods and services and the colonial health system has been overhauled and social systems strengthened to provide better services for its people. The per capita income, which was under 1,000 US dollars at independence, has now passed 4,000 US dollars and continues to grow, with the economy largely based on strong exports that amount to over 100 billion US dollars. The mental health system that was based on institutional care in four mental hospitals at independence from British colonial rule in 1957 with no Malaysian psychiatrists is today largely based on over 30 general hospital psychiatric units spread throughout the country. With three local postgraduate training programmes in psychiatry and 12 undergraduate departments of psychiatry in the country--all started after independence--there is now a healthy development of mental health services. This is being supplemented by a newly established primary care mental health service that covers community mental health by integrating mental health into primary health care. Mental health care at the level of psychiatrists rests with about 140 psychiatrists most of whom had undertaken a four-year masters course in postgraduate psychiatry in Malaysia since 1973. However, there continues to be

  2. ISMS Implementation in Nuclear Malaysia

    International Nuclear Information System (INIS)

    Radhiah Jamalludin; Siti Nurbahyah Hamdan; Mohd Dzul Aiman Aslan

    2015-01-01

    Nuclear Malaysia provides important services and functions that depend on the resources including information. Use of the information assets must be consistent with good professional practices and procedures and legal requirements, regulations and contracts and the need to ensure the confidentiality, integrity and availability of all information assets of the Agency. ISO / IEC 27001, the international safety standard for information security management system provides the mandatory requirement to implement, review and continuously improve the Information Security Management System (ISMS). Information security policies and the implementation of ISMS is important to protect information assets from all threats; internal or external; intentionally or unintentionally. (author)

  3. Eastern Redcedar Seedling Assessment

    Data.gov (United States)

    U.S. Environmental Protection Agency — Eastern redcedar tree seedling growth in response to various soil, nitrogen, and photosynthetic radiation characteristics. This dataset is associated with the...

  4. Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia.

    Science.gov (United States)

    Fong, Mun-Yik; Rashdi, Sarah A A; Yusof, Ruhani; Lau, Yee-Ling

    2015-02-21

    Plasmodium knowlesi is one of the monkey malaria parasites that can cause human malaria. The Duffy binding protein of P. knowlesi (PkDBPαII) is essential for the parasite's invasion into human and monkey erythrocytes. A previous study on P. knowlesi clinical isolates from Peninsular Malaysia reported high level of genetic diversity in the PkDBPαII. Furthermore, 36 amino acid haplotypes were identified and these haplotypes could be separated into allele group I and allele group II. In the present study, the PkDBPαII of clinical isolates from the Malaysian states of Sarawak and Sabah in North Borneo was investigated, and compared with the PkDBPαII of Peninsular Malaysia isolates. Blood samples from 28 knowlesi malaria patients were used. These samples were collected between 2011 and 2013 from hospitals in North Borneo. The PkDBPαII region of the isolates was amplified by PCR, cloned into Escherichia coli, and sequenced. The genetic diversity, natural selection and phylogenetics of PkDBPαII haplotypes were analysed using MEGA5 and DnaSP ver. 5.10.00 programmes. Forty-nine PkDBPαII sequences were obtained. Comparison at the nucleotide level against P. knowlesi strain H as reference sequence revealed 58 synonymous and 102 non-synonymous mutations. Analysis on these mutations showed that PkDBPαII was under purifying (negative) selection. At the amino acid level, 38 different PkDBPαII haplotypes were identified. Twelve of the 28 blood samples had mixed haplotype infections. Phylogenetic analysis revealed that all the haplotypes were in allele group I, but they formed a sub-group that was distinct from those of Peninsular Malaysia. Wright's FST fixation index indicated high genetic differentiation between the North Borneo and Peninsular Malaysia haplotypes. This study is the first to report the genetic diversity and natural selection of PkDBPαII of P. knowlesi from Borneo Island. The PkDBPαII haplotypes found in this study were distinct from those from

  5. Politico-Islamic Issues in Malaysia in 1999

    OpenAIRE

    Abubakar, Ibrahim

    2001-01-01

    Tulisan ini merupakan kajian singkat sekitar isu politik Islam di Malaysia tahun 1999. Pada November 1999, Malaysia menyelenggarakan pemilihan Federal dan Negara Bagian yang ke-10. Titik berat tulisan ini ada pada beberapa isu politik Islam yang dipublikasikan di koran-koran Malaysia yang dilihat dari perspektif partai-partai politik serta para pendukmgnya. Partai politik di Malaysia cukup banyak, dan disini diangkat empat partai politik yaitu: Organisasi Nasional Malaysia Bersatu (UMNO), Aso...

  6. Problem Etnisitas India Dalam Cerita Pendek Malaysia

    Directory of Open Access Journals (Sweden)

    M. Shoim Anwar

    2015-12-01

    Full Text Available Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998, terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara historis merupakan bagian dari kolonialisme Inggris di masa lampau. Residu kolonialisme menciptakan jejak hitam kemanusiaan yang mendalam. Sebagai pendatang, tersirat ada ketegangan sosial-budaya yang dialami etnis India, tetapi bukan konflik. Problem etnis India dalam cerpen Malaysia adalah sarana untuk becermin bagi masyarakat dalam negara yang multietnis. Abstract: Literature is a document of humanity and culture. A collection of short stories Menara 7 (1998, especially five short stories written by Malaysian Indian, gives an overview of Indian ethnic problems in Malaysia. Using postcolonial theory as an anchor, their problems are poverty, education, gender, religion, culture, and unity. The existence Malaysian Indian was British colonial legacy. The leftover of colonialism deeply creates dark footprints of humanity. As a newcomer, it’s implied there was social-cultural tension, but not conflict, experienced by Malaysian Indian. The problems in Malaysia short stories are a tool of reflection in a multiethnic society. Key Words: problem, ethnic, ethnicity, short story

  7. Medical Tourism in Malaysia: Prospect and Challenges.

    Science.gov (United States)

    Sarwar, Abdullah

    2013-08-01

    Tourism, combined with the phrase medical, seems to be a new form of tourism which has gained huge popularity in recent decades. Though, a number of literatures available with regard to the tourism industry and the competitiveness of the destination, however, the major aspects which determine the satisfaction of medical tourists are hardly focused specifically on Malaysia. There is a lack of empirical evidence in this area of study which needs to be bridged. Hence, this study aimed at investigating the various factors contributing towards the development of medical tourism in Malaysia. As the purpose of the research was to find out various factors contributing towards the development of medical tourism in Malaysia, so this study used Structural Equation modeling (SEM) for data analysis. The target population for this study consisted of the medical tourists coming to Malaysia with the primary intension of seeking medical procedures other than sightseeing. A total sample size of 266 was collected through non-probability judgment sampling during the period between December 2012 and February 2013. The result confirms that destination competitiveness and service quality play an important role in the medical tourist's mind towards medical tourism aspect in Malaysia. Thus, Malaysia need to promote various medical success stories together with the services they offer to attract more foreign patients. This study contributes to the theoretical development in the tourism industry by offering the structured relationship among various aspects contributing towards the development of medical tourism in Malaysia.

  8. Engaging with Lyell: Alfred Russel Wallace's Sarawak Law and Ternate papers as reactions to Charles Lyell's Principles of Geology.

    Science.gov (United States)

    Costa, J T

    2013-12-01

    Alfred Russel Wallace (1823-1913) and Charles Darwin (1809-1882) are honored as the founders of modern evolutionary biology. Accordingly, much attention has focused on their relationship, from their independent development of the principle of natural selection to the receipt by Darwin of Wallace's essay from Ternate in the spring of 1858, and the subsequent reading of the Wallace and Darwin papers at the Linnean Society on 1 July 1858. In the events of 1858 Wallace and Darwin are typically seen as central players, with Darwin's friends Charles Lyell (1797-1875) and Joseph Dalton Hooker (1817-1911) playing supporting roles. This narrative has resulted in an under-appreciation of a more central role for Charles Lyell as both Wallace's inspiration and foil. The extensive anti-transmutation arguments in Lyell's landmark Principles of Geology were taken as the definitive statement on the subject. Wallace, in his quest to solve the mystery of species origins, engaged with Lyell's arguments in his private field notebooks in a way that is concordant with his engagement with Lyell in the 1855 and 1858 papers. I show that Lyell was the object of Wallace's Sarawak Law and Ternate papers through a consideration of the circumstances that led Wallace to send his Ternate paper to Darwin, together with an analysis of the material that Wallace drew upon from the Principles. In this view Darwin was, ironically, intended for a supporting role in mediating Wallace's attempted dialog with Lyell.

  9. Unmet Supportive Care Needs among Breast Cancer Survivors of Community-Based Support Group in Kuching, Sarawak

    Directory of Open Access Journals (Sweden)

    Emmanuel Joseph Fong

    2016-01-01

    Full Text Available Background. Recognizing the needs of cancer survivors is one of the important aspects in healthcare delivery. This study aimed to determine the prevalence of unmet supportive care needs and its associated factors among the breast cancer survivors of community-based support group in Kuching, Sarawak. Materials and Methods. This was a cross-sectional study using Supportive Care Needs Survey (SCNS-SF34. All the members of community-based breast cancer support groups in Kuching were invited. A total of 101 respondents were face-to-face interviewed after the consent was obtained. Data was entered and analyzed using SPSS version 20. Results. The respondents endorsed health system and information domain with the highest mean score (2.48; 95% CI: 2.32–2.64. Top 10 items with “moderate to high” level unmet needs had a prevalence of 14.9% to 34.7% of respondents indicating need. Significantly higher level of unmet needs was associated with survivors who were younger (less than 60 years old, had higher education attainment, were unemployed, had survival duration of up to 5 years, and were undergoing active treatment. Conclusion. Systematic delivery of health information which is targeted, culturally sensitive, and linguistically appropriate for addressing younger age, education level, employment status, length of survivorship, and treatment stage should be considered not only at hospital-based setting but also at the community-based support groups.

  10. Electricity Breakdown Management for Sarawak Energy: Use of Condition-Based Equipment for Detection of Defective Insulator

    Science.gov (United States)

    Tan, J. K.; Abas, N.

    2017-07-01

    Managing electricity breakdown is vital since an outage causes economic losses for customers and the utility companies. However, electricity breakdown is unavoidable due to some internal or external factors beyond our control. Electricity breakdown on overhead lines tend occur more frequently because it is prone to external disturbances such as animal, overgrown vegetation and defective pole top accessories. In Sarawak Energy Berhad (SEB), majority of the network are composed of overhead lines and hence, is more prone to failure. Conventional method of equipment inspection and fault finding are not effective to quickly identify the root cause of failure. SEB has engaged the use of corona discharge camera as condition-based monitoring equipment to carry out condition based inspection on the line in order to diagnose the condition of the lines prior to failure. Experimental testing has been carried out to determine the correlation between the corona discharge count and the level of defect on line insulator. The result shall be tabulated and will be used as reference for future scanning and diagnostic on any defect on the lines.

  11. A review of depression research in malaysia.

    Science.gov (United States)

    Ng, C G

    2014-08-01

    Depression is a debilitating illness and has become a leading cause of morbidity globally. We aim to summarise the evidence available in regard to the prevalence, type of assessment tools used and treatment options for depression in Malaysia. Two hundred and forty seven articles related to depression were found in a search through a database dedicated to indexing all original data relevant to medicine published in Malaysia between the years 2000-2013. Fifty seven articles were selected and reviewed on the basis of clinical relevance and future research implications. Findings were summarised, categorised and presented according to prevalence of depression, depression in women, depression in clinical condition, assessment tools, and treatment of depression. The prevalence of depression in Malaysia was estimated to be between 8 and 12%. The figures were higher among women of low socio-economic background or those with comorbid medical condition. The common assessment tools used in Malaysia include Beck Depression Inventory (BDI), Depression, Anxiety and Stress Scale (DASS), Patient Health Questionnaire 9 (PHQ-9) and Hospital Anxiety and Depression Scale (HADS). They were translated into the Malay language and their psychometric properties were established. Both pharmacological treatment and psychotherapy were commonly used in Malaysia, and were highly recommended in local clinical practice guidelines. There are discrepancies in the reported rates of depression in Malaysia and this needs to be addressed. There were lack of studies looking into the depression among subgroups in Malaysia especially in the male population. There were several instruments available for assessment of depression in Malaysia but their suitability for the local setting need further research. Both pharmacotherapy and psychotherapy were recommended in the local treatment guideline in Malaysia. With the emergence of generic medication, we need to compare their clinical efficacy and tolerability

  12. Green commercial building insurance in Malaysia

    Science.gov (United States)

    Yang, Yu Xin Ou; Chew, Boon Cheong; Loo, Heoy Shin; Tan, Lay Hong

    2017-03-01

    Green building construction is growing tremendously globally even in Malaysia. Currently, there are approximate 636 buildings have registered and to be certified with Green Building Index. Among these buildings, 45 buildings have already fulfilled the requirements and fully certified. The other buildings still under provisional certification stage. Malaysia had adopted Green Building Index in 2009 to support a move to promote green building concept. Malaysia starts to move towards green building because Malaysian construction and building industry realizes that both energy consumed and waste produced are reduced without irreversible impacts to ecosystems. Consequently, insurance companies such as Fireman's Fund from America has started the green building insurance policies for their green building in the year of 2006, while Malaysia still remain the coverage for green buildings using conventional property insurance. There are lacks of efforts to be seen from insurance companies to propose green building insurance for these green buildings. There are a few factors which can take into consideration for insurance companies to start the very first green building insurance in Malaysia. Although there are challenges, some efficient strategies have been identified to overcome the problems. The methods used in this research topic is qualitative research. The results obtained shows that green commercial building insurance has a huge business opportunity in Malaysia because the number of green commercial buildings are increasing tremendously in Malaysia. It is a favor to implement green building insurance in Malaysia. Furthermore, insurance companies can consider to add in extra coverage in standard building policy to provide extra protection for non-certified green buildings which have the intention to rebuilt in green when damage happens. Generally, it is very important to introduce green commercial buildings insurance into Malaysia so that all of the green commercial

  13. ANTARA BENCI DAN RINDU: HUBUNGAN INDONESIA-MALAYSIA DAN ISU TENAGA KERJA ILEGAL DI MALAYSIA

    OpenAIRE

    Maiwan, Mohammad

    2012-01-01

    The objective of this research is to get adeguate explanation and understanding to Indonesia-Malaysia relation in related to solving problem of the illegal workers. The method was using descriptive and qualitative. This study shows, that illegal workers was a serious problem which give impact to the Indonesia-Malaysia relations. In Malaysia contexs, its can be impact to the economy, social, security and etc. Nevertheless, Indonesian government must be take integrative and comprehensive progra...

  14. Gas in Eastern Europe

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    West European gas companies have long recognised the potential for lucrative business within eastern Europe. But they recognise that the region's integration into the west European system will be far from straightforward, with deals between east European gas companies and their western counterparts invariably containing financial mechanisms, such as barter trade, that are designed to cope with the easterners' shortage of hard currency. (author)

  15. Middle Eastern rhinoplasty.

    Science.gov (United States)

    Azizzadeh, Babak; Mashkevich, Grigoriy

    2010-02-01

    The ethnic appearance of the Middle Eastern nose is defined by several unique visual features, particularly a high radix, wide overprojecting dorsum, and an amorphous hanging nasal tip. These external characteristics reflect distinct structural properties of the osseo-cartilaginous nasal framework and skin-soft tissue envelope in patients of Middle Eastern extraction. The goal, and the ultimate challenge, of rhinoplasty on Middle Eastern patients is to achieve balanced aesthetic refinement, while avoiding surgical westernization. Detailed understanding of the ethnic visual harmony in a Middle Eastern nose greatly assists in preserving native nasal-facial relationships during rhinoplasty on Middle Eastern patients. Esthetic alteration of a Middle Eastern nose follows a different set of goals and principles compared with rhinoplasties on white or other ethnic patients. This article highlights the inherent nasal features of the Middle Eastern nose and reviews pertinent concepts of rhinoplasty on Middle Eastern patients. Essential considerations in the process spanning the consultation and surgery are reviewed. Reliable operative techniques that achieve a successful aesthetic outcome are discussed in detail. Copyright 2010 Elsevier Inc. All rights reserved.

  16. Absence of Plasmodium inui and Plasmodium cynomolgi, but detection of Plasmodium knowlesi and Plasmodium vivax infections in asymptomatic humans in the Betong division of Sarawak, Malaysian Borneo.

    Science.gov (United States)

    Siner, Angela; Liew, Sze-Tze; Kadir, Khamisah Abdul; Mohamad, Dayang Shuaisah Awang; Thomas, Felicia Kavita; Zulkarnaen, Mohammad; Singh, Balbir

    2017-10-17

    Plasmodium knowlesi, a simian malaria parasite, has become the main cause of malaria in Sarawak, Malaysian Borneo. Epidemiological data on malaria for Sarawak has been derived solely from hospitalized patients, and more accurate epidemiological data on malaria is necessary. Therefore, a longitudinal study of communities affected by knowlesi malaria was undertaken. A total of 3002 blood samples on filter paper were collected from 555 inhabitants of 8 longhouses with recently reported knowlesi malaria cases in the Betong Division of Sarawak, Malaysian Borneo. Each longhouse was visited bimonthly for a total of 10 times during a 21-month study period (Jan 2014-Oct 2015). DNA extracted from blood spots were examined by a nested PCR assay for Plasmodium and positive samples were then examined by nested PCR assays for Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, Plasmodium knowlesi, Plasmodium cynomolgi and Plasmodium inui. Blood films of samples positive by PCR were also examined by microscopy. Genus-specific PCR assay detected Plasmodium DNA in 9 out of 3002 samples. Species-specific PCR identified 7 P. knowlesi and one P. vivax. Malaria parasites were observed in 5 thick blood films of the PCR positive samples. No parasites were observed in blood films from one knowlesi-, one vivax- and the genus-positive samples. Only one of 7 P. knowlesi-infected individual was febrile and had sought medical treatment at Betong Hospital the day after sampling. The 6 knowlesi-, one vivax- and one Plasmodium-infected individuals were afebrile and did not seek any medical treatment. Asymptomatic human P. knowlesi and P. vivax malaria infections, but not P. cynomolgi and P. inui infections, are occurring within communities affected with malaria.

  17. Cage culture of sea bass in Malaysia

    OpenAIRE

    1994-01-01

    The article discusses the cage culture practice of sea bass (Lates calcarifer) in Malaysia. Problems on feed and seed supply and overcrowding are also discussed. Despite these problems, seabass cage culture still continuously booms.

  18. International Atomic Energy Agency and Malaysia

    International Nuclear Information System (INIS)

    Abd Rahim Mohd Nor

    1985-01-01

    A review on IAEA (International Atomic Energy Agency) and its relation with Malaysia is given. This article also discusses the background history of IAEA, its organization and functions in the field of nuclear energy

  19. Sustainable rice production in Malaysia beyond 2000

    International Nuclear Information System (INIS)

    Nashriyah Mat; Ho Nai Kin; Ismail Sahid; Ahyaudin Ali; Lum Keng Yeang; Mashhor Mansor

    2002-01-01

    This book is a compendium of works carried out by various institutions on subjects related to sustainable rice production. The institutions comprise Department of Agriculture, Malaysian Agricultural Research and Development Institute, Malaysian Institute for Nuclear Technology Research, Muda Agricultural Development Authority, Universiti Kebangsaan Malaysia, Universiti Putra Malaysia, Universiti Sains Malaysia, International Islamic University of Malaysia and the Agrochemical Company Mosanto. Integrated Biodiversity Management parallel with the Integrated Weed / Pest / Disease Management, rice-fish farming networking, agrochemical residue monitoring in rice and marine ecosystems, and application of biotechnology in rice productivity are taken as the future direction towards achieving sustainable rice production beyond 2000. Challenges from social and technical agroecosystem constraints, agricultural input management and maintenance of agroecosystem biodiversity are highlighted. It is imperative that the challenges are surmounted to attain the target that would be reflected by tangible rice output of 10 t/ha, and at the same time maintaining the well-being of rice-farmers. (Author)

  20. Feed-in tariff outlook in Malaysia

    International Nuclear Information System (INIS)

    Chua, Shing Chyi; Oh, Tick Hui; Goh, Wei Wei

    2011-01-01

    This paper aims to present the feed-in tariff (FiT) outlook in Malaysia, which is in the process of being enacted through a Renewable Energy (RE) Policy by the Government of Malaysia (GoM). A brief in policies leading towards the RE policy and the potential of each RE sources under FiT mechanism have been discussed. The successful utilisation of RE source in electricity generation and the FiT implementation globally are positive indicators to implement FiT in Malaysia. Potentials of FiT on biomass, biogas and solid waste energy are currently very promising in Malaysia, but it is solar energy which is predicted to be the main RE of the future, surpassing all other REs. (author)

  1. Islam and Economic Growth in Malaysia

    National Research Council Canada - National Science Library

    bin

    2003-01-01

    .... This thesis discusses nation building by fusing Islam, pluralism, democracy, and modernity. It argues that Malaysia's religious tolerance and adherence to western development models fostered economic growth since its independence...

  2. Sustainable development and construction industry in Malaysia

    Directory of Open Access Journals (Sweden)

    Suliman L. Kh. M.

    2009-12-01

    Full Text Available Sustainable construction is a way for the building and infrastructure industry to move towards achieving sustainable development, taking into account environmental, socioeconomic and cultural issues. Differing approaches and differing economic markets lead to different priorities. This paper presents the construction scenario of Malaysia and the developments in sustainable construction taking place in this country. Barriers to the implementation of sustainable construction are discussed. A list of recommendation was proposed to drive sustainable construction in this country. In conclusion, the status of sustainable construction in Malaysia is still in its infancy. The lack of awareness, training and education, ineffective procurement systems, existing public policies and regulatory frameworks are among the major barriers for sustainable construction in Malaysia. Besides the needs for capacities, technologies and tools, total and ardent commitment by all players in the construction sectors including the governments and the public atlarge are required in order to achieve sustainable construction in Malaysia.

  3. Hepatitis in Malaysia: Past, Present, and Future.

    Science.gov (United States)

    Raihan, Ruksana

    2016-01-01

    Malaysia is multiethnic, with a population of 31,127,247 comprising a mixture of Malays (50.1%), Chinese (22.6%), Indians (6.7%), Aborigines (11.8%), others (0.7%), and noncitizens (8.2%). Like other countries in the region, viral hepatitis is an important public health problem in Malaysia. The 3 most common causes for hepatitis in Malaysia are hepatitis A, B, and C. Hepatitis A has been a reportable disease in Malaysia since 1988. Due to the introduction of government control programs, the national incidence rate has dropped steadily. It is now estimated that 50% of Malaysians less than 30 years of age do not have antibodies to hepatitis A and are therefore susceptible to the disease, which can be prevented by reinforcing the hygiene status of the general population. Malaysia is a country of medium seroprevalence for the hepatitis B virus (HBV) surface antigen (HBsAg) in the general population (1.5-9.8%). The major route of transmission is from infected mother to fetus. There are an estimated 1 million people chronically infected with hepatitis B in Malaysia. Approximately 75% of all viral hepatitis cases are due to hepatitis B infection, with a male-to-female ratio of 2:1. Chronic hepatitis B (CHB) accounts for more than 80% of the hepatocellular carcinoma (HCC) cases seen in Malaysia and HCC is the 3rd most common malignant neoplasm and among the 10 leading causes of death. Most common genotypes are B and C. Incidence rates among Chinese, Malays, and Indians are 36, 26, and 15% respectively. The hepatitis B vaccination program for children was introduced in 1989, which successfully managed to reduce the seroprevalence of infection among Malaysians to 0.01% (graph 4, 2014). But the disease burden will still remain high for some time as the infected people are getting older and living longer. Hepatitis C virus (HCV) infection is a growing problem in Malaysia. An estimated 453,700 people were living with HCV infection in Malaysia in 2009 (2.5% of the population

  4. Review of toxoplasmosis in Malaysia.

    Science.gov (United States)

    Yahaya, N

    1991-12-01

    Various studies on toxoplasmosis in Malaysia have shown that specific antibodies to Toxoplasma gondii are common among Malaysians. Among the ethnic groups, the Malays have the highest prevalence rate followed by Indians, Orang Aslis (aborigines) and Chinese. Antibody is acquired early in life and increases with age. There is no significant difference in the prevalence rate between males and females. The disease is apparently more prevalent among rural dwellers and those in the lower socioeconomic group. It appears that the prevalence rate is also influenced by environmental conditions, occupation, diet and cultural habits. Studies with animals have shown the presence of antibody to T. gondii, but this does not seem to be the source of infection since Malaysians normally cook their meat well.

  5. MARITIME VIOLENCE : IMPLICATIONS TO MALAYSIA

    Directory of Open Access Journals (Sweden)

    Nurulizwan Ahmad Zubir

    2014-04-01

    Full Text Available Abstract Maritime Piracy has been a serious threat to the international community especially in the SoutheastAsia region. This threat has caused tremendous implications towards the world economy, environment,political stability of the nations involved because 45% of the shipping company passes through theSoutheast Asia. The worrying fact is that these attacks were committed by terrorists as well as traditionalmaritime pirates. This paper examines on the implications of maritime crime in Malaysia and discusseswhether the definition of piracy under the International Law could be applied to these attacks. Thispaper concludes that cooperation between the region’s states and the enhancement of a good securitysystem of one state are needed to combat maritime violence. Thus it is imperative that the internationallaw need to be changed in order to enhance the meaning of piracy and also to include sea terrorism. Key words: piracy, maritime, terrorist

  6. Determinants of Commercial Banks' Profitability in Malaysia

    OpenAIRE

    Trofimov, Ivan D.; Md. Aris, Nazaria; Ying Ying, Jovena Kho

    2018-01-01

    This study aims to examine the relationship between non-performing loans (NPLs) and commercial banks' performance in Malaysia, alongside other factors. It considers the effect of NPLs, cost efficiency and bank size on commercial banks' profitability by using panel data regression (Pooled OLS model), covering the period of 2010-2015. The findings of the study show that NPLs and cost efficiency have a significant negative relationship with commercial banks' performances in Malaysia. On the othe...

  7. Stabilisasi Harga Pangan Nonberas Di Malaysia

    OpenAIRE

    Sayaka, Bambang; Adhie, Setyo

    2016-01-01

    Malaysian Government applies policy on non-rice price stabilization through farmers' product purchase, incentives for farmers, and retail price control. This paper aims (i) to review Malaysia's policy on food production; (ii) to assess price control and farmers' protection policy; and (iii) to learn a lesson from Malaysia's success in stabilizing strategic goods prices. Ministry of Domestic Trade, Co-operatives and Consumerism (MDTCC) controls strategic goods price established by Malaysian Go...

  8. Public Debt and Economic Growth in Malaysia

    OpenAIRE

    Siew-Peng Lee; Yan-Ling Ng

    2015-01-01

    Public debt in the Malaysia increased because of fiscal expansions. This study examines whether public debt contributed to the economic growth in Malaysia over the period 1991 to 2013. It also examines whether other indicators of debt burden, such as budget deficit, budget expenditure, and external debt service and government consumption, have an impact on economic growth. The results of this study are consistent with the existing literature that found a negative association between diet and ...

  9. Islam Observed: the Case of Contemporary Malaysia

    OpenAIRE

    Metzger, Laurent

    1998-01-01

    The phenomenon of the rise of Islam in Malaysia does not attract much attention of observers when compared with the same phenomenon in the countries of the Middle East, North Africa, Central or South Asia. This paper attempted to review comprehensively the development of Islam in Malaysia since obtaining its independence from Britain in August 1957.Copyright (c) 2014 by SDI. All right reserved.DOI: 10.15408/sdi.v5i2.753

  10. Financial Analysis Report: Malaysia Airlines 2007 - 2011

    OpenAIRE

    Gilbert O'Neil Mushure

    2014-01-01

    This work is an analysis of the annual reports of Malaysia Airlines Berhad from 2007 to 2011. Profitability analysis was done on the financial statements of the company from 2007 to 2011. Cash and working capital management analysis were done on the financial statements of 2010 and 2011. It was found that Malaysia Airlines Berhad was constantly suffering from high costs of operations which resulted in consecutive negative gross profit over the years.Net profit remained positive only as a resu...

  11. Foreign Students’ Motivation for Studying In Malaysia

    OpenAIRE

    Muh. Amin; Sugiyanto; Keppi Sukesi; Ismadi

    2013-01-01

    Purpose – With the recognition of the importance of education in economy different countries are responding with changes within their education systems. Education is recognized as a foundation to the continued growth of a country but with the globalization of business, is education becoming a commodity?Objective - This paper examines international students’ motivation for studying in Malaysia. The second objective is to analyze educational policies and their implementation within Malaysia.Des...

  12. Internationalization of Boost Juice to Malaysia

    OpenAIRE

    Jane L. Menzies; Stuart C. Orr

    2014-01-01

    This case describes the process that the Australian juice retail chain, Boost Juice, has used to internationalize to Malaysia. The main objective of this case is to demonstrate good practice in regard to internationalization. The case provides the background of the juice bar industry in Malaysia and determines that it is an attractive market for new start-up juice bars. An analysis of Boost Juice's capability determined that the company utilized the skills of its staff, product innovations, b...

  13. Brand Awareness and Consumer Loyalty in Malaysia

    OpenAIRE

    Firend, A.R; Alvandi, S.

    2015-01-01

    The objectives of this study is to evaluate consumer's awareness of brand by studying the relationship between brand awareness and variables such as customer loyalty, customer satisfaction, customer trust and quality of services. The study examines the relationship through a quantitative research methodology conducted in main peninsula Malaysia. The examined brand Air Asia airline's services in Malaysia. This study finds the existence of crucial association between customer loyalty, trust, sa...

  14. Recent and prospective population trends in Malaysia.

    Science.gov (United States)

    Jones, G W; Tan, P C

    1985-09-01

    Recent population trends in Malaysia are reviewed, with the focus on Peninsular Malaysia. Separate consideration is given to population growth between 1970 and 1980; mortality trends; period and cohort fertility trends; factors affecting fertility, including changes in age structure, nuptiality, and other socioeconomic and demographic changes; and the recent development of a pro-natalist policy involving a goal of a population of 70 million by 2050.

  15. Maritime Security: Malaysia’s Persistent Problem

    Science.gov (United States)

    2012-01-01

    navies, and air forces of the littoral states.”20 In his keynote address at the 2011 Shangri-La Dialogue, Prime Minister Dato’ Sri Najib Tun Razak ...Monitor, Vol. 4 No. 3, 2006. Razak , Dato’ Sri Najib Tun, Prime Minister Malaysia. Keynote Address. Shangri-La Dialogue. Singapore, June 3, 2011... Razak , Dato’ Sri Najib , Deputy Prime Minister Malaysia, Address. Shangri-La Dialogue. Enhancing Maritime Security Cooperation. Singapore, 2005

  16. Population mobility in Peninsular Malaysia.

    Science.gov (United States)

    Jones, G W; Sidh, M S

    1979-12-01

    1970 census materials were used to analyze migration patterns in Peninsular Malaysia. Inter-state migration patterns were analyzed by comparing birth place and current place of residence data, and inter-district and intra-district migration patterns were assessed using information on previous and current place of residence. The proportion of inter-state migrants in the total population increased from 4.7%-10.9% from 1947-1970. 53% of the inter-state migrants were Malays, 33% were Chinese, and 13% were Indian. The states of Selangor and Pahang had the highest net migration gains and Perak had the highest number of out-migrants. Selangor attracted migrants because it was a major industrial, administrative and educational center. Migrants were attracted to Pahang because of recent efforts by the government to promote agricultural development in the state. Areas which showed a net migration loss were experiencing slow economic growth. 48.4% of the inter-state migrants migrated to either rural or suburban areas, 26% moved to cities with populations of 75,000 or more, and 26% moved to towns with populations of 1000-10,000. 48.6% of the inter-state migrants were females. When all types of internal migration were taken into account it was estimated that approximately 30% of the population had moved at some point in their life time. During the early 1900s, Peninsular Malaysia received many immigrants from China, India, and other countries, and the Chinese became the dominant group in many urban areas and in many economic sectors. In 1950 the government, fearing that the Malays would become a minority group in their own country, halted international immigration. The recent increase in internal migration has contributed toward equalizing the influence and power of the Chinese and the Malays in urban areas and in various economic sectors.

  17. Federation of Malaysia. Country profile.

    Science.gov (United States)

    Newcomb, L

    1985-01-01

    The 1984 population of Malaysia has been estimated at 14.7 million and the population growth rate averaged 2.3% in 1970-80. Population growth is officially encouraged to form a substantial home market for economic development. Toward this end, the 1985 budget has increased tax deductions for families with 5 children. The capital city of Kuala Lumpur is the largest metropolitan area (1 million population) and the Federal Territory is the most densely populated region. Immigration is strictly controlled by the government, and the percentage of foreign-born citizens was 5% in 1980. China, India, and Pakistan are decreasing in importance as countries of origin. Internal mobility, however, is increasing. Rural-rural migration accounted for 45% of internal migration in 1970-80 and was largely motivated by family reasons. Only 7% of Malaysians are estimated to move in search of work. Racial tensions led the government to grant special economic privileges to native-born Islamic Malays. The greatest proportion of the population is centered in the lowest age groups. The percentage of females 15-29 years of age rose from 26% in 1970 to 30% in 1980 and is expected to continue to rise. Fertility is on the decline. The majority of households in the country involve nuclear families. There has been an increase in the number of men and women who delay marriage or remain single. Education is widely available for children aged 6-15 years and those who meet certain academic standards receive free education up to age 19 years. The current labor force is estimated at 5.4 million, with an annual growth rate of 3.1%. Malaysia's per capita income (US $1860 in 1982) is among the highest in Southeast Asia and the gross national product increased by an average annual rate of 8% in 1970-81. The government plans to move toward the development of heavier industries and more manufacturing concerns.

  18. Renewable energy technology acceptance in Peninsular Malaysia

    International Nuclear Information System (INIS)

    Kardooni, Roozbeh; Yusoff, Sumiani Binti; Kari, Fatimah Binti

    2016-01-01

    Despite various policies, renewable energy resources have not been developed in Malaysia. This study investigates the factors that influence renewable energy technology acceptance in Peninsular Malaysia and attempts to show the impact of cost and knowledge on the perceived ease of use and perceived usefulness of renewable energy technology. The results show that cost of renewable energy has an indirect effect on attitudes towards using renewable energy through the associated impact on the perceived ease of use and perceived usefulness. The results also indicate that public knowledge in Peninsular Malaysia does not affect perceived ease of use, although the positive impact of knowledge on perceived usefulness is supported. Furthermore, our results show that the current business environment in Peninsular Malaysia does not support the adoption of renewable energy technology, and thus, renewable energy technology is not commercially viable in Peninsular Malaysia. Additionally, the population of Peninsular Malaysia associates the use of renewable energy with a high level of effort and therefore has a negative attitude towards the use of renewable energy technology. There is, therefore, a definite need to pay more attention to the role of public perception and awareness in the successes and failures of renewable energy policy. - Highlights: • Public acceptance is an essential element in the diffusion of renewable energy. • Perceived ease of use and perceived usefulness affect intention to use renewables. • It is important to reduce the cost of renewable energy, particularly for end users. • Renewable energy policies should address issues of public perception and awareness.

  19. A cross-cultural comparison of autistic traits in the UK, India and Malaysia.

    Science.gov (United States)

    Freeth, Megan; Sheppard, Elizabeth; Ramachandran, Rajani; Milne, Elizabeth

    2013-11-01

    The disorder of autism is widely recognised throughout the world. However, the diagnostic criteria and theories of autism are based on research predominantly conducted in Western cultures. Here we compare the expression of autistic traits in a sample of neurotypical individuals from one Western culture (UK) and two Eastern cultures (India and Malaysia), using the Autism-spectrum Quotient (AQ) in order to identify possible cultural differences in the expression of autistic traits. Behaviours associated with autistic traits were reported to a greater extent in the Eastern cultures than the Western culture. Males scored higher than females and science students scored higher than non-science students in each culture. Indian students scored higher than both other groups on the Imagination sub-scale, Malaysian students scored higher than both other groups on the Attention Switching sub-scale. The underlying factor structures of the AQ for each population were derived and discussed.

  20. Situation Report--Austria, Cameroon, Canada, Czechoslovakia, Denmark, Egypt, France, German Federal Republic, Greece, Hungary, Irish Republic, Jamaica, Malta, Norway, Sabah, Sarawak, Spain, Tahiti (French Polynesia), Tonga, Turkey, and United Kingdom.

    Science.gov (United States)

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in 21 foreign countries are presented in these situation reports. Countries included are Austria, Cameroon, Canada, Czechoslovakia, Denmark, Egypt, France, German Federal Republic, Greece, Hungary, Irish Republic, Jamaica, Malta, Norway, Sabah, Sarawak, Spain, Tahiti, Tonga, Turkey, and United…

  1. Morphological indicators of growth stages in carbonates platform evolution: comparison between present-day and Miocene platforms of Northern Borneo, Malaysia.

    Science.gov (United States)

    Pierson, B.; Menier, D.; Ting, K. K.; Chalabi, A.

    2012-04-01

    Satellite images of present-day reefs and carbonate platforms of the Celebes Sea, east of Sabah, Malaysia, exhibit large-scale features indicative of the recent evolution of the platforms. These include: (1) multiple, sub-parallel reef rims at the windward margin, suggestive of back-stepping of the platform margin; (2) contraction of the platform, possibly as a result of recent sea level fluctuations; (3) colonization of the internal lagoons by polygonal reef structures and (4) fragmentation of the platforms and creation of deep channels separating platforms that used to be part of a single entity. These features are analogue to what has been observed on seismic attribute maps of Miocene carbonate platforms of Sarawak. An analysis of several growth stages of a large Miocene platform, referred to as the Megaplatform, shows that the platform evolves in function of syn-depositional tectonic movements and sea level fluctuations that result in back-stepping of the margin, illustrated by multiple reef rims, contraction of the platform, the development of polygonal structures currently interpreted as karstic in origin and fragmentation of the megaplatform in 3 sub-entities separated by deep channels that precedes the final demise of the whole platform. Comparing similar features on present-day to platforms and Miocene platforms leads to a better understanding of the growth history of Miocene platforms and to a refined predictability of reservoir and non-reservoir facies distribution.

  2. Prevalence of a koinobiont endoparasitoid Misotermes mindeni (Diptera: Phoridae) in colonies of the fungus-growing termite Macrotermes gilvus (Blattodea: Termitidae) in Malaysia.

    Science.gov (United States)

    Foo, Foong-Kuan; Singham, G Veera; Othman, Ahmad Sofiman; Lee, Chow-Yang

    2011-10-01

    A survey of the infestation rate of colonies of Macrotermes gilvus (Hagen) (Termitidae: Macrotermitinae) with the koinobiont endoparasitoid Misotermes mindeni Disney & Neoh (Diptera: Phoridae) was conducted in Malaysia from September 2009 to January 2011 in the states of Kedah, Penang, Perak, Selangor, Kuala Lumpur, Johor, Terengganu, and Sarawak. Of the 1,125 M. gilvus mounds surveyed, 12.4% contained termites parasitized by M. mindeni and these mounds occurred only in the states of Penang and Perak. High frequencies of mounds containing parasitized termites were found at sites in Penang: Bayan Lepas (21.1%), Minden Campus of Universiti Sains Malaysia ([USM]; 24.5%), Teluk Bahang (28.0%), and Bukit Mertajam (35.0%); the lowest frequency (4.0%) was recorded from Gelugor. The parasitized colonies at all sites were classified as healthy, with exception of several from the Minden Campus of USM (96.4% healthy) and Ayer Itam (87.5% healthy). Most parasitized colonies (71.2%) had a low level of M. mindeni infestation. Only 16.7 and 12.1% of the infested colonies had moderate or high parasite infestation levels, respectively. The height of infected mounds was significantly higher than that of the healthy mounds, but there was no difference between the mound diameters of infested and uninfested mounds. Parasite infestation level was not significantly correlated with mound height or mound diameter. The ambient light intensity at sites with infested mounds was significantly lower than that of uninfested mounds. There was also a significant negative relationship between light intensity and degree of parasitism.

  3. Distribution network connection pricing framework and methodology: identification of areas of improvement for Sarawak Energy Berhad Connection Charges Guidelines through modified delphi method

    Science.gov (United States)

    Tan, J. K.; Abas, N.

    2017-07-01

    Complaints on issues and matters related to connection charges have been very common for electricity supply utility companies around the world including Sarawak Energy Berhad. In order to identify the areas that can be improved, a mixed method of exploratory research involving qualitative and quantitative methods have been designed and undertaken rather than a single method of survey. This will ensure a more comprehensive and detailed understanding of the issues from various target groups. The method is designed under three phases, employing Modified Delphi Technique for phase 1 through a series of stake holder engagements, online and offline survey questionnaires to be filled by internal wiring contractors for phase 2 whilst under phase 3, case studies shall be carried out on the issues identified from phase 1 and phase 2 of the study. This paper presented the findings from the Modified Delphi Technique. The findings revealed that there are areas of improvement for Sarawak Energy Berhad connection guidelines in term of differentiation of dedicated and shared assets which leads to unfairness to the connecting customers, inconsistency and non-transparent in charging. The findings of Modified Delphi Technique shall be used for implementation of phase 2 and phase 3 of the study.

  4. Treatment of wastewater from rubber industry in Malaysia ...

    African Journals Online (AJOL)

    Treatment of wastewater from rubber industry in Malaysia. ... Discharge of untreated rubber effluent to waterways resulted in water pollution that affected the human health. ... Key words: Rubber industry, effluent, waste management, Malaysia.

  5. 78 FR 57620 - Trade Mission to Philippines and Malaysia

    Science.gov (United States)

    2013-09-19

    ... DEPARTMENT OF COMMERCE International Trade Administration Trade Mission to Philippines and Malaysia AGENCY: International Trade Administration, Department of Commerce. ACTION: Notice. SUMMARY: The... trade mission to Manila, Philippines and Kuala Lumpur, Malaysia scheduled for October 23-October 30...

  6. Malaysia. Valget handler om vækst og ulighed

    DEFF Research Database (Denmark)

    Søborg, Henrik

    2013-01-01

    Corruption, growth and increasing inequality are some of main theme at the election in Malaysia today.......Corruption, growth and increasing inequality are some of main theme at the election in Malaysia today....

  7. Malaysia: Political, Security, Economic, and Trade Issues Considered

    National Research Council Canada - National Science Library

    Vaughn, Bruce; Martin, Michael

    2007-01-01

    This report discusses key aspects of the U.S.-Malaysia relationship, including economics and trade, counterterrorism cooperation, defense ties, and Malaysia's external posture as it affects Amen can interests...

  8. Traditional and Complementary Medicine Use in Knee Osteoarthritis and its Associated Factors Among Patients in Northeast Peninsular Malaysia.

    Science.gov (United States)

    Nik Shafii, Nik Abdul Hafiz; Yaacob, Lili Husniati; Ishak, Azlina; Kadir, Azidah Abdul

    2018-03-01

    We sought to determine the prevalence of traditional and complementary medicine (TCM) use for knee osteoarthritis and its associated factors among patients attending a referral hospital in an eastern coastal state of Malaysia. This cross-sectional study included 214 patients with knee osteoarthritis. A universal sampling method was applied to patients who attended the outpatient clinic in Hospital Universiti Sains Malaysia from May 2013 to October 2013. Participants were given a questionnaire to determine their sociodemographic information and a validated Bahasa Malaysia version of the Western Ontario and McMaster Universities Arthritis Index (WOMAC). This questionnaire was used to assess the severity of knee osteoarthritis (i.e., pain, stiffness, and disturbances in daily activity). Over half (57.9%) of patients reported using TCM to treat knee osteoarthritis. Factors associated with TCM use were gender (odd ratio (OR) = 2.47; 95% confidence interval (CI): 1.28-4.77), duration of knee osteoarthritis (OR = 1.51; 95% CI: 1.03-2.23), and the severity of knee pain (OR = 2.56; 95% CI: 1.71-3.86). The prevalence of TCM use among eastern Malaysian patients with knee osteoarthritis was high. Physicians caring for these patients should be aware of these findings so that inquiries regarding TCM use can be made and patients can be appropriately counseled.

  9. Regional air pollution over Malaysia

    Science.gov (United States)

    Krysztofiak, G.; Catoire, V.; Dorf, M.; Grossmann, K.; Hamer, P. D.; Marécal, V.; Reiter, A.; Schlager, H.; Eckhardt, S.; Jurkat, T.; Oram, D.; Quack, B.; Atlas, E.; Pfeilsticker, K.

    2012-12-01

    During the SHIVA (Stratospheric Ozone: Halogen Impacts in a Varying Atmosphere) campaign in Nov. and Dec. 2011 a number of polluted air masses were observed in the marine and terrestrial boundary layer (0 - 2 km) and in the free troposphere (2 - 12 km) over Borneo/Malaysia. The measurements include isoprene, CO, CO2, CH4, N2O, NO2, SO2 as primary pollutants, O3 and HCHO as secondary pollutants, and meteorological parameters. This set of trace gases can be used to fingerprint different sources of local and regional air pollution (e.g., biomass burning and fossil fuel burning, gas flaring on oil rigs, emission of ships and from urban areas, volcanic emissions, and biogenic emissions). Individual sources and location can be identified when the measurements are combined with a nested-grid regional scale chemical and meteorological model and lagrangian particle dispersion model (e.g., CCATT-BRAMS and FLEXPART). In the case of the former, emission inventories of the primary pollutants provide the basis for the trace gas simulations. In this region, the anthropogenic influence on air pollution seems to dominate over natural causes. For example, CO2 and CH4 often show strong correlations with CO, suggesting biomass burning or urban fossil fuel combustion dominates the combustion sources. The study of the CO/CO2 and CH4/CO ratios can help separate anthropogenic combustion from biomass burning pollution sources. In addition, these ratios can be used as a measure of combustion efficiency to help place the type of biomass burning particular to this region within the wider context of fire types found globally. On several occasions, CH4 enhancements are observed near the ocean surface, which are not directly correlated with CO enhancements thus indicating a non-combustion-related CH4 source. Positive correlations between SO2 and CO show the anthropogenic influence of oil rigs located in the South China Sea. Furthermore, SO2 enhancements are observed without any increase in CO

  10. Tourists, Expatriates and International Retirees: An Empirical Evidence from Malaysia

    OpenAIRE

    Tan Chuie-Hong; Ho Sin-Ban

    2014-01-01

    Malaysia relies heavily on tourism industry to spur its economic growth. Parallel to the growth of tourists, Malaysia is also a popular destination for international retiree migration through the Malaysia My Second Home (MM2H) programme and expatriates. Hence this study attempts to investigate the relationship between tourists, expatriates and MM2H participants. The pull factors of Malaysia as a destination of tourism, expatriates and international retirees are prevalent, and could be further...

  11. Inter-Religious Dialogue Models in Malaysia

    Directory of Open Access Journals (Sweden)

    Wan Sabri Wan Yusof

    2012-06-01

    Full Text Available Over the years, many organizations have involved in the implementation of inter-religious dialogue in Malaysia. However, there are stillthose who doubt the role and purpose of interreligious dialogue. This might be due to lack of information and understanding regardingthe methodology of dialogue and also about different types that it may take. The present study is aimed at exploring a few models ofinter-religious dialogue that have been practised by some organizations that actively involved in dialogue. The study focuses on a review of selected organizational or institutional dialoguemodels such as Center for Civilizational Dialogue (CCD, Students Representative Council of Malaysia Science University (HealthCampus and Inter-faith Spiritual Fellowship (INSaF. This study provides information concerning the various designs of inter-religiousdialogue model in Malaysia and proposes that different designs of inter-religious dialogue rely on its different types and goals. It is found that, the commonly practiced type of dialogue in Malaysia is educational type which focuses on exploring inter-religious commonalities as well as differences which consequently willincrease understanding and foster meaningful engagement between people of different ethnic and religious background in Malaysia. Thistype of dialogue is distinguished from conflict resolution types of dialogue which aims at identifying issues and generating action plansto conflicts or disputes.

  12. RESEARCH UNIVERSITIES IN MALAYSIA: WHAT BEHOLDS?

    Directory of Open Access Journals (Sweden)

    Nooraini Mohamad Sheriff

    2017-12-01

    Full Text Available The National Higher Education Strategic Plan Beyond 2020 aims at further strengthening Malaysian research universities and envisions that two Malaysian universities will be among the Top 100 world universities. To date there are 5 research universities in Malaysia, namely University of Malaya (UM, Universiti Kebangsaan Malaysia (UKM, Universiti Sains Malaysia (USM, Universiti Putra Malaysia (UPM and Universiti Teknologi Malaysia (UTM being the latest addition. These research universities are required to focus primarily on research and innovation activities, driven by highly competent academics and competitive student admissions. Research universities too are expected to explore their intellectual capacity and become models of Malaysian universities in conducting research activities aimed at knowledge advancement. Apart from this research universities are entrusted to generate their own income and establish holding companies responsible for conducting business ventures through the commercialization of their research products. Quality and quantity of researchers, research and postgraduates are also expected to increase in these research driven institutions. This calls for a visionary university leadership and the application of a new image and organizational principles. Education, training and employment policies too have to be reviewed, to ensure staff have the skills necessary for the development of research activities.

  13. Fulbright-Hays Seminars Abroad Program: Malaysia 1995. Participants' Reports.

    Science.gov (United States)

    Malaysian-American Commission on Educational Exchange, Kuala Lumpur.

    These reports and lesson plans were developed by teachers and coordinators who traveled to Malaysia during the summer of 1995 as part of the U.S. Department of Education's Fulbright-Hays Seminars Abroad Program. Sections of the report include: (1) "Gender and Economics: Malaysia" (Mary C. Furlong); (2) "Malaysia: An Integrated,…

  14. Antenatal calcium intake in Malaysia.

    Science.gov (United States)

    Mahdy, Zaleha Abdullah; Basri, Hashimah; Md Isa, Zaleha; Ahmad, Shuhaila; Shamsuddin, Khadijah; Mohd Amin, Rahmah

    2014-04-01

    To determine the adequacy of antenatal calcium intake in Malaysia, and the influencing factors. A cross-sectional study was conducted among postnatal women who delivered in two tertiary hospitals. Data were collected from antenatal cards, hospital documents and diet recall on daily milk and calcium intake during pregnancy. SPSS version 19.0 was used for statistical analyses. A total of 150 women were studied. The total daily calcium intake was 834 ± 43 mg (mean ± standard error of the mean), but the calcium intake distribution curve was skewed to the right with a median intake of 725 mg daily. When calcium intake from milk and calcium supplements was excluded, the daily dietary calcium intake was only 478 ± 25 mg. Even with inclusion of milk and calcium supplements, more than a third (n=55 or 36.7%) of the women consumed less than 600 mg calcium in their daily diet. The adequacy of daily calcium intake was not influenced by maternal age, ethnicity, income or maternal job or educational status as well as parity. The daily dietary calcium intake of the Malaysian antenatal population is far from adequate without the addition of calcium supplements and milk. © 2013 The Authors. Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology.

  15. Nuclear Malaysia in The News 2015

    International Nuclear Information System (INIS)

    2016-01-01

    Nuclear was a term that always misunderstands by public as a terrifying term. The nuclear activities around Malaysia was disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency for nuclear for peace were collecting that news and compiled them to make the public aware the benefits of nuclear energy to develop our country. All the news about nuclear were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  16. Nuclear Malaysia in the news 2011

    International Nuclear Information System (INIS)

    2012-01-01

    Nuclear was a term that always misunderstood by public as a terrifying term. Nuclear activities around Malaysia were disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency were collecting that news and compiled them. The purpose for this compilation were to make the public aware the benefits of nuclear energy and all the activities regarding nuclear surround them. All the news about nuclear technology were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  17. Nuclear Malaysia in the news 2014

    International Nuclear Information System (INIS)

    2009-01-01

    Nuclear was a term that always misunderstands by public as a terrifying term. The nuclear activities around Malaysia was disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency for nuclear for peace were collecting that news and compiled them to make the public aware the benefits of nuclear energy to develop our country. All the news about nuclear were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  18. Nuclear Malaysia in the news 2009

    International Nuclear Information System (INIS)

    2008-01-01

    Nuclear was a term that always misunderstands by public as a terrifying term. The nuclear activities around Malaysia was disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency for nuclear for peace were collecting that news and compiled them to make the public aware the benefits of nuclear energy to develop our country. All the news about nuclear were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  19. Nuclear Malaysia in the news 2010

    International Nuclear Information System (INIS)

    2011-01-01

    Nuclear was a term that always misunderstood by public as a terrifying term. Nuclear activities around Malaysia were disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency were collecting that news and compiled them. The purpose for this compilation were to make the public aware the benefits of nuclear energy and all the activities regarding nuclear surround them. All the news about nuclear technology were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  20. Nuclear Malaysia in the news 2012

    International Nuclear Information System (INIS)

    2013-01-01

    Nuclear was a term that always misunderstood by public as a terrifying term. Nuclear activities around Malaysia were disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency were collecting that news and compiled them. The purpose for this compilation were to make the public aware the benefits of nuclear energy and all the activities regarding nuclear surround them. All the news about nuclear technology were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  1. Nuclear Malaysia in the news 2008

    International Nuclear Information System (INIS)

    2009-01-01

    Nuclear was a term that always misunderstood by public as a terrifying term. Nuclear activities around Malaysia were disseminated in newspaper and Malaysian Nuclear Agency as a responsible agency were collecting that news and compiled them. The purpose for this compilation were to make the public aware the benefits of nuclear energy and all the activities regarding nuclear surround them. All the news about nuclear technology were collected using various type of newspaper published in Malaysia such as Utusan Malaysia, Berita Harian, Daily Express, News Straits Time, The Star, Borneo Post and others. This news was compiled according to their main topics such as energy, nuclear in agriculture, education and others. Each year one edition of this report will publish and disseminate it to the other libraries, government agencies, school and others to make the public aware the existence of nuclear activities around their countries.

  2. Radiation exposure during travelling in Malaysia

    International Nuclear Information System (INIS)

    Omar, M.; Hassan, A.; Sulaiman, I.

    2006-01-01

    Absorbed dose rates in vehicles during travelling by different modes of transport in Malaysia were measured. Radiation levels measured on roads in Peninsular Malaysia were within a broad range, i.e. between 36 and 1560 nGy h -1 . The highest reading, recorded while travelling near monazite and zircon mineral dumps, was 13 times the mean environmental radiation level of Malaysia. It is evident that radioactive material dumps on the roadsides can influence the radiation level on the road. The absorbed dose rates measured while travelling on an ordinary train were between 60 and 350 nGy h -1 . The highest reading was measured when the train passed a tunnel built through a granite rock hill. The measurement during sea travelling by ferries gave the lowest radiation level owing to merely cosmic radiation at the sea level. (authors)

  3. Rare earth industries: Strategies for Malaysia

    International Nuclear Information System (INIS)

    2011-01-01

    Evidently, many reports cite Malaysia as having reasonably substantial amounts of rare earths elements. In fact, based on the rare earths found in the residual tin deposits alone, Malaysia has about 30,000 tonnes. This does not take into account unmapped deposits which experts believe may offer more tonnages of rare earths. Brazil which is reported to have about 48,000 tonnes has announced plans to invest aggressively in the rare earths business. China has on record the largest reserves with about 36 million tonnes. This explains why China has invested heavily in the entire value chain of the rare earths business. Chinas committed investment in rare earths started many years ago when the country's foremost leaders proclaimed the strategic position of rare earths in the world economy. That forecast is now a reality where the rise in the green high-tech economy is seen driving global demand for rare earths in a big way. Malaysia needs to discover and venture into new economic growth areas. This will help fuel the country's drive to achieve a high income status by 2020 as articulated in the New Economic Model (NEM) and the many supporting Economic Transformation Plans that the Government has recently launched. Rare earths may be the new growth area for Malaysia. However, the business opportunities should not just be confined to the mining, extraction and production of rare earths elements alone if Malaysia is to maximise benefits from this industry. The industry's gold mine is in the downstream products. This is also the sector that China wants to expand. Japan which now controls about 50 % of the global market for downstream rare earths-based high-tech components is desperately looking for partners to grow their stake in the business. Malaysia needs to embark on the right strategies in order to build the rare earths industry in the country. What are the strategies? (author)

  4. The Eastern Partnership

    DEFF Research Database (Denmark)

    Nielsen, Kristian L.; Vilson, Maili

    2014-01-01

    When the EU launched the Eastern Partnership (EaP) in 2009, it did so with much rhetoric about projecting its soft power into Eastern Europe. Yet today, the EU's soft power project seems to have stalled, with developments in the region being less than favourable. This article argues that the EaP...... essentially replicated the main weaknesses of the European Neighbourhood Policy, by offering too little incentive and support to the partners, rendering both conditionality and soft power ineffective as tools for milieu shaping. In promoting the EaP as a policy of soft power, the EU has once again forgotten...

  5. Ketahanan Fiskal: Studi Kasus Malaysia dan Indonesia

    OpenAIRE

    Sriyana, Jaka

    2009-01-01

    In the last ten years, fiscal policy has played an important role to the macroeco¬nomy. This paper aims to explore the fiscal strength and the synchronization between fiscal and monetary policy for Malaysia and Indonesia. For the first issue, this paper applies the Trehan and Walsh method, meanwhile the Berument’s approach is used to examine the syn¬chronization between fiscal and monetary policy. The result shows that in case of Malaysia, the government applied tax-financed policy; meanwhile...

  6. Ketahanan Fiskal: Studi Kasus Malaysia Dan Indonesia

    OpenAIRE

    Sriyana, Jaka

    2005-01-01

    In the last ten years, fiscal policy has played an important role to the macroeco¬nomy. This paper aims to explore the fiscal strength and the synchronization between fiscal and monetary policy for Malaysia and Indonesia. For the first issue, this paper applies the Trehan and Walsh method, meanwhile the Berument's approach is used to examine the syn¬chronization between fiscal and monetary policy. The result shows that in case of Malaysia, the government applied tax-financed policy; meanwhile...

  7. Social engineering awareness in Nuclear Malaysia

    International Nuclear Information System (INIS)

    Mohd Dzul Aiman bin Aslan; Mohamad Safuan bin Sulaiman; Abdul Muin bin Abdul Rahman

    2010-01-01

    Social engineering is the best tools to infiltrate an organization weakness. It can go bypass the best fire wall or Intrusion Detection System (IDS) the organization ever had, effectively. Nuclear Malaysia staffs should aware of this technique as information protection it is not only depends on paper and computer. This paper consist a few test cases including e mail, dump ster diving, phishing, malicious web content, and impersonation to acknowledge all Nuclear Malaysia staffs about the method, effect and prevention of social engineering. (author)

  8. Middle-class projects in modern Malaysia

    DEFF Research Database (Denmark)

    Fischer, Johan

    2017-01-01

    picture surrounding this class and its relationship to Malaysian national repertoires such as Islamic revivalism, politics, consumer culture, social mobility and the state-market nexus. I understand middle-class projects to be the making of local class culture in Malaysia and explore these in four...... research projects that each in their own way examine how Malay Muslim informants understand and practice “middle-classness” in different spatial and temporal contexts. In short, my findings show how Malay Muslim middle-class projects such as Islamic consumption shape local class culture in Malaysia....

  9. Radiation processing facilities and services in Malaysia

    International Nuclear Information System (INIS)

    Zulkafli Ghazali

    2007-01-01

    It is envisaged that radiation processing will continue to play an important role towards the progress and development of industry in Malaysia. Malaysian Government will continue to play an active role to support R and D in this field by providing the necessary infrastructure, facility, trained manpower and research funds. Additional e-beam accelerator is planned to be installed at Nuclear Malaysia in 2007. The medium energy electron beam accelerator (1 MeV, 50 mA) will be mainly use to evaluate the commercial viability for treating aqueous products such as wastewater. (author)

  10. The economic burden of schizophrenia in Malaysia

    Directory of Open Access Journals (Sweden)

    Teoh SL

    2017-07-01

    Full Text Available Siew Li Teoh,1 Huey Yi Chong,1 Salina Abdul Aziz,2 Norliza Chemi,2 Abdul Razak Othman,2 Nurzuriana Md Zaki,2 Possatorn Vanichkulpitak,3 Nathorn Chaiyakunapruk1,4–6 1School of Pharmacy, Monash University Malaysia, Selangor, 2Department of Psychiatry and Mental Health, Hospital Kuala Lumpur, Kuala Lumpur, Malaysia; 3Faculty of Pharmacy, Silpakorn University, Nakhon Pathom, 4Center of Pharmaceutical Outcomes Research (CPOR, Department of Pharmacy Practice, Faculty of Pharmaceutical Sciences, Naresuan University, Phitsanulok, Thailand; 5School of Pharmacy, University of Wisconsin, Madison, WI, USA; 6Health and Well-being Cluster, Global Asia in the 21st Century (GA21 Platform, Monash University Malaysia, Selangor, MalaysiaIntroduction: Schizophrenia (SCZ is a highly debilitating disease despite its low prevalence. The economic burden associated with SCZ is substantial and mainly attributed to productivity loss. To improve the understanding of economic burden of SCZ in the low- and middle-income country regions, we aimed to determine the economic burden of SCZ in Malaysia.Methods: A retrospective study was conducted using a prevalence-based approach from a societal perspective in Malaysia with a 1 year period from 2013. We used micro-costing technique with bottom-up method and included direct medical cost, direct non-medical cost, and indirect cost. The main data source was medical chart review which was conducted in Hospital Kuala Lumpur (HKL. The medical charts were identified electronically by matching the unique patient’s identification number registered under the National Mental Health Schizophrenia Registry and the list of patients in HKL in 2013. Other data sources were government documents, literatures, and local websites. To ensure robustness of result, probabilistic sensitivity analysis was conducted.Results: The total estimated number of treated SCZ cases in Malaysia in 2015 was 15,104 with the total economic burden of USD 100 million

  11. Potential of food irradiation in Malaysia

    International Nuclear Information System (INIS)

    Rahman, Mohd Ghazali Bin HJ Abdul

    1985-01-01

    Food irradiation has recently been viewed as a technology that can contribute to the solution of problems associated with the preservation of Malaysia's agricultural produce, hence improving the economic status of the rural sector. Economic, political, social and environmental factors need to be taken into consideration in the implementation of a food irradiation program in Malaysia. Coordinated research is being carried out on various food items such as rice and pepper. The government holds a positive view of the technology. However, it is important to consider consumer acceptance of the technology and its legislation before the technology is adopted

  12. Supply of Rubber Wood Log in Malaysia

    OpenAIRE

    Noraida, A. W.; Abdul-Rahim, A. S.

    2014-01-01

    Issue on shortage of raw material for wood processing solved by discovery of rubber wood log as one of the substitutes the natural log. This paper examines the supply of rubber wood log in Malaysia. We employ ARDL Bound Approach Test and time series data from 1980 to 2010 which represented the whole Malaysia are used to achieve the established objectives. The result shown, in the long run harvested area and wages have 1% and 10% significant level respectively. While in the short run, there wa...

  13. Suicide and ethnicity in Malaysia.

    Science.gov (United States)

    Murty, Om Prakash; Cheh, Lo Boon; Bakit, Pangie Anak; Hui, Foo Jhi; Ibrahim, Zarina Binti; Jusoh, Nazirah Binti

    2008-03-01

    This article highlights methods of ending life in different ethnic groups. This inference is drawn from analysis of data from suicidal cases from the University Malaya Medical Centre mortuary. This study also looked at sex, age, social, and employment factors. Kuala Lumpur has sizeable populations of Muslims, Chinese, Indians and Indonesian, etc. This study is based on 251 cases of suicide that were reported at the University Malaya Medical Centre from 2000 to 2004. Malaysia has a population of 22,662,365 people with 3 major ethnic groups: Malay (58%), Chinese (24%), and Indians (8%) with a minority of "others" (10%), which includes foreigners, Sabahan, and Sarawakian. This research found suicides of 164 male (65%) and 87 female (35%) victims. Their age ranged from 15 to 80 years. The age group from 21 to 30 had the highest total cases of suicide (83 of 251; 33.1%). Among ethnic groups highest rate of suicide was among Chinese with a total of 120 cases (120 of 251; 47.8%). As far as lone method of suicide is concerned, hangings accounted for the highest proportion of cases (108 of 251; 43%). Among ethnic groups, jumping from height was the commonest method used by Chinese (49 of 120; 41%), Malay (9 of 16; 56%), and others (15 of 28; 53.4%); whereas, hanging was the commonest method of committing suicide by Indians (49 of 87); Muslims showed the lowest cases of suicide (18 of 251; 7.2%). In poisoning group Indian was the highest ethnic group who used this method (20 of 37; 54.1%).

  14. Infant feeding practices in Malaysia.

    Science.gov (United States)

    Chen, S T

    1978-12-01

    Retrospective nutritional data on 100 children, aged 6 months to 2 1/2 years, who were admitted to the University Hospital in Kuala Lumpur, Malaysia, was obtained by interviewing the mothers of the children. Analysis of the data revealed that 1) only 49% of the children were breast-fed as infants; 2) 50% of the mothers who did breast-feed discontinued breast-feeding before the children were 3 months old; and 3) the weaning diet of at least 1/3 of the children was inadequate. 18% of the children were Malays, 49% were Chinese, and 33% were Indian. The proportion of breast-fed children was highest among the Malays and lowest among the Chinese. Mothers with higher incomes tended to stop breast-feeding earlier than mothers with lower incomes. 67% of the women said they stopped breast-feeding due to inadequate lactation. Most of the children received supplementary foods at relatively early ages. 50% of the infants received starchy foods by the time they were 3 1/2 months old, and 50% received fruit or fruit juice by the time they were 3 1/2 months old. Vegetable products, meat, fish, and eggs were not added to the diet until the children were considerably older. Recommendations, based on the study findings, were 1) hospitals should discontinue the practice of deferring breast-feeding initiation for 24 hours after delivery; 2) mothers should be encouraged to breast-feed fully; and 3) health personnel should discourage the widespread use of costly precooked cereals for supplementary feeding. Tables depicted 1) the frequency distribution of the 100 children by income and by milk feeding patterns according to ethnic affiliation and 2) the cost of serving precooked cereals as compared to the cost of serving home cooked meals.

  15. Islamist Civil Society Activism Malaysia Abdullah: Angkatan Belia Islam Malaysia (ABIM) Darul Arqam

    OpenAIRE

    Hamid, Ahmad Fauzi Abdul

    2009-01-01

    Without discounting the relevance of such a framework, this article seeks to look at the phenomenon of Islamism in Malaysia from the angle of Islamist civil society movements that are not directly involved in the domain of electoral politics, but that have nonetheless significantly in fenced political behavior of especially the majority Malay-Muslim population of Malaysia. The provisional impact of these new groupings form the main thread in our discussion, which narrows down to an inv...

  16. Eastern Frequency Response Study

    Energy Technology Data Exchange (ETDEWEB)

    Miller, N.W.; Shao, M.; Pajic, S.; D' Aquila, R.

    2013-05-01

    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  17. Variation of 231Pa, 230Th and 231Paex/230Thex in surface sediments of the Sabah-Sarawak coastal waters

    International Nuclear Information System (INIS)

    Zal U'yun Wan Mahmood; Zaharudin Ahmad; Abdul Kadir Ishak; Norfaizal Mohamed; Che Abd Rahim Mohamed

    2011-01-01

    Protactinium and thorium activities were measured in eight surface sediment taken in 2004 to determine effectiveness scavenging of 231 Pa at Sabah-Sarawak coastal waters. The result found that activity ratios of 231 Pa ex / 230 Th ex were ranged from 0.07 to 0.13 at all sampling stations. The high 231 Pa ex / 230 Th ex activity ratio than the production ratio of 0.093 in seawater at station SR 01, SR 02, SR 04, SB 02 and SB 05, revealed that 231 Pa is effectively removed from the water column into the sediment in comparison with 230 Th at those stations. Low percentage of 230 Th ex (90-95%) in comparison with 231 Pa ex at all stations can be attributed to less efficiently scavenged of 230 Th onto particles prior deposited at the marine sediment bed. (author)

  18. Strategies of Indian University Students in Malaysia

    DEFF Research Database (Denmark)

    Svensson, Christian Franklin

    2014-01-01

    can challenge existing conceptions of the role of the nation-state, cultural mechanisms and hierarchies. He further contributes to the debate by demonstrating how social imagination evolves from the Indian students’ contested social position as a minority group in Malaysia....

  19. Business Registration Reform Case Studies : Malaysia

    OpenAIRE

    Olaisen, John

    2009-01-01

    This collection of case studies describes experiences and draws lessons from varied business registration reform programs in economies in vastly different stages of development: Bulgaria, Estonia, Ireland, Madagascar, and Malaysia. Over the last twenty years, a number of countries have recognized the importance of smooth and efficient business start up procedures. A functioning business re...

  20. The Law of Student Discipline in Malaysia

    Science.gov (United States)

    Hee, Tie Fatt

    2008-01-01

    Judicial review of decisions on student discipline is limited in Malaysia. This arises because of the general presumption that in the enforcement of school discipline, educators are able to act in the best interest of the student to maintain a safe learning environment. This article examines the range of disciplinary measures in Malaysian schools…