
Sample records for sara markowitz michael


    Institute of Scientific and Technical Information of China (English)

    Yan Jia-an; Zhou Xunyu


    Continuous-time Markowitz's mean-variance efficient strategies are modified by parameterizing a critical quantity. It is shown that these parameterized Markowitz strategies could reach the original mean target with arbitrarily high probabilities. This, in turn, motivates the introduction of certain stopped strategies where stock holdings are liquidated whenever the parameterized Markowitz strategies reach the present value of the mean target. The risk aspect of the revised Markowitz strategies are examined via expected discounted loss from the initial budget. A new portfolio selection model is suggested based on the results of the paper.

  2. Sparse and stable Markowitz portfolios. (United States)

    Brodie, Joshua; Daubechies, Ingrid; De Mol, Christine; Giannone, Domenico; Loris, Ignace


    We consider the problem of portfolio selection within the classical Markowitz mean-variance framework, reformulated as a constrained least-squares regression problem. We propose to add to the objective function a penalty proportional to the sum of the absolute values of the portfolio weights. This penalty regularizes (stabilizes) the optimization problem, encourages sparse portfolios (i.e., portfolios with only few active positions), and allows accounting for transaction costs. Our approach recovers as special cases the no-short-positions portfolios, but does allow for short positions in limited number. We implement this methodology on two benchmark data sets constructed by Fama and French. Using only a modest amount of training data, we construct portfolios whose out-of-sample performance, as measured by Sharpe ratio, is consistently and significantly better than that of the naïve evenly weighted portfolio.

  3. The Markowitz model for portfolio selection

    Directory of Open Access Journals (Sweden)



    Full Text Available Since its first appearance, The Markowitz model for portfolio selection has been a basic theoretical reference, opening several new development options. However, practically it has not been used among portfolio managers and investment analysts in spite of its success in the theoretical field. With our paper we would like to show how The Markowitz model may be of great help in real stock markets. Through an empirical study we want to verify the capability of Markowitz’s model to present portfolios with higher profitability and lower risk than the portfolio represented by IBEX-35 and IGBM indexes. Furthermore, we want to test suggested efficiency of these indexes as representatives of market theoretical-portfolio.

  4. Asset management using an extended Markowitz theorem

    Directory of Open Access Journals (Sweden)

    Paria Karimi


    Full Text Available Markowitz theorem is one of the most popular techniques for asset management. The method has been widely used to solve many applications, successfully. In this paper, we present a multi objective Markowitz model to determine asset allocation by considering cardinality constraints. The resulted model is an NP-Hard problem and the proposed study uses two metaheuristics, namely genetic algorithm (GA and particle swarm optimization (PSO to find efficient solutions. The proposed study has been applied on some data collected from Tehran Stock Exchange over the period 2009-2011. The study considers four objectives including cash return, 12-month return, 36-month return and Lower Partial Moment (LPM. The results indicate that there was no statistical difference between the implementation of PSO and GA methods.

  5. Markowitz portfolio optimization model employing fuzzy measure (United States)

    Ramli, Suhailywati; Jaaman, Saiful Hafizah


    Markowitz in 1952 introduced the mean-variance methodology for the portfolio selection problems. His pioneering research has shaped the portfolio risk-return model and become one of the most important research fields in modern finance. This paper extends the classical Markowitz's mean-variance portfolio selection model applying the fuzzy measure to determine the risk and return. In this paper, we apply the original mean-variance model as a benchmark, fuzzy mean-variance model with fuzzy return and the model with return are modeled by specific types of fuzzy number for comparison. The model with fuzzy approach gives better performance as compared to the mean-variance approach. The numerical examples are included to illustrate these models by employing Malaysian share market data.

  6. Michael Thonet

    Index Scriptorium Estoniae


    Saksa päritolu austria mööblidisaineri ja mööblitöösturi Michael Thonet' (1796-1871) disainiloomingust. 1859. a. Michael Thonet' loodud tool nr. 14 on endiselt tootmises ja on tuntud ka Viini toolina. 2 ill

  7. Michael Thonet

    Index Scriptorium Estoniae


    Saksa päritolu austria mööblidisaineri ja mööblitöösturi Michael Thonet' (1796-1871) disainiloomingust. 1859. a. Michael Thonet' loodud tool nr. 14 on endiselt tootmises ja on tuntud ka Viini toolina. 2 ill

  8. Parametric Portfolio Selection: Evaluating and Comparing to Markowitz Portfolios

    Directory of Open Access Journals (Sweden)

    Marcelo C. Medeiros


    Full Text Available In this paper we exploit the parametric portfolio optimization in the Brazilian market. Our data consists of monthly returns of 306 Brazilian stocks in the period between 2001 and 2013. We tested the model both in and out of sample and compared the results with the value and equal weighted portfolios and with a Markowitz based portfolio. We performed statistical inference in the parametric optimization using bootstrap techniques in order to build the parameters empirical distributions. Our results showed that the parametric optimization is a very efficient technique out of sample. It consistently showed superior results when compared with the VW, EW and Markowitz portfolios even when transaction costs were included. Finally, we consider the parametric approach to be very flexible to the inclusion of constraints in weights, transaction costs and listing and delisting of stocks.


    Directory of Open Access Journals (Sweden)

    Silvia Rostianingsih


    Full Text Available Modern portfolio theory is based on asumption that investor can choose his proportion asset in portfolio, so they can minimize the risk and maximize the return. This paper presents the use of genetic algorithm (GA to optimize the choice of share portfolio in markowitz model by representing the efficient set portfolio. GA represent the efficient set using undirect representation to avoid infeasible solution and penalty function. From the implementation, it can be concluded that GA is one of methods which is able to obtain optimum point from portfolio. Abstract in Bahasa Indonesia : Teori portofolio modern mendasarkan teorinya pada asumsi bahwa investor bertindak secara rasional dengan memilih proporsi asetnya dalam sebuah portofolio sedemikian rupa sehingga dapat meminimalkan resiko dan memaksimalkan return. Dalam paper ini penulis mencoba menyajikan penggunaan algoritma genetika (Genetic Algorithm/GA untuk optimasi pemilihan portofolio saham dalam model markowitz dengan cara merepresentasikannya sebagai kumpulan portofolio yang efisien (the efficient set portofolio. GA merepresentasikan kumpulan yang effisien ini dengan menggunakan representasi tidak langsung untuk menghindari solusi yang tidak feasible dan fungsi penalti. Dari hasil yang telah diimplementasikan dapat disimpulkan bahwa GA dapat digunakan sebagai salah satu metode yang cukup berhasil dalam menemukan titik optimum dari sebuah portofolio. Kata kunci: markowitz, teori portofolio, algoritma genetika.

  10. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  11. Michael Schwantzer

    Institute of Scientific and Technical Information of China (English)



    In the seven years that he has been in China, German-native Michael, Schwantzer has found himself at the sharp end of business,building up a successful enterprise from humble beginnings in a highly competitive market. Michael initially came to China in 1997 to run a Sino-German joint venture supplying the shipbuilding industry in Nanjing. Two years later he joined LAP, starting the company's China operations. Within two years he had helped bring LAP's annual China sales from zero to US$ 5 million, in part through his extensive contacts within the steel industry.Based in Shanghai, where he lives with his wife and two children, Michael has caught the China-bug and has no plans to return to his native Germany. “Why would I?” he says.“Shanghai is the place to be right now.”

  12. Michael Scott

    Directory of Open Access Journals (Sweden)

    Ersin Hussein


    Full Text Available Associate Professor Michael Scott is a researcher and lecturer based in the department of Classics and Ancient History at the University of Warwick. He is also President of the Lytham St Annes Classical Association. Prior to his appointment at Warwick, Michael was the Moses and Mary Finley Research Fellow in ancient history at Darwin College, as well as an Affiliated Lecturer in the Faculty of Classics, at Cambridge University.Michael's research and teaching engages with interdisciplinary approaches to the literary, epigraphic and material evidence to investigate ancient Greek and Roman society, particularly focusing on Delphi and Olympia as religious spaces.While Michael has contributed significantly to the field of classics and ancient history by publishing extensively, he has also enjoyed great success in engaging wider audiences with the ancient world. He regularly talks in schools around the country, writes books intended for the popular market as well as articles for national and international newspapers and magazines. Michael's experience in writing and presenting a range of programmes intended for TV and radio audiences has made him a household name. He has written and presented programmes for the National Geographic, History Channel, Nova, and the BBC including Delphi: bellybutton of the ancient world (BBC4; Guilty Pleasures: luxury in the ancient and medieval words (BBC4; Jesus: rise to power (Natural Geographic; Ancient Discoveries (History Channel; Who were the Greeks? (BBC2; The Mystery of the X Tombs (BBC2/Nova; The Greatest Show on Earth (BBC4, in conjunction with the Open University. He has also presented a radio series for BBC Radio 4, Spin the Globe. Michael's most recent programme, Roman Britain from the Air, was aired on ITV in December 2014.In this interview, I talk to him about his engagement with other disciplines within the humanities, his forthcoming book project, and his experiences writing and presenting TV and radio

  13. Michael Jordan

    Institute of Scientific and Technical Information of China (English)



    Many of us know Michael Jordan is a famous American basketball star. He is perhaps the greatest player in basketball history. Jordan is 1.98m tall. He plays guard(后卫)for the Chicago Bulls. He led his team to six NBA(National Basketball Association ) championships (冠军4).

  14. An application of Markowitz theorem on Tehran Stock Exchange

    Directory of Open Access Journals (Sweden)

    Hassan Ghodrati


    Full Text Available During the past 65 years, there have been tremendous efforts on portfolio selection problem. The standard Markowitz mean–variance model to portfolio selection includes tracing out an efficient frontier, a continuous curve demonstrating the tradeoff between return and risk. This frontier can be often detected via standard quadratic programming, categorized in convex optimization. Traditional Markowitz problem has been recently extended into a new form of mixed integer nonlinear problems by considering various constraints such as cardinality constraints, industry limitation, etc. This paper proposes a mixed integer nonlinear programming to determine optimal asset allocation on Tehran Stock Exchange. The results have indicated that a petrochemical firm named Farabi has gained 44% of the portfolio followed by a drug firm named Kosar Pharmacy gaining 28%. In addition, banking sector was the third winning firm where Eghtesad Novin bank gained nearly 10% of the portfolio. Minerals and mining firms were the next sector in our portfolio where Gol Gohar Iron Ore and Tehran Cement collected 0.73% and 0.57% of the portfolio, respectively. In our survey, auto industry gained only 0.26% of the portfolio, which belonged to Saipa group.

  15. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  16. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  17. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  18. Application of Markowitz Portfolio Theory by Building Optimal Portfolio on the US Stock Market


    Širůček, Martin; Křen, Lukáš


    ŠIRŮČEK MARTIN, KŘEN LUKÁŠ. 2015. Application of Markowitz Portfolio Theory by Building Optimal Portfolio on the US Stock Market. Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis, 63(4): 1375–1386. This paper is focused on building investment portfolios by using the Markowitz Portfolio Theory (MPT). Derivation based on the Capital Asset Pricing Model (CAPM) is used to calculate the weights of individual securities in portfolios. The calculated portfolios include a po...

  19. Analisis Portofolio Saham dengan Metode Capm dan Markowitz

    Directory of Open Access Journals (Sweden)

    Hartiwi Prabowo


    Full Text Available  LQ45 index is a row of 45 stocks with the largest commercial transactions in BEI. These stocks are also commonly referred to as blue-chip stocks. Stocks at LQ 45 index must meet the criteria and pass a predetermined key. The LQ 45 stocks are continuously being monitored and will be a reviewed for every 6 months (early February and August. Capital Asset Pricing Model (CAPM is used to estimate the return of a securities, while minimizing the risk to the desired level of returns in stock investing can be done by way of diversification or invest the funds into more than one type of securities (forming portfolios. The purpose of this study was to determine the expected return, and choosing the best stocks to obtain the optimal portfolio composition and profitable to invest. This study uses secondary data, ie data LQ 45, stock prices, the level of available SBI Stock Exchange, BI, and websites. To analyze the data, the writer used method of CAPM and Markowitz Portfolio. The results showed the election of 5 stocks of the most profitable for investors, namely stock UNTR, SMCB, ASII, INDF and BBRI. For companies that issue stocks should interact more with the society and the capital markets to attract more investors.

  20. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  1. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  2. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  3. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  4. Differentiability properties of the efficient (u,q2)-set in the Markowitz portfolio selection method

    NARCIS (Netherlands)

    Kriens, J.; Strijbosch, L.W.G.; Vörös, J.


    The set of efficient (Rho2)-combinations in the (Rho2)-plane of the Markowitz portfolio selection method consists of a series of strictly convex parabola. In the transition points from one parabola to the next one, the curve may be indifferentiable. The article gives necessary and sufficient conditi

  5. Spectrally-Corrected Estimation for High-Dimensional Markowitz Mean-Variance Optimization

    NARCIS (Netherlands)

    Z. Bai (Zhidong); H. Li (Hua); M.J. McAleer (Michael); W-K. Wong (Wing-Keung)


    textabstractThis paper considers the portfolio problem for high dimensional data when the dimension and size are both large. We analyze the traditional Markowitz mean-variance (MV) portfolio by large dimension matrix theory, and find the spectral distribution of the sample covariance is the main

  6. Spectrally-Corrected Estimation for High-Dimensional Markowitz Mean-Variance Optimization

    NARCIS (Netherlands)

    Z. Bai (Zhidong); H. Li (Hua); M.J. McAleer (Michael); W-K. Wong (Wing-Keung)


    textabstractThis paper considers the portfolio problem for high dimensional data when the dimension and size are both large. We analyze the traditional Markowitz mean-variance (MV) portfolio by large dimension matrix theory, and find the spectral distribution of the sample covariance is the main fac

  7. Differentiability properties of the efficient (u,q2)-set in the Markowitz portfolio selection method

    NARCIS (Netherlands)

    Kriens, J.; Strijbosch, L.W.G.; Vörös, J.


    The set of efficient (Rho2)-combinations in the (Rho2)-plane of the Markowitz portfolio selection method consists of a series of strictly convex parabola. In the transition points from one parabola to the next one, the curve may be indifferentiable. The article gives necessary and sufficient

  8. An inequality for detecting financial fraud, derived from the Markowitz Optimal Portfolio Theory (United States)

    Bard, Gregory V.


    The Markowitz Optimal Portfolio Theory, published in 1952, is well-known, and was often taught because it blends Lagrange Multipliers, matrices, statistics, and mathematical finance. However, the theory faded from prominence in American investing, as Business departments at US universities shifted from techniques based on mathematics, finance, and statistics, to focus instead on leadership, public speaking, interpersonal skills, advertising, etc… The author proposes a new application of Markowitz's Theory: the detection of a fairly broad category of financial fraud (called "Ponzi schemes" in American newspapers) by looking at a particular inequality derived from the Markowitz Optimal Portfolio Theory, relating volatility and expected rate of return. For example, one recent Ponzi scheme was that of Bernard Madoff, uncovered in December 2008, which comprised fraud totaling 64,800,000,000 US dollars [23]. The objective is to compare investments with the "efficient frontier" as predicted by Markowitz's theory. Violations of the inequality should be impossible in theory; therefore, in practice, violations might indicate fraud.

  9. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  10. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  11. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  12. Portafolio management: A critical view beyond Markowitz Gestión de portafolios. Una mirada crítica más allá de Markowitz

    Directory of Open Access Journals (Sweden)

    Duván Darío Grajales Bedoya


    Full Text Available Since its first appearance, the Markowitz model for portfolio selection has been a basic theoretical reference, opening several new development options. However, practically it has not been used among portfolio managers and investment analysts in spite of its success in the theoretical field. This paper presents and discusses the Markowitz’s model limitations modal to its practical implementation, the existence of transaction costs, equilibrium considerations, technical and fundamental analysis importance and the focus on behavioural finance as that of limited rationality, determine that the decision process of the individuals possesses limitations so much cognitive as computing that reduce perfection to their decisions, nevertheless, these theories of behavioural portfolios is possible to consider to be more a descriptive theory of how the investors construct their portfolios, in contrast with the theory of Markowitz's portfolios that is more prescriptive on having tried to instruct the investors how they must their portfolios.Desde su aparición, el modelo de Markowitz ha sido un referente teórico fundamental para la selección de carteras de valores y ha dado lugar a múltiples desarrollos y derivaciones. Su utilización en la práctica, entre gestores de carteras y analistas de inversiones, no es tan amplia como podría esperarse de su éxito teórico. Aquí se presentan y discuten sus limitaciones en cuanto a implementación práctica, presencia de costos de transacción, consideraciones de rebalanceo, importancia de los análisis fundamental y técnico, y el enfoque de finanzas del comportamiento que, como el de racionalidad limitada, determinan que el proceso de decisión de los individuos posee especificaciones cognitivas y computacionales que le restan perfección a las decisiones. Tales teorías de comportamiento se pueden considerar descriptivas de cómo los inversionistas construyen sus portafolios, en contraste con la de

  13. The efficiency criterion of Markowitz portfolio theory application in the short-term trading at the Ukrainian Stock Exchange example

    Directory of Open Access Journals (Sweden)

    Evdokimenko Yuri


    Full Text Available The article presents a comparative analysis of the profitability and risk of the two stock portfolios: a portfolio with equal shares of assets and portfolio of assets with shares determined on the basis of Markowitz portfolio theory. The purpose of the research is to identify the effectiveness of the Markowitz portfolio theory for prediction in terms of trade on the Ukrainian Stock Exchange. According to the study results, the efficiency criteria were developed and evaluated. It is proved that the portfolio based on the Markowitz problem solutions presents smaller risk at equal profitability, and in some cases, greater profitability, which makes it more efficient in the process of diversification of the risk portfolio.

  14. Following Michael Faraday's Footprints (United States)

    Galeano, Javier


    Last fall I had the good fortune of receiving financial support to shoot a documentary about Michael Faraday. I took the opportunity to learn more about this great experimentalist and to visit the highlights of places in his life. In this paper, I would like to share a list and description of some of the most remarkable places in London suitable…

  15. Michael Faraday's Bicentenary. (United States)

    Williams, L. Pearce; And Others


    Six articles discuss the work of Michael Faraday, a chemist whose work revolutionized physics and led directly to both classical field and relativity theory. The scientist as a young man, the electromagnetic experiments of Faraday, his search for the gravelectric effect, his work on optical glass, his laboratory notebooks, and his creative use of…

  16. SARA: a server for function annotation of RNA structures. (United States)

    Capriotti, Emidio; Marti-Renom, Marc A


    Recent interest in non-coding RNA transcripts has resulted in a rapid increase of deposited RNA structures in the Protein Data Bank. However, a characterization and functional classification of the RNA structure and function space have only been partially addressed. Here, we introduce the SARA program for pair-wise alignment of RNA structures as a web server for structure-based RNA function assignment. The SARA server relies on the SARA program, which aligns two RNA structures based on a unit-vector root-mean-square approach. The likely accuracy of the SARA alignments is assessed by three different P-values estimating the statistical significance of the sequence, secondary structure and tertiary structure identity scores, respectively. Our benchmarks, which relied on a set of 419 RNA structures with known SCOR structural class, indicate that at a negative logarithm of mean P-value higher or equal than 2.5, SARA can assign the correct or a similar SCOR class to 81.4% and 95.3% of the benchmark set, respectively. The SARA server is freely accessible via the World Wide Web at

  17. Application of Markowitz Portfolio Theory by Building Optimal Portfolio on the US Stock Market

    Directory of Open Access Journals (Sweden)

    Martin Širůček


    Full Text Available This paper is focused on building investment portfolios by using the Markowitz Portfolio Theory (MPT. Derivation based on the Capital Asset Pricing Model (CAPM is used to calculate the weights of individual securities in portfolios. The calculated portfolios include a portfolio copying the benchmark made using the CAPM model, portfolio with low and high beta coefficients, and a random portfolio. Only stocks were selected for the examined sample from all the asset classes. Stocks in each portfolio are put together according to predefined criteria. All stocks were selected from Dow Jones Industrial Average (DJIA index which serves as a benchmark, too. Portfolios were compared based on their risk and return profiles. The results of this work will provide general recommendations on the optimal approach to choose securities for an investor’s portfolio.

  18. Sara endosomes and the asymmetric division of intestinal stem cells. (United States)

    Montagne, Chrystelle; Gonzalez-Gaitan, Marcos


    Tissue homeostasis is maintained by adult stem cells, which self-renew and give rise to differentiating cells. The generation of daughter cells with different fates is mediated by signalling molecules coming from an external niche or being asymmetrically dispatched between the two daughters upon stem cell mitosis. In the adult Drosophila midgut, the intestinal stem cell (ISC) divides to generate a new ISC and an enteroblast (EB) differentiating daughter. Notch signalling activity restricted to the EB regulates intestinal cell fate decision. Here, we show that ISCs divide asymmetrically, and Sara endosomes in ISCs are specifically dispatched to the presumptive EB. During ISC mitosis, Notch and Delta traffic through Sara endosomes, thereby contributing to Notch signalling bias, as revealed in Sara mutants: Sara itself contributes to the control of the ISC asymmetric division. Our data uncover an intrinsic endosomal mechanism during ISC mitosis, which participates in the maintenance of the adult intestinal lineage.

  19. Sensor Activation and Radius Adaptation (SARA) in Heterogeneous Sensor Networks

    CERN Document Server

    Bartolini, Novella; la Porta, Thomas; Petrioli, Chiara; Silvestri, Simone


    In this paper we address the problem of prolonging the lifetime of wireless sensor networks (WSNs) deployed to monitor an area of interest. In this scenario, a helpful approach is to reduce coverage redundancy and therefore the energy expenditure due to coverage. We introduce the first algorithm which reduces coverage redundancy by means of Sensor Activation and sensing Radius Adaptation (SARA)in a general applicative scenario with two classes of devices: sensors that can adapt their sensing range (adjustable sensors) and sensors that cannot (fixed sensors). In particular, SARA activates only a subset of all the available sensors and reduces the sensing range of the adjustable sensors that have been activated. In doing so, SARA also takes possible heterogeneous coverage capabilities of sensors belonging to the same class into account. It specifically addresses device heterogeneity by modeling the coverage problem in the Laguerre geometry through Voronoi-Laguerre diagrams. SARA executes quickly and is guarante...

  20. Gene : CBRC-SARA-01-1782 [SEVENS

    Lifescience Database Archive (English)


  1. Gene : CBRC-SARA-01-1760 [SEVENS

    Lifescience Database Archive (English)


  2. Michael Faraday, media man. (United States)

    Fara, Patricia


    Michael Faraday was an enthusiastic portrait collector, and he welcomed the invention of photography not only as a possible means of recording observations accurately, but also as a method for advertising science and its practitioners. This article (which is part of the Science in the Industrial Revolution series) shows that like many eminent scientists, Faraday took advantage of the burgeoning Victorian media industry by posing in various roles.

  3. UCLA SARA (System Architect's Apprentice) demonstration

    Energy Technology Data Exchange (ETDEWEB)

    Fenchel, R.S.; Razouk, R.R.


    A sample session with the SARA system is given. The system is a set of design and modeling tools which are implemented on the MIT-Multics computer system. This demonstration is intended to acquaint all interested persons with the state of implementation of the SARA system and the flavor of its use. The system is currently under implementation; however, all the demonstrated tools are available to any user with access to the MIT-Multics system. Additional tools will soon be available.

  4. Michael Learns to Rock

    Institute of Scientific and Technical Information of China (English)



    夜幕降临.空气中传来北欧的声音,来自丹麦的四人流行乐队Michael Learns to Rock(迈克学摇滚)正把探情款款的歌声带到上海的咖啡厅和酒吧。北欧一直活跃着一批世界顶级的乐队.从丹麦的A-Ha到Aqua,从瑞典的ABBA到Roxette和Ace of Base,从挪威的Se

  5. Michael Frayn visits CERN

    CERN Document Server


    Award-winning playwright and novelist Michael Frayn gave a guest lecture in the main auditorium at CERN on Friday 15 March about his new book The Human Touch: Our Part in the Creation of the Universe. The lecture focused on cosmology and philosophy and the limitations that language places on our ability to understand the creation of a universe in which we seem to play such a small part. In addition to his novels and plays, which include Copenhagen, a play about the 1941 meeting between German physicist Werner Heisenberg and Danish physicist Niels Bohr, Frayn has translated several works from Russian, including plays by Chekhov and Tolstoy.

  6. Analysis Of Dynamic Portfolio Allocation Of Indonesian LQ45 During 2005 – 2011 Following The Markowitz Theowry

    Directory of Open Access Journals (Sweden)

    Agustini Hamid


    Full Text Available The research observed that equity portfolio and investment managers were facing challenges in determining the optimum portfolio, especially during the turbulent times. As a result, they needed to implement portfolio management strategies to overcome the risk associated with stock return volatility in turbulence periods. This research focused on selecting stocks from the LQ-45 index during 2005-2011 using The Markowitz theory combining the Solver Linear Programming. The portfolio selection method which has been introduced by Markowitz (1952 used variance or standard deviation as a risk measurement. The result of this research proves that the composition of the portfolio is not the same in the different period. In the bearish period, the composition of the optimum portfolio is dominated by the banking sector and manufacture sector. In the bullish period, the optimum portfolio is dominated by the commodity stocks.

  7. Optimal algorithms and intuitive explanations for Markowitz's portfolio selection model and Sharpe's ratio with no short-selling

    Institute of Scientific and Technical Information of China (English)

    SHI NingZhong; LAI Min; ZHENG ShuRong; ZHANG BaoXue


    Most of the previous researches about portfolio analysis focus on short-selling.In fact,no short-selling is also important because short-selling is not allowed in stock markets of some coun-tries.This paper gives the sufficient and necessary conditions and proposes an optimal algorithm for Markowitz's mean-variance models and Sharpe's ratio with no short-selling.The optimal algorithm makes it easier to obtain the efficient frontiers with no short-selling.



    Prof. Carmen Corduneanu Ph. D; Assist. Laura Raisa Miloș Ph. D


    In this paper, the authors test a model of an efficient portfolio with minimum risk, starting from the analysis of one year portfolio payoff and risk of ten securities from Bucharest Stock Exchange. In accordance with the modern portfolio theory, maximization of returns at minimal risk should be the main objective of every investor. We show, using a mathematical methodology based on Markowitz portfolio theory and on Lagrange function, which is the exact amount of stocks to be purchased from a...


    Directory of Open Access Journals (Sweden)

    Ana Lúcia Miranda Lopes


    Full Text Available A seleção de ativos para a construção de carteiras de investimento no mercado de ações é de extrema importância para investidores, pois pode definir seu lucro ou prejuízo. Neste trabalho é investigado se a aplicação do modelo de otimização de Markowitz sobre carteiras selecionadas por meio de Data Envelopment Analysis - DEA gera retornos maiores que carteiras de ativos obtidas somente com DEA. Para atender esse objetivo foram projetadas carteiras mensais para 36 meses, iniciando em Janeiro de 2006 e finalizando em Dezembro de 2008, utilizando indicadores fundamentalistas como inputs e outputs do modelo DEA. O modelo DEA utilizado foi o Assurance Region, que depois foram otimizados gerando outra carteira DEA. Ao comparar as carteiras DEA com o IBOVESPA chegou-se a conclusão que as carteiras otimizadas alcançam melhor desempenho que as carteiras DEA originais e IBOVESPA.

  10. VAR Portfolio Optimal: Perbandingan Antara Metode Markowitz dan Mean Absolute Deviation

    Directory of Open Access Journals (Sweden)

    R. Agus Sartono


    Full Text Available Portfolio selection method which have been introduced by Harry Markowitz (1952 used variance or deviation standard as a measure of risk. Kanno and Yamazaki (1991 introduced another method and used mean absolute deviation as a measure of risk instead of variance. The Value-at Risk (VaR is a relatively new method to capitalized risk that been used by financial institutions. The aim of this research is compare between mean variance and mean absolute deviation of two portfolios. Next, we attempt to assess the VaR of two portfolios using delta normal method and historical simulation. We use the secondary data from the Jakarta Stock Exchange – LQ45 during 2003. We find that there is a weak-positive correlation between deviation standard and return in both portfolios. The VaR nolmal delta based on mean absolute deviation method eventually is higher than the VaR normal delta based on mean variance method. However, based on the historical simulation the VaR of two methods is statistically insignificant. Thus, the deviation standard is sufficient measures of portfolio risk.Keywords: optimalisasi portofolio, mean-variance, mean-absolute deviation, value-at-risk, metode delta normal, metode simulasi historis

  11. Professor Michael Levitt

    Directory of Open Access Journals (Sweden)

    Gemma-Louise Davies


    Full Text Available Professor Michael Levitt (Stanford University, USA won the 2013 Nobel Prize in Chemistry for the development of multiscale models for complex chemical systems—computational tools which can calculate the course of chemical reactions. Professor Levitt was born in Pretoria, South Africa; he came to the UK on a summer vacation aged 16, where he decided to stay and study for his A‑levels. His interest in the physics of living systems drove him to study biophysics at King’s College London, before securing a PhD position at the Laboratory of Molecular Biology in Cambridge. In the interim year between his degree and beginning his PhD, Professor Levitt worked at the Weizmann Institute of Science in Israel, where he met his future wife. They married later that year and moved to Cambridge, where their three children were born. After completing his PhD, he spent time working in Israel, Cambridge, the Salk Institute and Stanford (both California. Since 1986, he has split his time between Israel and California. Outside of science, he is a keen hiker and he is well-known to have attended the eclectic ‘Burning Man’ Festival in California.[1]Professor Levitt visited the University of Warwick to speak at the Computational Molecular Science Annual Conference in March 2015. In this interview, Dr Gemma-Louise Davies, an Institute of Advanced Study Global Research Fellow, spoke to Professor Levitt about the importance of Interdisciplinarity in his field, role models in Academia, and his plans for the future.Image: Professor Michael Levitt (left with Dr Scott Habershon (right, organiser of the 2015 Computational Molecular Science Annual Conference during his visit to the University of Warwick in March 2015.[1] ‘Burning Man’ is a unique annual festival dedicated to community, art, music, self-expression and self-reliance. Tens of thousands of people flock to this temporary metropolis built in the Californian desert.

  12. The relationship between SARA fractions and crude oil stability

    Directory of Open Access Journals (Sweden)

    Siavash Ashoori


    Full Text Available Asphaltene precipitation and deposition are drastic issues in the petroleum industry. Monitoring the asphaltene stability in crude oil is still a serious problem and has been subject of many studies. To investigate crude oil stability by saturate, aromatic, resin and asphaltene (SARA analysis seven types of crudes with different components were used. The applied methods for SARA quantification are IP-143 and ASTM D893-69 and the colloidal instability index (CII is computed from the SARA values as well. In comparison between CII results, the values of oil compositions demonstrated that the stability of asphaltenes in crude oils is a phenomenon that is related to all these components and it cannot be associated only with one of them, individually.

  13. Enantioselective Michael Addition of Water

    NARCIS (Netherlands)

    Chen, B.S.; Resch, V.; Otten, L.G.; Hanefeld, U.


    The enantioselective Michael addition using water as both nucleophile and solvent has to date proved beyond the ability of synthetic chemists. Herein, the direct, enantioselective Michael addition of water in water to prepare important β-hydroxy carbonyl compounds using whole cells of Rhodococcus st

  14. Interview with Michael Gazzaniga. (United States)

    Gazzaniga, Michael


    Widely considered the father of the field of cognitive neuroscience, Professor Michael S. Gazzaniga is one of the world's premier neuroscientists. He founded the Center for Neuroscience at the University of California, Davis; the Center for Cognitive Neuroscience at Dartmouth College; the Cognitive Neuroscience Institute; Journal of Cognitive Neuroscience; and the Cognitive Neuroscience Society. He is currently the director of the Sage Center for the Study of the Mind at the University of California, Santa Barbara. Born on December 12, 1939 in Los Angeles and educated at Dartmouth College, he received his Ph.D. in psychobiology at the California Institute of Technology under the tutelage of Roger Sperry. As a graduate student, Professor Gazzaniga initiated the first lateralized testing of human split-brain patients, leading to a fundamental shift in our understanding of functional lateralization in the brain and how the cerebral hemispheres communicate with one another. His many scholarly publications and pioneering work during the last 50 years have produced significant contributions to our understanding of how the brain enables the mind. His landmark 1995 book for MIT Press, The Cognitive Neurosciences, now in its fourth edition, is recognized as the sourcebook for the field. He has also published many books accessible to a lay audience, including Mind Matters, Nature's Mind, and The Ethical Brain.

  15. Optimization model using Markowitz model approach for reducing the number of dengue cases in Bandung (United States)

    Yong, Benny; Chin, Liem


    Dengue fever is one of the most serious diseases and this disease can cause death. Currently, Indonesia is a country with the highest cases of dengue disease in Southeast Asia. Bandung is one of the cities in Indonesia that is vulnerable to dengue disease. The sub-districts in Bandung had different levels of relative risk of dengue disease. Dengue disease is transmitted to people by the bite of an Aedesaegypti mosquito that is infected with a dengue virus. Prevention of dengue disease is by controlling the vector mosquito. It can be done by various methods, one of the methods is fogging. The efforts made by the Health Department of Bandung through fogging had constraints in terms of limited funds. This problem causes Health Department selective in fogging, which is only done for certain locations. As a result, many sub-districts are not handled properly by the Health Department because of the unequal distribution of activities to prevent the spread of dengue disease. Thus, it needs the proper allocation of funds to each sub-district in Bandung for preventing dengue transmission optimally. In this research, the optimization model using Markowitz model approach will be applied to determine the allocation of funds should be given to each sub-district in Bandung. Some constraints will be added to this model and the numerical solution will be solved with generalized reduced gradient method using Solver software. The expected result of this research is the proportion of funds given to each sub-district in Bandung correspond to the level of risk of dengue disease in each sub-district in Bandung so that the number of dengue cases in this city can be reduced significantly.

  16. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  17. Gene : CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)


  18. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  19. Apocalipsis XX di Sara de Ibáñez

    Directory of Open Access Journals (Sweden)

    Stefano Tedeschi


    Full Text Available Rewriting the text of Saint John, Sara de Ibáñez uses a kind of style innovative and away from schools and trends in vogue: is thus able able to evoke the tragic experiences of the twentieth century, but the date of publication of the book (1970 reveals that it advances in themes and forms the concrete apocalypse lived by Uruguay and Latin America in the seventies. However, far from political themes and motifs, Sara de Ibáñez is able to express the absolute horror of contemporary tragedies and to propose a poetic reflection of great quality. This article suggests a rediscovery of this twentieth-century poetic voice, unjustly forgotten, through her 'apocalyptic' text.

  20. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich

    Directory of Open Access Journals (Sweden)

    Paula Daniela Bianchi


    Full Text Available The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  1. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich


    Paula Daniela Bianchi


    The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez) by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  2. Subacute ruminal acidosis (SARA) challenge, ruminal condition and cellular immunity in cattle. (United States)

    Sato, Shigeru


    Subacute ruminal acidosis (SARA) is characterized by repeated bouts of low ruminal pH. Cows with SARA often develop complications or other diseases, and associate physiologically with immunosuppression and inflammation. Ruminal free lipopolysaccharide (LPS) increases during SARA and translocates into the blood circulation activating an inflammatory response. Ruminal fermentation and cellular immunity are encouraged by supplementing hay with calf starter during weaning. SARA calves given a 5-day repeated administration of a bacteria-based probiotic had stable ruminal pH levels (6.6-6.8). The repeated administration of probiotics enhance cellular immune function and encourage recovery from diarrhea in pre-weaning calves. Furthermore, the ruminal fermentation could guard against acute and short-term feeding changes, and changes in the rumen microbial composition of SARA cattle might occur following changes in ruminal pH. The repeated bouts of low ruminal pH in SARA cattle might be associated with depression of cellular immunity.

  3. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers...... for the diagnosis of SARA are needed. The goal of this study was to evaluate clinical signs of SARA and to investigate the use of blood, faecal and urinary parameters as indicators of SARA. Six lactating, rumen cannulated, Danish Holstein cows were used in a cross-over study with three periods. The first and second...... periods included two cows on control diet and two cows on nutritional SARA challenge. The third period only included two cows on SARA challenge. Control diet was a conventional total mixed ration [45.5% dry matter (DM), 17.8% crude protein, 43.8% neutral detergent fibre, and 22.5% acid detergent fibre (DM...

  4. Teologi Politik Berbalu SARA Antara Ambisi dan Konspirasi

    Directory of Open Access Journals (Sweden)

    M. Sidi Ritau'din


    Full Text Available In a multi-cultural democracy based on Pancasila philosophy of independence, ethnic, religious, racial and intergroup issues it call (SARA are political indicators that can trigger conflict and division. If the player is ambitious and power-hungry, then he will not hesitate to do everything he can to gain power, even build a big conspiracy using SARA as a tool to divide the ummah, then he emerges as a unifier and presents programs prestigious sympathetic, there Imaging actions and slogans of the pro poor people, but essentially no more as political deceit, a false gift of hope, it familiar said (PHP that never realized, only reap the political advantage in the game of SARA, even not hesitate to shout thief when he Itself is a thieving thief based on greed and greed where the horizontal relations of fellow human beings deny the bond of faith as the foundation. Political conspiracy based on political interests and abuse of power, an action of political pathology that is not civilized that has become a trend of contemporary politics and globalization.

  5. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. (United States)

    Trotonda, María Pilar; Manna, Adhar C; Cheung, Ambrose L; Lasa, Iñigo; Penadés, José R


    The biofilm-associated protein Bap is a staphylococcal surface protein involved in biofilm formation. We investigated the influence of the global regulatory locus sarA on bap expression and Bap-dependent biofilm formation in three unrelated Staphylococcus aureus strains. The results showed that Bap-dependent biofilm formation was diminished in the sarA mutants by an agr-independent mechanism. Complementation studies using a sarA clone confirmed that the defect in biofilm formation was due to the sarA mutation. As expected, the diminished capacity to form biofilms in the sarA mutants correlated with the decreased presence of Bap in the bacterial surface. Using transcriptional fusion and Northern analysis data, we demonstrated that the sarA gene product acts as an activator of bap expression. Finally, the bap promoter was characterized and the transcriptional start point was mapped by the rapid amplification of cDNA ends technique. As expected, we showed that purified SarA protein binds specifically to the bap promoter, as determined by gel shift and DNase I footprinting assays. Based on the previous studies of others as well as our work demonstrating the role for SarA in icaADBC and bap expression, we propose that SarA is an essential regulator controlling biofilm formation in S. aureus.

  6. Q&A: Michael Honey (United States)

    Helicher, Karl


    The mid-1960s saw civil rights victories in Congress during Lyndon B. Johnson's presidency. In "Going Down Jericho Road," Michael Honey wrote how Martin Luther King Jr.'s final focus showed that the struggle for black and working class parity continued. The 1968 Memphis sanitation workers strike was a gritty struggle won in the streets by a host…

  7. Michael Beitz: Objects of Communication (United States)

    Hoefferle, Mary


    For this Instructional Resource, the author interviewed contemporary sculptor Michael Beitz, who uses art to explore the role of designed objects in human communication and emotional experience. This column was written in response to calls for using Enduring Understandings/Big Ideas (National Coalition for Core Arts Standards, 2013; Stewart &…

  8. Michael J. Fox: Spurring Research on Parkinson's (United States)

    ... please turn JavaScript on. Feature: Parkinson's Disease Michael J. Fox: Spurring Research on Parkinson's Past Issues / Winter 2014 Table of Contents Michael J. Fox and his wife, actress Tracy Pollan, founded ...

  9. Michael Faraday vs. the Spiritualists (United States)

    Hirshfeld, Alan


    In the 1850s, renowned physicist Michael Faraday launched a public campaign against pseudoscience and spiritualism, which were rampant in England at the time. Faraday objected especially to claims that electrical or magnetic forces were responsible for paranormal phenomena, such as table-spinning and communication with the dead. Using scientific methods, Faraday unmasked the deceptions of spiritualists, clairvoyants and mediums and also laid bare the credulity of a public ill-educated in science. Despite his efforts, Victorian society's fascination with the paranormal swelled. Faraday's debacle anticipates current controversies about public science education and the interface between science and religion. This episode is one of many described in the new biography, The Electric Life of Michael Faraday (Walker & Co.), which chronicles Faraday's discoveries and his unlikely rise from poverty to the pinnacle of the English science establishment.

  10. Gene : CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ctin receptor 1 isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin... receptor 1 isoform 4 [Macaca mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin re...ceptor 1 isoform 5 [Macaca mulatta] ref|XP_001105878.1| PREDICTED: similar to adiponectin... receptor 1 isoform 6 [Macaca mulatta] ref|XP_001105957.1| PREDICTED: similar to adiponectin recepto...CBRC-SARA-01-1167 Novel UN B UNKNOWN ADR1_HUMAN 1e-139 67% ref|XP_001105680.1| PREDICTED: similar to adipone

  11. Factors contributing to the biofilm-deficient phenotype of Staphylococcus aureus sarA mutants.

    Directory of Open Access Journals (Sweden)

    Laura H Tsang

    Full Text Available Mutation of sarA in Staphylococcus aureus results in a reduced capacity to form a biofilm, but the mechanistic basis for this remains unknown. Previous transcriptional profiling experiments identified a number of genes that are differentially expressed both in a biofilm and in a sarA mutant. This included genes involved in acid tolerance and the production of nucleolytic and proteolytic exoenzymes. Based on this we generated mutations in alsSD, nuc and sspA in the S. aureus clinical isolate UAMS-1 and its isogenic sarA mutant and assessed the impact on biofilm formation. Because expression of alsSD was increased in a biofilm but decreased in a sarA mutant, we also generated a plasmid construct that allowed expression of alsSD in a sarA mutant. Mutation of alsSD limited biofilm formation, but not to the degree observed with the corresponding sarA mutant, and restoration of alsSD expression did not restore the ability to form a biofilm. In contrast, concomitant mutation of sarA and nuc significantly enhanced biofilm formation by comparison to the sarA mutant. Although mutation of sspA had no significant impact on the ability of a sarA mutant to form a biofilm, a combination of protease inhibitors (E-64, 1-10-phenanthroline, and dichloroisocoumarin that was shown to inhibit the production of multiple extracellular proteases without inhibiting growth was also shown to enhance the ability of a sarA mutant to form a biofilm. This effect was evident only when all three inhibitors were used concurrently. This suggests that the reduced capacity of a sarA mutant to form a biofilm involves extracellular proteases of all three classes (serine, cysteine and metalloproteases. Inclusion of protease inhibitors also enhanced biofilm formation in a sarA/nuc mutant, with the combined effect of mutating nuc and adding protease inhibitors resulting in a level of biofilm formation with the sarA mutant that approached that of the UAMS-1 parent strain. These results

  12. Michael Niegl (1985-2009)

    CERN Multimedia


    Our friend and colleague Michael Niegl died in a tragic accident in the first hours of the new year. Michael was a Master’s student in Microsystems Engineering at the University of Applied Sciences Wiener Neustadt. He was responsible for the development of the ATLAS Beam Conditions Monitor (BCM) ROD FPGA firmware, which acquires the data from the BCM detector modules and provides online monitoring of the LHC beams within the ATLAS experiment. He spent several months at CERN to carry out beam tests on the BCM detectors and received his Bachelor of Science with first class honours for his thesis: Concept and Implementation of an FPGA-based Data Recorder and Processor for the ATLAS Beam Conditions Monitor. Michael spent six months at CERN last year to finish the development and commissioning of the ROD firmware for the first beam. He worked the entire night of 10 September to fine tune the system for the first beam. It was a joy to ...

  13. Michael De Sousa (1989 - 2012)

    CERN Multimedia


    We are deeply saddened to announce the death of Mr Michael De Sousa on 13 May 2012. Mr De Sousa, who was born on 02.09.1989, was working as an apprentice in the TE Department and had been at CERN since 24.08.2009. The Director-General has sent a message of condolence to his family on behalf of the CERN personnel. Social Affairs Human Resources Department     It is with great emotion and deep sadness that we learn of the tragic loss of our colleague and friend Michael De Sousa. Michael was a hard working colleague, cordial and considerate. Within a few months, he marked his presence by the implementation of the instrumentation benches for gas permeation measurement in polymers, and the calibration of high technology gas analyzers, necessary for vacuum technology. His last contribution will enable us to measure pressures in the extreme high vacuum range for the ELENA project.  With the continuation of this activity, his memory will remain. His accomplishments will remain...

  14. Organocatalytic aza-Michael/retro-aza-Michael reaction: pronounced chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction. (United States)

    Cai, Yong-Feng; Li, Li; Luo, Meng-Xian; Yang, Ke-Fang; Lai, Guo-Qiao; Jiang, Jian-Xiong; Xu, Li-Wen


    A detailed experimental investigation of an aza-Michael reaction of aniline and chalcone is presented. A series of Cinchona alkaloid-derived organocatalysts with different functional groups were prepared and used in the aza-Michael and retro-aza-Michael reaction. There was an interesting finding that a complete reversal of stereoselectivity when a benzoyl group was introduced to the cinchonine and cinchonidine. The chirality amplification vs. time proceeds in the quinine-derived organocatalyst containing silicon-based bulky group, QN-TBS, -catalyzed aza-Michael reaction under solvent-free conditions. In addition, we have demonstrated for the first time that racemization was occurred in suitable solvents under mild conditions due to retro-aza-Michael reaction of the Michael adduct of aniline with chalcone. These indicate the equilibrium of retro-aza-Michael reaction and aza-Michael reaction produce the happening of chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction under different conditions, which would be beneficial to the development of novel chiral catalysts for the aza-Michael reactions.

  15. Low energy neutral atom imaging on the Moon with the SARA instrument aboard Chandrayaan-1 mission

    Indian Academy of Sciences (India)

    Anil Bhardwaj; Stas Barabash; Yoshifumi Futaana; Yoichi Kazama; Kazushi Asamura; David McCann; R Sridharan; Mats Holmstrom; Peter Wurz; Rickard Lundin


    This paper reports on the Sub-keV Atom Reflecting Analyzer (SARA)experiment that will be flown on the first Indian lunar mission Chandrayaan-1.The SARA is a low energy neutral atom (LENA)imaging mass spectrometer,which will perform remote sensing of the lunar surface via detection of neutral atoms in the energy range from 10 eV to 3 keV from a 100 km polar orbit.In this report we present the basic design of the SARA experiment and discuss various scientific issues that will be addressed.The SARA instrument consists of three major subsystems:a LENA sensor (CENA),a solar wind monitor (SWIM),and a digital processing unit (DPU).SARA will be used to image the solar wind –surface interaction to study primarily the surface composition and surface magnetic anomalies and associated mini-magnetospheres.Studies of lunar exosphere sources and space weathering on the Moon will also be attempted.SARA is the first LENA imaging mass spectrometer of its kind to be flown on a space mission.A replica of SARA is planned to fly to Mercury onboard the BepiColombo mission.

  16. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation.

    Directory of Open Access Journals (Sweden)

    Jessica N Snowden

    Full Text Available Infection is a frequent and serious complication following the treatment of hydrocephalus with CSF shunts, with limited therapeutic options because of biofilm formation along the catheter surface. Here we evaluated the possibility that the sarA regulatory locus engenders S. aureus more resistant to immune recognition in the central nervous system (CNS based on its reported ability to regulate biofilm formation. We utilized our established model of CNS catheter-associated infection, similar to CSF shunt infections seen in humans, to compare the kinetics of bacterial titers, cytokine production and inflammatory cell influx elicited by wild type S. aureus versus an isogenic sarA mutant. The sarA mutant was more rapidly cleared from infected catheters compared to its isogenic wild type strain. Consistent with this finding, several pro-inflammatory cytokines and chemokines, including IL-17, CXCL1, and IL-1β were significantly increased in the brain following infection with the sarA mutant versus wild type S. aureus, in agreement with the fact that the sarA mutant displayed impaired biofilm growth and favored a planktonic state. Neutrophil influx into the infected hemisphere was also increased in the animals infected with the sarA mutant compared to wild type bacteria. These changes were not attributable to extracellular protease activity, which is increased in the context of SarA mutation, since similar responses were observed between sarA and a sarA/protease mutant. Overall, these results demonstrate that sarA plays an important role in attenuating the inflammatory response during staphylococcal biofilm infection in the CNS via a mechanism that remains to be determined.

  17. Video interview with Michael Dell

    CERN Multimedia

    CERN Bulletin


    Michael Dell, founder and presently Chairman of the Board of Directors and Chief Executive Office of the DELL computer company visited CERN on Tuesday 26th January 2010. The Bulletin and the Video productions team had the opportunity to meet him. The video interview is transcribed for your convenience.   Michael S. Dell with CERN Director-General Rolf Heuer. What motivated you to come and visit CERN? I obviously heard about the great science and research has going on here, and DELL is very pleased to be a partner and providing a lot of the computers to analyse the data and I really wanted to see for myself in person, some of the great science that is going on here. What is your view on fundamental research in IT, and in general? I think if you look at the field of science in the last hundred years, we have been able to solve a lot of problems, but there are still lots of unsolved problems and unsolved mysteries. And it is only through basic fundamental research that we will address these probl...

  18. System Analysis and Risk Assessment system (SARA) Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Sattison, M B; Russell, K D; Skinner, N L [EG and G Idaho, Inc., Idaho Falls, ID (United States)


    This NUREG is the tutorial for the System Analysis and Risk Assessment System (SARA) Version 4.0, a microcomputer-based system used to analyze the safety issues of a family (i.e., a power plant, a manufacturing facility, any facility on which a probabilistic risk assessment (PRA) might be performed). A series of lessons are provided that walk the user through some basic steps common to most analyses performed with SARA. The example problems presented in the lessons build on one another, and in combination, lead the user through all aspects of SARA sensitivity analysis.

  19. SarA influences the sporulation and secondary metabolism in Streptomyces coelicolor M145

    Institute of Scientific and Technical Information of China (English)

    Xijun Ou; Bo Zhang; Lin Zhang; Kai Dong; Chun Liu; Guoping Zhao; Xiaoming Ding


    The filamentous bacteria Streptomyces exhibit a complex life cycle involving morphological differentiation and secondary metabolism. A putative membrane protein gene sarA (sco4069), sporulation and antibiotic production related gene A, was partially characterized in Streptomyces coelicolor M145. The gene product had no characterized functional domains and was highly conserved in Streptomyces. Compared with the wild-type M145, the sarA mutant accelerated sporulation and dramatically decreased the production of actinorhodin and undecylprodigiosin.Reverse transcription-polymerase chain reaction analysis showed that SarA influenced antibiotic production by controlling the abundance of actll-orf4 and redZ messenger RNA.

  20. CERN Library and Art@CMS present Artist and Painter Xavier Cortada and CMS Physicist Pete Markowitz

    CERN Multimedia

    CERN Library


    Xavier Cortada is an American artist and painter, and an artist in residence at Florida International University (FIU) College of Architecture and the Arts who also specializes in participatory art projects. His work includes art installations at the Earth’s poles to generate awareness about climate change, child welfare murals in Bolivia and peace murals in Cyprus. Xavier will be in conversation with CMS physicist Pete Markowitz, also from FIU, to discuss the participatory art piece which they developed together. The piece will be showcased in the CMS detector hall on Thursday 11 April during the experiment’s conference week. The piece promises to "engage 300 scientists from around the world in a performance art piece that transforms them into the very subatomic particles they research". It is the first piece by Art@CMS, a new project inspired by the Arts@CERN programme. Discover more about how this new piece was developed and more about Xavier’s ...

  1. Sara, a patient with borderline personality structure: A "crisis" management

    Directory of Open Access Journals (Sweden)

    Paola Marinelli


    Full Text Available In this article the author examines some significant passages of his treatment of a patient with borderline personality structure, with the intention of giving a formative contribution to the delicate issue of the search for congruence between theory and clinic operations. This reflection is therefore an opportunity to integrate these aspects. The individualization of the therapeutic relationship in the theoretical framework of group analysis allowed the emotional investment in the person of the therapist, which is useful in the construction of a meaningful relationship on the human, emotional and cognitive plane; a space within which it has become increasingly possible for Sara, share and process emotions, re-build, contact parts of the self frustrated and disappointed, perceive less and less the void and become less vulnerable, being able to pull over to the original trauma. 

  2. PDB: CBRC-SARA-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0838 3ODU,3OE0,3OE6,3OE8,3OE9, Region:8-324(Identity=89%) PDB:3ODU Chain:A (X-ray Resolution...=2.5),Region:8-324(Identity=89%) PDB:3OE0 Chain:A (X-ray Resolution=2.9),Region:8-330(...Identity=90%) PDB:3OE6 Chain:A (X-ray Resolution=3.2),Region:8-324(Identity=89%) PDB:3OE8 Chain:A (X-ray Resolution...=3.1),Region:8-324(Identity=89%) PDB:3OE9 Chain:A (X-ray Resolution=3.1), ...

  3. Depression of biofilm formation and antibiotic resistance by sarA disruption in Staphylococcus epidermidis

    Institute of Scientific and Technical Information of China (English)

    Ju-Hong Tao; Chang-Sheng Fan; Shan-E Gao; Hai-Jiao Wang; Guo-Xin Liang; Qing Zhang


    AIM: To study the effects of disruption of sarA gene on biofilm formation and antibiotic resistance of Staphylococcus epidermidis (S. epidermidis ).METHODS: In order to disrupt sarA gene, the doublecrossover homologous recombination was applied in S. epidermidis RP62A, and tetracycline resistance gene (tet) was used as the selective marker which was amplified by PCR from the pBR322 and inserted into the locus between sarA upstream and downstream,resulting in pBT2△sarA. By electroporation, the plasmid pBT2△sarA was transformed into S. epidermidis.Gene transcription was detected by real-time reverse transcription-PCR (RT-PCR). Determination of biofilm was performed in 96-well flat-bottomed culture plates, and antibiotic resistance was analyzed with test tube culture by spectrophotometry at 570 nm respectively.RESULTS: A sarA disrupted strain named S. epidermidis RP62A△sarA was constructed, which was completely defective in biofilm formation, while the sarA complement strain RP62A△sarA (pHPS9sarA) restored the biofilm formation phenotype. Additionally, the knockout of sarA resulted in decreased erythromycin and kanamycin resistance of S. epidermidis RP62A. Compared to the original strain, S. epidermidis RP62A△sarA had an increase of the sensitivity to erythromycin at 200-400 μg/mL and kanamycin at 200-800 μg/mL respectively.CONCLUSION: The knockout of sarA can result in the defect in biofilm formation and the decreased erythromycin and kanamycin resistance in S. epidermidis RP62A.

  4. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. (United States)

    Valle, Jaione; Toledo-Arana, Alejandro; Berasain, Carmen; Ghigo, Jean-Marc; Amorena, Beatriz; Penadés, José R; Lasa, Iñigo


    Staphylococcus aureus biofilm formation is associated with the production of the polysaccharide intercellular adhesin (PIA/PNAG), the product of the ica operon. The staphylococcal accessory regulator, SarA, is a central regulatory element that controls the production of S. aureus virulence factors. By screening a library of Tn917 insertions in a clinical S. aureus strain, we identified SarA as being essential for biofilm development. Non-polar mutations of sarA in four genetically unrelated S. aureus strains decreased PIA/PNAG production and completely impaired biofilm development, both in steady state and flow conditions via an agr-independent mechanism. Accordingly, real-time PCR showed that the mutation in the sarA gene resulted in downregulation of the ica operon transcription. We also demonstrated that complete deletion of sigmaB did not affect PIA/PNAG production and biofilm formation, although it slightly decreased ica operon transcription. Furthermore, the sarA-sigmaB double mutant showed a significant decrease of ica expression but an increase of PIA/PNAG production and biofilm formation compared to the sarA single mutant. We propose that SarA activates S. aureus development of biofilm by both enhancing the ica operon transcription and suppressing the transcription of either a protein involved in the turnover of PIA/PNAG or a repressor of its synthesis, whose expression would be sigmaB-dependent.

  5. Single-access retroperitoneoscopic adrenalectomy (SARA) versus conventional retroperitoneoscopic adrenalectomy (CORA): a case-control study. (United States)

    Walz, Martin K; Groeben, Harald; Alesina, Piero F


    Stimulated by the concept of Natural Orifice Transluminal Endoscopic Surgery (NOTES), minimizing the access even further has become a new trend in minimally invasive surgery. We compare our recently described new method of endoscopic single-access adrenalectomy with the conventional retroperitoneoscopic approach in a matched-pairs study. Fifty single-access retroperitoneoscopic adrenalectomies (SARA) were performed in 47 selected patients suffering from Conn's adenomas (n = 20), pheochromocytomas (n = 15), Cushing's adenomas (n = 6), and other diseases (n = 6). For SARA, a single 2-cm skin incision beneath the 12th rib was used. Following creation of the retroperitoneal space with the rigid endoscope, dissection was carried out single-handed. Another 47 patients served as control group; they were treated by the traditional retroperitoneoscopic three-port approach (CORA). Patients were matched with respect to gender, body mass index, diagnoses, tumor size, and tumor site. Mortality was zero and no major complications occurred in both groups. SARA was completed in 41 cases (86%). The overall complication rate was 8.5% in SARA and 6.4% in CORA. Operative time was longer for SARA (56 +/- 28 min) than for CORA (40 +/- 12 min) (P CORA patients (P = 0.01). Mean hospital stay was 2.4 +/- 0.7 days (SARA) and 3.1 +/- 1.2 days (CORA) (P < 0.01). Because feasibility and safety of SARA could be demonstrated in a large group of selected patients, this surgical technique may represent a new milestone in minimally invasive endocrine surgery.

  6. The Markowitz's Portfolio Theory and Its Application in China%证券投资组合理论在中国的运用

    Institute of Scientific and Technical Information of China (English)




  7. Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. (United States)

    Kressmann, Sabine; Campos, Claudia; Castanon, Irinka; Fürthauer, Maximilian; González-Gaitán, Marcos


    Asymmetric division of neural precursor cells contributes to the generation of a variety of neuronal types. Asymmetric division is mediated by the asymmetric inheritance of fate determinants by the two daughter cells. In vertebrates, asymmetric fate determinants, such as Par3 and Mib, are only now starting to be identified. Here we show that, during mitosis of neural precursors in zebrafish, directional trafficking of Sara endosomes to one of the daughters can function as such a determinant. In asymmetric lineages, where one daughter cell becomes a neuron (n cell) whereas the other divides again to give rise to two neurons (p cell), we found that the daughter that inherits most of the Sara endosomes acquires the p fate. Sara endosomes carry an endocytosed pool of the Notch ligand DeltaD, which is thereby itself distributed asymmetrically. Sara and Notch are both essential for cell fate assignation within asymmetric lineages. Therefore, the Sara endosome system determines the fate decision between neuronal differentiation and mitosis in asymmetric lineages and thereby contributes to controlling the number of neural precursors and differentiated neurons during neurogenesis in a vertebrate.


    Directory of Open Access Journals (Sweden)

    Sulistyastuti Sutomo


    Full Text Available Not only does art   have   self-fullfillment, but  it also has axiological  benefits both socially, culturally, religiously, and economiclally.  So does Sara Douda dance.  Sara Douda aesthetics  is first contained  in its whole dance movements. In addition, it  can also be found in the whole dance equipments.  Moreover,  this dance aesthetics  may  also be contained in the verbal symbols in the speech forms  prior to the dance performance. However,  both verbal and non-verbal aesthetical forms are incorporated by the pieces of socio-cultural and  religious values in the Loli community about  their honoring their ancestors,  having social harmony, and  highly respecting each other among the community members. This study uses a cultural linguistic approach to find out and to review the aesthetics of Sara Douda dance.   Seni memang memiliki kepenuhan dalam dirinya sendiri. Tetapi ia juga sekaligus punya faedah aksiologis, baik secara sosial, kultural, religius maupun secara ekonomis. Tarian Sara Douda pun demikian. Estetika Sara Douda pertama-tama ada dalam semua gerak tariannya. Juga dalam seluruh perlengkapan tarian tersebut. Bukan itu saja, estetika tarian ini juga ada dalam simbol-simbol verbal berupa tuturan menjelang tarian. Tetapi baik bentuk-bentuk estetisasi nonverbal maupun verbal, sama-sama disatukan oleh kepingan-kepingan nilai-nilai sosio-kultural dan religius masyarakat Loli tentang penghormatan kepada leluhur, tentang harmoni sosial, dan tentang penghargaan yang tinggi terhadap satu sama lain. Penelitian ini menggunakan pendekatan linguistik kebudayaan demi menemukan dan menelaah estetika dalam tarian Sara Douda

  9. Michael Wood’s Yangzhou Dream

    Institute of Scientific and Technical Information of China (English)

    Yuan; Dan


    <正>Mr.Michael Wood is a wellknown British historian and documentary maker who has produced more than a hundred documentaries on various national histories and cultures exemplified by The Story of India.They enjoy wide popularity in more than 150 countries.I met him in February when he took his fi lm crew to Yangzhou to shoot The Story of China documentary for the British Broadcasting Corporation(BBC).It was a snowy day,cold and wet,but Michael said happily that the

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|YP_001391163.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langel...and] gb|ABS40017.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langeland] YP_001391163.1 3.1 34% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiest...erase 3 (Neutral sphingomyelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1323 ref|NP_001008277.1| rhodopsin [Canis lupus familiaris] ref|XP_855...608.1| PREDICTED: rhodopsin [Canis familiaris] emb|CAA70209.1| unnamed protein product [Canis familiaris] NP_001008277.1 2e-62 94% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|YP_857334.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK35937.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_857334.1 5.5 42% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1116 gb|AAC62470.1| chemokine receptor CCR5 [Cercocebus torquatus torq...uatus] gb|AAC62473.1| chemokine receptor CCR5 [Cercocebus torquatus torquatus] AAC62470.1 3e-72 86% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_776833.1| opioid receptor, mu 1 [Bos taurus] sp|P79350|OPRM_BOVIN Mu-type opioid... receptor (MOR-1) gb|AAB49477.2| mu opioid receptor [Bos taurus] NP_776833.1 0.0 91% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_001029087.1| opioid receptor, mu 1 [Pan troglodytes] sp|Q5...IS39|OPRM_PANTR Mu-type opioid receptor (MOR-1) gb|AAV74327.1| opioid receptor MU-1 [Pan troglodytes] NP_001029087.1 0.0 90% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0854 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0854 gb|EAW79490.1| calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal...eptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism), isoform CRA_c [Homo sapiens] EAW79490.1 0.0 90% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_001125845.1| hypothetical protein GTNG_1736 [Geobacillus thermoden...itrificans NG80-2] gb|ABO67100.1| Conserved hypothetical protein [Geobacillus thermodenitrificans NG80-2] YP_001125845.1 0.47 23% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|NP_965427.1| hypothetical protein LJ1621 [Lactobacillus johnson...ii NCC 533] gb|AAS09393.1| hypothetical protein LJ_1621 [Lactobacillus johnsonii NCC 533] NP_965427.1 0.12 24% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1366 gb|AAI40135.1| Olfactory receptor 1239 [synthetic construct] gb|A...AI40175.1| Olfactory receptor 1239 [synthetic construct] gb|AAI43150.1| Olfactory receptor 1239 [synthetic construct] AAI40135.1 2e-80 82% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  7. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers fo...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0590 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0590 ref|NP_297344.1| hypothetical protein XF0051 [Xylella fastidiosa ...9a5c] gb|AAF82864.1|AE003859_5 hypothetical protein XF_0051 [Xylella fastidiosa 9a5c] NP_297344.1 8e-19 51% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0430 ref|NP_878187.1| NADH dehydrogenase subunit 1 [Fejervarya limnoch...aris] gb|AAO12107.1| NADH dehydrogenase subunit 1 [Fejervarya limnocharis] NP_878187.1 2.5 29% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1095 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1095 ref|XP_001231930.1| PREDICTED: similar to claudin 14b [Gallus gal...lus] ref|XP_001231960.1| PREDICTED: similar to claudin 14b [Gallus gallus] XP_001231930.1 6e-34 37% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1648 ref|NP_694727.1| histamine H4 receptor [Mus musculus] gb|AAK97380.1|AF358859_1 histamine... H4 receptor [Mus musculus] gb|EDL01579.1| histamine H4 receptor [Mus musculus] NP_694727.1 1e-129 61% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

  13. Rumen Microbiome Composition in Cattle during Grain-Induced Subacute Ruminal Acidosis (SARA)

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Derakshani, Hooman; Li, Shucong


    day of the control period, and first and last day of full SARA-feeding. DNA was extracted and V4 region of bacterial 16S rRNA amplified and subjected to Illumina sequencing. Data was analyzed using QIIME pipelines and resultant operational taxonomic units (OTUs) were aligned to Greengenes database...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|ZP_00743402.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO52327.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00743402.1 0.20 36% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0256 ref|ZP_00739965.1| Integral membrane protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO55770.1| Integral membrane protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00739965.1 1.3 24% ...

  16. The new species of Mysidacea (Crustacea), Anchialina labatus and Gastrosaccus sarae, from south west Australia

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Descriptions of two new sepcies Anchialina labatus and Gastrosaccus sarae, are give. A. lobatus is distinguished from the other species of the genus by the presence of a hairy lobe on the first segment of the antennule, by the modified setae...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001003037.1| melanin-concentrating hormone receptor 2 [ lupus familiaris] gb|AAM51852.1| melanin-concentrating hormone receptor subtype 2 [Canis familiaris] NP_001003037.1 1e-126 73% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001038074.1| putative melanin concentrating hormone recept...or 2 [Sus scrofa] emb|CAJ55683.1| putative melanin concentrating hormone receptor 2 [Sus scrofa] NP_001038074.1 1e-129 73% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_001337495.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumonia...e MGH 78578] gb|ABR79228.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001337495.1 0.93 29% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0303 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0303 ref|YP_001109469.1| valine-pyruvate aminotransferase [Saccharopol...yspora erythraea NRRL 2338] emb|CAM06544.1| valine-pyruvate aminotransferase [Saccharopolyspora erythraea NRRL 2338] YP_001109469.1 5.0 33% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_873218.1| chitinase. Glycosyl Hydrolase family 18. [Acidot...hermus cellulolyticus 11B] gb|ABK53232.1| chitinase. Glycosyl Hydrolase family 18. [Acidothermus cellulolyticus 11B] YP_873218.1 9.3 29% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01788010.1| multidrug resistance protein [Haemophilus influenza...e 3655] gb|EDJ93712.1| multidrug resistance protein [Haemophilus influenzae 3655] ZP_01788010.1 0.22 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01792636.1| multidrug resistance protein [Haemophilus influenza...e PittHH] gb|EDK09769.1| multidrug resistance protein [Haemophilus influenzae PittHH] ZP_01792636.1 0.22 27% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01797490.1| multidrug resistance protein [Haemophilus influenza...e R3021] gb|EDK13267.1| multidrug resistance protein [Haemophilus influenzae 22.4-21] ZP_01797490.1 0.22 27% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01785759.1| multidrug resistance protein [Haemophilus influenza...e 22.4-21] gb|EDJ91681.1| multidrug resistance protein [Haemophilus influenzae R3021] ZP_01785759.1 0.22 27% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|YP_248596.1| multidrug resistance protein [Haemophilus influenza...e 86-028NP] gb|AAX87936.1| multidrug resistance protein [Haemophilus influenzae 86-028NP] YP_248596.1 0.22 27% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_026098.1| NADH dehydrogenase subunit 5 [Habronattus oregon...ensis] gb|AAT02495.1| NADH dehydrogenase subunit 5 [Habronattus oregonensis] YP_026098.1 0.032 22% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0491 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0491 ref|YP_001517065.1| hypothetical protein AM1_2749 [Acaryochloris marina... MBIC11017] gb|ABW27749.1| conserved hypothetical protein [Acaryochloris marina MBIC11017] YP_001517065.1 2e-13 45% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1485 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1485 ref|YP_001518234.1| pentapeptide repeat domain protein [Acaryochloris marina... MBIC11017] gb|ABW28917.1| pentapeptide repeat domain protein [Acaryochloris marina MBIC11017] YP_001518234.1 1.9 43% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0594 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 3e-10 35% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1578 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1578 ref|NP_001077100.1| cOR52N9 olfactory receptor family 52 subfamily N-like [Canis lupus... familiaris] gb|ABO36681.1| 52N9 olfactory receptor protein [Canis lupus familiaris] NP_001077100.1 1e-146 78% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1392 sp|Q9BDS7|GPR15_MACFA G-protein coupled receptor 15 gb|AAK25741.1...|AF291670_1 orphan seven transmembrane receptor GPR15 [Macaca fascicularis] Q9BDS7 1e-169 81% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|ZP_01666375.1| conserved hypothetical protein 374 [Thermosinus... carboxydivorans Nor1] gb|EAX47725.1| conserved hypothetical protein 374 [Thermosinus carboxydivorans Nor1] ZP_01666375.1 0.86 31% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_001499570.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae... MTU5] gb|ABV85023.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae MTU5] YP_001499570.1 4.7 36% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1560 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1560 ref|YP_984227.1| filamentous haemagglutinin family outer membrane... protein [Polaromonas naphthalenivorans CJ2] gb|ABM39306.1| filamentous haemagglutinin family outer membrane protein [Polaromonas naphthalenivorans CJ2] YP_984227.1 2.9 30% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0844 ref|NP_949451.1| putative conjugal transfer protein trbI [Rhodopseudomonas... palustris CGA009] emb|CAE29556.1| putative conjugal transfer protein trbI [Rhodopseudomonas palustris CGA009] NP_949451.1 0.38 29% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1393 ref|NP_946691.1| hypothetical protein RPA1341 [Rhodopseudomonas p...alustris CGA009] emb|CAE26784.1| conserved hypothetical protein [Rhodopseudomonas palustris CGA009] NP_946691.1 2.4 28% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 9e-19 40% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-22 39% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1273 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1273 ref|YP_001111321.1| hypothetical protein GrBNV_gp54 [Gryllus bima...culatus nudivirus] gb|ABO45387.1| unknown [Gryllus bimaculatus nudivirus] YP_001111321.1 0.001 35% ...

  2. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow (United States)

    Fletcher, Jack M.; Morris, Robin D.


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow's long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the…

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_848356.1| PREDICTED: similar to adiponectin receptor 1 iso...form 2 [Canis familiaris] ref|XP_537118.2| PREDICTED: similar to adiponectin receptor 1 isoform 1 [Canis familiaris] XP_848356.1 1e-138 67% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1030 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-170 79% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1688 emb|CAH72617.1| chromosome 10 open reading frame 18 [Homo sapiens...] emb|CAI13368.1| chromosome 10 open reading frame 18 [Homo sapiens] CAH72617.1 1e-103 49% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ensis HTE831] sp|Q8EQA1|PRSW_OCEIH Protease prsW (Protease responsible for activating sigma-W) dbj|BAC13763....CBRC-SARA-01-0522 ref|NP_692728.1| hypothetical protein OB1807 [Oceanobacillus ihey

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_574775.1| transcriptional regulator, LysR family [Chromohalobacter salex...igens DSM 3043] gb|ABE60076.1| transcriptional regulator, LysR family [Chromohalobacter salexigens DSM 3043] YP_574775.1 9.3 31% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0831 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0831 ref|XP_001526559.1| hypothetical protein LELG_01387 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK43209.1| hypothetical protein LELG_01387 [Lodderomyces elongisporus NRRL YB-4239] XP_001526559.1 2.8 51% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0106 ref|XP_001524609.1| hypothetical protein LELG_04581 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK46400.1| hypothetical protein LELG_04581 [Lodderomyces elongisporus NRRL YB-4239] XP_001524609.1 3e-17 39% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0566 sp|Q91ZI0|CELR3_MOUSE Cadherin EGF LAG seven-pass G-type receptor... 3 precursor gb|AAL25099.1|AF427498_1 cadherin EGF LAG seven-pass G-type receptor [Mus musculus] Q91ZI0 0.0 74% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_438659.1| alcohol dehydrogenase, zinc-containing [Burkholderia thail...andensis E264] gb|ABC35120.1| alcohol dehydrogenase, zinc-containing [Burkholderia thailandensis E264] YP_438659.1 0.69 35% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0383 ref|XP_361721.2| hypothetical protein MGG_04195 [Magnaporthe gris...ea 70-15] gb|EDJ99501.1| hypothetical protein MGG_04195 [Magnaporthe grisea 70-15] XP_361721.2 1.4 24% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_001009331.1| cannabinoid receptor 1 [Felis catus] sp|O02777|CNR1_FELCA Canna...binoid receptor 1 (CB1) (CB-R) gb|AAB53440.1| CB1 cannabinoid receptor [Felis catus] NP_001009331.1 0.0 96% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0175 ref|NP_603288.1| hypothetical protein FN0384 [Fusobacterium nucle...atum subsp. nucleatum ATCC 25586] gb|AAL94587.1| Hypothetical protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586] NP_603288.1 9.0 32% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0415 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0415 ref|YP_547770.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS...666] gb|ABE42872.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS666] YP_547770.1 4.6 26% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|YP_468056.1| phosphate ABC transporter, permease protein [Rhizobium... etli CFN 42] gb|ABC89329.1| phosphate ABC transporter, permease protein [Rhizobium etli CFN 42] YP_468056.1 1.1 27% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1549 ref|YP_001101288.1| twin-arginine translocase subunit, sec-indepe...ndent protein export [Herminiimonas arsenicoxydans] emb|CAL63167.1| twin-arginine translocase subunit, sec-i

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1142 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1142 ref|NP_787448.1| twin-arginine translocase TatC component [Trophe...ryma whipplei str. Twist] gb|AAO44417.1| twin-arginine translocase TatC component [Tropheryma whipplei str. Twist] NP_787448.1 0.17 24% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0268 ref|XP_566600.1| hypothetical protein [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW40781.1| expressed protein [Cryptococcus neoformans var. neoformans JEC21] XP_566600.1 0.017 30% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|XP_572921.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW45614.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neoformans JEC21] XP_572921.1 0.90 26% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0348 ref|XP_001586881.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN97385.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001586881.1 2.4 28% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|XP_001588188.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN94760.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001588188.1 4.6 34% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|NP_223335.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter... pylori J99] gb|AAD06197.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter pylori J99] NP_223335.1 5.2 32% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1253 ref|YP_264377.1| hypothetical protein Psyc_1092 [Psychrobacter 273-4] gb|AAZ18943.1| conserved hypothetical protein [Psychrobacter arcticus 273-4] YP_264377.1 1.2 25% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0873 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0873 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.36 25% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.78 25% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_708759.1| hypothetical protein RHA1_ro10412 [Rhodococcus s...p. RHA1] gb|ABH00601.1| conserved hypothetical protein [Rhodococcus sp. RHA1] YP_708759.1 2.7 25% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1967 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1967 ref|ZP_00370594.1| Predicted DNA repair exonuclease [Campylobacter upsalien...sis RM3195] gb|EAL53370.1| Predicted DNA repair exonuclease [Campylobacter upsaliensis RM3195] ZP_00370594.1 0.047 31% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_001015622.1| prostacyclin receptor [Bos taurus] sp|P79393|PI2R_BOVIN Prostacy...clin receptor (Prostanoid IP receptor) (PGI receptor) (Prostaglandin I2 receptor) emb|CAB07510.1| prostacyclin receptor [Bos taurus] NP_001015622.1 1e-113 86% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|YP_001302962.1| putative flippase [Parabacteroides distasonis... ATCC 8503] gb|ABR43340.1| putative flippase [Parabacteroides distasonis ATCC 8503] YP_001302962.1 5.1 26% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0459 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0459 ref|YP_001297164.1| hypothetical protein FP2308 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44363.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001297164.1 7.3 30% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1901 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1901 ref|ZP_01733372.1| hypothetical protein FBBAL38_03440 [Flavobacte...ria bacterium BAL38] gb|EAZ96441.1| hypothetical protein FBBAL38_03440 [Flavobacteria bacterium BAL38] ZP_01733372.1 4.4 19% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0253 ref|NP_001038089.1| G protein-coupled receptor 54 [Sus scrofa] gb...|ABE73452.1| G protein-coupled receptor 54 [Sus scrofa] gb|ABE73453.1| G protein-coupled receptor 54 [Sus scrofa] NP_001038089.1 3e-51 67% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0420 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0420 ref|ZP_00588106.1| Bile acid:sodium symporter [Pelodictyon phaeocl...athratiforme BU-1] gb|EAN26387.1| Bile acid:sodium symporter [Pelodictyon phaeoclathratiforme BU-1] ZP_00588106.1 0.33 29% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available moniae subsp. pneumoniae MGH 78578] gb|ABR77598.1| putative H+/gluconate symporter ...and related permeases [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001335828.1 1.8 26% ... ...CBRC-SARA-01-1117 ref|YP_001335828.1| putative H+/gluconate symporter and related permeases [Klebsiella pneu

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1572 ref|NP_652753.1| NADH dehydrogenase subunit 5 [Tigriopus japonicu...s] dbj|BAB97224.1| NADH dehydrogenase subunit 5 [Tigriopus japonicus] NP_652753.1 0.14 27% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1999 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1999 ref|YP_126627.1| hypothetical protein lpl1277 [Legionella pneumop...hila str. Lens] emb|CAH15517.1| hypothetical protein [Legionella pneumophila str. Lens] YP_126627.1 0.38 21% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1615 ref|XP_001683626.1| formin, putative [Leishmania major] emb|CAJ04...769.1| formin, putative [Leishmania major] gb|ABQ43162.1| formin B [Leishmania major] XP_001683626.1 0.52 46% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-2040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2040 ref|NP_001075253.1| 5-hydroxytryptamine (serotonin) receptor 2A [Equus caba...llus] dbj|BAF32954.1| 5-hydroxytryptamine receptor 2A [Equus caballus] NP_001075253.1 1e-128 87% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0322 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0322 ref|ZP_01459778.1| conserved hypothetical protein [Stigmatella aura...ntiaca DW4/3-1] gb|EAU69359.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01459778.1 5.2 34% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0796 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0796 ref|ZP_01774245.1| conserved hypothetical protein [Geobacter bemi...djiensis Bem] gb|EDJ80432.1| conserved hypothetical protein [Geobacter bemidjiensis Bem] ZP_01774245.1 3e-33 39% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001029253.1| progestin and adipoQ receptor family member V...II [Rattus norvegicus] gb|AAY67652.1| progestin membrane receptor alpha [Rattus norvegicus] NP_001029253.1 1e-167 82% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001033642.1| progestin and adipoQ receptor family member V...II [Bos taurus] gb|AAI11285.1| Progestin and adipoQ receptor family member VII [Bos taurus] NP_001033642.1 1e-180 87% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1656 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1656 ref|NP_001034958.1| bitter taste receptor Modo-T2R7B [Monodelphis... domestica] dbj|BAE80368.1| bitter taste receptor [Monodelphis domestica] NP_001034958.1 2e-39 43% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1755 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1755 ref|NP_001034947.1| bitter taste receptor Modo-T2R25 [Monodelphis... domestica] dbj|BAE80373.1| bitter taste receptor [Monodelphis domestica] NP_001034947.1 1e-40 35% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0389 ref|NP_001034959.1| bitter taste receptor Modo-T2R41 [Monodelphis... domestica] dbj|BAE80381.1| bitter taste receptor [Monodelphis domestica] NP_001034959.1 1e-101 60% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_033365.1| hypothetical protein BH05300 [Bartonella hensela...e str. Houston-1] emb|CAF27338.1| hypothetical protein [Bartonella henselae str. Houston-1] YP_033365.1 0.47 19% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.40 27% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.53 28% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.67 27% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.53 28% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.52 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.67 27% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1348 ref|NP_001028103.1| cholinergic receptor, muscarinic 5 [Macaca mu...latta] sp|P56490|ACM5_MACMU Muscarinic acetylcholine receptor M5 gb|AAB95159.1| muscarinic receptor [Macaca mulatta] NP_001028103.1 0.0 88% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_898010.1| phosphatidylserine synthase [Francisella tularen...sis subsp. novicida U112] gb|ABK89256.1| phosphatidylserine synthase [Francisella tularensis subsp. novicida U112] YP_898010.1 3.0 27% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|NP_693392.1| glycerol-3-phosphate dehydrogenase [ iheyensis HTE831] dbj|BAC14427.1| glycerol-3-phosphate dehydrogenase [Oceanobacillus iheyensis HTE831] NP_693392.1 8.7 23% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1651 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.5 19% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|NP_203162.1|ND5_15766 NADH dehydrogenase subunit 5 [Tribolium... castaneum] emb|CAC51706.1| NADH dehydrogenase subunit 5 [Tribolium castaneum] NP_203162.1 5.5 32% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0795 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0795 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.8 19% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_001039945.1| opioid receptor, kappa 1 [Bos taurus] sp|Q2KIP6|OPRK_BOVIN opioid receptor (KOR-1) gb|AAI12562.1| Opioid receptor, kappa 1 [Bos taurus] NP_001039945.1 9e-80 92% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|XP_001221542.1| hypothetical protein CHGG_05447 [Chaetomium globo...sum CBS 148.51] gb|EAQ88828.1| hypothetical protein CHGG_05447 [Chaetomium globosum CBS 148.51] XP_001221542.1 0.21 28% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|XP_001229383.1| hypothetical protein CHGG_02867 [Chaetomium globo...sum CBS 148.51] gb|EAQ90932.1| hypothetical protein CHGG_02867 [Chaetomium globosum CBS 148.51] XP_001229383.1 4.1 30% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0179 ref|XP_001226930.1| predicted protein [Chaetomium globosum CBS 14...8.51] gb|EAQ84989.1| predicted protein [Chaetomium globosum CBS 148.51] XP_001226930.1 1e-04 40% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_913161.1| ATP synthase F0 subunit 6 [Romanomermis culicivo...rax] gb|ABL11588.1| ATP synthase F0 subunit 6 [Romanomermis culicivorax] YP_913161.1 0.33 24% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1697 ref|YP_913162.1| NADH dehydrogenase subunit 5 [Romanomermis culic...ivorax] gb|ABL11589.1| NADH dehydrogenase subunit 5 [Romanomermis culicivorax] YP_913162.1 0.62 35% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1085 ref|NP_829355.1| hypothetical protein CCA00489 [Chlamydophila cav...iae GPIC] gb|AAP05233.1| conserved hypothetical protein [Chlamydophila caviae GPIC] NP_829355.1 0.26 23% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008277.1| hypothetical protein pc1278 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24002.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008277.1 0.89 28% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0159 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0159 ref|YP_008619.1| hypothetical protein pc1620 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24344.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008619.1 7.8 27% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008281.1| hypothetical protein pc1282 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24006.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008281.1 3.4 25% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1753 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1753 ref|YP_001476411.1| amino acid permease-associated region [Serratia proteam...aculans 568] gb|ABV39283.1| amino acid permease-associated region [Serratia proteamaculans 568] YP_001476411.1 0.83 35% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1462 ref|YP_300930.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyt...icus ATCC 15305] dbj|BAE17985.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305] YP_300930.1 0.020 25% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|YP_213442.1| putative iron transport, fusion membrane protein... [Bacteroides fragilis NCTC 9343] emb|CAH09534.1| putative iron transport, fusion membrane protein [Bacteroides fragilis NCTC 9343] YP_213442.1 1.8 26% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1386 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1386 ref|XP_001165973.1| PREDICTED: prokineticin receptor 2 isoform 1 ...[Pan troglodytes] ref|XP_001166012.1| PREDICTED: prokineticin receptor 2 isoform 2 [Pan troglodytes] XP_001165973.1 1e-115 91% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1868 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1868 ref|NP_067356.2| prokineticin receptor 1 [Mus musculus] gb|AAH59003.1| Prokinetic...2080.1| unnamed protein product [Mus musculus] gb|EDK99210.1| prokineticin receptor 1 [Mus musculus] NP_067356.2 2e-55 77% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_001100989.1| non imprinted in Prader-Willi/Angelman 1 homolog [Rattus norvegicus] gb|EDL86455.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (predicted) [Rattus norvegicus] NP_001100989.1 1e-113 80% ...

  16. 基于随机矩阵理论的Markowitz组合投资模型%Markowitz Portfolio Model Based on Random Matrix Theory

    Institute of Scientific and Technical Information of China (English)

    唐晓清; 白延琴; 刘念祖; 刘莹


    通过随机矩阵方法识别、消除极端或非无关抽样样本,提高Markowitz模型的参数估计精度,改进应用Markowitz模型的效果;同时,针对抽样不足的情况,使用Bootstrap方法较好地解决了该问题.%Markowitz's mean-variances model in this paper is improved,and the random matrix theory is used that can identify extreme sampling data and relevance data to get rid of those data such that more accurate estimate of mean and variance can be gotten.Then Bootstrap method to solve the problem of insufficient sample is used.

  17. Michael Hauskeller: Sex and the Posthuman Condition

    NARCIS (Netherlands)

    Miller, Lantz Eugene


    This new book from Michael Hauskeller explores the currently marketed or projected sex/love products that exhibit some trait of so-called “posthumanistic” theory or design. These products are so designated because of their intention to fuse high technologies, including robotics and computing, with

  18. Michael Hauskeller: Sex and the Posthuman Condition

    NARCIS (Netherlands)

    Miller, Lantz Flemming


    This new book from Michael Hauskeller explores the currently marketed or projected sex/love products that exhibit some trait of so-called “posthumanistic” theory or design. These products are so designated because of their intention to fuse high technologies, including robotics and computing, with t

  19. Reframing Michael Scott: Exploring Inappropriate Workplace Communication (United States)

    Schaefer, Zachary A.


    Individuals who work in professional settings interact with others who may exhibit a variety of cultural beliefs and decision-making approaches. Page (2007) argues that cognitive diversity (i.e., how people approach and attempt to solve problems) is a vital asset in effective organizations. Michael Scott, who portrays the inept main character on…

  20. Comments on Michael (1993): Establishing Operations (United States)

    Moore, J.


    The present comments concern Michael's concept of motivative variables, and the implications of that concept for our understanding of the nature of reinforcement as well as the extinction of responses maintained through positive and negative reinforcement. We note that both extinction and altering motivative variables decrease responding, but…


    Directory of Open Access Journals (Sweden)

    Serge Cipko


    Full Text Available This paper examines the reaction of the Ukrainian community in Canada at the Ukrainian famine of 1932–1933 in particular highlights the activities member of parliament, a Ukrainian-born Michael Luchkovich which 5 February 1934 gave a speech in federal parliament, reporting on the famine in the USSR and the related this protest the Ukrainian diaspora.

  2. Reflections: Michael Watts interviewed by Murat Arsel

    NARCIS (Netherlands)

    M. Arsel (Murat)


    textabstractMichael Watts is ‘Class of 1963’ Chair in Undergraduate Studies and Chancellor’s Professor of Geography at the University of California, Berkeley. Born and raised in rural southwest England, Watts studied at University College London and completed his PhD in 1979 at the University of Mic

  3. Michael Haneke film Euroopa parim / M. T.

    Index Scriptorium Estoniae

    M. T.


    IX PÖFFil linastuv Michael Haneke film "Varjatud" ("Cache") võitis laupäeval mitu Euroopa Filmiakadeemia auhinda, selhulgas parima filmi, parima lavastaja, parima meesnäitleja (Daniel Auteuil) ja FIPRESCI auhinna. Parim naisnäitleja - Julia Jentsch ("Sophie Scholli viimased päevad"), operaator - Franz Lustig ("Don't Come Knocking"), stsenaarium - Hany Abu-Assad, Bero Beyer ("Kohe paradiisi")

  4. STS-86 Pilot Michael Bloomfield suits up (United States)


    STS-86 Pilot Michael J. Bloomfield relaxes for a moment while donning his launch and entry suit with the assistance of a suit technician in the Operations and Checkout Building. This will be Bloomfields first spaceflight. He and the six other crew members will depart shortly for Launch Pad 39A, where the Space Shuttle Atlantis awaits liftoff on a 10-day mission slated to be the seventh docking of the Space Shuttle with the Russian Space Station Mir.

  5. Comments on Michael (1993): Establishing Operations


    Moore, J


    The present comments concern Michael's concept of motivative variables, and the implications of that concept for our understanding of the nature of reinforcement as well as the extinction of responses maintained through positive and negative reinforcement. We note that both extinction and altering motivative variables decrease responding, but they do so differently. The former does so by discontinuing the response-reinforcer relation. The latter does so by altering the motivation to respond. ...

  6. Michael Haneke film Euroopa parim / M. T.

    Index Scriptorium Estoniae

    M. T.


    IX PÖFFil linastuv Michael Haneke film "Varjatud" ("Cache") võitis laupäeval mitu Euroopa Filmiakadeemia auhinda, selhulgas parima filmi, parima lavastaja, parima meesnäitleja (Daniel Auteuil) ja FIPRESCI auhinna. Parim naisnäitleja - Julia Jentsch ("Sophie Scholli viimased päevad"), operaator - Franz Lustig ("Don't Come Knocking"), stsenaarium - Hany Abu-Assad, Bero Beyer ("Kohe paradiisi")

  7. Obituary: Michael James Ledlow, 1964-2004 (United States)

    Puxley, Philip John; Grashuis, Randon M.


    Michael James Ledlow died on 5 June 2004 from a large, unsuspected brain tumor. Since 2000 he had been on the scientific staff of the Gemini Observatory in La Serena, Chile, initially as a Science Fellow and then as a tenure-track astronomer. Michael was born in Bartlesville, Oklahoma on 1 October 1964 to Jerry and Sharon Ledlow. He obtained his Bachelor Degree in astrophysics at the University of Oklahoma in 1987 and attended the University of New Mexico for his graduate work, obtaining his PhD while studying Galaxy Clusters under Frazer Owen in 1994. From 1995-1997 Michael held a postdoctoral position with Jack Burns at New Mexico State University where he used various astronomical facilities including the VLA and Apache Point Observatory to study distant galaxies. From 1998-2000 Michael rejoined the Physics and Astronomy Department at the University of New Mexico where he was a visiting professor until he moved on to Gemini. At the Gemini Observatory, Mike shared in the excitement, hard work and many long days and nights associated with bringing on-line a major new astronomical facility and its instrumentation. Following its commissioning he assisted visiting observers, supported and took data for many more remote users via the queue system, and for each he showed the same care and attention to detail evident in his own research to ensure that all got the best possible data. His research concentrated on the radio and optical properties of galaxy clusters, especially rich Abell clusters such as A2125, on luminous radio galaxies, including the detection of a powerful double radio source in the "wrong sort of galaxy," the spiral system 0313-192, and on EROs (extremely red objects), dusty galaxies barely detectable at optical wavelengths. Michael thoroughly enjoyed living in Chile and enthusiastically immersed himself in the culture of his surroundings. He and his family were actively involved with the International English Spanish Association in La Serena. He had a

  8. Graph model of behavior simulator. [Interactive simulator developed as part of UCLA SARA system

    Energy Technology Data Exchange (ETDEWEB)

    Razouk, R.R.; Estrin, G.


    An interactive simulator developed at UCLA as part of the SARA system is described. This simulator, in conjunction with other design tools of the SARA system, allows the user to model the behavior of the system being designed at various levels of detail. The models which drive the simulator are control graphs and associated data graphs. The simulator uses the control graph to express synchronization of sequences of events. Initiation of any control node triggers the simulator to call on the data graph model to provide interpretation of a process at a desired level of abstraction. The simulator gives the user the capability to examine, or modify, the state of the control and data graphs during a simulation. 8 figures.

  9. SARA (System ARchitects Apprentice): Modeling, analysis, and simulation support for design of concurrent systems

    Energy Technology Data Exchange (ETDEWEB)

    Estrin, G.; Fenchel, R.S.; Razouk, R.R.; Vernon, M.K.


    An environment to support designers in the modeling, analysis and simulation of concurrent systems is described. It is shown how a fully nested structure model supports multilevel design and focuses attention on the interfaces between the modules which serve to encapsulate behavior. Using simple examples the paper indicates how a formal graph model can be used to model behavior in three domains: control flow, data flow, and interpretation. The effectiveness of the explicity environment model in SARA is discussed and the capability to analyze correctness and evaluate performance of a system model are demonstrated. A description of the integral help designed into SARA shows how the designer can be offered consistent use of any new tool introduced to support the design process.

  10. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA)

    CERN Document Server

    Keel, William C; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA), a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofisica de Canarias. SARA observatories comprise a 0.96m telescope at Kitt Peak, Arizona; a 0.6m instrument on Cerro Tololo, Chile; and the 1m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for f...

  11. Serum acute phase proteins in cows with SARA (Subacute Ruminal Acidosis suspect

    Directory of Open Access Journals (Sweden)

    C. Cannizzo


    Full Text Available The aim of this study was to evaluate the variations of Acute Phase Proteins (APPs and other blood constituents during the onset of the sub-acute ruminal acidosis (SARA pathological status. A total of 108 cows from 12 dairy herds were randomly selected and divided into three Groups of 36 animals each. All animals were subjected to a rumenocentesis. Group A was composed by subjects with a rumen pH>5.8, Group B was composed by subjects with a rumen pH ≤5.5≤5.8 and Group C was composed by subjects with a rumen pH<5.5. Blood samples were collected by jugular venipuncture and Haptoglobin (Hp, Serum Amyloid A (SAA, Total Proteins, Albumin and White Blood Cells (WBC were determined. One-way ANOVA showed a statistical significance on Rumen pH, Hp, SAA. SARA seems not stimulate the APPs production from liver.

  12. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow


    Fletcher, Jack M.; Morris, Robin D


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow’s long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the maturational lag theory of developmental dyslexia proposed with Paul Satz, her mentor. The research program that emerged from this work had a wide impact...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_999614.1| luteinizing hormone/choriogonadotropin receptor ...[Sus scrofa] sp|P16582|LSHR_PIG Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAA31062.1| luteinizing hormone receptor precursor NP_999614.1 0.0 65% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_776806.1| luteinizing hormone/choriogonadotropin receptor ...[Bos taurus] sp|Q28005|LSHR_BOVIN Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAC24012.1| luteinizing hormone receptor [Bos taurus] NP_776806.1 0.0 65% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_776826.1| neuropeptide Y receptor Y2 [Bos taurus] sp|P79113|NPY2R_BOVIN Neurope...ptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAB40600.1| type 2 neuropeptide Y receptor NP_776826.1 0.0 85% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0123 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 1e-120 70% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_653200.2| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Homo sapiens] sp|Q7RTP0|NIPA1_HUMAN Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 tpg|...DAA01477.1| TPA_exp: non-imprinted in Prader-Willi/Angelman syndrome 1 [Homo sapiens] NP_653200.2 1e-113 81% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0466 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0466 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 3e-32 71% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1400 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1400 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sapie...ns] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 4e-34 52% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1193 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1193 ref|NP_776427.1| calcium-sensing receptor [Bos taurus] sp|P35384|...CASR_BOVIN Extracellular calcium-sensing receptor precursor (CaSR) (Parathyroid Cell calcium-sensing recepto...r) gb|AAB29171.1| Ca(2+)-sensing receptor [Bos taurus] prf||2002360A Ca-sensing receptor NP_776427.1 0.0 86% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1360 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1360 ref|NP_599155.1| trace-amine-associated receptor 1 [Rattus norveg...icus] gb|AAL65137.1|AF421352_1 trace amine receptor 1 [Rattus norvegicus] gb|AAV70127.1| trace amine associa...ted receptor 1 [Rattus norvegicus] gb|EDL87747.1| trace-amine-associated receptor 1 [Rattus norvegicus] NP_599155.1 1e-145 74% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|NP_001029267.1| tubulin, alpha, ubiquitous [Pan troglodytes] ...sp|Q5R1W4|TBA1B_PANTR Tubulin alpha-1B chain (Tubulin alpha-ubiquitous chain) (Alpha-tubulin ubiquitous) (Tu...bulin K-alpha-1) dbj|BAD74034.1| ubiquitous alpha-tubulin [Pan troglodytes verus] NP_001029267.1 1e-136 86% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|YP_001474562.1| DNA internalization-related competence protei...n ComEC/Rec2 [Shewanella sediminis HAW-EB3] gb|ABV37434.1| DNA internalization-related competence protein ComEC/Rec2 [Shewanella sediminis HAW-EB3] YP_001474562.1 1.7 33% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0675 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0675 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-136 76% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1437 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-123 71% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0312 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-137 76% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1238 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1238 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-116 72% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0756 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0756 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sa...piens] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 1e-66 52% ...

  10. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA) (United States)

    Keel, William C.; Oswalt, Terry; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A.


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA) , a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofísica de Canarias. SARA observatories comprise a 0.96 m telescope at Kitt Peak, Arizona; one of 0.6 m aperture on Cerro Tololo, Chile; and the 1 m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for frequent local service, and a second CCD for offset guiding. The Arizona and Chile telescopes also have fiber-fed echelle spectrographs. Switching between imaging and spectroscopy is very rapid, so a night can easily accommodate mixed observing modes. We present some sample observational programs. For the benefit of other groups organizing similar consortia, we describe the operating structure and principles of SARA, as well as some lessons learned from almost 20 years of remote operations.

  11. Innovative Stormwater Quality Tools by SARA for Holistic Watershed Master Planning (United States)

    Thomas, S. M.; Su, Y. C.; Hummel, P. R.


    Stormwater management strategies such as Best Management Practices (BMP) and Low-Impact Development (LID) have increasingly gained attention in urban runoff control, becoming vital to holistic watershed master plans. These strategies can help address existing water quality impairments and support regulatory compliance, as well as guide planning and management of future development when substantial population growth and urbanization is projected to occur. However, past efforts have been limited to qualitative planning due to the lack of suitable tools to conduct quantitative assessment. The San Antonio River Authority (SARA), with the assistance of Lockwood, Andrews & Newnam, Inc. (LAN) and AQUA TERRA Consultants (a division of RESPEC), developed comprehensive hydrodynamic and water quality models using the Hydrological Simulation Program-FORTRAN (HSPF) for several urban watersheds in the San Antonio River Basin. These models enabled watershed management to look at water quality issues on a more refined temporal and spatial scale than the limited monitoring data. They also provided a means to locate and quantify potential water quality impairments and evaluate the effects of mitigation measures. To support the models, a suite of software tools were developed. including: 1) SARA Timeseries Utility Tool for managing and processing of large model timeseries files, 2) SARA Load Reduction Tool to determine load reductions needed to achieve screening levels for each modeled constituent on a sub-basin basis, and 3) SARA Enhanced BMP Tool to determine the optimal combination of BMP types and units needed to achieve the required load reductions. Using these SARA models and tools, water quality agencies and stormwater professionals can determine the optimal combinations of BMP/LID to accomplish their goals and save substantial stormwater infrastructure and management costs. The tools can also help regulators and permittees evaluate the feasibility of achieving compliance

  12. Reactivity of Athabasca residue and of its SARA fractions during residue hydroconversion

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, J.; Danial-Fortain, P.; Gauthier, T.; Merdrignac, I. [IFP-Lyon, Vermaison (France); Budzinski, H. [Bordeaux Univ. (France). ISM-LPTC, UMR CNRS


    Residue conversion processes are becoming increasingly important because of the declining market for residual fuel oil and a greater demand for middle distillates. Ebullated-bed hydroconversion is a commercially proven technology for converting heavy feedstocks with high amounts of impurities. The process enables the conversion of atmospheric or vacuum residues at temperatures up to 440 degrees C, and at liquid hourly space velocity (LHSV) conditions in the range of 0.15 to 0.5 per hour. A 540 degrees C conversion of up to 80 weight per cent can be achieved under these conditions. This paper reported on a research study conducted at IFP Lyon in which the residue hydroconversion in a large-scale ebullated bed bench unit was investigated to determine the impact of operating conditions and feed properties on yield and product qualities. Hydrogen was added to the feed in the bench units to keep a high hydrogen partial pressure and favour the catalytic hydroconversion reactions. In a typical test, the reactor was fed with 50 g of feedstock and 0.45 g of crushed equilibrium industrial NiMo catalyst, pressurized hydrogen and quickly heated at the reaction temperature. This paper also discussed the conversion of Athabasca bitumen residue in the large-scale pilot plant and also in the small scale batch reactor. The effect of operating temperature and space velocity was examined. The reactivity of the saturates, aromatics, resins and asphaltenes (SARA) fractions of the bitumen was studied separately in order to better understand the conversion mechanisms and reactivities. The Athabasca bitumen feed and SARA fractions were also analyzed in terms of standard petroleum analysis, SARA fractionation, elemental analysis, size exclusion chromatography (SEC) and 13C NMR. Hydroconversion experiments were conducted in the batch unit at different reaction temperatures and reaction times. A comparison of small-scale batch results with those obtained with the continuous large-scale bench

  13. A conversation with Michael Freeman, MD. (United States)

    Freeman, M


    The Institute for Behavioral Healthcare, a nonprofit organization that serves as an informational resource on issues surrounding the delivery of Behavioral Health Care Services, has been directed by Dr. Michael Freeman since its inception in 1988. In this crucial, unstable period in health care, membership in the Institute and attendance at its sponsored meetings has increased dramatically. Recently, Medical Interface talked with Dr. Freeman about topics of interest to the behavioral health care industry, ranging from any willing provider laws to the benefit itself.

  14. Anne Michaels e le ferite del linguaggio

    Directory of Open Access Journals (Sweden)

    Oriana Palusci


    Fugitive Pieces is analysed taking into consideration its polyphonic structure, the manifold motives and threads that weave together an intricate pattern, based on historical events and personal stories. Thanks to her use of scientific language from the realm of geology, paleobotany and geography, Michaels excavates time and space, past and present, in order to find a language to unveil the atrocities of Nazism against Jews, to preserve and evoke the memories of the survivors, but at the same time lead to a possible reconciliation with the past.

  15. Richard Michael Suzman (1942-2015). (United States)

    Kahneman, Daniel


    Presents an obituary for Richard Michael Suzman, who died on April 16, 2015. Suzman was trained as a sociologist and anthropologist, but he was attracted to the approaches of demography and economics. He came to know a great deal about diverse fields of science, including health, physiology, psychology, genetics, and economics. He was a scientific leader who was on a quest to develop new transdisciplinary fields and to mobilize the best scientists to work in them. Suzman's passion for transdisciplinary science was fully expressed in his greatest achievement: the famous Health and Retirement Survey (HRS), which he initiated in 1988 and continued to guide and inspire. (PsycINFO Database Record

  16. Modelo de Markowitz y Modelo de Black-Litterman en la Optimización de Portafolios de Inversión

    Directory of Open Access Journals (Sweden)

    Luis C. Franco-Arbeláez


    Full Text Available La optimización de portafolios de inversión es un aspecto central en el mundo financiero. El modelo de Markowitz ha logrado éxito a nivel teórico en el medio de las finanzas, en cuanto a la estructuración de portafolios y en la búsqueda de la diversificación implícita en el análisis de inversiones. Sin embargo, en la práctica, se presentan dificultades e inconvenientes, que han influido notoriamente en el poco éxito de su aplicación. En este artículo se hace un estudio reflexivo sobre las desventajas de este modelo en situaciones reales, y se presenta el modelo de Black-Litterman como alternativa metodológica que contribuye a neutralizar algunas de esas desventajas y permite maximizar el rendimiento esperado, generando un portafolio más eficiente, estable y diversificado.

  17. Michael Roitmann : Kalandus ei ole Eestile ilmselt prioriteetne valdkond / Michael Roitmann ; interv. Marko Saaret

    Index Scriptorium Estoniae

    Roitmann, Michael


    Ilmunud ka: Delovõje Vedomosti 3. dets. lk. 9. Euroopa Komisjoni kalandusdirektoraadi koordinaator Euroopa Liidu laienemise küsimuses Michael Roitmann juhib tähelepanu Eesti kalanduse suurematele probleemidele ning prognoosib EL-iga liitumise mõju Eesti kalandussektori arengule

  18. Michael Roitmann : Kalandus ei ole Eestile ilmselt prioriteetne valdkond / Michael Roitmann ; interv. Marko Saaret

    Index Scriptorium Estoniae

    Roitmann, Michael


    Ilmunud ka: Delovõje Vedomosti 3. dets. lk. 9. Euroopa Komisjoni kalandusdirektoraadi koordinaator Euroopa Liidu laienemise küsimuses Michael Roitmann juhib tähelepanu Eesti kalanduse suurematele probleemidele ning prognoosib EL-iga liitumise mõju Eesti kalandussektori arengule

  19. Impact of subacute ruminal acidosis (SARA) adaptation and recovery on the density and diversity of bacteria in the rumen of dairy cows

    NARCIS (Netherlands)

    Hook, S.E.; Steele, M.A.; Northwood, K.S.; Dijkstra, J.; France, J.; Wright, A.G.; McBride, B.W.


    Subacute ruminal acidosis (SARA) is characterized by ruminal pH depression and microbial perturbation. The impact of SARA adaptation and recovery on rumen bacterial density and diversity was investigated following high-grain feeding. Four ruminally cannulated dairy cows were fed a hay diet, transiti

  20. PLS models for determination of SARA analysis of Colombian vacuum residues and molecular distillation fractions using MIR-ATR

    Directory of Open Access Journals (Sweden)

    Jorge A. Orrego-Ruiz


    Full Text Available In this work, prediction models of Saturates, Aromatics, Resins and Asphaltenes fractions (SARA from thirty-seven vacuum residues of representative Colombian crudes and eighteen fractions of molecular distillation process were obtained. Mid-Infrared (MIR Attenuated Total Reflection (ATR spectroscopy in combination with partial least squares (PLS regression analysis was used to estimate accurately SARA analysis in these kind of samples. Calibration coefficients of prediction models were for saturates, aromatics, resins and asphaltenes fractions, 0.99, 0.96, 0.97 and 0.99, respectively. This methodology permits to control the molecular distillation process since small differences in chemical composition can be detected. Total time elapsed to give the SARA analysis per sample is 10 minutes.

  1. SARAS: a precision system for measurement of the Cosmic Radio Background and signatures from the Epoch of Reionization

    CERN Document Server

    Patra, Nipanjana; Raghunathan, A; Shankar, N Udaya


    SARAS is a correlation spectrometer purpose designed for precision measurements of the cosmic radio background and faint features in the sky spectrum at long wavelengths that arise from redshifted 21-cm from gas in the reionization epoch. SARAS operates in the octave band 87.5-175 MHz. We present herein the system design arguing for a complex correlation spectrometer concept. The SARAS design concept provides a differential measurement between the antenna temperature and that of an internal reference termination, with measurements in switched system states allowing for cancellation of additive contaminants from a large part of the signal flow path including the digital spectrometer. A switched noise injection scheme provides absolute spectral calibration. Additionally, we argue for an electrically small frequency-independent antenna over an absorber ground. Various critical design features that aid in avoidance of systematics and in providing calibration products for the parametrization of other unavoidable s...

  2. Michael Maier--nine newly discovered letters. (United States)

    Lenke, Nils; Roudet, Nicolas; Tilton, Hereward


    The authors provide a transcription, translation, and evaluation of nine newly discovered letters from the alchemist Michael Maier (1568-1622) to Gebhardt Johann von Alvensleben (1576-1631), a noble landholder in the vicinity of Magdeburg. Stemming from the final year of his life, this correspondence casts new light on Maier's biography, detailing his efforts to secure patronage amid the financial crisis of the early Thirty Years' War. While his ill-fated quest to perfect potable gold continued to form the central focus of his patronage suits, Maier also offered his services in several arts that he had condemned in his printed works, namely astrology and "supernatural" magic. Remarks concerning his previously unknown acquaintance with Heinrich Khunrath call for a re-evaluation of Maier's negotiation of the discursive boundaries between Lutheran orthodoxy and Paracelsianism. The letters also reveal Maier's substantial contribution to a work previously ascribed solely to the English alchemist Francis Anthony.

  3. STS-97 Crew Interviews: Michael J. Bloomfield (United States)


    Live footage of a preflight interview with Pilot Michael J. Bloomfield is shown. The interview addresses many different questions including why Bloomfield became interested in the space program, the events and people that influence him and ultimately led to his interest, and his vigorous training in the astronaut program. Other interesting information that this one-on-one interview discusses are the main goals of the STS-97 mission, its scheduled docking with the new International Space Station (ISS), and its delivery of the first set of U.S.-provided solar arrays, batteries, and radiators. Bloomfield briefly discusses his responsibilities during the much-anticipated docking as well as during the scheduled space-walks.

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_104995.1| alcohol dehydrogenase, zinc-containing [Burkholder...ia mallei ATCC 23344] ref|YP_111924.1| alcohol dehydrogenase [Burkholderia pseudomallei K96243] ref|ZP_004...40487.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei GB8 horse 4] ref|YP_336176.1| alc...ohol dehydrogenase, zinc-containing [Burkholderia pseudomallei 1710b] ref|ZP_0093...0750.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei FMH] ref|ZP_00934487.1| COG1064: Z

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1695 sp|Q9NYW0|T2R10_HUMAN Taste receptor type 2 member 10 (T2R10) (Taste... receptor family B member 2) (TRB2) gb|AAH69089.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AA...U21148.1| taste receptor T2R10 [Homo sapiens] gb|AAI01763.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AAI01765.1| Taste

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1608 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1608 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabinoid... receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cannabinoid... receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cannabinoid

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cannabinoid... receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cannabinoid... receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0921 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0921 ref|NP_003292.1| thyrotropin-releasing hormone receptor [Homo sap...iens] sp|P34981|TRFR_HUMAN Thyrotropin-releasing hormone receptor (TRH-R) (Thyroliberin receptor) emb|CAA52965.1| thyrotropin-releasi...BAA04120.1| human thyrotropin-releasing hormone receptor [Homo sapiens] gb|AAB32222.1| hormone receptor; TRH receptor [Homo sapiens] dbj|BAA12796.1| thyrotropin-releasing... hormone receptor [Homo sapiens] gb|AAR84356.1| thyrotropin-releasing hormone receptor [Homo sapiens] gb|

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_001105680.1| PREDICTED: similar to adiponectin receptor 1 ...isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin receptor 1 isoform 4 [Macac...a mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin receptor 1 isoform 5 [Macaca mulatta] ref|X...P_001105878.1| PREDICTED: similar to adiponectin receptor 1 isoform 6 [Macaca mul...atta] ref|XP_001105957.1| PREDICTED: similar to adiponectin receptor 1 isoform 7 [Macaca mulatta] XP_001105680.1 1e-138 67% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|NP_057083.2| adiponectin receptor 1 [Homo sapiens] ref|XP_514107.1| PREDICTED: adipone...ctin receptor 1 isoform 7 [Pan troglodytes] ref|XP_001152270.1| PREDICTED: adiponectin... receptor 1 isoform 1 [Pan troglodytes] ref|XP_001152338.1| PREDICTED: adiponectin receptor 1 isoform 2 [...Pan troglodytes] ref|XP_001152393.1| PREDICTED: adiponectin receptor 1 isoform 3 ...[Pan troglodytes] ref|XP_001152460.1| PREDICTED: adiponectin receptor 1 isoform 4 [Pan troglodytes] ref|XP_0

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_000951.1| prostaglandin I2 (prostacyclin) receptor (IP) [ I2 receptor) dbj|BAA05008.1| prostacyclin receptor [Homo sapiens] gb|AAA36448.1| prostanoid IP receptor dbj|BAA06110.1| pros...tacyclin receptor [Homo sapiens] dbj|BAA07325.1| prostacyclin ...receptor [Homo sapiens] gb|AAO92301.1| prostaglandin I2 (prostacyclin) receptor [Homo sapiens] gb|AAH75814.1| Prostaglandin I2 (pros...tacyclin) receptor (IP) [Homo sapiens] gb|EAW57432.1| prostaglandin I2 (prostacyclin

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|XP_001107503.1| PREDICTED: tubulin, alpha, ubiquitous isoform... 10 [Macaca mulatta] ref|XP_001107562.1| PREDICTED: tubulin, alpha, ubiquitous isoform 11 [Macaca mulatta] r...ef|XP_001107624.1| PREDICTED: tubulin, alpha, ubiquitous isoform 12 [Macaca mulatta] ref|XP_001107684.1| PRE...| PREDICTED: tubulin, alpha, ubiquitous isoform 14 [Macaca mulatta] ref|XP_001107805.1| PREDICTED: tubulin, alpha, ubiquitous... isoform 15 [Macaca mulatta] ref|XP_001107870.1| PREDICTED: tubulin, alpha, ubiquitous isof

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_848509.1| progestin and adipoQ receptor family member VII ...[Homo sapiens] sp|Q86WK9|MPRA_HUMAN Membrane progestin receptor alpha (mPR alpha) (Progestin and adipoQ rece...ptor family member VII) gb|AAO47233.1|AF313620_1 putative membrane steroid receptor [Homo sapiens] gb|AAR08373.1| progesti...1| hCG1642829 [Homo sapiens] emb|CAM12867.1| progestin and adipoQ receptor family member VII [Homo sapiens] NP_848509.1 1e-178 87% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_001122232.1| CDP-alcohol phosphatidyltransferase [Francise...lla tularensis subsp. tularensis WY96-3418] ref|YP_001427783.1| CDP-alcohol phosphatidyltransferase [Francis...ella tularensis subsp. holarctica FTA] gb|ABO47111.1| CDP-alcohol phosphatidyltransferase [Francisella tular...ensis subsp. tularensis WY96-3418] gb|EDN35713.1| phosphatidylserine synthase [Francis...ella tularensis subsp. novicida GA99-3549] gb|EDN37179.1| hypothetical protein FTDG_01588 [Francisella

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 gb|ABR53744.1| opsin 1 short-wavelength senstive protein [Daubent...onia madagascariensis] gb|ABR53745.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensi...s] gb|ABR53746.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensis] gb|ABR53747.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53748.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53749.1| opsin 1 short-wave

  16. Book Review: Invitation to Topological Robotics by Michael Farber

    DEFF Research Database (Denmark)

    Raussen, Martin


    Book Review: Invitaton to Topological Robotics by Michael Farber. Zurich Lectures in Advanced Mathematics, European Mathematical Society (2008), ISBN 978-3-03719-054-8......Book Review: Invitaton to Topological Robotics by Michael Farber. Zurich Lectures in Advanced Mathematics, European Mathematical Society (2008), ISBN 978-3-03719-054-8...

  17. Interview with Michael Apple: The Biography of a Public Intellectual (United States)

    Peters, Michael A.


    Michael W. Apple is the John Bascom Professor of Curriculum and Instruction and Educational Policy Studies in the Departments of Curriculum and Instruction (CI) and Educational Policy Studies (EPS) at the University of Wisconsin-Madison School of Education where he has taught since 1970. Michael Apple is one of the foremost educational theorists…

  18. Michael J. Meaney: Award for Distinguished Scientific Contributions (United States)

    American Psychologist, 2012


    Presents Michael J. Meaney as one of the winners of the American Psychological Association's Award for Distinguished Scientific Contributions (2012). Michael J. Meaney has taken the phenomenon of "handling" of newborn rats and opened a new area of investigation that has given new meaning to epigenetics via his work demonstrating transgenerational…

  19. Michael Young and the Curriculum Field in South Africa (United States)

    Hoadley, Ursula


    The paper addresses the question of what we should make of Michael Young's recent work with respect to curriculum theory by considering the particular case of South African curriculum reform. The paper thus traces two trajectories: the evolution of Michael Young's ideas over time and South African curriculum reform in the post-apartheid period.…

  20. saeRS and sarA act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Lara N Mrak

    Full Text Available Mutation of the staphylococcal accessory regulator (sarA limits biofilm formation in diverse strains of Staphylococcus aureus, but there are exceptions. One of these is the commonly studied strain Newman. This strain has two defects of potential relevance, the first being mutations that preclude anchoring of the fibronectin-binding proteins FnbA and FnbB to the cell wall, and the second being a point mutation in saeS that results in constitutive activation of the saePQRS regulatory system. We repaired these defects to determine whether either plays a role in biofilm formation and, if so, whether this could account for the reduced impact of sarA in Newman. Restoration of surface-anchored FnbA enhanced biofilm formation, but mutation of sarA in this fnbA-positive strain increased rather than decreased biofilm formation. Mutation of sarA in an saeS-repaired derivative of Newman (P18L or a Newman saeRS mutant (ΔsaeRS resulted in a biofilm-deficient phenotype like that observed in clinical isolates, even in the absence of surface-anchored FnbA. These phenotypes were correlated with increased production of extracellular proteases and decreased accumulation of FnbA and/or Spa in the P18L and ΔsaeRS sarA mutants by comparison to the Newman sarA mutant. The reduced accumulation of Spa was reversed by mutation of the gene encoding aureolysin, while the reduced accumulation of FnbA was reversed by mutation of the sspABC operon. These results demonstrate that saeRS and sarA act synergistically to repress the production of extracellular proteases that would otherwise limit accumulation of critical proteins that contribute to biofilm formation, with constitutive activation of saeRS limiting protease production, even in a sarA mutant, to a degree that can be correlated with increased enhanced capacity to form a biofilm. Although it remains unclear whether these effects are mediated directly or indirectly, studies done with an sspA::lux reporter suggest they

  1. Illness, everyday life and narrative montage: the visual aesthetics of cancer in Sara Bro's Diary. (United States)

    Henriksen, Nina; Tjørnhøj-Thomsen, Tine; Hansen, Helle Ploug


    This article presents a study of Sara Bro's Diary (2004), a book montage of images and texts recording the experiences of a Danish breast cancer survivor, Sara Bro. It examines two montages of photography and text, drawing on Roland Barthes' concept of 'the third meaning' to explain and discuss the effect of the layered meanings in the montage alongside their multi-medium and self-referential expression. The discussion is centred on the aesthetic practices that are invited by Bro's book montage. The article considers how the juxtaposition of images and texts are experienced and co-created by the reader. It points to the effect of the aesthetics of disguise and carnival implicit in the visual-verbal montage and argues that these generate a third meaning. This meaning is associated with the breast cancer experience but is not directly discernible in the montage. The article concludes by discussing how Bro's montage acts as an ideological statement, subverting or 'poaching on' the health care system.

  2. First Results on the Epoch of Reionization from First Light with SARAS 2 (United States)

    Singh, Saurabh; Subrahmanyan, Ravi; Udaya Shankar, N.; Sathyanarayana Rao, Mayuri; Fialkov, Anastasia; Cohen, Aviad; Barkana, Rennan; Girish, B. S.; Raghunathan, A.; Somashekar, R.; Srivani, K. S.


    Long-wavelength spectral distortions in the cosmic microwave background arising from the 21 cm transition in neutral hydrogen are a key probe of the Cosmic Dawn and the Epoch of Reionization. These features may reveal the nature of the first stars and ultra-faint galaxies that transformed the spin temperature and ionization state of the primordial gas. SARAS 2 is a spectral radiometer purposely designed for the precision measurement of these monopole or all-sky global 21 cm spectral distortions. We use 63 hr nighttime observations of the radio background in the frequency band 110-200 MHz, with the radiometer deployed at the Timbaktu Collective in Southern India, to derive likelihoods for plausible redshifted 21 cm signals predicted by theoretical models. First light with SARAS 2 disfavors the class of models that feature weak X-ray heating (with {f}X≤slant 0.1) and rapid reionization (with peak \\tfrac{{{dT}}b}{{dz}}≥slant 120 mK per unit redshift interval).

  3. An Interview with Sir Michael Marmot

    Directory of Open Access Journals (Sweden)



    Full Text Available In August of 2008 the WHO Commission on the Social Determinants of Health concluded its work with the publication of a report entitled: “Closing the gap in a generation: Health equity through action on the social determinants of health.” The Commission’s chair, Sir Michael Marmot, was kind enough to answer our questions about the Commission’s recommendations. This interview was conducted by email in May of this year. Social Medicine: We congratulate the Com-mission on its excellent work in bringing attention to the social determinants of health and the Commission’s call for health equity. We appreciated the Commission’s recognition that: “Social Justice is a matter of life and death.” We were also happy that the Commission included representatives of civil society in their work. This was an important affirmation of democratic values. When thinking about health inequalities people often use the analogue of the ladder to show how the gradient of worsening health outcomes affects all people in society except (presumably those at the very top. Thinking about the ladder leads us to pose the following question: Is making the ladder shorter (i.e. reducing inequalities the only approach to inequalities or is it possible to imagine making the ladder disappear entirely? Sir Michael Marmot: All societies have hier-archies. It is not conceivable, therefore, to have a society with no ladder. The conceptual framework of the Commission on Social Determinants of Health leads us to think of at least two (linked ways to address the relation between position on the ladder and health: act at the societal level to reduce social inequalities, and break the link between position in the social hierarchy and health. The first argues for reducing the slope of the social gradient. To see this, suppose, just for a moment, that the ladder were defined on the basis of years of education. People who had three years or fewer had life expectancy of 50 years

  4. 基于马科维茨模型的投连险投资组合分析%Analysis of even the insurance investment portfolio based on the Markowitz model

    Institute of Scientific and Technical Information of China (English)



    This paper uses Markowitz model theory, combined with China's investment-linked insurance fund application, the calculated optimal portfolio theory, and empirical analysis with the insurance company cast even insurance funds account portfolio.%  本文利用马科维茨模型理论,结合我国投资连结保险资金运用的实际,计算出投资组合理论最优值,并对保险公司投连险资金账户投资组合进行了实证分析。

  5. Race, punishment, and the Michael Vick experience. (United States)

    Piquero, Alex R; Piquero, Nicole Leeper; Gertz, Marc; Baker, Thomas; Batton, Jason; Barnes, J C


    Objective. The relationship between race and crime has been contentious, focusing primarily on offending and incarceration patterns among minorities. There has been some limited work on public perceptions of criminal punishment, and findings show that while minorities believe in the role and rule of law, they simultaneously perceive the justice system as acting in a biased and/or unfair manner. Two limitations have stalled this literature. First, research has focused mainly on criminal punishments to the neglect of noncriminal punishments. Second, most studies have not examined whether race remains salient after considering other demographic variables or discrimination and legitimacy attitudes.Methods. Using data from 400 adults, we examine how race affects perceptions of criminal punishment and subsequent reinstatement into the National Football League in the case of Michael Vick, a star professional quarterback who pled guilty to charges of operating an illegal dog-fighting ring.Results. Findings show that whites are more likely to view Vick's punishment as too soft and that he should not be reinstated, while nonwhites had the opposite views. Race remained significant after controlling for other variables believed to be related to punishment perceptions.Conclusion. Attitudes toward both criminal punishment and NFL reinstatement vary across race such that there exists important divides in how individuals perceive the system meting out punishment and subsequently reintegrating offenders back into society. These results underscore that white and nonwhites perceive the law and its administration differently.

  6. Obituary: Michael John Klein, 1940-2005 (United States)

    Gulkis, Samuel


    Michael John Klein died on 14 May 2005 at home in South Pasadena, California. The cause of death was tongue cancer that metastasized to the lungs. He was a non-smoker. Mike was a passionate radio astronomer, a trusted astronomical observer, an educator and a family man. Mike was born on 19 January 1940 in Ames, Iowa, the son of Florence Marie (Graf) and Fred Michael Klein. His mother was a homemaker, and his father was a banker. Mike had two older sisters, Lois Jean (Klein) Flauher and Marilyn June (Klein) Griffin. In 1962, Mike married his high school sweetheart Barbara Dahlberg, who survives him along with their three children, Kristin Marie (Klein) Shields, Michael John Klein Jr., Timothy Joel Klein, and six grandchildren. Mike developed a love for astronomy early in his life, and credited an early morning, newspaper-delivery route that he had at age twelve, which took him outside well before sunrise. He told family members that as he walked along his route, he stared into the sky and wondered what everything was. He studied sky charts, located stars, and began to understand how the planets shifted their positions relative to the stars each day. Another big influence in Mike's life was his brother in-law, Jim Griffin. Jim helped Mike understand that his passion for science did not have to remain a hobby, but could and should become a career. Jim's encouragement led Mike to attend Iowa State University in Ames, where he earned a BS in electrical engineering in 1962. Mike then started graduate school in electrical engineering at Michigan State, but after one semester transferred to the University of Michigan, Ann Arbor, where he earned an MS (1966) and PhD (1968) in astronomy. His doctoral dissertation, under the direction of Professor Fred Haddock, was based on extensive observations of the planets and examined the physical and thermal properties of planetary atmospheres and surfaces. Mike was awarded a Resident Research Associate position at JPL by the National

  7. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  8. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  9. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. (United States)

    Plaizier, Jan C; Li, Shucong; Danscher, Anne Mette; Derakshani, Hooman; Andersen, Pia H; Khafipour, Ehsan


    The effects of a grain-based subacute ruminal acidosis (SARA) challenge on bacteria in the rumen and feces of lactating dairy cows were determined. Six lactating, rumen-cannulated Danish Holstein cows were used in a cross-over study with two periods. Periods included two cows on a control diet and two cows on a SARA challenge. The control diet was a total mixed ration containing 45.5% dry matter (DM), 43.8% DM neutral detergent fiber, and 19.6% DM starch. The SARA challenge was conducted by gradually substituting the control diet with pellets containing 50% wheat and 50% barley over 3 days to reach a diet containing 55.6% DM, 31.3% DM neutral detergent fiber, and 31.8% DM starch, which was fed for four more days. Rumen fluid samples were collected at day 7 and 10 of experimental periods. Feces samples were collected on days 8 and 10 of these periods. Extracted DNA from the rumen and feces samples was analyzed to assess their bacterial communities using MiSeq Illumina sequencing of the V4 region of the 16S rRNA gene. The induction of SARA reduced the richness, diversity, and stability of bacterial communities and resulted in distinctly different microbiota in the rumen and feces. Bacteroidetes and Firmicutes were the most abundant phyla and, combined, they represented 76.9 and 94.4% of the bacterial community in the rumen fluid and the feces, respectively. Only the relative abundance of Firmicutes in the rumen was increased by the SARA challenge. In rumen fluid and feces, the abundances of nine out of the 90 and 25 out of the 89 taxa, respectively, were affected by the challenge. Hence, SARA challenge altered the composition of the bacterial community at the lower taxonomical level in the feces and therefore also likely in the hindgut, as well as in the rumen. However, only reductions in the bacterial richness and diversity in the rumen fluid and feces were in agreement with those of other studies and had a biological basis. Although the composition of the

  10. Meet EPA Scientist Michael Nye, Ph.D. (United States)

    Michael Nye, Ph.D., is a social scientist who studies natural risk, socio-demographic change and sustainable behavior. Prior to joining EPA, he worked for the UK Environment Agency in flood risk management and emergency preparedness

  11. Nitrosonium (NO+) catalyzed Michael addition of indoles to unsaturated enones

    Institute of Scientific and Technical Information of China (English)

    Guai Li Wu; Long Min Wu


    An efficient Michael addition of indoles to unsaturated enones, such as chalcones and β-nitrostyrenes, was achieved in thepresence of a catalytic amount of nitrosoninm tetrafluoroborate in ethyl ether.

  12. Immigration and Social Systems : Collected Essays of Michael Bommes

    NARCIS (Netherlands)


    Michael Bommes (hoogleraar Sociologie en Migratieonderzoek) was een van de meest briljante en originele geleerden in zijn vakgebied. Deze postume bundel bevat een selectie van zijn belangrijkste werk over immigratie en de verzorgingsstaat, de integratie van immigranten, discriminatie, illegale

  13. Michael Polanyi: Science as Personal Knowledge and Social Practice. (United States)

    Nye, Mary Jo


    Tacit knowing: 2016 marked the 125th anniversary of the birth of the physical chemist Michael Polanyi, as well as the 40th of his death. This essay discusses his philosophy of science-in particular, his most significant work in this area, Personal Knowledge-from the perspective of his personal biography, as well as its lasting influence on the social sciences. In the photograph: Michael Polanyi at the Fritz Haber Institute in 1968.

  14. Psyche’s Daughter of Today: Sara Jeannette Duncan and the New Woman

    Directory of Open Access Journals (Sweden)

    Michelle Gadpaille


    Full Text Available The Canadian novelist Sara Jeannette Duncan (1861-1922 constructed a New Woman heroine in the fin-de- siecle novel; A Daughter of Today (1894. Written in the popular mode of the transatlantic novel; the work engages in debate on the appropriate construction of femininity in art and public life. The heroine; Elfrida Bell; descends from artist; to muse; to model; to painted image—a descent framed by a rival male artist and a hostile London art scene. Represented as Psyche; the heroine undergoes a quest and failure similar to the mythical one. Adaptation of the Psyche myth clarifies the position of Duncan in the spectrum of gender ideologies of the fin-de- siecle.

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1066 ref|NP_473371.1| MAS-related GPR, member X2 [Homo sapiens] sp|Q96...LB1|MRGX2_HUMAN Mas-related G-protein coupled receptor member X2 gb|AAK91805.1| G protein-coupled receptor [Homo sapie...ns] dbj|BAB89339.1| putative G-protein coupled receptor [Homo sapiens] dbj|BAC06030.1| seven trans...membrane helix receptor [Homo sapiens] gb|AAH63450.1| MAS-related GPR, member X2 [Homo sapie...ns] gb|AAW70056.1| MRGX2 [Homo sapiens] gb|AAW70057.1| MRGX2 [Homo sapiens] gb|AAW70058.1| MRGX2 [Homo sapie

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0185 ref|NP_000852.1| histamine receptor H1 [Homo sapiens] ref|NP_001091681.1| histamine... receptor H1 [Homo sapiens] ref|NP_001091682.1| histamine receptor H1 [Homo sapiens] ref|NP_001091683.1| histamine... receptor H1 [Homo sapiens] sp|P35367|HRH1_HUMAN Histamine H1 receptor emb|CAA54182.1| histamine... H1 receptor [Homo sapiens] dbj|BAA05840.1| histamine H1 receptor [ sapiens] emb|CAA84380.1| Human histamine H1 receptor [Homo sapiens] dbj|BAA03319.1| histamine H1 receptor

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_705806.1| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Mus musculus] sp|Q8BHK1|NIPA1_MOUSE Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 homo...log gb|AAM34534.1| non-imprinted in Prader-Willi/Angelman syndrome 1 [Mus musculus] dbj|BAC32809.1| unnamed ...protein product [Mus musculus] gb|AAH55828.1| Non imprinted in Prader-Willi/ syndrome 1 homolog (human) [Mus musculus] gb|EDL21870.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) [Mus musculus] NP_705806.1 1e-113 81% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_035141.1| opioid receptor, kappa 1 [Mus musculus] sp|P33534|OPRK_MOUSE opioid receptor (KOR-1) (MSL-1) gb|AAA39363.1| kappa opioid receptor gb|AAB34130.2| opioid receptor; KOR [Mus sp.] gb|AAP32232.1| kappa-opioid receptor [Mus sp.] gb|AAI16796.1| Opioid receptor, 1 [Mus musculus] gb|AAI19027.1| Opioid receptor, kappa 1 [Mus muscu...lus] gb|EDL14259.1| opioid receptor, kappa 1, isoform CRA_a [Mus musculus] NP_035141.1 1e-78 92% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0004 ref|NP_000900.1| neuropeptide Y receptor Y1 [Homo sapiens] sp|P25929|NPY1R_HUMAN Neurope...ptide Y receptor type 1 (NPY1-R) gb|AAA73215.1| [Human neuropeptide Y peptide YY rece...ptor mRNA, complete cds.], gene product gb|AAA59947.1| neuropeptide Y receptor Y1 gb|AAH36657.1| Neuropeptid...e Y receptor Y1 [Homo sapiens] gb|AAS55647.1| neuropeptide Y1 receptor [Homo sapiens] gb|AAH71720.1| Neuro...peptide Y receptor Y1 [Homo sapiens] gb|EAX04841.1| neuropeptide Y receptor Y1 [Hom

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_000901.1| neuropeptide Y receptor Y2 [Homo sapiens] ref|NP_001012655.1| neurope...ptide Y receptor Y2 [Pan troglodytes] sp|P49146|NPY2R_HUMAN Neuropeptide Y receptor typ...e 2 (NPY2-R) (NPY-Y2 receptor) sp|Q5IS62|NPY2R_PANTR Neuropeptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAC50281.1| neurope...ptide Y/peptide YY Y2 receptor gb|AAB04120.1| y2 receptor gb|AAC51115.1| type 2 neuropeptide Y receptor gb|AAO92062.1| neuropeptide Y receptor Y2 [Homo

  1. SarA is a negative regulator of Staphylococcus epidermidis biofilm formation

    DEFF Research Database (Denmark)

    Martin, Christer; Heinze, C.; Busch, M.


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive S. epidermidis isolates fail to show accumulative biofilm growth in vitro. We here tested the hypothesis that this apparent paradox is related...... to the existence of superimposed regulatory systems suppressing a multi-cellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA,chief regulator of staphylococcal...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via over-expression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1942 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1942 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenerg...ic receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AA...B59487.1| alpha 1a/d adrenergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenerg

  3. Escribiendo el silencio: la contemplación poética de Sara Pujol

    Directory of Open Access Journals (Sweden)

    Gala, Candelas


    Full Text Available Reading Sara Pujol Russell's El fuego tiende su aire (1999 and Intacto asombro de la luz del silencio (2001, is entering into a poetic world whose content and form are both innovative and complex. This poetry invites the reader into a state of meditative contemplation that seeks correspondences among different elements in reality as the key to access a superior type of knowledge. Pujol's writing moves in the fringes between voice and silence, art and nature, meaning and nothingness, identity and difference, it seeks to surpass its own verbal texture while only in that texture does it find articulation and only through it does transcendence becones accessible. The focus of the present reading centers on the point where Pujol's language seeks to transcend the disjunction between sign and surrounding, the point where synthesis is fusion about to dissolve.La lectura de El fuego tiende su aire (1999 e Intacto asombro en la luz del silencio (2001 de Sara Pujol Russell, supone la entrada en un discurso poético innovador y complejo tanto en contenido como en forma. Esta poesía invita a una contemplación meditativa que busca las correspondencias entre los diversos elementos de la realidad como clave para acceder a un conocimiento superior. Su escritura se mueve en los bordes entre la voz y el silencio, el arte y la naturaleza, el sentido y el vacío, la identidad y la diferencia, buscando trascender lo que está más allá de su misma urdimbre verbal pero que sólo en ella se configura, y sólo desde ella se puede acceder. En el movimiento de esta escritura por superar la disyunción entre signo y entorno, en esa síntesis a punto de disolverse, es donde se enfoca la lectura en este ensayo.

  4. Functional impairment in patients with myotonic dystrophy type 1 can be assessed by an ataxia rating scale (SARA). (United States)

    DiPaolo, Giovanni; Jimenez-Moreno, Cecilia; Nikolenko, Nikoletta; Atalaia, Antonio; Monckton, Darren G; Guglieri, Michela; Lochmüller, Hanns


    Myotonic dystrophy type 1 (DM1) is not characterised by ataxia per se; however, DM1 and ataxia patients show similar disturbances in movement coordination often experiencing walking and balance difficulties, although caused by different underlying pathologies. This study aims to investigate the use of a scale previously described for the assessment and rating of ataxia (SARA) with the hypothesis that it could have utility in DM1 patients as a measure of disease severity and risk of falling. Data from 54 DM1 patients were pulled from the PHENO-DM1 natural history study for analysis. Mean SARA score in the DM1 population was 5.45 relative to the maximum score of eight. A flooring effect (score 0) was observed in mild cases within the sample. Inter-rater and test-retest reliability was high with intraclass coefficients (ICC) of 0.983 and 1.00, respectively. Internal consistency was acceptable as indicated by a Cronbach's alpha of 0.761. Component analysis revealed two principle components. SARA correlated with: (1) all measures of muscle function tested, including quantitative muscle testing of ankle dorsiflexion (r = -0.584*), the 6 min walk test (r = -0.739*), 10 m walk test (r = 0.741*), and the nine hole peg test (r = 0.602*) and (2) measures of disease severity/burden, such as MIRS (r = 0.718*), MDHI (r = 0.483*), and DM1-Activ (r = -0.749*) (*p < 0.001). The SARA score was predicted by an interaction between modal CTG repeat length and age at sampling (r = 0.678, p = 0.003). A score of eight or above predicted the use of a walking aid with a sensitivity of 100% and a specificity of 85.7%. We suggest that further research is warranted to ascertain whether SARA or components of SARA are useful outcome measures for clinical trials in DM1. As a tool, it can be used for gathering information about disease severity/burden and helping to identify patients in need of a walking aid, and can potentially be applied in both research and healthcare

  5. Principles of Chemistry (by Michael Munowitz) (United States)

    Kovac, Reviewed By Jeffrey


    At a time when almost all general chemistry textbooks seem to have become commodities designed by marketing departments to offend no one, it is refreshing to find a book with a unique perspective. Michael Munowitz has written what I can only describe as a delightful chemistry book, full of conceptual insight, that uses a novel and interesting pedagogic strategy. This is a book that has much to recommend it. This is the best-written general chemistry book I have ever read. An editor with whom I have worked recently remarked that he felt his job was to help authors make their writing sing. Well, the writing in Principles of Chemistry sings with the full, rich harmonies and creative inventiveness of the King's Singers or Chanticleer. Here is the first sentence of the introduction: "Central to any understanding of the physical world is one discovery of paramount importance, a truth disarmingly simple yet profound in its implications: matter is not continuous." This is prose to be savored and celebrated. Principles of Chemistry has a distinct perspective on chemistry: the perspective of the physical chemist. The focus is on simplicity, what is common about molecules and reactions; begin with the microscopic and build bridges to the macroscopic. The author's perspective is clear from the organization of the book. After three rather broad introductory chapters, there are four chapters that develop the quantum mechanical theory of atoms and molecules, including a strong treatment of molecular orbital theory. Unlike many books, Principles of Chemistry presents the molecular orbital approach first and introduces valence bond theory later only as an approximation for dealing with more complicated molecules. The usual chapters on descriptive inorganic chemistry are absent (though there is an excellent chapter on organic and biological molecules and reactions as well as one on transition metal complexes). Instead, descriptive chemistry is integrated into the development of

  6. Entrevista al profesor D. Michael Walker. - Interview with Professor D. Michael Walker.

    Directory of Open Access Journals (Sweden)

    Caravaca Guerrero, Consuelo Isabel


    Full Text Available Entrevistar a un investigador de la talla de D. Michael Walker supone hablar de un investigador reconocido a nivel nacional e internacional, uno de los mayores expertos en evolución humana de nuestros días. Nació en Colchester (Inglaterra en 1941 y tiene doble nacionalidad: británica y australiana. Actualmente es profesor emérito de la Universidad de Murcia en el Departamento de Zoología y Antropología Física de la Facultad de Biología. Pero su currículum no acaba aquí, Michael realizó tres carreras, Fisiología Animal, Medicina, y Arqueología Prehistórica, en la Universidad de Oxford. Es Doctor por esta universidad, gracias a su tesis leída sobre Paleoantropología y Prehistoria de las cuencas de los ríos Segura y Vinalopó. Nuestro entrevistado, también fue elegido Académico (Fellow –F.S.A.- en 1988 de la Society of Antiquaries of Londono SAL. Fundada en 1707, la SAL es la equivalente británica de la española Real Academia de la Historia. Es Fellow también del Real Instituto Antropológico de la Gran Bretaña (Royal Anthropological Institute of Great Britain y socio emérito de la Asociación Americana de Antropólogos Físicos (American Association of Physical Anthropologists.

  7. Guest Foreword from Michael Thomas CMG QC

    Directory of Open Access Journals (Sweden)

    Michael Thomas


    precedents and thought in a unique legal market in which ideas drawn from Islamic law, civil law and common law can intermingle and blend. It is not surprising therefore to see that this new publication will be dedicated to the subject of international law, both public and private. Its laudable aim is to promote legal discourse around the world, and to promote a wider international understanding of contemporary legal issues for the common benefit. As an open access, bilingual journal, addressing topics concerning any jurisdiction, I hope it will reach a wide audience, and fulfil its aim of promoting understanding between different cultures. I am sure that the journal will not only benefit Qatar’s legal community by advancing academic and practice-based legal discussion. I am also confident that it will stimulate thought in the global legal community at large. May I wish it every success and a long life. Michael Thomas CMG QC

  8. The Sub-keV Atom Reflecting Analyzer (SARA) Experiment Aboard Chandrayaan-1 Mission: Instrument and Observations

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Barabash, Stas; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura


    SARA experiment aboard the first Indian lunar mission Chandrayaan-1 had the objective to explore the solar wind-lunar interaction using energetic neutral atoms (ENA) from the lunar surface as diagnostic tool. SARA consisted of an ENA imaging mass analyzer CENA (Chandrayaan-1 Energetic Neutral Analyzer) and an ion mass analyser SWIM (Solar Wind Monitor), along with a digital processing unit (DPU) which commands and controls the sensors and provides the interface to the spacecraft. Both sensors have provided excellent observational data. CENA has observed ENAs from the lunar surface and found that ~20% of the incident solar wind ions get backscattered as ENAs from the lunar surface. This is contrary to the previous assumptions of almost complete absorption of solar wind by the lunar surface. The observation is relevant for other airless bodies in the solar system.

  9. Holocene environment changes around the Sara Us River, northern China, revealed by optical dating of lacustrine-aeolian sediments (United States)

    Zhao, Hui; Sheng, Yongwei; Li, Bo; Fan, Yuxin


    The Sara Us River is located along the boundary of the Mu Us Desert and the Chinese Loess Plateau in northern China. The river has cut down through Quaternary sediments creating 70-80 m deep valleys with thick lacustrine/aeolian sequences exposed. We applied optical stimulated luminescence on sediments from a Holocene section of aeolian sand/lacustrine deposits in the top of the river valley. The dating results show that a humid period existed from 7.1 to 2.0 ka ago as evidenced by two layers of peat and lacustrine sediments. However, compared to other published Holocene sections in the Sara Us River valleys close to the section under studying, the local environment experienced very complicated changes during the Holocene. All of the sections recorded a period with drought and/or cold before the Holocene at around 13 ka, and an episode of aridity after about 2 ka ago as evidenced by the layers of aeolian sand. However, the ages of the lacustrine and peat layers in these sections are substantially different. Geomorphological analysis by digital elevation models does not support the existence of a mega lake covering the study area at 2 ka. The intricate environmental changes may have been caused by the meandering of the Sara Us River. Environmental changes also strongly affected human migration in this area, which is documented by Chinese historical records.

  10. SARA: a self-adaptive and resource-aware approach towards secure wireless ad hoc and sensor networks (United States)

    Chigan, Chunxiao; Li, Leiyuan


    Providing security is essential for mission critical Wireless Ad Hoc and Sensor Networks (WAHSN) applications. Often a highly secure mechanism inevitably consumes a rather large amount of system resources, which in turn may unintentionally cause a Security Service Denial of Service (SSDoS) attack. This paper proposes a self-adaptive resource-aware (SARA) security provisioning approach for WAHSNs. For resource scarce WAHSNs, SARA strives to provide the optimal tradeoff between the sufficient security (which is reflected by the Security Index (SI)) and the acceptable network performance degradation (which is reflected by the Performance Index (PI)). With the support of the offline optimal secure protocol selection module and the online self-adaptive security control module, SARA is capable of employing different combinations of secure protocol sets to satisfy different security need at different condition for different applications. To determine the security index SI of a secure protocol set, a heuristic cross-layer security-service mapping mechanism is presented. Furthermore, we evaluate performance index PI of a secure protocol set via simulation followed by Analysis of Variance (ANOVA). Consequently, the proposed self-adaptive security provisioning based on both SI and PI achieves the maximum overall network security services and network performance services, without causing the SSDoS attack. Furthermore, this self-adaptive mechanism is capable of switching from one secure protocol set to another while keeping similar level of security and performance, it thus provides additional security by security service hopping.

  11. Saras Cranes in Palwal District in Southern Haryana are Asking for Immediate Attention for Their Last Rescue Effort

    Directory of Open Access Journals (Sweden)

    Tirshem Kumar Kaushik


    Full Text Available Saras Cranes Grus antigone are endangered birds of open wetlands with highly worrying depletion trends being witnessed related with disappearance of marshy and shallow perennial, expansive wetlands throughout northern India. Alongside, massive hunting in 18th, 19th and 20th centuries and even today is another serious cause for their worrisome deterioration. Also, destruction of nests, eggs, fledglings and adults by aboriginals indeliberately or deliberately is causing these cranes to perish sooner than latter, completely. Now, Saras Cranes are found in limited number and domain as four populations in the entire world including India, China, Burma, South East Asia and northern Australia. The population of Indian Saras Crane is pitiably restricted to Etawa and Mainpuri districts of Uttar Pradesh. Stray birds of this species are restricted to Kanha National Park in Madhya Pradesh and in some parts of Gujarat and Assam. It is interesting to note that few pairs have been seen in Faridabad and Palwal districts in southern Haryana, India. These need to be protected and conserved.

  12. Studying the Lunar-Solar Wind Interaction with the SARA Experiment aboard the Indian Lunar Mission Chandrayaan-1

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Wieser, Martin; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura; 10.1063/1.3395916


    The first Indian lunar mission Chandrayaan-1 was launched on 22 October 2008. The Sub-keV Atom Reflecting Analyzer (SARA) instrument onboard Chandrayaan-1 consists of an energetic neutral atom (ENA) imaging mass analyzer called CENA (Chandrayaan-1 Energetic Neutrals Analyzer), and an ion-mass analyzer called SWIM (Solar wind Monitor). CENA performed the first ever experiment to study the solar wind-planetary surface interaction via detection of sputtered neutral atoms and neutralized backscattered solar wind protons in the energy range ~0.01-3.0 keV. SWIM measures solar wind ions, magnetosheath and magnetotail ions, as well as ions scattered from lunar surface in the ~0.01-15 keV energy range. The neutral atom sensor uses conversion of the incoming neutrals to positive ions, which are then analyzed via surface interaction technique. The ion mass analyzer is based on similar principle. This paper presents the SARA instrument and the first results obtained by the SWIM and CENA sensors. SARA observations suggest...

  13. Obituary: Michael John Seaton, 1923-2007 (United States)

    Pradhan, Anil; Nahar, Sultana


    Professor Michael John Seaton, hailed as the "Father of Atomic Astrophysics," passed away on May 29, 2007. He was one of the few Honorary Fellows of both the American Astronomical Society and the American Physical Society, so honored for his monumental contributions to both physics and astronomy. Mike Seaton was born on January 16, 1923 in Bristol, England. He attended Wallington County High School. But his leftist political activities, even at that stage, led to his expulsion, though he was eventually allowed to matriculate. He enlisted in the Royal Air Force as a navigator during the Second World War, and flew many dangerous missions. His legendary concentration and precision are reflected in the following anecdote. Once after a bombing mission his aircraft was lost in fog over the Alps. Seaton calculated the position and coordinates in flight to guide the aircraft. When the fog lifted, the crew found themselves flying perilously close to the mountains, but made it safely back. His associates often said, "A Seaton calculation is carried out as if his life depended on it." After the War he was admitted to University College London (UCL) as an undergraduate. Thereafter, he spent all of his professional career at UCL. Seaton received his Batchelor's degree in 1948, and his Ph.D. in 1951. His tenure at UCL coincided with the golden age of atomic astrophysics, for he was largely responsible for it. Seaton was elected Fellow of the Royal Society in 1967, and as President of the Royal Astronomical Society (RAS) in 1978. He was the recipient of an Honorary Doctorate from the Observatoire de Paris, an Honorary D.Sc. from the Queen's University of Belfast, the Gold Medal for Astronomy by the RAS, the Guthrie Medal by the Institute of Physics, the Royal Society Hughes award for lifetime work by the RAS, and several other prestigious awards. Nevertheless, as Alex Dalgarno recently remarked, Seaton was not part of the establishment because he chose not to be. Though rooted in

  14. Markowitz投资组合理论在房地产投资组合决策中的应用%Application of Markowitz Portfolio Theory in Real Estate Portfolio Decision

    Institute of Scientific and Technical Information of China (English)




  15. Triphenylphosphine-Catalyzed Michael Addition of Alcohols to Acrylic Compounds

    Institute of Scientific and Technical Information of China (English)

    LIU, Hai-Ling; JIANG, Huan-Feng; WANG, Yu-Gang


    A facile triphenylphosphine-catalyzed Michael addition of alcohols to acrylic compounds was described. The reaction was carried out in open air at refluxing temperature in the presence of 10 mol% PPh3. Michael addition of saturated and unsaturated alcohols to acrylonitrile or acrylates has been examined. The reaction gaveβ-alkoxy derivatives with isolated yields of 5%-79%. PPh3 is cheaper and more stable than those trialkylphosphines previously used for the similar reactions, and the products can be easily separated from the reaction mixture via distillation.

  16. TRADE instructional materials for SARA/OSHA training. Volume 2, Managers and supervisors training

    Energy Technology Data Exchange (ETDEWEB)


    This document provides instructional materials for an eight-hour training course for managers and supervisors of hazardous waste sites. It is one of three volumes of course materials TRADE is preparing to help DOE contractor training staff comply with 29 CFR 1910.120, the Occupational Health and Safety Administration (OSHA) rule that implements Title I of the Superfund Amendments and Reauthorization Act (SARA) of 1986. OSHA`s final rule for hazardous waste operators was published in the Federal Register of March 6, 1989 (54 FR 9294). Combined with the materials in Volumes I and III and with appropriate site-specific information, these materials will help DOE contractors to meet the requirements of 1910.120 (e) that ``on-site management and supervisors directly responsible for, or who supervise employees engaged in, hazardous waste operations`` receive the same initial training as that of the employees they supervise and at least eight additional hours of specialized training in managing hazardous waste operations.

  17. La difesa della donna ebrea: Sara Copio Sullam e Debora Ascarelli

    Directory of Open Access Journals (Sweden)

    Umberto Fortis


    Full Text Available Sara Copio Sullam and Debora Ascarelli, the best-known Jewish women poets of the age of the Italian ghetto, have often been studied with a focus on the distinctive features of their writing: the former as a translator of sacred texts, the latter as the author of original verses, sometimes written as a risposta per le rime (reply through rhymes or in defence of her orthodoxy. They share, however, a common theme, which has often been neglected: the defence of the Jewish woman, which is overt in some of Copio’s sonnets and prose, whereas it has not yet been properly pointed out in some of Ascarelli’s verses. This paper aims at bringing this theme to the fore not only in Copio, through a rereading of some passages of her Manifesto, but also in Debora Ascarelli, through an analysis of her few original verses. These hendecasyllables certainly reflect the Petrarchan and classicistic atmosphere of the late 16th century in Rome, but they are far from the mainstream modes of women’s poetry of the age. They allow us, therefore, to highlight, besides the differences, the similarities between the two poetesses; their commitment, in the late 16th and early 17th century, to the intellectual and moral defence of the Jewish woman, in a context of general depreciation of women, but also in the background of the claim to the “nobility and excellence of women”.

  18. Lipase-Catalyzed Aza-Michael Reaction on Acrylate Derivatives

    NARCIS (Netherlands)

    Steunenberg, P.; Sijm, M.; Zuilhof, H.; Sanders, J.P.M.; Scott, E.L.; Franssen, M.C.R.


    A methodology has been developed for an efficient and selective lipase-catalyzed aza-Michael reaction of various amines (primary and secondary) with a series of acrylates and alkylacrylates. Reaction parameters were tuned, and under the optimal conditions it was found that Pseudomonas stutzeri lipas

  19. Michael hydratase alcohol dehydrogenase or just alcohol dehydrogenase?

    NARCIS (Netherlands)

    Resch, V.A.; Jin, J.; Chen, B.S.; Hanefeld, U.


    The Michael hydratase – alcohol dehydrogenase (MhyADH) from Alicycliphilus denitrificans was previously identified as a bi-functional enzyme performing a hydration of α,β-unsaturated ketones and subsequent oxidation of the formed alcohols. The investigations of the bi-functionality were based on a

  20. Michael Moore kaevati kohtusse pettuse eest / Mari Rebane

    Index Scriptorium Estoniae

    Rebane, Mari


    Dokumentaalfilm "9/11 Fahrenheiti" ("Fahrenheit 9/11") : režissöör Michael Moore : USA 2004. Iraagi sõja invaliidistunud veteran andis režissööri kohtusse teda kujutavate flmikaadrite loata ja tenentsliku kasutamise pärast

  1. Reading Michael Apple--The Sociological Imagination at Work (United States)

    Ball, Stephen J.


    This article discusses Michael Apple's contribution to the sociology of education and education policy analysis and the politics of education. It focuses on ways of "reading" Apple as an intellectual and an activist and looks at the trajectory of his work over a long and illustrious career.

  2. Eesti luksushotellide ristiisa / Michael Stenner ; interv. Malle Koido

    Index Scriptorium Estoniae

    Stenner, Michael


    Eesti tipphotelle 1997. aastast juhtinud sakslane, praegu hotellide Kolm Õde ja Telegraaf juht räägib Eesti ja Saksamaa erinevustest, Eesti hotelliärist, teeninduskultuurist ja personalist. Lisa: Kes on Michael Stenner ning kuidas ta Eestisse sattus? Ilmunud ka: Linnaleht : Pärnu, 23. veebr. 2007, lk. 5-6

  3. Tweeting Prayers and Communicating Grief over Michael Jackson Online (United States)

    Sanderson, Jimmy; Cheong, Pauline Hope


    Death and bereavement are human experiences that new media helps facilitate alongside creating new social grief practices that occur online. This study investigated how people's postings and tweets facilitated the communication of grief after pop music icon Michael Jackson died. Drawing on past grief research, religion, and new media studies, a…

  4. Genres and Genre Theory: A Response to Michael Rosen (United States)

    Christie, Frances


    This paper responds to Michael Rosen's blog entries, "How Genre Theory Saved the World", arguing that genre theory in the tradition of systemic functional linguistics (SFL) has made an important contribution to language and literacy pedagogy. It emerged in the Australian context in about 1980 and was initially developed in response to…

  5. Michael Moore kaevati kohtusse pettuse eest / Mari Rebane

    Index Scriptorium Estoniae

    Rebane, Mari


    Dokumentaalfilm "9/11 Fahrenheiti" ("Fahrenheit 9/11") : režissöör Michael Moore : USA 2004. Iraagi sõja invaliidistunud veteran andis režissööri kohtusse teda kujutavate flmikaadrite loata ja tenentsliku kasutamise pärast

  6. Solvent-free microwave-mediated Michael addition reactions

    Indian Academy of Sciences (India)

    H Surya Prakash Rao; S Jothilingam


    Facile Michael addition of active methylene compounds to ,-unsaturated carbonyl compounds takes place on the surface of potassium carbonate under microwave irradiation. Further studies on microwave-mediated Robinson annulations reveal a convenient and facile method for condensation of chalcone with methylene compounds to furnish cyclohexenones.

  7. SuchThatCast Episode 6: Michael Boylan

    NARCIS (Netherlands)

    Soraker, Johnny


    Michael Boylan is the John J. McDonnell jr chair in Ethics, and professor and chair of the philosophy department at Marymount University in Arlington, Virginia. In addition to being a poet and novelist, he has written more than 100 published articles and 25 books primarily in ethics, social and

  8. The correspondence of Michael Faraday, v.4 1849-1855

    CERN Document Server

    James, F


    This volume includes 70% of previously unpublished letters of Michael Farday spanning half of the 1850s and most of 1860. Topics include Faraday's work on regelation, the transmission of light through gold and his appointment by Emperor Napoleon III to be a Commander of the Legion of Honour.

  9. Correspondence of Michael Faraday, v.5 1855-1860

    CERN Document Server

    Faraday, Michael


    This volume includes 70% of previously unpublished letters of Michael Farday spanning half of the 1850s and most of 1860. Topics include Faraday's work on regelation, the transmission of light through gold and his appointment by Emperor Napoleon III to be a Commander of the Legion of Honour.

  10. Aza-Michael Reaction for an Undergraduate Organic Chemistry Laboratory (United States)

    Nigam, Manisha; Rush, Brittney; Patel, Jay; Castillo, Raul; Dhar, Preeti


    A green, aza-Michael reaction is described that can be used to teach undergraduate students conjugate addition of nitrogen nucleophile to an a,ß-unsaturated ester. Students analyze spectral data of the product obtained from the assigned reaction to determine product structure and propose the mechanism of its formation. The experiment requires…

  11. Professor Porter ja tema viis konkurentsitegurit / Michael E Porter

    Index Scriptorium Estoniae

    Porter, Michael E


    Maailmas tuntud juhtimisguru Michael Porter viie konkurentsijõu teooriast ja selle rakendatavusest erinevates valdkondades. Lisad: Erinevused valdkondade kasumlikkuses; 5 määravat konkurentsijõudu; Investeeritud kapitali keskmine tasuvus; Mõnede USA tegevusvaldkondade kasumlikkus; Valdkonnaanalüüs praktikas; Valdkonna määratlemine; Valdkonnaanalüüsi sammud

  12. Michael Young's "The Rise of the Meritocracy": A Philosophical Critique (United States)

    Allen, Ansgar


    This paper examines Michael Young's 1958 dystopia, "The Rise of the Meritocracy". In this book, the word "meritocracy" was coined and used in a pejorative sense. Today, however, meritocracy represents a positive ideal against which we measure the justice of our institutions. This paper argues that, when read in the twenty-first century, Young's…

  13. Aza-Michael Reaction for an Undergraduate Organic Chemistry Laboratory (United States)

    Nigam, Manisha; Rush, Brittney; Patel, Jay; Castillo, Raul; Dhar, Preeti


    A green, aza-Michael reaction is described that can be used to teach undergraduate students conjugate addition of nitrogen nucleophile to an a,ß-unsaturated ester. Students analyze spectral data of the product obtained from the assigned reaction to determine product structure and propose the mechanism of its formation. The experiment requires…

  14. Educational Implications of Michael Fishbane's "Sacred Attunement: A Jewish Theology" (United States)

    Marom, Daniel


    This article posits Michael Fishbane's Judaic scholarship as a prime resource for Jewish education. The link between the two fields can be made through a translation of the theological underpinnings of Fishbane's insights into Judaism to educational purposes and practices. Initial work with Jewish educators on establishing this link encouraged…

  15. An active and selective heterogeneous catalytic system for Michael addition

    Institute of Scientific and Technical Information of China (English)

    Hoda Keipour; Mohammad A. Khalilzadeh; Abolfazl Hosseini; Afsaneh Pilevar; Daryoush Zareyee


    Potassium fluoride doped natural zeolite was found to be an efficient and selective solid base catalyst for 1,4-Michael addition.The catalyst is easily prepared and the workup procedure simplified by simple filtration.All products were obtained in high yields as well as short reaction times.

  16. Fooling LC: Michael Crichton and "Eaters of the Dead." (United States)

    Lonergan, David


    Chronicles the variety of means with which the novelist Michael Crichton has attempted to give his works the appearance of nonfiction. Specific and successful techniques utilized in "Eaters of the Dead" are noted, and the resulting erroneous classifications by the Library of Congress and subsequent catalogers are discussed. (Author)

  17. Berliinis võidutses Michael Haneke / Jüri Laulik

    Index Scriptorium Estoniae

    Laulik, Jüri, 1959-


    IX PÖFFil linastuv Michael Haneke film "Varjatud" ("Cache") võitis laupäeval mitu Euroopa Filmiakadeemia auhinda, sealhulgas parima filmi, parima lavastaja ja parima meesnäitleja (Daniel Auteuil) auhinna. Parima naisnäitleja tiitli pälvis Julia Jentsch ("Sophie Scholli viimased päevad"). Elutööpreemia sai sir Sean Connery

  18. "No More Excuses": Michael M. Crow on Analytics (United States)

    Crow, Michael M.


    Michael M. Crow became the 16th president of Arizona State University in July 2002, with the goal of transforming ASU into what he calls a "New American University"--an institution combining the highest levels of academic excellence, inclusiveness to a broad demographic, and maximum societal impact. His view included increasing graduate…

  19. A Good Time: A Conversation with C. Michael Nelson (United States)

    Zabel, Robert; Kaff, Marilyn; Teagarden, Jim


    C. Michael Nelson began his special education career as a teacher of adolescents with learning and behavior disorders. He has worked as a child psychologist and as a professor with the Department of Special Education and Rehabilitation Counseling at the University of Kentucky. He coordinated the graduate Personnel Preparation Program for Teachers…

  20. Michael hydratase alcohol dehydrogenase or just alcohol dehydrogenase?

    NARCIS (Netherlands)

    Resch, V.A.; Jin, J.; Chen, B.S.; Hanefeld, U.


    The Michael hydratase – alcohol dehydrogenase (MhyADH) from Alicycliphilus denitrificans was previously identified as a bi-functional enzyme performing a hydration of α,β-unsaturated ketones and subsequent oxidation of the formed alcohols. The investigations of the bi-functionality were based on a s

  1. SuchThatCast Episode 6: Michael Boylan

    NARCIS (Netherlands)

    Søraker, J.H.


    Michael Boylan is the John J. McDonnell jr chair in Ethics, and professor and chair of the philosophy department at Marymount University in Arlington, Virginia. In addition to being a poet and novelist, he has written more than 100 published articles and 25 books primarily in ethics, social and poli

  2. Insight into the Mechanism of the Michael Reaction. (United States)

    Giraldo, Carolina; Gómez, Sara; Weinhold, Frank; Restrepo, Albeiro


    The mechanism for the nucleophilic addition step of the Michael reaction between methanethiol as a model Michael donor and several α-substituted methyl acrylates (X=F, Cl, Me, H, CN, NO2 ) as model Michael acceptors is described in detail. We suggest a novel way to condense electrophilic Fukui functions at specific atoms in terms of the contributions from the atomic orbitals to the LUMO or, more generally, to the orbital controlling the reaction. This procedure correctly associates activation energies to local electrophilic Fukui indices for the cases treated in this work. The calculated reaction barriers strongly depend on the nature of the substituent. As a general rule, activation energies are governed by structural changes, although electronic factors are significant for electron-withdrawing groups. Nucleophilic addition to Michael receptors is best described as a highly nonsynchronous process, in which the geometry of the transition state comprises a nonplanar six-membered ring. Formation of the S⋅⋅⋅C bond, which defines the interaction between the reactants, progresses ahead of all other primitive processes in the early stages of the transformation. In view of our results, we postulate that highly complex chemical reactions, as is the case for the nucleophilic addition step studied herein, that involve cleavage/formation of a total of six bonds, lower their activation energies by favoring nonsynchronicity, that is, for these types of systems, primitive changes should advance at different rates.

  3. Professor Porter ja tema viis konkurentsitegurit / Michael E Porter

    Index Scriptorium Estoniae

    Porter, Michael E


    Maailmas tuntud juhtimisguru Michael Porter viie konkurentsijõu teooriast ja selle rakendatavusest erinevates valdkondades. Lisad: Erinevused valdkondade kasumlikkuses; 5 määravat konkurentsijõudu; Investeeritud kapitali keskmine tasuvus; Mõnede USA tegevusvaldkondade kasumlikkus; Valdkonnaanalüüs praktikas; Valdkonna määratlemine; Valdkonnaanalüüsi sammud

  4. Tweeting Prayers and Communicating Grief over Michael Jackson Online (United States)

    Sanderson, Jimmy; Cheong, Pauline Hope


    Death and bereavement are human experiences that new media helps facilitate alongside creating new social grief practices that occur online. This study investigated how people's postings and tweets facilitated the communication of grief after pop music icon Michael Jackson died. Drawing on past grief research, religion, and new media studies, a…

  5. Immigration and Social Systems : Collected Essays of Michael Bommes



    Popular science Michael Bommes (hoogleraar Sociologie en Migratieonderzoek) was een van de meest briljante en originele geleerden in zijn vakgebied. Deze postume bundel bevat een selectie van zijn belangrijkste werk over immigratie en de verzorgingsstaat, de integratie van immigranten, discriminatie, illegale migratie, migrantennetwerken en migratiebeleidsonderzoek. Deze bundel laat zien hoe Bommes' inzichten en deskundigheid een fundamentele bijdrage hebben geleverd aan immigratiestudies....

  6. Domino Michael-Michael and Aldol-Aldol Reactions: Diastereoselective Synthesis of Functionalized Cyclohexanone Derivatives Containing Quaternary Carbon Center. (United States)

    Ghorai, Manas K; Halder, Sandipan; Das, Subhomoy


    A simple strategy for the synthesis of highly functionalized cyclohexanone derivatives containing an all-carbon quaternary center from α-(aryl/alkyl)methylidene-β-keto esters or β-diketones via a K-enolate mediated domino Michael-Michael reaction sequence with moderate to good yield and excellent diastereoselectivity (de > 99%) is described. Interestingly, Li-base mediated reaction of α-arylmethylidene-β-diketones affords functionalized 3,5-dihydroxy cyclohexane derivatives as the kinetically controlled products via a domino aldol-aldol reaction sequence with excellent diastereoselectivity. Li-enolates of the β-keto esters or β-diketones undergo facile domino Michael-Michael reaction with nitro-olefins to afford the corresponding nitrocyclohexane derivatives in good yields and excellent diastereoselectivity (de > 99%). The formation of the products and the observed stereoselectivity were explained by plausible mechanisms and supported by extensive computational study. An asymmetric version of the protocol was explored with (L)-menthol derived nonracemic substrates, and the corresponding nonracemic cyclohexanone derivatives containing an all-carbon quaternary center were obtained with excellent stereoselectivity (de, ee > 99%).

  7. Michael Pärt ئ suure muusika taustajõud / Michael Pärt ; interv. Siim Nestor

    Index Scriptorium Estoniae

    Pärt, Michael


    Arvo Pärdi pojast Michael Pärdist. Tema tööst "music editor"-ina - helimonteerijana, tööst muusika produktsiooni, salvestamise ja muusika kirjutamise abijõuna. Koostööst maailmas tuntud muusikutega

  8. Michael Pärt ئ suure muusika taustajõud / Michael Pärt ; interv. Siim Nestor

    Index Scriptorium Estoniae

    Pärt, Michael


    Arvo Pärdi pojast Michael Pärdist. Tema tööst "music editor"-ina - helimonteerijana, tööst muusika produktsiooni, salvestamise ja muusika kirjutamise abijõuna. Koostööst maailmas tuntud muusikutega

  9. Aza-Michael Addition of Isatin and Phthalimide to Symmetrical Fumaric Esters in Ionic Liquid Media

    Institute of Scientific and Technical Information of China (English)

    IMANZADEH Gholam Hassan; MOLLAEI TAVANA Mahdieh; ZAMANLOO Mohammad Reza; MANSOORI Yagoub


    Highly efficient aza-Michael additions of isatin and phthalimide to symmetrical fumaric esters in ionic liquid media to produce the corresponding Michael adducts in excellent yields are described which were performed at 100 ℃ for 1-5 h. The results show that these aza-Michael additions are not effective with fumaric esters containing sterically hindered alkoxy groups.

  10. Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. (United States)

    Sambanthamoorthy, Karthik; Smeltzer, Mark S; Elasri, Mohamed O


    The staphylococcal accessory regulator (sarA) plays a central role in the regulation of virulence in Staphylococcus aureus. To date, studies involving sarA have focused on its activity as a global regulator that modulates transcription of a wide variety of genes (>100) and its role in virulence. However, there is also evidence to suggest the existence of accessory elements that modulate SarA production and/or function. A reporter system was developed to identify such elements, and a new gene, msa (SA1233), mutation of which results in reduced expression of SarA, was identified and characterized. Additionally, it was shown that mutation of msa resulted in altered transcription of the accessory gene regulator (agr) and the genes encoding several virulence factors including alpha toxin (hla) and protein A (spa). However, the impact of mutating msa was different in the laboratory strain RN6390 and the clinical isolate UAMS-1. For instance, mutation of msa caused a decrease in spa and hla transcription in RN6390 but had a different effect in UAMS-1. The strain-dependent effects of the msa mutation were similar to those observed previously, which suggests that msa may modulate the production of specific virulence factors through its impact on sarA. Interestingly, sequence analysis of Msa suggests that it is a putative membrane protein with three membrane-spanning regions, indicating that Msa might interact with the environment. The findings show that msa is involved in the expression of SarA and several virulence factors.

  11. Tribute to Professor Anthony J. McMichael

    Directory of Open Access Journals (Sweden)

    Ashwin Swaminathan


    Full Text Available Emeritus Professor A. J. “Tony” McMichael (1942–2014 was an internationally renowned and pioneering Australian academic and advocate in epidemiology, who was passionate about understanding the influences of the environment on human health. In an illustrious career spanning more than four decades, he made significant contributions to the scientific community and policy discourse—including ground-breaking research related to the health of children. McMichael was a prolific academic writer with over 300 peer-reviewed papers; 160 book chapters and two sole-authored books. However, his outstanding talent was for integrating complex and seemingly unrelated strands from the environmental and health sciences into a cohesive narrative—and highlighting its relevance to lay persons, scientists and governments alike. He was instrumental in validating this nascent field of research and inspiring many others to follow his lead.

  12. Double Michael Addition Reaction of Bischalcone under Ultrasound

    Institute of Scientific and Technical Information of China (English)

    LI,Ji-Tai; XU,Wen-Zhi; CHEN,Guo-Feng; LI,Tong-Shuang


    @@ The Michael addition of 1,5-diaryl-1,4-pentadien-3-ones with active methylene compounds has been the subjects of many investigations. Ultrasound has increasingly been used in organic synthesis in the last three decades. Compared with traditional methods, this method is more convenient and easily controlled. A large number of organic reactions can be carried out in higher yield, shorter reaction time or milder conditions under ultrasonic irradiation. KF/Al2O3 as a useful solid supported catalyst has received considerable attention because of their high level of chemoselectivity and environmental compatibility as well as simplicity of operation and their ready availability at low cost. Herein we report the double Michael addition of dibenzalacetone with active methlene compounds such as dimethyl malonate, diethyl malonate,methyl cyanoacetate and ethyl cyanoacetate catalyzed by KF/Al2O3 under ultrasound irradiation.

  13. Tribute to Professor Anthony J. McMichael. (United States)

    Swaminathan, Ashwin; Lucas, Robyn M; Harley, David


    Emeritus Professor A. J. "Tony" McMichael (1942-2014) was an internationally renowned and pioneering Australian academic and advocate in epidemiology, who was passionate about understanding the influences of the environment on human health. In an illustrious career spanning more than four decades, he made significant contributions to the scientific community and policy discourse-including ground-breaking research related to the health of children. McMichael was a prolific academic writer with over 300 peer-reviewed papers; 160 book chapters and two sole-authored books. However, his outstanding talent was for integrating complex and seemingly unrelated strands from the environmental and health sciences into a cohesive narrative-and highlighting its relevance to lay persons, scientists and governments alike. He was instrumental in validating this nascent field of research and inspiring many others to follow his lead.

  14. Pengaruh Tipografi pada Era Massimo Vignelli terhadap Tipografi Michael Bierut

    Directory of Open Access Journals (Sweden)

    Irwan Harnoko


    Full Text Available Massimo Vignelli is a senior graphic designer lived in New York, as a vocal modernism against postmodernism. His statement firmly opposing post-modernism in several occasions: interview in Helvetica the movie, type radio, talk show, and some articles in Looking Closer or AIGA Journal. Graphic design works of Massimo Vignelli reflected his characteristic, which is firmly choosing typeface. Typefaces of Vignelly are around 5 typefaces: Bodoni, Helvetica, Times Roman, Century, and Futura. The article uses formal analysis method. The writers collected materials about Michael Bierut, Massimo VIgnelli and Tibor Kalman from books and websites. The writers compare the typeface opinion of Massimo Vignelli (modernism designer, Michael Bierut designer (transition era designer from modernism to post-modernism, and Tibor Kalman (a designer in A Century of Graphic Design, as the influence of Bieruts betrayal over Vignelli.

  15. Pengaruh Tipografi pada Era Massimo Vignelli terhadap Tipografi Michael Bierut

    Directory of Open Access Journals (Sweden)

    Irwan Harnoko


    Full Text Available Massimo Vignelli is a senior graphic designer lived in New York, as a vocal modernism against post-modernism. His statement firmly opposing post-modernism in several occasions: interview in Helvetica the movie, typeradio, talkshow, and some articles in Looking Closer or AIGA Journal. Graphic design works of Massimo Vignelli reflected his characteristic, which is firmly choosing typeface. Typefaces of Vignelly are around 5 typefaces: Bodoni, Helvetica, Times Roman, Century, and Futura. The article uses formal analysis method. The writers collected materials about Michael Bierut, Massimo VIgnelli and Tibor Kalman from books and websites. The writers compare the typeface opinion of Massimo Vignelli (modernism designer, Michael Bierut designer (transition era designer from modernism to post-modernism, and Tibor Kalman (a designer in A Century of Graphic Design, as the influencer of Bierut’s betrayal over Vignelli. 

  16. Euroopa parimaks filmiks sai Michael Haneke "Valge lint" / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016


    Euroopa Filmiakadeemia auhindadest: parima filmiauhinna sai Saksamaal Bochumis toimunud tseremoonial Michael Haneke "Valge lint", mille eest Haneke sai ka parima režissööri ja stsenaristi auhinna. Parimaks meesnäitlejaks pärjati Tahar Rahim ("Un Prophete"), parimaks naisnäitlejaks Kate Winslet ("The Reader"), publikupreemia sai Danny Boyle'i "Rentslimiljonär. Ka teistest võitjatest

  17. The cinema of Michael Bay : an aesthetic of excess


    Bennett, Bruce


    The hyper-kinetic action films of Michael Bay have come to exemplify the commercial, technical and aesthetic transformations of contemporary blockbuster cinema during a period in which the dynamic, disorienting effects of media convergence are reconfiguring viewing practices and remodelling cinematic institutions. However, despite their commercial success and cultural visibility, these films remain more or less absent from academic criticism of late twentieth and early twenty-first century gl...

  18. Analysis of the black crust on Saint Michael's Church (United States)

    Popister, I.; Zeman, A.


    The goal of the present study is to characterize the black crust on the main stone used at Saint Michael's Church in Cluj-Napoca, Romania. The gases in the atmosphere, along with natural and artificial pollutants can cause damage the integrity of the stone when it comes in contact with the stone's chemistry. In order to explain the mechanism of stone decay due to black crust it is necessary to know what "weathering" means, so it must be seen as a complex process that consists of: type of material, the environment in which the material is located, and the amount of time required for the process to take place. Each material has particular properties, due to its composition and genesis. When it comes in contact with the acidity of the "acid rain" (caused by sulphur, nitrogen oxides and carbon dioxide), the rain penetrates into the pore structure, corroding it and "allowing" the atmospheric particles to penetrate the stone. St. Michael's Church is one of the oldest Gothic architectural monuments in Cluj, Romania, being built predominantly from Cenozoic (Upper Eocene) limestone, locally known as the Cluj Limestone. The main quarry was in Baciu, near Cluj. The samples that were collected from the Saint Michael's Church were characterized by means of: optical microscope, Scattering Electronic Microscope, thin sections, EDS The samples that were collected from the Saint Michael's Church went through a series of tests: optical microscope, Scattering Electronic Microscope, thin sections, EDX, and cross-section. The optical microscope analysis of the thin sections revealed that the black crust layer is approximately 0.01mm, and in the sample there are perfectly shaped ooides, which is characteristic to this type of limestone. The SEM analysis shows a resedimentation layer on the surface of the black crust, which occurred probably due to the effect of acid rain. Further information regarding the results of the test will be presented on the poster.

  19. Euroopa parimaks filmiks sai Michael Haneke "Valge lint" / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016


    Euroopa Filmiakadeemia auhindadest: parima filmiauhinna sai Saksamaal Bochumis toimunud tseremoonial Michael Haneke "Valge lint", mille eest Haneke sai ka parima režissööri ja stsenaristi auhinna. Parimaks meesnäitlejaks pärjati Tahar Rahim ("Un Prophete"), parimaks naisnäitlejaks Kate Winslet ("The Reader"), publikupreemia sai Danny Boyle'i "Rentslimiljonär. Ka teistest võitjatest

  20. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation (United States)

    Godwin, Allison; Potvin, Geoff


    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  1. Impact of individual extracellular proteases on Staphylococcus aureus biofilm formation in diverse clinical isolates and their isogenic sarA mutants. (United States)

    Loughran, Allister J; Atwood, Danielle N; Anthony, Allison C; Harik, Nada S; Spencer, Horace J; Beenken, Karen E; Smeltzer, Mark S


    We demonstrate that the purified Staphylococcus aureus extracellular proteases aureolysin, ScpA, SspA, and SspB limit biofilm formation, with aureolysin having the greatest impact. Using protease-deficient derivatives of LAC, we confirmed that this is due to the individual proteases themselves. Purified aureolysin, and to a lesser extent ScpA and SspB, also promoted dispersal of an established biofilm. Mutation of the genes encoding these proteases also only partially restored biofilm formation in an FPR3757 sarA mutant and had little impact on restoring virulence in a murine bacteremia model. In contrast, eliminating the production of all of these proteases fully restored both biofilm formation and virulence in a sarA mutant generated in the closely related USA300 strain LAC. These results confirm an important role for multiple extracellular proteases in S. aureus pathogenesis and the importance of sarA in repressing their production. Moreover, purified aureolysin limited biofilm formation in 14 of 15 methicillin-resistant isolates and 11 of 15 methicillin-susceptible isolates, while dispersin B had little impact in UAMS-1, LAC, or 29 of 30 contemporary isolates of S. aureus. This suggests that the role of sarA and its impact on protease production is important in diverse strains of S. aureus irrespective of their methicillin resistance status.

  2. Michael Marinov memorial volume multiple facets of quantization and supersymmetry

    CERN Document Server

    Vainshtein, A I


    This book is dedicated to the memory of Michael Marinov, the theorist who, together with Felix Berezin, introduced the classical description of spin by anticommuting Grassmann variables. It contains original papers and reviews by physicists and mathematicians written specifically for the book. These articles reflect the current status and recent developments in the areas of Marinov's research: quantum tunneling, quantization of constrained systems, supersymmetry, and others. The personal recollections included portray the human face of M Marinov, a person of great knowledge and integrity.

  3. Michael Kohlhaas or the Germans and Their Law

    Directory of Open Access Journals (Sweden)

    Heike Jung


    Full Text Available Asked to pick a single representative ‘German’ piece for a discourse on ‘Law and Literature’ one almost inevitably ends up with Kleist’s tale Michael Kohlhaas. It seems to be the literary incarnation of the German stance vis-à-vis the law. It is all about horses; it could just as well be about dogs. Kohlhaas fights a devastating battle, using legal means and outright violence, even warfare, for their recovery in good shape. Victorious eventually with his legal actions, he is happy to trade in his own life for this victory, thus giving an extreme example for the nice line between being in the right and pursuing this position with disproportionate rigour. Of course, the interpretations of Michael Kohlhaas (which, in its complete version, dates of 1810 have varied from epoch to epoch as well as from reader to reader. It is not possible to rehearse the bulk of ‘Kohlhaas literature’. In comparing legal cultures, it might be of interest to look into the question why such a somber story on the law forms part and will continue to form part of the German cultural heritage. Si se tiene que elegir un único representante “alemán” para una ponencia sobre “derecho y literatura”, es inevitable optar por la obra de Kleist, Michael Kohlhaas. Parece la encarnación literaria de la posición alemana hacia el derecho. El libro trata de caballos; también podría tratar sobre perros. Kohlhaas libra una batalla devastadora usando medios legales y la violencia pura y dura, incluso la guerra, para que se recuperen en buena forma. Finalmente resulta ganador mediante acciones legales, está contento de dedicar su propia vida para conseguir esta victoria, dando así un ejemplo extremo de la línea que existe entre tener la razón y seguir esta posición con un rigor desproporcionado. Por supuesto, las interpretaciones de Michael Kohlhaas (publicado en 1810 han variado de una época a otra, y de un lector a otro. No es posible revisar el grueso de

  4. Hechter Michael, Horne Christine (Dir., Theories of Social Order

    Directory of Open Access Journals (Sweden)

    Yves Laberge


    Full Text Available Cette anthologie méconnue examine le concept fondamental de l’ordre social en 34 textes tantôt anciens (de Tocqueville, Marx, Engels, Simmel ou relativement récents (le chapitre 19 comparant les groupes humains aux fourmis date de 2007. Ici, l’ordre social est compris de diverses manières ; Michael Hechter et Christine Horne rappellent d’emblée que « sans ordre social, il ne peut y avoir ni agriculture, ni industrie, ni commerce, ni investissement, ni développement économique, ni justice, n...

  5. Estratégia competitiva: Michael Porter 30 anos depois


    Manuel Portugal Ferreira; Fernando A. Ribeiro Serra; Marcelo Lopes Carneiro; Aline Botelho Schneider


    Os estudos de estratégia têm sido muito influenciados pelos trabalhos de Michael Porter, em todas as suas fases, como as cinco forças, as estratégias genéricas, a cadeia de valor e as vantagens competitivas das nações. Neste artigo, analisou-se a influência de Porter nos trabalhos brasileiros em estratégia, a partir dos trabalhos selecionados e apresentados no EnANPAD. No levantamento para a análise dos artigos, considerando 10 anos de EnANPAD (1997-2006), foram selecionados 46 artigos. A ide...

  6. The Correspondence of Michael Faraday Pt 6 1860-1867

    CERN Document Server

    Frank, James


    Michael Faraday (1791-1867) was one of the most important men of science in nineteenth century Britain. His discoveries of electro-magnetic rotations (1821) and electro-magnetic induction (1831) laid the foundations of the modern electrical industry. His discovery of the magneto-optical effect and diamagnetism (1845) led him to formulate the field theory of electro-magnetism, which forms one of the cornerstones of modern physics.These and a whole host of other fundamental discoveries in physics and chemistry, together with his lecturing at the Royal Institution, his work for the state (includi

  7. Glutathione Adduct Patterns of Michael-Acceptor Carbonyls. (United States)

    Slawik, Christian; Rickmeyer, Christiane; Brehm, Martin; Böhme, Alexander; Schüürmann, Gerrit


    Glutathione (GSH) has so far been considered to facilitate detoxification of soft organic electrophiles through covalent binding at its cysteine (Cys) thiol group, followed by stepwise catalyzed degradation and eventual elimination along the mercapturic acid pathway. Here we show that in contrast to expectation from HSAB theory, Michael-acceptor ketones, aldehydes and esters may form also single, double and triple adducts with GSH involving β-carbon attack at the much harder N-terminus of the γ-glutamyl (Glu) unit of GSH. In particular, formation of the GSH-N single adduct contradicts the traditional view that S alkylation always forms the initial reaction of GSH with Michael-acceptor carbonyls. To this end, chemoassay analyses of the adduct formation of GSH with nine α,β-unsaturated carbonyls employing high performance liquid chromatography and tandem mass spectrometry have been performed. Besides enriching the GSH adductome and potential biomarker applications, electrophilic N-terminus functio-nalization is likely to impair GSH homeostasis substantially through blocking the γ-glutamyl transferase catalysis of the first breakdown step of modified GSH, and thus its timely reconstitution. The discussion includes a comparison with cyclic adducts of GSH and furan metabolites as reported in literature, and quantum chemically calculated thermodynamics of hard-hard, hard-soft and soft-soft adducts.

  8. En recuerdo de Michael Heyd (1943-2014

    Directory of Open Access Journals (Sweden)

    Peset, José Luis


    Full Text Available In homage to Professor Michael Heyd, in this paper are presented some of the main influences of his book “Be sober and reasonable” (1995 on several studies about Robert Burton and his classical book The Anatomy of Melancholy. Mainly, the relations between medicine and religious thought are briefly followed, looking for confluences between North and South Europe. The influence of “enthusiasm” and “melancholy” in the history of European thought was always an important interest in the life and teaching of this very intelligent researcher of cultural history.En homenaje al Profesor Michael Heyd, se muestran en este artículo algunas de las influencias principales de su libro “Be sober and reasonable” (1995 en algunos estudios sobre el clásico libro de Robert Burton The Anatomy of Melancholy. En especial, se siguen brevemente las relaciones entre la medicina y el pensamiento religioso, buscando confluencias entre el norte y el sur de Europa. La influencia de “entusiasmo” y “melancolía” en la historia del pensamiento europeo fue siempre un importante interés en la vida y la enseñanza de este muy inteligente investigador en historia cultural.

  9. Asymmetric Michael Addition of Activated Alkenes to Nitro Alkenes Catalyzed by Organic Catalyst

    Institute of Scientific and Technical Information of China (English)

    XUE Dong; CHEN Yong-Chun; CUI Xin; WANG Qi-Wei; ZHU Jin; DENG Jin-Gen


    @@ Enantioselective Michael addition is one of the most powerfulbond-forming reaction in organic synthesis. [1] A mong the Michael acceptors, nitro alkenes are very attractive, because the nitro group is the most electron-withdrawing group known and it can serve as masked functionality to be further transformed after the addition has taken place. [2] Recently, asymmetric Michael reactions catalyzed by organic catalyst have draw much attention.[3

  10. Enantioselective Synthesis of β-(3-Hydroxypyrazol-1-yl)ketones Using An Organocatalyzed Michael Addition Reaction (United States)

    Gogoi, Sanjib; Zhao, Cong-Gui; Ding, Derong


    β-(3-Hydroxypyrazol-1-yl)ketones have been prepared in high yields and excellent enantioselectivities (94–98% ee) via a Michael addition reaction between 2-pyrazolin-5-ones and aliphatic acyclic α,β-unsaturated ketones using 9-epi-9-amino-9-deoxyquinine as the catalyst. These results account for the first example of an aza-Michael addition of the ambident 2-pyrazolin-5-one anion to a Michael acceptor. PMID:19415906

  11. Memoria de la guerra civil española. Entre el sol y la tormenta de Sara Berenguer

    Directory of Open Access Journals (Sweden)

    Helena López


    Full Text Available En este artículo pretendo analizar dos cuestiones en relación con las memorias de guerra de la militante anarquista Sara Berenguer. En primer lugar, quiero atender a las estrategias discursivas (clase, género, sexualidad de construcción de la subjetividad en este texto. Además, me interesa indagar cómo estos discursos se interseccionan con la posición espacio-temporal (tiempo de la memoria y tiempo-espacio del exilio del sujeto autobiográfico. Mi objetivo principal es proponer una problematización de los conceptos de “memoria colectiva” y de “experiencia femenina” y reivindicar, por lo tanto, la relevancia tanto teórica como política de análisis críticos basados en narrativas personales.

  12. BUS 320 Assignment 2: Case Study: Michael Dell—The Man Behind Dell




    BUS 320 Assignment 2: Case Study: Michael Dell—The Man Behind Dell   Click Link Below To Buy: Or Visit   Assignment 2: Case Study: Michael Dell—The Man Behind Dell Presentation (Change Management) Michael Dell began building and selling computers from his dorm room at age 19. He dropped out of the University of Texas when his sales hit $60 million and has nev...

  13. Proline Based Chiral Ionic Liquids for Enantioselective Michael Reaction

    Directory of Open Access Journals (Sweden)

    Kaoru Nobuoka


    Full Text Available Chiral ionic liquids, starting from (S-proline, have been prepared and evaluated the ability of a chiral catalyst. In Michael reaction of trans-β-nitrostyrene and cyclohexanone, all the reactions were carried out under homogeneous conditions without any solvent except for excess cyclohexanone. The chiral ionic liquid catalyst with the positive charge delocalized bulky pyrrolidinium cation shows excellent yields (up to 92%, diastereoselectivities (syn/anti = 96/4, and enantioselectivities (up to 95% ee and could be reused at least three times without any loss of its catalytic activity. Such results demonstrated a promising new approach for green and economic chiral synthesis by using the chiral ionic liquids as a chiral catalyst and a chiral medium.

  14. Profiles in medical courage: Michael Wilkins and the Willowbrook School

    Directory of Open Access Journals (Sweden)

    Robbins RA


    Full Text Available No abstract available. Article truncated at 150 words. “Never doubt that a small group of thoughtful, committed citizens can change the world. Indeed, it is the only thing that ever has. "- Margaret Mead With this article we begin an intermittent series on physicians who displayed courage in trying to help their patients. Although there are many examples, hopefully what will be illustrated are examples of the lesser known doctors who identified problems and stood up to address them. Few remember the controversy surrounding the now closed Willowbrook School and Dr. Michael Wilkins’ involvement. However, Wilkins’ courage in advocating for change not only resulted in substantial improvement in conditions at the school but also led to the Civil Rights of Institutionalized Persons Act (CRIPA of 1980.Wilkins was originally from Kansas City and graduated from the University of Missouri School of Medicine in 1967 (1. He left Missouri to do his pediatric internship and complete his military obligation…

  15. Solvent-free Michael addition reaction of fluorene with chalcon

    Institute of Scientific and Technical Information of China (English)

    Fu Feng


    A series of novel Michael addition products of fluorene to chalcone were obtained in the presence of sodium hydroxide under solvent-free condition. The advantages of this procedure were mild reaction conditions, simple protocol, and high yields. The structures of the products were characterized by IR, 1H NMR, MS and X-ray diffraction. The crystal of the new compound 3 h is y= 64.2440(10)°, V = 2.4137(3) nm3, Z= 4, Dc=1.220 g/cm3, μ = 0.286 mm-1, F(000) = 920, R = 0.0656 and wR = 0.1554 for 5664 observed reflection with I > 2σ(I).

  16. Michael Longley’s Father: Memory, Mourning and History

    Directory of Open Access Journals (Sweden)

    Barry Sloan


    Full Text Available Michael Longley’s father has been a recurring presence in the poet’s work from his earliest to his most recent collection. This paper examines the exceptional strength of that bond reflected in the varied and changing ways in which the poet has responded to it – memorizing and mourning his loss; discovering through his father’s First World War stories a means of memorialising loss of life in contemporary conflicts and a way of facing the history of the twentieth century; confronting his own ageing and sense of mortality; and marking the specific, but also representative, generational history of his family. Close readings of key poems are offered to highlight Longley’s skills in meeting his own exacting standards of aesthetic propriety and moral and social responsibility for writers of elegy in order to avoid either exploitation of tragedy and loss, or facile gestures of consolation.

  17. Michael Tenzer, ed., Analytical Studies in World Music




    Pour Michael Tenzer, professeur de musique à l’Université de Colombie britannique et spécialiste (analyste et interprète) de musique pour gamelan, la réunion des textes proposés dans cet ouvrage a deux objectifs : construire une théorie de la musique dans le monde qui s’émancipe des oppositions entre musiques « classiques » et « populaires », « occidentales » et « non occidentales », c’est-à-dire jeter les bases d’une théorie générale de la musique et, pour ce faire, montrer que l’analyse mus...

  18. A Study of Postmodern Narrative in Michael Cunningham's The Hours

    Directory of Open Access Journals (Sweden)

    Hajar Abbasi Narinabad


    Full Text Available This project aims at providing a detailed analysis of the major features of the theory of postmodern narrative and at going through the novel The Hours by the American writer Michael Cunningham concentrating on some postmodern narrative techniques. To do so, the researcher goes through the theories set forth by some postmodern theoreticians like Roland Barthes, Jacque Derrida, Jean-François Lyotard and Julia Kristeva to investigate the postmodern narrative techniques and elements used in the novel. The researcher first examines the theories and then critically applies them on the novel. The article goes through the most eminent elements of postmodern narrative including intertextuality, stream of consciousness style, fragmentation and representation respectively which are delicately utilized in The Hours. The article concludes by recommending a few directions for the further research.

  19. Asymmetric synthesis of functionalized cyclohexanes bearing five stereocenters via a one-pot organocatalytic Michael-Michael-1,2-addition sequence. (United States)

    Chauhan, Pankaj; Urbanietz, Gregor; Raabe, Gerhard; Enders, Dieter


    A highly stereoselective one-pot procedure involving an enantioselective Michael addition promoted by low loading of an amino-squaramide catalyst followed by an achiral base catalyzed domino Michael-Knoevenagel-type 1,2-addition sequence provides efficient access to fully substituted cyclohexanes bearing five contiguous stereogenic centers in good yields (68-86%) and excellent stereoselectivities (>30 : 1 dr and 96-99% ee).

  20. Estratégia competitiva: Michael Porter 30 anos depois

    Directory of Open Access Journals (Sweden)

    Manuel Portugal Ferreira


    Full Text Available Os estudos de estratégia têm sido muito influenciados pelos trabalhos de Michael Porter, em todas as suas fases, como as cinco forças, as estratégias genéricas, a cadeia de valor e as vantagens competitivas das nações. Neste artigo, analisou-se a influência de Porter nos trabalhos brasileiros em estratégia, a partir dos trabalhos selecionados e apresentados no EnANPAD. No levantamento para a análise dos artigos, considerando 10 anos de EnANPAD (1997-2006, foram selecionados 46 artigos. A identificação e seleção dos artigos envolveram os seguintes critérios: busca complementar por palavra-chave Porter na base de dados do EnANPAD; avaliação dos títulos e resumos dos artigos apresentados na área de estratégia entre 1997 e 2006, bem como na íntegra quando necessário. Procedeu-se também à análise das referências utilizadas nos artigos e o posicionamento dos autores em relação às tipologias de Porter. Como resultado, verificou-se que Michael Porter é um autor com grande influência nas pesquisas acadêmicas de estratégia. Seus estudos mais utilizados são os da análise da indústria e das estratégias genéricas, e também se verificou que a maioria dos estudos analisados é favorável aos seus conceitos, mesmo existindo pesquisas contrárias.

  1. Domino Mukaiyama-Michael reactions in the synthesis of polycyclic systems

    NARCIS (Netherlands)

    Sarabèr, F.C.E.; Dratch, S.; Bosselaar, G.; Jansen, B.J.M.; Groot, de Æ.


    Good results were obtained in the Mukaiyama-Michael reaction of the silyl enol ether of cyclohexanone with 2-methyl-2cyclopentenone and carvone, with transfer of the silyl group to the receiving enone and with TrSbCl6 as catalyst. A second Mukaiyama-Michael reaction of this new silyl enol ether with

  2. Asymmetric Michael Reaction of Malononitrile Catalyzed by Chiral Ru(Ⅱ) Complex and Achiral Base

    Institute of Scientific and Technical Information of China (English)

    MA Ya-Ping; XING Zhi-Kui; ZHU Jin; CUI Xin; CUN Lin-Feng; DENG Jin-Gen


    @@ Michael addition reactions represent one of the most important carbon-carbon bond forming reactions in modern synthetic organic chemistry. [1 ~3] We achieved catalytic enantioselective Michael addition reactions of malononitrile with chiral vicinal diamine-Ru(Ⅱ) complex in the presence of achiral base. High yields and moderate ee were observed.

  3. 75 FR 22436 - Michael Williams-Control Exemption-St. Maries River Railroad, Inc. (United States)


    ... Surface Transportation Board Michael Williams-Control Exemption-St. Maries River Railroad, Inc. Michael Williams (applicant),\\1\\ a noncarrier, has filed a verified notice of exemption to acquire control of St... from STMA's parent, Potlatch Land & Lumber, LLC, by Williams Group, Inc. (WG).\\2\\ Applicant...

  4. Domino Mukaiyama-Michael reactions in the synthesis of polycyclic systems

    NARCIS (Netherlands)

    Sarabèr, F.C.E.; Dratch, S.; Bosselaar, G.; Jansen, B.J.M.; Groot, de Æ.


    Good results were obtained in the Mukaiyama-Michael reaction of the silyl enol ether of cyclohexanone with 2-methyl-2cyclopentenone and carvone, with transfer of the silyl group to the receiving enone and with TrSbCl6 as catalyst. A second Mukaiyama-Michael reaction of this new silyl enol ether with

  5. A Response to Michael Newman's "Calling Transformative Learning into Question: Some Mutinous Thoughts" (United States)

    Cranton, Patricia; Kasl, Elizabeth


    This article presents the authors' response to Michael Newman's "Calling Transformative Learning into Question: Some Mutinous Thoughts". The authors begin by noting their appreciation of Michael Newman's challenge to transformative learning theory. In their response, the authors review and comment on the fatal flaws presented by Newman and then…

  6. Markets, Marx, Modernity and Mathematics Education: A Response to Michael Apple. (United States)

    Gates, Peter

    This paper is a response to Michael Apple's paper, "What Postmodernists Forget: Cultural Capital and Official Knowledge." The paper advocates Michael's identification of the current dangers and processes of the growth of new right ideologies in the development of subjectivity, society, and education. The differences in success in the education…

  7. Feminism and Faith: Exploring Christian Spaces in the Writing of Sara Maitland and Michèle Roberts

    Directory of Open Access Journals (Sweden)



    Full Text Available En 1983, les féministes britanniques Sara Maitland et Jo Garcia ont publié Walking on the Water (London : Virago, une collection d’essais, de récits, de poèmes et de photos produits par des femmes sur le thème de la spiritualité. Les contributrices ont été en particulier invitées à explorer la relation entre leur identité féministe et leurs croyances religieuses. Le ton de ces contributions varie fortement, allant de l’envie passionnée de concilier les objectifs du féminisme avec le christianisme à un rejet total de l’Eglise comme institution patriarcale suprême. Cet article met en dialogue des récits diamétralement opposés du rapport entre christianisme et féminisme en s’intéressante plus particulièrement à deux des contributrices, Sara Maitland (1950 - et Michèle Roberts (1949 - . Ces deux écrivaines, qui se sont activement impliquées dans les mouvements féministes des années 1970, ont toutes deux lutté pour se réconcilier avec leur héritage chrétien. Néanmoins, alors que Maitland tente essentiellement de revisiter le christianisme en y incorporant les points essentiels d’une idéologie féministe, Roberts sent le besoin impérieux de se défaire de son identité religieuse afin de devenir indépendante ; en effet, dans son autobiographie Paper Houses (2007 elle décrit son éducation catholique comme “autoritaire et misogyne” (16. Cet article explore les façons dont l’identité spirituelle se construit dans le jeu complexe des interactions entre féminisme et foi. Il se propose, dans une perspective comparatiste, d’analyser d’une part le recueil de nouvelles de Sara Maitland intitulé A Book of Spells, et d’autre part, le roman acclamé de Michèle Roberts, Daughters of the House. Dans ces écrits, Maitland et Roberts ont un objectif commun qui est de renégocier la place des femmes dans l’histoire chrétienne dont elles reconnaissent – il est vrai à partir de perspectives diff

  8. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis‐dependent release of eDNA

    DEFF Research Database (Denmark)

    Christner, Martin; Heinze, Constanze; Busch, Michael;


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant‐associated infections. Nonetheless, large proportions of invasive Staphylococcus epidermidis isolates fail to form a biofilm in vitro. We here tested the hypothesis that this apparent paradox is related...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via overexpression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  9. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Diego O Andrey

    Full Text Available Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1, encoded by tst(H, and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1, RNAIII, rot, and the alternative stress sigma factor sigB (σB. By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  10. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus. (United States)

    Andrey, Diego O; Jousselin, Ambre; Villanueva, Maite; Renzoni, Adriana; Monod, Antoinette; Barras, Christine; Rodriguez, Natalia; Kelley, William L


    Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1), encoded by tst(H), and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1), RNAIII, rot, and the alternative stress sigma factor sigB (σB). By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  11. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014). Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.


    Florencia Henshaw


    This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  12. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014. Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.

    Directory of Open Access Journals (Sweden)

    Florencia Henshaw


    Full Text Available This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  13. Women Empowerment in the Realms of Institutionalized Religion and Patriarchy: El Saadawi’s Firdaus and Yezierska’s Sara as Examples

    Directory of Open Access Journals (Sweden)

    Abdullah K. Shehabat


    Full Text Available This paper explains how the two protagonists, Firdaus and Sara, successfully paved their own ways in search of self-liberation despite the authoritarian patriarchy and institutionalized religions that plagued them. El Saadawi's Woman at Point Zero and Yezierska’s Bread Givers represent the fruitful struggle these protagonists experienced as they come to forge an identity and be themselves. The paper argues that the protagonists manage to free themselves, establish their own spiritual homes at their own homes and assert the potentials of their femininity despite their endings. Empowered by the powers of reading, strong will and meticulous work, the protagonists were able to realize their own material independence and achieve their lifelong ambitions. However, through Firdaus' and Sara's journeys of breaking their silence, they were subject to different patterns of self-annihilation. While Firdaus was sentenced to death for killing a pimp, Sara embraced living under the hegemony of an authoritarian husband.      Keywords: Women empowerment, authoritarian patriarchy, institutionalized and/or gendered religion, spiritual feminist homes

  14. Decision-making model of apparel suppliers based on Markowitz's risk theory and utility function%基于Markowitz风险和效用理论的服装供应商决策模型

    Institute of Scientific and Technical Information of China (English)

    季晓芬; 陈炜; 蔡丽玲; 胡觉亮; 徐蓉蓉


    Due to the complexity of apparel supply chain and the characteristics of apparel suppliers, the costs and risks associated with material purchasing and apparel processing of apparel enterprises are difficult to be predicted accurately. So, an optimized decision-making model of apparel suppliers considering the risk may help enterprises to select correct suppliers. The apparel suppliers could be divided into raw material suppliers and garment processing factories. Then, according to the mean-variance theory, the expected cost and combined risk of suppliers were described. Furthermore, with the complete constraints, the decision-making optimization model was established which aimed at minimizing the costs and risks of suppliers. The risk aversion coefficient was proposed by Markowitz's risk price theory. This method combining the utility function reflected the risk preferences of decision makers objectively. Practical examples demonstrating the effectiveness of the model were given.%由于服装供应链的复杂性和供应商特点,服装企业原料采购和成衣加工成本及风险很难准确预测,建立考虑风险的供应商优化决策模型有助于企业做出正确的供应商选择.将服装供应商分为原料供应商和成衣加工厂2类,借鉴均值-方差理论刻画供应商的期望成本和组合风险,并较为全面地设定了约束条件,构建以选择供应商成本和风险最小化为目标的优化决策模型.通过Markowitz风险价格确定模型中的风险回避系数,该方法结合了决策者效用函数,较为真实地反映了决策者的风险偏好.最后通过实例分析,验证了模型的有效性.

  15. 77 FR 30047 - Notice of Opportunity for Public Comment on Surplus Property Release at Michael J Smith Field... (United States)


    ... Michael J Smith Field, Beaufort, NC AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice... approximately 7.5 acres of airport property, located at the Michael J Smith Field, be used for aeronautical... Authority to release approximately 7.5 acres of airport property at the Michael J Smith Field. The...

  16. 75 FR 62635 - Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program... (United States)


    ... AFFAIRS Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program... needed to determine patients' satisfaction with services provided by or through the Michael E. DeBakey.... Title: Patient Satisfaction Survey Michael E. DeBakey Home Care Program, VA Form 10-0476. OMB...

  17. A Musical Italy: Michael W. Balfe’s Italian Experiences

    Directory of Open Access Journals (Sweden)

    Basil Walsh


    Full Text Available The Dublin-born musician, Michael W. Balfe, was a singer, composerand conductor whose brilliant musical career was heavily influenced byformative experiences in Italy. In 1825, Balfe, interested in broadeninghis musical studies first went to Paris where he was introduced to thegreat composers, Luigi Cherubini and Gioachino Rossini, who took apersonal interest in him and his musical talents. On the advice of Rossinihe spent the next few years in Italy studying singing with the famousRossini singer, Filippo Galli, and taking music composition lessonsfrom Ferdinando Paer, in Rome. Later in Milan he studied harmonyand counterpoint with Vincenzo Federici. By 1831, when he was only23 years old, his first three operas had been produced in Palermo, Pavia,and Milan. He returned to London in August 1835, participatingwith the great Lablache, Tamburini, Rubini and Grisi in a concert inVauxhall Gardens. In 1834 he made his debut at La Scala, Milan, singingopposite the renowned mezzo-soprano, Maria Malibran in Rossini’sOtello. He appeared again with Malibran in Venice early in 1835,singing once more in Rossini and Bellini operas. Balfe worked as a singerand composer throughout the Italian peninsula/states during the years,1825-1835 and this article will chart these experiences and demonstratehow the time he spent in Italy and the people he met, influenced hislife and later career as an important and popular European composer.

  18. El fetiche etnográfico de Michael Taussig

    Directory of Open Access Journals (Sweden)

    Matthew Carlin


    Full Text Available El antropólogo Michael Taussig ha producido una gran cantidad de trabajo etnográfico sobre América Latina en el que toma por objeto la universalidad de la cultura burguesa y en el que, al reorientar la mirada del etnógrafo hacia los elementos embriagantes y orgiásticos de la vida, atenúa las líneas que dividen ciencia y arte. En este ensayo tengo la intención de mostrar lo siguiente: 1 que sus etnografías sobre magia, violencia y el Es-tado, están enraizadas en su priorización del mundo fenomenológico y en una concepción materialista en deuda con la teoría estética alemana del si-glo XIX y con la antropología especulativa de Karl Marx y Walter Benjamin; 2 que su proyecto etnográfico no consiste en la eliminación de la ciencia del ámbito de la etnografía, sino en disminuir el papel de la explicación en favor de una forma de escritura que, como el arte, trabaja para refundar las imágenes del mundo.

  19. Michael Field’s “A Dance of Death”

    Directory of Open Access Journals (Sweden)

    LeeAnne Richardson


    Full Text Available The 1912 poem "A Dance of Death" by Michael Field (pen name of Katherine Bradley and her niece Edith Cooper depicts Salome in an alternate version of the biblical story: this Salome dances on a frozen river, falls through the ice, and is decapitated on a jagged edge. Nonetheless, her beautiful head continues dancing over the frozen river. This poem is highly unusual, especially in the context of the other poems in the postconversion volume Poems of Adoration, because it questions, rather than submits to, authority. In re-writing a familiar Christian tale, as well as a familiar decadent theme, Field uses the poem to assert the supremacy of their artistic vision, which (despite their ardent Catholicism cannot be subject to any law outside themselves. Like the continually dancing head of Salome, which continues to create beauty even after nature (and perhaps God has struck it down, the poet is subjugate only to her own law and creates without boundaries or restrictions on her art. Bradley and Cooper were acutely aware of their authorial persona (actively taking not only a masculine but also a singular poetic identity, and their mode of reconciling the apparent contradictions of this identity are mirrored in their presentation of Salome in a "Dance of Death."

  20. Subjetividade e defesa na obra de Michael Balint

    Directory of Open Access Journals (Sweden)

    Renata Mello


    Full Text Available Currently we can observe the diffusion of the so-called tough patients in psychoanalytic clinic. These patients have proven resistant to the classic psychoanalysis technique, leading to the necessity of relying on their psychic dynamics, aiming at a broader understanding of what is at stake in these cases. It can be observed that the subjectivation process relates to a precocious traumatic experience that touches the relation of the individual with what is external to him. Because of the overwhelming intensity provoked by the trauma, elementary protection measures are mobilized in order to prevent a narcissistic collapse. The defense then becomes the preferred way through which psychism constitutes itself, which translates into a meaningful impoverishment of subjective life. In an attempt to understand this dynamic and propose a direction for the psychic treatment, we will resort to Michael Balint¿s ideas about primary object relations, as his thinking offers important elements for a renewal of the understanding of both the analytical practice and the very psychic dynamic we currently see. In regards to Balint¿s ideas, we will hold on to his primary love theory and to the question of the modalities of defensive links - ocnophilia and philobatism - given the lack of loving of the primordial objects, ideas that can provide subsidies to deal with these tough patients.

  1. Alle soglie dell'osceno. Poetiche della profanazione in Sara de Ibáñez e Alejandra Pizarnik

    Directory of Open Access Journals (Sweden)

    Luca Salvi


    Full Text Available Moving from Adorno’s statement about the enigmatic nature of modern aesthetics, this paper aims to analyse the forms the enigma takes in the works of the Uruguayan and Argentinian poets Sara de Ibáñez and Alejandra Pizarnik. The essay will consider the figures and the shapes of the enigma as they appear in both poetries. Proper of the revelation of the enigma through its profanation by the poetic language is, in fact, the never-ending and mutual reflection of two different states of the being. Through Martin Heidegger and Giorgio Agamben’s studies on language and negativity, the way in which the enigmatic word appears continuously in its constitutive suspension between infancy and adulthood, absence of time and history, language and silence, the Self and the Other will be revealed. Through the resulting dichotomy of matter and form, emerging from a passage of Agostino’s De natura boni, it will be possible, in conclusion, to recognise in the silent form of the enigma the embryonic proposal of a poetical ethics of writing.

  2. Unsymmetric ordering using a constrained Markowitz scheme

    Energy Technology Data Exchange (ETDEWEB)

    Amestoy, Patrick R.; Xiaoye S.; Pralet, Stephane


    We present a family of ordering algorithms that can be used as a preprocessing step prior to performing sparse LU factorization. The ordering algorithms simultaneously achieve the objectives of selecting numerically good pivots and preserving the sparsity. We describe the algorithmic properties and challenges in their implementation. By mixing the two objectives we show that we can reduce the amount of fill-in in the factors and reduce the number of numerical problems during factorization. On a set of large unsymmetric real problems, we obtained the median reductions of 12% in the factorization time, of 13% in the size of the LU factors, of 20% in the number of operations performed during the factorization phase, and of 11% in the memory needed by the multifrontal solver MA41-UNS. A byproduct of this ordering strategy is an incomplete LU-factored matrix that can be used as a preconditioner in an iterative solver.

  3. Eesti disain on kõva, ent see tuleb moondada ekspordiks / Michael Thomson ; interv. Urmas Oja

    Index Scriptorium Estoniae

    Thomson, Michael


    Euroopa Disainiassotsiatsioonide Liidu presidendi ja Tallinnas toimunud festivali Disainiöö Eesti disainiauhinna Bruno žürii juhi Michael Thomsoni arvamus eesti disainist ning disainipoliitika vajalikkusest Eestis. Auhinnasaajate nimekiri

  4. Theory and practice in action: the contributions of Michael Perkins to clinical linguistics. (United States)

    Damico, Jack S; Lynch, Karen E


    This article reviews the scholarly contributions of Michael R. Perkins in the discipline of clinical linguistics and provides some indication of the reasons that he has been so successful. Three primary attributes were described through an analysis of his publications.

  5. Tõsine fotoelamus Dubrovnikus / Wade Goddard, Heidi Levine, Michael Robinson Chaver ; interv. Ahto Külvet

    Index Scriptorium Estoniae

    Goddard, Wade


    Dubrovniku vanalinnas asub Sõjafotokeskus. Intervjuu keskuse asutaja, kanadalasest fotograafi Wade Goddardi ja kahe seal augustis avatud näitusel osalenud fotograafi Heidi Levine'i ja Michael Robinson Chavez'iga. Sõjafotograafi tööst

  6. Reports of the working groups / Eino Tamm, Sahlin Michael, Valve Kirsipuu...[jt.

    Index Scriptorium Estoniae


    Töögruppide "EU enlargement and relevant institutional reforms" (juhatajad Eino Tamm, Michael Sahlin) ja "Maintaining of competitiveness of Estonia and other candidate countries" (juhatajad Valve Kirsipuu, Terry Calbom) tööst. Autor: Reformierakond

  7. Tõsine fotoelamus Dubrovnikus / Wade Goddard, Heidi Levine, Michael Robinson Chaver ; interv. Ahto Külvet

    Index Scriptorium Estoniae

    Goddard, Wade


    Dubrovniku vanalinnas asub Sõjafotokeskus. Intervjuu keskuse asutaja, kanadalasest fotograafi Wade Goddardi ja kahe seal augustis avatud näitusel osalenud fotograafi Heidi Levine'i ja Michael Robinson Chavez'iga. Sõjafotograafi tööst

  8. High Blood Cholesterol Q&A Dr. Michael Lauer | NIH MedlinePlus the Magazine (United States)

    ... high cholesterol research. Dr. Michael Lauer and his wife, Dr. Robin Avery, agree on the health benefits ... trial of the drug methotrexate in high-risk patients with vascular disease. We have come to appreciate ...

  9. Chiral Aminophosphines as Catalysts for Enantioselective Double-Michael Indoline Syntheses

    Directory of Open Access Journals (Sweden)

    Ohyun Kwon


    Full Text Available The bisphosphine-catalyzed double-Michael addition of dinucleophiles to electron-deficient acetylenes is an efficient process for the synthesis of many nitrogen-containing heterocycles. Because the resulting heterocycles contain at least one stereogenic center, this double-Michael reaction would be even more useful if an asymmetric variant of the reaction were to be developed. Aminophosphines can also facilitate the double-Michael reaction and chiral amines are more readily available in Nature and synthetically; therefore, in this study we prepared several new chiral aminophosphines. When employed in the asymmetric double-Michael reaction between ortho-tosylamidophenyl malonate and 3-butyn-2-one, the chiral aminophosphines produced indolines in excellent yields with moderate asymmetric induction.

  10. Dr. Michael DeBakey "is a magician of the heart…" (United States)

    ... of Baylor's new Michael E. DeBakey Library and Museum. In a lengthy Christmas Day interview that year ... blood circulation. — 1706 Raymond de Vieussens, a French anatomy professor, first describes the structure of the heart's ...

  11. Reports of the working groups / Eino Tamm, Sahlin Michael, Valve Kirsipuu...[jt.

    Index Scriptorium Estoniae


    Töögruppide "EU enlargement and relevant institutional reforms" (juhatajad Eino Tamm, Michael Sahlin) ja "Maintaining of competitiveness of Estonia and other candidate countries" (juhatajad Valve Kirsipuu, Terry Calbom) tööst. Autor: Reformierakond

  12. Trimethylsilylethynyl ketones as surrogates for ethynyl ketones in the double Michael reaction. (United States)

    Holeman, Derrick S; Rasne, Ravindra M; Grossman, Robert B


    Trimethylsilylethynyl ketones can be desilylated in the presence of a tethered carbon diacid and induced to undergo a double Michael reaction in situ. The trimethylsilylethynyl ketones can serve as surrogates of ethynyl ketones that are difficult to prepare or isolate.

  13. A Conversation with his Honour Chief Judge Michael Rozenes AO County Court of Victoria

    Directory of Open Access Journals (Sweden)

    Michael Rozenes


    Full Text Available VULJ Editors and invited students interviewed the Chief Judge of the County Court of Victoria, His Honour Michael Rozenes AO QC, on Tuesday 19 August 2014 at the College of Law & Justice, Victoria University.

  14. L-prolinol as a highly enantioselective catalyst for Michael addition of cyclohexanone to nitroolefins. (United States)

    Chua, Pei Juan; Tan, Bin; Zeng, Xiaofei; Zhong, Guofu


    Though many chiral amines such as l-proline and its derivatives have proven to be versatile catalysts in many reactions, L-prolinol was seldom used as organocatalyst for reactions. Herein, we report the first L-prolinol catalyzed asymmetric Michael addition of cyclohexanone to nitroolefins in the presence of benzoic acid to afford Michael adducts with high diastereoselectivities (87:13->99:1) and enantioselectivities (82-96%).

  15. A post-Byzantine creation: The archangel Michael triumphant and psychopomp

    Directory of Open Access Journals (Sweden)

    Leontakianakou Irini


    Full Text Available This paper deals with a specific iconographic type of Archangel Michael: he is shown bearing a soul in the form of a swaddled infant, while subduing an old man who is wearing only a loincloth. Who is Michael subduing? Three possible answers are considered: 1 the figure can be identified with Satan the fallen angel who, like Michael, has an immaterial nature and is commonly considered as his enemy par excellence; 2 he can also be an anonymous sinner, whose soul is depicted in Michael's hand; 3 finally, one could identify him with Hades, the god of the Underworld and personification of death, because he is depicted as an old man, semi-nude with a pronounced musculature, as well as because of the assimilation of Michael to God. Rather than making a single choice, the author proposes a combined interpretation of the image, which allows for the integration of all the aspects of Michael's cult (military, triumph over Satan, psychopomp, archangel of the Last Judgment and unifies the past (the fall of Satan, the present (death of a sinner and the future (Last Judgment.

  16. Beta-lactams interfering with PBP1 induce Panton-Valentine leukocidin expression by triggering sarA and rot global regulators of Staphylococcus aureus. (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression.

  17. β-Lactams Interfering with PBP1 Induce Panton-Valentine Leukocidin Expression by Triggering sarA and rot Global Regulators of Staphylococcus aureus ▿ (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L.; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression. PMID:21502633

  18. The comparison of naturally weathered oil and artificially photo-degraded oil at the molecular level by a combination of SARA fractionation and FT-ICR MS

    Energy Technology Data Exchange (ETDEWEB)

    Islam, Ananna; Cho, Yunju [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Yim, Un Hyuk; Shim, Won Joon [Oil and POPs Research Group, Korea Institute of Ocean Science and Technology, Geoje 656-834 (Korea, Republic of); Kim, Young Hwan [Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of); Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Sunghwan, E-mail: [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of)


    Highlights: • Weathered oils from the Hebei Spirit oil spill and photo degraded oils are compared. • We investigate changes of polar species at the molecular level by 15T FT-ICR MS. • Significant reduction of sulfur class compounds in saturates fraction is observed. • The relative abundance of protonated compounds (presumably basic nitrogen compounds) increase after degradation. • Changes of polar compounds occurred by natural and photo degradation are similar. -- Abstract: Two sets of oil samples, one obtained from different weathering stages of the M/V Hebei Spirit oil spill site and the other prepared by an in vitro photo-degradation experiment, were analyzed and compared at the molecular level by atmospheric pressure photo-ionization coupled with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS). For a more detailed comparison at the molecular level, the oil samples were separated into saturate, aromatic, resin, and asphaltene (SARA) fractions before MS analysis. Gravimetric analysis of the SARA fractions revealed a decreased weight percentage of the aromatic fraction and an increased resin fraction in both sets of samples. Molecular-level investigations of the SARA fractions showed a significant reduction in the S{sub 1} class in the saturate fraction and increase of S{sub 1}O{sub 1} class compounds with high DBE values in resin fraction. Levels of N{sub 1} and N{sub 1}O{sub 1} class compounds resulting in protonated ions (presumably basic nitrogen compounds) increased after degradation compared to compounds generating molecular ions (presumably non-basic nitrogen compounds). This study revealed changes occurring in heteroatom polar species of crude oils such as sulfur and nitrogen containing compounds that have not been easily detected with conventional GC based techniques.

  19. The CHINA CONNECTION: Michael Rossmann and his first encounter with me

    Institute of Scientific and Technical Information of China (English)

    Jia-huai Wang


    @@ "We would have never belived it, if it were not told by Dorothy Hodgkin," Michael Rossmann of Purdue University said to me. He was referring to what the late Nobel laureate Dorothy Hodgkin announced in an international meeting about the achievements of Chinese scientists in determining the crystal structure of insulin in early 70's. This significant contribution occurred at the time when China was still deeply entangled in the chaos of the Cultural Revolution, while even in the international community there were less than a dozen protein structures solved by scientists (Michael included) from a handful of countries. Michael and I sat in his cozy dinning room. While enjoying a breakfast with his favorite applesauce,observing a wild rabbit sneaking underneath the bush in the garden, we had a long chat. That was dudng my first visit to his lab in West Lafayette in 1980.

  20. Aza-Michael Mono-addition Using Acidic Alumina under Solventless Conditions

    Directory of Open Access Journals (Sweden)

    Giovanna Bosica


    Full Text Available Aza-Michael reactions between primary aliphatic and aromatic amines and various Michael acceptors have been performed under environmentally-friendly solventless conditions using acidic alumina as a heterogeneous catalyst to selectively obtain the corresponding mono-adducts in high yields. Ethyl acrylate was the main acceptor used, although others such as acrylonitrile, methyl acrylate and acrylamide were also utilized successfully. Bi-functional amines also gave the mono-adducts in good to excellent yields. Such compounds can serve as intermediates for the synthesis of anti-cancer and antibiotic drugs.

  1. Michael Goodsite gæsteprofessor på Thunderbird School of Global Management

    DEFF Research Database (Denmark)

    Pedersen, Jens Christian


    Professor Michael Goodsite er blevet udnævnt til "Visiting Professor of Global Processes and Senior Research Fellow in Climate Strategy" ved Thunderbird School of Global Management, som har verdens højst rangerede MBA uddannelse inden for international handel.......Professor Michael Goodsite er blevet udnævnt til "Visiting Professor of Global Processes and Senior Research Fellow in Climate Strategy" ved Thunderbird School of Global Management, som har verdens højst rangerede MBA uddannelse inden for international handel....

  2. Beyond the techno-thriller: Michael Crichton and societal issues in science and technology


    Stengler, E.


    Michael Crichton is primarily known for being an outstanding writer of techno-thrillers and co-creator of the genre. In this paper I suggest that his fictional works can and should be considered under the deeper and wider perspective of his concern for societal issues regarding science and technology with a profound consideration of their effects and on the life of people and the development of society.\\ud \\ud In fact this defining feature of his work is inclusive of numerous works by Michael...

  3. Copper-catalyzed asymmetric conjugate addition of organometallic reagents to extended Michael acceptors

    Directory of Open Access Journals (Sweden)

    Thibault E. Schmid


    Full Text Available The copper-catalyzed asymmetric conjugate addition (ACA of nucleophiles onto polyenic Michael acceptors represents an attractive and powerful methodology for the synthesis of relevant chiral molecules, as it enables in a straightforward manner the sequential generation of two or more stereogenic centers. In the last decade, various chiral copper-based catalysts were evaluated in combination with different nucleophiles and Michael acceptors, and have unambiguously demonstrated their usefulness in the control of the regio- and enantioselectivity of the addition. The aim of this review is to report recent breakthroughs achieved in this challenging field.

  4. A Greener, Efficient Approach to Michael Addition of Barbituric Acid to Nitroalkene in Aqueous Diethylamine Medium

    Directory of Open Access Journals (Sweden)

    Hany J. Al-Najjar


    Full Text Available An efficient method for the synthesis of a variety of pyrimidine derivatives 3a–t by reaction of barbituric acids 1a,b as Michael donor with nitroalkenes 2a–k as Michael acceptor using an aqueous medium and diethylamine is described. This 1,4-addition strategy offers several advantages, such as using an economic and environmentally benign reaction media, high yields, versatility, and shorter reaction times. The synthesized compounds were identified by 1H-NMR, 13C-NMR, CHN, IR, and MS. The structure of compound 3a was further confirmed by single crystal X-ray structure determination.

  5. The staphylococcal accessory regulator, SarA, is an RNA-binding protein that modulates the mRNA turnover properties of late-exponential and stationary phase Staphylococcus aureus cells

    Directory of Open Access Journals (Sweden)

    John M Morrison


    Full Text Available The modulation of mRNA turnover is gaining recognition as a mechanism by which Staphylococcus aureus regulates gene expression, but the factors that orchestrate alterations in transcript degradation are poorly understood. In that regard, we previously found that 138 mRNA species, including the virulence factors protein A (spa and collagen binding protein (cna, are stabilized in a sarA-dependent manner during exponential phase growth, suggesting that SarA protein may directly or indirectly effect the RNA turnover properties of these transcripts. Herein, we expanded our characterization of the effects of sarA on mRNA turnover during late exponential and stationary phases of growth. Results revealed that the locus affects the RNA degradation properties of cells during both growth phases. Further, using gel mobility shift assays and RIP-ChIP, it was found that SarA protein is capable of binding mRNA species that it stabilizes both in vitro and within bacterial cells. Taken together, these results suggest that SarA post-transcriptionally regulates S. aureus gene expression in a manner that involves binding to and consequently altering the mRNA turnover properties of target transcripts.

  6. Nutritional Models of Experimentally-Induced Subacute Ruminal Acidosis (SARA) Differ in Their Impact on Rumen and Hindgut Bacterial Communities in Dairy Cows (United States)

    Plaizier, Jan C.; Li, Shucong; Tun, Hein M.; Khafipour, Ehsan


    Effects of subacute ruminal acidosis (SARA) challenges on the bacteria in rumen fluid, cecal digesta, and feces of dairy cows were determined using 16S rRNA gene pyrosequencing and real-time quantitative PCR. Six non-lactating Holstein cows with cannulas in the rumen and cecum were used in a 3 × 3 Latin square arrangement of treatments. During the first 3 wk of each experimental period, cows received a control diet containing 70% forages on a dry matter (DM) basis. In wk 4 of each period, cows received one of three diets: (1) the control diet; (2) a diet in which 34% of the dietary DM was replaced with pellets of ground wheat and barley (GBSC); or (3) a diet in which 37% of dietary DM was replaced with pellets of ground alfalfa (APSC). Rumen fluid, cecal digesta and feces were collected on d 5 of wk 4 of each period and the composition of the bacterial community was studied. Rumen fermentation responses were reported in a companion study. Both SARA-inducing challenges resulted in similar digesta pH depressions (as shown by the companion study), and reduced bacterial richness and diversity in rumen fluid, but GBSC had the larger effect. None of the challenges affected these measures in cecal digesta, and only GBSC reduced bacterial richness and diversity in feces. Only GBSC reduced the abundance of Bacteroidetes in rumen fluid. Abundances of limited number of bacterial genera identified by 16S rRNA gene sequencing in the rumen, cecum and feces were affected by the GBSC. The APSC did not affect any of these abundances. Both challenges increased the abundances of several starch, pectin, xylan, dextrin, lactate, succinate, and sugar fermenting bacterial species in the rumen, cecum, and feces as determined by qPCR. Only GBSC increased that of Megasphaera elsdenii in the rumen. Both challenges decreased the abundance of Streptococcus bovis, and increased that of Escherichia coli, in cecal digesta and feces, with GBSC having the larger effect. These results showed that

  7. 78 FR 6851 - Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program... (United States)


    ... AFFAIRS Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program....'' SUPPLEMENTARY INFORMATION: Title: Patient Satisfaction Survey Michael E. DeBakey Home Care Program, VA Form 10.... Abstract: VA Form 10-0476 will be used to gather feedback from patients regarding their satisfaction...

  8. 77 FR 69550 - Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program... (United States)


    ... AFFAIRS Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program.... This notice solicits comments on information needed to determine patients' satisfaction with services... information technology. Title: Patient Satisfaction Survey Michael E. DeBakey Home Care Program, VA Form...

  9. 76 FR 624 - Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program... (United States)


    ... AFFAIRS Proposed Information Collection (Patient Satisfaction Survey Michael E. DeBakey Home Care Program.... 2900-New (VA Form 10-0476).'' SUPPLEMENTARY INFORMATION: Title: Patient Satisfaction Survey Michael E... Review: New collection. Abstract: VA Form 10-0476 will be used to gather feedback from patients...

  10. Pyrrolidinyl-sulfamide derivatives as a new class of bifunctional organocatalysts for direct asymmetric Michael addition of cyclohexanone to nitroalkenes. (United States)

    Chen, Jia-Rong; Fu, Liang; Zou, You-Quan; Chang, Ning-Jie; Rong, Jian; Xiao, Wen-Jing


    A series of chiral pyrrolidinyl-sulfamide derivatives have been identified as efficient bifunctional organocatalysts for the direct Michael addition of cyclohexanone to a wide range of nitroalkenes. The desired Michael adducts were obtained in high chemical yields and excellent stereoselectivities (up to 99/1 dr and 95% ee).

  11. Michael Shaffer, 6th July 1936 to 23rd March 2009: A heartfelt tribute (United States)

    Mr. Michael Shaffer, Retired Pyraloidea Curator, at the Natural History Museum, London, England, passed away on March 23, 2009. He was an acknowledged world expert on Pyraloidea, a group of agriculturally important moths. He was curator of the largest Pyraloidea type collection in the world, and a...

  12. Michael Corleone's Destiny——From the perspective of interpersonal metafunction to analyze Godfather

    Institute of Scientific and Technical Information of China (English)



    Godfather is Maria Puzo's famous long story. Maria Puzo presented us the unknown Italians-American's life with underworld background. Although many comments from different perspectives have been made, few studies are made. with Halliday's framework. This paper is an attempt to study the destiny of Michael Corleone from the perspective of interpersonal metafunction in systemic functional linguistis.

  13. Training and Mastery of Techniques in Wittgenstein's Later Philosophy: A Response to Michael Luntley (United States)

    Stickney, Jeff


    Responding to Michael Luntley's article, "Learning, Empowerment and Judgement," the author shows he cannot successfully make the following three moves: (1) dissolve the analytic distinction between learning by training and learning by reasoning, while advocating the latter; (2) diminish the role of training in Wittgenstein's philosophy, nor…

  14. Wolff-Michael Roth's passibility: at the limits of the constructivist metaphor: a book review (United States)

    Brendel, Michelle


    Wolff-Michael Roth deconstructs the preeminent role conceded to constructivism in Science Education and demonstrates how we learn and know through pain, suffering, love or passion. This review explores his book "Passibility: At the Limits of the Constructivist Metaphor" through the eyes of an outsider to the world of science education.

  15. European Management: an emerging competitive advantage of European nations : A reply to Michael Porter

    NARCIS (Netherlands)

    F.A.J. van den Bosch (Frans); A.A. van Prooijen


    textabstractThis article extends the debate begun in the June 1992 issue of EMJ when the authors first criticized Michael Porter's explanatory framework in his Competitive Advantage of Nations (1990), over the role of national culture on the competitive advantage of nations. In this paper, Frans van

  16. Little Mosie from the Margaree: A Biography of Moses Michael Coady. (United States)

    Welton, Michael R.

    This book examines the life of the Reverend Moses Michael Coady (1890-1959), a Roman Catholic priest who led the Antigonish Movement. During the Antigonish Movement, residents of the small maritime town of Antigonish, Nova Scotia, worked to achieve a nonviolent alternative to communism and fascism and to effect the social and economic…

  17. From Gouldner to Gramsci: The Making of Michael Apple's "Ideology and Curriculum" (United States)

    Gottesman, Isaac


    Michael Apple's "Ideology and Curriculum", published in 1979, helped initiate a broad turn in the field of education in the United States to Marxist thought as a lens through which to analyze the relationship between school and society. This classic text continues to inform scholarship in the field. While "Ideology" has…

  18. Ytterbium triflate catalyzed Michael additions of beta-ketoesters in water

    NARCIS (Netherlands)

    Keller, E; Feringa, BL


    Michael addition of various beta-ketoesters towards enones and alpha,beta-unsaturated aldehydes resulted in a quantitative conversion to the corresponding 1,4-adducts by performing the reactions in water in the presence of ytterbium triflate as a water-tolerant Lewis acid.

  19. Highly efficient ytterbium triflate catalyzed Michael additions of alpha-nitroesters in water

    NARCIS (Netherlands)

    Keller, E; Feringa, B.L.

    Michael additions of alpha-nitroesters with enones and alpha,beta-unsaturated aldehydes result in quantitative conversions to the corresponding 1,4-adducts by performing the reactions in water in the presence of ytterbium triflate as water-tolerant Lewis acid.

  20. Novel chiral thioureas for highly enantioselective Michael reactions of malonates to nitroalkenes

    Institute of Scientific and Technical Information of China (English)

    Li Jun Yan; Quan Zhong Liu; Xue Lian Wang


    Highly efficient Michael addition reactions of malonates to nitroalkenes catalyzed by novel chiral thioureas derived from optically pure BINOL and amino acids are reported. Various trans-nitroalkenes reacted with malonates affording the desired products in up to 95% yield with excellent enantioselectivities (up to 97% ee).

  1. On the study of culture and mind: Interview with Prof. Michael Cole

    DEFF Research Database (Denmark)

    Glaveanu, Vlad Petre


    the two. And yet, as Professor Michael Cole and, more broadly, cultural psychologists would argue: there is no way of making sense of one if we disregard the other. Culture and mind constitute each other through action and communication and it is their intricate relationship that holds the key...

  2. European Management: an emerging competitive advantage of European nations : A reply to Michael Porter

    NARCIS (Netherlands)

    F.A.J. van den Bosch (Frans); A.A. van Prooijen


    textabstractThis article extends the debate begun in the June 1992 issue of EMJ when the authors first criticized Michael Porter's explanatory framework in his Competitive Advantage of Nations (1990), over the role of national culture on the competitive advantage of nations. In this paper, Frans van

  3. KF-Montmorillonite-catalyzed Michael Addition Reaction of Malononitrile to α,β-Unsaturated Ketones

    Institute of Scientific and Technical Information of China (English)

    SHI Daqing; WU Nan; ZHUANG Qiya


    The Michael addition reaction of α,β-unsaturated ketones with malononitrile catalyzed by KF-montmorillonite was investigated. It was interesting to note that at different reaction temperatures the addition and cycloaddition re-action products were obtained. This method has the advantages of good yields, mild reaction conditions, easy work-up and inexpensive reagents over the existing procedures.


    NARCIS (Netherlands)



    Addition of the Schiff bases derived from reaction of glycine alkyl esters with benzophenoneimine to alpha,beta-unsaturated ketones, followed by hydrogenation of the addition products, leads to 5- or 3,5-substituted prolines. Hydrolysis of the Michael adducts rather than hydrogenation allows

  5. 78 FR 69661 - Michael Canales v. Edison International, EIX, Southern California Edison; Notice of Complaint (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Michael Canales v. Edison International, EIX, Southern California Edison; Notice of Complaint Take notice that on November 11, 2013, pursuant to sections 205, 206, and 301 of the Federal Power Act (FPA), 16 U.S.C....

  6. Michael Eric Dyson: A Scholar and a Hip-Hop Preacher. (United States)

    Fletcher, Michael A.


    Introduces Michael Eric Dyson, an African American man who grew up in the ghetto and eventually received a PhD from Princeton University. Today, he is a professor at DePaul University, the author of a radically revisionist new biography of Martin Luther King, Jr., a lecturer and talk show guest, a Baptist preacher, and a self-styled hip-hop…

  7. A Metal-Ligand Cooperative Pathway for Intermolecular Oxa-Michael Additions to Unsaturated Nitriles

    NARCIS (Netherlands)

    Perdriau, Sebastien; Zijlstra, Douwe S.; Heeres, Hero J.; de Vries, Johannes G.; Otten, Edwin


    An unprecedented catalytic pathway for oxa-Michael addition reactions of alcohols to unsaturated nitriles has been revealed using a PNN pincer ruthenium catalyst with a dearomatized pyridine backbone. The isolation of a catalytically competent Ru-dieneamido complex from the reaction between the Ru

  8. How to move things around a hospital: transport logistics at St. Michael's. (United States)

    Yau, A; Zorn, R; McLaughlin, J


    Ongoing fiscal restraint challenges hospitals to focus their resources primarily on core services. Support services receive much less attention. This article describes the experience of Toronto's St. Michael's Hospital when it re-engineered its transport logistics by consolidating centralized support services into a logistics department and creating new roles and processes to enhance patient care.

  9. Moral Education and Education in Altruism: Two Replies to Michael Hand (United States)

    White, John


    This article is a critical discussion of two recent papers by Michael Hand on moral education. The first is his "Towards a Theory of Moral Education", published in the "Journal of Philosophy of Education" in 2014 (Volume 48, Issue 4). The second is a chapter called "Beyond Moral Education?" in an edited book of new…

  10. The power of virtual integration: an interview with Dell Computer's Michael Dell. Interview by Joan Magretta. (United States)

    Dell, M


    Michael Dell started his computer company in 1984 with a simple business insight. He could bypass the dealer channel through which personal computers were then being sold and sell directly to customers, building products to order. Dell's direct model eliminated the dealer's markup and the risks associated with carrying large inventories of finished goods. In this interview, Michael Dell provides a detailed description of how his company is pushing that business model one step further, toward what he calls virtual integration. Dell is using technology and information to blur the traditional boundaries in the value chain between suppliers, manufacturers, and customers. The individual pieces of Dell's strategy--customer focus, supplier partnerships, mass customization, just-in-time manufacturing--may be all be familiar. But Michael Dell's business insight into how to combine them is highly innovative. Direct relationships with customers create valuable information, which in turn allows the company to coordinate its entire value chain back through manufacturing to product design. Dell describes how his company has come to achieve this tight coordination without the "drag effect" of ownership. Dell reaps the advantages of being vertically integrated without incurring the costs, all the while achieving the focus, agility, and speed of a virtual organization. As envisioned by Michael Dell, virtual integration may well become a new organizational model for the information age.


    NARCIS (Netherlands)



    Addition of the Schiff bases derived from reaction of glycine alkyl esters with benzophenoneimine to alpha,beta-unsaturated ketones, followed by hydrogenation of the addition products, leads to 5- or 3,5-substituted prolines. Hydrolysis of the Michael adducts rather than hydrogenation allows synthes

  12. "Raising Standards" or Reducing Aspirations and Opportunities Still Further? Michael Gove and Examination Reforms (United States)

    Allen, Martin


    Well before the examinations grade crisis of 2012, Michael Gove had set out clear intentions for reforming public examinations. Though he claimed to be improving examinations and assessment by replicating practices that took place in high-performing countries and thus improving the ability of the UK economy to "compete", this…

  13. Noted astrophysicist Michael S. Turner to Head NSF'S mathematical and physical sciences directorate

    CERN Multimedia


    "The National Science Foundation has named celebrated astrophysicist Michael S. Turner of the University of Chicago as Assistant Director for Mathematical and Physical Sciences. He will head a $1 billion directorate that supports research in mathematics, physics, chemistry, materials and astronomy, as well as multidisciplinary programs and education" (1/2 page).

  14. Guanidinium Lactate Ionic Liquid:An Efficient and Recycling Catalyst for Michael Addition Reaction

    Institute of Scientific and Technical Information of China (English)

    LIANG Da-peng; XIN Xin; GAO Han; DUAN Hai-feng; LIN Ying-jie


    A facile and efficient 1,4-conjungate addition(Michael addition) reaction of active methylene compounds to a,β-unsaturated compounds,catalyzed by guanidinium lactate ionic liquid(IL9),has been developed.A range of chaicones and nitroaikenes together with active methylene compounds have been converted smoothly to the corresponding products in high yields.

  15. Synthesis of bicyclic guanidines via cascade hydroamination/Michael additions of mono-N-acryloylpropargylguanidines. (United States)

    Kwon, Ki-Hyeok; Serrano, Catherine M; Koch, Michael; Barrows, Louis R; Looper, Ryan E


    A cascade silver(I)-catalyzed hydroamination/Michael addition sequence has been developed to deliver highly substituted bicyclic guanidines. This transformation gives rise to geometrically and constitutionally stable ene-guanidines and generates a remote stereocenter with moderate to high diastereoselectivity.

  16. Aza-Michael reaction of 12-N-carboxamide of (-)-cytisine under high pressure conditions. (United States)

    Tsypysheva, Inna P; Lobov, Alexander N; Kovalskaya, Alena V; Petrova, Polina R; Ivanov, Sergey P; Rameev, Shamil A; Borisevich, Sophia S; Safiullin, Rustam L; Yunusov, Marat S


    The first example of aza-Michael reaction of 12-N-carboxamide of quinolizidine alkaloid (-)-cytisine with α,β-unsaturated ketones, dimethyl acetylenedicarboxylate and β-nitrostyrene under high pressure condition has been described. It has been shown that the [4+2]-cycloaddition takes place in the case with N-phenylmaleimide.

  17. Little Mosie from the Margaree: A Biography of Moses Michael Coady. (United States)

    Welton, Michael R.

    This book examines the life of the Reverend Moses Michael Coady (1890-1959), a Roman Catholic priest who led the Antigonish Movement. During the Antigonish Movement, residents of the small maritime town of Antigonish, Nova Scotia, worked to achieve a nonviolent alternative to communism and fascism and to effect the social and economic…

  18. Hexafluorobenzene: A powerful solvent for a noncovalent stereoselective organocatalytic Michael addition reaction

    KAUST Repository

    Lattanzi, Alessandra


    A dramatic enhancement of the diastereo- and enantioselectivity in the nitro-Michael addition reaction organocatalysed by a commercially available α,α-l-diaryl prolinol was disclosed when performing the reaction in unconventional hexafluorobenzene as a medium. DFT calculations were performed to clarify the origin of stereoselectivity and the role of C 6F 6. © The Royal Society of Chemistry 2012.

  19. Michael Pressley's Contributions to the History and Future of Strategies Research (United States)

    Harris, Karen R.; Alexander, Patricia; Graham, Steve


    The history of strategies research during the past quarter century has been a story of significant conceptualizations and reconceptualizations regarding the nature, development, and teaching of cognitive and metacognitive strategies. Theoretical models, empirical research, and discussions contributed by Michael Pressley have been central to…

  20. Outside in America: George Michael's music video, public sex and global pop culture

    NARCIS (Netherlands)

    Kooijman, J.


    Six months after his controversial arrest for ‘lewd conduct’ at a men’s public restroom in Beverly Hills, British pop star George Michael released the song and music video ‘Outside’ which can be seen as an explicit commentary on the controversy. In this article, I read the music video in three ways:

  1. Vice Premier Zeng Peiyan Meets with Michael Cohrs, CEO of Corporate & Investment Banking of Deutsche Bank

    Institute of Scientific and Technical Information of China (English)


    <正>Invited by the CPAFFC, Michael Cohrs, Chief Executive Officer of the Corporate and Investment Banking of Deutsche Bank, visited Beijing from February 26 to 28, 2004. Vice Premier Zeng Peiyan of the State Council met with Cohrs and his party. Deutsche Bank AG, a global multipurpose bank

  2. Gender Relations and Sexual Harassment in the Workplace: Michael Crichton's "Disclosure" as a Teaching Tool. (United States)

    Comer, Debra R.; Cooper, Elizabeth A.


    Describes how to use Michael Crichton's novel "Disclosure" and the film based on it for class discussions of such issues as what constitutes sexual harassment, harassment of men, relationship between sexual harassment and power, organizational responses to harassment, and gender differences in career advancement tactics. (SK)

  3. Briti ekspert : euroliidus kaob Eestist tööpuudus / Michael Richardson ; interv. Airi Ilisson

    Index Scriptorium Estoniae

    Richardson, Michael


    Eestis Suurbritannia tööreformi tutvustava töö- ja sotsiaalnõuniku sõnul on Suurbritannias peaaegu kadunud pikaajaline töötus noorte hulgas, vanematest inimestest on vaid üksikud tööta kauem kui aasta. Vt. samas: Kes on Michael Richardson?

  4. Michael Peters' Lyotardian Account of Postmodernism and Education: Some Epistemic Problems and Naturalistic Solutions (United States)

    Clark, John A.


    Postmodernism has established a significant hold in educational thought and some of the most important ideas are to be found in the writings of Michael Peters. This paper examines his postmodern stance and use of Lyotard's account of knowledge, and from a naturalist point of view raises a number of objections centred on science as a metanarrative,…

  5. Schools as "Poetry-Friendly Places": Michael Rosen on Poetry in the Curriculum (United States)

    Xerri, Daniel


    This article explores the views of children's poet Michael Rosen in relation to poetry in education. It is based on an interview in which Rosen not only discusses the significance of encouraging young people to engage with poetry at school but also analyzes a number of threats to poetry's place in the English curriculum. This article identifies…

  6. Training and Mastery of Techniques in Wittgenstein's Later Philosophy: A Response to Michael Luntley (United States)

    Stickney, Jeff


    Responding to Michael Luntley's article, "Learning, Empowerment and Judgement," the author shows he cannot successfully make the following three moves: (1) dissolve the analytic distinction between learning by training and learning by reasoning, while advocating the latter; (2) diminish the role of training in Wittgenstein's philosophy, nor…

  7. Subjectivity and Cultural Adjustment in Mathematics Education: A Response to Wolff-Michael Roth (United States)

    Brown, Tony


    In this volume, Wolff-Michael Roth provides a critical but partial reading of Tony Brown's book "Mathematics Education and Subjectivity". The reading contrasts Brown's approach with Roth's own conception of subjectivity as derived from the work of Vygotsky, in which Roth aims to "reunite" psychology and sociology. Brown's book, however, focuses on…

  8. Enzymatic carbon-carbon bond-forming Michael-type additions

    NARCIS (Netherlands)

    Geertsema, Edzard; Poelarends, Gerrit; Faber, Kurt; Fessner, Wolf-Dieter; Turner, Nicholas


    This chapter gives an overview of practical biocatalytic procedures for C-C bond-forming Michael(-type) additions suitable for organic synthesis purposes. Reported product yields, workup and isolation methods, stereoselectivity, and availability of the applied enzymes are assessed. All methodologies

  9. Kunstlik viljastamine - kas rahva püsimajäämise võti? / Michael Cook

    Index Scriptorium Estoniae

    Cook, Michael


    Kunstlikust viljastamisest pole üksi abi - vaid siis, kui noored mehed ja naised pööravad selja tarbimiskultusele ja individualismile, hakkab sündimus tõusma taastootmisest kõrgemale, kirjutab BioEdge toimetaja Michael Cook

  10. The Educational Philosophies of Mordecai Kaplan and Michael Rosenak: Surprising Similarities and Illuminating Differences (United States)

    Schein, Jeffrey; Caplan, Eric


    The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…

  11. Michael Perelman: An ecological future in view of Marxist Economics (Ⅱ)

    Institute of Scientific and Technical Information of China (English)

    Ren Xiaomei


    @@ Interviewee profile: Michael Perelman, currently professor of Economics Department of California State University, USA, American economist and economic historian with nearly 20 publications in the field of economics criticism, including Railroading Economics, Manufacturing Discontent, The Perverse Economy, and The Invention of Capitalism.

  12. Neuroscientific Investigator of High Mathematical Ability: An Interview with Michael W. O'Boyle (United States)

    Kalbfleisch, M. Layne


    This article presents an interview with Michael W. O'Boyle, a neuroscientific investigator of high mathematical ability. O'Boyle is a professor in the Department of Human Development and Family Studies, Texas Tech University, and Adjunct Professor of Pharmacology and Neuroscience, School of Medicine, Texas Tech University Health Sciences Center.…

  13. A tribute to Michael R. Raupach for contributions to aeolian fluid dynamics (United States)

    Since the early work of Bagnold in the 1940s, aeolian research has grown to become a major integral part of earth-system studies. Many individuals have contributed to this development, and Dr. Michael R. Raupach (MR2, 1950 – 2015) was one of the most outstanding. MR2 worked for about a decade (1985 ...

  14. Synthesis of β3-Amino Acids via Catalyst- and Solvent-Free Aza-Michael Reaction

    Institute of Scientific and Technical Information of China (English)


    A safe, environmentally friendly and cost-effective method for the synthesis of β-amino acid derivatives has been developed. Treatment of α,β-unsaturated compounds with aliphatic amines furnishes β-amino acid derivatives in good to excellent yields via a catalyst- and solvent-free aza-Michael addition.

  15. What Work Do the Concepts of "Language" and "Literature" Do for Michael Rosenak? (United States)

    Levisohn, Jon A.


    Michael Rosenak uses the twin metaphors of "language" and "literature," borrowed from Oakeshott and Peters, to argue that the goal of education is initiation into a language. This goal transcends the study of literature in that language. It includes, as well, the development of the capacity both to critique literature and to…

  16. Book Review of "The Molecular Biology of Cancer" by Stella Pelengaris, Michael Khan (Editors

    Directory of Open Access Journals (Sweden)

    Schmidt Christian


    Full Text Available Abstract Here, a review of "The Molecular Biology of Cancer" (Stella Pelengaris and Michael Khan [Editors] is given. The detailed description of the book is provided here: Pelengaris S, Khan M (Eds: The Molecular Biology of Cancer; Blackwell Publishing, Oxford (U.K.; 2006. 531 pages, 214 illustrations, ISBN 9-78140-511-814-9, £31.99.

  17. Highly efficient ytterbium triflate catalyzed Michael additions of alpha-nitroesters in water

    NARCIS (Netherlands)

    Keller, E; Feringa, B.L.


    Michael additions of alpha-nitroesters with enones and alpha,beta-unsaturated aldehydes result in quantitative conversions to the corresponding 1,4-adducts by performing the reactions in water in the presence of ytterbium triflate as water-tolerant Lewis acid.

  18. Outside in America: George Michael's music video, public sex and global pop culture

    NARCIS (Netherlands)

    Kooijman, J.


    Six months after his controversial arrest for ‘lewd conduct’ at a men’s public restroom in Beverly Hills, British pop star George Michael released the song and music video ‘Outside’ which can be seen as an explicit commentary on the controversy. In this article, I read the music video in three ways:

  19. Michael Faraday on the Learning of Science and Attitudes of Mind. (United States)

    Crawford, Elspeth


    Makes use of Michael Faraday's ideas on learning, focusing on his attitudes toward the unknowns of science and the development of an attitude that improves scientific decision making. This approach acknowledges that there is an inner struggle involved in facing unknowns. (DDR)

  20. A Relação entre o Risco e as Práticas de Governança Corporativa Diferenciada no Mercado Brasileiro de Ações: uma abordagem sob a égide da teoria dos portfólios de MarkowitzRisk Relation and the Corporative Governance Practice in the Brazilian Stock Market: an approach according to the portfolio theory by MarkowitzLa Relación entre el Riesgo y las Prácticas de Gobernanza Corporativa Diferenciada en el Mercado Brasileño de Acciones: un análisis bajo la égida de la teoría de los portafolios de Markowitz

    Directory of Open Access Journals (Sweden)

    SILVA, Rhoger Fellipe Marinho da


    Full Text Available RESUMOEste estudo objetivou analisar se há uma relação entre o risco de uma carteira, considerada suficientemente diversificada no mercado brasileiro de ações, composta pelas empresas classificadas no IGC, em comparação à Carteira de Mercado. Para tanto, utilizou-se preliminarmente do proceder metodológico de pesquisa bibliográfico-documental de caráter exploratório e, posteriormente, do levantamento das carteiras teóricas do índice de ações com governança corporativa diferenciada da BM&FBOVESPA válidas para o primeiro, segundo e terceiro quadrimestres de 2009. E, com o auxílio da planilha eletrônica Excel, utilizando-se do modelo de Markowitz (1952 e da metodologia desenvolvida por Gonçalves Junior, Pamplona e Montevechi (2002, buscou-se encontrar as carteiras de variância mínima para cada quadrimestre, a fim de testar a hipótese de que há uma relação entre o risco dessas carteiras, consideradas suficientemente diversificadas no mercado brasileiro de ações (de acordo com os achados de Sanvicente e Bellato, 2004, compostas por empresas classificadas no IGC. Assim, os resultados indicaram que tais carteiras compostas pelos ativos do IGC, são superiores à carteira de mercado, uma vez que teriam seus riscos representados por cerca de 34%, 32% e 21% do risco do IBOVESPA de seu período correspondente, em níveis de retorno idênticos, ou seja, por meio da teoria de diversificação é possível obter uma relação inversa entre o risco e as boas práticas de governança corporativa. Adicionalmente, a carteira selecionada IGC domina a carteira do IGC e do IBOVESPA, respectivamente, utilizando-se o coeficiente de variação, ou seja, possui o menor risco contido por cada retorno adicional.ABSTRACTThis study examines whether there is a relationship between the risk of a portfolio that would be sufficiently diversified in the Brazilian stock market, made by companies classified in the IGC, in comparison with the Market

  1. Novel Ionic Liquid with Both Lewis and Brønsted Acid Sites for Michael Addition

    Directory of Open Access Journals (Sweden)

    Runpu Shen


    Full Text Available Ionic liquid with both Lewis and Brønsted acid sites has been synthesized and its catalytic activities for Michael addition were carefully studied. The novel ionic liquid was stable to water and could be used in aqueous solution. The molar ratio of the Lewis and Brønsted acid sites could be adjusted to match different reactions. The results showed that the novel ionic liquid was very efficient for Michael addition with good to excellent yields within several min. Operational simplicity, high stability to water and air, small amount used, low cost of the catalyst used, high yields, chemoselectivity, applicability to large-scale reactions and reusability are the key features of this methodology, which indicated that this novel ionic liquid also holds great potential for environmentally friendly processes.

  2. Sir Michael Francis Addison Woodruff (1911-2001) FRS DSc MD MS FRCS. (United States)

    Leigh, Winston


    Michael Woodruff performed the first successful renal transplant in the UK and described the technique of joining the ureter of the transplant to the bladder. He contributed to all aspects of transplantation biology and was responsible for the design of the first purpose-built transplant unit in the world. As a Japanese prisoner of war at Changi in Singapore, Michael Woodruff studied the effects of malnutrition and devised a machine for extracting vitamins and trace elements from grass. After the war he demonstrated that the anterior chamber of the eye was an immunologically privileged site. He was the first person to describe 'adaptation'. He showed that antilymphocytic serum was effective as an immunosuppressive agent for homografts.

  3. An Analysis of Michael Long's Interaction Hypothesis in Second Language Acquisition

    Institute of Scientific and Technical Information of China (English)



    The Interaction Hypothesis,which was first advanced by Michael Long,is considered ag a further supplement or extension of the Input Hypothesis in the field of second language acquisition.This paper explains the main claims of Michael Long'8 Interaction Hypothesis,the three steps to study how input and interaction affect the acquisition of a second language,and the importance of the interactional modifications applied by both participants of the interaction.Emphasis is placed on the evaluation of the theory as well as its relation to second language teaching,with many researchers'findings and arguments discussed as supporting evidence.It aims to help the effective application of this theory in second language teaching.

  4. Interviews with Michael Baxandall, February 3rd and 4th, 1994, Berkeley, CA

    Directory of Open Access Journals (Sweden)

    Allan Langdale


    Full Text Available The following interviews with Michael Baxandall were conducted in Berkeley on February 3rd and 4th of 1994. The content of these interviews include general responses about developments in art history in the years between 1960 and 1985, a period of dramatic modifications in the discipline. Among the issues are the rise of the social history of art and the sources from anthropology that informed Baxandall’s concept of the ‘Period Eye’. Baxandall talks about his own work, his personal intellectual history, and the scholars of past and current generations who influenced him. Other topics include Baxandall’s professional trajectory, the Warburg Library, and aspects of cultural history having to do with Renaissance Humanism. These interviews first appeared as an appendix to the PhD dissertation by Allan Langdale, Art History and Intellectual History: Michael Baxandall’s Work between 1963 and 1985, U. C. Santa Barbara, 1995.

  5. [An exceptional human relationship (Michael P. Kierkegaard, Søren Kierkegaard)]. (United States)

    Jacobs, R


    There were a father and a son, Michael and Sören Kierkegaard, both highly talented, imaginitive, witty, humorous, especially interested in shrewd dialectrical dialogues respectively debates, both profound melancholy ponderers. But according to very own individuality their congeniality wasn't absolute. The father, being under a questionable rigorous opinion of sin, suffered from undeserved divine grace since early childhood. And Michael Kierkegaard made Sören anxious with the religious experience of original sin. This anxiety moved (touched or affected) the sensitive son mighty. Nevertheless he should not despair hopelessly like his unlucky father. On the contrary: Sørens incomparable melancholy, mental agony and anxiety (fear or anguish) forced the faith, existing independently of them, in a radical refining. That is why Sören Kierkegaard succeeded in sublimation of all psychological and philosophic (al) attitudes (or opinions) in the sphere of religiousness. And the result? A novel philosophy of life: Christian existentialism.

  6. Michael K. Scullin: Psi Chi/APA Edwin B. Newman Graduate Research Award. (United States)


    Presents Michael K. Scullin as the 2011 winner of the American Psychological Association Psi Chi/APA Edwin B. Newman Graduate Research Award. "For an outstanding research paper that examines the relationship between prospective memory in executing a goal and various lapses of time from 20 minutes up to a 12- hour wake delay and a 12-hour sleep delay. The results suggest that consolidation processes active during sleep increase the probability of goal execution. The paper, titled 'Remembering to Execute a Goal: Sleep On It!' was published in Psychological Science in 2010 and was the basis for Michael K. Scullin's selection as the recipient of the 2011 Psi Chi/APA Edwin B. Newman Graduate Research Award. Mark A. McDaniel, PhD, served as faculty research advisor." (PsycINFO Database Record (c) 2011 APA, all rights reserved). 2011 APA, all rights reserved

  7. Navigating Transition: Freedom, Limitation and the Post-colonial Persona in Michael Ondaatje's The Cat's Table

    Directory of Open Access Journals (Sweden)

    Alaa Alghamdi


    Full Text Available Michael Ondaatje's 2011 novel The Cat's Table follows a young boy's voyage from Colombo, Sri Lanka to London, England. Through this character and the unique environment of the ship, which forms a compelling sense of transitory place, Ondaatje explores liminality and its relationship with limitations or barriers. The young protagonist, Michael, and his companions enjoy an unusual level of freedom aboard the contained and hierarchically segmented ship. Polarization and transition between Eastern and Western culture is present but pales in importance compared to the validation of the self that is located within and defined by the sense of the in-between, an essential rite of passage undertaken before re-joining society.

  8. An Integral Part of the Frederick Community—Michael Dean | Poster (United States)

    For more than 30 years, Michael Dean, Ph.D., has been an integral part of the NCI at Frederick community. In addition to studying several different aspects of genomics and cancer research, he has worked with the Werner H. Kirsten Student Intern Program and also volunteered his time with Mission of Mercy, a community-based organization providing free healthcare and free prescription medications to the uninsured and under-insured.

  9. Highlighting High Performance: Michael E. Capuano Early Childhood Center; Somerville, Massachusetts

    Energy Technology Data Exchange (ETDEWEB)


    This brochure describes the key high-performance building features of the Michael E. Capuano Early Childhood Center. The brochure was paid for by the Massachusetts Technology Collaborative as part of their Green Schools Initiative. High-performance features described are daylighting and energy-efficient lighting, indoor air quality, solar and wind energy, building envelope, heating and cooling systems, water conservation, and acoustics. Energy cost savings are also discussed.

  10. Is there sexism?——Feminist discourse analysis of the recruitment advertisement of Michael Page

    Institute of Scientific and Technical Information of China (English)



    Sexism can be discovered in every sector oftbe society although it is under different guises. Women as a whole are treated oppressively and differently from men and they are subject to personal and institutional discrimination. This paper reveals sexism common in the business world through analyzing the register of tbe recruitment advert of'Michael Page' in 'Financial World' to raise critical gender awareness of the readers so that true equality between men and women can be eventually realized in the world.

  11. Horror movie aspects and experimentation in Michael Jackson’s Thriller music video


    Vargas, Herom; Universidade Municipal de São Caetano do Sul - USCS; Gonçalves, Rafael; Universidade Municipal de São Caetano do Sul - USCS


    This article analyzes the use of elements from the horror fi lm genre in the music video Thriller (1982), by Michael Jackson, as experimentation within the field of pop music. Based on the semiotics of culture, grounded on the concepts of cultural text, semiosphere, border and modeling, developed by Iuri Lotman, the analysis identified innovations in the use of horror as humor and, in the music, modeling of creatures, moving among horror, the fantastic and the reality.Keywords: horror, music ...

  12. Efficient Lewis Acids Catalyzed Aza-Michael Reactions of Enones with Carbamates

    Institute of Scientific and Technical Information of China (English)

    XIA Chun-Gu; XU Li-Wen


    The a-amino carbonyl functionality is not only a segment of biologically important natural products but also a versatile intermediate for the synthesis of nitrogen-containing compounds.1 The development of novel synthetic methods leading to a-amino ketone, a-amino acids or their derivatives has attracted much attention in organic synthesis.2 Among the traditional methods for generating a-amino carbonyl compounds, Mannich-type reaction is one of the classical and powerful methods.3 However, the classic Mannich reaction presents serious disadvantages, for example, there is still a drawback in that the silyl enolates have to be prepared from the corresponding carbonyl compounds. Alternatively, aza-Michael additions can be used to create carbon-heteroatom bonds by reaction of a,a-unsaturated carbonyl compounds with amines. Although recent advances have made this route more attractive, development of cheaper, simpler, and more efficient metal catalyst, especially which can be applied to chalcone, is highly desirable.In this paper, we demonstrated that the first aza-Michael reaction of chalcone with a less nucleophilic carbamates can be accomplished on Me3SiCFFeCl3 catalyst system under very mild conditions. Apart from experimental simplicity, the advantages of this methodology are the use of a very cheap Lewis acid catalyst and the insensitivity of the reaction mixture towards air and moisture.catalyst for aza-Michael reaction of chalcone and cyclic enones with carbamates. And with the cyclic enones with carbamates in dichloromethane at room temperature were also investigated. In this conjugate addition reaction, good to excellent yields of a-amino ketones were obtained with system could also mediates aza-Michael addition of carbamates to chalcone and derivatives.These new strategies opened efficient procedures for the synthesis of a-amino ketones under mild conditions.

  13. Asymmetric Synthesis of Fully Substituted Cyclopentane-Oxindoles through an Organocatalytic Triple Michael Domino Reaction (United States)

    Zou, Liang-Hua; Philipps, Arne R; Raabe, Gerhard; Enders, Dieter


    An efficient, highly stereoselective asymmetric synthesis of fully functionalized cyclopentanes bearing an oxindole moiety and several other functional groups in one pot has been developed. Key step is an organocatalytic triple Michael domino reaction forming three C–C bonds and six stereocenters, including a quaternary one. Starting from equimolar amounts of simple substrates, a high molecular complexity can be reached after a Wittig olefination in one pot. The new protocol can easily be scaled up to gram amounts. PMID:25470781

  14. Tetramethylguanidium Lactate Ionic Liquid:Catalyst-free Medium for Michael Addition Reaction

    Institute of Scientific and Technical Information of China (English)


    A catalyst-free, facile and efficient Michael addition reaction of active methylene compounds as well as nitromethane with chalcones catalyzed by guanidinium lactate ionic liquid was done. A series of chalcones,nitromethane, and active methylene compounds were converted smoothly to the corresponding products in high yields.The simple procedure, very mild conditions, high yields, and reuse of the IL without any loss of catalytic activity make this protocol considerably attractive for academic researches and practical applications.

  15. Catalytic enantioselective Michael addition reactions of alpha-nitroesters to alpha,beta-unsaturated ketones

    NARCIS (Netherlands)

    Keller, E; Veldman, N; Spek, AL; Feringa, BL


    Enantioselective Michael additions of alpha-nitroesters 2a-d with alpha,beta-unsaturated ketones were carried out in the presence of a catalytic amount of chiral Al-Li-(R,R')-2,2'-dihydroxy-1,1'-binaphthyl ('AlLiBINOL') complex prepared in situ from LiAlH4 and 2.45 equiv. of (R,R')-BINOL. The enanti

  16. Catalytic enantioselective Michael addition reactions of α-nitroesters to α,β-unsaturated ketones

    NARCIS (Netherlands)

    Keller, Erik; Veldman, Nora; Spek, Anthony L.; Feringa, Bernard


    Enantioselective Michael additions of α-nitroesters 2a-d with α,β-unsaturated ketones were carried out in the presence of a catalytic amount of chiral Al-Li-(R,R')-2,2'-dihydroxy-1,1'-binaphthyl (‘AlLiBINOL’) complex prepared in situ from LiAlH4 and 2.45 equiv. of (R,R')-BINOL. The enantioselectivit

  17. Functionalized 3D Architected Materials via Thiol-Michael Addition and Two-Photon Lithography. (United States)

    Yee, Daryl W; Schulz, Michael D; Grubbs, Robert H; Greer, Julia R


    Fabrication of functionalized 3D architected materials is achieved by a facile method using functionalized acrylates synthesized via thiol-Michael addition, which are then polymerized using two-photon lithography. A wide variety of functional groups can be attached, from Boc-protected amines to fluoroalkanes. Modification of surface wetting properties and conjugation with fluorescent tags are demonstrated to highlight the potential applications of this technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Feeding Health: Michael Pollan on Improving Public Health through the Food Systems

    Centers for Disease Control (CDC) Podcasts


    In this podcast, author Michael Pollan discusses his March 2009 visit to CDC and offers his thoughts on the intersection between the government, the food systems, and public health.  Created: 8/19/2009 by National Center for Environmental Health (NCEH), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Office of Sustainability.   Date Released: 4/15/2010.

  19. N-1 regioselective Michael-type addition of 5-substituted uracils to (2-hydroxyethyl acrylate

    Directory of Open Access Journals (Sweden)

    Walczak Krzysztof Z


    Full Text Available Abstract N-1 regioselective Michael-type addition of 5-substituted uracils to (2-hydroxyethyl acrylate is presented. The reactions were performed in polar aprotic solvents and with avoidance of polymerization of acrylic substrate. The obtained adducts may serve as versatile substrates for further functionalization, e.g. into (3-uracil-1-ylpropanoic acids or transformations, with participation of hydroxyl group, into ester-conjugated acyclic nucleosides.

  20. Remote Sensing of Sea Surface Wind of Hurricane Michael by GPS Reflected Signals

    Institute of Scientific and Technical Information of China (English)


    In this paper, the propagating geometry and the waveform of the GPS reflected signals are expatiated in detail. Furthermore, the principle and the method of retrieving sea surface wind are presented. In order to test the feasibility of retrieval, the experiment data obtained by NASA in Hurricane Michael are used. The result shows that the retrieval accuracy of wind speed is about 2 m/s.