
Sample records for sara lee corporation

  1. 76 FR 2712 - Sara Lee Corporation, Master Data, Cash Applications, Deductions, Collections, Call Center... (United States)


    ..., Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial Accounts..., Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial Accounting..., Deductions, Collections, Call Center, Information Technology, Accounts Payable, General Accounts,......

  2. Análisis del proceso de cierre contable mensual y propuesta de mejora basada en la filosofía de manufactura esbelta para la empresa Sara Lee Underwear, Operación Centroamérica


    Chinchilla Méndez, Ana Catalina


    Tesis de maestría -- Universidad de Costa Rica. Posgrado en Administración y Dirección de Empresas. Maestría Profesional en Administración y Dirección de Empresas con énfasis en Gerencia, 2006 El objetivo general del trabajo es analizar las áreas de mejora del proceso de cierre contable mensual de la empresa Sara Lee Underwear, Operación Centroamérica, con base en los principios básicos establecidos en la filosofía de manufactura esbelta; esto, con el fin de proponer un proceso mejorado aj...


    The Environmental Technology Verification report discusses the technology and performance of the Static Pac System, Phase II, natural gas reciprocating compressor rod packing manufactured by the C. Lee Cook Division, Dover Corporation. The Static Pac System is designed to seal th...

  4. 75 FR 67770 - Sara Lee Corporation Including On-Site Leased Workers From EDS, Hewitt Packard, Sapphire... (United States)


    ..., Cash Applications, Deductions, Collections, Call Center, Information Technology, Accounts Payable, General Accounts, Financial Accounts, Payroll, and Employee Master Data Departments Including On-Site... Payable, General Accounts, Financial Accounts, Payroll, and Employee Master Data Departments, including...

  5. Corporate social responsibility in the coffee sector: The dynamics of MNC responses and code development

    NARCIS (Netherlands)

    A. Kolk


    Since the collapse of the international coffee agreement in 1989, attention has increasingly focused on the role of multinational corporations in this sector. As the main actors in the international coffee chain, companies such as Sara Lee/Douwe Egberts, Nestlé and Kraft have been pressurised to sho

  6. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  7. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich

    Directory of Open Access Journals (Sweden)

    Paula Daniela Bianchi


    Full Text Available The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  8. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich


    Paula Daniela Bianchi


    The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez) by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  9. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  10. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  11. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  12. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  13. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  14. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  15. Tim Berners-Lee

    Institute of Scientific and Technical Information of China (English)



    Tim Berners-Lee,computer scientist,was born in 1955 in London, England.His parents were both mathematicians,who worked on the Ferranti Mark I,the first computer to be sold commercially.Berners- Lee’s childhood hobby was electronics.When he entered Queen’s College at Oxford University in 1972,Berners-Lee chose to major in

  16. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  17. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  18. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  19. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  20. On Maximum Lee Distance Codes


    Alderson, Tim L.; Svenja Huntemann


    Singleton-type upper bounds on the minimum Lee distance of general (not necessarily linear) Lee codes over ℤq are discussed. Two bounds known for linear codes are shown to also hold in the general case, and several new bounds are established. Codes meeting these bounds are investigated and in some cases characterised.

  1. Lee Wick Dark Energy

    CERN Document Server

    Lee, Seokcheon


    We consider the cosmological application of Lee-Wick theory where a field has a higher derivative kinetic operators. The higher derivative term can be eliminated by introducing a set of auxiliary fields. We investigate the cosmological evolutions of these fields as a candidate of dark energy. This model has the same structure as so called ``quintom' model except the form of potentials and the sign of the slope of the potentials. This model can give the stable late time phantom dominated scaling solution ($\\omega_{\\DE} < -1$) or tracking attractors ($\\omega_{\\DE} = 0$) depending on the choice of the slopes of the potential. In order to be a viable dark energy candidate, the present energy density contrast of dark energy ($\\Omega_{\\DE}^{(0)}$) should be close to an observed value (0.73) at the same time. However, a simple toy model of the theory can not satisfy both $\\omega_{\\DE}^{(0)} \\simeq -1$ and $\\Omega_{\\DE}^{(0)} = 0.73$. This is also true for any quintom model in literatures unless we suffer from the...

  2. SARA: a server for function annotation of RNA structures. (United States)

    Capriotti, Emidio; Marti-Renom, Marc A


    Recent interest in non-coding RNA transcripts has resulted in a rapid increase of deposited RNA structures in the Protein Data Bank. However, a characterization and functional classification of the RNA structure and function space have only been partially addressed. Here, we introduce the SARA program for pair-wise alignment of RNA structures as a web server for structure-based RNA function assignment. The SARA server relies on the SARA program, which aligns two RNA structures based on a unit-vector root-mean-square approach. The likely accuracy of the SARA alignments is assessed by three different P-values estimating the statistical significance of the sequence, secondary structure and tertiary structure identity scores, respectively. Our benchmarks, which relied on a set of 419 RNA structures with known SCOR structural class, indicate that at a negative logarithm of mean P-value higher or equal than 2.5, SARA can assign the correct or a similar SCOR class to 81.4% and 95.3% of the benchmark set, respectively. The SARA server is freely accessible via the World Wide Web at

  3. Management recommendations: Lee Metcalf Refuge (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a review of land management practices at the Lee Metcalf National Wildlife Refuge, by a land use specialist. Recommendations, time frame and...

  4. Sara endosomes and the asymmetric division of intestinal stem cells. (United States)

    Montagne, Chrystelle; Gonzalez-Gaitan, Marcos


    Tissue homeostasis is maintained by adult stem cells, which self-renew and give rise to differentiating cells. The generation of daughter cells with different fates is mediated by signalling molecules coming from an external niche or being asymmetrically dispatched between the two daughters upon stem cell mitosis. In the adult Drosophila midgut, the intestinal stem cell (ISC) divides to generate a new ISC and an enteroblast (EB) differentiating daughter. Notch signalling activity restricted to the EB regulates intestinal cell fate decision. Here, we show that ISCs divide asymmetrically, and Sara endosomes in ISCs are specifically dispatched to the presumptive EB. During ISC mitosis, Notch and Delta traffic through Sara endosomes, thereby contributing to Notch signalling bias, as revealed in Sara mutants: Sara itself contributes to the control of the ISC asymmetric division. Our data uncover an intrinsic endosomal mechanism during ISC mitosis, which participates in the maintenance of the adult intestinal lineage.

  5. Sensor Activation and Radius Adaptation (SARA) in Heterogeneous Sensor Networks

    CERN Document Server

    Bartolini, Novella; la Porta, Thomas; Petrioli, Chiara; Silvestri, Simone


    In this paper we address the problem of prolonging the lifetime of wireless sensor networks (WSNs) deployed to monitor an area of interest. In this scenario, a helpful approach is to reduce coverage redundancy and therefore the energy expenditure due to coverage. We introduce the first algorithm which reduces coverage redundancy by means of Sensor Activation and sensing Radius Adaptation (SARA)in a general applicative scenario with two classes of devices: sensors that can adapt their sensing range (adjustable sensors) and sensors that cannot (fixed sensors). In particular, SARA activates only a subset of all the available sensors and reduces the sensing range of the adjustable sensors that have been activated. In doing so, SARA also takes possible heterogeneous coverage capabilities of sensors belonging to the same class into account. It specifically addresses device heterogeneity by modeling the coverage problem in the Laguerre geometry through Voronoi-Laguerre diagrams. SARA executes quickly and is guarante...

  6. Gene : CBRC-SARA-01-1782 [SEVENS

    Lifescience Database Archive (English)


  7. Gene : CBRC-SARA-01-1760 [SEVENS

    Lifescience Database Archive (English)


  8. UCLA SARA (System Architect's Apprentice) demonstration

    Energy Technology Data Exchange (ETDEWEB)

    Fenchel, R.S.; Razouk, R.R.


    A sample session with the SARA system is given. The system is a set of design and modeling tools which are implemented on the MIT-Multics computer system. This demonstration is intended to acquaint all interested persons with the state of implementation of the SARA system and the flavor of its use. The system is currently under implementation; however, all the demonstrated tools are available to any user with access to the MIT-Multics system. Additional tools will soon be available.

  9. The relationship between SARA fractions and crude oil stability

    Directory of Open Access Journals (Sweden)

    Siavash Ashoori


    Full Text Available Asphaltene precipitation and deposition are drastic issues in the petroleum industry. Monitoring the asphaltene stability in crude oil is still a serious problem and has been subject of many studies. To investigate crude oil stability by saturate, aromatic, resin and asphaltene (SARA analysis seven types of crudes with different components were used. The applied methods for SARA quantification are IP-143 and ASTM D893-69 and the colloidal instability index (CII is computed from the SARA values as well. In comparison between CII results, the values of oil compositions demonstrated that the stability of asphaltenes in crude oils is a phenomenon that is related to all these components and it cannot be associated only with one of them, individually.

  10. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  11. Gene : CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)


  12. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  13. Ten Years Public Domain for the original Web Software : message from Tim Berners-Lee

    CERN Multimedia


    "CERN's decision to make the Web foundations and protocols available on a royalty free basis, and without additional impediments, was crucial to the Web's existence. Without this commitment, the enormous individual and corporate investment in Web technology simply would never have happened, and we wouldn't have the Web today." (Tim Berners-Lee, Director, WWW Consortium)

  14. Lee-Wick Black Holes

    CERN Document Server

    Bambi, Cosimo; Wang, Yixu


    We derive and study an approximate static vacuum solution generated by a point-like source in a higher derivative gravitational theory with a pair of complex conjugate ghosts. The gravitational theory is local and characterized by a high derivative operator compatible with Lee-Wick unitarity. In particular, the tree-level two-point function only shows a pair of complex conjugate poles besides the massless spin two graviton. We show that singularity-free black holes exist when the mass of the source $M$ exceeds a critical value $M_{\\rm crit}$. For $M > M_{\\rm crit}$ the spacetime structure is characterized by an outer event horizon and an inner Cauchy horizon, while for $M = M_{\\rm crit}$ we have an extremal black hole with vanishing Hawking temperature. The evaporation process leads to a remnant that approaches the zero-temperature extremal black hole state in an infinite amount of time.

  15. Lee-Wick black holes (United States)

    Bambi, Cosimo; Modesto, Leonardo; Wang, Yixu


    We derive and study an approximate static vacuum solution generated by a point-like source in a higher derivative gravitational theory with a pair of complex conjugate ghosts. The gravitational theory is local and characterized by a high derivative operator compatible with Lee-Wick unitarity. In particular, the tree-level two-point function only shows a pair of complex conjugate poles besides the massless spin two graviton. We show that singularity-free black holes exist when the mass of the source M exceeds a critical value Mcrit. For M >Mcrit the spacetime structure is characterized by an outer event horizon and an inner Cauchy horizon, while for M =Mcrit we have an extremal black hole with vanishing Hawking temperature. The evaporation process leads to a remnant that approaches the zero-temperature extremal black hole state in an infinite amount of time.

  16. Apocalipsis XX di Sara de Ibáñez

    Directory of Open Access Journals (Sweden)

    Stefano Tedeschi


    Full Text Available Rewriting the text of Saint John, Sara de Ibáñez uses a kind of style innovative and away from schools and trends in vogue: is thus able able to evoke the tragic experiences of the twentieth century, but the date of publication of the book (1970 reveals that it advances in themes and forms the concrete apocalypse lived by Uruguay and Latin America in the seventies. However, far from political themes and motifs, Sara de Ibáñez is able to express the absolute horror of contemporary tragedies and to propose a poetic reflection of great quality. This article suggests a rediscovery of this twentieth-century poetic voice, unjustly forgotten, through her 'apocalyptic' text.

  17. Subacute ruminal acidosis (SARA) challenge, ruminal condition and cellular immunity in cattle. (United States)

    Sato, Shigeru


    Subacute ruminal acidosis (SARA) is characterized by repeated bouts of low ruminal pH. Cows with SARA often develop complications or other diseases, and associate physiologically with immunosuppression and inflammation. Ruminal free lipopolysaccharide (LPS) increases during SARA and translocates into the blood circulation activating an inflammatory response. Ruminal fermentation and cellular immunity are encouraged by supplementing hay with calf starter during weaning. SARA calves given a 5-day repeated administration of a bacteria-based probiotic had stable ruminal pH levels (6.6-6.8). The repeated administration of probiotics enhance cellular immune function and encourage recovery from diarrhea in pre-weaning calves. Furthermore, the ruminal fermentation could guard against acute and short-term feeding changes, and changes in the rumen microbial composition of SARA cattle might occur following changes in ruminal pH. The repeated bouts of low ruminal pH in SARA cattle might be associated with depression of cellular immunity.

  18. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers...... for the diagnosis of SARA are needed. The goal of this study was to evaluate clinical signs of SARA and to investigate the use of blood, faecal and urinary parameters as indicators of SARA. Six lactating, rumen cannulated, Danish Holstein cows were used in a cross-over study with three periods. The first and second...... periods included two cows on control diet and two cows on nutritional SARA challenge. The third period only included two cows on SARA challenge. Control diet was a conventional total mixed ration [45.5% dry matter (DM), 17.8% crude protein, 43.8% neutral detergent fibre, and 22.5% acid detergent fibre (DM...

  19. Fort Lee's Comprehensive Peer Outreach Program. (United States)

    Kehayan, V. Alex

    This paper describes the Peer Outreach Service Team (POST), a peer multi-service, student support system organization operating in the Fort Lee schools in Fort Lee, New Jersey. The goals of the POST program are described as reducing numbers of school dropouts as well as levels of negative behavior, chemical dependency, teenage depression, and…

  20. Tim Berners-Lee during the WSIS

    CERN Multimedia

    Maximilien Brice


    Tim Berners-Lee stands in front of the first web server at the Geneva Palexpo during the World Summit on the Information Society (WSIS) in 2003. Tim Berners-Lee developed the first network and server system that lead to the World Wide Web.

  1. Marion McGregor Lee Loy (United States)

    Rossi, Joe


    This article presents an interview with Marion Frances Kaleleonalani McGregor Lee Loy who served as a teacher in the Hawai'i Department of Education from 1935 to 1974. Marion McGregor Lee Loy was born in 1911 in Honolulu. She attended Central Grammar and Lincoln Grammar schools before entering Kamehameha School for Girls in the ninth grade. Lee…

  2. The Earl Lee Street Art Campaign (United States)



    This article describes a catchy phrase with more to its meaning than first view. A slogan "All the girls love Earl Lee," appears in street art around the world. Earl Lee is a lovable, handsome man who owns the fictitious Earl Lube industries. Originally intended to bring a smile to people's faces at a time when there wasn't much to smile…

  3. Teologi Politik Berbalu SARA Antara Ambisi dan Konspirasi

    Directory of Open Access Journals (Sweden)

    M. Sidi Ritau'din


    Full Text Available In a multi-cultural democracy based on Pancasila philosophy of independence, ethnic, religious, racial and intergroup issues it call (SARA are political indicators that can trigger conflict and division. If the player is ambitious and power-hungry, then he will not hesitate to do everything he can to gain power, even build a big conspiracy using SARA as a tool to divide the ummah, then he emerges as a unifier and presents programs prestigious sympathetic, there Imaging actions and slogans of the pro poor people, but essentially no more as political deceit, a false gift of hope, it familiar said (PHP that never realized, only reap the political advantage in the game of SARA, even not hesitate to shout thief when he Itself is a thieving thief based on greed and greed where the horizontal relations of fellow human beings deny the bond of faith as the foundation. Political conspiracy based on political interests and abuse of power, an action of political pathology that is not civilized that has become a trend of contemporary politics and globalization.

  4. Corporate Responsibility

    DEFF Research Database (Denmark)

    Waddock, Sandra; Rasche, Andreas


    We define and discuss the concept of corporate responsibility. We suggest that corporate responsibility has some unique characteristics, which makes it different from earlier conceptions of corporate social responsibility. Our discussion further shows commonalities and differences between corporate...... responsibility and related concepts, such as corporate citizenship and business ethics. We also outline some ways in which corporations have implemented corporate responsibility in practice....

  5. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. (United States)

    Trotonda, María Pilar; Manna, Adhar C; Cheung, Ambrose L; Lasa, Iñigo; Penadés, José R


    The biofilm-associated protein Bap is a staphylococcal surface protein involved in biofilm formation. We investigated the influence of the global regulatory locus sarA on bap expression and Bap-dependent biofilm formation in three unrelated Staphylococcus aureus strains. The results showed that Bap-dependent biofilm formation was diminished in the sarA mutants by an agr-independent mechanism. Complementation studies using a sarA clone confirmed that the defect in biofilm formation was due to the sarA mutation. As expected, the diminished capacity to form biofilms in the sarA mutants correlated with the decreased presence of Bap in the bacterial surface. Using transcriptional fusion and Northern analysis data, we demonstrated that the sarA gene product acts as an activator of bap expression. Finally, the bap promoter was characterized and the transcriptional start point was mapped by the rapid amplification of cDNA ends technique. As expected, we showed that purified SarA protein binds specifically to the bap promoter, as determined by gel shift and DNase I footprinting assays. Based on the previous studies of others as well as our work demonstrating the role for SarA in icaADBC and bap expression, we propose that SarA is an essential regulator controlling biofilm formation in S. aureus.

  6. Generalization of Friedberg-Lee symmetry (United States)

    Huang, Chao-Shang; Li, Tianjun; Liao, Wei; Zhu, Shou-Hua


    We study the possible origin of Friedberg-Lee symmetry. First, we propose the generalized Friedberg-Lee symmetry in the potential by including the scalar fields in the field transformations, which can be broken down to the Friedberg-Lee symmetry spontaneously. We show that the generalized Friedberg-Lee symmetry allows a typical form of Yukawa couplings, and the realistic neutrino masses and mixings can be generated via the seesaw mechanism. If the right-handed neutrinos transform nontrivially under the generalized Friedberg-Lee symmetry, we can have the testable TeV scale seesaw mechanism. Second, we present two models with the SO(3)×U(1) global flavor symmetry in the lepton sector. After the flavor symmetry breaking, we can obtain the charged lepton masses, and explain the neutrino masses and mixings via the seesaw mechanism. Interestingly, the complete neutrino mass matrices are similar to those of the above models with generalized Friedberg-Lee symmetry. So the Friedberg-Lee symmetry is the residual symmetry in the neutrino mass matrix after the SO(3)×U(1) flavor symmetry breaking.

  7. Gene : CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ctin receptor 1 isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin... receptor 1 isoform 4 [Macaca mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin re...ceptor 1 isoform 5 [Macaca mulatta] ref|XP_001105878.1| PREDICTED: similar to adiponectin... receptor 1 isoform 6 [Macaca mulatta] ref|XP_001105957.1| PREDICTED: similar to adiponectin recepto...CBRC-SARA-01-1167 Novel UN B UNKNOWN ADR1_HUMAN 1e-139 67% ref|XP_001105680.1| PREDICTED: similar to adipone

  8. Factors contributing to the biofilm-deficient phenotype of Staphylococcus aureus sarA mutants.

    Directory of Open Access Journals (Sweden)

    Laura H Tsang

    Full Text Available Mutation of sarA in Staphylococcus aureus results in a reduced capacity to form a biofilm, but the mechanistic basis for this remains unknown. Previous transcriptional profiling experiments identified a number of genes that are differentially expressed both in a biofilm and in a sarA mutant. This included genes involved in acid tolerance and the production of nucleolytic and proteolytic exoenzymes. Based on this we generated mutations in alsSD, nuc and sspA in the S. aureus clinical isolate UAMS-1 and its isogenic sarA mutant and assessed the impact on biofilm formation. Because expression of alsSD was increased in a biofilm but decreased in a sarA mutant, we also generated a plasmid construct that allowed expression of alsSD in a sarA mutant. Mutation of alsSD limited biofilm formation, but not to the degree observed with the corresponding sarA mutant, and restoration of alsSD expression did not restore the ability to form a biofilm. In contrast, concomitant mutation of sarA and nuc significantly enhanced biofilm formation by comparison to the sarA mutant. Although mutation of sspA had no significant impact on the ability of a sarA mutant to form a biofilm, a combination of protease inhibitors (E-64, 1-10-phenanthroline, and dichloroisocoumarin that was shown to inhibit the production of multiple extracellular proteases without inhibiting growth was also shown to enhance the ability of a sarA mutant to form a biofilm. This effect was evident only when all three inhibitors were used concurrently. This suggests that the reduced capacity of a sarA mutant to form a biofilm involves extracellular proteases of all three classes (serine, cysteine and metalloproteases. Inclusion of protease inhibitors also enhanced biofilm formation in a sarA/nuc mutant, with the combined effect of mutating nuc and adding protease inhibitors resulting in a level of biofilm formation with the sarA mutant that approached that of the UAMS-1 parent strain. These results

  9. Generalization of Friedberg-Lee Symmetry

    CERN Document Server

    Huang, Chao-Shang; Liao, Wei; Zhu, Shou-Hua


    We study the possible origin of Friedberg-Lee symmetry. First, we propose the generalized Friedberg-Lee symmetry in the potential by including the scalar fields in the field transformations, which can be broken down to the FL symmetry spontaneously. We show that the generalized Friedberg-Lee symmetry allows a typical form of Yukawa couplings, and the realistic neutrino masses and mixings can be generated via see-saw mechanism. If the right-handed neutrinos transform non-trivially under the generalized Friedberg-Lee symmetry, we can have the testable TeV scale see-saw mechanism. Second, we present two models with the $SO(3)\\times U(1)$ global flavour symmetry in the lepton sector. After the flavour symmetry breaking, we can obtain the charged lepton masses, and explain the neutrino masses and mixings via see-saw mechanism. Interestingly, the complete neutrino mass matrices are similar to those of the above models with generalized Friedberg-Lee symmetry. So the Friedberg-Lee symmetry is the residual symmetry in...

  10. Lee Iacocca and the Generation of Myth in the Spokesman Advertising Campaign for Chrysler from 1980-1984. (United States)

    Thorpe, Judie Mosier

    Applying knowledge of myth to the milieu of commercial television programming, this paper focuses on the way myth was generated in an advertising campaign that featured Lee Iacocca, chief executive officer of Chrysler Corporation, during the period of 1979-1982, when Chrysler moved from the edge of bankruptcy to financial stability. After…

  11. Low energy neutral atom imaging on the Moon with the SARA instrument aboard Chandrayaan-1 mission

    Indian Academy of Sciences (India)

    Anil Bhardwaj; Stas Barabash; Yoshifumi Futaana; Yoichi Kazama; Kazushi Asamura; David McCann; R Sridharan; Mats Holmstrom; Peter Wurz; Rickard Lundin


    This paper reports on the Sub-keV Atom Reflecting Analyzer (SARA)experiment that will be flown on the first Indian lunar mission Chandrayaan-1.The SARA is a low energy neutral atom (LENA)imaging mass spectrometer,which will perform remote sensing of the lunar surface via detection of neutral atoms in the energy range from 10 eV to 3 keV from a 100 km polar orbit.In this report we present the basic design of the SARA experiment and discuss various scientific issues that will be addressed.The SARA instrument consists of three major subsystems:a LENA sensor (CENA),a solar wind monitor (SWIM),and a digital processing unit (DPU).SARA will be used to image the solar wind –surface interaction to study primarily the surface composition and surface magnetic anomalies and associated mini-magnetospheres.Studies of lunar exosphere sources and space weathering on the Moon will also be attempted.SARA is the first LENA imaging mass spectrometer of its kind to be flown on a space mission.A replica of SARA is planned to fly to Mercury onboard the BepiColombo mission.

  12. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation.

    Directory of Open Access Journals (Sweden)

    Jessica N Snowden

    Full Text Available Infection is a frequent and serious complication following the treatment of hydrocephalus with CSF shunts, with limited therapeutic options because of biofilm formation along the catheter surface. Here we evaluated the possibility that the sarA regulatory locus engenders S. aureus more resistant to immune recognition in the central nervous system (CNS based on its reported ability to regulate biofilm formation. We utilized our established model of CNS catheter-associated infection, similar to CSF shunt infections seen in humans, to compare the kinetics of bacterial titers, cytokine production and inflammatory cell influx elicited by wild type S. aureus versus an isogenic sarA mutant. The sarA mutant was more rapidly cleared from infected catheters compared to its isogenic wild type strain. Consistent with this finding, several pro-inflammatory cytokines and chemokines, including IL-17, CXCL1, and IL-1β were significantly increased in the brain following infection with the sarA mutant versus wild type S. aureus, in agreement with the fact that the sarA mutant displayed impaired biofilm growth and favored a planktonic state. Neutrophil influx into the infected hemisphere was also increased in the animals infected with the sarA mutant compared to wild type bacteria. These changes were not attributable to extracellular protease activity, which is increased in the context of SarA mutation, since similar responses were observed between sarA and a sarA/protease mutant. Overall, these results demonstrate that sarA plays an important role in attenuating the inflammatory response during staphylococcal biofilm infection in the CNS via a mechanism that remains to be determined.

  13. System Analysis and Risk Assessment system (SARA) Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Sattison, M B; Russell, K D; Skinner, N L [EG and G Idaho, Inc., Idaho Falls, ID (United States)


    This NUREG is the tutorial for the System Analysis and Risk Assessment System (SARA) Version 4.0, a microcomputer-based system used to analyze the safety issues of a family (i.e., a power plant, a manufacturing facility, any facility on which a probabilistic risk assessment (PRA) might be performed). A series of lessons are provided that walk the user through some basic steps common to most analyses performed with SARA. The example problems presented in the lessons build on one another, and in combination, lead the user through all aspects of SARA sensitivity analysis.

  14. SarA influences the sporulation and secondary metabolism in Streptomyces coelicolor M145

    Institute of Scientific and Technical Information of China (English)

    Xijun Ou; Bo Zhang; Lin Zhang; Kai Dong; Chun Liu; Guoping Zhao; Xiaoming Ding


    The filamentous bacteria Streptomyces exhibit a complex life cycle involving morphological differentiation and secondary metabolism. A putative membrane protein gene sarA (sco4069), sporulation and antibiotic production related gene A, was partially characterized in Streptomyces coelicolor M145. The gene product had no characterized functional domains and was highly conserved in Streptomyces. Compared with the wild-type M145, the sarA mutant accelerated sporulation and dramatically decreased the production of actinorhodin and undecylprodigiosin.Reverse transcription-polymerase chain reaction analysis showed that SarA influenced antibiotic production by controlling the abundance of actll-orf4 and redZ messenger RNA.

  15. Sara, a patient with borderline personality structure: A "crisis" management

    Directory of Open Access Journals (Sweden)

    Paola Marinelli


    Full Text Available In this article the author examines some significant passages of his treatment of a patient with borderline personality structure, with the intention of giving a formative contribution to the delicate issue of the search for congruence between theory and clinic operations. This reflection is therefore an opportunity to integrate these aspects. The individualization of the therapeutic relationship in the theoretical framework of group analysis allowed the emotional investment in the person of the therapist, which is useful in the construction of a meaningful relationship on the human, emotional and cognitive plane; a space within which it has become increasingly possible for Sara, share and process emotions, re-build, contact parts of the self frustrated and disappointed, perceive less and less the void and become less vulnerable, being able to pull over to the original trauma. 

  16. PDB: CBRC-SARA-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0838 3ODU,3OE0,3OE6,3OE8,3OE9, Region:8-324(Identity=89%) PDB:3ODU Chain:A (X-ray Resolution...=2.5),Region:8-324(Identity=89%) PDB:3OE0 Chain:A (X-ray Resolution=2.9),Region:8-330(...Identity=90%) PDB:3OE6 Chain:A (X-ray Resolution=3.2),Region:8-324(Identity=89%) PDB:3OE8 Chain:A (X-ray Resolution...=3.1),Region:8-324(Identity=89%) PDB:3OE9 Chain:A (X-ray Resolution=3.1), ...

  17. Corporate Branding and Corporate Reputation

    DEFF Research Database (Denmark)

    Karmark, Esben


    Corporate branding has been seen as developing in “waves”. This chapter explores the links between corporate branding and corporate reputation as they emerge in the context of three waves of corporate branding. It highlights the way in which the two constructs have related to each other through o...... for corporate brands and corporate communication.......Corporate branding has been seen as developing in “waves”. This chapter explores the links between corporate branding and corporate reputation as they emerge in the context of three waves of corporate branding. It highlights the way in which the two constructs have related to each other through...... organizational culture and identity, and how, although characterized by parallel developments, new ideas and models from a “third” wave of corporate branding challenge prevailing assumptions of corporate reputation particularly in terms of the assumptions that reputations emerge from authentic and transparent...

  18. Robert Lee Pyle honored with emeritus status


    Douglas, Jeffrey S.


    Dr. Robert Lee Pyle of Blacksburg, professor of cardiology in the Department of Small Animal Clinical Science at the Virginia-Maryland Regional College of Veterinary Medicine at Virginia Tech, was conferred the "professor emeritus" title by the Virginia Tech Board of Visitors during the board's quarterly meeting August 27.

  19. Courtland Lee: A Global Advocate for Counseling (United States)

    Gladding, Samuel T.


    Courtland Lee is exemplary in his accomplishments nationally and internationally. His academic achievements are notable in multicultural counseling and social justice. His leadership in counseling has been outstanding with his having served as president of the American Counseling Association, the Association for Multicultural Counseling and…

  20. JFK in Blackface: Spike Lee's "Malcolm X." (United States)

    Walker, Clarence E.


    Discusses the failure of filmmaker Spike Lee to grapple with the real politics of Malcolm X before and after he left the Nation of Islam. Acknowledging the complexity of the man and his context would avoid creating a mythical figure similar to Oliver Stone's movie "JFK." (SLD)

  1. Depression of biofilm formation and antibiotic resistance by sarA disruption in Staphylococcus epidermidis

    Institute of Scientific and Technical Information of China (English)

    Ju-Hong Tao; Chang-Sheng Fan; Shan-E Gao; Hai-Jiao Wang; Guo-Xin Liang; Qing Zhang


    AIM: To study the effects of disruption of sarA gene on biofilm formation and antibiotic resistance of Staphylococcus epidermidis (S. epidermidis ).METHODS: In order to disrupt sarA gene, the doublecrossover homologous recombination was applied in S. epidermidis RP62A, and tetracycline resistance gene (tet) was used as the selective marker which was amplified by PCR from the pBR322 and inserted into the locus between sarA upstream and downstream,resulting in pBT2△sarA. By electroporation, the plasmid pBT2△sarA was transformed into S. epidermidis.Gene transcription was detected by real-time reverse transcription-PCR (RT-PCR). Determination of biofilm was performed in 96-well flat-bottomed culture plates, and antibiotic resistance was analyzed with test tube culture by spectrophotometry at 570 nm respectively.RESULTS: A sarA disrupted strain named S. epidermidis RP62A△sarA was constructed, which was completely defective in biofilm formation, while the sarA complement strain RP62A△sarA (pHPS9sarA) restored the biofilm formation phenotype. Additionally, the knockout of sarA resulted in decreased erythromycin and kanamycin resistance of S. epidermidis RP62A. Compared to the original strain, S. epidermidis RP62A△sarA had an increase of the sensitivity to erythromycin at 200-400 μg/mL and kanamycin at 200-800 μg/mL respectively.CONCLUSION: The knockout of sarA can result in the defect in biofilm formation and the decreased erythromycin and kanamycin resistance in S. epidermidis RP62A.

  2. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. (United States)

    Valle, Jaione; Toledo-Arana, Alejandro; Berasain, Carmen; Ghigo, Jean-Marc; Amorena, Beatriz; Penadés, José R; Lasa, Iñigo


    Staphylococcus aureus biofilm formation is associated with the production of the polysaccharide intercellular adhesin (PIA/PNAG), the product of the ica operon. The staphylococcal accessory regulator, SarA, is a central regulatory element that controls the production of S. aureus virulence factors. By screening a library of Tn917 insertions in a clinical S. aureus strain, we identified SarA as being essential for biofilm development. Non-polar mutations of sarA in four genetically unrelated S. aureus strains decreased PIA/PNAG production and completely impaired biofilm development, both in steady state and flow conditions via an agr-independent mechanism. Accordingly, real-time PCR showed that the mutation in the sarA gene resulted in downregulation of the ica operon transcription. We also demonstrated that complete deletion of sigmaB did not affect PIA/PNAG production and biofilm formation, although it slightly decreased ica operon transcription. Furthermore, the sarA-sigmaB double mutant showed a significant decrease of ica expression but an increase of PIA/PNAG production and biofilm formation compared to the sarA single mutant. We propose that SarA activates S. aureus development of biofilm by both enhancing the ica operon transcription and suppressing the transcription of either a protein involved in the turnover of PIA/PNAG or a repressor of its synthesis, whose expression would be sigmaB-dependent.

  3. On the linear programming bound for linear Lee codes. (United States)

    Astola, Helena; Tabus, Ioan


    Based on an invariance-type property of the Lee-compositions of a linear Lee code, additional equality constraints can be introduced to the linear programming problem of linear Lee codes. In this paper, we formulate this property in terms of an action of the multiplicative group of the field [Formula: see text] on the set of Lee-compositions. We show some useful properties of certain sums of Lee-numbers, which are the eigenvalues of the Lee association scheme, appearing in the linear programming problem of linear Lee codes. Using the additional equality constraints, we formulate the linear programming problem of linear Lee codes in a very compact form, leading to a fast execution, which allows to efficiently compute the bounds for large parameter values of the linear codes.

  4. Corporate Law and Corporate Governance


    Roberta Romano


    We have seen a revival in interest in corporate law and corporate governance since the 1980s, as researchers applied the tools of the new institutional economics and modern corporate finance to analyze the new transactions emerging in the 1980s takeover wave. This article focuses on three mechanisms of corporate governance to illustrate the analytical usefulness of transaction cost economics for corporate law. They are the board of directors; relational investing, a form of block ownership in...

  5. Leptogenesis with Friedberg-Lee Symmetry (United States)

    Araki, Takeshi; Geng, C. Q.

    We consider the µ - τ symmetric Friedberg-Lee (FL) symmetry for the neutrino sector and show that a specific FL translation leads to the tribimaximal mixing pattern of the Maki-Nakagawa-Sakata (MNS) matrix. We also apply the symmetry to the type-I seesaw framework and address the baryon asymmetry of the universe through the leptogenesis mechanism. We try to establish a relation between the net baryon asymmetry and CP phases included in the MNS matrix.

  6. Leptogenesis with Friedberg-Lee Symmetry

    CERN Document Server

    Araki, Takeshi


    We consider the $\\mu-\\tau$ symmetric Friedberg-Lee (FL) symmetry for the neutrino sector and show that a specific FL translation leads to the tribimaximal mixing pattern of the Maki-Nakagawa-Sakata (MNS) matrix. We also apply the symmetry to the type-I seesaw framework and address the baryon asymmetry of the universe through the leptogenesis mechanism. We try to establish a relation between the net baryon asymmetry and CP phases included in the MNS matrix.

  7. Single-access retroperitoneoscopic adrenalectomy (SARA) versus conventional retroperitoneoscopic adrenalectomy (CORA): a case-control study. (United States)

    Walz, Martin K; Groeben, Harald; Alesina, Piero F


    Stimulated by the concept of Natural Orifice Transluminal Endoscopic Surgery (NOTES), minimizing the access even further has become a new trend in minimally invasive surgery. We compare our recently described new method of endoscopic single-access adrenalectomy with the conventional retroperitoneoscopic approach in a matched-pairs study. Fifty single-access retroperitoneoscopic adrenalectomies (SARA) were performed in 47 selected patients suffering from Conn's adenomas (n = 20), pheochromocytomas (n = 15), Cushing's adenomas (n = 6), and other diseases (n = 6). For SARA, a single 2-cm skin incision beneath the 12th rib was used. Following creation of the retroperitoneal space with the rigid endoscope, dissection was carried out single-handed. Another 47 patients served as control group; they were treated by the traditional retroperitoneoscopic three-port approach (CORA). Patients were matched with respect to gender, body mass index, diagnoses, tumor size, and tumor site. Mortality was zero and no major complications occurred in both groups. SARA was completed in 41 cases (86%). The overall complication rate was 8.5% in SARA and 6.4% in CORA. Operative time was longer for SARA (56 +/- 28 min) than for CORA (40 +/- 12 min) (P CORA patients (P = 0.01). Mean hospital stay was 2.4 +/- 0.7 days (SARA) and 3.1 +/- 1.2 days (CORA) (P < 0.01). Because feasibility and safety of SARA could be demonstrated in a large group of selected patients, this surgical technique may represent a new milestone in minimally invasive endocrine surgery.

  8. Literary And Psychological Journey Into Lee Brightmans Consciousness

    Directory of Open Access Journals (Sweden)

    Moza Al Hammoudi


    Full Text Available The purpose of this research is to analyze the character of Lee Brightman from both literary and psychological perspective. Lee Brightman is a main character in Elizabeth Hayness novel Into the Darkest Corner. Lee has psychopathic traits which fall under the dark triad personalities narcissism Machiavellianism and psychopathy. After Catharine Baily falls in love with him he starts to change his attitude towards her. Lee uses emotional psychological and physical abuse against Catharine. This research helps to uncover the reasons behind Lee Brightmans domestic violence. In addition this research serves as a case study of someone who has psychological problems.

  9. Yang-Lee Circle Theorem for an Antiferromagnetic Heisenberg Ladder

    Institute of Scientific and Technical Information of China (English)



    The Yang-Lee zeros of an antiferromagnetic Heisenberg ladder model are determined. It is found that if J4≤0 Yang-Lee zeros are located on the unit circle and on the negative real axis in the complex activity plane. In particular, if J4≤0 and 2J2≥J4, Yang-Lee zeros are located on the unit circle and the Yang-Lee circle theorem is valid. If J4 > 0, Yang-Lee zeros are located on some complicated curves.

  10. Corporate Awakening

    DEFF Research Database (Denmark)

    LaFrance, Julie; Lehmann, Martin


    Predominantly since the 1992 Rio Summit, corporations have been increasingly pursuing partnerships with public institutions including governments, international organisations and NGOs that aim to contribute to sustainable development activities. Partnerships have become more common as corporation...... public-private partnerships. These theoretical perspectives are used to gain a deeper understanding of the corporate drivers that motivated TOTAL S.A. to approach UNESCO for cooperation on community development programs in Myanmar.......Predominantly since the 1992 Rio Summit, corporations have been increasingly pursuing partnerships with public institutions including governments, international organisations and NGOs that aim to contribute to sustainable development activities. Partnerships have become more common as corporations...... react to mounting pressure from corporate stakeholders, civil society and government on the responsible nature of their business practices. The corporate awakening towards a broader role of business in society and the trend of corporations embracing partnerships has led many to question the driving...

  11. Rand Corporation (United States)

    ... Toggle Search Site-wide Search Search RAND RAND Corporation Provides Objective Research Services and Public Policy Analysis ... on Twitter Share on LinkedIn About The RAND Corporation is a research organization that develops solutions to ...

  12. Corporate Governance


    International Finance Corporation; UN Global Compact


    Corporate citizenship - a commitment to ethical behavior in business strategy, operations, and culture - has been on the periphery of corporate governance and board leadership, linked mainly to corporate reputation. However, in today’s globalized and interconnected world, investors, creditors, and other stakeholders have come to recognize that environmental, social, and governance responsi...

  13. Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. (United States)

    Kressmann, Sabine; Campos, Claudia; Castanon, Irinka; Fürthauer, Maximilian; González-Gaitán, Marcos


    Asymmetric division of neural precursor cells contributes to the generation of a variety of neuronal types. Asymmetric division is mediated by the asymmetric inheritance of fate determinants by the two daughter cells. In vertebrates, asymmetric fate determinants, such as Par3 and Mib, are only now starting to be identified. Here we show that, during mitosis of neural precursors in zebrafish, directional trafficking of Sara endosomes to one of the daughters can function as such a determinant. In asymmetric lineages, where one daughter cell becomes a neuron (n cell) whereas the other divides again to give rise to two neurons (p cell), we found that the daughter that inherits most of the Sara endosomes acquires the p fate. Sara endosomes carry an endocytosed pool of the Notch ligand DeltaD, which is thereby itself distributed asymmetrically. Sara and Notch are both essential for cell fate assignation within asymmetric lineages. Therefore, the Sara endosome system determines the fate decision between neuronal differentiation and mitosis in asymmetric lineages and thereby contributes to controlling the number of neural precursors and differentiated neurons during neurogenesis in a vertebrate.

  14. Corporate attributes and corporate accruals

    National Research Council Canada - National Science Library

    Md Shamimul Hasan; Normah Omar; Rashidah Abdul Rahman; Syed Zabid Hossain


    ... (discretionary accruals) in Bangladesh. The behaviour of corporate accruals is explained by corporate attributes such as asset size, turnover, earnings per share, number of shareholders, year of listing, international link of audit firm...


    Directory of Open Access Journals (Sweden)

    Sulistyastuti Sutomo


    Full Text Available Not only does art   have   self-fullfillment, but  it also has axiological  benefits both socially, culturally, religiously, and economiclally.  So does Sara Douda dance.  Sara Douda aesthetics  is first contained  in its whole dance movements. In addition, it  can also be found in the whole dance equipments.  Moreover,  this dance aesthetics  may  also be contained in the verbal symbols in the speech forms  prior to the dance performance. However,  both verbal and non-verbal aesthetical forms are incorporated by the pieces of socio-cultural and  religious values in the Loli community about  their honoring their ancestors,  having social harmony, and  highly respecting each other among the community members. This study uses a cultural linguistic approach to find out and to review the aesthetics of Sara Douda dance.   Seni memang memiliki kepenuhan dalam dirinya sendiri. Tetapi ia juga sekaligus punya faedah aksiologis, baik secara sosial, kultural, religius maupun secara ekonomis. Tarian Sara Douda pun demikian. Estetika Sara Douda pertama-tama ada dalam semua gerak tariannya. Juga dalam seluruh perlengkapan tarian tersebut. Bukan itu saja, estetika tarian ini juga ada dalam simbol-simbol verbal berupa tuturan menjelang tarian. Tetapi baik bentuk-bentuk estetisasi nonverbal maupun verbal, sama-sama disatukan oleh kepingan-kepingan nilai-nilai sosio-kultural dan religius masyarakat Loli tentang penghormatan kepada leluhur, tentang harmoni sosial, dan tentang penghargaan yang tinggi terhadap satu sama lain. Penelitian ini menggunakan pendekatan linguistik kebudayaan demi menemukan dan menelaah estetika dalam tarian Sara Douda

  16. Corporate Awakening

    DEFF Research Database (Denmark)

    LaFrance, Julie; Lehmann, Martin


    Predominantly since the 1992 Rio Summit, corporations have been increasingly pursuing partnerships with public institutions including governments, international organisations and NGOs that aim to contribute to sustainable development activities. Both the business community and public organisations...... are recognizing the potential benefits of public-private partnerships for furthering the Millennium Development Goals while having a positive impact on business. Partnerships have become more common as corporations react to mounting pressure from corporate stakeholders, civil society and government...... on the responsible nature of their business practices. The accountability of corporations has moved beyond the traditional obligations of addressing shareholder demands and today, corporations must be accountable to society and all stakeholders affected by global development. The corporate awakening towards...

  17. Corporate Foundations

    DEFF Research Database (Denmark)

    Herlin, Heidi; Thusgaard Pedersen, Janni


    This paper aims to explore the potential of Danish corporate foundations as boundary organizations facilitating relationships between their founding companies and non-governmental organizations (NGOs). Hitherto, research has been silent about the role of corporate foundations in relation to cross......-sector partnerships. The results of this paper are based on interviews, participant observations, and organizational documents from a 19-month empirical study of a Danish corporate foundation. Findings suggest that corporate foundations have potential to act as boundary organizations and facilitate collaborative...... action between business and NGOs through convening, translation, collaboration, and mediation. Our study provides valuable insights into the tri-part relationship of company foundation NGO by discussing the implications of corporate foundations taking an active role in the realm of corporate social...

  18. Corporate Taxation and Corporate Governance

    DEFF Research Database (Denmark)

    Köthenbürger, Marko; Stimmelmayr, Michael


    interests between shareholders and managers. We set up an agency model and analyze the crucial issue in corporate taxation of whether the normal return on investment should be exempted from taxation. The findings suggest that the divergence of interests may be intensified and welfare reduced...... if the corporate tax system exempts the normal return on investment from taxation. The optimal system may well use the full return on investment as a tax base. Hence, tax systems such as an Allowance for Corporate Equity (ACE) or a Cash-flow tax do not have the familiar efficiency-enhancing effects in the presence......The effects of corporate taxation on firm behavior have been extensively discussed in the neoclassical model of firm behavior which abstracts from agency problems. As emphasized by the corporate governance literature, corporate investment behavior is however crucially influenced by diverging...

  19. Corporate Taxation and Corporate Governance

    DEFF Research Database (Denmark)

    Köthenbürger, Marko; Stimmelmayr, Michael


    The effects of corporate taxation on firm behavior have been extensively discussed in the neoclassical model of firm behavior which abstracts from agency problems. As emphasized by the corporate governance literature, corporate investment behavior is however crucially influenced by diverging...... interests between shareholders and managers. We set up an agency model and analyze the crucial issue in corporate taxation of whether the normal return on investment should be exempted from taxation. The findings suggest that the divergence of interests may be intensified and welfare reduced...... if the corporate tax system exempts the normal return on investment from taxation. The optimal system may well use the full return on investment as a tax base. Hence, tax systems such as an Allowance for Corporate Equity (ACE) or a Cash-flow tax do not have the familiar efficiency-enhancing effects in the presence...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|YP_001391163.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langel...and] gb|ABS40017.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langeland] YP_001391163.1 3.1 34% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiest...erase 3 (Neutral sphingomyelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1323 ref|NP_001008277.1| rhodopsin [Canis lupus familiaris] ref|XP_855...608.1| PREDICTED: rhodopsin [Canis familiaris] emb|CAA70209.1| unnamed protein product [Canis familiaris] NP_001008277.1 2e-62 94% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|YP_857334.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK35937.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_857334.1 5.5 42% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1116 gb|AAC62470.1| chemokine receptor CCR5 [Cercocebus torquatus torq...uatus] gb|AAC62473.1| chemokine receptor CCR5 [Cercocebus torquatus torquatus] AAC62470.1 3e-72 86% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_776833.1| opioid receptor, mu 1 [Bos taurus] sp|P79350|OPRM_BOVIN Mu-type opioid... receptor (MOR-1) gb|AAB49477.2| mu opioid receptor [Bos taurus] NP_776833.1 0.0 91% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_001029087.1| opioid receptor, mu 1 [Pan troglodytes] sp|Q5...IS39|OPRM_PANTR Mu-type opioid receptor (MOR-1) gb|AAV74327.1| opioid receptor MU-1 [Pan troglodytes] NP_001029087.1 0.0 90% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0854 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0854 gb|EAW79490.1| calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal...eptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism), isoform CRA_c [Homo sapiens] EAW79490.1 0.0 90% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_001125845.1| hypothetical protein GTNG_1736 [Geobacillus thermoden...itrificans NG80-2] gb|ABO67100.1| Conserved hypothetical protein [Geobacillus thermodenitrificans NG80-2] YP_001125845.1 0.47 23% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|NP_965427.1| hypothetical protein LJ1621 [Lactobacillus johnson...ii NCC 533] gb|AAS09393.1| hypothetical protein LJ_1621 [Lactobacillus johnsonii NCC 533] NP_965427.1 0.12 24% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1366 gb|AAI40135.1| Olfactory receptor 1239 [synthetic construct] gb|A...AI40175.1| Olfactory receptor 1239 [synthetic construct] gb|AAI43150.1| Olfactory receptor 1239 [synthetic construct] AAI40135.1 2e-80 82% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  17. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers fo...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0590 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0590 ref|NP_297344.1| hypothetical protein XF0051 [Xylella fastidiosa ...9a5c] gb|AAF82864.1|AE003859_5 hypothetical protein XF_0051 [Xylella fastidiosa 9a5c] NP_297344.1 8e-19 51% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0430 ref|NP_878187.1| NADH dehydrogenase subunit 1 [Fejervarya limnoch...aris] gb|AAO12107.1| NADH dehydrogenase subunit 1 [Fejervarya limnocharis] NP_878187.1 2.5 29% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1095 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1095 ref|XP_001231930.1| PREDICTED: similar to claudin 14b [Gallus gal...lus] ref|XP_001231960.1| PREDICTED: similar to claudin 14b [Gallus gallus] XP_001231930.1 6e-34 37% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1648 ref|NP_694727.1| histamine H4 receptor [Mus musculus] gb|AAK97380.1|AF358859_1 histamine... H4 receptor [Mus musculus] gb|EDL01579.1| histamine H4 receptor [Mus musculus] NP_694727.1 1e-129 61% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

  3. Rumen Microbiome Composition in Cattle during Grain-Induced Subacute Ruminal Acidosis (SARA)

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Derakshani, Hooman; Li, Shucong


    day of the control period, and first and last day of full SARA-feeding. DNA was extracted and V4 region of bacterial 16S rRNA amplified and subjected to Illumina sequencing. Data was analyzed using QIIME pipelines and resultant operational taxonomic units (OTUs) were aligned to Greengenes database...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|ZP_00743402.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO52327.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00743402.1 0.20 36% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0256 ref|ZP_00739965.1| Integral membrane protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO55770.1| Integral membrane protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00739965.1 1.3 24% ...

  6. The new species of Mysidacea (Crustacea), Anchialina labatus and Gastrosaccus sarae, from south west Australia

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Descriptions of two new sepcies Anchialina labatus and Gastrosaccus sarae, are give. A. lobatus is distinguished from the other species of the genus by the presence of a hairy lobe on the first segment of the antennule, by the modified setae...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001003037.1| melanin-concentrating hormone receptor 2 [ lupus familiaris] gb|AAM51852.1| melanin-concentrating hormone receptor subtype 2 [Canis familiaris] NP_001003037.1 1e-126 73% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001038074.1| putative melanin concentrating hormone recept...or 2 [Sus scrofa] emb|CAJ55683.1| putative melanin concentrating hormone receptor 2 [Sus scrofa] NP_001038074.1 1e-129 73% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_001337495.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumonia...e MGH 78578] gb|ABR79228.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001337495.1 0.93 29% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0303 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0303 ref|YP_001109469.1| valine-pyruvate aminotransferase [Saccharopol...yspora erythraea NRRL 2338] emb|CAM06544.1| valine-pyruvate aminotransferase [Saccharopolyspora erythraea NRRL 2338] YP_001109469.1 5.0 33% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_873218.1| chitinase. Glycosyl Hydrolase family 18. [Acidot...hermus cellulolyticus 11B] gb|ABK53232.1| chitinase. Glycosyl Hydrolase family 18. [Acidothermus cellulolyticus 11B] YP_873218.1 9.3 29% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01788010.1| multidrug resistance protein [Haemophilus influenza...e 3655] gb|EDJ93712.1| multidrug resistance protein [Haemophilus influenzae 3655] ZP_01788010.1 0.22 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01792636.1| multidrug resistance protein [Haemophilus influenza...e PittHH] gb|EDK09769.1| multidrug resistance protein [Haemophilus influenzae PittHH] ZP_01792636.1 0.22 27% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01797490.1| multidrug resistance protein [Haemophilus influenza...e R3021] gb|EDK13267.1| multidrug resistance protein [Haemophilus influenzae 22.4-21] ZP_01797490.1 0.22 27% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01785759.1| multidrug resistance protein [Haemophilus influenza...e 22.4-21] gb|EDJ91681.1| multidrug resistance protein [Haemophilus influenzae R3021] ZP_01785759.1 0.22 27% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|YP_248596.1| multidrug resistance protein [Haemophilus influenza...e 86-028NP] gb|AAX87936.1| multidrug resistance protein [Haemophilus influenzae 86-028NP] YP_248596.1 0.22 27% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_026098.1| NADH dehydrogenase subunit 5 [Habronattus oregon...ensis] gb|AAT02495.1| NADH dehydrogenase subunit 5 [Habronattus oregonensis] YP_026098.1 0.032 22% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0491 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0491 ref|YP_001517065.1| hypothetical protein AM1_2749 [Acaryochloris marina... MBIC11017] gb|ABW27749.1| conserved hypothetical protein [Acaryochloris marina MBIC11017] YP_001517065.1 2e-13 45% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1485 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1485 ref|YP_001518234.1| pentapeptide repeat domain protein [Acaryochloris marina... MBIC11017] gb|ABW28917.1| pentapeptide repeat domain protein [Acaryochloris marina MBIC11017] YP_001518234.1 1.9 43% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0594 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 3e-10 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1578 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1578 ref|NP_001077100.1| cOR52N9 olfactory receptor family 52 subfamily N-like [Canis lupus... familiaris] gb|ABO36681.1| 52N9 olfactory receptor protein [Canis lupus familiaris] NP_001077100.1 1e-146 78% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1392 sp|Q9BDS7|GPR15_MACFA G-protein coupled receptor 15 gb|AAK25741.1...|AF291670_1 orphan seven transmembrane receptor GPR15 [Macaca fascicularis] Q9BDS7 1e-169 81% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|ZP_01666375.1| conserved hypothetical protein 374 [Thermosinus... carboxydivorans Nor1] gb|EAX47725.1| conserved hypothetical protein 374 [Thermosinus carboxydivorans Nor1] ZP_01666375.1 0.86 31% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_001499570.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae... MTU5] gb|ABV85023.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae MTU5] YP_001499570.1 4.7 36% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1560 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1560 ref|YP_984227.1| filamentous haemagglutinin family outer membrane... protein [Polaromonas naphthalenivorans CJ2] gb|ABM39306.1| filamentous haemagglutinin family outer membrane protein [Polaromonas naphthalenivorans CJ2] YP_984227.1 2.9 30% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0844 ref|NP_949451.1| putative conjugal transfer protein trbI [Rhodopseudomonas... palustris CGA009] emb|CAE29556.1| putative conjugal transfer protein trbI [Rhodopseudomonas palustris CGA009] NP_949451.1 0.38 29% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1393 ref|NP_946691.1| hypothetical protein RPA1341 [Rhodopseudomonas p...alustris CGA009] emb|CAE26784.1| conserved hypothetical protein [Rhodopseudomonas palustris CGA009] NP_946691.1 2.4 28% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 9e-19 40% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-22 39% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1273 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1273 ref|YP_001111321.1| hypothetical protein GrBNV_gp54 [Gryllus bima...culatus nudivirus] gb|ABO45387.1| unknown [Gryllus bimaculatus nudivirus] YP_001111321.1 0.001 35% ...

  12. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow (United States)

    Fletcher, Jack M.; Morris, Robin D.


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow's long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the…

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_848356.1| PREDICTED: similar to adiponectin receptor 1 iso...form 2 [Canis familiaris] ref|XP_537118.2| PREDICTED: similar to adiponectin receptor 1 isoform 1 [Canis familiaris] XP_848356.1 1e-138 67% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1030 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-170 79% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1688 emb|CAH72617.1| chromosome 10 open reading frame 18 [Homo sapiens...] emb|CAI13368.1| chromosome 10 open reading frame 18 [Homo sapiens] CAH72617.1 1e-103 49% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ensis HTE831] sp|Q8EQA1|PRSW_OCEIH Protease prsW (Protease responsible for activating sigma-W) dbj|BAC13763....CBRC-SARA-01-0522 ref|NP_692728.1| hypothetical protein OB1807 [Oceanobacillus ihey

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_574775.1| transcriptional regulator, LysR family [Chromohalobacter salex...igens DSM 3043] gb|ABE60076.1| transcriptional regulator, LysR family [Chromohalobacter salexigens DSM 3043] YP_574775.1 9.3 31% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0831 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0831 ref|XP_001526559.1| hypothetical protein LELG_01387 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK43209.1| hypothetical protein LELG_01387 [Lodderomyces elongisporus NRRL YB-4239] XP_001526559.1 2.8 51% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0106 ref|XP_001524609.1| hypothetical protein LELG_04581 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK46400.1| hypothetical protein LELG_04581 [Lodderomyces elongisporus NRRL YB-4239] XP_001524609.1 3e-17 39% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0566 sp|Q91ZI0|CELR3_MOUSE Cadherin EGF LAG seven-pass G-type receptor... 3 precursor gb|AAL25099.1|AF427498_1 cadherin EGF LAG seven-pass G-type receptor [Mus musculus] Q91ZI0 0.0 74% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_438659.1| alcohol dehydrogenase, zinc-containing [Burkholderia thail...andensis E264] gb|ABC35120.1| alcohol dehydrogenase, zinc-containing [Burkholderia thailandensis E264] YP_438659.1 0.69 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0383 ref|XP_361721.2| hypothetical protein MGG_04195 [Magnaporthe gris...ea 70-15] gb|EDJ99501.1| hypothetical protein MGG_04195 [Magnaporthe grisea 70-15] XP_361721.2 1.4 24% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_001009331.1| cannabinoid receptor 1 [Felis catus] sp|O02777|CNR1_FELCA Canna...binoid receptor 1 (CB1) (CB-R) gb|AAB53440.1| CB1 cannabinoid receptor [Felis catus] NP_001009331.1 0.0 96% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0175 ref|NP_603288.1| hypothetical protein FN0384 [Fusobacterium nucle...atum subsp. nucleatum ATCC 25586] gb|AAL94587.1| Hypothetical protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586] NP_603288.1 9.0 32% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0415 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0415 ref|YP_547770.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS...666] gb|ABE42872.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS666] YP_547770.1 4.6 26% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|YP_468056.1| phosphate ABC transporter, permease protein [Rhizobium... etli CFN 42] gb|ABC89329.1| phosphate ABC transporter, permease protein [Rhizobium etli CFN 42] YP_468056.1 1.1 27% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1549 ref|YP_001101288.1| twin-arginine translocase subunit, sec-indepe...ndent protein export [Herminiimonas arsenicoxydans] emb|CAL63167.1| twin-arginine translocase subunit, sec-i

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1142 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1142 ref|NP_787448.1| twin-arginine translocase TatC component [Trophe...ryma whipplei str. Twist] gb|AAO44417.1| twin-arginine translocase TatC component [Tropheryma whipplei str. Twist] NP_787448.1 0.17 24% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0268 ref|XP_566600.1| hypothetical protein [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW40781.1| expressed protein [Cryptococcus neoformans var. neoformans JEC21] XP_566600.1 0.017 30% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|XP_572921.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW45614.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neoformans JEC21] XP_572921.1 0.90 26% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0348 ref|XP_001586881.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN97385.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001586881.1 2.4 28% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|XP_001588188.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN94760.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001588188.1 4.6 34% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|NP_223335.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter... pylori J99] gb|AAD06197.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter pylori J99] NP_223335.1 5.2 32% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1253 ref|YP_264377.1| hypothetical protein Psyc_1092 [Psychrobacter 273-4] gb|AAZ18943.1| conserved hypothetical protein [Psychrobacter arcticus 273-4] YP_264377.1 1.2 25% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0873 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0873 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.36 25% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.78 25% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_708759.1| hypothetical protein RHA1_ro10412 [Rhodococcus s...p. RHA1] gb|ABH00601.1| conserved hypothetical protein [Rhodococcus sp. RHA1] YP_708759.1 2.7 25% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1967 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1967 ref|ZP_00370594.1| Predicted DNA repair exonuclease [Campylobacter upsalien...sis RM3195] gb|EAL53370.1| Predicted DNA repair exonuclease [Campylobacter upsaliensis RM3195] ZP_00370594.1 0.047 31% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_001015622.1| prostacyclin receptor [Bos taurus] sp|P79393|PI2R_BOVIN Prostacy...clin receptor (Prostanoid IP receptor) (PGI receptor) (Prostaglandin I2 receptor) emb|CAB07510.1| prostacyclin receptor [Bos taurus] NP_001015622.1 1e-113 86% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|YP_001302962.1| putative flippase [Parabacteroides distasonis... ATCC 8503] gb|ABR43340.1| putative flippase [Parabacteroides distasonis ATCC 8503] YP_001302962.1 5.1 26% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0459 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0459 ref|YP_001297164.1| hypothetical protein FP2308 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44363.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001297164.1 7.3 30% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1901 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1901 ref|ZP_01733372.1| hypothetical protein FBBAL38_03440 [Flavobacte...ria bacterium BAL38] gb|EAZ96441.1| hypothetical protein FBBAL38_03440 [Flavobacteria bacterium BAL38] ZP_01733372.1 4.4 19% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0253 ref|NP_001038089.1| G protein-coupled receptor 54 [Sus scrofa] gb...|ABE73452.1| G protein-coupled receptor 54 [Sus scrofa] gb|ABE73453.1| G protein-coupled receptor 54 [Sus scrofa] NP_001038089.1 3e-51 67% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0420 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0420 ref|ZP_00588106.1| Bile acid:sodium symporter [Pelodictyon phaeocl...athratiforme BU-1] gb|EAN26387.1| Bile acid:sodium symporter [Pelodictyon phaeoclathratiforme BU-1] ZP_00588106.1 0.33 29% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available moniae subsp. pneumoniae MGH 78578] gb|ABR77598.1| putative H+/gluconate symporter ...and related permeases [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001335828.1 1.8 26% ... ...CBRC-SARA-01-1117 ref|YP_001335828.1| putative H+/gluconate symporter and related permeases [Klebsiella pneu

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1572 ref|NP_652753.1| NADH dehydrogenase subunit 5 [Tigriopus japonicu...s] dbj|BAB97224.1| NADH dehydrogenase subunit 5 [Tigriopus japonicus] NP_652753.1 0.14 27% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1999 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1999 ref|YP_126627.1| hypothetical protein lpl1277 [Legionella pneumop...hila str. Lens] emb|CAH15517.1| hypothetical protein [Legionella pneumophila str. Lens] YP_126627.1 0.38 21% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1615 ref|XP_001683626.1| formin, putative [Leishmania major] emb|CAJ04...769.1| formin, putative [Leishmania major] gb|ABQ43162.1| formin B [Leishmania major] XP_001683626.1 0.52 46% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-2040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2040 ref|NP_001075253.1| 5-hydroxytryptamine (serotonin) receptor 2A [Equus caba...llus] dbj|BAF32954.1| 5-hydroxytryptamine receptor 2A [Equus caballus] NP_001075253.1 1e-128 87% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0322 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0322 ref|ZP_01459778.1| conserved hypothetical protein [Stigmatella aura...ntiaca DW4/3-1] gb|EAU69359.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01459778.1 5.2 34% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0796 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0796 ref|ZP_01774245.1| conserved hypothetical protein [Geobacter bemi...djiensis Bem] gb|EDJ80432.1| conserved hypothetical protein [Geobacter bemidjiensis Bem] ZP_01774245.1 3e-33 39% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001029253.1| progestin and adipoQ receptor family member V...II [Rattus norvegicus] gb|AAY67652.1| progestin membrane receptor alpha [Rattus norvegicus] NP_001029253.1 1e-167 82% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001033642.1| progestin and adipoQ receptor family member V...II [Bos taurus] gb|AAI11285.1| Progestin and adipoQ receptor family member VII [Bos taurus] NP_001033642.1 1e-180 87% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1656 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1656 ref|NP_001034958.1| bitter taste receptor Modo-T2R7B [Monodelphis... domestica] dbj|BAE80368.1| bitter taste receptor [Monodelphis domestica] NP_001034958.1 2e-39 43% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1755 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1755 ref|NP_001034947.1| bitter taste receptor Modo-T2R25 [Monodelphis... domestica] dbj|BAE80373.1| bitter taste receptor [Monodelphis domestica] NP_001034947.1 1e-40 35% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0389 ref|NP_001034959.1| bitter taste receptor Modo-T2R41 [Monodelphis... domestica] dbj|BAE80381.1| bitter taste receptor [Monodelphis domestica] NP_001034959.1 1e-101 60% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_033365.1| hypothetical protein BH05300 [Bartonella hensela...e str. Houston-1] emb|CAF27338.1| hypothetical protein [Bartonella henselae str. Houston-1] YP_033365.1 0.47 19% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.40 27% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.53 28% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.67 27% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.53 28% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.52 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.67 27% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1348 ref|NP_001028103.1| cholinergic receptor, muscarinic 5 [Macaca mu...latta] sp|P56490|ACM5_MACMU Muscarinic acetylcholine receptor M5 gb|AAB95159.1| muscarinic receptor [Macaca mulatta] NP_001028103.1 0.0 88% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_898010.1| phosphatidylserine synthase [Francisella tularen...sis subsp. novicida U112] gb|ABK89256.1| phosphatidylserine synthase [Francisella tularensis subsp. novicida U112] YP_898010.1 3.0 27% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|NP_693392.1| glycerol-3-phosphate dehydrogenase [ iheyensis HTE831] dbj|BAC14427.1| glycerol-3-phosphate dehydrogenase [Oceanobacillus iheyensis HTE831] NP_693392.1 8.7 23% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1651 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.5 19% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|NP_203162.1|ND5_15766 NADH dehydrogenase subunit 5 [Tribolium... castaneum] emb|CAC51706.1| NADH dehydrogenase subunit 5 [Tribolium castaneum] NP_203162.1 5.5 32% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0795 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0795 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.8 19% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_001039945.1| opioid receptor, kappa 1 [Bos taurus] sp|Q2KIP6|OPRK_BOVIN opioid receptor (KOR-1) gb|AAI12562.1| Opioid receptor, kappa 1 [Bos taurus] NP_001039945.1 9e-80 92% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|XP_001221542.1| hypothetical protein CHGG_05447 [Chaetomium globo...sum CBS 148.51] gb|EAQ88828.1| hypothetical protein CHGG_05447 [Chaetomium globosum CBS 148.51] XP_001221542.1 0.21 28% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|XP_001229383.1| hypothetical protein CHGG_02867 [Chaetomium globo...sum CBS 148.51] gb|EAQ90932.1| hypothetical protein CHGG_02867 [Chaetomium globosum CBS 148.51] XP_001229383.1 4.1 30% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0179 ref|XP_001226930.1| predicted protein [Chaetomium globosum CBS 14...8.51] gb|EAQ84989.1| predicted protein [Chaetomium globosum CBS 148.51] XP_001226930.1 1e-04 40% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_913161.1| ATP synthase F0 subunit 6 [Romanomermis culicivo...rax] gb|ABL11588.1| ATP synthase F0 subunit 6 [Romanomermis culicivorax] YP_913161.1 0.33 24% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1697 ref|YP_913162.1| NADH dehydrogenase subunit 5 [Romanomermis culic...ivorax] gb|ABL11589.1| NADH dehydrogenase subunit 5 [Romanomermis culicivorax] YP_913162.1 0.62 35% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1085 ref|NP_829355.1| hypothetical protein CCA00489 [Chlamydophila cav...iae GPIC] gb|AAP05233.1| conserved hypothetical protein [Chlamydophila caviae GPIC] NP_829355.1 0.26 23% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008277.1| hypothetical protein pc1278 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24002.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008277.1 0.89 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0159 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0159 ref|YP_008619.1| hypothetical protein pc1620 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24344.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008619.1 7.8 27% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008281.1| hypothetical protein pc1282 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24006.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008281.1 3.4 25% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1753 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1753 ref|YP_001476411.1| amino acid permease-associated region [Serratia proteam...aculans 568] gb|ABV39283.1| amino acid permease-associated region [Serratia proteamaculans 568] YP_001476411.1 0.83 35% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1462 ref|YP_300930.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyt...icus ATCC 15305] dbj|BAE17985.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305] YP_300930.1 0.020 25% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|YP_213442.1| putative iron transport, fusion membrane protein... [Bacteroides fragilis NCTC 9343] emb|CAH09534.1| putative iron transport, fusion membrane protein [Bacteroides fragilis NCTC 9343] YP_213442.1 1.8 26% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1386 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1386 ref|XP_001165973.1| PREDICTED: prokineticin receptor 2 isoform 1 ...[Pan troglodytes] ref|XP_001166012.1| PREDICTED: prokineticin receptor 2 isoform 2 [Pan troglodytes] XP_001165973.1 1e-115 91% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1868 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1868 ref|NP_067356.2| prokineticin receptor 1 [Mus musculus] gb|AAH59003.1| Prokinetic...2080.1| unnamed protein product [Mus musculus] gb|EDK99210.1| prokineticin receptor 1 [Mus musculus] NP_067356.2 2e-55 77% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_001100989.1| non imprinted in Prader-Willi/Angelman 1 homolog [Rattus norvegicus] gb|EDL86455.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (predicted) [Rattus norvegicus] NP_001100989.1 1e-113 80% ...

  6. Tim Berners-Lee and Kofi Annan during the WSIS

    CERN Multimedia

    Patrice Loïez


    During the 2003 World Summit on the Information Society (WSIS) at Geneva Palexpo, Tim Berners-Lee W3C's director (World Wide Web consortium) was introduced to Kofi Annan, Secretary General of the United Nations. Tim Berners-Lee developed the first network and server system that lead to the World Wide Web.

  7. Tim Berners-Lee and Kofi Annan during the WSIS

    CERN Multimedia

    Patrice Loïez


    During the 2003 World Summit on the Information Society (WSIS) at Geneva Palexpo, Tim Berners-Lee, W3C's director (World Wide Web consortium) was introduced to Kofi Annan, Secretary General of the United Nations. Tim Berners-Lee developed the first network and server system that lead to the World Wide Web.

  8. Web Inventor Berners-Lee starts a Blog

    CERN Multimedia

    Olson, Parmy


    Berners-Lee created what is known today as the World Wide Web. Now, just in time for the Web's 15th anniversary and after taking his proverbial stroll around the global dwelling of cyberspace, Berners-Lee is chatting with the rest of us about what he thinks with a blog

  9. "Identity in Flux": Exploring the Work of Nikki S. Lee (United States)

    Allison, Amanda


    Identity is a vital topic for discussion, exploration, and discovery in the art classroom. The artwork of Nikki S. Lee provides an opportunity for students to begin reformulating their notions about selfhood. The work of Nikki S. Lee is significant because it blends documentary, fashion, and staged and unstaged photography to allow viewers to…

  10. Tim Berners-Lee receives the Millennium Technology Prize

    CERN Multimedia


    On 15 April, for his invention of the Web, Tim Berners-Lee was awarded the first ever Millennium Technology Prize by the Finnish Technology Award Foundation, which recognises technological innovations of lasting benefit to society. "Tim Berners-Lee's invention perfectly encapsulates the spirit of the Prize. The Web is encouraging new types of social networks, contributing to transparency and democracy, and opening up new avenues for information management and business development," underlined Pekka Tarjanne, chairman of the jury and former Secretary-General of the International Telecommunication Union (ITU). Tim Berners-Lee is congratulated by Jukka Valtasaari, Finland's Ambassador to the United States. Tim Berners-Lee created the first server, browser and editor, the HTML code, the URL address and the HTTP transmission protocol at CERN in 1990. CERN released the Web into the public domain in 1993. Tim Berners-Lee is currently head of the World Wide Web Consortium, managed by ERCIM (Europe...

  11. Corporate Language and Corporate Talk

    DEFF Research Database (Denmark)

    Zølner, Mette


    the geographical borders by the medium of common corporate values for knowledge management, collection of data and analysis in these studies inspired by approach of ground theory and presents a usefulness of distinguishing between corporate language and talks to enable the headquarters learning. Also it concludes...

  12. Corporate entrepreneurship

    DEFF Research Database (Denmark)

    Christensen, Karina


    Corporate entreprenørskab kan blive svaret på, hvordan Danmark fremmer en mere videnintensiv produktion. Begrebet er blevet anvendt til at forklare forskellige organisatoriske fænomener alt fra strategi over ledelse i al almindelighed til innovation, hvilket har medført en mangfoldighed af begreber...... og perspektiver, som har skabt stor uklarhed omkring corporate entreprenørskab. Med henblik på at skabe fundamentet for et fælles fodslag redegøres der i denne artikel for corporate entreprenørskabsbegrebet ud fra forskellige perspektiver. Der gives i artiklen endvidere et overblik ved hjælp af en...... model, der indeholder intraprenørskab og exoprenørskab, samt fire organisatoriske perspektiver: corporate venturing, interne ressourcer, internationalisering og eksterne netværk....

  13. Corporate Responsibility


    World Bank


    Appeals to corporate responsibility often simply take for granted that businesses have ethical responsibilities that go beyond just respecting the law. This paper addresses arguments to the effect that businesses have no such responsibilities. The interesting claim is not that businesses have no ethical responsibility at all but that their primal responsibility is to increase their profits. The extent to which there is reason to take such arguments seriously delineates the limits of corporate...

  14. Examining corporate governance and corporate tax management

    Directory of Open Access Journals (Sweden)

    Martin Surya Mulyadi


    Full Text Available Taxation play an essential role both in a country and in a corporation. For a country it is one of the primary income source, while for the corporation taxes will reduce corporate net income. To minimize the tax payment, corporation conduct a corporate tax management. According to some of previous research, there is a correlation between corporate governance and corporate tax management. While there are many corporate governance proxies could be used in corporate governance research, in this research we are focusing on three: number of board, number of independent board and board compensation. We measure corporate tax management by using effective tax rate (GAAP ETR and current ETR are used in this research. By using several other control variables, we run the regression and conduct the statistical analysis to examine the correlation between corporate governance and corporate tax management. Our result show that corporate governance have a significant correlation to corporate tax management.

  15. Corporate Governance

    Directory of Open Access Journals (Sweden)

    Dragoș-Mihail Daghie


    Full Text Available The purpose of this study is to analyze and understand the recently introduced form of managementof a company limited by shares. The Law no. 441/2006, which fundamentally amended Company Law,created this form of controlling the company, the corporate governance, but the legislation does not explicitlydefine what it wants to achieve through this instrument. This topic is recent in research as the theme ofgerman-roman commercial law systems (in French corporate governance system was introduced in 1966 andin Romania in 2006 but in terms of Anglo-Saxon law, the topic has been addressed years since 1776 (AdamSmith: The Wealth of Nations The concept of corporate governance would like, as a result, to establish somerules that companies must comply in order to achieve effective governance, transparent and beneficial forboth shareholders and for the minority. Corporate governance is a key element with an aim at improvingefficiency and economic growth in full accordance with the increase of investors’ confidence. Corporategovernance assumes a series of relationship between the company management, leadership, shareholders andthe other people concerned. Also corporate governance provides for that structure by means of which thecompany’s targets are set out and the means to achieve them and also the manner how to monitor such.


    Directory of Open Access Journals (Sweden)

    Dan Alexandru SITARU


    Full Text Available The work is aimed to examine the issues “corporate governance” involves, with the goal set to clarify the meanings of such notion, and to provide an overall image of the positive effects arising implementing the corporate governance principles. The first section includes a series of definitions for the purpose of explaining and outlining the concept of “corporate governance”, subsequently giving a definition that appears adequate to us, from the legal standpoint pre eminently. The second section has for purpose to state the corporate governance Principles, and briefly examine the same. Its purpose also includes concretely illustrating the efficient operation methods for a “corporation”, as well as the main dilemmas, and the existing solutions for the same within the internal structure of a joint stock company to adopt, and subject itself to, such principles. Finally, the last section of the work underlines the corporate governance importance, and states the goals to be attained for purposes of securing effective, balanced, and not in the last place profitable management.

  17. Graph model of behavior simulator. [Interactive simulator developed as part of UCLA SARA system

    Energy Technology Data Exchange (ETDEWEB)

    Razouk, R.R.; Estrin, G.


    An interactive simulator developed at UCLA as part of the SARA system is described. This simulator, in conjunction with other design tools of the SARA system, allows the user to model the behavior of the system being designed at various levels of detail. The models which drive the simulator are control graphs and associated data graphs. The simulator uses the control graph to express synchronization of sequences of events. Initiation of any control node triggers the simulator to call on the data graph model to provide interpretation of a process at a desired level of abstraction. The simulator gives the user the capability to examine, or modify, the state of the control and data graphs during a simulation. 8 figures.

  18. SARA (System ARchitects Apprentice): Modeling, analysis, and simulation support for design of concurrent systems

    Energy Technology Data Exchange (ETDEWEB)

    Estrin, G.; Fenchel, R.S.; Razouk, R.R.; Vernon, M.K.


    An environment to support designers in the modeling, analysis and simulation of concurrent systems is described. It is shown how a fully nested structure model supports multilevel design and focuses attention on the interfaces between the modules which serve to encapsulate behavior. Using simple examples the paper indicates how a formal graph model can be used to model behavior in three domains: control flow, data flow, and interpretation. The effectiveness of the explicity environment model in SARA is discussed and the capability to analyze correctness and evaluate performance of a system model are demonstrated. A description of the integral help designed into SARA shows how the designer can be offered consistent use of any new tool introduced to support the design process.

  19. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA)

    CERN Document Server

    Keel, William C; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA), a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofisica de Canarias. SARA observatories comprise a 0.96m telescope at Kitt Peak, Arizona; a 0.6m instrument on Cerro Tololo, Chile; and the 1m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for f...

  20. Serum acute phase proteins in cows with SARA (Subacute Ruminal Acidosis suspect

    Directory of Open Access Journals (Sweden)

    C. Cannizzo


    Full Text Available The aim of this study was to evaluate the variations of Acute Phase Proteins (APPs and other blood constituents during the onset of the sub-acute ruminal acidosis (SARA pathological status. A total of 108 cows from 12 dairy herds were randomly selected and divided into three Groups of 36 animals each. All animals were subjected to a rumenocentesis. Group A was composed by subjects with a rumen pH>5.8, Group B was composed by subjects with a rumen pH ≤5.5≤5.8 and Group C was composed by subjects with a rumen pH<5.5. Blood samples were collected by jugular venipuncture and Haptoglobin (Hp, Serum Amyloid A (SAA, Total Proteins, Albumin and White Blood Cells (WBC were determined. One-way ANOVA showed a statistical significance on Rumen pH, Hp, SAA. SARA seems not stimulate the APPs production from liver.

  1. The Trail Inventory of Lee Metcalf NWR [Cycle 2 (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Lee Metcalf National Wildlife Refuge. Trails in this inventory are...

  2. Nobel laureate T.D. Lee at CERN

    CERN Multimedia


    On 30 August, Professor T.D. Lee, who received the Nobel Prize for Physics in 1957, gave a seminar at CERN on symmetry and asymmetry in electroweak interactions, 50 years after the discovery of the non-conservation of parity. In 1956, Tsung-Dao Lee postulated with Chen Ning Yang that parity is not conserved in weak interactions, and suggested several experiments to demonstrate this. The following year, an experiment led by Chien-Shiung Wu proved this prediction and, soon after, T.D. Lee and Chen Ning Yang were awarded the Nobel Prize for Physics. Still very active at over 80 years of age, T.D. Lee pursues his theory work to this day.

  3. A light sterile neutrino from Friedberg–Lee symmetry

    National Research Council Canada - National Science Library

    He, Xiao-Gang; Liao, Wei


    .... In this article we show that such an eV scale light sterile neutrino candidate can be obtained in a seesaw model in which the right-handed neutrinos satisfy a softly-broken Friedberg-Lee (FL) symmetry...

  4. Parcels and Land Ownership, Published in 2011, Lee County Government. (United States)

    NSGIC GIS Inventory (aka Ramona) — This Parcels and Land Ownership dataset as of 2011. The extent of these data is generally Lee County, IA. This metadata was auto-generated through the Ramona GIS...

  5. Lee Metcalf National Wildlife Refuge : Annual Narrative : Calendar Year 1992 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuge outlines Refuge accomplishments during the 1992 calendar year. The report begins with a summary...

  6. Fenhexamid adsorption behavior on soil amended with wine lees. (United States)

    Pinna, Maria Vittoria; Budroni, Marilena; Farris, Giovanni Antonio; Pusino, Alba


    The adsorption of fenhexamid (FEN) [N-(2,3-dichloro-4-hydroxyphenyl)-1-methylcyclohexanecarboxamide] on vineyard soil amended with wine lees (WL) produced by vinery was studied. The adsorption extent depends on WL fraction. The addition of the centrifuged solid lees (SWL) increases the FEN adsorption on soil. Most likely, the organic insoluble fraction formed mainly by dead fermentation yeasts is responsible for the observed increase. The adsorption measured on some deactivated yeasts of wine fermentation shows that Saccharomyces cerevisiae are the most active in FEN retention. On the other hand, the soil amendment with whole WL decreases considerably the fungicide adsorption. This opposite effect may be the result of FEN hydrophobic bonds with the dissolved organic matter of lees that keeps fungicide in solution. This hypothesis is substantiated by the increased FEN solubility in the supernatant of centrifuged wine lees (LWL). The results of soil column mobility confirm that the elution with LWL increases the mobility of FEN in soil.

  7. Lee Metcalf National Wildlife Refuge : Annual Narrative : Calendar Year 1991 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuge outlines Refuge accomplishments during the 1991 calendar year. The report begins with a summary...

  8. Lee Metcalf National Wildlife Refuge 2005 annual habitat work plan (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual habitat management plan outlines working habitat objectives for wetland habitats based on refuge purposes, professional judgment and experience for Lee...

  9. Lee Metcalf National Wildlife Refuge : Annual Narrative : Calendar Year 1993 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuge outlines Refuge accomplishments during the 1993 calendar year. The report begins with a summary...

  10. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow


    Fletcher, Jack M.; Morris, Robin D


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow’s long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the maturational lag theory of developmental dyslexia proposed with Paul Satz, her mentor. The research program that emerged from this work had a wide impact...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_999614.1| luteinizing hormone/choriogonadotropin receptor ...[Sus scrofa] sp|P16582|LSHR_PIG Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAA31062.1| luteinizing hormone receptor precursor NP_999614.1 0.0 65% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_776806.1| luteinizing hormone/choriogonadotropin receptor ...[Bos taurus] sp|Q28005|LSHR_BOVIN Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAC24012.1| luteinizing hormone receptor [Bos taurus] NP_776806.1 0.0 65% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_776826.1| neuropeptide Y receptor Y2 [Bos taurus] sp|P79113|NPY2R_BOVIN Neurope...ptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAB40600.1| type 2 neuropeptide Y receptor NP_776826.1 0.0 85% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0123 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 1e-120 70% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_653200.2| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Homo sapiens] sp|Q7RTP0|NIPA1_HUMAN Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 tpg|...DAA01477.1| TPA_exp: non-imprinted in Prader-Willi/Angelman syndrome 1 [Homo sapiens] NP_653200.2 1e-113 81% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0466 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0466 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 3e-32 71% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1400 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1400 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sapie...ns] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 4e-34 52% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1193 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1193 ref|NP_776427.1| calcium-sensing receptor [Bos taurus] sp|P35384|...CASR_BOVIN Extracellular calcium-sensing receptor precursor (CaSR) (Parathyroid Cell calcium-sensing recepto...r) gb|AAB29171.1| Ca(2+)-sensing receptor [Bos taurus] prf||2002360A Ca-sensing receptor NP_776427.1 0.0 86% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1360 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1360 ref|NP_599155.1| trace-amine-associated receptor 1 [Rattus norveg...icus] gb|AAL65137.1|AF421352_1 trace amine receptor 1 [Rattus norvegicus] gb|AAV70127.1| trace amine associa...ted receptor 1 [Rattus norvegicus] gb|EDL87747.1| trace-amine-associated receptor 1 [Rattus norvegicus] NP_599155.1 1e-145 74% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|NP_001029267.1| tubulin, alpha, ubiquitous [Pan troglodytes] ...sp|Q5R1W4|TBA1B_PANTR Tubulin alpha-1B chain (Tubulin alpha-ubiquitous chain) (Alpha-tubulin ubiquitous) (Tu...bulin K-alpha-1) dbj|BAD74034.1| ubiquitous alpha-tubulin [Pan troglodytes verus] NP_001029267.1 1e-136 86% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|YP_001474562.1| DNA internalization-related competence protei...n ComEC/Rec2 [Shewanella sediminis HAW-EB3] gb|ABV37434.1| DNA internalization-related competence protein ComEC/Rec2 [Shewanella sediminis HAW-EB3] YP_001474562.1 1.7 33% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0675 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0675 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-136 76% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1437 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-123 71% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0312 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-137 76% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1238 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1238 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-116 72% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0756 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0756 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sa...piens] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 1e-66 52% ...

  8. Corporate Venturing

    DEFF Research Database (Denmark)

    Vintergaard, Christian

    From the perspective of Austrian economics, this paper develops a conceptual understanding ofhow corporate venture managers recognize and discover opportunities in a network environment.In an effort to create a better understanding of who is involved in process, this paper reports onthe development...... path of an entrepreneurial opportunity of the Danish corporate venture capitalist,Danfoss A/S. This paper distinguishes itself from previous research done on entrepreneurialopportunities by creating a holistic and conceptual framework, which broadens and expands theperception of the market participants...... involved in recognition and discovery. Consequently thepaper offers insight to a diversified group of actors who mix and match technological and marketcapabilities in a constant process of recognition and discovery.Key words: Corporate venturing, entrepreneurship, discovery, networks, opportunities,recognition....

  9. Corporate Entrepreneurship

    DEFF Research Database (Denmark)

    Lassen, Astrid Heidemann

    Corporate entrepreneurship is often highlighted as being more relevant than ever, as a viable means for existing organizations to pursue creative new solutions to the complex challenges facing firms today. This includes continuously exploring and exploiting previously unexploited opportunities, a...... entrepreneurship and innovation, and identifying management practices supportive of these particular innovation processes.......Corporate entrepreneurship is often highlighted as being more relevant than ever, as a viable means for existing organizations to pursue creative new solutions to the complex challenges facing firms today. This includes continuously exploring and exploiting previously unexploited opportunities......, and thereby moving the organization to a new state of being. In spite of a general consensus on a strong interlinkage between the concepts of innovation and corporate entrepreneurship, the nature of this linkage is rarely addressed directly. This has made further research in the two areas problematic, mainly...

  10. Friedberg-Lee Symmetry for Quark Masses and Flavor Mixing

    CERN Document Server

    Ren, Ping


    We point out a generic correlation between the Friedberg-Lee symmetry of quark mass operators and the vanishing of quark masses. We make phenomenological explorations on two textures of quark mass matrices with the broken Friedberg-Lee symmetry. We present a new pattern of quark mass matrices in agreement with current experimental data. Both analytical and numerical results of our calculations are discussed in detail.

  11. Lee as Critical Thinker: The Example of the Gettysburg Campaign (United States)


    overconfidence, lack of intelligence , and partial blindness to his opponent, caused General Lee to continue an ill- advised tactically offensive battle...factors, notably poor health, overconfidence, lack of intelligence , and a partial blindness to an improving opponent, caused General Lee to continue an...natural tendency to forget information that does not support our line of thinking. - Egocentric myopia refers to thinking within an overly narrow

  12. A conducting surface in Lee-Wick electrodynamics

    Energy Technology Data Exchange (ETDEWEB)

    Barone, F.A. [IFQ, Universidade Federal de Itajuba (Brazil); Nogueira, A.A. [IFT, Sao Paulo (Brazil)


    Lee-Wick electrodynamics in the vicinity of a conducting plate is investigated. The propagator for the gauge field is calculated and the interaction between the plate and a point-like electric charge is computed. The boundary condition imposed on the vector field is taken to be the one that makes, on the plate, the normal component of the dual field strength to the plate vanish. It is shown that the image method is not valid in Lee-Wick electrodynamics. (orig.)

  13. Fixed-point B.G. Lee IDCT without multiplication (United States)

    Zhu, P. P.; Liu, J. G.; Dai, S. K.


    An improved modified approach to compute the inverse discrete cosine transform (IDCT) is proposed based on B. G. Lee algorithm. We replace the multiplication operator in original B. G. Lee algorithm with addition and shift operators and looking-up table to implement the fix-point computation. Due to the absence of the multiplication operator, this modified algorithm will take less time to complete the same computation.

  14. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA) (United States)

    Keel, William C.; Oswalt, Terry; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A.


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA) , a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofísica de Canarias. SARA observatories comprise a 0.96 m telescope at Kitt Peak, Arizona; one of 0.6 m aperture on Cerro Tololo, Chile; and the 1 m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for frequent local service, and a second CCD for offset guiding. The Arizona and Chile telescopes also have fiber-fed echelle spectrographs. Switching between imaging and spectroscopy is very rapid, so a night can easily accommodate mixed observing modes. We present some sample observational programs. For the benefit of other groups organizing similar consortia, we describe the operating structure and principles of SARA, as well as some lessons learned from almost 20 years of remote operations.

  15. Corporate responsibility

    DEFF Research Database (Denmark)

    Jensen, Karsten Klint


    Is it legitimate for a business to concentrate on profits under respect for the law and ethical custom? On the one hand, there seems to be good reasons for claiming that a corporation has a duty to act for the benefit of all its stakeholders. On the other hand, this seems to dissolve the notion...... to this paradox as Goodpaster, namely that a corporation is the instrument of the shareholders only, but that shareholders still have an obligation to act ethically responsibly. To this, I add discussion of Friedman's claim that this responsibility consists in increasing profits. I show that most of his arguments...

  16. Predicting bed form roughness: the influence of lee side angle (United States)

    Lefebvre, Alice; Winter, Christian


    Flow transverse bedforms (ripples and dunes) are ubiquitous in rivers and coastal seas. Local hydrodynamics and transport conditions depend on the size and geometry of these bedforms, as they constitute roughness elements at the bed. Bedform influence on flow energy must be considered for the understanding of flow dynamics, and in the development and application of numerical models. Common estimations or predictors of form roughness (friction factors) are based mostly on data of steep bedforms (with angle-of-repose lee slopes), and described by highly simplified bedform dimensions (heights and lengths). However, natural bedforms often are not steep, and differ in form and hydraulic effect relative to idealised bedforms. Based on systematic numerical model experiments, this study shows how the hydraulic effect of bedforms depends on the flow structure behind bedforms, which is determined by the bedform lee side angle, aspect ratio and relative height. Simulations reveal that flow separation behind bedform crests and, thus, a hydraulic effect is induced at lee side angles steeper than 11 to 18° depending on relative height, and that a fully developed flow separation zone exists only over bedforms with a lee side angle steeper than 24°. Furthermore, the hydraulic effect of bedforms with varying lee side angle is evaluated and a reduction function to common friction factors is proposed. A function is also developed for the Nikuradse roughness (k s), and a new equation is proposed which directly relates k s to bedform relative height, aspect ratio and lee side angle.

  17. Quantitation and structural determination of glucosylceramides contained in sake lees. (United States)

    Takahashi, Koshiro; Izumi, Kazuki; Nakahata, Eriko; Hirata, Miyo; Sawada, Kazutaka; Tsuge, Keisuke; Nagao, Koji; Kitagaki, Hiroshi


    Sake lees are solid parts filtered from the mash of sake, the traditional rice wine of Japan, which is brewed with Aspergillus oryzae and Saccharomyces cerevisiae. The moisture-holding activity of sake lees has long been recognized in Japan. However, the constituent responsible for this activity has not been elucidated. In this study, we first determined the structure of the glucosylceramides contained in sake lees. The glucosylceramides contained in sake lees were N-2'-hydroxyoctadecanoyl-l-O-β-D-glucopyranosyl-9-methyl-4,8-sphingadienine (d19:2/C18:0h), N-2'-hydroxyoctadecanoyl-l-O-β-D-glucopyranosyl-4,8-sphingadienine (d18:2/C18:0h), N-2'-hydroxyicosanoyl-l-O-β-D-glucopyranosyl-4,8-sphingadienine (d18:2/C20:0h) and N-2'-hydroxyicosanoyl-l-O-β-D-glucopyranosyl-4,8-sphingadienine (d18:2/C22:0h), which corresponded to those of A. oryzae and rice. The glucosylceramide produced by A. oryzae constituted the most abundant species (43% of the total glucosylceramide) in the sake lees. These results will be of value in the utilization of sake lees for cosmetics and functional foods.

  18. [Montana MOYOCO Invasive Species Strike Team Final Report 2011] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  19. [Montana MOYOCO Invasive Species Strike Team Final Report 2012] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  20. [Montana MOYOCO Invasive Species Strike Team Final Report 2014] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO MT Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  1. [Montana MOYOCO Invasive Species Strike Team Final Report 2013] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  2. [Montana MOYOCO Invasive Species Strike Team Final Report 2016] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  3. [Montana MOYOCO Invasive Species Strike Team Final Report 2015] Lee Metcalf National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  4. Corporate Governance and Corporate Creditworthiness

    Directory of Open Access Journals (Sweden)

    Dror Parnes


    Full Text Available We examine the relation between corporate governance and bankruptcy risk as an underlying force affecting a bond’s yield. The level of corporate governance is captured by the G-index, along with the explicit groups of governance provisions. We estimate bankruptcy risk by Z-score, by cash-flow-score, by O-score, through Merton structural model default probabilities, and by S&P credit ratings. After addressing endogeneity and while controlling for firm-specific factors, based on the four objective methodologies we find that corporate governance is inversely related to bankruptcy risk. Yet, rating agencies take a mixed approach towards this association likely because of the conflicting impact of different governance provisions.

  5. Innovative Stormwater Quality Tools by SARA for Holistic Watershed Master Planning (United States)

    Thomas, S. M.; Su, Y. C.; Hummel, P. R.


    Stormwater management strategies such as Best Management Practices (BMP) and Low-Impact Development (LID) have increasingly gained attention in urban runoff control, becoming vital to holistic watershed master plans. These strategies can help address existing water quality impairments and support regulatory compliance, as well as guide planning and management of future development when substantial population growth and urbanization is projected to occur. However, past efforts have been limited to qualitative planning due to the lack of suitable tools to conduct quantitative assessment. The San Antonio River Authority (SARA), with the assistance of Lockwood, Andrews & Newnam, Inc. (LAN) and AQUA TERRA Consultants (a division of RESPEC), developed comprehensive hydrodynamic and water quality models using the Hydrological Simulation Program-FORTRAN (HSPF) for several urban watersheds in the San Antonio River Basin. These models enabled watershed management to look at water quality issues on a more refined temporal and spatial scale than the limited monitoring data. They also provided a means to locate and quantify potential water quality impairments and evaluate the effects of mitigation measures. To support the models, a suite of software tools were developed. including: 1) SARA Timeseries Utility Tool for managing and processing of large model timeseries files, 2) SARA Load Reduction Tool to determine load reductions needed to achieve screening levels for each modeled constituent on a sub-basin basis, and 3) SARA Enhanced BMP Tool to determine the optimal combination of BMP types and units needed to achieve the required load reductions. Using these SARA models and tools, water quality agencies and stormwater professionals can determine the optimal combinations of BMP/LID to accomplish their goals and save substantial stormwater infrastructure and management costs. The tools can also help regulators and permittees evaluate the feasibility of achieving compliance

  6. Reactivity of Athabasca residue and of its SARA fractions during residue hydroconversion

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, J.; Danial-Fortain, P.; Gauthier, T.; Merdrignac, I. [IFP-Lyon, Vermaison (France); Budzinski, H. [Bordeaux Univ. (France). ISM-LPTC, UMR CNRS


    Residue conversion processes are becoming increasingly important because of the declining market for residual fuel oil and a greater demand for middle distillates. Ebullated-bed hydroconversion is a commercially proven technology for converting heavy feedstocks with high amounts of impurities. The process enables the conversion of atmospheric or vacuum residues at temperatures up to 440 degrees C, and at liquid hourly space velocity (LHSV) conditions in the range of 0.15 to 0.5 per hour. A 540 degrees C conversion of up to 80 weight per cent can be achieved under these conditions. This paper reported on a research study conducted at IFP Lyon in which the residue hydroconversion in a large-scale ebullated bed bench unit was investigated to determine the impact of operating conditions and feed properties on yield and product qualities. Hydrogen was added to the feed in the bench units to keep a high hydrogen partial pressure and favour the catalytic hydroconversion reactions. In a typical test, the reactor was fed with 50 g of feedstock and 0.45 g of crushed equilibrium industrial NiMo catalyst, pressurized hydrogen and quickly heated at the reaction temperature. This paper also discussed the conversion of Athabasca bitumen residue in the large-scale pilot plant and also in the small scale batch reactor. The effect of operating temperature and space velocity was examined. The reactivity of the saturates, aromatics, resins and asphaltenes (SARA) fractions of the bitumen was studied separately in order to better understand the conversion mechanisms and reactivities. The Athabasca bitumen feed and SARA fractions were also analyzed in terms of standard petroleum analysis, SARA fractionation, elemental analysis, size exclusion chromatography (SEC) and 13C NMR. Hydroconversion experiments were conducted in the batch unit at different reaction temperatures and reaction times. A comparison of small-scale batch results with those obtained with the continuous large-scale bench

  7. Collider Bounds on Lee-Wick Higgs Bosons

    CERN Document Server

    Alvarez, Ezequiel; Zurita, José


    We study the constraints on the Lee-Wick Higgs sector arising from direct collider searches. We work in an effective-field theory framework, where all of the Lee-Wick partners are integrated out, with the sole exception of the Lee-Wick Higgs bosons. The resulting theory is a two-Higgs doublet model where the second doublet has wrong-sign kinetic and mass terms. We include the bounds coming from direct Higgs searches at both LEP and Tevatron using the code HiggsBounds, and show the currently excluded parameter space. We also analyze the prospects of LHC Run-I, finding that with a total integrated luminosity of 5 fb $^{-1}$ and a center-of-mass energy of 7 TeV, most of the parameter space for the SM-like CP-even Higgs will be probed.

  8. Impact of subacute ruminal acidosis (SARA) adaptation and recovery on the density and diversity of bacteria in the rumen of dairy cows

    NARCIS (Netherlands)

    Hook, S.E.; Steele, M.A.; Northwood, K.S.; Dijkstra, J.; France, J.; Wright, A.G.; McBride, B.W.


    Subacute ruminal acidosis (SARA) is characterized by ruminal pH depression and microbial perturbation. The impact of SARA adaptation and recovery on rumen bacterial density and diversity was investigated following high-grain feeding. Four ruminally cannulated dairy cows were fed a hay diet, transiti

  9. Awards: New Year Knighthood for Tim Berners-Lee

    CERN Multimedia


    Tim Berners-Lee has been awarded his country's highest honour - a knighthood - in the UK's New Year Honours list for his work while at CERN on the World Wide Web. In the same honours list, Roger Cashmore has been made a Companion of the Order of St Michael and St George (CMG) "for his services to international co-operation in particle physics". Cashmore was CERN's Director for Collider Programmes from 1999-2003, and is now Principal of Brasenose College, Oxford. Tim Berners-Lee stands in front of the first web server at Palexpo during the World Summit on the Information Society.

  10. Generic Friedberg-Lee symmetry of Dirac neutrinos (United States)

    Luo, Shu; Xing, Zhi-Zhong; Li, Xin


    We write out the generic Dirac neutrino mass operator which possesses the Friedberg-Lee symmetry and find that its corresponding neutrino mass matrix is asymmetric. Following a simple way to break the Friedberg-Lee symmetry, we calculate the neutrino mass eigenvalues and show that the resultant neutrino mixing pattern is nearly tri-bimaximal. Imposing the Hermitian condition on the neutrino mass matrix, we also show that the simplified ansatz is consistent with current experimental data and favors the normal neutrino mass hierarchy.

  11. Andrew Lees, a visionary mentored by a madman

    Directory of Open Access Journals (Sweden)

    Francisco Cardoso

    Full Text Available ABSTRACT Andrew Lees, Professor of Neurology at the National Hospital Queen Square (London, UK, has been recognized as the world’s most highly-cited researcher over the 200-year history of Parkinson’s Disease. Although he remains actively involved in the investigation of movement disorders, Prof. Lees embarked on a literary career that started in 2011 with the publication of a social history of his native Liverpool. His last work is Mentored by a Madman: The William Burroughs Experiment, which is reviewed here.

  12. PLS models for determination of SARA analysis of Colombian vacuum residues and molecular distillation fractions using MIR-ATR

    Directory of Open Access Journals (Sweden)

    Jorge A. Orrego-Ruiz


    Full Text Available In this work, prediction models of Saturates, Aromatics, Resins and Asphaltenes fractions (SARA from thirty-seven vacuum residues of representative Colombian crudes and eighteen fractions of molecular distillation process were obtained. Mid-Infrared (MIR Attenuated Total Reflection (ATR spectroscopy in combination with partial least squares (PLS regression analysis was used to estimate accurately SARA analysis in these kind of samples. Calibration coefficients of prediction models were for saturates, aromatics, resins and asphaltenes fractions, 0.99, 0.96, 0.97 and 0.99, respectively. This methodology permits to control the molecular distillation process since small differences in chemical composition can be detected. Total time elapsed to give the SARA analysis per sample is 10 minutes.

  13. SARAS: a precision system for measurement of the Cosmic Radio Background and signatures from the Epoch of Reionization

    CERN Document Server

    Patra, Nipanjana; Raghunathan, A; Shankar, N Udaya


    SARAS is a correlation spectrometer purpose designed for precision measurements of the cosmic radio background and faint features in the sky spectrum at long wavelengths that arise from redshifted 21-cm from gas in the reionization epoch. SARAS operates in the octave band 87.5-175 MHz. We present herein the system design arguing for a complex correlation spectrometer concept. The SARAS design concept provides a differential measurement between the antenna temperature and that of an internal reference termination, with measurements in switched system states allowing for cancellation of additive contaminants from a large part of the signal flow path including the digital spectrometer. A switched noise injection scheme provides absolute spectral calibration. Additionally, we argue for an electrically small frequency-independent antenna over an absorber ground. Various critical design features that aid in avoidance of systematics and in providing calibration products for the parametrization of other unavoidable s...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_104995.1| alcohol dehydrogenase, zinc-containing [Burkholder...ia mallei ATCC 23344] ref|YP_111924.1| alcohol dehydrogenase [Burkholderia pseudomallei K96243] ref|ZP_004...40487.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei GB8 horse 4] ref|YP_336176.1| alc...ohol dehydrogenase, zinc-containing [Burkholderia pseudomallei 1710b] ref|ZP_0093...0750.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei FMH] ref|ZP_00934487.1| COG1064: Z

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1695 sp|Q9NYW0|T2R10_HUMAN Taste receptor type 2 member 10 (T2R10) (Taste... receptor family B member 2) (TRB2) gb|AAH69089.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AA...U21148.1| taste receptor T2R10 [Homo sapiens] gb|AAI01763.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AAI01765.1| Taste

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1608 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1608 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabinoid... receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cannabinoid... receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cannabinoid

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cannabinoid... receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cannabinoid... receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0921 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0921 ref|NP_003292.1| thyrotropin-releasing hormone receptor [Homo sap...iens] sp|P34981|TRFR_HUMAN Thyrotropin-releasing hormone receptor (TRH-R) (Thyroliberin receptor) emb|CAA52965.1| thyrotropin-releasi...BAA04120.1| human thyrotropin-releasing hormone receptor [Homo sapiens] gb|AAB32222.1| hormone receptor; TRH receptor [Homo sapiens] dbj|BAA12796.1| thyrotropin-releasing... hormone receptor [Homo sapiens] gb|AAR84356.1| thyrotropin-releasing hormone receptor [Homo sapiens] gb|

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_001105680.1| PREDICTED: similar to adiponectin receptor 1 ...isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin receptor 1 isoform 4 [Macac...a mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin receptor 1 isoform 5 [Macaca mulatta] ref|X...P_001105878.1| PREDICTED: similar to adiponectin receptor 1 isoform 6 [Macaca mul...atta] ref|XP_001105957.1| PREDICTED: similar to adiponectin receptor 1 isoform 7 [Macaca mulatta] XP_001105680.1 1e-138 67% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|NP_057083.2| adiponectin receptor 1 [Homo sapiens] ref|XP_514107.1| PREDICTED: adipone...ctin receptor 1 isoform 7 [Pan troglodytes] ref|XP_001152270.1| PREDICTED: adiponectin... receptor 1 isoform 1 [Pan troglodytes] ref|XP_001152338.1| PREDICTED: adiponectin receptor 1 isoform 2 [...Pan troglodytes] ref|XP_001152393.1| PREDICTED: adiponectin receptor 1 isoform 3 ...[Pan troglodytes] ref|XP_001152460.1| PREDICTED: adiponectin receptor 1 isoform 4 [Pan troglodytes] ref|XP_0

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_000951.1| prostaglandin I2 (prostacyclin) receptor (IP) [ I2 receptor) dbj|BAA05008.1| prostacyclin receptor [Homo sapiens] gb|AAA36448.1| prostanoid IP receptor dbj|BAA06110.1| pros...tacyclin receptor [Homo sapiens] dbj|BAA07325.1| prostacyclin ...receptor [Homo sapiens] gb|AAO92301.1| prostaglandin I2 (prostacyclin) receptor [Homo sapiens] gb|AAH75814.1| Prostaglandin I2 (pros...tacyclin) receptor (IP) [Homo sapiens] gb|EAW57432.1| prostaglandin I2 (prostacyclin

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|XP_001107503.1| PREDICTED: tubulin, alpha, ubiquitous isoform... 10 [Macaca mulatta] ref|XP_001107562.1| PREDICTED: tubulin, alpha, ubiquitous isoform 11 [Macaca mulatta] r...ef|XP_001107624.1| PREDICTED: tubulin, alpha, ubiquitous isoform 12 [Macaca mulatta] ref|XP_001107684.1| PRE...| PREDICTED: tubulin, alpha, ubiquitous isoform 14 [Macaca mulatta] ref|XP_001107805.1| PREDICTED: tubulin, alpha, ubiquitous... isoform 15 [Macaca mulatta] ref|XP_001107870.1| PREDICTED: tubulin, alpha, ubiquitous isof

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_848509.1| progestin and adipoQ receptor family member VII ...[Homo sapiens] sp|Q86WK9|MPRA_HUMAN Membrane progestin receptor alpha (mPR alpha) (Progestin and adipoQ rece...ptor family member VII) gb|AAO47233.1|AF313620_1 putative membrane steroid receptor [Homo sapiens] gb|AAR08373.1| progesti...1| hCG1642829 [Homo sapiens] emb|CAM12867.1| progestin and adipoQ receptor family member VII [Homo sapiens] NP_848509.1 1e-178 87% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_001122232.1| CDP-alcohol phosphatidyltransferase [Francise...lla tularensis subsp. tularensis WY96-3418] ref|YP_001427783.1| CDP-alcohol phosphatidyltransferase [Francis...ella tularensis subsp. holarctica FTA] gb|ABO47111.1| CDP-alcohol phosphatidyltransferase [Francisella tular...ensis subsp. tularensis WY96-3418] gb|EDN35713.1| phosphatidylserine synthase [Francis...ella tularensis subsp. novicida GA99-3549] gb|EDN37179.1| hypothetical protein FTDG_01588 [Francisella

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 gb|ABR53744.1| opsin 1 short-wavelength senstive protein [Daubent...onia madagascariensis] gb|ABR53745.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensi...s] gb|ABR53746.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensis] gb|ABR53747.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53748.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53749.1| opsin 1 short-wave

  6. Corporate Fictions

    DEFF Research Database (Denmark)

    Staunæs, Dorthe; Søndergaard, D. M.


    The article describes a particular strategy of communication called a social science fiction. The strategy was taken up following an empirical research project on gender and management, in order to communicate results to the company's managers and Human Resource Staff. The research results showed...... fiction was the kind of narrative therapy, which aims to reconfigure the problem in focus by a process of externalisation that allows a reconstruction and retelling of the issue. The article describes how three cultural mechanisms in the company were condensed into three imaginary figures: Mr. Corporate...

  7. Corporate Foresight

    DEFF Research Database (Denmark)

    Rohrbeck, René; Gemünden, Hans Georg


    Although in the last three decades much knowledge has been produced on how best to conduct foresight exercises, but little is known on how foresight should be integrated with the innovation effort of a company. Drawing on empirical evidence from 19 case studies and 107 interviews, we identify three...... roles that corporate foresight should play to maximize the innovation capacity of a firm: (1) the strategist role, which explores new business fields; (2) the initiator role, which increases the number of innovation concepts and ideas; and (3) the opponent role, which challenges innovation projects...

  8. Corporate Entrepreneurship

    DEFF Research Database (Denmark)

    Lassen, Astrid Heidemann


    The recognition of the importance of entrepreneurial dynamics in corporate context is increasingly acknowledged in both entrepreneurship and strategic management literature, as firms today face a reality in which frame-breaking innovation is an important element of survival. From this understanding......, the concept of Strategic Entrepreneurship (SE) has arisen, arguing a logic of focusing on the intersections between the two fields. This paper sets out to explore the SE construct empirically. Through seven case studies evolving around radical technological innovations, evidence is found of the importance...

  9. Going Corporate

    CERN Document Server

    Kadre, Shailendra


    Going Corporate: A Geek's Guide shows technology workers how to gain the understanding and skills necessary for becoming an effective, promotable manager or sought-after consultant or freelancer. Technology professionals typically dive deeply into small pieces of technology - like lines of code or the design of a circuit. As a result, they may have trouble seeing the bigger picture and how their work supports an organization's goals. But ignoring or dismissing the business or operational aspects of projects and products can lead to career stagnation. In fact, understanding the larger business

  10. Corporate Fictions

    DEFF Research Database (Denmark)

    Staunæs, Dorthe; Søndergaard, D. M.


    The article describes a particular strategy of communication called a social science fiction. The strategy was taken up following an empirical research project on gender and management, in order to communicate results to the company's managers and Human Resource Staff. The research results showed...... fiction was the kind of narrative therapy, which aims to reconfigure the problem in focus by a process of externalisation that allows a reconstruction and retelling of the issue. The article describes how three cultural mechanisms in the company were condensed into three imaginary figures: Mr. Corporate...

  11. Corporate Foresight

    DEFF Research Database (Denmark)

    Rohrbeck, René; Gemünden, Hans Georg


    Although in the last three decades much knowledge has been produced on how best to conduct foresight exercises, but little is known on how foresight should be integrated with the innovation effort of a company. Drawing on empirical evidence from 19 case studies and 107 interviews, we identify three...... roles that corporate foresight should play to maximize the innovation capacity of a firm: (1) the strategist role, which explores new business fields; (2) the initiator role, which increases the number of innovation concepts and ideas; and (3) the opponent role, which challenges innovation projects...

  12. saeRS and sarA act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Lara N Mrak

    Full Text Available Mutation of the staphylococcal accessory regulator (sarA limits biofilm formation in diverse strains of Staphylococcus aureus, but there are exceptions. One of these is the commonly studied strain Newman. This strain has two defects of potential relevance, the first being mutations that preclude anchoring of the fibronectin-binding proteins FnbA and FnbB to the cell wall, and the second being a point mutation in saeS that results in constitutive activation of the saePQRS regulatory system. We repaired these defects to determine whether either plays a role in biofilm formation and, if so, whether this could account for the reduced impact of sarA in Newman. Restoration of surface-anchored FnbA enhanced biofilm formation, but mutation of sarA in this fnbA-positive strain increased rather than decreased biofilm formation. Mutation of sarA in an saeS-repaired derivative of Newman (P18L or a Newman saeRS mutant (ΔsaeRS resulted in a biofilm-deficient phenotype like that observed in clinical isolates, even in the absence of surface-anchored FnbA. These phenotypes were correlated with increased production of extracellular proteases and decreased accumulation of FnbA and/or Spa in the P18L and ΔsaeRS sarA mutants by comparison to the Newman sarA mutant. The reduced accumulation of Spa was reversed by mutation of the gene encoding aureolysin, while the reduced accumulation of FnbA was reversed by mutation of the sspABC operon. These results demonstrate that saeRS and sarA act synergistically to repress the production of extracellular proteases that would otherwise limit accumulation of critical proteins that contribute to biofilm formation, with constitutive activation of saeRS limiting protease production, even in a sarA mutant, to a degree that can be correlated with increased enhanced capacity to form a biofilm. Although it remains unclear whether these effects are mediated directly or indirectly, studies done with an sspA::lux reporter suggest they

  13. Dan Gilmor Column [Berners-Lee and the WWW

    CERN Multimedia

    Gillmore, D


    In the keynote speech at the 11th Annual World Wide Web Conference, Tim Berner's Lee said that in the early days of the web, people were worrying about the same thing as today - one company dominating the market and controlling standards (2 pages).

  14. Must Historians Regress? An Answer to Lee Benson. (United States)

    Kousser, J. Morgan


    Considers the impact of empirical social science methodology and data analysis techniques on the process of historical analysis and its product, generalizations about the past. Uses political preference and voting information as a vehicle to illustrate the differences in historical conclusions reached by Lee Benson and J. Morgan Kousser. (JDH)

  15. Robert E. Lee, George Peabody, and Sectional Reunion. (United States)

    Parker, Franklin


    Discusses an 1869 meeting between George Peabody, educational philanthropist, and Robert E. Lee. The meeting focused public attention on the Peabody Education Fund and the South's educational plight. Significant measures of educational efforts in the South are directly attributable to several informal meetings centered around Peabody and Lee…

  16. Leptogenesis in a model with Friedberg-Lee symmetry (United States)

    Araki, Takeshi; Geng, C. Q.


    We study the matter-antimatter asymmetry through the leptogenesis mechanism in a specific model with the Friedberg-Lee (FL) symmetry. We relate the leptogenesis with the CP violating Dirac and Majorana phases in the Maki-Nakagawa-Sakata leptonic mixing matrix and illustrate the net baryon asymmetry of the universe in terms of these phases.

  17. Quark masses and mixings with hierarchical Friedberg-Lee symmetry (United States)

    Araki, Takeshi; Geng, C. Q.


    We consider the Friedberg-Lee symmetry for the quark sector and show that the symmetry closely relates to both quark masses and mixing angles. We also extend our scheme to the fourth generation quark model and find the relation |Vtb'|≃|Vt'b|≃mb/mb'199GeV.

  18. Leptogenesis in a model with Friedberg-Lee symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Araki, Takeshi [Department of Physics, National Tsing Hua University, Hsinchu, 300, Taiwan (China)], E-mail:; Geng, C.Q. [Department of Physics, National Tsing Hua University, Hsinchu, 300, Taiwan (China)], E-mail:


    We study the matter-antimatter asymmetry through the leptogenesis mechanism in a specific model with the Friedberg-Lee (FL) symmetry. We relate the leptogenesis with the CP violating Dirac and Majorana phases in the Maki-Nakagawa-Sakata leptonic mixing matrix and illustrate the net baryon asymmetry of the universe in terms of these phases.

  19. George C.Lee Honored by White House

    Institute of Scientific and Technical Information of China (English)


    @@ On November 16,2007,George C.Lee,the editor-in-chief of our journal-Earthquake Engineering and Engineering Vibration (EEEV),was among 11 people to receive a 2006 Presidential Award for Excellence in Science,Mathematics and Engineering Mentoring (PAESMEM) from President George W.Bush in a ceremony at the White House.

  20. Lee de Forest King of Radio, Television, and Film

    CERN Document Server

    Adams, Mike


    Lee de Forest, Yale doctorate and Oscar winner, gave voice to the radio and the motion picture. Yet by the 1930s, after the radio and the Talkies were regular features of American life, Lee de Forest had seemingly lost everything. Why? Why didn’t he receive the recognition and acclaim he sought his entire life until years later in 1959, when he was awarded an Oscar? A lifelong innovator, Lee de Forest invented the three-element vacuum tube which he developed between 1906 and 1916 as a detector, amplifier, and oscillator of radio waves. As early as 1907, he was broadcasting music programming. In 1918, he began to develop a system for recording and playing back sound by using light patterns on motion picture film. In order to promote and demonstrate his process he made hundreds of short sound films, found theatres for their showing, and issued publicity to gain audiences for his invention. While he received many patents for this technology, he was ignored by the film industry. Lee de Forest, King of Radio, Te...

  1. Virginia Lee Burton's "Little House" in Popular Consciousness

    DEFF Research Database (Denmark)

    Goddard, Joe


    This paper considers the significance of Victoria Lee Burton’s authorship, specifically the Little House for lifestyle preferences and the development of environmental consciousness in the postwar period. The paper argues that Burton deliberately designed her work to evoke country-friendly sensib...

  2. Robert E. Lee's Demand for the Surrender of John Brown (United States)

    Rulli, Daniel F.


    The featured document that is the main topic of this article, Robert E. Lee's Demand for the Surrender of John Brown and his Party [at Harpers Ferry], October 18, 1859, is from the Records of the Adjutant General's Office, 1780s-1917; Record Group 94, and is in the holdings of the National Archives. As a part of "Teaching with…

  3. Tim Berners-Lee, World Wide Web inventor

    CERN Multimedia


    The "Internet, Web, What's next?" conference on 26 June 1998 at CERN: Tim Berners-Lee, inventor of the World Wide Web and Director of the W3C, explains how the Web came to be and gave his views on the future.

  4. Expanding Hipolito-Delgado and Lee's Empowerment Theory: A Response (United States)

    Zalaquett, Carlos; D'Andrea, Michael


    Hipolito-Delgado and Lee's article entitled "Empowerment Theory for the Professional School Counselor: A Manifesto for What Really Matters" represents an important contribution to the school counseling literature for two reasons: (1) It helps to expand a growing knowledge base related to the work school counselors can do to foster the…

  5. Leptogenesis in model with Friedberg-Lee symmetry

    CERN Document Server

    Araki, Takeshi


    We study the matter-antimatter asymmetry through the leptogenesis mechanism in the model with the Friedberg-Lee (FL) symmetry. We relate the leptogenesis with the CP violating Dirac and Majorana phases in the Maki-Nakagawa-Sakata leptonic mixing matrix and illustrate the net baryon asymmetry of the universe in terms of these phases.

  6. Quark Masses and Mixings with Hierarchical Friedberg-Lee Symmetry

    CERN Document Server

    Araki, T


    We propose the hierarchically translating Friedberg-Lee (FL) symmetry for the quark sector and show that the symmetry closely relates to both quark masses and mixings angles. We also extend our scheme to the fourth generation quark model and find the relation $|V_{tb^{'}}| \\simeq |V_{t^{'}b}| \\simeq m_b/m_{b^{'}}199 \\gev$.

  7. Catalogue of Radionuclide Low-Energy Electron Spectra (LEES)

    CERN Document Server

    Vylov, T D; Kovalik, A; Yakushev, E A; Mahmoud, M; Novgorodov, A F; Lebedev, N A; Filossofov, D V; Briançon, C; Walen, R J; Coursol, N F; Minkova, A; Petev, P; Dragoun, O; Brabec, V; Inoyatov, A


    More than 100 of apparatus low-energy electron spectra from radionuclides with Z=24-95 are collected in the presented LEES Catalogue. These spectra have been recorded in systematical investigations of Auger and internal conversion electrons with the ESA-50 electrostatic spectrometer during past 20 years.

  8. The Significance of Grit: A Conversation with Angela Lee Duckworth (United States)

    Perkins-Gough, Deborah


    For the last 11 years, Angela Lee Duckworth of the University of Pennsylvania has been conducting ground breaking studies on "grit"--the quality that enables individuals to work hard and stick to their long-term passions and goals. In this interview with "Educational Leadership," Duckworth describes what her research has shown…

  9. Berners-Lee wins inaugural Millennium Technology prize

    CERN Multimedia


    "World Wide Web inventor Tim Berners-Lee today was named recipient of the first-ever Millennium Technology Prize. The honor, which is accompanied by one million euros, is bestowed by the Finnish Technology Award Foundation as an international acknowledgement of outstanding technological innovation aimed at promoting quality of life and sustainable economic and societal development" (1 page)

  10. Illness, everyday life and narrative montage: the visual aesthetics of cancer in Sara Bro's Diary. (United States)

    Henriksen, Nina; Tjørnhøj-Thomsen, Tine; Hansen, Helle Ploug


    This article presents a study of Sara Bro's Diary (2004), a book montage of images and texts recording the experiences of a Danish breast cancer survivor, Sara Bro. It examines two montages of photography and text, drawing on Roland Barthes' concept of 'the third meaning' to explain and discuss the effect of the layered meanings in the montage alongside their multi-medium and self-referential expression. The discussion is centred on the aesthetic practices that are invited by Bro's book montage. The article considers how the juxtaposition of images and texts are experienced and co-created by the reader. It points to the effect of the aesthetics of disguise and carnival implicit in the visual-verbal montage and argues that these generate a third meaning. This meaning is associated with the breast cancer experience but is not directly discernible in the montage. The article concludes by discussing how Bro's montage acts as an ideological statement, subverting or 'poaching on' the health care system.

  11. First Results on the Epoch of Reionization from First Light with SARAS 2 (United States)

    Singh, Saurabh; Subrahmanyan, Ravi; Udaya Shankar, N.; Sathyanarayana Rao, Mayuri; Fialkov, Anastasia; Cohen, Aviad; Barkana, Rennan; Girish, B. S.; Raghunathan, A.; Somashekar, R.; Srivani, K. S.


    Long-wavelength spectral distortions in the cosmic microwave background arising from the 21 cm transition in neutral hydrogen are a key probe of the Cosmic Dawn and the Epoch of Reionization. These features may reveal the nature of the first stars and ultra-faint galaxies that transformed the spin temperature and ionization state of the primordial gas. SARAS 2 is a spectral radiometer purposely designed for the precision measurement of these monopole or all-sky global 21 cm spectral distortions. We use 63 hr nighttime observations of the radio background in the frequency band 110-200 MHz, with the radiometer deployed at the Timbaktu Collective in Southern India, to derive likelihoods for plausible redshifted 21 cm signals predicted by theoretical models. First light with SARAS 2 disfavors the class of models that feature weak X-ray heating (with {f}X≤slant 0.1) and rapid reionization (with peak \\tfrac{{{dT}}b}{{dz}}≥slant 120 mK per unit redshift interval).

  12. Corporate ethic policy


    Хадарцева, Лариса; Кайтмазов, Владимир


    The article deals with the general concept of business ethics, a corporate code of ethics and corporate social responsibility. Corporations take pains to promote sustainability through codes of ethics and their efforts are positively received by consumers.

  13. Managing Corporate Reputation Through Corporate Branding

    DEFF Research Database (Denmark)

    Schultz, Majken; Hatch, Mary Jo; Adams, Nick


    This article, which concentrates on symbolic management by explaining the role of corporate branding in managing corporate reputation, using Novo Nordisk as a case study, presents three perspectives on corporate branding: the marketing perspective, the organisational perspective and the co......-creation perspective. The three perspectives reviewed show the possibility of developing a multidisciplinary conceptualisation of corporate branding. They all offer insights important to managing organisations as corporate brands in a multi-stakeholder context and thus to the likelihood that corporate branding...... is a way to influence corporate reputation. The Novo Nordisk management believes the data indicate that corporate branding influenced reputation more than the other way around. Formal brand management practices may work considerably better when they complement rather than try to control existing forces...

  14. Managing Corporate Reputation Through Corporate Branding

    DEFF Research Database (Denmark)

    Schultz, Majken; Hatch, Mary Jo; Adams, Nick


    -creation perspective. The three perspectives reviewed show the possibility of developing a multidisciplinary conceptualisation of corporate branding. They all offer insights important to managing organisations as corporate brands in a multi-stakeholder context and thus to the likelihood that corporate branding......This article, which concentrates on symbolic management by explaining the role of corporate branding in managing corporate reputation, using Novo Nordisk as a case study, presents three perspectives on corporate branding: the marketing perspective, the organisational perspective and the co...... is a way to influence corporate reputation. The Novo Nordisk management believes the data indicate that corporate branding influenced reputation more than the other way around. Formal brand management practices may work considerably better when they complement rather than try to control existing forces...

  15. Nooruslikud juubilarid: fotokelder Lee 20 ja fotomuuseum 30 / Mall Parmas, Betty Ester-Väljaots

    Index Scriptorium Estoniae

    Parmas, Mall


    Peeter Toominga algatusel 1992. aastal asutatud Lee fotokeldrist. Loetletud fotomuuseumis oma töid eksponeerinud fotograafid. Ülevaatenäitus "Lee fotokelder 20" 17. jaanuarist 20. märtsini, koostaja Betty Ester-Väljaots

  16. Corporate Social Communication and Corporate Social Performance


    Ziggers, Gerrit Willem


    The purpose of this paper is to provide firms in the food and agricultural sector a model that enables them to assess their corporate social initiatives in conjunction with their stakeholders. Building on the concepts of corporate social responsibility (CSR), corporate social performance (CSP) and the relational view the paper argues that firms can improve the results of their corporate social initiatives by setting up a dialogue with their stakeholders and to relate this to their internal or...

  17. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  18. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  19. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. (United States)

    Plaizier, Jan C; Li, Shucong; Danscher, Anne Mette; Derakshani, Hooman; Andersen, Pia H; Khafipour, Ehsan


    The effects of a grain-based subacute ruminal acidosis (SARA) challenge on bacteria in the rumen and feces of lactating dairy cows were determined. Six lactating, rumen-cannulated Danish Holstein cows were used in a cross-over study with two periods. Periods included two cows on a control diet and two cows on a SARA challenge. The control diet was a total mixed ration containing 45.5% dry matter (DM), 43.8% DM neutral detergent fiber, and 19.6% DM starch. The SARA challenge was conducted by gradually substituting the control diet with pellets containing 50% wheat and 50% barley over 3 days to reach a diet containing 55.6% DM, 31.3% DM neutral detergent fiber, and 31.8% DM starch, which was fed for four more days. Rumen fluid samples were collected at day 7 and 10 of experimental periods. Feces samples were collected on days 8 and 10 of these periods. Extracted DNA from the rumen and feces samples was analyzed to assess their bacterial communities using MiSeq Illumina sequencing of the V4 region of the 16S rRNA gene. The induction of SARA reduced the richness, diversity, and stability of bacterial communities and resulted in distinctly different microbiota in the rumen and feces. Bacteroidetes and Firmicutes were the most abundant phyla and, combined, they represented 76.9 and 94.4% of the bacterial community in the rumen fluid and the feces, respectively. Only the relative abundance of Firmicutes in the rumen was increased by the SARA challenge. In rumen fluid and feces, the abundances of nine out of the 90 and 25 out of the 89 taxa, respectively, were affected by the challenge. Hence, SARA challenge altered the composition of the bacterial community at the lower taxonomical level in the feces and therefore also likely in the hindgut, as well as in the rumen. However, only reductions in the bacterial richness and diversity in the rumen fluid and feces were in agreement with those of other studies and had a biological basis. Although the composition of the

  20. A new formulation of Lee-Wick quantum field theory (United States)

    Anselmi, Damiano; Piva, Marco


    The Lee-Wick models are higher-derivative theories that are claimed to be unitary thanks to a peculiar cancelation mechanism. In this paper, we provide a new formulation of the models, to clarify several aspects that have remained quite mysterious, so far. Specifically, we define them as nonanalytically Wick rotated Euclidean theories. The complex energy plane is divided into disconnected regions, which can be related to one another by a well-defined, albeit nonanalytic procedure. Working in a generic Lorentz frame, the models are intrinsically equipped with the right recipe to treat the pinchings of the Lee-Wick poles, with no need of external ad hoc prescriptions. We describe these features in detail by calculating the one-loop bubble diagram and explaining how the key properties generalize to more complicated diagrams. The physical results of our formulation are different from those of the previous ones. The unusual behaviors of the physical amplitudes lead to interesting phenomenological predictions.

  1. Economist Innovation Award for Tim Berners-Lee

    CERN Multimedia


    In September, Tim Berners-Lee, who invented the World Wide Web at CERN and is now Director of the W3C World Wide Web Consortium, received the 2nd Economist Annual Innovation Award in Computing. With the award The Economist, a British weekly newspaper, recognises individuals responsible for breakthroughs in Bioscience, Computing, Energy and the Environment, and Telecommunications that have a profound impact on industry. A fifth award is given in a special "No Boundaries" category, observing innovation that transcends industries. Candidates for the awards are proposed by The Economist readers and writers, and by a group of judges. Tim Berners-Lee received the Computing award for his global hypertext project, to be known as the World Wide Web, which "forever altered the way information is shared" and is a huge contribution to the efficiency of the scientific community. Based on a programme for storing information using random associations called "Enquire", it...

  2. A Higher-Derivative Lee-Wick Standard Model

    CERN Document Server

    Carone, Christopher D


    The Lee-Wick Standard Model assumes a minimal set of higher-derivative quadratic terms that produce a negative-norm partner for each Standard Model particle. Here we introduce additional terms of one higher order in the derivative expansion that give each Standard Model particle two Lee-Wick partners: one with negative and one with positive norm. These states collectively cancel unwanted quadratic divergences and resolve the hierarchy problem as in the minimal theory. We show how this next-to-minimal higher-derivative theory may be reformulated via an auxiliary field approach and written as a Lagrangian with interactions of dimension four or less. This mapping provides a convenient framework for studies of the formal and phenomenological properties of the theory.

  3. Lee Miller, une battante sur tous les fronts

    Directory of Open Access Journals (Sweden)

    Anaïs Boutot


    Full Text Available L’art photographique de Lee Miller, à l’image de sa vie, revêt de multiples facettes. Après avoir été devant l’objectif en tant que mannequin puis égérie du Paris surréaliste, elle passe derrière l’objectif pour devenir photographe de mode, reporter de guerre ou encore portraitiste. L’exposition L’Art de Lee Miller, présentée au Jeu de Paume du 21 octobre 2008 au 4 janvier 2009 et accompagnée d’un ouvrage paru en français chez Hazan mettait en avant une quête d’identité et d’indépendance qui ...

  4. Tim Berners-Lee, World Wide Web inventor

    CERN Multimedia


    Former physicist, Tim Berners-Lee invented the World Wide Web as an essential tool for high energy physics at CERN from 1989 to 1994. Together with a small team he conceived HTML, http, URLs, and put up the first server and the first 'what you see is what you get' browser and html editor. Tim is now Director of the Web Consortium W3C, the International Web standards body based at INRIA, MIT and Keio University.

  5. Probing Features of the Lee-Wick Quantum Electrodynamics

    Directory of Open Access Journals (Sweden)

    R. Turcati


    Full Text Available We discuss some aspects concerning the electromagnetic sector of the abelian Lee-Wick (LW quantum electrodynamics (QED. Using the Dirac’s theory of constrained systems, the higher-order canonical quantization of the LW electromagnetism is performed. A quantum bound on the LW heavy mass is also estimated using the best known measurement of the anomalous magnetic moment of the electron. Finally, it is shown that magnetic monopoles can coexist peacefully in the LW scenario.

  6. Triniti daripada Perspektif Taoisme: Analisis Pemikiran Jung Young Lee

    Directory of Open Access Journals (Sweden)



    Full Text Available Jung Young Lee is a Korean-born theologian who employs creatively the doctrine of the Trinity from an Asian worldview. This article aims to analyze Lee’s approaches of the Trinity with the Yin-Yang symbolism. The main reference is based on the book written by him entitled ‘The Trinity in Asian Perspective (1996’. Lee has turned his attention to the topic of Trinity through the lens of the culture and thought patterns of his own milieu. One of the leading point in presenting Yin-Yang principle as Trinitarian thinking, Lee examines the interpretation of the term “in” in the Bible, "Believe me that I am in the Father and the Father is in me" (John 14:11. The statement leads to the point that Yin and Yang cannot exist without each other because relationality is given priority than individuality. The idea is based on the terminology of ‘both/and’. So, ‘and’ indicates a Trinitarian statement, there is interdependence and unification. With reference to Trinity, the Father and the Son are One because of ‘and’. In addition, the same concept implements to the Holy Spirit. Lee views ‘and’ is not only a linking principle in both-and thinking but also the principle that is ‘between’ two. When ‘two’ exists, the third also exist between them. Based on the idea of ‘middle’, represents the connecting element between two, which contributes for the existence of the Third. Accordingly, the Spirit is the third element in the Trinity relationship.

  7. The Corporate Secretary


    International Finance Corporation


    This Handbook offers a concise and practical description of how corporate secretaries might carry out their role to improve governance in their organizations. It can also serve as a guidance tool for both International Finance Corporation (IFC) clients and advisory staff to clarify the potentially expansive duties of corporate secretaries and to help them assist corporate secretaries in un...

  8. Information and Corporate Cultures. (United States)

    Drake, Miriam A.


    This paper defines "corporate culture" (set of values and beliefs shared by people working in an organization which represents employees' collective judgments about future) and discusses importance of corporate culture, nature of corporate cultures in business and academia, and role of information in shaping present and future corporate cultures.…

  9. Realizing Corporate Responsibility

    DEFF Research Database (Denmark)

    Girschik, Verena

    This doctoral dissertation aims to understand how companies realize corporate responsibility - both how they perform corporate responsibility in particular local contexts and how they negotiate understandings of what corporate responsibility means. It builds on an inductive case study of the Danish...... in this dissertation unfold distinct yet interdependent processes of positioning and framing that constitute new ways of performing and understanding corporate responsibility....

  10. Friedberg-Lee model at finite temperature and density (United States)

    Mao, Hong; Yao, Minjie; Zhao, Wei-Qin


    The Friedberg-Lee model is studied at finite temperature and density. By using the finite temperature field theory, the effective potential of the Friedberg-Lee model and the bag constant B(T) and B(T,μ) have been calculated at different temperatures and densities. It is shown that there is a critical temperature TC≃106.6 MeV when μ=0 MeV and a critical chemical potential μ≃223.1 MeV for fixing the temperature at T=50 MeV. We also calculate the soliton solutions of the Friedberg-Lee model at finite temperature and density. It turns out that when T⩽TC (or μ⩽μC), there is a bag constant B(T) [or B(T,μ)] and the soliton solutions are stable. However, when T>TC (or μ>μC) the bag constant B(T)=0 MeV [or B(T,μ)=0 MeV] and there is no soliton solution anymore, therefore, the confinement of quarks disappears quickly.

  11. The Friedberg-Lee model at finite temperature and density

    CERN Document Server

    Mao, Hong; Zhao, Wei-Qin


    The Friedberg-Lee model is studied at finite temperature and density. By using the finite temperature field theory, the effective potential of the Friedberg-Lee model and the bag constant $B(T)$ and $B(T,\\mu)$ have been calculated at different temperatures and densities. It is shown that there is a critical temperature $T_{C}\\simeq 106.6 \\mathrm{MeV}$ when $\\mu=0 \\mathrm{MeV}$ and a critical chemical potential $\\mu \\simeq 223.1 \\mathrm{MeV}$ for fixing the temperature at $T=50 \\mathrm{MeV}$. We also calculate the soliton solutions of the Friedberg-Lee model at finite temperature and density. It turns out that when $T\\leq T_{C}$ (or $\\mu \\leq \\mu_C$), there is a bag constant $B(T)$ (or $B(T,\\mu)$) and the soliton solutions are stable. However, when $T>T_{C}$ (or $\\mu>\\mu_C$) the bag constant $B(T)=0 \\mathrm{MeV}$ (or $B(T,\\mu)=0 \\mathrm{MeV}$) and there is no soliton solution anymore, therefore, the confinement of quarks disappears quickly.

  12. Psyche’s Daughter of Today: Sara Jeannette Duncan and the New Woman

    Directory of Open Access Journals (Sweden)

    Michelle Gadpaille


    Full Text Available The Canadian novelist Sara Jeannette Duncan (1861-1922 constructed a New Woman heroine in the fin-de- siecle novel; A Daughter of Today (1894. Written in the popular mode of the transatlantic novel; the work engages in debate on the appropriate construction of femininity in art and public life. The heroine; Elfrida Bell; descends from artist; to muse; to model; to painted image—a descent framed by a rival male artist and a hostile London art scene. Represented as Psyche; the heroine undergoes a quest and failure similar to the mythical one. Adaptation of the Psyche myth clarifies the position of Duncan in the spectrum of gender ideologies of the fin-de- siecle.

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1066 ref|NP_473371.1| MAS-related GPR, member X2 [Homo sapiens] sp|Q96...LB1|MRGX2_HUMAN Mas-related G-protein coupled receptor member X2 gb|AAK91805.1| G protein-coupled receptor [Homo sapie...ns] dbj|BAB89339.1| putative G-protein coupled receptor [Homo sapiens] dbj|BAC06030.1| seven trans...membrane helix receptor [Homo sapiens] gb|AAH63450.1| MAS-related GPR, member X2 [Homo sapie...ns] gb|AAW70056.1| MRGX2 [Homo sapiens] gb|AAW70057.1| MRGX2 [Homo sapiens] gb|AAW70058.1| MRGX2 [Homo sapie

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0185 ref|NP_000852.1| histamine receptor H1 [Homo sapiens] ref|NP_001091681.1| histamine... receptor H1 [Homo sapiens] ref|NP_001091682.1| histamine receptor H1 [Homo sapiens] ref|NP_001091683.1| histamine... receptor H1 [Homo sapiens] sp|P35367|HRH1_HUMAN Histamine H1 receptor emb|CAA54182.1| histamine... H1 receptor [Homo sapiens] dbj|BAA05840.1| histamine H1 receptor [ sapiens] emb|CAA84380.1| Human histamine H1 receptor [Homo sapiens] dbj|BAA03319.1| histamine H1 receptor

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_705806.1| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Mus musculus] sp|Q8BHK1|NIPA1_MOUSE Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 homo...log gb|AAM34534.1| non-imprinted in Prader-Willi/Angelman syndrome 1 [Mus musculus] dbj|BAC32809.1| unnamed ...protein product [Mus musculus] gb|AAH55828.1| Non imprinted in Prader-Willi/ syndrome 1 homolog (human) [Mus musculus] gb|EDL21870.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) [Mus musculus] NP_705806.1 1e-113 81% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_035141.1| opioid receptor, kappa 1 [Mus musculus] sp|P33534|OPRK_MOUSE opioid receptor (KOR-1) (MSL-1) gb|AAA39363.1| kappa opioid receptor gb|AAB34130.2| opioid receptor; KOR [Mus sp.] gb|AAP32232.1| kappa-opioid receptor [Mus sp.] gb|AAI16796.1| Opioid receptor, 1 [Mus musculus] gb|AAI19027.1| Opioid receptor, kappa 1 [Mus muscu...lus] gb|EDL14259.1| opioid receptor, kappa 1, isoform CRA_a [Mus musculus] NP_035141.1 1e-78 92% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0004 ref|NP_000900.1| neuropeptide Y receptor Y1 [Homo sapiens] sp|P25929|NPY1R_HUMAN Neurope...ptide Y receptor type 1 (NPY1-R) gb|AAA73215.1| [Human neuropeptide Y peptide YY rece...ptor mRNA, complete cds.], gene product gb|AAA59947.1| neuropeptide Y receptor Y1 gb|AAH36657.1| Neuropeptid...e Y receptor Y1 [Homo sapiens] gb|AAS55647.1| neuropeptide Y1 receptor [Homo sapiens] gb|AAH71720.1| Neuro...peptide Y receptor Y1 [Homo sapiens] gb|EAX04841.1| neuropeptide Y receptor Y1 [Hom

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_000901.1| neuropeptide Y receptor Y2 [Homo sapiens] ref|NP_001012655.1| neurope...ptide Y receptor Y2 [Pan troglodytes] sp|P49146|NPY2R_HUMAN Neuropeptide Y receptor typ...e 2 (NPY2-R) (NPY-Y2 receptor) sp|Q5IS62|NPY2R_PANTR Neuropeptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAC50281.1| neurope...ptide Y/peptide YY Y2 receptor gb|AAB04120.1| y2 receptor gb|AAC51115.1| type 2 neuropeptide Y receptor gb|AAO92062.1| neuropeptide Y receptor Y2 [Homo

  19. SarA is a negative regulator of Staphylococcus epidermidis biofilm formation

    DEFF Research Database (Denmark)

    Martin, Christer; Heinze, C.; Busch, M.


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive S. epidermidis isolates fail to show accumulative biofilm growth in vitro. We here tested the hypothesis that this apparent paradox is related...... to the existence of superimposed regulatory systems suppressing a multi-cellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA,chief regulator of staphylococcal...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via over-expression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1942 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1942 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenerg...ic receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AA...B59487.1| alpha 1a/d adrenergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenerg

  1. Escribiendo el silencio: la contemplación poética de Sara Pujol

    Directory of Open Access Journals (Sweden)

    Gala, Candelas


    Full Text Available Reading Sara Pujol Russell's El fuego tiende su aire (1999 and Intacto asombro de la luz del silencio (2001, is entering into a poetic world whose content and form are both innovative and complex. This poetry invites the reader into a state of meditative contemplation that seeks correspondences among different elements in reality as the key to access a superior type of knowledge. Pujol's writing moves in the fringes between voice and silence, art and nature, meaning and nothingness, identity and difference, it seeks to surpass its own verbal texture while only in that texture does it find articulation and only through it does transcendence becones accessible. The focus of the present reading centers on the point where Pujol's language seeks to transcend the disjunction between sign and surrounding, the point where synthesis is fusion about to dissolve.La lectura de El fuego tiende su aire (1999 e Intacto asombro en la luz del silencio (2001 de Sara Pujol Russell, supone la entrada en un discurso poético innovador y complejo tanto en contenido como en forma. Esta poesía invita a una contemplación meditativa que busca las correspondencias entre los diversos elementos de la realidad como clave para acceder a un conocimiento superior. Su escritura se mueve en los bordes entre la voz y el silencio, el arte y la naturaleza, el sentido y el vacío, la identidad y la diferencia, buscando trascender lo que está más allá de su misma urdimbre verbal pero que sólo en ella se configura, y sólo desde ella se puede acceder. En el movimiento de esta escritura por superar la disyunción entre signo y entorno, en esa síntesis a punto de disolverse, es donde se enfoca la lectura en este ensayo.

  2. Corporate Social Responsibility: Consumer Behavior, Corporate Strategy, and Public Policy

    National Research Council Canada - National Science Library

    Kreng, Victor B; Huang, May-Yao


    ... as "the consumers' impression of the corporation itself, corporate product marketing, and the services provided by the corporation". Corporate image is thus the consumers' subjective overall assessment of the corporation. Some marketing experts believe that the role corporations play in the wider society will help build their corporate image. ...

  3. Functional impairment in patients with myotonic dystrophy type 1 can be assessed by an ataxia rating scale (SARA). (United States)

    DiPaolo, Giovanni; Jimenez-Moreno, Cecilia; Nikolenko, Nikoletta; Atalaia, Antonio; Monckton, Darren G; Guglieri, Michela; Lochmüller, Hanns


    Myotonic dystrophy type 1 (DM1) is not characterised by ataxia per se; however, DM1 and ataxia patients show similar disturbances in movement coordination often experiencing walking and balance difficulties, although caused by different underlying pathologies. This study aims to investigate the use of a scale previously described for the assessment and rating of ataxia (SARA) with the hypothesis that it could have utility in DM1 patients as a measure of disease severity and risk of falling. Data from 54 DM1 patients were pulled from the PHENO-DM1 natural history study for analysis. Mean SARA score in the DM1 population was 5.45 relative to the maximum score of eight. A flooring effect (score 0) was observed in mild cases within the sample. Inter-rater and test-retest reliability was high with intraclass coefficients (ICC) of 0.983 and 1.00, respectively. Internal consistency was acceptable as indicated by a Cronbach's alpha of 0.761. Component analysis revealed two principle components. SARA correlated with: (1) all measures of muscle function tested, including quantitative muscle testing of ankle dorsiflexion (r = -0.584*), the 6 min walk test (r = -0.739*), 10 m walk test (r = 0.741*), and the nine hole peg test (r = 0.602*) and (2) measures of disease severity/burden, such as MIRS (r = 0.718*), MDHI (r = 0.483*), and DM1-Activ (r = -0.749*) (*p < 0.001). The SARA score was predicted by an interaction between modal CTG repeat length and age at sampling (r = 0.678, p = 0.003). A score of eight or above predicted the use of a walking aid with a sensitivity of 100% and a specificity of 85.7%. We suggest that further research is warranted to ascertain whether SARA or components of SARA are useful outcome measures for clinical trials in DM1. As a tool, it can be used for gathering information about disease severity/burden and helping to identify patients in need of a walking aid, and can potentially be applied in both research and healthcare

  4. Corporate governance and government owned corporations in Queensland

    National Research Council Canada - National Science Library

    MCDONOUGH, Darryl D


    ...) - principles of corporate governance applicable to government owned corporations - history of corporatisation - objectives and features of the Government Owned Corporations Act 1993 - categorisation...

  5. Corporate Bonds in Denmark

    DEFF Research Database (Denmark)

    Tell, Michael


    Corporate financing is the choice between capital generated by the corporation and capital from external investors. However, since the financial crisis shook the markets in 2007–2008, financing opportunities through the classical means of financing have decreased. As a result, corporations have...... to think in alternative ways such as issuing corporate bonds. A market for corporate bonds exists in countries such as Norway, Germany, France, the United Kingdom and the United States, while Denmark is still behind in this trend. Some large Danish corporations have instead used foreign corporate bonds...... markets. However, NASDAQ OMX has introduced the First North Bond Market in December 2012 and new regulatory framework came into place in 2014, which may contribute to a Danish based corporate bond market. The purpose of this article is to present the regulatory changes in Denmark in relation to corporate...

  6. The Sub-keV Atom Reflecting Analyzer (SARA) Experiment Aboard Chandrayaan-1 Mission: Instrument and Observations

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Barabash, Stas; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura


    SARA experiment aboard the first Indian lunar mission Chandrayaan-1 had the objective to explore the solar wind-lunar interaction using energetic neutral atoms (ENA) from the lunar surface as diagnostic tool. SARA consisted of an ENA imaging mass analyzer CENA (Chandrayaan-1 Energetic Neutral Analyzer) and an ion mass analyser SWIM (Solar Wind Monitor), along with a digital processing unit (DPU) which commands and controls the sensors and provides the interface to the spacecraft. Both sensors have provided excellent observational data. CENA has observed ENAs from the lunar surface and found that ~20% of the incident solar wind ions get backscattered as ENAs from the lunar surface. This is contrary to the previous assumptions of almost complete absorption of solar wind by the lunar surface. The observation is relevant for other airless bodies in the solar system.

  7. Tri-bimaximal mixing from twisted Friedberg-Lee symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Araki, Takeshi [National Tsing Hua University, Department of Physics, Hsinchu (China); Takahashi, Ryo [Osaka University, Department of Physics, Graduate School of Science, Osaka (Japan)


    We investigate the Friedberg-Lee (FL) symmetry and its promotion to include the {mu}-{tau} symmetry, and call this the twisted FL symmetry. Based on the twisted FL symmetry, two possible schemes are presented toward the realistic neutrino mass spectrum and the tri-bimaximal mixing. In the first scheme, we suggest the semi-uniform translation of the FL symmetry. The second one is based on the S{sub 3} permutation family symmetry. The breaking terms, which are twisted FL symmetric, are introduced. Some viable models in each scheme are also presented. (orig.)

  8. Tri-bimaximal mixing from twisted Friedberg-Lee symmetry (United States)

    Araki, Takeshi; Takahashi, Ryo


    We investigate the Friedberg-Lee (FL) symmetry and its promotion to include the μ- τ symmetry, and call this the twisted FL symmetry. Based on the twisted FL symmetry, two possible schemes are presented toward the realistic neutrino mass spectrum and the tri-bimaximal mixing. In the first scheme, we suggest the semi-uniform translation of the FL symmetry. The second one is based on the S 3 permutation family symmetry. The breaking terms, which are twisted FL symmetric, are introduced. Some viable models in each scheme are also presented.

  9. Generic Friedberg-Lee Symmetry of Dirac Neutrinos

    CERN Document Server

    Luo, Shu; Li, Xin


    We write out the generic Dirac neutrino mass operator which possesses the Friedberg-Lee (FL) symmetry and find that its corresponding neutrino mass matrix is asymmetric. Following a simple way to break the FL symmetry, we calculate the neutrino mass eigenvalues and show that the resultant neutrino mixing pattern is nearly tri-bimaximal. Imposing the Hermitian condition on the neutrino mass matrix, we also show that the simplified ansatz is consistent with current experimental data and favors the normal neutrino mass hierarchy.

  10. Holocene environment changes around the Sara Us River, northern China, revealed by optical dating of lacustrine-aeolian sediments (United States)

    Zhao, Hui; Sheng, Yongwei; Li, Bo; Fan, Yuxin


    The Sara Us River is located along the boundary of the Mu Us Desert and the Chinese Loess Plateau in northern China. The river has cut down through Quaternary sediments creating 70-80 m deep valleys with thick lacustrine/aeolian sequences exposed. We applied optical stimulated luminescence on sediments from a Holocene section of aeolian sand/lacustrine deposits in the top of the river valley. The dating results show that a humid period existed from 7.1 to 2.0 ka ago as evidenced by two layers of peat and lacustrine sediments. However, compared to other published Holocene sections in the Sara Us River valleys close to the section under studying, the local environment experienced very complicated changes during the Holocene. All of the sections recorded a period with drought and/or cold before the Holocene at around 13 ka, and an episode of aridity after about 2 ka ago as evidenced by the layers of aeolian sand. However, the ages of the lacustrine and peat layers in these sections are substantially different. Geomorphological analysis by digital elevation models does not support the existence of a mega lake covering the study area at 2 ka. The intricate environmental changes may have been caused by the meandering of the Sara Us River. Environmental changes also strongly affected human migration in this area, which is documented by Chinese historical records.

  11. SARA: a self-adaptive and resource-aware approach towards secure wireless ad hoc and sensor networks (United States)

    Chigan, Chunxiao; Li, Leiyuan


    Providing security is essential for mission critical Wireless Ad Hoc and Sensor Networks (WAHSN) applications. Often a highly secure mechanism inevitably consumes a rather large amount of system resources, which in turn may unintentionally cause a Security Service Denial of Service (SSDoS) attack. This paper proposes a self-adaptive resource-aware (SARA) security provisioning approach for WAHSNs. For resource scarce WAHSNs, SARA strives to provide the optimal tradeoff between the sufficient security (which is reflected by the Security Index (SI)) and the acceptable network performance degradation (which is reflected by the Performance Index (PI)). With the support of the offline optimal secure protocol selection module and the online self-adaptive security control module, SARA is capable of employing different combinations of secure protocol sets to satisfy different security need at different condition for different applications. To determine the security index SI of a secure protocol set, a heuristic cross-layer security-service mapping mechanism is presented. Furthermore, we evaluate performance index PI of a secure protocol set via simulation followed by Analysis of Variance (ANOVA). Consequently, the proposed self-adaptive security provisioning based on both SI and PI achieves the maximum overall network security services and network performance services, without causing the SSDoS attack. Furthermore, this self-adaptive mechanism is capable of switching from one secure protocol set to another while keeping similar level of security and performance, it thus provides additional security by security service hopping.

  12. Saras Cranes in Palwal District in Southern Haryana are Asking for Immediate Attention for Their Last Rescue Effort

    Directory of Open Access Journals (Sweden)

    Tirshem Kumar Kaushik


    Full Text Available Saras Cranes Grus antigone are endangered birds of open wetlands with highly worrying depletion trends being witnessed related with disappearance of marshy and shallow perennial, expansive wetlands throughout northern India. Alongside, massive hunting in 18th, 19th and 20th centuries and even today is another serious cause for their worrisome deterioration. Also, destruction of nests, eggs, fledglings and adults by aboriginals indeliberately or deliberately is causing these cranes to perish sooner than latter, completely. Now, Saras Cranes are found in limited number and domain as four populations in the entire world including India, China, Burma, South East Asia and northern Australia. The population of Indian Saras Crane is pitiably restricted to Etawa and Mainpuri districts of Uttar Pradesh. Stray birds of this species are restricted to Kanha National Park in Madhya Pradesh and in some parts of Gujarat and Assam. It is interesting to note that few pairs have been seen in Faridabad and Palwal districts in southern Haryana, India. These need to be protected and conserved.

  13. Studying the Lunar-Solar Wind Interaction with the SARA Experiment aboard the Indian Lunar Mission Chandrayaan-1

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Wieser, Martin; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura; 10.1063/1.3395916


    The first Indian lunar mission Chandrayaan-1 was launched on 22 October 2008. The Sub-keV Atom Reflecting Analyzer (SARA) instrument onboard Chandrayaan-1 consists of an energetic neutral atom (ENA) imaging mass analyzer called CENA (Chandrayaan-1 Energetic Neutrals Analyzer), and an ion-mass analyzer called SWIM (Solar wind Monitor). CENA performed the first ever experiment to study the solar wind-planetary surface interaction via detection of sputtered neutral atoms and neutralized backscattered solar wind protons in the energy range ~0.01-3.0 keV. SWIM measures solar wind ions, magnetosheath and magnetotail ions, as well as ions scattered from lunar surface in the ~0.01-15 keV energy range. The neutral atom sensor uses conversion of the incoming neutrals to positive ions, which are then analyzed via surface interaction technique. The ion mass analyzer is based on similar principle. This paper presents the SARA instrument and the first results obtained by the SWIM and CENA sensors. SARA observations suggest...

  14. Fostering Corporate Entrepreneurship

    African Journals Online (AJOL)

    ). The choice of using a strategy for corporate entrepreneurship as a primary means of .... Corporate venturing is a means of planning for organizational ambiguity in .... Multidiscipline teamwork approach, Long time horizon, Volunteer program.

  15. Corporate Consumer Contact API (United States)

    General Services Administration — The data in the Corporate Consumer Contact API is based on the content you can find in the Corporate Consumer Contact listing in the Consumer Action Handbook (PDF)....

  16. Fortune 500 Corporate Headquarters (United States)

    Department of Homeland Security — Large Corporate Headquarters in the United States This database is composed of 'an annual list of the 500 largest industrial corporations in the U.S., published by...

  17. Corporate Business Diplomacy

    DEFF Research Database (Denmark)

    Søndergaard, Mikael


    This article illustrates the interdisciplinary nature of the field of corporate business diplomacy using examples from academic disciplines, such as economics and political science, which can contribute to the understanding of corporate business diplomacy. Examples also show that corporate business...... diplomacy can complement business theories such as stakeholder theory and agency theory. Examples from practice show that in a broad sense, corporate business diplomacy is concerned with managing external stakeholders, while in a narrow sense, it is concerned with managing internal stakeholders...

  18. 25 CFR 227.6 - Corporations and corporate information. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Corporations and corporate information. 227.6 Section 227... § 227.6 Corporations and corporate information. (a) If the applicant for a lease is a corporation, it... the lands are located, evidence showing compliance with the corporation laws thereof. Statements...

  19. 25 CFR 213.14 - Corporations and corporate information. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Corporations and corporate information. 213.14 Section... Corporations and corporate information. If the applicant for a lease is a corporation, it shall file evidence..., evidence showing compliance with the corporation laws thereof. Statements of changes in officers...

  20. T.D Lee and Lisa Randall visit ATLAS

    CERN Multimedia

    Pauline Gagnon

    Professor Tsung-Dao Lee, who received the Nobel Prize for Physics in 1957 for postulating that parity is not conserved in weak interactions, visited the ATLAS detector this month. He is seen here in the company of Peter Jenni, spokesperson for ATLAS. T.D. Lee is still very active at over 80, pursuing his theory work to this day. Professor Lisa Randall from Harvard University, the well-known theorist behind the Randall-Sundrum theory for extra dimensions, was also part of the group visiting the ATLAS detector. She is seen here with Fabiola Gianotti, deputy spokesperson for ATLAS. Lisa Randall's two initial papers have been quoted both more than 2500 times, making her the most cited theoretical physicist in the world in the last five years as of last autumn - a total of about 10,000 citations! One wonders here if Peter is pointing to a CP-violating graviton spotted in the ATLAS cavern... From left to right: Fabiola Gianotti, Gustaaf Brooijmans, convener of the ATLAS Exotics physics gro...

  1. Corporate communications impact on corporate image and corporate competitiveness


    Valentina Pirić


    The subject of this paper is an analysis of the impact of corporate communications and of the intensity of their application on a company’s image management, and an emphasis of the role that a company’s image plays as one of the fundamental sources of its competitiveness in contemporary market conditions. Through review and analysis of theoretical contributions, the paper shows how corporate communications integrate management, organization and the marketing communication dimension at the lev...

  2. Evolution of Corporate Essence

    DEFF Research Database (Denmark)

    Fomcenco, Alex


    , it offers a legal framework where public benefit is more important than profits. As a corporate entity, Public Benefit Corporation already exists in numerous jurisdictions and those jurisdictions that do not yet facilitate creation of this corporate form should most definitely consider it....

  3. Reinventing Corporate Communications. (United States)

    Toth, Elizabeth L.; Trujillo, Nick


    Urges a "re-inventing" of corporate communications in today's organizations, and provides information about how corporations can change in new and positive ways during the current "information age." Discusses specific public relations and organizational communication concepts essential for a comprehensive understanding of corporate communications…

  4. Oxygen Consumption by Postfermentation Wine Yeast Lees: Factors Affecting Its Rate and Extent under Oenological Conditions


    Schneider, Volker; Müller, Jonas; Schmidt, Dominik


    Postfermentation wine yeast lees show antioxidant properties based on their ability to consume dissolved oxygen. The oxygen consumption capacity of suspended yeast lees obtained after fermentations with six commercial active dry yeast strains was investigated in model, white and red wines using fluorescence-based oxygen sensors operating in a nondestructive way. In model solution, the oxygen consumption rate of yeast lees was shown to depend on their amount, yeast strain, sulfur dioxide and t...

  5. TRADE instructional materials for SARA/OSHA training. Volume 2, Managers and supervisors training

    Energy Technology Data Exchange (ETDEWEB)


    This document provides instructional materials for an eight-hour training course for managers and supervisors of hazardous waste sites. It is one of three volumes of course materials TRADE is preparing to help DOE contractor training staff comply with 29 CFR 1910.120, the Occupational Health and Safety Administration (OSHA) rule that implements Title I of the Superfund Amendments and Reauthorization Act (SARA) of 1986. OSHA`s final rule for hazardous waste operators was published in the Federal Register of March 6, 1989 (54 FR 9294). Combined with the materials in Volumes I and III and with appropriate site-specific information, these materials will help DOE contractors to meet the requirements of 1910.120 (e) that ``on-site management and supervisors directly responsible for, or who supervise employees engaged in, hazardous waste operations`` receive the same initial training as that of the employees they supervise and at least eight additional hours of specialized training in managing hazardous waste operations.

  6. La difesa della donna ebrea: Sara Copio Sullam e Debora Ascarelli

    Directory of Open Access Journals (Sweden)

    Umberto Fortis


    Full Text Available Sara Copio Sullam and Debora Ascarelli, the best-known Jewish women poets of the age of the Italian ghetto, have often been studied with a focus on the distinctive features of their writing: the former as a translator of sacred texts, the latter as the author of original verses, sometimes written as a risposta per le rime (reply through rhymes or in defence of her orthodoxy. They share, however, a common theme, which has often been neglected: the defence of the Jewish woman, which is overt in some of Copio’s sonnets and prose, whereas it has not yet been properly pointed out in some of Ascarelli’s verses. This paper aims at bringing this theme to the fore not only in Copio, through a rereading of some passages of her Manifesto, but also in Debora Ascarelli, through an analysis of her few original verses. These hendecasyllables certainly reflect the Petrarchan and classicistic atmosphere of the late 16th century in Rome, but they are far from the mainstream modes of women’s poetry of the age. They allow us, therefore, to highlight, besides the differences, the similarities between the two poetesses; their commitment, in the late 16th and early 17th century, to the intellectual and moral defence of the Jewish woman, in a context of general depreciation of women, but also in the background of the claim to the “nobility and excellence of women”.

  7. Bayesian Population Forecasting: Extending the Lee-Carter Method. (United States)

    Wiśniowski, Arkadiusz; Smith, Peter W F; Bijak, Jakub; Raymer, James; Forster, Jonathan J


    In this article, we develop a fully integrated and dynamic Bayesian approach to forecast populations by age and sex. The approach embeds the Lee-Carter type models for forecasting the age patterns, with associated measures of uncertainty, of fertility, mortality, immigration, and emigration within a cohort projection model. The methodology may be adapted to handle different data types and sources of information. To illustrate, we analyze time series data for the United Kingdom and forecast the components of population change to the year 2024. We also compare the results obtained from different forecast models for age-specific fertility, mortality, and migration. In doing so, we demonstrate the flexibility and advantages of adopting the Bayesian approach for population forecasting and highlight areas where this work could be extended.

  8. Perturbative unitarity of Lee-Wick quantum field theory (United States)

    Anselmi, Damiano; Piva, Marco


    We study the perturbative unitarity of the Lee-Wick models, formulated as nonanalytically Wick rotated Euclidean theories. The complex energy plane is divided into disconnected regions and the values of a loop integral in the various regions are related to one another by a nonanalytic procedure. We show that the one-loop diagrams satisfy the expected, unitary cutting equations in each region: only the physical d.o.f. propagate through the cuts. The goal can be achieved by working in suitable subsets of each region and proving that the cutting equations can be analytically continued as a whole. We make explicit calculations in the cases of the bubble and triangle diagrams and address the generality of our approach. We also show that the same higher-derivative models violate unitarity if they are formulated directly in Minkowski spacetime.

  9. The Friedberg-Lee symmetry and minimal seesaw model

    Energy Technology Data Exchange (ETDEWEB)

    He Xiaogang [Center for High Energy Physics, Peking University, Beijing (China); Department of Physics and Center for Theoretical Sciences, National Taiwan University, Taipei, Taiwan (China); Liao Wei, E-mail: [Center for High Energy Physics, Peking University, Beijing (China); Institute of Modern Physics, East China University of Science and Technology, Shanghai (China)


    The Friedberg-Lee (FL) symmetry is generated by a transformation of a fermionic field q to q+xiz. This symmetry puts very restrictive constraints on allowed terms in a Lagrangian. Applying this symmetry to N fermionic fields, we find that the number of independent fields is reduced to N-1 if the fields have gauge interaction or the transformation is a local one. Using this property, we find that a seesaw model originally with three generations of left- and right-handed neutrinos, with the left-handed neutrinos unaffected but the right-handed neutrinos transformed under the local FL translation, is reduced to an effective theory of minimal seesaw which has only two right-handed neutrinos. The symmetry predicts that one of the light neutrino masses must be zero.

  10. Modified Friedberg-Lee symmetry for neutrino mixing (United States)

    Zhao, Zhen-hua


    In this paper, we put forward a special neutrino mass matrix which is invariant under a modified Friedberg-Lee (FL) transformation νe→νe-2 ξ and νμ ,τ→νμ ,τ+ξ with ξ being a space-time independent element of the Grassmann algebra. Compared to the original FL symmetry (with the transformation νe ,μ ,τ→νe ,μ ,τ+ξ ) which results in the TM2 neutrino mixing, the modified FL symmetry will lead us to the TM1 mixing which has a better agreement with the experimental results. While the original FL symmetry has to be broken in order to produce a realistic neutrino mass spectrum, the modified FL symmetry is allowed to remain intact and give us a vanishing m1. A combination of the FL symmetry with the μ -τ reflection symmetry is also discussed.

  11. Excitation Spectrum in the Friedberg-Lee Model (United States)

    Kowata, H.; Arima, M.


    The excitation spectrum of a nucleon with spin 1/2 is examined using the Friedberg-Lee model containing constituent quarks and a scalar meson. An appropriate method of quantization for the non-linear meson field is employed by taking account of the non-topological soliton existing at the classical level. Our model space for the nucleon resonances includes the three quark plus one meson state, in addition to the pure three quark state. The excitation spectrum in this model space reveals that the positive parity state appears as the first excited state associated with the 0s-excitation of the scalar meson. The meson excitation also generates an additional negative parity state apart from the well-known 0p-excitation of the quark.

  12. Excitation Spectrum in the Friedberg-Lee Model

    CERN Document Server

    Kowata, H


    The excitation spectrum of the nucleon with the spin 1/2 is examined by using the Friedberg-Lee model containing the constituent quark and the scalar meson. An appropriate way of quantization for the non-linear meson field is employed by taking account of the non-topological soliton existed in the classical level. Our model space for the nucleon resonances includes the three-quark plus one-meson state in addition to the pure three-quark state. The excitation spectrum in this model space shows that the positive parity state appears as the first excited state associated with the 0s-excitation of the scalar meson. The meson excitation also generates the additional negative parity state apart from the well-known 0p-excitation of the quark.

  13. The Friedberg-Lee symmetry and minimal seesaw model (United States)

    He, Xiao-Gang; Liao, Wei


    The Friedberg-Lee (FL) symmetry is generated by a transformation of a fermionic field q to q + ξz. This symmetry puts very restrictive constraints on allowed terms in a Lagrangian. Applying this symmetry to N fermionic fields, we find that the number of independent fields is reduced to N - 1 if the fields have gauge interaction or the transformation is a local one. Using this property, we find that a seesaw model originally with three generations of left- and right-handed neutrinos, with the left-handed neutrinos unaffected but the right-handed neutrinos transformed under the local FL translation, is reduced to an effective theory of minimal seesaw which has only two right-handed neutrinos. The symmetry predicts that one of the light neutrino masses must be zero.

  14. Excitation spectrum in the Friedberg-Lee model

    Energy Technology Data Exchange (ETDEWEB)

    Kowata, Hiroto; Arima, Masaki [Department of Physics, Osaka City University, Osaka (Japan)


    The excitation spectrum of a nucleon with spin 1/2 is examined using the Friedberg-Lee model containing constituent quarks and a scalar meson. An appropriate method of quantization for the non-linear meson field is employed by taking account of the non-topological soliton existing at the classical level. Our model space for the nucleon resonances includes the three quark plus one meson state, in addition to the pure three quark state. The excitation spectrum in this model space reveals that the positive parity state appears as the first excited state associated with the 0s-excitation of the scalar meson. The meson excitation also generates an additional negative parity state apart from the well-known 0p-excitation of the quark. (author)

  15. Applicability of the Friedberg-Lee-Zhao Method

    Institute of Scientific and Technical Information of China (English)

    ZHAO Gong-Bo; DING Yi-Bing; LI Xue-Qian; QIAN Ke; WANG Guo-Li; Zhaorigetu


    Friedberg, Lee and Zhao (FLZ) proposed a method for effectively evaluating the eigenenergies and eigen wavefunctions of quantum systems. In this work, we study several special cases to investigate applicability of the method.Concretely, we calculate the ground-state eigenenergy of the Hellmann potential as well as the Cornell potential, and also evaluate the energies of the systems where linear term is added to the Coulomb as a perturbation. The results obtained in this method have a surprising agreement with the traditional method or the numerical results. Since the results in this method have obvious analyticity compared to that in other methods, and because of the simplicity for calculations this method can be applied to solving the Schrodinger equation and provides us a better understanding of the physical essence of the concerned systems. But meanwhile applications of the FLZ method are restricted at present, especially for certain potential forms, but due to its obvious advantages, it should be further developed.

  16. The Friedberg-Lee Symmetry and Minimal Seesaw Model

    CERN Document Server

    He, Xiao-Gang


    The Friedberg-Lee (FL) symmetry is generated by a transformation of a fermionic field $q$ to $q + \\xi z$. This symmetry puts very restrictive constraints on allowed terms in a Lagrangian. Applying this symmetry to $N$ fermionic fields, we find that the number of independent fields is reduced to $N-1$ if the fields have gauge interaction or the transformation is a local one. Using this property, we find that a seesaw model originally with three generations of left- and right-handed neutrinos, with the left-handed neutrinos unaffected but the right-handed neutrinos transformed under the local FL translation, is reduced to an effective theory of minimal seesaw which has only two right-handed neutrinos. The symmetry predicts that one of the light neutrino mass must be zero.

  17. Applicability of the Friedberg-Lee-Zhao method

    CERN Document Server

    Zhao Gong Bo; Li Xue Qian; Wang Guo Li; Zhao, Gong-Bo; Ding, Yi-Bing; Li, Xue-Qian; Wang, Guo-Li


    Friedberg, Lee and Zhao proposed a method for effectively evaluating the eigenenergies and eigen wavefunctions of quantum systems. In this work, we study several special cases to investigate applicability of the method. Concretely, we calculate the ground-state eigenenergy of the Hellmann potential as well as the Cornell potential, and also evaluate the energies of the systems where linear term is added to the Coulomb and harmonic oscillator potentials as a perturbation. The results obtained in this method have a surprising agreement with the traditional method or the numerical results. Since the results in this method have obvious analyticity compared to that in other methods, and because of the simplicity for calculations this method can be applied to solving the Schr\\"{o}dinger equation and provides us better understanding of the physical essence of the concerned systems. But meanwhile applications of the FLZ method are restricted at present, especially for certain potential forms, but due to its obvious a...

  18. The Yuan-Tseh Lee Array for Microwave Background Anisotropy

    CERN Document Server

    Ho, Paul T P; Chang, Chia-Hao; Chang, Shu-Hao; Chang, Su-Wei; Chen, Chung-Cheng; Chen, Ke-Jung; Chen, Ming-Tang; Han, Chih-Chiang; Ho, West M; Huang, Yau-De; Hwang, Yuh-Jing; Ibanez-Romano, Fabiola; Jiang, Homin; Koch, Patrick M; Kubo, Derek Y; Li, Chao-Te; Lim, Jeremy; Lin, Kai-Yang; Liu, Guo-Chin; Lo, Kwok-Yung; Ma, Cheng-Jiun; Martin, Robert N; Martin-Cocher, Pierre; Molnar, Sandor M; Ng, Kin-Wang; Nishioka, Hiroaki; O'Connell, Kevin E; Oshiro, Peter; Patt, Ferdinand; Raffin, Philippe; Umetsu, Keiichi; Wei, Tashun; Wu, Jiun-Huei Proty; Chiueh, Tzi-Dar; Chiueh, Tzihong; Chu, Tah-Hsiung; Huang, Chih-Wei Locutus; Hwang, W Y Pauchy; Liao, Yu-Wei; Lien, Chun-Hsien; Wang, Fu-Cheng; Wang, Huei; Wei, Ray-Ming; Yang, Chia-Hsiang; Kesteven, Michael; Kingsley, Jeff; Sinclair, Malcolm M; Wilson, Warwick; Birkinshaw, Mark; Liang, Haida; Lancaster, Katy; Park, Chan-Gyung; Pen, Ue-Li; Peterson, Jeffrey B


    The Yuan-Tseh Lee Array for Microwave Background Anisotropy (AMiBA) is the first interferometer dedicated to studying the cosmic microwave background (CMB) radiation at 3mm wavelength. The choice of 3mm is to minimize the contributions from foreground synchrotron radiation and Galactic dust emission. The initial configuration of seven 0.6m telescopes mounted on a 6-m hexapod platform, was dedicated in October 2006 on Mauna Loa, Hawaii. Scientific operations began with the detection of a number of clusters of galaxies via the thermal Sunyaev-Zel'dovich effect. We compare our data with Subaru weak lensing data in order to study the structure of dark matter. We also compare our data with X-ray data in order to derive the Hubble constant.

  19. Perturbations in Symmetric Lee-Wick Bouncing Universe

    CERN Document Server

    Cho, Inyong


    We investigate the tensor and the scalar perturbations in the symmetric bouncing universe driven by one ordinary field and its Lee-Wick partner field which is a ghost. We obtain the even- and the odd-mode functions of the tensor perturbation in the matter-dominated regime. The tensor perturbation grows in time during the contracting phase of the Universe, and decays during the expanding phase. The power spectrum for the tensor perturbation is evaluated and the spectral index is given by $n_{\\rm T} =6$. We add the analysis on the scalar perturbation by inspecting the even- and the odd-mode functions in the matter-dominated regime, which was studied numerically in our previous work. We conclude that the comoving curvature by the scalar perturbation is constant in the super-horizon scale and starts to decay in the far sub-horizon scale while the Universe expands.

  20. Effects of corporate governance on corporate reputation


    López González, Eva


    One of the most critical strategic and enduring assets that a corporation may possess is good reputation. The positive impact of corporate reputation on firm performance has been analyzed and documented for ages. Intangible assets like reputation are increasing their importance in companies as sources of sustainable advantages. Organizations used to look for tangible assets as the drivers of these advantages, but nowadays intangible ones are getting much more weight in this sense. This is wh...





    Sustainability is targeted in this article to be integrated with corporate governance presenting its importance in business world not as obligation, but as a tool be adopted. Economic challenges push companies to think twice before making decisions. Corporate governance is a success key for companies through improving performance and gain mistrust of investors serving business sustainability. Objectives direction has been changed from concentrating on shareholders’ benefits to maintain sustai...





    Sustainability is targeted in this article to be integrated with corporate governance presenting its importance in business world not as obligation, but as a tool be adopted. Economic challenges push companies to think twice before making decisions. Corporate governance is a success key for companies through improving performance and gain mistrust of investors serving business sustainability. Objectives direction has been changed from concentrating on shareholders’ benefits to maintain sustai...

  3. Super-renormalizable or finite Lee-Wick quantum gravity (United States)

    Modesto, Leonardo


    We propose a class of multidimensional higher derivative theories of gravity without extra real degrees of freedom besides the graviton field. The propagator shows up the usual real graviton pole in k2 = 0 and extra complex conjugates poles that do not contribute to the absorptive part of the physical scattering amplitudes. Indeed, they may consistently be excluded from the asymptotic observable states of the theory making use of the Lee-Wick and Cutkosky, Landshoff, Olive and Polkinghorne prescription for the construction of a unitary S-matrix. Therefore, the spectrum consists of the graviton and short lived elementary unstable particles that we named ;anti-gravitons; because of their repulsive contribution to the gravitational potential at short distance. However, another interpretation of the complex conjugate pairs is proposed based on the Calmet's suggestion, i.e. they could be understood as black hole precursors long established in the classical theory. Since the theory is CPT invariant, the conjugate complex of the micro black hole precursor can be interpreted as a white hole precursor consistently with the 't Hooft complementarity principle. It is proved that the quantum theory is super-renormalizable in even dimension, i.e. only a finite number of divergent diagrams survive, and finite in odd dimension. Furthermore, turning on a local potential of the Riemann tensor we can make the theory finite in any dimension. The singularity-free Newtonian gravitational potential is explicitly computed for a range of higher derivative theories. Finally, we propose a new super-renormalizable or finite Lee-Wick standard model of particle physics.


    Energy Technology Data Exchange (ETDEWEB)



    This paper presents the history of Professor T. D. Lee's seminal work on the theory of relativistic heavy ion collisions, and the founding and development of the Riken Brookhaven Center. A number of anecdotes are given about Prof. Lee, and his strong positive effect on his colleagues, particularly young physicists.

  5. Tim Berners-Lee at the RSIS conference from 8-9 December 2003.

    CERN Multimedia

    Patrice Loiez


    Tim Berners-Lee participated in the Role of Science in the Information Society conference held at CERN from 8-9 December 2003. Tim Berners-Lee developed the first network and server system that lead to the World Wide Web.

  6. Women peers in the scientific realm: Sarah Bowdich (Lee)'s expert collaborations with Georges Cuvier, 1825–33 (United States)

    Orr, Mary


    The accepted rule for women contributing to nineteenth-century science before 1851 was that they could play only secondary roles in its production and authorship—as translators, illustrators, popularizers—and these by virtue of kinship or marriage to eminent scientists in the field or the laboratory. Sarah Bowdich (Lee) (1791–1856) presents an important amendment to this rule. As an explorer of West Africa on an equal scientific footing with her husband, and then a writer of science independently after his early death, she had other key roles as Georges Cuvier's cross-Channel scientific collaborator and as his first biographer. This article investigates and reframes Sarah's many individual achievements in science and its writing, to examine the larger questions of her case. How were her publications and ‘uneasy career’ in science possible? Can research on women in science today find inspiration in her example? PMID:26489182


    Directory of Open Access Journals (Sweden)

    Ciprian Apostol


    Full Text Available The objective of the research was focused on measuring the performance level of corporate governance in Romania. This is carried out by evaluating the importance level given to the principles of corporate governance in the Romanian economy, while the practices of transparency and dissemination of companies’ information in the selected sample were monitored. To achieve the objectives of the study, we need to examine the Corporate Governance Code of the Bucharest Stock Exchange. Sample companies were selected and their information from the “Comply or Explain” Statements was analyzed.The research method is a non-participating observation—based on the information from the “Comply or Explain” Statement to determine whether companies are applying corporate governance and transparency elements. The research results highlight the progress of Romanian companies in the process of exercising to the principles of corporate governance, becoming internationally recognized, and integrating into the Corporate Governance Code of the Bucharest Stock Exchange.

  8. The Corporate Marketing Department

    DEFF Research Database (Denmark)

    Ritter, Thomas; Eggert, Andreas; Münkhoff, Eva

    it can best add value to the firm. Based on a qualitative study among B2B companies, we develop a conceptual framework highlighting the various parental roles through which corporate marketing can contribute to overall firm and business unit performance. In addition, we identify five gaps that restrain......Corporate marketing has been downsized or eliminated in many firms. At the same time, firms that still own a corporate marketing department struggle with organizing and positioning their commercial front‐end. The question arises whether firms need a corporate marketing department, and if so, how...... successful outcomes of corporate marketing activities. In sum, our framework provides important insights on how to successfully organize corporate marketing activities....

  9. 25 CFR 226.8 - Corporation and corporate information. (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Corporation and corporate information. 226.8 Section 226... RESERVATION LANDS FOR OIL AND GAS MINING Leasing Procedure, Rental and Royalty § 226.8 Corporation and corporate information. (a) If the applicant for a lease is a corporation, it shall file evidence...

  10. Corporate governance in Malaysia

    National Research Council Canada - National Science Library

    SINGAM, Kamini


    ... governance in Malaysia - the ownership structure, composition and operation of Malaysian companies in Malaysia - the nature of shareholder control and protection made available in the Malaysian corporate...

  11. Corporate Governance Country Assessment : Malaysia


    World Bank


    This report assesses Ghana s corporate governance policy framework. It highlights recent improvements in corporate governance regulation, makes policy recommendations, and provides investors with a benchmark against which to measure corporate governance in Ghana. It is an update of the 2005 Corporate Governance ROSC. Good corporate governance enhances investor trust, helps to protects mino...

  12. Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. (United States)

    Sambanthamoorthy, Karthik; Smeltzer, Mark S; Elasri, Mohamed O


    The staphylococcal accessory regulator (sarA) plays a central role in the regulation of virulence in Staphylococcus aureus. To date, studies involving sarA have focused on its activity as a global regulator that modulates transcription of a wide variety of genes (>100) and its role in virulence. However, there is also evidence to suggest the existence of accessory elements that modulate SarA production and/or function. A reporter system was developed to identify such elements, and a new gene, msa (SA1233), mutation of which results in reduced expression of SarA, was identified and characterized. Additionally, it was shown that mutation of msa resulted in altered transcription of the accessory gene regulator (agr) and the genes encoding several virulence factors including alpha toxin (hla) and protein A (spa). However, the impact of mutating msa was different in the laboratory strain RN6390 and the clinical isolate UAMS-1. For instance, mutation of msa caused a decrease in spa and hla transcription in RN6390 but had a different effect in UAMS-1. The strain-dependent effects of the msa mutation were similar to those observed previously, which suggests that msa may modulate the production of specific virulence factors through its impact on sarA. Interestingly, sequence analysis of Msa suggests that it is a putative membrane protein with three membrane-spanning regions, indicating that Msa might interact with the environment. The findings show that msa is involved in the expression of SarA and several virulence factors.

  13. Understanding Corporate Culture. (United States)

    Cluff, Gary A.


    Considers concept of corporate culture and discusses several values which can be considered when assessing corporate culture, and the "compatibility scales" used to measure them. Included are discussions of employee attitudes, work atmosphere, internal communications, management style, employment opportunity, stability, business ethics, corporate…

  14. Corporate Bankruptcy Tourists

    NARCIS (Netherlands)

    Couwenberg, Oscar; Lubben, Stephen J.


    Foreign corporations facing financial distress have a choice: resructure in their home jurisdiction or file for bankruptcy in the United States. And some number of foreign corporations do file bankruptcy petitions in the United States. But besides the occasional anecdotal account, how frequently thi

  15. Efficiency in Corporate Takeovers

    NARCIS (Netherlands)

    Y. Dai (Yun)


    markdownabstractCorporate takeover is a very important economic activity that generates profound consequences on many classes of market participants. The great financing needs and transaction costs directly change the wealth of both shareholders and creditors. The corporate restructuring induced by

  16. Corporate Media Governance

    NARCIS (Netherlands)

    Kempen, Petrus Cornelis


    The media can make or break a reputation. This being said, it seems to be essential for companies, governments and institutions to pay specific attention to corporate media management in their daily operations. However, this thesis shows that they often neglect to pay adequate attention to corporate

  17. Corporate Bankruptcy Tourists

    NARCIS (Netherlands)

    Couwenberg, Oscar; Lubben, Stephen J.


    Foreign corporations facing financial distress have a choice: resructure in their home jurisdiction or file for bankruptcy in the United States. And some number of foreign corporations do file bankruptcy petitions in the United States. But besides the occasional anecdotal account, how frequently

  18. Corporate Media Governance

    NARCIS (Netherlands)

    Kempen, Petrus Cornelis


    The media can make or break a reputation. This being said, it seems to be essential for companies, governments and institutions to pay specific attention to corporate media management in their daily operations. However, this thesis shows that they often neglect to pay adequate attention to corporate

  19. Corporate Crime and Restitution. (United States)

    Abel, Charles F.


    Articulates need, nature, and form of a restitutionary approach to corporate crime. Considers small, in-prison production-oriented programs; residential in-community programs, and nonresidential in-community programs for individual offenders; also considers lump sum and continuous payments for corporations to make restitution. (NRB)

  20. Reinventing Corporate Communications. (United States)

    Toth, Elizabeth L.; Trujillo, Nick


    Urges a "re-inventing" of corporate communications in today's organizations, and provides information about how corporations can change in new and positive ways during the current "information age." Discusses specific public relations and organizational communication concepts essential for a comprehensive understanding of…

  1. Corporation as climate ambassador

    DEFF Research Database (Denmark)

    Trapp, Leila


    At a time when corporations are addressing increasingly complex, global corporate social responsibility (CSR) issues, this study examines and evaluates the strategies used in Vattenfall’s challenging and innovative CSR campaign which aimed at establishing the energy company as a credible climate...

  2. James Lee Byars 1/2 an autobiography, sourcebook

    CERN Document Server

    Byars, James Lee; Eleey, Peter


    "I see my autobiography as an arbitrary segment of so many pages of time, of things that I have paid attention to at this point in my life," wrote James Lee Byars (1932-1997) in 1969. He was then 37, about half the average male lifespan at the time, and accordingly thought it appropriate to write his "1/2 autobiography." Byars' art ranged from highly refined objects to extremely minimal performance and events, and books, ephemera and correspondence that he distributed widely among friends and colleagues. Today, more than 15 years after his death, assessments of his art must negotiate Byars' performance of his charismatic self in his life and art. For his first major posthumous survey in the US, exhibition curators Magalí Arriola and Peter Eleey decided to produce a catalogue in two "halves," playing on his "1/2 autobiography": a catalogue of the exhibition itself, including new scholarship, and a sourcebook of primary documents. 1/2 an Autobiography, Sourcebook constitutes the latter volume--a reference guid...

  3. Tri-Bimaximal Mixing from Twisted Friedberg-Lee Symmetry

    CERN Document Server

    Araki, Takeshi


    We consider the tri-bimaximal generation mixing in terms of the Friedberg-Lee (FL) symmetry. The symmetry is a kind of translational one for the fermion field operators. The symmetry with uniform translation for each generation of neutrinos can partially realize the desired form of the neutrino mass matrix for the tri-bimaximal mixing but should be improved to obtain the experimentally favored neutrino mass spectrum. It is firstly pointed out that patterns of the uniformity breaking are important for resulting form of the neutrino mass matrix. Then we propose a promotion of the FL symmetry to have the $\\mu - \\tau$ one, and call that the twisted FL symmetry. Based on the twisted FL symmetry, two possible schemes are also presented toward the realistic neutrino mass spectrum and the tri-bimaximal mixing. The first possible scheme is that the uniformity of the FL symmetry is broken by terms preserving the twisted FL one. The second one is based on the $S_3$ permutation family symmetry. The breaking terms, which ...

  4. A light sterile neutrino from Friedberg–Lee symmetry

    Energy Technology Data Exchange (ETDEWEB)

    He, Xiao-Gang [Shanghai Key Laboratory of Particle Physics and Cosmology, Shanghai (China); INPAC and Department of Physics, Shanghai Jiao Tong University, Shanghai (China); Physics Division, National Center for Theoretical Sciences, Department of Physics, National Tsing Hua University, Hsinchu, Taiwan (China); CTS, CASTS and Department of Physics, National Taiwan University, Taipei, Taiwan (China); Liao, Wei, E-mail: [Institute of Modern Physics, School of Science, East China University of Science and Technology, Shanghai (China)


    Light sterile neutrinos of mass about an eV with mixing U{sup -tilde}{sub ls} of a few percent to active neutrinos may solve some anomalies shown in experimental data related to neutrino oscillation. How to have light sterile neutrinos is one of the theoretical problems which have attracted a lot of attentions. In this article we show that such an eV scale light sterile neutrino candidate can be obtained in a seesaw model in which the right-handed neutrinos satisfy a softly-broken Friedberg–Lee (FL) symmetry. In this model a right-handed neutrino is guaranteed by the FL symmetry to be light comparing with other two heavy right-handed neutrinos. It can be of eV scale when the FL symmetry is softly broken and can play the role of eV scale sterile neutrino needed for explaining the anomalies of experimental data. This model predicts that one of the active neutrino is massless. We find that this model prefers inverted hierarchy mass pattern of active neutrinos than normal hierarchy. An interesting consequence of this model is that realizing relatively large |U{sup -tilde}{sub es}| and relatively small |U{sup -tilde}{sub μs}| in this model naturally leads to a relatively small |U{sup -tilde}{sub τs}|. This interesting prediction can be tested in future atmospheric or solar neutrino experiments.

  5. A light sterile neutrino from Friedberg-Lee symmetry (United States)

    He, Xiao-Gang; Liao, Wei


    Light sterile neutrinos of mass about an eV with mixing U of a few percent to active neutrinos may solve some anomalies shown in experimental data related to neutrino oscillation. How to have light sterile neutrinos is one of the theoretical problems which have attracted a lot of attentions. In this article we show that such an eV scale light sterile neutrino candidate can be obtained in a seesaw model in which the right-handed neutrinos satisfy a softly-broken Friedberg-Lee (FL) symmetry. In this model a right-handed neutrino is guaranteed by the FL symmetry to be light comparing with other two heavy right-handed neutrinos. It can be of eV scale when the FL symmetry is softly broken and can play the role of eV scale sterile neutrino needed for explaining the anomalies of experimental data. This model predicts that one of the active neutrino is massless. We find that this model prefers inverted hierarchy mass pattern of active neutrinos than normal hierarchy. An interesting consequence of this model is that realizing relatively large |U| and relatively small |U| in this model naturally leads to a relatively small |U|. This interesting prediction can be tested in future atmospheric or solar neutrino experiments.

  6. Fragmented structures of lee waves over combined obstacles (United States)

    Makarenko, Nikolay; Maltseva, Janna


    The problem on finite amplitude internal waves arising in a steady non-homogeneous flow over an uneven bottom is considered. Semi-analytical model deals with asymptotic solutions of the Euler equations of uniformly stratified fluid. Approximate solutions are constructed by the perturbation procedure combined with the Fourier method of modal expansion. Preliminary simulations used either of the first-order linear solution and the second-order non-linear solution (see [1,2]), and these numerical calculations found the fragmentation effect which occurs for near-field wave patterns forced by multi-bumped topography of finite extension. In this paper, we explain analytically the existence of sharp fronts which separate the flow domains having different wave scales. The results are illustrated numerically via modeling of wave structures generated by real bottom topography. References [1] N. Makarenko, J. Maltseva, Interference of lee waves over mountain ranges, NHESS, 2011, 11, 27-32. [2] N. Makarenko, J. Maltseva, Steady waves in a stratified flow over a combined obstacle, JAMTP, 2014, 55(2), 311-317.

  7. A Light Sterile Neutrino from Friedberg-Lee Symmetry

    CERN Document Server

    He, Xiao-Gang


    Light sterile neutrinos of mass about an eV with mixing $\\tilde U_{ls}$ of a few percent to active neutrinos may solve some anomalies shown in experimental data related to neutrino oscillation. How to have light sterile neutrinos is one of the theoretical problems which have attracted a lot of attentions. In this article we show that such an eV scale light sterile neutrino candidate can be obtained in a seesaw model in which the right-handed neutrinos satisfy a softly-broken Friedberg-Lee (FL) symmetry. In this model a right-handed neutrino is guaranteed by the FL symmetry to be light comparing with other two heavy right-handed neutrinos. It can be of eV scale when the FL symmetry is softly broken and can play the role of eV scale sterile neutrino needed for explaining the anomalies of experimental data. This model predicts that one of the active neutrino is massless. We find that this model prefers inverted hierarchy mass pattern of active neutrinos than normal hierarchy. An interesting consequence of this m...

  8. Lee-Yang Model in Presence of Defects

    CERN Document Server

    Deeb, Omar El


    I choose the Lee-Yang model and go through different approaches to analyze it using the form factor approach and the bootstrap program, the lattice description and the lattice TBA equations for a full understanding of the model. The bootstrap program aims to explicitly solve 1+1 dimensional integrable quantum field theories. In the first step, called the S-matrix bootstrap, the scattering matrix, is determined from its properties. In developing a defect form factor program the first step is the T-matrix bootstrap. Interacting integrable defect theories are purely transmitting and topological. We analyze both operators localized in the bulk and also on the defect. By finding their solutions, the spectral representation of any correlator can be determined. Next we consider the model on the lattice. The lattice approach allows to obtain both massive and massless excited TBA equations by studying the continuum scaling limit of the associated integrable lattice models. The most important input from the lattice app...

  9. Institutional conditions of corporate citizenship

    NARCIS (Netherlands)

    Jeurissen, R.J.M.


    Exploring the concept of citizenship from the history of political philosophy provides suggestions about what corporate citizenship could mean. The metaphor of corporate citizenship suggests an institutional approach to corporate social responsibility. Citizenship is a social role, characterized by

  10. Institutional conditions of corporate citizenship

    NARCIS (Netherlands)

    Jeurissen, R.J.M.


    Exploring the concept of citizenship from the history of political philosophy provides suggestions about what corporate citizenship could mean. The metaphor of corporate citizenship suggests an institutional approach to corporate social responsibility. Citizenship is a social role, characterized by


    Directory of Open Access Journals (Sweden)

    Herman Darwis


    Full Text Available The research aimed to provide empirical evidence that corporate governance implementation,managerial ownership, institutional ownership, board of executive, and independent executiveaffected corporate performance. Population of the research was companies listed at IndonesianStock Exchange (ISX between 2006 – 2008; sampling method used was purposive sampling as well asmultiple regression analysis. The result showed the implementation of GCG affected corporate performance.This meant that if the listed companies at BEI and have been surveyed by IICG implement agood corporate governance, the performance would increase. The higher corporate governance wasmeasured by corporate governance index perception, the higher corporate obedience and result ina good corporate performance. Institutional ownership affected corporate performance. The greaterinstitutional share ownership, the better corporate performance. The result showed that controlfunction from the ownership did determine improving corporate performance. Managerial ownership,board of commissioner, and commissioner independent did not affect corporate.

  12. Effect of the Lee-Wick partners in the evolution of the early universe

    CERN Document Server

    Bhattacharya, Kaushik


    Recently some work has been done on Lee-Wick standard model where the authors tried to tackle the hierarchy problem by using higher derivative field theory. All those theories require unusual Lee-Wick partners to the Standard model particles where these unusual fields appear with negative signs in the Lagrangian. The thermodynamics of such unusual Lee-Wick particles has also been studied. In the present article the thermodynamic results of the Lee-Wick partner infested universe have been applied in a model where there is one Lee-Wick partner to each of the standard model particle. In this model one can analytically calculate the time-temperature relation in the very early radiation dominated universe which shows interesting new physics. The article also tries to point out how a Lee-Wick particle dominated early cosmology transforms into the standard cosmological model. Based on the results of the previous analysis a brief discussion on the more realistic model, which can accommodate two Lee-Wick parters for e...

  13. Corporate Language Policies

    DEFF Research Database (Denmark)

    Sanden, Guro Refsum

    This paper offers a review of literature dealing with language policies in general and corporate language policies in particular. Based on a discussion of various definitions of these concepts within two research traditions, i.e. sociolinguistics and international management, a three......-level definition of corporate language policies is presented, emphasising that a corporate language policy is a context-specific policy about language use. The three-level definition is based on the argument that in order to acquire a complete understanding of what corporate language policies involve, one needs...... to consider three progressive questions; 1) what is a policy? 2) what is a language policy?, and ultimately, 3) what is a corporate language policy?...

  14. Corporate Language Policies

    DEFF Research Database (Denmark)

    Sanden, Guro Refsum


    This paper offers a review of literature dealing with language policies in general and corporate language policies in particular. Based on a discussion of various definitions of these concepts within two research traditions, i.e. sociolinguistics and international management, a three......-level definition of corporate language policies is presented, emphasising that a corporate language policy is a context-specific policy about language use. The three-level definition is based on the argument that in order to acquire a complete understanding of what corporate language policies involve, one needs...... to consider three progressive questions; 1) what is a policy? 2) what is a language policy?, and ultimately, 3) what is a corporate language policy?...


    Directory of Open Access Journals (Sweden)

    Sorin Nicolae BORLEA


    Full Text Available This study attempts to provide a theoretical framework for the corporate governance debate. The review of various corporate governance theories enhances the major objective of corporate governance which is maximizing the value for shareholders by ensuring good social and environment performances. The theories of corporate governance are rooted in agency theory with the theory of moral hazard’s implications, further developing within stewardship theory and stakeholder theory and evolving at resource dependence theory, transaction cost theory and political theory. Later, to these theories was added ethics theory, information asymmetry theory or the theory of efficient markets. These theories are defined based on the causes and effects of variables such as: the configuration of the board of directors, audit committee, independence of managers, the role of top management and their social relations beyond the legal regulatory framework. Effective corporate governance requires applying a combination

  16. 76 FR 39869 - Lee 8 Storage Partnership; Notice of Motion for Extension of Rate Case Filing Deadline (United States)


    ... Energy Regulatory Commission Lee 8 Storage Partnership; Notice of Motion for Extension of Rate Case Filing Deadline Take notice that on June 27, 2011, Lee 8 Storage Partnership (Lee 8) filed a request for.... Eastern Time on Monday, July 11, 2011. Dated: June 28, 2011. Nathaniel J. Davis, Sr., Deputy...

  17. An analytical model for the amplitude of lee waves forming on the boundary layer inversion (United States)

    Sachsperger, Johannes; Serafin, Stefano; Stiperski, Ivana; Grubišić, Vanda


    Lee waves are horizontally propagating gravity waves with a typical wavelength of 5-15 km that may be generated when stratified flow is lifted over a mountain. A frequently observed type of such waves is that of interfacial lee waves. Those develop, similar to surface waves on a free water surface, when the upstream flow features a density discontinuity. Such conditions are often present for example at the capping inversion in boundary layer flow. The dynamics of interfacial lee waves can be described concisely with linear interfacial gravity wave theory. However, while this theoretical framework accurately describes the wavelength, it fails to properly predict the amplitude of lee waves. It is well known that large amplitude lee waves may lead to low-level turbulence, which poses a potential hazard for aviation. Therefore, this property of interfacial lee waves deserves further attention. In this study, we develop a simple analytical model for the amplitude of lee waves forming on the boundary layer inversion. This model is based on the energetics of two-layer flow. We obtain an expression for the wave amplitude by equating the energy loss across an internal jump with the energy radiation through lee waves. The verification of the result with water tank experiments of density-stratified two-layer flow over two-dimensional topography from the HYDRALAB campaign shows good agreement between theory and observations. This new analytical model may be useful in determining potential hazards of interfacial lee waves with negligible computational cost as compared to numerical weather prediction models.

  18. About the triviality of the higher derivative sector in the abelian Lee-Wick model

    CERN Document Server

    Fiorentini, D


    Canonical quantization is reviewed here for the Abelian Lee-Wick model by using the Dirac constraints method. New degrees of freedom associated to the (higher derivatives) Lee-Wick ghost are excluded from the (physical) space of observables by a new prescription, based on the Nielsen-type BRST-extended symmetry for the Lee-Wick mass term. We prove that this prescription is nothing but an effective form of implementing the cohomological triviality of the higher-derivative pure sector associated to the existence of a new exclusive higher-derivative BRST symmetry.

  19. Corporate Blogging For Dummies

    CERN Document Server

    Karr, Douglas


    Establish a successful corporate blog to reach your customers. Corporate blogs require careful planning and attention to legal and corporate policies in order for them to be productive and effective. This fun, friendly, and practical guide walks you through using blogging as a first line of communication to customers and explains how to protect your company and employees through privacy, disclosure, and moderation policies. Blogging guru Douglas Karr demonstrates how blogs are an ideal way to offer a conversational and approachable relationship with customers. You'll discover how to prepare, e

  20. Strategic corporate sustainability

    DEFF Research Database (Denmark)

    Grewatsch, Sylvia; Rohrbeck, René; Madsen, Henning

    This paper aims to advance the understanding of the circumstances under which corporate sustainability (CS) pays off. On the basis of a review of 129 major papers from both the sustainability and general management literature, we discuss the development of the research field. In addition we discuss...... antecedents and outcomes. To overcome this limitation we propose an integrated typology which may facilitate more research on the link between corporate sustainability performance (CSP) and corporate financial performance (CFP). Our expectation is that the strategy type might play a moderating or mediating...

  1. Corporate Social Behaviour

    DEFF Research Database (Denmark)

    Neergaard, Peter; Rahbek Pedersen, Esben


    , human rights and environmental protection. Without a common point of reference in national regulation, managers in multinational enterprises now have to develop their own codes of corporate social behaviour. This has created a growing market for private standards within the field of environmental...... management systems, social accountability, corporate citizenship, occupational health and safety and so forth. However, both the idea of government regulation and the literature acclaiming corporate self-regulation should be met with some scepticism. This paper offers a short assessment of the potentials...

  2. Strategic corporate sustainability

    DEFF Research Database (Denmark)

    Grewatsch, Sylvia; Rohrbeck, René; Madsen, Henning

    This paper aims to advance the understanding of the circumstances under which corporate sustainability (CS) pays off. On the basis of a review of 129 major papers from both the sustainability and general management literature, we discuss the development of the research field. In addition we discuss...... antecedents and outcomes. To overcome this limitation we propose an integrated typology which may facilitate more research on the link between corporate sustainability performance (CSP) and corporate financial performance (CFP). Our expectation is that the strategy type might play a moderating or mediating...

  3. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation (United States)

    Godwin, Allison; Potvin, Geoff


    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  4. Impact of individual extracellular proteases on Staphylococcus aureus biofilm formation in diverse clinical isolates and their isogenic sarA mutants. (United States)

    Loughran, Allister J; Atwood, Danielle N; Anthony, Allison C; Harik, Nada S; Spencer, Horace J; Beenken, Karen E; Smeltzer, Mark S


    We demonstrate that the purified Staphylococcus aureus extracellular proteases aureolysin, ScpA, SspA, and SspB limit biofilm formation, with aureolysin having the greatest impact. Using protease-deficient derivatives of LAC, we confirmed that this is due to the individual proteases themselves. Purified aureolysin, and to a lesser extent ScpA and SspB, also promoted dispersal of an established biofilm. Mutation of the genes encoding these proteases also only partially restored biofilm formation in an FPR3757 sarA mutant and had little impact on restoring virulence in a murine bacteremia model. In contrast, eliminating the production of all of these proteases fully restored both biofilm formation and virulence in a sarA mutant generated in the closely related USA300 strain LAC. These results confirm an important role for multiple extracellular proteases in S. aureus pathogenesis and the importance of sarA in repressing their production. Moreover, purified aureolysin limited biofilm formation in 14 of 15 methicillin-resistant isolates and 11 of 15 methicillin-susceptible isolates, while dispersin B had little impact in UAMS-1, LAC, or 29 of 30 contemporary isolates of S. aureus. This suggests that the role of sarA and its impact on protease production is important in diverse strains of S. aureus irrespective of their methicillin resistance status.

  5. Lee Metcalf National Wildlife Refuge: Annual narrative report: Calendar year 1990 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf NWR outlines Refuge accomplishments during the 1990 calendar year. The report begins with a summary of the year's...

  6. [Montana MOYOCO Invasive Species Strike Team Final Report 2014] Ninepipe National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO MT Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered by...

  7. [Montana MOYOCO Invasive Species Strike Team Final Report 2016] Ninepipe National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  8. Lee Metcalf National Wildlife Refuge Annual narrative report: Calendar year 1979 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuges outlines Refuge accomplishments during the 1979 calendar year. The report begins with an...

  9. Lee Metcalf National Wildlife Refuge Annual narrative report: Calendar year 1982 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuges outlines Refuge accomplishments during the 1982 calendar year. The report begins with an...

  10. The Trail Inventory of Lee Metcalf National Wildlife Refuge [Cycle 1 (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Lee Metcalf National Wildlife Refuge. Trails in this inventory are...

  11. [Montana MOYOCO Invasive Species Strike Team Final Report 2014] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO MT Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered by...

  12. Näitleja Tommy Lee Jonesi meditatsioon režissööritoolis / Andris Feldmanis

    Index Scriptorium Estoniae

    Feldmanis, Andris, 1982-


    Vestern "Melquiades Estrada kolm matust" ("The Three Burials of Melquiades Estrada") : stsenarist Guillermo Arriaga : režissöör ja osatäitja Tommy Lee Jones : operaator Chris Menges : Ameerika Ühendriigid, 2005

  13. Environmental Assessment : proposed shotgun slug/blackpowder antlerless deer hunt on Lee Metcalf National Wildlife Refuge (United States)

    US Fish and Wildlife Service, Department of the Interior — Lee Metcalf NWR, in this assessment, is proposing a gun hunt for the 1988 deer hunting season in an effort to reduce the deer herd on the refuge. A biological...

  14. Physical modelling of baroclinic development in the lee of the Alps

    Directory of Open Access Journals (Sweden)

    E. Ferrero


    Full Text Available When baroclinic development is triggered by an obstacle, like an extended mountain range, the so-called lee, or secondary cyclogenesis can develop. The presence of the obstacle exerts a blocking effect on the lower layers of the impinging airflow, forcing them to go round its borders and reach the lee region with a delay. Blocking and delay are both responsible for the initial pressure decrease downwind of the mountain and for the subsequent proper downstream baroclinic development. According to this rather simple scheme, a cyclogenesis episode in the lee of the Alps was simulated in a hydraulic turntable. The results of these experiments showed a good agreement, both from a qualitative and quantitative point of view, with the analysis of an episode of lee cyclogenesis coupled to a cold outbreak in the Mediterranean, which actually occured in Southern Europe downstream of the Alps.

  15. Constant-effort mist netting on the Lee Metcalf National Wildlife refuge, Montana 1993-1998 (United States)

    US Fish and Wildlife Service, Department of the Interior — In 1993, a constant-effort mist netting station (CEMN) was established on the Lee Metcalf National Wildlife Refuge as part of a network of monitoring stations for...

  16. National Wildlife Refuge Visitor Survey 2012: Individual refuge results for Lee Metcalf National Wildlife Refuge (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes the National Wildlife Refuge Visitor Survey for Lee Metcalf National Wildlife Refuge and is part of the USGS Data Series 754. The survey was...

  17. Lee Metcalf National Wildlife Refuge Annual narrative report: Calendar year 1981 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf National Wildlife Refuges outlines Refuge accomplishments during the 1981 calendar year. The report begins with an...

  18. [Montana MOYOCO Invasive Species Strike Team Final Report 2013] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO MT Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered by...

  19. [Montana MOYOCO Invasive Species Strike Team Final Report 2015] Ninepipe National Wildlife Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  20. Näitleja Tommy Lee Jonesi meditatsioon režissööritoolis / Andris Feldmanis

    Index Scriptorium Estoniae

    Feldmanis, Andris, 1982-


    Vestern "Melquiades Estrada kolm matust" ("The Three Burials of Melquiades Estrada") : stsenarist Guillermo Arriaga : režissöör ja osatäitja Tommy Lee Jones : operaator Chris Menges : Ameerika Ühendriigid, 2005

  1. Lee Metcalf National Wildlife Refuge: Annual narrative report: Calendar year 1987 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf NWR outlines Refuge accomplishments during the 1987 calendar year. The report begins with a summary of the year's...

  2. [The philosophy & medicinal thought of Dong Mu Lee Jae-Ma]. (United States)

    Jeong, W Y


    In this paper, the philosophy and the content of medicinal philosophy of Lee Jae-Ma were illuminated through the history and philosophy of the late Choseon times from 1837 to 1900. Some conclusions were as follows: 1) Lee Jae-Ma was a philosopher as well as a physician, and his philosophical background was well appeared in the book of (Kogchigo). 2) Although the philosophy of Lee Jae-Ma and its terms were derived from the Kyunghakseol of Confucianism, the concept of these terms was different from the Neo-Confucianism of Song Dynasty in China. 3) The four phases of the philosophy of Lee Jae-Ma was originated from the four important trigrams, however, he did not take the meanings of the changes and development of the trigrams in I Ching>, but also took the four components of construction of cosmos similar to the Western theory of four component. ...

  3. [Montana MOYOCO Invasive Species Strike Team Final Report 2011] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  4. [Montana MOYOCO Invasive Species Strike Team Final Report 2012] National Elk Refuge, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  5. Recovery of squalene from wine lees using ultrasound assisted extraction-a feasibility study. (United States)

    Naziri, Eleni; Mantzouridou, Fani; Tsimidou, Maria Z


    The present work is a systematic approach for valorization of wine lees regarding the recovery of squalene, a bioactive lipid. Such a study is presented for the first time in literature. Separate examination of squalene content in "light" and "heavy" lees from different vinification processes by RP-HPLC demonstrated that these waste streams can be used as a source for this lipid, despite variations due to technological or genetic effects. Next, ultrasound assisted extraction of squalene from the "industrial waste" (the mixture of wine lees generated from different wines) using n-hexane was optimized with the aid of response surface methodology (independent variables: sonication duration and duty cycles). Autolysis was monitored through optical microscopy. Squalene yield (0.6 ± 0.08 g SQ/kg dry lees) was comparable to that of recently examined potential sources (0.2-0.35 g SQ/kg dry olive pomace and 0.06 g SQ/kg olive leaves).

  6. Biohydrogen-production from beer lees biomass by cow dung compost

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Yao-Ting; Zhang, Gao-Sheng; Xing, Yan [Department of Chemistry, Zhengzhou University, Zhengzhou, Henan 450052 (China); Guo, Xin-Yong [Laboratory of Special Functional Materials, Henan University, Kaifeng, Henan 475001 (China); Fan, Mao-Hong [Center for Sustainable Environmental Technologies, Iowa State University, Ames, Iowa 50011 (United States)


    Efficient conversion of beer lees wastes into biohydrogen gas by microorganisms was reported for the first time. Batch tests were carried out to analyze influences of several environmental factors on yield of H{sub 2} from beer lees wastes. The maximum yield of H{sub 2} 68.6mlH{sub 2}/g TVS was observed, the value is about 10-fold as compared with that of raw beer lees wastes. The hydrogen content in the biogas was more than 45% and there was no significant methane observed in this study. In addition, biodegradation characteristics of the substrate were also discussed. The results indicated that the HCl pretreatment of the substrate plays a key role in the conversion of the beer lees wastes into biohydrogen by the cow dung composts. (author)

  7. [Montana MOYOCO Invasive Species Strike Team Final Report 2016] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  8. [Montana MOYOCO Invasive Species Strike Team Final Report 2015] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  9. [Montana MOYOCO Invasive Species Strike Team Final Report 2012] National Bison Range, Lee Metcalf ISST (United States)

    US Fish and Wildlife Service, Department of the Interior — The MOYOCO (MT) Invasive Species Strike Team is made up of two field strike teams, housed at Benton Lake and Lee Metcalf National Wildlife Refuges, yet administered...

  10. Lee Metcalf National Wildlife Refuge: Annual narrative report: Calendar year 1988 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf NWR outlines Refuge accomplishments during the 1988 calendar year. The report begins with a summary of the year's...

  11. Lee Metcalf National Wildlife Refuge: Annual narrative report: Calendar year 1989 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Lee Metcalf NWR outlines Refuge accomplishments during the 1989 calendar year. The report begins with a summary of the year's...

  12. An Evaluation of Ecosystem Restoration Options for Lee Metcalf National Wildlife Refuge (United States)

    US Fish and Wildlife Service, Department of the Interior — This Evaluation of Ecosystem Restoration and Management Options covers the hydrogeomorphic analysis (HGM) for Lee Metcalf National Wildlife Refuge. This three step...

  13. 78 FR 52982 - Experian, Experian US Headquarters: Corporate Departments (Finance, HRMD, Contracts, Corporate... (United States)


    ... Employment and Training Administration Experian, Experian US Headquarters: Corporate Departments (Finance...), Experian, Experian US Headquarters: Corporate Departments (finance, HRMD, Contracts, Corporate Marketing...: Corporate Departments (finance, HRMD, Contracts, Corporate Marketing, Global Corporate Systems, Legal...

  14. Template-free modeling by LEE and LEER in CASP11. (United States)

    Joung, InSuk; Lee, Sun Young; Cheng, Qianyi; Kim, Jong Yun; Joo, Keehyoung; Lee, Sung Jong; Lee, Jooyoung


    For the template-free modeling of human targets of CASP11, we utilized two of our modeling protocols, LEE and LEER. The LEE protocol took CASP11-released server models as the input and used some of them as templates for 3D (three-dimensional) modeling. The template selection procedure was based on the clustering of the server models aided by a community detection method of a server-model network. Restraining energy terms generated from the selected templates together with physical and statistical energy terms were used to build 3D models. Side-chains of the 3D models were rebuilt using target-specific consensus side-chain library along with the SCWRL4 rotamer library, which completed the LEE protocol. The first success factor of the LEE protocol was due to efficient server model screening. The average backbone accuracy of selected server models was similar to that of top 30% server models. The second factor was that a proper energy function along with our optimization method guided us, so that we successfully generated better quality models than the input template models. In 10 out of 24 cases, better backbone structures than the best of input template structures were generated. LEE models were further refined by performing restrained molecular dynamics simulations to generate LEER models. CASP11 results indicate that LEE models were better than the average template models in terms of both backbone structures and side-chain orientations. LEER models were of improved physical realism and stereo-chemistry compared to LEE models, and they were comparable to LEE models in the backbone accuracy. Proteins 2016; 84(Suppl 1):118-130. © 2015 Wiley Periodicals, Inc.

  15. Lee and the Operational Art: The Right Place, The Right Time (United States)


    eighteenth."’! Most students of the Civil War would agree that Chancellorsville was Lee’s most brilliant achievement. Chancellors ville was won at the...Hooker. 32 At Chancellors ville Lee-perhaps in desperation-gave brigade commanders more latitude than he was prepared to allow Longstreet two Napoleon ler (32 vals.; Paris: Henry Plon,1. Dumaine, 1866), no. 15310. XIX, 81. 22. "Projet d’une nouvelle organisation de 1 ’armee." Corres

  16. Comparative genomics and stx phage characterization of LEE-negative Shiga toxin-producing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Susan Renee Steyert


    Full Text Available Infection by Escherichia coli and Shigella species are among the leading causes of death due to diarrheal disease in the world. Shiga toxin producing Escherichia coli (STEC that do not encode the locus of enterocyte effacement (LEE-negative STEC often possess Shiga toxin gene variants and have been isolated from humans and a variety of animal sources. In this study, we compare the genomes of nine LEE-negative STEC harboring various stx alleles with four complete reference LEE-positive STEC isolates. Compared to a representative collection of prototype E. coli and Shigella isolates representing each of the pathotypes, the whole genome phylogeny demonstrated that these isolates are diverse. Whole genome comparative analysis of the 13 genomes revealed that in addition to the absence of the LEE pathogenicity island, phage encoded genes including non-LEE encoded effectors, were absent from all nine LEE-negative STEC genomes. Several plasmid-encoded virulence factors reportedly identified in LEE-negative STEC isolates were identified in only a subset of the nine LEE-negative isolates further confirming the diversity of this group. In combination with whole genome analysis, we characterized the lambdoid phages harboring the various stx alleles and determined their genomic insertion sites. Although the integrase gene sequence corresponded with genomic location, it was not correlated with stx variant, further highlighting the mosaic nature of these phages. The transcription of these phages in different genomic backgrounds was examined. Expression of the Shiga toxin genes, stx1 and/or stx2, as well as the Q genes, were examined with quantitative reverse transcriptase polymerase chain reaction (qRT-PCR assays. A wide range of basal and induced toxin induction was observed. Overall, this is a first significant foray into the genome space of this unexplored group of emerging and divergent pathogens.

  17. Corporate Social Responsibility

    DEFF Research Database (Denmark)

    Kampf, Constance


    Understanding Corporate Social Responsibility (CSR) as having explicit policies and implicit norms situated in cultural systems highlights the connections between institutional and cultural structures of nation states and business' commitment to CSR as reflected in the strategies used to communic...

  18. Corporate Social Responsibility

    National Research Council Canada - National Science Library

    Suhaimi Ishak; Mohamad Naimi Mohamad Nor


    .... In Malaysia, based on the Malaysian Code on Corporate Governance (MCCG), (2007; 2012) clearly stated the role and responsibility of the board of directors toward the risk management activities...

  19. The corporate security professional

    DEFF Research Database (Denmark)

    Petersen, Karen Lund


    In our age of globalization and complex threat environments, every business is called upon to manage security. This tendency is reflected in the fact that a wide range of businesses increasingly think about security in broad terms and strive to translate national security concerns into corporate...... speech. This article argues that the profession of the security manager has become central for understanding how the relationship between national and corporate security is currently negotiated. The national security background of most private sector security managers makes the corporate security...... professional inside the company a powerful hybrid agent. By zooming in on the profession and the practice of national security inside companies, the article raises questions about where to draw the line between corporate security and national security along with the political consequences of the constitution...

  20. Measuring Corporate Sustainability Performance

    Directory of Open Access Journals (Sweden)

    Eugen Nicolăescu


    Full Text Available The aim of the present study is to examine and evaluate the evolving character of sustainability management in corporations, the significance of environmental protection and sustainability, and barriers to carrying out an incorporated and strategic firm-wide advance of social responsibility. In the present paper, we focus on the contribution of sustainability undertakings towards enhancing corporate performance, the financial involvements of sustainability position and operation, and the chief function of values in corporate policy. Our paper contributes to the literature by supplying proof of elements that lead to the triumph of business patterns for sustainable development, processes through which stakeholders are affecting corporate sustainability conduct, and the link between economic growth and the environment.

  1. Corporate Social Responsibility

    DEFF Research Database (Denmark)

    Kampf, Constance


    Understanding Corporate Social Responsibility (CSR) as having explicit policies and implicit norms situated in cultural systems highlights the connections between institutional and cultural structures of nation states and business' commitment to CSR as reflected in the strategies used...

  2. Oxygen Consumption by Postfermentation Wine Yeast Lees: Factors Affecting Its Rate and Extent under Oenological Conditions

    Directory of Open Access Journals (Sweden)

    Jonas Müller


    Full Text Available Postfermentation wine yeast lees show antioxidant properties based on their ability to consume dissolved oxygen. The oxygen consumption capacity of suspended yeast lees obtained after fermentations with six commercial active dry yeast strains was investigated in model, white and red wines using fluorescence-based oxygen sensors operating in a nondestructive way. In model solution, the oxygen consumption rate of yeast lees was shown to depend on their amount, yeast strain, sulfur dioxide and temperature. It is slightly lower in red than in white wines. It is strongly decreased by current levels of free sulfur dioxide, thus excluding the complementary use of both as antioxidants in wine. However, in 25 randomly sampled white wines produced under commercial conditions, the rate and extent of oxygen consumption during the first six months of postfermentation had no significant correlation with any of these interacting factors, making it difficult to predict the actual antioxidant effect of yeast lees. In these wines, yeast lees consumed 0 to 47 % of the dissolved oxygen. Although total oxygen consumption capacity of yeast lees is not a limiting factor under commercial winemaking conditions, their oxygen consumption proceeds at a limited rate that reduces but cannot totally prevent concomitant chemical oxidation of the wine.

  3. Oxygen Consumption by Postfermentation Wine Yeast Lees: Factors Affecting Its Rate and Extent under Oenological Conditions (United States)

    Müller, Jonas; Schmidt, Dominik


    Summary Postfermentation wine yeast lees show antioxidant properties based on their ability to consume dissolved oxygen. The oxygen consumption capacity of suspended yeast lees obtained after fermentations with six commercial active dry yeast strains was investigated in model, white and red wines using fluorescence-based oxygen sensors operating in a nondestructive way. In model solution, the oxygen consumption rate of yeast lees was shown to depend on their amount, yeast strain, sulfur dioxide and temperature. It is slightly lower in red than in white wines. It is strongly decreased by current levels of free sulfur dioxide, thus excluding the complementary use of both as antioxidants in wine. However, in 25 randomly sampled white wines produced under commercial conditions, the rate and extent of oxygen consumption during the first six months of postfermentation had no significant correlation with any of these interacting factors, making it difficult to predict the actual antioxidant effect of yeast lees. In these wines, yeast lees consumed 0 to 47% of the dissolved oxygen. Although total oxygen consumption capacity of yeast lees is not a limiting factor under commercial winemaking conditions, their oxygen consumption proceeds at a limited rate that reduces but cannot totally prevent concomitant chemical oxidation of the wine. PMID:28115896

  4. Corporate Governance and Shareholder Litigation


    Kalchev, Georgi


    The probability for shareholder litigation is studied and how corporate governance characteristics and other factors explain it. Shareholder litigation results from failure of corporate governance. Thus a better quality of corporate governance is hypothesized to decrease the litigation probability. Corporate governance index is constructed based on principal components. It is found to be a significant predictor of shareholder litigation.

  5. Corporate risk management : an overview

    NARCIS (Netherlands)

    Oosterhof, Casper M.


    Corporate risk management and hedging are important activities within financial as well as non-financial corporations. Under the assumptions of Modigliani and Miller [1958], corporate risk management is a redundant activity. However, the existence of market imperfections can explain the corporate us

  6. Corporate Governance Country Assessment : Brazil


    World Bank


    This report assesses Brazil's corporate governance policy framework. It highlights recent improvements in corporate governance regulation, makes policy recommendations, and provides investors with a benchmark against which to measure corporate governance in Brazil. It is an update of the 2005 corporate governance Report on the Observance of Standards and Codes (ROSC). Brazil's experience o...

  7. Tax planning in corporation


    Nevodnicheva, Yulia


    This thesis "Tax planning in corporation" puts brain to legal entity income tax and it is looking for possible solutions in tax planning in corporation. The first part deals with the tax theory, the other part is the theory of tax planning, comparison of tax regimes and tax policy and tax revenue by optimizing both internationally and in the local aspect. The last part discusses options for optimizing tax

  8. China Petrochemical Corporation

    Institute of Scientific and Technical Information of China (English)


    China Petrochemical Corporation (Sinopec Group) is a super-large petroleum and petrochemical enterprise group, established in July 1998 on the basis of the former China Petrochemical Corporation. Sinopec Group is a state-owned company solely invested by the state, function ing as a state-authorized investment organization in which the state holds the controlling share. Headquartered in Beijing, Sinopec Group has a registered capital of 182 billion yuan. The board chairman of Sinopec Group is its legal representative.

  9. The Corporations Act 2001


    Bostock, Tom


    The author outlines reforms made in Australia in the area of company law with an analysis of the Corporations Act 2001, which along with the Australian Securities and Investments Commission Act 2001 comprises Corporations legislation in Australia. Article by Tom Bostock (a partner in the law firm Mallesons Stephen Jaques, Melbourne, Australia). Published in Amicus Curiae - Journal of the Institute of Advanced Legal Studies and its Society for Advanced Legal Studies. The Journal is produced by...

  10. Corporate Risk Disclosure and Corporate Governance

    Directory of Open Access Journals (Sweden)

    Kaouthar Lajili


    Full Text Available To date, research which integrates corporate governance and risk management has been limited. Yet, risk exposure and management are increasingly becoming the core function of modern business enterprises in various sectors and industries domestically and globally. Risk identification and management are crucial in any business strategy design and implementation. From the investors’ point of view, knowledge of the risk profile, risk appetite and risk management are key elements in making sound portfolio investment decisions. This paper examines the relationships between corporate governance mechanisms and risk disclosure behavior using a sample of Canadian publicly-traded companies (TSX 230. Results show that Canadian public companies are more likely to disclose risk management information over and above the mandatory risk disclosures, if they are larger in size and if their boards of directors have more independent members. Minority voting control ownership structures appear to negatively impact risk disclosure and CEO incentive compensation shows mixed results. The paper concludes that more research is needed to further assess the impact of various governance mechanisms on corporate risk management and disclosure behavior.

  11. Memoria de la guerra civil española. Entre el sol y la tormenta de Sara Berenguer

    Directory of Open Access Journals (Sweden)

    Helena López


    Full Text Available En este artículo pretendo analizar dos cuestiones en relación con las memorias de guerra de la militante anarquista Sara Berenguer. En primer lugar, quiero atender a las estrategias discursivas (clase, género, sexualidad de construcción de la subjetividad en este texto. Además, me interesa indagar cómo estos discursos se interseccionan con la posición espacio-temporal (tiempo de la memoria y tiempo-espacio del exilio del sujeto autobiográfico. Mi objetivo principal es proponer una problematización de los conceptos de “memoria colectiva” y de “experiencia femenina” y reivindicar, por lo tanto, la relevancia tanto teórica como política de análisis críticos basados en narrativas personales.

  12. APL: a corporate strategy. (United States)

    Fox, J; Nyatanga, L; Ringer, C; Greaves, J


    This paper is based on, and summarises, papers read at the second annual international conference of Nurse Education Tomorrow held at the University of Durham (UK) September 1991. To this end this paper will offer: Some Accreditation of Prior Learning (APL) definition and process as reflected in the literature available. A distinction will be made between APL and Accreditation of Prior Experiential Learning (APEL) although the procedures and processes for assessing them will be shown to be the same. A brief outline of corporate strategy, as it applies to APL, will be given to form the basis for logical demonstration of how Derbyshire Institute of Health and Community Studies has employed such a corporate strategy. Insights developed and gained from APL research currently being undertaken through the college of nursing and midwifery will be used to inform the development and nature of corporate strategy. A flowchart of the operationalisation of the corporate strategy is offered as an integrative summary of how all the APL ideas have had a positive cumulative effect. The paper finishes by highlighting the possible strengths and limitations of APL corporate strategy.

  13. Corporate governance and liquidity

    DEFF Research Database (Denmark)

    Farooq, Omar; Derrabi, Mohamed; Naciri, Monir


    This paper examines the impact of corporate governance mechanisms on liquidity in the MENA region, i.e. Morocco, Egypt, Saudi Arabia, United Arab Emirates, Jordan, Kuwait, and Bahrain. Using turnover as a proxy for liquidity, we document significant difference in liquidity between the pre......- and the post-crisis periods in the MENA region. In addition, our results show that bulk of this reduction in turnover can be explained due to weaknesses of corporate governance mechanisms. For example, that dividend payout ratio and choice of auditors – proxies for agency problems – can explain the entire...... difference in liquidity between the two periods. Furthermore, our results indicate that more than 50% of this difference between the two periods can be explained by operational and informational complexity of a firm – proxy for transparency. We argue that poor corporate governance mechanisms increase...

  14. Corporate dentistry in 2032? (United States)

    Watson, Michael


    During the last 20 years, there has been considerable growth in the number of dental practices owned by corporate bodies. At present, well over 800 practices are owned by such bodies and they employ over 3000 dentists. This paper describes the factors that have led to this growth and explores the advantages and disadvantages of 'corporate' dentistry for patients, dentists, and the dental team. It then considers how and why dental practice may change over the next 20 years and concludes that by 2032 the small one-dentist practice may well be in the past. It is likely that smaller practices will have to work in some form of association if they are to survive. Although their current model is unstable, corporates are likely to adapt to a changing environment. By 2032, in some cases, dentistry may well be taken out of its conventional setting, into supermarkets or a school environment.

  15. Corporate governance and liquidity

    DEFF Research Database (Denmark)

    Farooq, Omar; Derrabi, Mohamed; Naciri, Monir


    This paper examines the impact of corporate governance mechanisms on liquidity in the MENA region, i.e. Morocco, Egypt, Saudi Arabia, United Arab Emirates, Jordan, Kuwait, and Bahrain. Using turnover as a proxy for liquidity, we document significant difference in liquidity between the pre......- and the post-crisis periods in the MENA region. In addition, our results show that bulk of this reduction in turnover can be explained due to weaknesses of corporate governance mechanisms. For example, that dividend payout ratio and choice of auditors – proxies for agency problems – can explain the entire...... difference in liquidity between the two periods. Furthermore, our results indicate that more than 50% of this difference between the two periods can be explained by operational and informational complexity of a firm – proxy for transparency. We argue that poor corporate governance mechanisms increase...

  16. Iranian Corporations and Corporate Social Responsibility

    Directory of Open Access Journals (Sweden)

    Hadi Chapardar


    Full Text Available Comparative studies have demonstrated that the themes for corporate social responsibility (CSR initiatives are different among nations and geographic regions based on their cultural, political, legal, social, and economic contexts. In this research, which was conducted on 56 corporations from IMI100 (100 Iranian companies with highest annual sales, ranked by Industrial Management Institute or IMI, CSR themes in priority have been identified. Data collected from a semistructured questionnaire and some complementary interviews were analyzed against the results of a reference study over 100 companies from developed countries. The resulted themes, some of which may have several subthemes, were developed in three economic, environmental, and social categories. Beside these qualitative findings, two indices are constructed for indicating the “importance” of and “contribution” to each theme. The results and discussions are supposed to help business leaders, international companies inside Iran, governmental authorities, and researchers to improve CSR discussions and practices in the country where CSR undergoes a less structured platform.

  17. Jaarboek corporate governance 2011-2012

    NARCIS (Netherlands)

    Lückerath – Rovers, M.; Bier, B.; Kaptein, M.; Paape, L.


    In dit eerste Jaarboek Corporate Governance worden uiteenlopende aspecten van Corporate Governance nader besproken door toonaangevende schrijvers uit verschillende disciplines. Inclusief actuele corporate governance code.

  18. Jaarboek corporate governance 2011-2012

    NARCIS (Netherlands)

    Lückerath – Rovers, M.; Bier, B.; Kaptein, M.; Paape, L.


    In dit eerste Jaarboek Corporate Governance worden uiteenlopende aspecten van Corporate Governance nader besproken door toonaangevende schrijvers uit verschillende disciplines. Inclusief actuele corporate governance code.

  19. Practicing psychology in the art gallery: Vernon Lee's aesthetics of empathy. (United States)

    Lanzoni, Susan


    Late nineteenth-century psychologists and aestheticians were fascinated by the study of psychological and physiological aspects of aesthetic response, and the British intellectual and aesthete Vernon Lee was a major participant in this venture. Working outside the academy, Lee conducted informal experiments with Clementina Anstruther-Thomson, recording changes in respiration, balance, emotion, and body movements in response to aesthetic form. In fashioning her aesthetics of empathy, she mined a wealth of psychological theories of the period including motor theories of mind, physiological theories of emotion, evolutionary models of the usefulness of art, and, most prominently, the empathic projection of feeling and movement into form. Lee distributed questionnaires, contributed to scientific journals, carried out her own introspective studies, and debated aesthetics with leading psychologists. This paper critiques the prevailing view of Lee's aesthetics as a displaced sign of her gender or sexuality, and questions her status as simply an amateur in the field of psychology. Instead, I argue that Lee's empirically based empathy theory of art was a significant contribution to debates on psychological aesthetics at the outset of the twentieth century, offering a synthesis of Lipps's mentalistic Einfühlung and sensation-based imitation theories of aesthetic response.

  20. Adsorption Characteristics of Pb(2+) onto Wine Lees-Derived Biochar. (United States)

    Zhu, Qihong; Wu, Jun; Wang, Lilin; Yang, Gang; Zhang, Xiaohong


    Biochar has great advantages in soil amendment and polluted soil remediation. Herein, the pore and adsorption properties of wine lees-derived biochar were explored. Specifically, the adsorption isotherm and kinetics of Pb(2+) onto wine lees-derived biochar were examined. Experimental results revealed that wine lees-derived biochar featured large specific surface area and total pore volume, and high contents of -COOH and -OH on its surface. Adsorption of Pb(2+) onto wine lees-derived biochar proceeded via a multilayer adsorption mechanism, as described by the Freundlich adsorption model. Adsorption kinetics followed the Lagergren pseudo-second-order kinetics model; adsorption equilibrium was achieved within 30-60 min. Furthermore, the effect of solution pH on the adsorption of Pb(2+) was investigated. Within the studied pH range of 3-6, the adsorption capacity increased with increasing pH. Under established optimized conditions, wine lees-derived biochar achieved a Pb(2+) adsorption capacity of 79.12 mg/g.

  1. [Lee Jungsook, a Korean independence activist and a nurse during the Japanese colonial period]. (United States)

    Kim, Sook Young


    This article examines the life of Lee Jungsook, a Korean nurse, as a independence activist during the Japanese colonial period. Lee Jungsook(1896-1950) was born in Bukchung in Hamnam province. She studied at Chungshin girl's high school and worked at Severance hospital. The characteristics and culture of her educational background and work place were very important factors which influenced greatly the life of Lee Jungsook. She learned independent spirit and nationalism from Chungshin girls' high school and worked as nurse at the Severance hospital which were full of intense aspiration for Korea's independence. Many of doctors, professors and medical students were participated in the 3.1 Independence Movement. Lee Jungsook was a founding member of Hyulsungdan who tried to help the independence activists in prison and their families and worked as a main member of Korean Women's Association for Korean Independece and Kyungsung branch of the Korean Red Cross. She was sent to jail by the Japanese government for her independence activism. After being released after serving two years confinement, she worked for the Union for Women's Liberation as a founding member. Lee Joungsook was a great independence activist who had a nursing care spirit as a nurse.

  2. Corporate Social Responsibility of Multinational Oil Corporations to ...

    African Journals Online (AJOL)

    Corporate Social Responsibility of Multinational Oil Corporations to Host ... adopting partnership strategies as a means of contributing to community development, ... community development partnership (CDPs) initiatives' undertaken by Exxon ...

  3. Corporate Identity as a Factor of Corporate Security

    Directory of Open Access Journals (Sweden)

    Elena B. Perelygina


    Full Text Available Forming-upof the corporate identity is based on cognitive, affective and conative elements of corporate culture. The group as an entity choosing goals and values ensures a certain response to standards and values of corporate culture within the parameters of its social responsibility. Corporate security as security of community and cooperation acts as a form of organizational and ethical approach to developing socially responsible attitude of government and business.



    Perelygina, Elena B.


    Forming-up of the corporate identity is based on cognitive, affective and conative elements of corporate culture. The group as an entity choosing goals and values ensures a certain response to standards and values of corporate culture within the parameters of its social responsibility. Corporate security as security of community and cooperation acts as a form of organizational and ethical approach to developing socially responsible attitude of government and business.

  5. The integration of corporate governance in corporate social responsibility disclosures

    NARCIS (Netherlands)

    Kolk, A.; Pinkse, J.


    In recent years, not only has attention to corporate governance increased but also the notion has broadened considerably, and started to cover some aspects traditionally seen as being part of corporate social responsibility (CSR). CSR, corporate governance and their interlink seem particularly relev

  6. The integration of corporate governance in corporate social responsibility disclosures

    NARCIS (Netherlands)

    Kolk, A.; Pinkse, J.


    In recent years, not only has attention to corporate governance increased but also the notion has broadened considerably, and started to cover some aspects traditionally seen as being part of corporate social responsibility (CSR). CSR, corporate governance and their interlink seem particularly relev

  7. The integration of corporate governance in corporate social responsibility disclosures

    NARCIS (Netherlands)

    Kolk, A.; Pinkse, J.


    In recent years, not only has attention to corporate governance increased but also the notion has broadened considerably, and started to cover some aspects traditionally seen as being part of corporate social responsibility (CSR). CSR, corporate governance and their interlink seem particularly

  8. Hubungan Corporate Governance, Corporate Social Responsibilities dan Corporate Financial Performance Dalam Satu Continuum

    Directory of Open Access Journals (Sweden)

    Etty Murwaningsari


    Full Text Available This research aims to identify the influence of Good Corporate Governance, represented by institutional ownership and managerial ownership, on Corporate Social Responsibility and Corporate Financial Performance, and also to observe the possible influence of Corporate Social Responsibility on Corporate Financial Performance. This research examines 126 manufacturing companies which are listed in Indonesian Stock Exchange (ISX and have issued an audited financial statement for 2006. The statistical method used to test the hypothesis is Path Analysis. The result suggests that Good Corporate Governance influences both the disclosure of Corporate Social Responsibility and Corporate Financial Performance and that Corporate Social Responsibility significantly influences Corporate Financial Performance. The result also suggests that CEO Tenure, the controlling variable, holds a significant influence on the disclosure of Corporate Social Responsibility. Yet, there is no strong evidence to support the type of industries as an influencing factor of Corporate Social Responsibility. Furthermore, we found that the latter condition would also apply when we analyze the influence of Corporate Secretary and Nomination and Remuneration Committee on Corporate Financial Performance. Abstract in Bahasa Indonesia: Penelitian ini bertujuan untuk mengidentifikasi pengaruh antara struktur Coorporate Governance yang diproksikan sebagai kepemilikan institusional, kepemilikan manajerial terhadap corporate social responsibility dan corporate social responsibility terhadap corporate financial performance. Penelitian menggunakan data sekunder dari laporan tahunan 2006 perusahaan publik yang terdapat di Pusat Referensi Pasar Modal (PRPM Bursa Efek Indonesia (BEI. Sampel dalam penelitian ini sebanyak 126 perusahaan. Melalui pendekatan analisa jalur (path analysis menunjukkan Good Corporate Governance yaitu kepemilikan managerial dan institusional mempunyai pengaruh terhadap

  9. Feminism and Faith: Exploring Christian Spaces in the Writing of Sara Maitland and Michèle Roberts

    Directory of Open Access Journals (Sweden)



    Full Text Available En 1983, les féministes britanniques Sara Maitland et Jo Garcia ont publié Walking on the Water (London : Virago, une collection d’essais, de récits, de poèmes et de photos produits par des femmes sur le thème de la spiritualité. Les contributrices ont été en particulier invitées à explorer la relation entre leur identité féministe et leurs croyances religieuses. Le ton de ces contributions varie fortement, allant de l’envie passionnée de concilier les objectifs du féminisme avec le christianisme à un rejet total de l’Eglise comme institution patriarcale suprême. Cet article met en dialogue des récits diamétralement opposés du rapport entre christianisme et féminisme en s’intéressante plus particulièrement à deux des contributrices, Sara Maitland (1950 - et Michèle Roberts (1949 - . Ces deux écrivaines, qui se sont activement impliquées dans les mouvements féministes des années 1970, ont toutes deux lutté pour se réconcilier avec leur héritage chrétien. Néanmoins, alors que Maitland tente essentiellement de revisiter le christianisme en y incorporant les points essentiels d’une idéologie féministe, Roberts sent le besoin impérieux de se défaire de son identité religieuse afin de devenir indépendante ; en effet, dans son autobiographie Paper Houses (2007 elle décrit son éducation catholique comme “autoritaire et misogyne” (16. Cet article explore les façons dont l’identité spirituelle se construit dans le jeu complexe des interactions entre féminisme et foi. Il se propose, dans une perspective comparatiste, d’analyser d’une part le recueil de nouvelles de Sara Maitland intitulé A Book of Spells, et d’autre part, le roman acclamé de Michèle Roberts, Daughters of the House. Dans ces écrits, Maitland et Roberts ont un objectif commun qui est de renégocier la place des femmes dans l’histoire chrétienne dont elles reconnaissent – il est vrai à partir de perspectives diff

  10. Annexe III. Biographie de Lee Kuan Yew, premier ministre de Singapour



    Harry Lee Kuan Yew (« la lumière qui brille »), fils aîné de Lee Chin Koon (cadre de société pétrolière et bijoutier) et de Chua Jim Neo, est né à Singapour en 1923. Sa famille, d’origine Hakka (Chine méridionale), est implantée à Singapour depuis 1830-40 ; l’arrière grand-mère maternelle et le grand-père paternel ont épousé respectivement un Malais et un Chinois peranakan indonésien, ce qui explique l’esprit multiracial du cercle familial qui a tant marqué le jeune Lee dans ses luttes ultéri...

  11. Modeling of Atmospheric Flow Around a Coastal Cape: Lee Side Story

    CERN Document Server

    Perlin, Natalie


    The current research focuses on mesoscale dynamics of the atmospheric circulation around an idealized coastal cape representing typical summertime circulation along the northwest coast of the U.S., studied using a mesoscale coupled ocean-atmosphere modeling system. The orographic wind maximum features a strong NW flow extending a few hundred kilometers downstream and seaward of the cape, which closely follows mesoscale orographic low pressure developed in the lee of the cape. Both wind maximum and the lee trough experience a pronounced diurnal cycle, marked by maximum northwest flow and minimum pressure in the local evening hours (its opposite phase during morning hours), and confirmed by observations from limited buoy and coastal stations. Vertical structure of the atmospheric boundary layer over the coastal ocean on the lee side of the cape indicated the downward propagation of potential temperature and wind features during the course of the day, as opposed to the traditional surface-driven development of t...

  12. The Lee-Wick Extension of the Two-Higgs Doublet Model

    CERN Document Server

    Johansen, Aria R; Thrasher, Keith


    The Lee-Wick Standard Model is a highly constrained model which solves the gauge hierarchy problem at the expense of including fields with negative norm. It appears to be macroscopically causal and consistent. This model is extended by considering the two-Higgs doublet extension of the Lee-Wick model. Rewriting the Lagrangian using auxiliary fields introduces two additional doublets of Lee-Wick partners. The model is highly constrained, with only one or two additional parameters beyond that of the usual two-Higgs doublet model, and yet there are four doublets. Mass relations are established by diagonalizing the mass matrices and further constraints are established by studying results from B --> tau nu, neutral B-meson mixing, and B --> X_s gamma. The prospects of detecting evidence for this model at the LHC are discussed.

  13. Deterministic and stochastic trends in the Lee-Carter mortality model

    DEFF Research Database (Denmark)

    Callot, Laurent; Haldrup, Niels; Kallestrup-Lamb, Malene

    that characterizes mortality data. We find empirical evidence that this feature of the Lee-Carter model overly restricts the system dynamics and we suggest to separate the deterministic and stochastic time series components at the benefit of improved fit and forecasting performance. In fact, we find...... as a two (or several)-factor model where one factor is deterministic and the other factors are stochastic. This feature generalizes to the range of models that extend the Lee-Carter model in various directions.......The Lee and Carter (1992) model assumes that the deterministic and stochastic time series dynamics loads with identical weights when describing the development of age specific mortality rates. Effectively this means that the main characteristics of the model simplifies to a random walk model...

  14. Corporate Social Responsibility in Afghanistan

    DEFF Research Database (Denmark)

    Azizi, Sameer

    This doctoral dissertation examines the business-development relations in Afghanistan by focusing on Corporate Social Responsibility (CSR) and other related practices from corporations in the Afghan mobile telecommunications industry. More concretely, the study aims to explore the characteristics...

  15. 76 FR 68747 - Hess Corporation (United States)


    ...] Hess Corporation v. PJM Interconnection, L.L.C.; Notice of Petition for Declaratory Order and Complaint... 385.212, Hess Corporation (Complainant) filed a Petition for Declaratory Order requesting that...

  16. Of Corporate Bondage (United States)

    Ridgeway, James


    "While it is entirely possible that the university will continue to function as an essential arm of the giant agribusiness and energy corporations, there are, nevertheless, a wealth of opportunities for it to direct its energies to more useful purposes." The author traces universities' past involvement noting alternatives in energy and agriculture…

  17. Corporate Stakeholding and Globalism

    DEFF Research Database (Denmark)

    Lauesen, Linne Marie


    Most corporations consider their stakeholders to be those, who can be defined in a relatively narrow periphery. Customers, workers, investors, authorities, neighbours, suppliers and various interest groups, for instance NGOs. However, during the last decades, phenomena such as the financial crisis...

  18. Corporate governance through codes

    NARCIS (Netherlands)

    Haxhi, I.; Aguilera, R.V.; Vodosek, M.; den Hartog, D.; McNett, J.M.


    The UK's 1992 Cadbury Report defines corporate governance (CG) as the system by which businesses are directed and controlled. CG codes are a set of best practices designed to address deficiencies in the formal contracts and institutions by suggesting prescriptions on the preferred role and compositi

  19. Trends in corporate greening

    DEFF Research Database (Denmark)

    Madsen, Henning; Ulhøi, John Parm

    The concept of corporate environmental management has existed for the last two to three decades. Many companies have fully or partly adopted the concept in their efforts to eliminate or reduce the impacts on the natural environment caused by their business activities. The question is, however, if...

  20. Essential Corporate Bankruptcy Law

    NARCIS (Netherlands)

    Couwenberg, Oscar; Lubben, Stephen J.


    This article begins from a simple observation: Chapter 11 of the United States Bankruptcy Code is the global standard for corporate restructuring, but at the same time it is a far more complex procedure than most jurisdictions seem to require. This observation begs the question what parts of a