
Sample records for sara kelly johns

  1. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  2. STS-103 Pilot Scott Kelly and MS John Grunsfeld try on oxygen masks (United States)


    In the bunker at Launch Pad 39B, STS-103 Pilot Scott J. Kelly (left) and Mission Specialist John M. Grunsfeld (Ph.D.) (right) try on oxygen masks during Terminal Countdown Demonstration Test (TCDT) activities. The TCDT provides the crew with emergency egress training, opportunities to inspect their mission payloads in the orbiter's payload bay, and simulated countdown exercises. Other crew members taking part are Commander Curtis L. Brown Jr. and Mission Specialists Steven L. Smith, C. Michael Foale (Ph.D.), and Jean-Frangois Clervoy of France and Claude Nicollier of Switzerland, who are with the European Space Agency. STS-103 is a 'call-up' mission due to the need to replace and repair portions of the Hubble Space Telescope, including the gyroscopes that allow the telescope to point at stars, galaxies and planets. The STS-103 crew will be replacing a Fine Guidance Sensor, an older computer with a new enhanced model, an older data tape recorder with a solid-state digital recorder, a failed spare transmitter with a new one, and degraded insulation on the telescope with new thermal insulation. The crew will also install a Battery Voltage/Temperature Improvement Kit to protect the spacecraft batteries from overcharging and overheating when the telescope goes into a safe mode. Four EVA's are planned to make the necessary repairs and replacements on the telescope. The mission is targeted for launch Dec. 6 at 2:37 a.m. EST.

  3. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  4. Research progress on the Kelly game (United States)

    Zhang, Liang


    The growth-optimal portfolio optimization strategy has been investigated in many ways since firstly pioneered by Kelly. This paper firstly introduces the research progress of this so-called Kelly game. Based on the original Kelly game the optimality is shortly proofed. Especially generalized research is introduced such as the relation between M-V approach and the Kelly approach, the question of diversification, the influence of transaction fees and limited information, etc. Then the application of Kelly strategy is discussed with some conclusions.

  5. Apocalipsis XX di Sara de Ibáñez

    Directory of Open Access Journals (Sweden)

    Stefano Tedeschi


    Full Text Available Rewriting the text of Saint John, Sara de Ibáñez uses a kind of style innovative and away from schools and trends in vogue: is thus able able to evoke the tragic experiences of the twentieth century, but the date of publication of the book (1970 reveals that it advances in themes and forms the concrete apocalypse lived by Uruguay and Latin America in the seventies. However, far from political themes and motifs, Sara de Ibáñez is able to express the absolute horror of contemporary tragedies and to propose a poetic reflection of great quality. This article suggests a rediscovery of this twentieth-century poetic voice, unjustly forgotten, through her 'apocalyptic' text.

  6. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  7. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  8. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  9. Novel variations of the Kelly game

    CERN Document Server

    Medo, Matus; Zhang, Yi-Cheng


    In the Kelly game (Kelly, 1956), a gambler is allowed to invest a part of the wealth in each turn. With a certain probability this investment is doubled, and otherwise it is lost. Motivated by the complexity of real investments, we propose several modifications of this game to investigate the influence of diversification and limited information on investment performance. Analytical and numerical results obtained from these toy games are well related to their real-life counterparts.

  10. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  11. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  12. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  13. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  14. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  15. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  16. George Kelly: cognitive psychologist, humanistic psychologist, or something else entirely? (United States)

    Benjafield, John G


    George Kelly was regarded by some of his contemporaries as a cognitive psychologist and by others as a humanistic psychologist. Kelly himself resisted being rubricized. He did, however, name several people who had been influential in his life and work, one of whom was J.F. Herbart. A comparison of Herbart and Kelly reveals several similarities. Both shared a belief that psychology was fundamentally a mathematical discipline. Both eliminated distinctions usually taken for granted in psychology, such as emotion versus cognition. Reconstructing Kelly's relation to Herbart allows one to see more clearly why Kelly was such a unique figure in 20th century psychology.

  17. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  18. University physics Arfken Griffing Kelly Priest

    CERN Document Server

    Houk, T William; Snider, John W


    University Physics: Arfken Griffing Kelly Priest covers the concepts upon which the quantitative nature of physics as a science depends; the types of quantities with which physics deals are defined as well as their nature; and the concepts of units and dimensions. The book describes the concepts of scalars and vectors; the rules for performing mathematical operations on vector quantities; the concepts of force, torque, center of gravity, and types of equilibrium. The text also describes the concepts and quantities required to describe motion; the linear kinematical relationships to describe m

  19. Blair oli ikkagi seotud Kelly nime lekitamisega / Maris Lillak

    Index Scriptorium Estoniae

    Lillak, Maris, 1970-


    Suurbritannia kaitseministeeriumi relvaeksperdi David Kelly surmaga seotud asjaolusid uuriv Huttoni komisjon selgitas, et peaminister Tony Blair oli kohtumisel, kus otsustati relvaeksperdi nime avalikustamine

  20. Diversification and limited information in the Kelly game (United States)

    Medo, Matúš; Pis'mak, Yury M.; Zhang, Yi-Cheng


    Financial markets, with their vast range of different investment opportunities, can be seen as a system of many different simultaneous games with diverse and often unknown levels of risk and reward. We introduce generalizations to the classic Kelly investment game [J.L. Kelly, IEEE Transactions on Information Theory 2 (1956) 185-189] that incorporates these features, and use them to investigate the influence of diversification and limited information on Kelly-optimal portfolios. In particular, we present approximate formulas for optimizing diversified portfolios and exact results for optimal investment in unknown games where the only available information is past outcomes.

  1. The Trail Inventory of Kellys Slough NWR [Cycle 2 (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Kellys Slough National Wildlife Refuge. Trails in this inventory are...

  2. The Trail Inventory of Kellys Slough NWR [Cycle 3 (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Kellys Slough National Wildlife Refuge. Trails in this inventory are...

  3. SARA: a server for function annotation of RNA structures. (United States)

    Capriotti, Emidio; Marti-Renom, Marc A


    Recent interest in non-coding RNA transcripts has resulted in a rapid increase of deposited RNA structures in the Protein Data Bank. However, a characterization and functional classification of the RNA structure and function space have only been partially addressed. Here, we introduce the SARA program for pair-wise alignment of RNA structures as a web server for structure-based RNA function assignment. The SARA server relies on the SARA program, which aligns two RNA structures based on a unit-vector root-mean-square approach. The likely accuracy of the SARA alignments is assessed by three different P-values estimating the statistical significance of the sequence, secondary structure and tertiary structure identity scores, respectively. Our benchmarks, which relied on a set of 419 RNA structures with known SCOR structural class, indicate that at a negative logarithm of mean P-value higher or equal than 2.5, SARA can assign the correct or a similar SCOR class to 81.4% and 95.3% of the benchmark set, respectively. The SARA server is freely accessible via the World Wide Web at

  4. Kelly Hot Spring Geothermal Project: Kelly Hot Spring Agricultural Center preliminary design. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Longyear, A.B. (ed.)


    A Phase 1 Preliminary Design, Construction Planning and Economic Analysis has been conducted for the Kelly Hot Spring Agricultural Center in Modoc County, California. The core activity is a 1360 breeding sow, swine raising complex that utilizes direct heat energy from the Kelly Hot Spring geothermal resource. The swine is to be a totally confined operation for producing premium pork in controlled-environment facilities. The complex contains a feed mill, swine raising buildings and a complete waste management facility that produces methane gas to be delivered to a utility company for the production of electricity. The complex produces 6.7 million pounds of live pork (29,353 animals) shipped to slaughter per year; 105,000 cu. ft. of scrubbed methane per day; and fertilizer. Total effluent is less than 200 gpm of agricultural quality-water with full odor control. The methane production rate made possible with geothermal direct heat is equivalent to at least 400 kw continuous. Sale of the methane on a co-generation basis is being discussed with the utility company. The use of geothermal direct heat energy in the complex displaces nearly 350,000 gallons of fuel oil per year. Generation of the biogas displaces an additional 300,000 gallons of fuel oil per year.

  5. Sara endosomes and the asymmetric division of intestinal stem cells. (United States)

    Montagne, Chrystelle; Gonzalez-Gaitan, Marcos


    Tissue homeostasis is maintained by adult stem cells, which self-renew and give rise to differentiating cells. The generation of daughter cells with different fates is mediated by signalling molecules coming from an external niche or being asymmetrically dispatched between the two daughters upon stem cell mitosis. In the adult Drosophila midgut, the intestinal stem cell (ISC) divides to generate a new ISC and an enteroblast (EB) differentiating daughter. Notch signalling activity restricted to the EB regulates intestinal cell fate decision. Here, we show that ISCs divide asymmetrically, and Sara endosomes in ISCs are specifically dispatched to the presumptive EB. During ISC mitosis, Notch and Delta traffic through Sara endosomes, thereby contributing to Notch signalling bias, as revealed in Sara mutants: Sara itself contributes to the control of the ISC asymmetric division. Our data uncover an intrinsic endosomal mechanism during ISC mitosis, which participates in the maintenance of the adult intestinal lineage.

  6. Sensor Activation and Radius Adaptation (SARA) in Heterogeneous Sensor Networks

    CERN Document Server

    Bartolini, Novella; la Porta, Thomas; Petrioli, Chiara; Silvestri, Simone


    In this paper we address the problem of prolonging the lifetime of wireless sensor networks (WSNs) deployed to monitor an area of interest. In this scenario, a helpful approach is to reduce coverage redundancy and therefore the energy expenditure due to coverage. We introduce the first algorithm which reduces coverage redundancy by means of Sensor Activation and sensing Radius Adaptation (SARA)in a general applicative scenario with two classes of devices: sensors that can adapt their sensing range (adjustable sensors) and sensors that cannot (fixed sensors). In particular, SARA activates only a subset of all the available sensors and reduces the sensing range of the adjustable sensors that have been activated. In doing so, SARA also takes possible heterogeneous coverage capabilities of sensors belonging to the same class into account. It specifically addresses device heterogeneity by modeling the coverage problem in the Laguerre geometry through Voronoi-Laguerre diagrams. SARA executes quickly and is guarante...

  7. Gene : CBRC-SARA-01-1782 [SEVENS

    Lifescience Database Archive (English)


  8. Gene : CBRC-SARA-01-1760 [SEVENS

    Lifescience Database Archive (English)


  9. UCLA SARA (System Architect's Apprentice) demonstration

    Energy Technology Data Exchange (ETDEWEB)

    Fenchel, R.S.; Razouk, R.R.


    A sample session with the SARA system is given. The system is a set of design and modeling tools which are implemented on the MIT-Multics computer system. This demonstration is intended to acquaint all interested persons with the state of implementation of the SARA system and the flavor of its use. The system is currently under implementation; however, all the demonstrated tools are available to any user with access to the MIT-Multics system. Additional tools will soon be available.

  10. Social contract of academic medical centres to the community: Dr Howard Atwood Kelly (1858-1943), a historical perspective. (United States)

    Allen, Paul


    Academic medical centres have traditionally been bastions of teaching and research. Outreach to the community at large and involvement in community affairs have sometimes been lacking in the overall mission and activities of academic medical centres. This paper provides an historical perspective first on the numerous achievements of a physician and surgeon and then on the topic of involvement in community affairs by reviewing the many contributions of America's pioneer gynaecological surgeon and one of the four physician founders of the Johns Hopkins Hospital and School of Medicine in 1889 - Dr Howard Atwood Kelly.

  11. Kelly D. Brownell: Award for Distinguished Scientific Applications of Psychology (United States)

    American Psychologist, 2012


    Presents a short biography of Kelly D. Brownwell, winner of the American Psychological Association's Award for Distinguished Scientific Applications of Psychology (2012). He won the award for outstanding contributions to our understanding of the etiology and management of obesity and the crisis it poses for the modern world. A seminal thinker in…

  12. The relationship between SARA fractions and crude oil stability

    Directory of Open Access Journals (Sweden)

    Siavash Ashoori


    Full Text Available Asphaltene precipitation and deposition are drastic issues in the petroleum industry. Monitoring the asphaltene stability in crude oil is still a serious problem and has been subject of many studies. To investigate crude oil stability by saturate, aromatic, resin and asphaltene (SARA analysis seven types of crudes with different components were used. The applied methods for SARA quantification are IP-143 and ASTM D893-69 and the colloidal instability index (CII is computed from the SARA values as well. In comparison between CII results, the values of oil compositions demonstrated that the stability of asphaltenes in crude oils is a phenomenon that is related to all these components and it cannot be associated only with one of them, individually.

  13. File list: ALL.Neu.50.AllAg.KELLY [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.50.AllAg.KELLY hg19 All antigens Neural KELLY SRX743828,SRX866612,SRX743834...,SRX743832,SRX743833,SRX743830,SRX743829,SRX743831 ...

  14. File list: ALL.Neu.05.AllAg.KELLY [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.05.AllAg.KELLY hg19 All antigens Neural KELLY SRX743828,SRX743831,SRX743830...,SRX743833,SRX866612,SRX743834,SRX743832,SRX743829 ...

  15. File list: ALL.Neu.10.AllAg.KELLY [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Neu.10.AllAg.KELLY hg19 All antigens Neural KELLY SRX743831,SRX743828,SRX866612...,SRX743830,SRX743833,SRX743834,SRX743829,SRX743832 ...

  16. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  17. Gene : CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)


  18. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  19. John Manke (United States)


    On October 1, 1981, John A. Manke was named to head the Directorate of Flight Operations, Ames Research Center, which resulted from the consolidation of NASA's Dryden Flight Research Center at Edwards, California, and Ames Research Center, Moffett Field, California. He also served as site manager of the NASA Ames-Dryden Flight Research Facility. Prior to this assignment, he served as Director of the Flight Operations and Support Directorate at Dryden. Manke attended the University of South Dakota before joining the U.S. Navy in 1951. He graduated from Marquette University at Milwaukee, Wisconsin, in 1956 with a Bachelor Degree in Electrical Engineering. While at school he was selected for the NROTC program and after graduating in 1956 entered flight training and served as a fighter pilot with the U.S. Marine Corps. John left the service in 1960, and prior to joining NASA, worked for Honeywell Corporation as a test engineer. John joined Dryden in 1962 as a research engineer and later became a research pilot, testing advanced craft such as the wingless lifting bodies, forerunners of the Space Shuttle. He was project pilot on the X-24B and also flew the M-2, HL-10 and the X-24A lifting bodies. Manke retired on April 27, 1984. John is a member of the Society of Experimental Test Pilots. He has been honored with two NASA Medals of Outstanding Leadership, two NASA Medals for Exceptional Service and was selected for the Aerospace Walk of Honor in 1997.

  20. AGN X-Ray emission and black holes (Kelly+, 2008)

    DEFF Research Database (Denmark)

    Kelly, B. C.; Bechtold, J.; Trump, J. R.


    In this analysis we combine 169 RQQs from Kelly et al. (2007ApJ...665.1489K) with 149 RQQs from the main SDSS sample of Strateva et al. (2005, Cat. J/AJ/130/387) to create a sample of 318 RQQs. Out of these 318 sources, 276 (86.8%) are detected in the X-ray. (1 data file)....

  1. STS-103 Pilot Kelly answers questions during interview at Pad 39B (United States)


    During an interview at Launch Pad 39B, STS-103 Pilot Scott J. Kelly responds to a question from the media about the mission. Standing with him are the remainder of the crew: (left to right) Commander Curtis L. Brown Jr., Kelly, and Mission Specialists Steven L. Smith, Jean-Frangois Clervoy of France, who is with the European Space Agency (ESA), John M. Grunsfeld (Ph.D.), C. Michael Foale (Ph.D.), and Claude Nicollier of Switzerland, who is also with ESA. As a preparation for launch, they have been participating in Terminal Countdown Demonstration Test (TCDT) activities at KSC. The TCDT provides the crew with emergency egress training, opportunities to inspect their mission payloads in the orbiter's payload bay, and simulated countdown exercises. STS-103 is a 'call-up' mission due to the need to replace and repair portions of the Hubble Space Telescope, including the gyroscopes that allow the telescope to point at stars, galaxies and planets. The STS-103 crew will be replacing a Fine Guidance Sensor, an older computer with a new enhanced model, an older data tape recorder with a solid-state digital recorder, a failed spare transmitter with a new one, and degraded insulation on the telescope with new thermal insulation. The crew will also install a Battery Voltage/Temperature Improvement Kit to protect the spacecraft batteries from overcharging and overheating when the telescope goes into a safe mode. Four EVA's are planned to make the necessary repairs and replacements on the telescope. The mission is targeted for launch Dec. 6 at 2:37 a.m. EST.

  2. John Lindsay

    CERN Document Server


    A few weeks ago John Lindsay passed away unexpectedly at his home in St. Genis. With his death we have lost a pioneer in detector electronics and one of the founding fathers of the CERN Electronics Group. John came to CERN in 1956 to join the Electronics Group, which was being formed in the SC Division. He thus participated from the beginning in the design, development, production, commissioning and support of electronics for the experiments at the CERN accelerators, initially at the SC and finally at the SPS. From the University of Glasgow he brought his expertise on pulse height analyzers, which were called kick sorters in those days, and did pioneering work with it in the early CERN experiments. He designed read-out systems for successive generations of detectors, such as wire spark chambers, multiwire proportional chambers, calorimeters, etc., often coming up with innovative solutions. Surely one of his finest moments must have been when he worked on complex detector systems, such as liquid argon calo...

  3. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich

    Directory of Open Access Journals (Sweden)

    Paula Daniela Bianchi


    Full Text Available The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  4. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich


    Paula Daniela Bianchi


    The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez) by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  5. Subacute ruminal acidosis (SARA) challenge, ruminal condition and cellular immunity in cattle. (United States)

    Sato, Shigeru


    Subacute ruminal acidosis (SARA) is characterized by repeated bouts of low ruminal pH. Cows with SARA often develop complications or other diseases, and associate physiologically with immunosuppression and inflammation. Ruminal free lipopolysaccharide (LPS) increases during SARA and translocates into the blood circulation activating an inflammatory response. Ruminal fermentation and cellular immunity are encouraged by supplementing hay with calf starter during weaning. SARA calves given a 5-day repeated administration of a bacteria-based probiotic had stable ruminal pH levels (6.6-6.8). The repeated administration of probiotics enhance cellular immune function and encourage recovery from diarrhea in pre-weaning calves. Furthermore, the ruminal fermentation could guard against acute and short-term feeding changes, and changes in the rumen microbial composition of SARA cattle might occur following changes in ruminal pH. The repeated bouts of low ruminal pH in SARA cattle might be associated with depression of cellular immunity.

  6. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers...... for the diagnosis of SARA are needed. The goal of this study was to evaluate clinical signs of SARA and to investigate the use of blood, faecal and urinary parameters as indicators of SARA. Six lactating, rumen cannulated, Danish Holstein cows were used in a cross-over study with three periods. The first and second...... periods included two cows on control diet and two cows on nutritional SARA challenge. The third period only included two cows on SARA challenge. Control diet was a conventional total mixed ration [45.5% dry matter (DM), 17.8% crude protein, 43.8% neutral detergent fibre, and 22.5% acid detergent fibre (DM...

  7. Application of the Kelly Criterion to Ornstein-Uhlenbeck Processes (United States)

    Lv, Yingdong; Meister, Bernhard K.

    In this paper, we study the Kelly criterion in the continuous time framework building on the work of E.O. Thorp and others. The existence of an optimal strategy is proven in a general setting and the corresponding optimal wealth process is found. A simple formula is provided for calculating the optimal portfolio for a set of price processes satisfying some simple conditions. Properties of the optimal investment strategy for assets governed by multiple Ornstein-Uhlenbeck processes are studied. The paper ends with a short discus-sion of the implications of these ideas for financial markets.

  8. Teologi Politik Berbalu SARA Antara Ambisi dan Konspirasi

    Directory of Open Access Journals (Sweden)

    M. Sidi Ritau'din


    Full Text Available In a multi-cultural democracy based on Pancasila philosophy of independence, ethnic, religious, racial and intergroup issues it call (SARA are political indicators that can trigger conflict and division. If the player is ambitious and power-hungry, then he will not hesitate to do everything he can to gain power, even build a big conspiracy using SARA as a tool to divide the ummah, then he emerges as a unifier and presents programs prestigious sympathetic, there Imaging actions and slogans of the pro poor people, but essentially no more as political deceit, a false gift of hope, it familiar said (PHP that never realized, only reap the political advantage in the game of SARA, even not hesitate to shout thief when he Itself is a thieving thief based on greed and greed where the horizontal relations of fellow human beings deny the bond of faith as the foundation. Political conspiracy based on political interests and abuse of power, an action of political pathology that is not civilized that has become a trend of contemporary politics and globalization.

  9. Briti minister ja Blairi nõunik lekitasid Kelly nime / Maris Lillak

    Index Scriptorium Estoniae

    Lillak, Maris, 1970-


    Briti relvaeksperdi David Kelly surma uuriva Huttoni komisjon selgitas, et Briti kaitseminister Geoff Hoon ja peaministri endine kommunikatsioonidirektor Alastair Campbell olid osalised relvaeksperdi nime avaldamises ajakirjandusele

  10. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. (United States)

    Trotonda, María Pilar; Manna, Adhar C; Cheung, Ambrose L; Lasa, Iñigo; Penadés, José R


    The biofilm-associated protein Bap is a staphylococcal surface protein involved in biofilm formation. We investigated the influence of the global regulatory locus sarA on bap expression and Bap-dependent biofilm formation in three unrelated Staphylococcus aureus strains. The results showed that Bap-dependent biofilm formation was diminished in the sarA mutants by an agr-independent mechanism. Complementation studies using a sarA clone confirmed that the defect in biofilm formation was due to the sarA mutation. As expected, the diminished capacity to form biofilms in the sarA mutants correlated with the decreased presence of Bap in the bacterial surface. Using transcriptional fusion and Northern analysis data, we demonstrated that the sarA gene product acts as an activator of bap expression. Finally, the bap promoter was characterized and the transcriptional start point was mapped by the rapid amplification of cDNA ends technique. As expected, we showed that purified SarA protein binds specifically to the bap promoter, as determined by gel shift and DNase I footprinting assays. Based on the previous studies of others as well as our work demonstrating the role for SarA in icaADBC and bap expression, we propose that SarA is an essential regulator controlling biofilm formation in S. aureus.

  11. Ned Kelly tattoos--origins and forensic implications. (United States)

    Byard, Roger W


    Tattoos depicting Ned Kelly, a 19th-century Australian bushranger (outlaw) are occasionally encountered in the contemporary Australian population at forensic autopsy. To determine the characteristics of decedents with such tattoos, twenty cases were identified in the autopsy files at Forensic Science SA. All of the decedents were white males (100%) with an age range of 20-67 yrs (average 37 yrs). Seventeen of the deaths (85%) were unnatural, due to suicide in eight cases (40%), accidents in seven cases (35%) and homicide in two cases (10%). Compared to the general autopsy population suicides and homicides were 2.7 and 7.7 times higher, respectively, than would be expected, with a striking male predominance. A Ned Kelly tattoo identified at autopsy in another country or in a disaster victim identification situation may suggest that the decedent was Australian or had a connection with that country. Although the population studied is highly selected, individuals with these tattoos had an above average incidence of traumatic deaths.

  12. Kelly Hoppen - suurte pealkirjadega läbi elu / Ketlin Priilinn

    Index Scriptorium Estoniae

    Priilinn, Ketlin, 1982-


    Inglise disainerist ja ruumikujundajast Kelly Hoppenist (sünd. 1962. a. Lõuna-Ameerikas, 1964. aastast elab Londonis) ning tema loomingust ja tegevusest. K. Hoppen on kirjutanud raamatuid ("Kelly Hoppen Style: The Golden Rules Of Design" jt.), 1979. a. avas ta oma disainistuudio, 2002. a. esimese poe Londonis. 5 värv. ill

  13. Kelly Hoppen - suurte pealkirjadega läbi elu / Ketlin Priilinn

    Index Scriptorium Estoniae

    Priilinn, Ketlin, 1982-


    Inglise disainerist ja ruumikujundajast Kelly Hoppenist (sünd. 1962. a. Lõuna-Ameerikas, 1964. aastast elab Londonis) ning tema loomingust ja tegevusest. K. Hoppen on kirjutanud raamatuid ("Kelly Hoppen Style: The Golden Rules Of Design" jt.), 1979. a. avas ta oma disainistuudio, 2002. a. esimese poe Londonis. 5 värv. ill

  14. Learning Performance of Prediction Markets with Kelly Bettors

    CERN Document Server

    Beygelzimer, Alina; Pennock, David


    In evaluating prediction markets (and other crowd-prediction mechanisms), investigators have repeatedly observed a so-called "wisdom of crowds" effect, which roughly says that the average of participants performs much better than the average participant. The market price---an average or at least aggregate of traders' beliefs---offers a better estimate than most any individual trader's opinion. In this paper, we ask a stronger question: how does the market price compare to the best trader's belief, not just the average trader. We measure the market's worst-case log regret, a notion common in machine learning theory. To arrive at a meaningful answer, we need to assume something about how traders behave. We suppose that every trader optimizes according to the Kelly criteria, a strategy that provably maximizes the compound growth of wealth over an (infinite) sequence of market interactions. We show several consequences. First, the market prediction is a wealth-weighted average of the individual participants' beli...

  15. Gene : CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ctin receptor 1 isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin... receptor 1 isoform 4 [Macaca mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin re...ceptor 1 isoform 5 [Macaca mulatta] ref|XP_001105878.1| PREDICTED: similar to adiponectin... receptor 1 isoform 6 [Macaca mulatta] ref|XP_001105957.1| PREDICTED: similar to adiponectin recepto...CBRC-SARA-01-1167 Novel UN B UNKNOWN ADR1_HUMAN 1e-139 67% ref|XP_001105680.1| PREDICTED: similar to adipone

  16. Factors contributing to the biofilm-deficient phenotype of Staphylococcus aureus sarA mutants.

    Directory of Open Access Journals (Sweden)

    Laura H Tsang

    Full Text Available Mutation of sarA in Staphylococcus aureus results in a reduced capacity to form a biofilm, but the mechanistic basis for this remains unknown. Previous transcriptional profiling experiments identified a number of genes that are differentially expressed both in a biofilm and in a sarA mutant. This included genes involved in acid tolerance and the production of nucleolytic and proteolytic exoenzymes. Based on this we generated mutations in alsSD, nuc and sspA in the S. aureus clinical isolate UAMS-1 and its isogenic sarA mutant and assessed the impact on biofilm formation. Because expression of alsSD was increased in a biofilm but decreased in a sarA mutant, we also generated a plasmid construct that allowed expression of alsSD in a sarA mutant. Mutation of alsSD limited biofilm formation, but not to the degree observed with the corresponding sarA mutant, and restoration of alsSD expression did not restore the ability to form a biofilm. In contrast, concomitant mutation of sarA and nuc significantly enhanced biofilm formation by comparison to the sarA mutant. Although mutation of sspA had no significant impact on the ability of a sarA mutant to form a biofilm, a combination of protease inhibitors (E-64, 1-10-phenanthroline, and dichloroisocoumarin that was shown to inhibit the production of multiple extracellular proteases without inhibiting growth was also shown to enhance the ability of a sarA mutant to form a biofilm. This effect was evident only when all three inhibitors were used concurrently. This suggests that the reduced capacity of a sarA mutant to form a biofilm involves extracellular proteases of all three classes (serine, cysteine and metalloproteases. Inclusion of protease inhibitors also enhanced biofilm formation in a sarA/nuc mutant, with the combined effect of mutating nuc and adding protease inhibitors resulting in a level of biofilm formation with the sarA mutant that approached that of the UAMS-1 parent strain. These results

  17. Low energy neutral atom imaging on the Moon with the SARA instrument aboard Chandrayaan-1 mission

    Indian Academy of Sciences (India)

    Anil Bhardwaj; Stas Barabash; Yoshifumi Futaana; Yoichi Kazama; Kazushi Asamura; David McCann; R Sridharan; Mats Holmstrom; Peter Wurz; Rickard Lundin


    This paper reports on the Sub-keV Atom Reflecting Analyzer (SARA)experiment that will be flown on the first Indian lunar mission Chandrayaan-1.The SARA is a low energy neutral atom (LENA)imaging mass spectrometer,which will perform remote sensing of the lunar surface via detection of neutral atoms in the energy range from 10 eV to 3 keV from a 100 km polar orbit.In this report we present the basic design of the SARA experiment and discuss various scientific issues that will be addressed.The SARA instrument consists of three major subsystems:a LENA sensor (CENA),a solar wind monitor (SWIM),and a digital processing unit (DPU).SARA will be used to image the solar wind –surface interaction to study primarily the surface composition and surface magnetic anomalies and associated mini-magnetospheres.Studies of lunar exosphere sources and space weathering on the Moon will also be attempted.SARA is the first LENA imaging mass spectrometer of its kind to be flown on a space mission.A replica of SARA is planned to fly to Mercury onboard the BepiColombo mission.

  18. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation.

    Directory of Open Access Journals (Sweden)

    Jessica N Snowden

    Full Text Available Infection is a frequent and serious complication following the treatment of hydrocephalus with CSF shunts, with limited therapeutic options because of biofilm formation along the catheter surface. Here we evaluated the possibility that the sarA regulatory locus engenders S. aureus more resistant to immune recognition in the central nervous system (CNS based on its reported ability to regulate biofilm formation. We utilized our established model of CNS catheter-associated infection, similar to CSF shunt infections seen in humans, to compare the kinetics of bacterial titers, cytokine production and inflammatory cell influx elicited by wild type S. aureus versus an isogenic sarA mutant. The sarA mutant was more rapidly cleared from infected catheters compared to its isogenic wild type strain. Consistent with this finding, several pro-inflammatory cytokines and chemokines, including IL-17, CXCL1, and IL-1β were significantly increased in the brain following infection with the sarA mutant versus wild type S. aureus, in agreement with the fact that the sarA mutant displayed impaired biofilm growth and favored a planktonic state. Neutrophil influx into the infected hemisphere was also increased in the animals infected with the sarA mutant compared to wild type bacteria. These changes were not attributable to extracellular protease activity, which is increased in the context of SarA mutation, since similar responses were observed between sarA and a sarA/protease mutant. Overall, these results demonstrate that sarA plays an important role in attenuating the inflammatory response during staphylococcal biofilm infection in the CNS via a mechanism that remains to be determined.

  19. System Analysis and Risk Assessment system (SARA) Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Sattison, M B; Russell, K D; Skinner, N L [EG and G Idaho, Inc., Idaho Falls, ID (United States)


    This NUREG is the tutorial for the System Analysis and Risk Assessment System (SARA) Version 4.0, a microcomputer-based system used to analyze the safety issues of a family (i.e., a power plant, a manufacturing facility, any facility on which a probabilistic risk assessment (PRA) might be performed). A series of lessons are provided that walk the user through some basic steps common to most analyses performed with SARA. The example problems presented in the lessons build on one another, and in combination, lead the user through all aspects of SARA sensitivity analysis.

  20. SarA influences the sporulation and secondary metabolism in Streptomyces coelicolor M145

    Institute of Scientific and Technical Information of China (English)

    Xijun Ou; Bo Zhang; Lin Zhang; Kai Dong; Chun Liu; Guoping Zhao; Xiaoming Ding


    The filamentous bacteria Streptomyces exhibit a complex life cycle involving morphological differentiation and secondary metabolism. A putative membrane protein gene sarA (sco4069), sporulation and antibiotic production related gene A, was partially characterized in Streptomyces coelicolor M145. The gene product had no characterized functional domains and was highly conserved in Streptomyces. Compared with the wild-type M145, the sarA mutant accelerated sporulation and dramatically decreased the production of actinorhodin and undecylprodigiosin.Reverse transcription-polymerase chain reaction analysis showed that SarA influenced antibiotic production by controlling the abundance of actll-orf4 and redZ messenger RNA.

  1. STS-103 MS Clervoy and Pilot Kelly inspect slideware basket at Pad 39B (United States)


    At Launch Pad 39B. STS-103 Mission Specialist Jean-Frangois Clervoy of France, who is with the European Space Agency (ESA), and Pilot Steven J. Kelly inspect the slidewire basket, part of the emergency egress system for persons in the Shuttle vehicle or on the Rotating Service Structure. Seven slidewires extend from the orbiter access arm, with a netted, flatbottom basket suspended from each wire. The STS-103 crew have been participating in Terminal Countdown Demonstration Test (TCDT) activities at KSC. Other crew members are Commander Curtis L. Brown Jr. and Mission Specialists Steven L. Smith, C. Michael Foale (Ph.D.), John M. Grunsfeld (Ph.D.), and Claude Nicollier of Switzerland, also with ESA. The TCDT provides the crew with the emergency egress training, opportunities to inspect their mission payloads in the orbiter's payload bay, and simulated countdown exercises. STS-103 is a 'call-up' mission due to the need to replace and repair portions of the Hubble Space Telescope, including the gyroscopes that allow the telescope to point at stars, galaxies and planets. The STS-103 crew will be replacing a Fine Guidance Sensor, an older computer with a new enhanced model, an older data tape recorder with a solid-state digital recorder, a failed spare transmitter with a new one, and degraded insulation on the telescope with new thermal insulation. The crew will also install a Battery Voltage/Temperature Improvement Kit to protect the spacecraft batteries from overcharging and overheating when the telescope goes into a safe mode. Four EVA's are planned to make the necessary repairs and replacements on the telescope. The mission is targeted for launch Dec. 6 at 2:37 a.m. EST.

  2. Ardoch Lake and Kellys Slough National Wildlife Range : Narrative Report : May to August 1963 (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Ardoch Lake and Kelly Slough National Wildlife Refuge outlines Refuge accomplishments from May to August of 1963. The report begins by...

  3. The Trail Inventory of Kellys Slough National Wildlife Refuge [Cycle 1 (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this report is to create a baseline inventory of all non-motorized trails on Kellys Slough National Wildlife Refuge. Trails in this inventory are...

  4. Ardoch Lake and Kellys Slough National Wildlife Range : Narrative Report : January to April 1963 (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Ardoch Lake and Kelly Slough National Wildlife Refuge outlines Refuge accomplishments from January to April of 1963. The report begins by...

  5. Ardoch Lake, Kellys Slough, Devils Lake National Wildlife Range : Narrative Report : Calendar Year 1964 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Ardoch Lake, Kellys Slough, Devils Lake National Wildlife Refuge outlines Refuge accomplishments during the 1964 calendar year. The...

  6. Ardoch Lake, Kellys Slough, Devils Lake National Wildlife Range : Narrative Report : Calendar Year 1965 (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Ardoch Lake, Kellys Slough, Devils Lake National Wildlife Refuge outlines Refuge accomplishments during the 1965 calendar year. The...

  7. Sara, a patient with borderline personality structure: A "crisis" management

    Directory of Open Access Journals (Sweden)

    Paola Marinelli


    Full Text Available In this article the author examines some significant passages of his treatment of a patient with borderline personality structure, with the intention of giving a formative contribution to the delicate issue of the search for congruence between theory and clinic operations. This reflection is therefore an opportunity to integrate these aspects. The individualization of the therapeutic relationship in the theoretical framework of group analysis allowed the emotional investment in the person of the therapist, which is useful in the construction of a meaningful relationship on the human, emotional and cognitive plane; a space within which it has become increasingly possible for Sara, share and process emotions, re-build, contact parts of the self frustrated and disappointed, perceive less and less the void and become less vulnerable, being able to pull over to the original trauma. 

  8. PDB: CBRC-SARA-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0838 3ODU,3OE0,3OE6,3OE8,3OE9, Region:8-324(Identity=89%) PDB:3ODU Chain:A (X-ray Resolution...=2.5),Region:8-324(Identity=89%) PDB:3OE0 Chain:A (X-ray Resolution=2.9),Region:8-330(...Identity=90%) PDB:3OE6 Chain:A (X-ray Resolution=3.2),Region:8-324(Identity=89%) PDB:3OE8 Chain:A (X-ray Resolution...=3.1),Region:8-324(Identity=89%) PDB:3OE9 Chain:A (X-ray Resolution=3.1), ...

  9. Remembering an Iron Outlaw : the cultural memory of Ned Kelly and the development of Australian identities



    Nineteenth-century outlaw Ned Kelly is probably Australia’s most famous historical figure. Ever since the start of his outlawry in 1878 his story has been repeated time and again, in every conceivable medium. Although the value of his memory has been hotly contested, he remains perhaps the national icon of Australia. This project explores the development of the cultural memory of Kelly over time, and the contributions it has made to constructions of national identity. Firstly, I show how the ...

  10. Depression of biofilm formation and antibiotic resistance by sarA disruption in Staphylococcus epidermidis

    Institute of Scientific and Technical Information of China (English)

    Ju-Hong Tao; Chang-Sheng Fan; Shan-E Gao; Hai-Jiao Wang; Guo-Xin Liang; Qing Zhang


    AIM: To study the effects of disruption of sarA gene on biofilm formation and antibiotic resistance of Staphylococcus epidermidis (S. epidermidis ).METHODS: In order to disrupt sarA gene, the doublecrossover homologous recombination was applied in S. epidermidis RP62A, and tetracycline resistance gene (tet) was used as the selective marker which was amplified by PCR from the pBR322 and inserted into the locus between sarA upstream and downstream,resulting in pBT2△sarA. By electroporation, the plasmid pBT2△sarA was transformed into S. epidermidis.Gene transcription was detected by real-time reverse transcription-PCR (RT-PCR). Determination of biofilm was performed in 96-well flat-bottomed culture plates, and antibiotic resistance was analyzed with test tube culture by spectrophotometry at 570 nm respectively.RESULTS: A sarA disrupted strain named S. epidermidis RP62A△sarA was constructed, which was completely defective in biofilm formation, while the sarA complement strain RP62A△sarA (pHPS9sarA) restored the biofilm formation phenotype. Additionally, the knockout of sarA resulted in decreased erythromycin and kanamycin resistance of S. epidermidis RP62A. Compared to the original strain, S. epidermidis RP62A△sarA had an increase of the sensitivity to erythromycin at 200-400 μg/mL and kanamycin at 200-800 μg/mL respectively.CONCLUSION: The knockout of sarA can result in the defect in biofilm formation and the decreased erythromycin and kanamycin resistance in S. epidermidis RP62A.

  11. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. (United States)

    Valle, Jaione; Toledo-Arana, Alejandro; Berasain, Carmen; Ghigo, Jean-Marc; Amorena, Beatriz; Penadés, José R; Lasa, Iñigo


    Staphylococcus aureus biofilm formation is associated with the production of the polysaccharide intercellular adhesin (PIA/PNAG), the product of the ica operon. The staphylococcal accessory regulator, SarA, is a central regulatory element that controls the production of S. aureus virulence factors. By screening a library of Tn917 insertions in a clinical S. aureus strain, we identified SarA as being essential for biofilm development. Non-polar mutations of sarA in four genetically unrelated S. aureus strains decreased PIA/PNAG production and completely impaired biofilm development, both in steady state and flow conditions via an agr-independent mechanism. Accordingly, real-time PCR showed that the mutation in the sarA gene resulted in downregulation of the ica operon transcription. We also demonstrated that complete deletion of sigmaB did not affect PIA/PNAG production and biofilm formation, although it slightly decreased ica operon transcription. Furthermore, the sarA-sigmaB double mutant showed a significant decrease of ica expression but an increase of PIA/PNAG production and biofilm formation compared to the sarA single mutant. We propose that SarA activates S. aureus development of biofilm by both enhancing the ica operon transcription and suppressing the transcription of either a protein involved in the turnover of PIA/PNAG or a repressor of its synthesis, whose expression would be sigmaB-dependent.

  12. St. John's Wort (image) (United States)

    The herb St. John's Wort is believed to be helpful in relieving mild to moderate depression, but should only be taken under a physician's supervision. St. John's Wort may clash with other medications or foods a ...

  13. Single-access retroperitoneoscopic adrenalectomy (SARA) versus conventional retroperitoneoscopic adrenalectomy (CORA): a case-control study. (United States)

    Walz, Martin K; Groeben, Harald; Alesina, Piero F


    Stimulated by the concept of Natural Orifice Transluminal Endoscopic Surgery (NOTES), minimizing the access even further has become a new trend in minimally invasive surgery. We compare our recently described new method of endoscopic single-access adrenalectomy with the conventional retroperitoneoscopic approach in a matched-pairs study. Fifty single-access retroperitoneoscopic adrenalectomies (SARA) were performed in 47 selected patients suffering from Conn's adenomas (n = 20), pheochromocytomas (n = 15), Cushing's adenomas (n = 6), and other diseases (n = 6). For SARA, a single 2-cm skin incision beneath the 12th rib was used. Following creation of the retroperitoneal space with the rigid endoscope, dissection was carried out single-handed. Another 47 patients served as control group; they were treated by the traditional retroperitoneoscopic three-port approach (CORA). Patients were matched with respect to gender, body mass index, diagnoses, tumor size, and tumor site. Mortality was zero and no major complications occurred in both groups. SARA was completed in 41 cases (86%). The overall complication rate was 8.5% in SARA and 6.4% in CORA. Operative time was longer for SARA (56 +/- 28 min) than for CORA (40 +/- 12 min) (P CORA patients (P = 0.01). Mean hospital stay was 2.4 +/- 0.7 days (SARA) and 3.1 +/- 1.2 days (CORA) (P < 0.01). Because feasibility and safety of SARA could be demonstrated in a large group of selected patients, this surgical technique may represent a new milestone in minimally invasive endocrine surgery.

  14. Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. (United States)

    Kressmann, Sabine; Campos, Claudia; Castanon, Irinka; Fürthauer, Maximilian; González-Gaitán, Marcos


    Asymmetric division of neural precursor cells contributes to the generation of a variety of neuronal types. Asymmetric division is mediated by the asymmetric inheritance of fate determinants by the two daughter cells. In vertebrates, asymmetric fate determinants, such as Par3 and Mib, are only now starting to be identified. Here we show that, during mitosis of neural precursors in zebrafish, directional trafficking of Sara endosomes to one of the daughters can function as such a determinant. In asymmetric lineages, where one daughter cell becomes a neuron (n cell) whereas the other divides again to give rise to two neurons (p cell), we found that the daughter that inherits most of the Sara endosomes acquires the p fate. Sara endosomes carry an endocytosed pool of the Notch ligand DeltaD, which is thereby itself distributed asymmetrically. Sara and Notch are both essential for cell fate assignation within asymmetric lineages. Therefore, the Sara endosome system determines the fate decision between neuronal differentiation and mitosis in asymmetric lineages and thereby contributes to controlling the number of neural precursors and differentiated neurons during neurogenesis in a vertebrate.


    Institute of Scientific and Technical Information of China (English)

    Chu Yuming; Cheng Jinfa; Wang Gendi


    Let D R2 be a Jordan domain, D* = -R2 \\ -D, the exterior of D. In this article, the authors obtained the following results: (1) If D is a John disk, then D is an outer linearly locally connected domain; (2) If D* is a John disk, then D is an inner linearly locally connected domain; (3) A homeomorphism f: R2→R2 is a quasiconformal mapping if and only if f(D) is a John disk for any John disk D(∈)R2; and (4) If D is a bounded quasidisk, then D is a John disk, and there exists an unbounded quasidisk which is not a John disk.


    Directory of Open Access Journals (Sweden)

    Sulistyastuti Sutomo


    Full Text Available Not only does art   have   self-fullfillment, but  it also has axiological  benefits both socially, culturally, religiously, and economiclally.  So does Sara Douda dance.  Sara Douda aesthetics  is first contained  in its whole dance movements. In addition, it  can also be found in the whole dance equipments.  Moreover,  this dance aesthetics  may  also be contained in the verbal symbols in the speech forms  prior to the dance performance. However,  both verbal and non-verbal aesthetical forms are incorporated by the pieces of socio-cultural and  religious values in the Loli community about  their honoring their ancestors,  having social harmony, and  highly respecting each other among the community members. This study uses a cultural linguistic approach to find out and to review the aesthetics of Sara Douda dance.   Seni memang memiliki kepenuhan dalam dirinya sendiri. Tetapi ia juga sekaligus punya faedah aksiologis, baik secara sosial, kultural, religius maupun secara ekonomis. Tarian Sara Douda pun demikian. Estetika Sara Douda pertama-tama ada dalam semua gerak tariannya. Juga dalam seluruh perlengkapan tarian tersebut. Bukan itu saja, estetika tarian ini juga ada dalam simbol-simbol verbal berupa tuturan menjelang tarian. Tetapi baik bentuk-bentuk estetisasi nonverbal maupun verbal, sama-sama disatukan oleh kepingan-kepingan nilai-nilai sosio-kultural dan religius masyarakat Loli tentang penghormatan kepada leluhur, tentang harmoni sosial, dan tentang penghargaan yang tinggi terhadap satu sama lain. Penelitian ini menggunakan pendekatan linguistik kebudayaan demi menemukan dan menelaah estetika dalam tarian Sara Douda

  17. 77 FR 59986 - General Motors Vehicle Manufacturing Including On-Site Leased Workers from Aerotek, Kelly... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employment and Training Administration General Motors Vehicle Manufacturing Including On-Site Leased Workers from Aerotek, Kelly Services, Voith Industrial Services, Shreveport Ramp Services, Dana Holding Corporation, The Landing of GM, Filtration Services...

  18. 77 FR 62535 - General Motors Vehicle Manufacturing Including On-Site Leased Workers From Aerotek, Kelly... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employment and Training Administration General Motors Vehicle Manufacturing Including On-Site Leased Workers From Aerotek, Kelly Services, Voith Industrial Services, Shreveport Ramp Services, Dana Holding Corporation, the Landing Of GM, Filtration Services...

  19. Remembering an Iron Outlaw : the cultural memory of Ned Kelly and the development of Australian identities

    NARCIS (Netherlands)

    Basu, L.S.


    Nineteenth-century outlaw Ned Kelly is probably Australia’s most famous historical figure. Ever since the start of his outlawry in 1878 his story has been repeated time and again, in every conceivable medium. Although the value of his memory has been hotly contested, he remains perhaps the national

  20. Narrative and Spectacle in the Hollywood Musical: Contrasting the Choreography of Busby Berkeley and Gene Kelly (United States)

    Pattullo, Lauren


    This paper examines the relationship between narrative and spectacle in the Hollywood musical, with reference to the work of Busby Berkeley and Gene Kelly. It discusses Busby Berkeley's "backstage" musicals in terms of his "aggregate" approach to dealing with the narrative/spectacle relationship, and considers the effect of the backstage musical's…

  1. Celiac disease presenting as the Paterson-Brown Kelly (Plummer-Vinson) syndrome. (United States)

    Dickey, W; McConnell, B


    We describe two patients with Paterson-Brown Kelly (Plummer-Vinson) syndrome whose iron deficiency anemia was due to celiac disease. They presented with dysphagia 13 and 9 yr, respectively, before celiac disease was diagnosed. Neither had gastrointestinal symptoms suggestive of malabsorption. Celiac disease is a recognized cause of chronic iron deficiency and should be considered as an etiological factor for sideropenic dysphagia.

  2. Remembering an Iron Outlaw : the cultural memory of Ned Kelly and the development of Australian identities

    NARCIS (Netherlands)

    Basu, L.S.|info:eu-repo/dai/nl/304823368


    Nineteenth-century outlaw Ned Kelly is probably Australia’s most famous historical figure. Ever since the start of his outlawry in 1878 his story has been repeated time and again, in every conceivable medium. Although the value of his memory has been hotly contested, he remains perhaps the national

  3. Jasper Johns' Painted Words. (United States)

    Levinger, Esther


    States that the painted words in Jasper Johns' art act in two different capacities: concealed words partake in the artist's interrogation of visual perception; and visible painted words question classical representation. Argues that words are Johns' means of critiquing modernism. (RS)

  4. John Dewey, an Appreciation (United States)

    Clopton, Robert W.


    The subject of the annual Presidential address of Phi Kappa Phi, presented on May 8, 1962, was John Dewey. Dewey is identified in the public mind chiefly as an educational philosopher. In this address, the author describes the life and work of John Dewey as an indefatigable student of life whose interests ranged, like those of Aristotle, over the…

  5. 78 FR 48468 - M/A-Com Technology Solutions, Including On-Site Leased Workers of Kelly Temps and Aerotek CE... (United States)


    ... Kelly Temps and Aerotek CE, Torrance, California; M/A-Com Technology Solutions, Including On-Site Leased Workers of Kelly Temps and Aerotek CE, Long Beach, California; Amended Certification Regarding Eligibility... Solutions, including on-site leased workers of Kelly Temps and Aerotek CE, Torrance, California. The...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|YP_001391163.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langel...and] gb|ABS40017.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langeland] YP_001391163.1 3.1 34% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiest...erase 3 (Neutral sphingomyelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1323 ref|NP_001008277.1| rhodopsin [Canis lupus familiaris] ref|XP_855...608.1| PREDICTED: rhodopsin [Canis familiaris] emb|CAA70209.1| unnamed protein product [Canis familiaris] NP_001008277.1 2e-62 94% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|YP_857334.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK35937.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_857334.1 5.5 42% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1116 gb|AAC62470.1| chemokine receptor CCR5 [Cercocebus torquatus torq...uatus] gb|AAC62473.1| chemokine receptor CCR5 [Cercocebus torquatus torquatus] AAC62470.1 3e-72 86% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_776833.1| opioid receptor, mu 1 [Bos taurus] sp|P79350|OPRM_BOVIN Mu-type opioid... receptor (MOR-1) gb|AAB49477.2| mu opioid receptor [Bos taurus] NP_776833.1 0.0 91% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_001029087.1| opioid receptor, mu 1 [Pan troglodytes] sp|Q5...IS39|OPRM_PANTR Mu-type opioid receptor (MOR-1) gb|AAV74327.1| opioid receptor MU-1 [Pan troglodytes] NP_001029087.1 0.0 90% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0854 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0854 gb|EAW79490.1| calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal...eptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism), isoform CRA_c [Homo sapiens] EAW79490.1 0.0 90% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_001125845.1| hypothetical protein GTNG_1736 [Geobacillus thermoden...itrificans NG80-2] gb|ABO67100.1| Conserved hypothetical protein [Geobacillus thermodenitrificans NG80-2] YP_001125845.1 0.47 23% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|NP_965427.1| hypothetical protein LJ1621 [Lactobacillus johnson...ii NCC 533] gb|AAS09393.1| hypothetical protein LJ_1621 [Lactobacillus johnsonii NCC 533] NP_965427.1 0.12 24% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1366 gb|AAI40135.1| Olfactory receptor 1239 [synthetic construct] gb|A...AI40175.1| Olfactory receptor 1239 [synthetic construct] gb|AAI43150.1| Olfactory receptor 1239 [synthetic construct] AAI40135.1 2e-80 82% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  3. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers fo...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0590 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0590 ref|NP_297344.1| hypothetical protein XF0051 [Xylella fastidiosa ...9a5c] gb|AAF82864.1|AE003859_5 hypothetical protein XF_0051 [Xylella fastidiosa 9a5c] NP_297344.1 8e-19 51% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0430 ref|NP_878187.1| NADH dehydrogenase subunit 1 [Fejervarya limnoch...aris] gb|AAO12107.1| NADH dehydrogenase subunit 1 [Fejervarya limnocharis] NP_878187.1 2.5 29% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1095 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1095 ref|XP_001231930.1| PREDICTED: similar to claudin 14b [Gallus gal...lus] ref|XP_001231960.1| PREDICTED: similar to claudin 14b [Gallus gallus] XP_001231930.1 6e-34 37% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1648 ref|NP_694727.1| histamine H4 receptor [Mus musculus] gb|AAK97380.1|AF358859_1 histamine... H4 receptor [Mus musculus] gb|EDL01579.1| histamine H4 receptor [Mus musculus] NP_694727.1 1e-129 61% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

  9. Rumen Microbiome Composition in Cattle during Grain-Induced Subacute Ruminal Acidosis (SARA)

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Derakshani, Hooman; Li, Shucong


    day of the control period, and first and last day of full SARA-feeding. DNA was extracted and V4 region of bacterial 16S rRNA amplified and subjected to Illumina sequencing. Data was analyzed using QIIME pipelines and resultant operational taxonomic units (OTUs) were aligned to Greengenes database...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|ZP_00743402.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO52327.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00743402.1 0.20 36% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0256 ref|ZP_00739965.1| Integral membrane protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO55770.1| Integral membrane protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00739965.1 1.3 24% ...

  12. The new species of Mysidacea (Crustacea), Anchialina labatus and Gastrosaccus sarae, from south west Australia

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Descriptions of two new sepcies Anchialina labatus and Gastrosaccus sarae, are give. A. lobatus is distinguished from the other species of the genus by the presence of a hairy lobe on the first segment of the antennule, by the modified setae...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001003037.1| melanin-concentrating hormone receptor 2 [ lupus familiaris] gb|AAM51852.1| melanin-concentrating hormone receptor subtype 2 [Canis familiaris] NP_001003037.1 1e-126 73% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001038074.1| putative melanin concentrating hormone recept...or 2 [Sus scrofa] emb|CAJ55683.1| putative melanin concentrating hormone receptor 2 [Sus scrofa] NP_001038074.1 1e-129 73% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_001337495.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumonia...e MGH 78578] gb|ABR79228.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001337495.1 0.93 29% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0303 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0303 ref|YP_001109469.1| valine-pyruvate aminotransferase [Saccharopol...yspora erythraea NRRL 2338] emb|CAM06544.1| valine-pyruvate aminotransferase [Saccharopolyspora erythraea NRRL 2338] YP_001109469.1 5.0 33% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_873218.1| chitinase. Glycosyl Hydrolase family 18. [Acidot...hermus cellulolyticus 11B] gb|ABK53232.1| chitinase. Glycosyl Hydrolase family 18. [Acidothermus cellulolyticus 11B] YP_873218.1 9.3 29% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01788010.1| multidrug resistance protein [Haemophilus influenza...e 3655] gb|EDJ93712.1| multidrug resistance protein [Haemophilus influenzae 3655] ZP_01788010.1 0.22 27% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01792636.1| multidrug resistance protein [Haemophilus influenza...e PittHH] gb|EDK09769.1| multidrug resistance protein [Haemophilus influenzae PittHH] ZP_01792636.1 0.22 27% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01797490.1| multidrug resistance protein [Haemophilus influenza...e R3021] gb|EDK13267.1| multidrug resistance protein [Haemophilus influenzae 22.4-21] ZP_01797490.1 0.22 27% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01785759.1| multidrug resistance protein [Haemophilus influenza...e 22.4-21] gb|EDJ91681.1| multidrug resistance protein [Haemophilus influenzae R3021] ZP_01785759.1 0.22 27% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|YP_248596.1| multidrug resistance protein [Haemophilus influenza...e 86-028NP] gb|AAX87936.1| multidrug resistance protein [Haemophilus influenzae 86-028NP] YP_248596.1 0.22 27% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_026098.1| NADH dehydrogenase subunit 5 [Habronattus oregon...ensis] gb|AAT02495.1| NADH dehydrogenase subunit 5 [Habronattus oregonensis] YP_026098.1 0.032 22% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0491 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0491 ref|YP_001517065.1| hypothetical protein AM1_2749 [Acaryochloris marina... MBIC11017] gb|ABW27749.1| conserved hypothetical protein [Acaryochloris marina MBIC11017] YP_001517065.1 2e-13 45% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1485 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1485 ref|YP_001518234.1| pentapeptide repeat domain protein [Acaryochloris marina... MBIC11017] gb|ABW28917.1| pentapeptide repeat domain protein [Acaryochloris marina MBIC11017] YP_001518234.1 1.9 43% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0594 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 3e-10 35% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1578 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1578 ref|NP_001077100.1| cOR52N9 olfactory receptor family 52 subfamily N-like [Canis lupus... familiaris] gb|ABO36681.1| 52N9 olfactory receptor protein [Canis lupus familiaris] NP_001077100.1 1e-146 78% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1392 sp|Q9BDS7|GPR15_MACFA G-protein coupled receptor 15 gb|AAK25741.1...|AF291670_1 orphan seven transmembrane receptor GPR15 [Macaca fascicularis] Q9BDS7 1e-169 81% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|ZP_01666375.1| conserved hypothetical protein 374 [Thermosinus... carboxydivorans Nor1] gb|EAX47725.1| conserved hypothetical protein 374 [Thermosinus carboxydivorans Nor1] ZP_01666375.1 0.86 31% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_001499570.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae... MTU5] gb|ABV85023.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae MTU5] YP_001499570.1 4.7 36% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1560 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1560 ref|YP_984227.1| filamentous haemagglutinin family outer membrane... protein [Polaromonas naphthalenivorans CJ2] gb|ABM39306.1| filamentous haemagglutinin family outer membrane protein [Polaromonas naphthalenivorans CJ2] YP_984227.1 2.9 30% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0844 ref|NP_949451.1| putative conjugal transfer protein trbI [Rhodopseudomonas... palustris CGA009] emb|CAE29556.1| putative conjugal transfer protein trbI [Rhodopseudomonas palustris CGA009] NP_949451.1 0.38 29% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1393 ref|NP_946691.1| hypothetical protein RPA1341 [Rhodopseudomonas p...alustris CGA009] emb|CAE26784.1| conserved hypothetical protein [Rhodopseudomonas palustris CGA009] NP_946691.1 2.4 28% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 9e-19 40% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-22 39% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1273 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1273 ref|YP_001111321.1| hypothetical protein GrBNV_gp54 [Gryllus bima...culatus nudivirus] gb|ABO45387.1| unknown [Gryllus bimaculatus nudivirus] YP_001111321.1 0.001 35% ...

  18. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow (United States)

    Fletcher, Jack M.; Morris, Robin D.


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow's long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the…

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_848356.1| PREDICTED: similar to adiponectin receptor 1 iso...form 2 [Canis familiaris] ref|XP_537118.2| PREDICTED: similar to adiponectin receptor 1 isoform 1 [Canis familiaris] XP_848356.1 1e-138 67% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1030 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-170 79% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1688 emb|CAH72617.1| chromosome 10 open reading frame 18 [Homo sapiens...] emb|CAI13368.1| chromosome 10 open reading frame 18 [Homo sapiens] CAH72617.1 1e-103 49% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ensis HTE831] sp|Q8EQA1|PRSW_OCEIH Protease prsW (Protease responsible for activating sigma-W) dbj|BAC13763....CBRC-SARA-01-0522 ref|NP_692728.1| hypothetical protein OB1807 [Oceanobacillus ihey

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_574775.1| transcriptional regulator, LysR family [Chromohalobacter salex...igens DSM 3043] gb|ABE60076.1| transcriptional regulator, LysR family [Chromohalobacter salexigens DSM 3043] YP_574775.1 9.3 31% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0831 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0831 ref|XP_001526559.1| hypothetical protein LELG_01387 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK43209.1| hypothetical protein LELG_01387 [Lodderomyces elongisporus NRRL YB-4239] XP_001526559.1 2.8 51% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0106 ref|XP_001524609.1| hypothetical protein LELG_04581 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK46400.1| hypothetical protein LELG_04581 [Lodderomyces elongisporus NRRL YB-4239] XP_001524609.1 3e-17 39% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0566 sp|Q91ZI0|CELR3_MOUSE Cadherin EGF LAG seven-pass G-type receptor... 3 precursor gb|AAL25099.1|AF427498_1 cadherin EGF LAG seven-pass G-type receptor [Mus musculus] Q91ZI0 0.0 74% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_438659.1| alcohol dehydrogenase, zinc-containing [Burkholderia thail...andensis E264] gb|ABC35120.1| alcohol dehydrogenase, zinc-containing [Burkholderia thailandensis E264] YP_438659.1 0.69 35% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0383 ref|XP_361721.2| hypothetical protein MGG_04195 [Magnaporthe gris...ea 70-15] gb|EDJ99501.1| hypothetical protein MGG_04195 [Magnaporthe grisea 70-15] XP_361721.2 1.4 24% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_001009331.1| cannabinoid receptor 1 [Felis catus] sp|O02777|CNR1_FELCA Canna...binoid receptor 1 (CB1) (CB-R) gb|AAB53440.1| CB1 cannabinoid receptor [Felis catus] NP_001009331.1 0.0 96% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0175 ref|NP_603288.1| hypothetical protein FN0384 [Fusobacterium nucle...atum subsp. nucleatum ATCC 25586] gb|AAL94587.1| Hypothetical protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586] NP_603288.1 9.0 32% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0415 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0415 ref|YP_547770.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS...666] gb|ABE42872.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS666] YP_547770.1 4.6 26% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|YP_468056.1| phosphate ABC transporter, permease protein [Rhizobium... etli CFN 42] gb|ABC89329.1| phosphate ABC transporter, permease protein [Rhizobium etli CFN 42] YP_468056.1 1.1 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1549 ref|YP_001101288.1| twin-arginine translocase subunit, sec-indepe...ndent protein export [Herminiimonas arsenicoxydans] emb|CAL63167.1| twin-arginine translocase subunit, sec-i

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1142 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1142 ref|NP_787448.1| twin-arginine translocase TatC component [Trophe...ryma whipplei str. Twist] gb|AAO44417.1| twin-arginine translocase TatC component [Tropheryma whipplei str. Twist] NP_787448.1 0.17 24% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0268 ref|XP_566600.1| hypothetical protein [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW40781.1| expressed protein [Cryptococcus neoformans var. neoformans JEC21] XP_566600.1 0.017 30% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|XP_572921.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW45614.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neoformans JEC21] XP_572921.1 0.90 26% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0348 ref|XP_001586881.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN97385.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001586881.1 2.4 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|XP_001588188.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN94760.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001588188.1 4.6 34% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|NP_223335.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter... pylori J99] gb|AAD06197.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter pylori J99] NP_223335.1 5.2 32% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1253 ref|YP_264377.1| hypothetical protein Psyc_1092 [Psychrobacter 273-4] gb|AAZ18943.1| conserved hypothetical protein [Psychrobacter arcticus 273-4] YP_264377.1 1.2 25% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0873 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0873 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.36 25% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.78 25% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_708759.1| hypothetical protein RHA1_ro10412 [Rhodococcus s...p. RHA1] gb|ABH00601.1| conserved hypothetical protein [Rhodococcus sp. RHA1] YP_708759.1 2.7 25% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1967 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1967 ref|ZP_00370594.1| Predicted DNA repair exonuclease [Campylobacter upsalien...sis RM3195] gb|EAL53370.1| Predicted DNA repair exonuclease [Campylobacter upsaliensis RM3195] ZP_00370594.1 0.047 31% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_001015622.1| prostacyclin receptor [Bos taurus] sp|P79393|PI2R_BOVIN Prostacy...clin receptor (Prostanoid IP receptor) (PGI receptor) (Prostaglandin I2 receptor) emb|CAB07510.1| prostacyclin receptor [Bos taurus] NP_001015622.1 1e-113 86% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|YP_001302962.1| putative flippase [Parabacteroides distasonis... ATCC 8503] gb|ABR43340.1| putative flippase [Parabacteroides distasonis ATCC 8503] YP_001302962.1 5.1 26% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0459 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0459 ref|YP_001297164.1| hypothetical protein FP2308 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44363.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001297164.1 7.3 30% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1901 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1901 ref|ZP_01733372.1| hypothetical protein FBBAL38_03440 [Flavobacte...ria bacterium BAL38] gb|EAZ96441.1| hypothetical protein FBBAL38_03440 [Flavobacteria bacterium BAL38] ZP_01733372.1 4.4 19% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0253 ref|NP_001038089.1| G protein-coupled receptor 54 [Sus scrofa] gb...|ABE73452.1| G protein-coupled receptor 54 [Sus scrofa] gb|ABE73453.1| G protein-coupled receptor 54 [Sus scrofa] NP_001038089.1 3e-51 67% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0420 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0420 ref|ZP_00588106.1| Bile acid:sodium symporter [Pelodictyon phaeocl...athratiforme BU-1] gb|EAN26387.1| Bile acid:sodium symporter [Pelodictyon phaeoclathratiforme BU-1] ZP_00588106.1 0.33 29% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available moniae subsp. pneumoniae MGH 78578] gb|ABR77598.1| putative H+/gluconate symporter ...and related permeases [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001335828.1 1.8 26% ... ...CBRC-SARA-01-1117 ref|YP_001335828.1| putative H+/gluconate symporter and related permeases [Klebsiella pneu

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1572 ref|NP_652753.1| NADH dehydrogenase subunit 5 [Tigriopus japonicu...s] dbj|BAB97224.1| NADH dehydrogenase subunit 5 [Tigriopus japonicus] NP_652753.1 0.14 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1999 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1999 ref|YP_126627.1| hypothetical protein lpl1277 [Legionella pneumop...hila str. Lens] emb|CAH15517.1| hypothetical protein [Legionella pneumophila str. Lens] YP_126627.1 0.38 21% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1615 ref|XP_001683626.1| formin, putative [Leishmania major] emb|CAJ04...769.1| formin, putative [Leishmania major] gb|ABQ43162.1| formin B [Leishmania major] XP_001683626.1 0.52 46% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-2040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2040 ref|NP_001075253.1| 5-hydroxytryptamine (serotonin) receptor 2A [Equus caba...llus] dbj|BAF32954.1| 5-hydroxytryptamine receptor 2A [Equus caballus] NP_001075253.1 1e-128 87% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0322 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0322 ref|ZP_01459778.1| conserved hypothetical protein [Stigmatella aura...ntiaca DW4/3-1] gb|EAU69359.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01459778.1 5.2 34% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0796 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0796 ref|ZP_01774245.1| conserved hypothetical protein [Geobacter bemi...djiensis Bem] gb|EDJ80432.1| conserved hypothetical protein [Geobacter bemidjiensis Bem] ZP_01774245.1 3e-33 39% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001029253.1| progestin and adipoQ receptor family member V...II [Rattus norvegicus] gb|AAY67652.1| progestin membrane receptor alpha [Rattus norvegicus] NP_001029253.1 1e-167 82% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001033642.1| progestin and adipoQ receptor family member V...II [Bos taurus] gb|AAI11285.1| Progestin and adipoQ receptor family member VII [Bos taurus] NP_001033642.1 1e-180 87% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1656 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1656 ref|NP_001034958.1| bitter taste receptor Modo-T2R7B [Monodelphis... domestica] dbj|BAE80368.1| bitter taste receptor [Monodelphis domestica] NP_001034958.1 2e-39 43% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1755 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1755 ref|NP_001034947.1| bitter taste receptor Modo-T2R25 [Monodelphis... domestica] dbj|BAE80373.1| bitter taste receptor [Monodelphis domestica] NP_001034947.1 1e-40 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0389 ref|NP_001034959.1| bitter taste receptor Modo-T2R41 [Monodelphis... domestica] dbj|BAE80381.1| bitter taste receptor [Monodelphis domestica] NP_001034959.1 1e-101 60% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_033365.1| hypothetical protein BH05300 [Bartonella hensela...e str. Houston-1] emb|CAF27338.1| hypothetical protein [Bartonella henselae str. Houston-1] YP_033365.1 0.47 19% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.40 27% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.53 28% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.67 27% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.53 28% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.52 27% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.67 27% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1348 ref|NP_001028103.1| cholinergic receptor, muscarinic 5 [Macaca mu...latta] sp|P56490|ACM5_MACMU Muscarinic acetylcholine receptor M5 gb|AAB95159.1| muscarinic receptor [Macaca mulatta] NP_001028103.1 0.0 88% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_898010.1| phosphatidylserine synthase [Francisella tularen...sis subsp. novicida U112] gb|ABK89256.1| phosphatidylserine synthase [Francisella tularensis subsp. novicida U112] YP_898010.1 3.0 27% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|NP_693392.1| glycerol-3-phosphate dehydrogenase [ iheyensis HTE831] dbj|BAC14427.1| glycerol-3-phosphate dehydrogenase [Oceanobacillus iheyensis HTE831] NP_693392.1 8.7 23% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1651 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.5 19% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|NP_203162.1|ND5_15766 NADH dehydrogenase subunit 5 [Tribolium... castaneum] emb|CAC51706.1| NADH dehydrogenase subunit 5 [Tribolium castaneum] NP_203162.1 5.5 32% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0795 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0795 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.8 19% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_001039945.1| opioid receptor, kappa 1 [Bos taurus] sp|Q2KIP6|OPRK_BOVIN opioid receptor (KOR-1) gb|AAI12562.1| Opioid receptor, kappa 1 [Bos taurus] NP_001039945.1 9e-80 92% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|XP_001221542.1| hypothetical protein CHGG_05447 [Chaetomium globo...sum CBS 148.51] gb|EAQ88828.1| hypothetical protein CHGG_05447 [Chaetomium globosum CBS 148.51] XP_001221542.1 0.21 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|XP_001229383.1| hypothetical protein CHGG_02867 [Chaetomium globo...sum CBS 148.51] gb|EAQ90932.1| hypothetical protein CHGG_02867 [Chaetomium globosum CBS 148.51] XP_001229383.1 4.1 30% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0179 ref|XP_001226930.1| predicted protein [Chaetomium globosum CBS 14...8.51] gb|EAQ84989.1| predicted protein [Chaetomium globosum CBS 148.51] XP_001226930.1 1e-04 40% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_913161.1| ATP synthase F0 subunit 6 [Romanomermis culicivo...rax] gb|ABL11588.1| ATP synthase F0 subunit 6 [Romanomermis culicivorax] YP_913161.1 0.33 24% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1697 ref|YP_913162.1| NADH dehydrogenase subunit 5 [Romanomermis culic...ivorax] gb|ABL11589.1| NADH dehydrogenase subunit 5 [Romanomermis culicivorax] YP_913162.1 0.62 35% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1085 ref|NP_829355.1| hypothetical protein CCA00489 [Chlamydophila cav...iae GPIC] gb|AAP05233.1| conserved hypothetical protein [Chlamydophila caviae GPIC] NP_829355.1 0.26 23% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008277.1| hypothetical protein pc1278 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24002.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008277.1 0.89 28% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0159 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0159 ref|YP_008619.1| hypothetical protein pc1620 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24344.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008619.1 7.8 27% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008281.1| hypothetical protein pc1282 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24006.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008281.1 3.4 25% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1753 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1753 ref|YP_001476411.1| amino acid permease-associated region [Serratia proteam...aculans 568] gb|ABV39283.1| amino acid permease-associated region [Serratia proteamaculans 568] YP_001476411.1 0.83 35% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1462 ref|YP_300930.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyt...icus ATCC 15305] dbj|BAE17985.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305] YP_300930.1 0.020 25% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|YP_213442.1| putative iron transport, fusion membrane protein... [Bacteroides fragilis NCTC 9343] emb|CAH09534.1| putative iron transport, fusion membrane protein [Bacteroides fragilis NCTC 9343] YP_213442.1 1.8 26% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1386 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1386 ref|XP_001165973.1| PREDICTED: prokineticin receptor 2 isoform 1 ...[Pan troglodytes] ref|XP_001166012.1| PREDICTED: prokineticin receptor 2 isoform 2 [Pan troglodytes] XP_001165973.1 1e-115 91% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1868 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1868 ref|NP_067356.2| prokineticin receptor 1 [Mus musculus] gb|AAH59003.1| Prokinetic...2080.1| unnamed protein product [Mus musculus] gb|EDK99210.1| prokineticin receptor 1 [Mus musculus] NP_067356.2 2e-55 77% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_001100989.1| non imprinted in Prader-Willi/Angelman 1 homolog [Rattus norvegicus] gb|EDL86455.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (predicted) [Rattus norvegicus] NP_001100989.1 1e-113 80% ...

  12. Sassis tuumamajandus / John Carey

    Index Scriptorium Estoniae

    Carey, John


    USA presidendikandidaadi John McCaini energeetikakava kohaselt tuleks USA-sse ehitada 100 uut tuumaelektrijaama, neist esimesed 45 peaksid valmima aastaks 2030. Tuumaelektrijaamad aitaksid rahuldada USA energiavajadust ning võitleksid ka kliimasoojenemise vastu. Eksperdid on arengukava suhtes kriitilised

  13. Sassis tuumamajandus / John Carey

    Index Scriptorium Estoniae

    Carey, John


    USA presidendikandidaadi John McCaini energeetikakava kohaselt tuleks USA-sse ehitada 100 uut tuumaelektrijaama, neist esimesed 45 peaksid valmima aastaks 2030. Tuumaelektrijaamad aitaksid rahuldada USA energiavajadust ning võitleksid ka kliimasoojenemise vastu. Eksperdid on arengukava suhtes kriitilised

  14. John Burd Carman

    National Research Council Canada - National Science Library


      Emeritus Professor, Auckland Medical School; MBChB, BMedSc, DPhil (Oxford); 8 November 1932 - 11 August 2012 John Carman, Foundation Head of Department of Anatomy at the Auckland University School of Medicine, died suddenly on 11 August...

  15. Interview with John Milnor

    DEFF Research Database (Denmark)

    Raussen, Martin; Skau, Christian


    This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society......This interview was given by Professor John Milnor in connection to the Abel Prize 2011 ceremony. Originally the interview appeared in the September issue of the Newsletter of the European Mathematical Society...

  16. Stability of a Kind of Kelly-type Queueing Network%一类Kelly-型排队网络的稳定性

    Institute of Scientific and Technical Information of China (English)

    吕文; 刘存霞


    排队网络可以用来模拟诸如通信嘲络这样的复杂系统.对排队网络的研究中的一个主要议题是建立其在某些特殊的规则下稳定的充要条件.本文的研究对象是一类具有两类顾客输入的Kelly-型排队网络.利用流体模型以及Lyapunov函数等工具,建立了该排队网络在所有非闲置的规则下稳定的充分条件.最后,对条件的充分性作了说明.%Queueing networks can be used to model complex systems such as communication networks. One of the main topics in the study of queueing network is to establish the necessary and sufficient condition for its stability under some particular disciplines. The subject of this paper is a kind of Kelly-type queueing network with two type customers input. With the help of the fluid model and Lyapunov function, we established a sufficient condition for the stability of the queueing network under all non-idling disciplines. At the end of this paper, some remarks are given to show the sufficiency of the condition.

  17. VizieR Online Data Catalog: AGN X-Ray emission and black holes (Kelly+, 2008) (United States)

    Kelly, B. C.; Bechtold, J.; Trump, J. R.; Vestergaard, M.; Siemiginowska, A.


    In this analysis we combine 169 RQQs from Kelly et al. (2007ApJ...665.1489K) with 149 RQQs from the main SDSS sample of Strateva et al. (2005, Cat. J/AJ/130/387) to create a sample of 318 RQQs. Out of these 318 sources, 276 (86.8%) are detected in the X-ray. (1 data file).

  18. Medical Movies on the Web Debuts with Gene Kelly's "Combat Fatigue Irritability" 1945 Film | NIH MedlinePlus the ... (United States)

    ... National Library of Medicine (NLM) is a World War II U.S. Navy training film directed by and starring Gene Kelly, who was then a rising Hollywood star. Combat Fatigue Irritability is a historically significant, yet ...

  19. John Deakin: Double Exposures

    Directory of Open Access Journals (Sweden)

    Paul Rousseau


    Full Text Available In this series of short films made by Jonathan Law, the art historian James Boaden, and the curator of The John Deakin Archive, Paul Rousseau, discuss the double-exposure images made by the photographer John Deakin (1912-1972 in the 1950s and 1960s. The films ask you, firstly, to look closely at the images being discussed. Each one begins with a sustained and intense shot of a single image before opening up to a wide-ranging discussion about Deakin, double exposures, and photography.

  20. John Donne no Brasil

    Directory of Open Access Journals (Sweden)

    Jose Garcez Ghirardi


    Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I:621

  1. Graph model of behavior simulator. [Interactive simulator developed as part of UCLA SARA system

    Energy Technology Data Exchange (ETDEWEB)

    Razouk, R.R.; Estrin, G.


    An interactive simulator developed at UCLA as part of the SARA system is described. This simulator, in conjunction with other design tools of the SARA system, allows the user to model the behavior of the system being designed at various levels of detail. The models which drive the simulator are control graphs and associated data graphs. The simulator uses the control graph to express synchronization of sequences of events. Initiation of any control node triggers the simulator to call on the data graph model to provide interpretation of a process at a desired level of abstraction. The simulator gives the user the capability to examine, or modify, the state of the control and data graphs during a simulation. 8 figures.

  2. SARA (System ARchitects Apprentice): Modeling, analysis, and simulation support for design of concurrent systems

    Energy Technology Data Exchange (ETDEWEB)

    Estrin, G.; Fenchel, R.S.; Razouk, R.R.; Vernon, M.K.


    An environment to support designers in the modeling, analysis and simulation of concurrent systems is described. It is shown how a fully nested structure model supports multilevel design and focuses attention on the interfaces between the modules which serve to encapsulate behavior. Using simple examples the paper indicates how a formal graph model can be used to model behavior in three domains: control flow, data flow, and interpretation. The effectiveness of the explicity environment model in SARA is discussed and the capability to analyze correctness and evaluate performance of a system model are demonstrated. A description of the integral help designed into SARA shows how the designer can be offered consistent use of any new tool introduced to support the design process.

  3. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA)

    CERN Document Server

    Keel, William C; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA), a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofisica de Canarias. SARA observatories comprise a 0.96m telescope at Kitt Peak, Arizona; a 0.6m instrument on Cerro Tololo, Chile; and the 1m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for f...

  4. Serum acute phase proteins in cows with SARA (Subacute Ruminal Acidosis suspect

    Directory of Open Access Journals (Sweden)

    C. Cannizzo


    Full Text Available The aim of this study was to evaluate the variations of Acute Phase Proteins (APPs and other blood constituents during the onset of the sub-acute ruminal acidosis (SARA pathological status. A total of 108 cows from 12 dairy herds were randomly selected and divided into three Groups of 36 animals each. All animals were subjected to a rumenocentesis. Group A was composed by subjects with a rumen pH>5.8, Group B was composed by subjects with a rumen pH ≤5.5≤5.8 and Group C was composed by subjects with a rumen pH<5.5. Blood samples were collected by jugular venipuncture and Haptoglobin (Hp, Serum Amyloid A (SAA, Total Proteins, Albumin and White Blood Cells (WBC were determined. One-way ANOVA showed a statistical significance on Rumen pH, Hp, SAA. SARA seems not stimulate the APPs production from liver.

  5. John Goethe China

    Institute of Scientific and Technical Information of China (English)



    John wolfgang von Goethe,a renowned German poet and writer, was first known to Chinese in the late 19th century,His name and masterpice "Faust" appeared in works of Chinese diplomats and overseas students such as Li Fengbac and Gu Hongmig.And it was Ma Junwu who first translated Goethe's works into Chinese.

  6. John Hatties feedbackmodel

    DEFF Research Database (Denmark)

    Hyldahl, Kirsten Kofod


    Med afsæt i den newzealandske professor John Hatties feedbackmodel giver denne artikel et perspektiv på, hvordan der kan arbejdes med effektiv feedback i undervisningen. Artiklen belyser hvordan en god feedbackkultur har betydning for, at læringsmål og feedbackprocesser anvendes konstruktivt og...

  7. Being John Rokesmith

    Directory of Open Access Journals (Sweden)

    Pete Orford


    Full Text Available As Birkbeck’s experiment in translating 'Our Mutual Friend 'to Twitter draws to a close, John Rokesmith reflects on the experience of being a nineteenth-century literary character in a twenty-first century digital world.

  8. John Cale avaldas memuaarid

    Index Scriptorium Estoniae


    Rockbändi "The Velvet Underground" asutajaliige John Cale avaldas oma autobiograafia "What's Welsh for Zen?". Koos biograafiakirjanik Victor Bockrisiga kirjutatud teos räägib 60ndate lõpu kultuurielust New Yorgis, koostööst Andy Warholiga jm.

  9. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow


    Fletcher, Jack M.; Morris, Robin D


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow’s long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the maturational lag theory of developmental dyslexia proposed with Paul Satz, her mentor. The research program that emerged from this work had a wide impact...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_999614.1| luteinizing hormone/choriogonadotropin receptor ...[Sus scrofa] sp|P16582|LSHR_PIG Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAA31062.1| luteinizing hormone receptor precursor NP_999614.1 0.0 65% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_776806.1| luteinizing hormone/choriogonadotropin receptor ...[Bos taurus] sp|Q28005|LSHR_BOVIN Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAC24012.1| luteinizing hormone receptor [Bos taurus] NP_776806.1 0.0 65% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_776826.1| neuropeptide Y receptor Y2 [Bos taurus] sp|P79113|NPY2R_BOVIN Neurope...ptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAB40600.1| type 2 neuropeptide Y receptor NP_776826.1 0.0 85% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0123 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 1e-120 70% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_653200.2| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Homo sapiens] sp|Q7RTP0|NIPA1_HUMAN Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 tpg|...DAA01477.1| TPA_exp: non-imprinted in Prader-Willi/Angelman syndrome 1 [Homo sapiens] NP_653200.2 1e-113 81% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0466 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0466 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 3e-32 71% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1400 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1400 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sapie...ns] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 4e-34 52% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1193 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1193 ref|NP_776427.1| calcium-sensing receptor [Bos taurus] sp|P35384|...CASR_BOVIN Extracellular calcium-sensing receptor precursor (CaSR) (Parathyroid Cell calcium-sensing recepto...r) gb|AAB29171.1| Ca(2+)-sensing receptor [Bos taurus] prf||2002360A Ca-sensing receptor NP_776427.1 0.0 86% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1360 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1360 ref|NP_599155.1| trace-amine-associated receptor 1 [Rattus norveg...icus] gb|AAL65137.1|AF421352_1 trace amine receptor 1 [Rattus norvegicus] gb|AAV70127.1| trace amine associa...ted receptor 1 [Rattus norvegicus] gb|EDL87747.1| trace-amine-associated receptor 1 [Rattus norvegicus] NP_599155.1 1e-145 74% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|NP_001029267.1| tubulin, alpha, ubiquitous [Pan troglodytes] ...sp|Q5R1W4|TBA1B_PANTR Tubulin alpha-1B chain (Tubulin alpha-ubiquitous chain) (Alpha-tubulin ubiquitous) (Tu...bulin K-alpha-1) dbj|BAD74034.1| ubiquitous alpha-tubulin [Pan troglodytes verus] NP_001029267.1 1e-136 86% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|YP_001474562.1| DNA internalization-related competence protei...n ComEC/Rec2 [Shewanella sediminis HAW-EB3] gb|ABV37434.1| DNA internalization-related competence protein ComEC/Rec2 [Shewanella sediminis HAW-EB3] YP_001474562.1 1.7 33% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0675 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0675 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-136 76% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1437 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-123 71% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0312 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-137 76% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1238 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1238 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-116 72% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0756 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0756 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sa...piens] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 1e-66 52% ...

  7. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA) (United States)

    Keel, William C.; Oswalt, Terry; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A.


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA) , a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofísica de Canarias. SARA observatories comprise a 0.96 m telescope at Kitt Peak, Arizona; one of 0.6 m aperture on Cerro Tololo, Chile; and the 1 m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for frequent local service, and a second CCD for offset guiding. The Arizona and Chile telescopes also have fiber-fed echelle spectrographs. Switching between imaging and spectroscopy is very rapid, so a night can easily accommodate mixed observing modes. We present some sample observational programs. For the benefit of other groups organizing similar consortia, we describe the operating structure and principles of SARA, as well as some lessons learned from almost 20 years of remote operations.

  8. Innovative Stormwater Quality Tools by SARA for Holistic Watershed Master Planning (United States)

    Thomas, S. M.; Su, Y. C.; Hummel, P. R.


    Stormwater management strategies such as Best Management Practices (BMP) and Low-Impact Development (LID) have increasingly gained attention in urban runoff control, becoming vital to holistic watershed master plans. These strategies can help address existing water quality impairments and support regulatory compliance, as well as guide planning and management of future development when substantial population growth and urbanization is projected to occur. However, past efforts have been limited to qualitative planning due to the lack of suitable tools to conduct quantitative assessment. The San Antonio River Authority (SARA), with the assistance of Lockwood, Andrews & Newnam, Inc. (LAN) and AQUA TERRA Consultants (a division of RESPEC), developed comprehensive hydrodynamic and water quality models using the Hydrological Simulation Program-FORTRAN (HSPF) for several urban watersheds in the San Antonio River Basin. These models enabled watershed management to look at water quality issues on a more refined temporal and spatial scale than the limited monitoring data. They also provided a means to locate and quantify potential water quality impairments and evaluate the effects of mitigation measures. To support the models, a suite of software tools were developed. including: 1) SARA Timeseries Utility Tool for managing and processing of large model timeseries files, 2) SARA Load Reduction Tool to determine load reductions needed to achieve screening levels for each modeled constituent on a sub-basin basis, and 3) SARA Enhanced BMP Tool to determine the optimal combination of BMP types and units needed to achieve the required load reductions. Using these SARA models and tools, water quality agencies and stormwater professionals can determine the optimal combinations of BMP/LID to accomplish their goals and save substantial stormwater infrastructure and management costs. The tools can also help regulators and permittees evaluate the feasibility of achieving compliance

  9. Reactivity of Athabasca residue and of its SARA fractions during residue hydroconversion

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, J.; Danial-Fortain, P.; Gauthier, T.; Merdrignac, I. [IFP-Lyon, Vermaison (France); Budzinski, H. [Bordeaux Univ. (France). ISM-LPTC, UMR CNRS


    Residue conversion processes are becoming increasingly important because of the declining market for residual fuel oil and a greater demand for middle distillates. Ebullated-bed hydroconversion is a commercially proven technology for converting heavy feedstocks with high amounts of impurities. The process enables the conversion of atmospheric or vacuum residues at temperatures up to 440 degrees C, and at liquid hourly space velocity (LHSV) conditions in the range of 0.15 to 0.5 per hour. A 540 degrees C conversion of up to 80 weight per cent can be achieved under these conditions. This paper reported on a research study conducted at IFP Lyon in which the residue hydroconversion in a large-scale ebullated bed bench unit was investigated to determine the impact of operating conditions and feed properties on yield and product qualities. Hydrogen was added to the feed in the bench units to keep a high hydrogen partial pressure and favour the catalytic hydroconversion reactions. In a typical test, the reactor was fed with 50 g of feedstock and 0.45 g of crushed equilibrium industrial NiMo catalyst, pressurized hydrogen and quickly heated at the reaction temperature. This paper also discussed the conversion of Athabasca bitumen residue in the large-scale pilot plant and also in the small scale batch reactor. The effect of operating temperature and space velocity was examined. The reactivity of the saturates, aromatics, resins and asphaltenes (SARA) fractions of the bitumen was studied separately in order to better understand the conversion mechanisms and reactivities. The Athabasca bitumen feed and SARA fractions were also analyzed in terms of standard petroleum analysis, SARA fractionation, elemental analysis, size exclusion chromatography (SEC) and 13C NMR. Hydroconversion experiments were conducted in the batch unit at different reaction temperatures and reaction times. A comparison of small-scale batch results with those obtained with the continuous large-scale bench

  10. Resistencia no violenta para una sociedad igualitaria y sostenible: el pensamiento de Petra Kelly


    Velasco Sesma, Angélica


    El problema de la guerra y de la violencia ha sido tratado por la ética desde diversos enfoques. Desde una postura pacifista, Petra Kelly ha señalado que este problema está estrechamente relacionado con la degradación ambiental, la violación de los derechos humanos, el aumento de la injusticia en el mundo y la desigualdad entre los sexos. El análisis que realiza de estos fenómenos, así como sus propuestas ético-políticas, nos proveen de elementos valiosos a la hora ...

  11. Charles John Huffam Dickens

    Institute of Scientific and Technical Information of China (English)


    Charles John Huffam Dickens(7 February1812-9 June 1870)was an English writer and social critic.He created some of the world’s most memorable fictional characters and is generally regarded as the greatest novelist of the Victorian period.During his life,his works enjoyed unprecedented fame,and by the twentieth centuryhis literary genius was broadly acknowledged by critics and scholars.His novels

  12. John Strong (1941 - 2006)

    CERN Multimedia

    Wickens, F

    Our friend and colleague John Strong was cruelly taken from us by a brain tumour on Monday 31st July, a few days before his 65th birthday John started his career working with a group from Westfield College, under the leadership of Ted Bellamy. He obtained his PhD and spent the early part of his career on experiments at Rutherford Appleton Laboratory (RAL), but after the early 1970s his research was focussed on experiments in CERN. Over the years he made a number of notable contributions to experiments in CERN: The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras to record the sparks in the spark chambers; He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems; He was responsible for the second level trigger system for the ALEPH detector and spent five years leading a team that designed and built the system, which ran for twelve years with only minor interventions. Following ALEPH he tur...

  13. Monro-Kellie 2.0: The dynamic vascular and venous pathophysiological components of intracranial pressure (United States)


    For 200 years, the ‘closed box’ analogy of intracranial pressure (ICP) has underpinned neurosurgery and neuro-critical care. Cushing conceptualised the Monro-Kellie doctrine stating that a change in blood, brain or CSF volume resulted in reciprocal changes in one or both of the other two. When not possible, attempts to increase a volume further increase ICP. On this doctrine’s “truth or relative untruth” depends many of the critical procedures in the surgery of the central nervous system. However, each volume component may not deserve the equal weighting this static concept implies. The slow production of CSF (0.35 ml/min) is dwarfed by the dynamic blood in and outflow (∼700 ml/min). Neuro-critical care practice focusing on arterial and ICP regulation has been questioned. Failure of venous efferent flow to precisely match arterial afferent flow will yield immediate and dramatic changes in intracranial blood volume and pressure. Interpreting ICP without interrogating its core drivers may be misleading. Multiple clinical conditions and the cerebral effects of altitude and microgravity relate to imbalances in this dynamic rather than ICP per se. This article reviews the Monro-Kellie doctrine, categorises venous outflow limitation conditions, relates physiological mechanisms to clinical conditions and suggests specific management options. PMID:27174995

  14. Preliminary factor analysis of the O’Kelly Women Beliefs Scale in a US sample

    Directory of Open Access Journals (Sweden)

    Arturo Heman Contreras


    Full Text Available Using a Rational Emotive Behavior Therapy framework, the O’Kelly Women Beliefs Scale (O’Kelly, in press was originally constructed in Australia to measure sex-role beliefs women may develop through sex-role stereotyping. Factor analysis of the 92 original items showed that 64 items loaded into a single component that accounted for 18.2% of the variance in a sample of 974 Australian women. The present exploratory study examined the psychometric properties of the OWBS in a sample of 202 women born and living in the US. A varimax rotation with cutoff eigenvalues of 3, showed that 37 items loaded into 3 components which accounted for 58.48% of the variance. The items were subsequently grouped into two factors: Ir- rationality, with a total of 27 items was created by merging component 1 and 3 (Pearson’s r = 0.8 between them, and Rationality, with the 10 items from component 2. Analyses indicated a Cronbach’s alpha of 0.91 for Fac- tor 1, and a Cronbach’s alpha 0.74 for Factor 2. Results indicate that this version of the instrument may be used to evaluate both the rational and irrational content of sex-role beliefs of women born in the US.

  15. John Adams in 1959

    CERN Multimedia


    On 24 November 1959, the Proton Synchrotron accelerated particles to 24 GeV. John Adams, leader of the construction team, announced the achievement in the Main Auditorium. In his hand can be seen an empty vodka bottle, which he had received from Nikitin with the message that it was to be drunk when CERN passed Dubna's world record energy of 10 Gev. The bottle now contains a polaroid photograph of the 24 GeV pulse ready to be sent to the Soviet Union.

  16. John Campbell Begg (United States)

    Campbell, Robert


    John Campbell Begg born in Dunedin in 1876 was the son of Alexander Campbell Begg and Katherine Begg, early Otago settlers. He studied physics and philosophy at the University of Otago before turning to business and rural pursuits. He died in Dunedin in 1965 age 89. The Begg family were foundation members of the Otago Astronomical Society. Visits to the Tanna Hill Observatory were made in 1915. The astronomical observatory which stands in Robin Hood Park, Roslyn, Dunedin bears his name; Beverly Begg Observatory

  17. Impact of subacute ruminal acidosis (SARA) adaptation and recovery on the density and diversity of bacteria in the rumen of dairy cows

    NARCIS (Netherlands)

    Hook, S.E.; Steele, M.A.; Northwood, K.S.; Dijkstra, J.; France, J.; Wright, A.G.; McBride, B.W.


    Subacute ruminal acidosis (SARA) is characterized by ruminal pH depression and microbial perturbation. The impact of SARA adaptation and recovery on rumen bacterial density and diversity was investigated following high-grain feeding. Four ruminally cannulated dairy cows were fed a hay diet, transiti

  18. PLS models for determination of SARA analysis of Colombian vacuum residues and molecular distillation fractions using MIR-ATR

    Directory of Open Access Journals (Sweden)

    Jorge A. Orrego-Ruiz


    Full Text Available In this work, prediction models of Saturates, Aromatics, Resins and Asphaltenes fractions (SARA from thirty-seven vacuum residues of representative Colombian crudes and eighteen fractions of molecular distillation process were obtained. Mid-Infrared (MIR Attenuated Total Reflection (ATR spectroscopy in combination with partial least squares (PLS regression analysis was used to estimate accurately SARA analysis in these kind of samples. Calibration coefficients of prediction models were for saturates, aromatics, resins and asphaltenes fractions, 0.99, 0.96, 0.97 and 0.99, respectively. This methodology permits to control the molecular distillation process since small differences in chemical composition can be detected. Total time elapsed to give the SARA analysis per sample is 10 minutes.

  19. SARAS: a precision system for measurement of the Cosmic Radio Background and signatures from the Epoch of Reionization

    CERN Document Server

    Patra, Nipanjana; Raghunathan, A; Shankar, N Udaya


    SARAS is a correlation spectrometer purpose designed for precision measurements of the cosmic radio background and faint features in the sky spectrum at long wavelengths that arise from redshifted 21-cm from gas in the reionization epoch. SARAS operates in the octave band 87.5-175 MHz. We present herein the system design arguing for a complex correlation spectrometer concept. The SARAS design concept provides a differential measurement between the antenna temperature and that of an internal reference termination, with measurements in switched system states allowing for cancellation of additive contaminants from a large part of the signal flow path including the digital spectrometer. A switched noise injection scheme provides absolute spectral calibration. Additionally, we argue for an electrically small frequency-independent antenna over an absorber ground. Various critical design features that aid in avoidance of systematics and in providing calibration products for the parametrization of other unavoidable s...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_104995.1| alcohol dehydrogenase, zinc-containing [Burkholder...ia mallei ATCC 23344] ref|YP_111924.1| alcohol dehydrogenase [Burkholderia pseudomallei K96243] ref|ZP_004...40487.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei GB8 horse 4] ref|YP_336176.1| alc...ohol dehydrogenase, zinc-containing [Burkholderia pseudomallei 1710b] ref|ZP_0093...0750.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei FMH] ref|ZP_00934487.1| COG1064: Z

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1695 sp|Q9NYW0|T2R10_HUMAN Taste receptor type 2 member 10 (T2R10) (Taste... receptor family B member 2) (TRB2) gb|AAH69089.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AA...U21148.1| taste receptor T2R10 [Homo sapiens] gb|AAI01763.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AAI01765.1| Taste

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1608 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1608 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabinoid... receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cannabinoid... receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cannabinoid

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cannabinoid... receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cannabinoid... receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-0921 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0921 ref|NP_003292.1| thyrotropin-releasing hormone receptor [Homo sap...iens] sp|P34981|TRFR_HUMAN Thyrotropin-releasing hormone receptor (TRH-R) (Thyroliberin receptor) emb|CAA52965.1| thyrotropin-releasi...BAA04120.1| human thyrotropin-releasing hormone receptor [Homo sapiens] gb|AAB32222.1| hormone receptor; TRH receptor [Homo sapiens] dbj|BAA12796.1| thyrotropin-releasing... hormone receptor [Homo sapiens] gb|AAR84356.1| thyrotropin-releasing hormone receptor [Homo sapiens] gb|

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_001105680.1| PREDICTED: similar to adiponectin receptor 1 ...isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin receptor 1 isoform 4 [Macac...a mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin receptor 1 isoform 5 [Macaca mulatta] ref|X...P_001105878.1| PREDICTED: similar to adiponectin receptor 1 isoform 6 [Macaca mul...atta] ref|XP_001105957.1| PREDICTED: similar to adiponectin receptor 1 isoform 7 [Macaca mulatta] XP_001105680.1 1e-138 67% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|NP_057083.2| adiponectin receptor 1 [Homo sapiens] ref|XP_514107.1| PREDICTED: adipone...ctin receptor 1 isoform 7 [Pan troglodytes] ref|XP_001152270.1| PREDICTED: adiponectin... receptor 1 isoform 1 [Pan troglodytes] ref|XP_001152338.1| PREDICTED: adiponectin receptor 1 isoform 2 [...Pan troglodytes] ref|XP_001152393.1| PREDICTED: adiponectin receptor 1 isoform 3 ...[Pan troglodytes] ref|XP_001152460.1| PREDICTED: adiponectin receptor 1 isoform 4 [Pan troglodytes] ref|XP_0

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_000951.1| prostaglandin I2 (prostacyclin) receptor (IP) [ I2 receptor) dbj|BAA05008.1| prostacyclin receptor [Homo sapiens] gb|AAA36448.1| prostanoid IP receptor dbj|BAA06110.1| pros...tacyclin receptor [Homo sapiens] dbj|BAA07325.1| prostacyclin ...receptor [Homo sapiens] gb|AAO92301.1| prostaglandin I2 (prostacyclin) receptor [Homo sapiens] gb|AAH75814.1| Prostaglandin I2 (pros...tacyclin) receptor (IP) [Homo sapiens] gb|EAW57432.1| prostaglandin I2 (prostacyclin

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|XP_001107503.1| PREDICTED: tubulin, alpha, ubiquitous isoform... 10 [Macaca mulatta] ref|XP_001107562.1| PREDICTED: tubulin, alpha, ubiquitous isoform 11 [Macaca mulatta] r...ef|XP_001107624.1| PREDICTED: tubulin, alpha, ubiquitous isoform 12 [Macaca mulatta] ref|XP_001107684.1| PRE...| PREDICTED: tubulin, alpha, ubiquitous isoform 14 [Macaca mulatta] ref|XP_001107805.1| PREDICTED: tubulin, alpha, ubiquitous... isoform 15 [Macaca mulatta] ref|XP_001107870.1| PREDICTED: tubulin, alpha, ubiquitous isof

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_848509.1| progestin and adipoQ receptor family member VII ...[Homo sapiens] sp|Q86WK9|MPRA_HUMAN Membrane progestin receptor alpha (mPR alpha) (Progestin and adipoQ rece...ptor family member VII) gb|AAO47233.1|AF313620_1 putative membrane steroid receptor [Homo sapiens] gb|AAR08373.1| progesti...1| hCG1642829 [Homo sapiens] emb|CAM12867.1| progestin and adipoQ receptor family member VII [Homo sapiens] NP_848509.1 1e-178 87% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_001122232.1| CDP-alcohol phosphatidyltransferase [Francise...lla tularensis subsp. tularensis WY96-3418] ref|YP_001427783.1| CDP-alcohol phosphatidyltransferase [Francis...ella tularensis subsp. holarctica FTA] gb|ABO47111.1| CDP-alcohol phosphatidyltransferase [Francisella tular...ensis subsp. tularensis WY96-3418] gb|EDN35713.1| phosphatidylserine synthase [Francis...ella tularensis subsp. novicida GA99-3549] gb|EDN37179.1| hypothetical protein FTDG_01588 [Francisella

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 gb|ABR53744.1| opsin 1 short-wavelength senstive protein [Daubent...onia madagascariensis] gb|ABR53745.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensi...s] gb|ABR53746.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensis] gb|ABR53747.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53748.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53749.1| opsin 1 short-wave

  12. saeRS and sarA act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Lara N Mrak

    Full Text Available Mutation of the staphylococcal accessory regulator (sarA limits biofilm formation in diverse strains of Staphylococcus aureus, but there are exceptions. One of these is the commonly studied strain Newman. This strain has two defects of potential relevance, the first being mutations that preclude anchoring of the fibronectin-binding proteins FnbA and FnbB to the cell wall, and the second being a point mutation in saeS that results in constitutive activation of the saePQRS regulatory system. We repaired these defects to determine whether either plays a role in biofilm formation and, if so, whether this could account for the reduced impact of sarA in Newman. Restoration of surface-anchored FnbA enhanced biofilm formation, but mutation of sarA in this fnbA-positive strain increased rather than decreased biofilm formation. Mutation of sarA in an saeS-repaired derivative of Newman (P18L or a Newman saeRS mutant (ΔsaeRS resulted in a biofilm-deficient phenotype like that observed in clinical isolates, even in the absence of surface-anchored FnbA. These phenotypes were correlated with increased production of extracellular proteases and decreased accumulation of FnbA and/or Spa in the P18L and ΔsaeRS sarA mutants by comparison to the Newman sarA mutant. The reduced accumulation of Spa was reversed by mutation of the gene encoding aureolysin, while the reduced accumulation of FnbA was reversed by mutation of the sspABC operon. These results demonstrate that saeRS and sarA act synergistically to repress the production of extracellular proteases that would otherwise limit accumulation of critical proteins that contribute to biofilm formation, with constitutive activation of saeRS limiting protease production, even in a sarA mutant, to a degree that can be correlated with increased enhanced capacity to form a biofilm. Although it remains unclear whether these effects are mediated directly or indirectly, studies done with an sspA::lux reporter suggest they

  13. Kallid eestimaalased / John Kjaer

    Index Scriptorium Estoniae

    Kjaer, John


    Ilmunud ka: Nädaline : Raplamaa teel Euroopasse ; Lääne Elu : Läänemaa teel Euroopasse 31. august lk. 2, Järva Teataja : Järvamaa teel Euroopasse 5. august lk. 2, Pärnu Postimees : Pärnumaa teel Euroopasse 5. august lk. 2, Koit : Põlvamaa teel Euroopasse 14. august lk. 2, Võrumaa Teataja : Võrumaa teel Euroopasse 14. august lk. 2, Vooremma : Jõgevamaa teel Euroopasse 19. august lk. 2, Harjumaa : Harjumaa teel Euroopasse 22. august lk. 2, Lääne-Harju Ekspress : Harjumaa teel Euroopasse lk. 2. Euroopa Komisjoni Delegatsiooni juht Eestis John Kjaer pole nõus väitega, et Eesti saab hakkama üksinda, väljapool Euroopa Liitu

  14. Filsafat Multikulturalisme John Rawls

    Directory of Open Access Journals (Sweden)

    Rina Rehayati


    Full Text Available Terjadinya konflik horizontal yang mengatasnamakan identitas kelompok (etnis, suku, keyakinan dan seterusnya dikarenakan adanya phobia terhadap perbedaan. Padahal perbedaan suatu keniscayaan, karena manusia tidak akan mampu menyeragamkan atau menuntut orang lain untuk sama dengan dirinya, baik pada aspek pemikiran, keyakinan, etnis, suku, budaya, dan sebagainya. Filsafat multikulturalisme John Rawls merupakan alternatif tawaran politik kebudayaan untuk mengatasi konflik horizontal. Menurut Rawls, suatu masyarakat yang adil bukanlah hanya menjamin “the greatest happiness for the greatest number” yang selama ini terkenal dalam prinsip demokrasi. Tetapi, masyarakat yang adil menurutnya adalah adanya pengakuan dan penerimaan terhadap perbedaan dan keberagaman. Pendapatnya ini dia rangkai dalam pokok-pokok pemikirannya tentang keadilan, seperti: Justice as Fairness, Veil of Ignorance, Principle of Equal Liberty, Maximin Rule, Lexical Order dan Reflective Equilibrium.

  15. John Bartlett and bioterrorism. (United States)

    Henderson, D A


    Until 1997, the subject of bioterrorism was not discussed within the medical community and deliberately ignored in national planning efforts. Biological weapons were regarded as "morally repulsive." This complacency stemmed from a 1972 Biological Weapons Convention where all countries agreed to cease offensive biological weapons research. In the 1990s, however, the Soviet Union was discovered to have an extensive bioweapons program and a Japanese religious cult sought to launch an anthrax attack on Tokyo. Biological weapons such as smallpox and anthrax had the potential to cause a national catastrophe. However, little was done until John Bartlett in 1997 led a symposium and program to educate the medical community and the country of the need for definitive bioweapons programs. It was highly persuasive and received a final stimulus when the anthrax attack occurred in the United States in 2001.

  16. Following John Wilkinson

    Directory of Open Access Journals (Sweden)

    Joe Luna


    Full Text Available This article reads closely John Wilkinson’s essay ‘Following the Poem’ (2007 alongside some of Wilkinson’s poetry from the 1980s and 1990s. Using the work of Donald Winnicott as a touchstone, the article critically evaluates the claims made in Wilkinson’s essay about fullness and intersubjectivity against some of his poetry’s expressions of fragmentation and dismemberment. The article concludes with some reflections on Wilkinson’s quotation of Shelley’s 'Prometheus Unbound in Proud Flesh' (1986, and on the later collection 'Hid Lip' (1992. It argues that an illuminating disparity or contradiction exists between the avowed aim of the reading practices described and advocated in ‘Following the Poem,’ and the state of the subjects repeatedly presented in Wilkinson’s poetry. The article finally suggests that this contradiction itself speaks volumes about the kind of world in which both poetry and poetics exist.

  17. John Snow and research. (United States)

    Shephard, D A


    John Snow's leadership in epidemiology as well as anaesthesia resulted from his research as much as his clinical practice. In anaesthesia, Snow's research concerned the regulation of concentrations of volatile agents and the development of efficient inhalers; the uptake and elimination of volatile agents; stages of anaesthesia; carbon dioxide metabolism and rebreathing; and metabolism in anaesthesia and the theory of anaesthesia. In epidemiology, Snow investigated the relationship of water supplies to mortality in cholera during the London epidemic in 1854, which led him to formulate an original and valid theory of the transmission of cholera. Snow's research, which has received less attention than anecdotes concerning his career (e.g., his anaesthetizing Queen Victoria and urging removal of the handle of a contaminated water pump), was always directed towards solving specific problems. The significance of his research is evident in its leading not only to improvements in health care but also to the evolution of anaesthesia and epidemiology as professional disciplines.

  18. On the Shock-Response-Spectrum Recursive Algorithm of Kelly and Richman (United States)

    Martin, Justin N.; Sinclair, Andrew J.; Foster, Winfred A.


    The monograph Principles and Techniques of Shock Data Analysis written by Kelly and Richman in 1969 has become a seminal reference on the shock response spectrum (SRS) [1]. Because of its clear physical descriptions and mathematical presentation of the SRS, it has been cited in multiple handbooks on the subject [2, 3] and research articles [4 10]. Because of continued interest, two additional versions of the monograph have been published: a second edition by Scavuzzo and Pusey in 1996 [11] and a reprint of the original edition in 2008 [12]. The main purpose of this note is to correct several typographical errors in the manuscript's presentation of a recursive algorithm for SRS calculations. These errors are consistent across all three editions of the monograph. The secondary purpose of this note is to present a Matlab implementation of the corrected algorithm.

  19. Kelley Hot Spring Geothermal Project: Kelly Hot Spring Agricultural Center conceptual design

    Energy Technology Data Exchange (ETDEWEB)

    Longyear, A.B. (ed.)


    The proposed core activity in the Kelly Hot Spring Agricultural Center is a nominal 1200 sow swine raising complex. The swine raising is to be a totally confined operation for producing premium pork in controlled environment facilities that utilize geothermal energy. The complex will include a feedmill for producing the various feed formulae required for the animals from breeding through gestation, farrowing, nursery, growing and finishing. The market animals are shipped live by truck to slaughter in Modesto, California. A complete waste management facility will include manure collection from all raising areas, transport via a water flush sysem to methane (biogas) generators, manure separation, settling ponds and disposition of the surplus agricultural quality water. The design is based upon the best commercial practices in confined swine raising in the US today. The most unique feature of the facility is the utilization of geothermal hot water for space heating and process energy throughout the complex.

  20. 76 FR 61749 - SpectraWatt, Inc. Including On-Site Leased Workers From Kelly Services Hopewell Junction, NY... (United States)


    ... the subject firm were engaged in employment related to the production of solar cells for their application in solar panels. The worker group includes on-site leased workers from Kelly Services. During the... articles like or directly competitive with solar cells produced by the subject firm have increased,...

  1. 76 FR 16447 - ETHICON, a Subsidiary of Johnson & Johnson Including On-Site Leased Workers From Kelly Temporary... (United States)


    ... Employment and Training Administration ETHICON, a Subsidiary of Johnson & Johnson Including On-Site Leased... Johnson & Johnson, including on-site leased workers from Kelly Temporary Services, San Angelo, Texas. The... certification of eligibility to apply for adjustment assistance was issued for all workers of ETHICON, A Johnson...

  2. 30 CFR 250.445 - What are the requirements for kelly valves, inside BOPs, and drill-string safety valves? (United States)


    ...). You must be able to strip the lower kelly valve through the BOP stack; (c) If you drill with a mud..., inside BOPs, and drill-string safety valves? 250.445 Section 250.445 Mineral Resources MINERALS... CONTINENTAL SHELF Oil and Gas Drilling Operations Blowout Preventer (bop) System Requirements § 250.445...

  3. Mechanical Analysis of Kelly Cock Valve%方钻杆旋塞阀失效的力学机理

    Institute of Scientific and Technical Information of China (English)

    何玉发; 朱海燕


    研究方钻杆旋塞阀的失效形式和失效原因,通过力学分析、有限元计算和流场数值模拟,为进一步提高方钻杆旋塞阀的设计水平和合理使用提供理论依据。%In terms of numerical modeling of the flow field of a Kelly cock valve,this paper reports that the velocity of fluid can be rapidly increased at upper and lower valve seats and this can easily prick out ball valves and valve seats,and there was an annular low-velocity zone of minimum speed between the ball valve and the inner wall of the main body and thus caused solid aggregation at this area.The research in this paper discussed the modes and causes of Kelly failure recognized systematically.The results of mechanical analysis,finite element calculation and flow field numerical modeling provided theoretical foundations for further improving the design and reasonable use of a Kelly cock valve,ultimately improving the overall working performance of a Kelly cock valve.

  4. 76 FR 46852 - Workers From Kelly Services, Working On-Site at Delphi Automotive Systems, LLC, Powertrain... (United States)


    ... workers from Kelly Services working on-site at Delphi Automotive Systems, LLC, El Paso, Texas. The workers...-site at Delphi Automotive Systems, LLC, Powertrain Division, El Paso, Texas. The amended notice...-site at Delphi Automotive Systems, LLC, Powertrain Division, El Paso, Texas, who became totally...

  5. Inactivation of poliovirus type 1 by the Kelly-Purdy ultraviolet seawater treatment unit. (United States)

    Hill, W F; Hamblet, F E; Benton, W H


    Three experiments were conducted to determine the effect of ultraviolet (UV) radiation on poliovirus-contaminated seawater. In two of the experiments, the effectiveness of the Kelly-Purdy UV Seawater Treatment Unit to inactivate poliovirus type 1 (T(1)) suspended in continuously flowing seawater was determined. In experiment 1, the observed survival ratio of poliovirus T(1) was 2.3 x 10(-4) (99.98% reduction) in 15.7 sec. No virus was detected (<0.2 plaque-forming unit/ml) in 20.6 seconds. The calculated half-life value was 1.29 sec. In experiment 2, the observed survival ratio of poliovirus T(1) was 5.9 x 10(-4) (99.94% reduction) in 11.7 sec. No virus was detected in 15.7 sec. The calculated half-life value was 1.37 sec. In experiment 3, a laboratory-controlled UV experiment designed to closely simulate the geometry of the continuously flowing seawater system, the observed survival ratios of poliovirus T(1) were 9.7 x 10(-3) (99.03% reduction) and 3.6 x 10(-4) (99.96% reduction) in 15 and 30 sec, respectively; the calculated half-life value was 2.38 sec. A statistically significant difference was found between the inactivation rates of poliovirus T(1) in the two test systems. This rate difference was attributed primarily to UV dosage and stirring effects. The data indicated that UV radiation effectively inactivated poliovirus T(1) in flowing seawater. These results validate the efficacy of the Kelly-Purdy UV Seawater Treatment Unit for use in commercial depuration systems.

  6. Inactivation of Poliovirus Type 1 by the Kelly-Purdy Ultraviolet Seawater Treatment Unit1 (United States)

    Hill, William F.; Hamblet, Frederick E.; Benton, William H.


    Three experiments were conducted to determine the effect of ultraviolet (UV) radiation on poliovirus-contaminated seawater. In two of the experiments, the effectiveness of the Kelly-Purdy UV Seawater Treatment Unit to inactivate poliovirus type 1 (T1) suspended in continuously flowing seawater was determined. In experiment 1, the observed survival ratio of poliovirus T1 was 2.3 × 10-4 (99.98% reduction) in 15.7 sec. No virus was detected (<0.2 plaque-forming unit/ml) in 20.6 seconds. The calculated half-life value was 1.29 sec. In experiment 2, the observed survival ratio of poliovirus T1 was 5.9 × 10-4 (99.94% reduction) in 11.7 sec. No virus was detected in 15.7 sec. The calculated half-life value was 1.37 sec. In experiment 3, a laboratory-controlled UV experiment designed to closely simulate the geometry of the continuously flowing seawater system, the observed survival ratios of poliovirus T1 were 9.7 × 10-3 (99.03% reduction) and 3.6 × 10-4 (99.96% reduction) in 15 and 30 sec, respectively; the calculated half-life value was 2.38 sec. A statistically significant difference was found between the inactivation rates of poliovirus T1 in the two test systems. This rate difference was attributed primarily to UV dosage and stirring effects. The data indicated that UV radiation effectively inactivated poliovirus T1 in flowing seawater. These results validate the efficacy of the Kelly-Purdy UV Seawater Treatment Unit for use in commercial depuration systems. Images PMID:4304572

  7. Illness, everyday life and narrative montage: the visual aesthetics of cancer in Sara Bro's Diary. (United States)

    Henriksen, Nina; Tjørnhøj-Thomsen, Tine; Hansen, Helle Ploug


    This article presents a study of Sara Bro's Diary (2004), a book montage of images and texts recording the experiences of a Danish breast cancer survivor, Sara Bro. It examines two montages of photography and text, drawing on Roland Barthes' concept of 'the third meaning' to explain and discuss the effect of the layered meanings in the montage alongside their multi-medium and self-referential expression. The discussion is centred on the aesthetic practices that are invited by Bro's book montage. The article considers how the juxtaposition of images and texts are experienced and co-created by the reader. It points to the effect of the aesthetics of disguise and carnival implicit in the visual-verbal montage and argues that these generate a third meaning. This meaning is associated with the breast cancer experience but is not directly discernible in the montage. The article concludes by discussing how Bro's montage acts as an ideological statement, subverting or 'poaching on' the health care system.

  8. First Results on the Epoch of Reionization from First Light with SARAS 2 (United States)

    Singh, Saurabh; Subrahmanyan, Ravi; Udaya Shankar, N.; Sathyanarayana Rao, Mayuri; Fialkov, Anastasia; Cohen, Aviad; Barkana, Rennan; Girish, B. S.; Raghunathan, A.; Somashekar, R.; Srivani, K. S.


    Long-wavelength spectral distortions in the cosmic microwave background arising from the 21 cm transition in neutral hydrogen are a key probe of the Cosmic Dawn and the Epoch of Reionization. These features may reveal the nature of the first stars and ultra-faint galaxies that transformed the spin temperature and ionization state of the primordial gas. SARAS 2 is a spectral radiometer purposely designed for the precision measurement of these monopole or all-sky global 21 cm spectral distortions. We use 63 hr nighttime observations of the radio background in the frequency band 110-200 MHz, with the radiometer deployed at the Timbaktu Collective in Southern India, to derive likelihoods for plausible redshifted 21 cm signals predicted by theoretical models. First light with SARAS 2 disfavors the class of models that feature weak X-ray heating (with {f}X≤slant 0.1) and rapid reionization (with peak \\tfrac{{{dT}}b}{{dz}}≥slant 120 mK per unit redshift interval).

  9. John Adams Lecture

    CERN Multimedia

    PH Department


    13 December 2010 14:30 - Council Chamber, Bldg.503-1-001 Accelerator Breakthroughs, Achievements and Lessons from the Tevatron Collider V. Shiltsev / Fermilab’s Accelerator Physics Centre This year we celebrate the 25th anniversary of the first proton-antiproton collisions in the Tevatron. For two and a half decades the Tevatron at Fermilab (Batavia, IL, USA) was a centerpiece of the US and world’s High Energy Physics as the world’s highest energy particle collider at 1.8 TeV center of mass energy. While funding agencies are deciding on a 3-year extension of the Collider Run II operation through 2014, we – in this 2010 John Adams Lecture - will take a look in exciting story of the Tevatron: the story of long preparations, great expectations, numerous difficulties, years of “blood and sweat”, continuous upgrades, exceeding original goals (by a factor of 400) and high emotions. An accelerator scientist prospective will be given on a wide spectrum o...

  10. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  11. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. (United States)

    Plaizier, Jan C; Li, Shucong; Danscher, Anne Mette; Derakshani, Hooman; Andersen, Pia H; Khafipour, Ehsan


    The effects of a grain-based subacute ruminal acidosis (SARA) challenge on bacteria in the rumen and feces of lactating dairy cows were determined. Six lactating, rumen-cannulated Danish Holstein cows were used in a cross-over study with two periods. Periods included two cows on a control diet and two cows on a SARA challenge. The control diet was a total mixed ration containing 45.5% dry matter (DM), 43.8% DM neutral detergent fiber, and 19.6% DM starch. The SARA challenge was conducted by gradually substituting the control diet with pellets containing 50% wheat and 50% barley over 3 days to reach a diet containing 55.6% DM, 31.3% DM neutral detergent fiber, and 31.8% DM starch, which was fed for four more days. Rumen fluid samples were collected at day 7 and 10 of experimental periods. Feces samples were collected on days 8 and 10 of these periods. Extracted DNA from the rumen and feces samples was analyzed to assess their bacterial communities using MiSeq Illumina sequencing of the V4 region of the 16S rRNA gene. The induction of SARA reduced the richness, diversity, and stability of bacterial communities and resulted in distinctly different microbiota in the rumen and feces. Bacteroidetes and Firmicutes were the most abundant phyla and, combined, they represented 76.9 and 94.4% of the bacterial community in the rumen fluid and the feces, respectively. Only the relative abundance of Firmicutes in the rumen was increased by the SARA challenge. In rumen fluid and feces, the abundances of nine out of the 90 and 25 out of the 89 taxa, respectively, were affected by the challenge. Hence, SARA challenge altered the composition of the bacterial community at the lower taxonomical level in the feces and therefore also likely in the hindgut, as well as in the rumen. However, only reductions in the bacterial richness and diversity in the rumen fluid and feces were in agreement with those of other studies and had a biological basis. Although the composition of the

  12. IN MEMORIAM: Hugh P Kelly, 3 September 1931 - 29 June 1992 (United States)

    Hansen, Jørgen E.


    It is said that Racah was one of the few physicists who was able not only to read Hermann Weyl's book "The Theory of Groups and Quantum Mechanics" but also to understand enough to use it himself. Something similar applies to Hugh Kelly, who introduced the methods of Many-Body Perturbation Theory (MBPT), which was being developed by nuclear physicists like Keith Brueckner whom Hugh worked with as a post-doc, into atomic physics. Since atomic physics with its "known" forces is a perfect area in which to apply the methods of MBPT, it is clear that this would have happened sooner or later. Hugh Kelly's achievement is that it happened very early. Hugh's death this summer after a long battle with cancer is a great loss to atomic physics and to his many friends in the community. Hugh P Kelly got his PhD from the University of California at Berkeley in 1963 under the supervision of Kenneth Watson and in 1965 he was hired as assistant Professor at the University of Virginia. His appointment was to a large extent due to the support of M E Rose, also a nuclear physicist with interest in atoms as is clear from his book "Elementary Theory of Angular Momentum". Hugh remained at the University of Virginia for the rest of his life, over the years serving as Department Chairman, Faculty Dean and, during the last years, as University Provost, but throughout Hugh pursued his real passion which was Physics. It is a clear sign of his dedication that he is sole author on a large number of papers particularly of course in the early years when he alone was Atomic Theory in Charlottesville. Hugh contributed to many areas of atomic physics although early on photoionization became his favourite subject and the one where he made his main contribution: first for closed shell atoms, but later extending his techniques to open shell systems for which the normal MBPT techniques did not apply. Hugh had a good nose for finding projects that were of topical interest and many of his papers are

  13. Marcel Breuer at Saint John's (United States)

    Carlson, Scott


    A visitor to Saint John's University and Saint John's Abbey, in north-central Minnesota, sees something of Gothic heritage while standing in front of the abbey church, designed and built around 1960. The church's 112-foot campanile--a trapezoidal slab made of 2,500 tons of steel and concrete--stands boldly in front of a huge concrete honeycomb…

  14. Market Feasibility of Burberry and Gucci in Zhang Jiagang City, P.R China : Case: Introduce a New Luxury Brand into Kelly Mall


    Wang, Ning; Wu, Youran


    With the rapid development of Chinese economy, wealth has spread from largest coastal cities to smaller cities and luxury stores have started to follow. Kelly Mall is the largest high-end department store situated in Zhang Jiagang City, Jiangsu Province, P.R China. This research aims to figure out if Kelly Mall should introduce a new luxury brand, help-ing Kelly Mall’s board members make decision on taking either Burberry or Gucci or both of them into its luxury department. Theoretical framew...

  15. Psyche’s Daughter of Today: Sara Jeannette Duncan and the New Woman

    Directory of Open Access Journals (Sweden)

    Michelle Gadpaille


    Full Text Available The Canadian novelist Sara Jeannette Duncan (1861-1922 constructed a New Woman heroine in the fin-de- siecle novel; A Daughter of Today (1894. Written in the popular mode of the transatlantic novel; the work engages in debate on the appropriate construction of femininity in art and public life. The heroine; Elfrida Bell; descends from artist; to muse; to model; to painted image—a descent framed by a rival male artist and a hostile London art scene. Represented as Psyche; the heroine undergoes a quest and failure similar to the mythical one. Adaptation of the Psyche myth clarifies the position of Duncan in the spectrum of gender ideologies of the fin-de- siecle.

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1066 ref|NP_473371.1| MAS-related GPR, member X2 [Homo sapiens] sp|Q96...LB1|MRGX2_HUMAN Mas-related G-protein coupled receptor member X2 gb|AAK91805.1| G protein-coupled receptor [Homo sapie...ns] dbj|BAB89339.1| putative G-protein coupled receptor [Homo sapiens] dbj|BAC06030.1| seven trans...membrane helix receptor [Homo sapiens] gb|AAH63450.1| MAS-related GPR, member X2 [Homo sapie...ns] gb|AAW70056.1| MRGX2 [Homo sapiens] gb|AAW70057.1| MRGX2 [Homo sapiens] gb|AAW70058.1| MRGX2 [Homo sapie

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0185 ref|NP_000852.1| histamine receptor H1 [Homo sapiens] ref|NP_001091681.1| histamine... receptor H1 [Homo sapiens] ref|NP_001091682.1| histamine receptor H1 [Homo sapiens] ref|NP_001091683.1| histamine... receptor H1 [Homo sapiens] sp|P35367|HRH1_HUMAN Histamine H1 receptor emb|CAA54182.1| histamine... H1 receptor [Homo sapiens] dbj|BAA05840.1| histamine H1 receptor [ sapiens] emb|CAA84380.1| Human histamine H1 receptor [Homo sapiens] dbj|BAA03319.1| histamine H1 receptor

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_705806.1| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Mus musculus] sp|Q8BHK1|NIPA1_MOUSE Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 homo...log gb|AAM34534.1| non-imprinted in Prader-Willi/Angelman syndrome 1 [Mus musculus] dbj|BAC32809.1| unnamed ...protein product [Mus musculus] gb|AAH55828.1| Non imprinted in Prader-Willi/ syndrome 1 homolog (human) [Mus musculus] gb|EDL21870.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) [Mus musculus] NP_705806.1 1e-113 81% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_035141.1| opioid receptor, kappa 1 [Mus musculus] sp|P33534|OPRK_MOUSE opioid receptor (KOR-1) (MSL-1) gb|AAA39363.1| kappa opioid receptor gb|AAB34130.2| opioid receptor; KOR [Mus sp.] gb|AAP32232.1| kappa-opioid receptor [Mus sp.] gb|AAI16796.1| Opioid receptor, 1 [Mus musculus] gb|AAI19027.1| Opioid receptor, kappa 1 [Mus muscu...lus] gb|EDL14259.1| opioid receptor, kappa 1, isoform CRA_a [Mus musculus] NP_035141.1 1e-78 92% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0004 ref|NP_000900.1| neuropeptide Y receptor Y1 [Homo sapiens] sp|P25929|NPY1R_HUMAN Neurope...ptide Y receptor type 1 (NPY1-R) gb|AAA73215.1| [Human neuropeptide Y peptide YY rece...ptor mRNA, complete cds.], gene product gb|AAA59947.1| neuropeptide Y receptor Y1 gb|AAH36657.1| Neuropeptid...e Y receptor Y1 [Homo sapiens] gb|AAS55647.1| neuropeptide Y1 receptor [Homo sapiens] gb|AAH71720.1| Neuro...peptide Y receptor Y1 [Homo sapiens] gb|EAX04841.1| neuropeptide Y receptor Y1 [Hom

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_000901.1| neuropeptide Y receptor Y2 [Homo sapiens] ref|NP_001012655.1| neurope...ptide Y receptor Y2 [Pan troglodytes] sp|P49146|NPY2R_HUMAN Neuropeptide Y receptor typ...e 2 (NPY2-R) (NPY-Y2 receptor) sp|Q5IS62|NPY2R_PANTR Neuropeptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAC50281.1| neurope...ptide Y/peptide YY Y2 receptor gb|AAB04120.1| y2 receptor gb|AAC51115.1| type 2 neuropeptide Y receptor gb|AAO92062.1| neuropeptide Y receptor Y2 [Homo

  2. SarA is a negative regulator of Staphylococcus epidermidis biofilm formation

    DEFF Research Database (Denmark)

    Martin, Christer; Heinze, C.; Busch, M.


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive S. epidermidis isolates fail to show accumulative biofilm growth in vitro. We here tested the hypothesis that this apparent paradox is related...... to the existence of superimposed regulatory systems suppressing a multi-cellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA,chief regulator of staphylococcal...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via over-expression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1942 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1942 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenerg...ic receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AA...B59487.1| alpha 1a/d adrenergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenerg

  4. Escribiendo el silencio: la contemplación poética de Sara Pujol

    Directory of Open Access Journals (Sweden)

    Gala, Candelas


    Full Text Available Reading Sara Pujol Russell's El fuego tiende su aire (1999 and Intacto asombro de la luz del silencio (2001, is entering into a poetic world whose content and form are both innovative and complex. This poetry invites the reader into a state of meditative contemplation that seeks correspondences among different elements in reality as the key to access a superior type of knowledge. Pujol's writing moves in the fringes between voice and silence, art and nature, meaning and nothingness, identity and difference, it seeks to surpass its own verbal texture while only in that texture does it find articulation and only through it does transcendence becones accessible. The focus of the present reading centers on the point where Pujol's language seeks to transcend the disjunction between sign and surrounding, the point where synthesis is fusion about to dissolve.La lectura de El fuego tiende su aire (1999 e Intacto asombro en la luz del silencio (2001 de Sara Pujol Russell, supone la entrada en un discurso poético innovador y complejo tanto en contenido como en forma. Esta poesía invita a una contemplación meditativa que busca las correspondencias entre los diversos elementos de la realidad como clave para acceder a un conocimiento superior. Su escritura se mueve en los bordes entre la voz y el silencio, el arte y la naturaleza, el sentido y el vacío, la identidad y la diferencia, buscando trascender lo que está más allá de su misma urdimbre verbal pero que sólo en ella se configura, y sólo desde ella se puede acceder. En el movimiento de esta escritura por superar la disyunción entre signo y entorno, en esa síntesis a punto de disolverse, es donde se enfoca la lectura en este ensayo.

  5. Hamilton decompositions of regular expanders: a proof of Kelly's conjecture for large tournaments

    CERN Document Server

    Kühn, Daniela


    A long-standing conjecture of Kelly states that every regular tournament on n vertices can be decomposed into (n-1)/2 edge-disjoint Hamilton cycles. We prove this conjecture for large n. In fact, we prove a far more general result, based on our recent concept of robust expansion and a new method for decomposing graphs. We show that every sufficiently large regular digraph G on n vertices whose degree is linear in n and which is a robust outexpander has a decomposition into edge-disjoint Hamilton cycles. This enables us to obtain numerous further results, e.g. as a special case we confirm a conjecture of Erdos on packing Hamilton cycles in random tournaments. As corollaries to the main result, we also obtain several results on packing Hamilton cycles in undirected graphs, giving e.g. the best known result on a conjecture of Nash-Williams. We also apply our result to solve a problem on the domination ratio of the Asymmetric Travelling Salesman problem, which was raised e.g. by Glover and Punnen as well as Alon,...

  6. Functional impairment in patients with myotonic dystrophy type 1 can be assessed by an ataxia rating scale (SARA). (United States)

    DiPaolo, Giovanni; Jimenez-Moreno, Cecilia; Nikolenko, Nikoletta; Atalaia, Antonio; Monckton, Darren G; Guglieri, Michela; Lochmüller, Hanns


    Myotonic dystrophy type 1 (DM1) is not characterised by ataxia per se; however, DM1 and ataxia patients show similar disturbances in movement coordination often experiencing walking and balance difficulties, although caused by different underlying pathologies. This study aims to investigate the use of a scale previously described for the assessment and rating of ataxia (SARA) with the hypothesis that it could have utility in DM1 patients as a measure of disease severity and risk of falling. Data from 54 DM1 patients were pulled from the PHENO-DM1 natural history study for analysis. Mean SARA score in the DM1 population was 5.45 relative to the maximum score of eight. A flooring effect (score 0) was observed in mild cases within the sample. Inter-rater and test-retest reliability was high with intraclass coefficients (ICC) of 0.983 and 1.00, respectively. Internal consistency was acceptable as indicated by a Cronbach's alpha of 0.761. Component analysis revealed two principle components. SARA correlated with: (1) all measures of muscle function tested, including quantitative muscle testing of ankle dorsiflexion (r = -0.584*), the 6 min walk test (r = -0.739*), 10 m walk test (r = 0.741*), and the nine hole peg test (r = 0.602*) and (2) measures of disease severity/burden, such as MIRS (r = 0.718*), MDHI (r = 0.483*), and DM1-Activ (r = -0.749*) (*p < 0.001). The SARA score was predicted by an interaction between modal CTG repeat length and age at sampling (r = 0.678, p = 0.003). A score of eight or above predicted the use of a walking aid with a sensitivity of 100% and a specificity of 85.7%. We suggest that further research is warranted to ascertain whether SARA or components of SARA are useful outcome measures for clinical trials in DM1. As a tool, it can be used for gathering information about disease severity/burden and helping to identify patients in need of a walking aid, and can potentially be applied in both research and healthcare

  7. Magic moments with John Bell

    Energy Technology Data Exchange (ETDEWEB)

    Bertlmann, Reinhold A.


    John Bell, with whom I had a fruitful collaboration and warm friendship, is best known for his seminal work on the foundations of quantum physics, but he also made outstanding contributions to particle physics and accelerator physics.

  8. St. John's Wort and Depression (United States)

    ... W X Y Z St. John's Wort and Depression: In Depth Share: On This Page Introduction Key ... will help ensure coordinated and safe care. About Depression Depression is a medical condition that affects about ...

  9. Col John Boyds Innovative DNA (United States)


    Steve Jobs put it, why do some people seem to “ think different”? Why are some people more successful innovators than others? Dyer, Gregersen, and...41–156. 4. Robert Coram, Boyd: The Fighter Pilot Who Changed the Art of War (Boston: Little, Brown , 2002). Let us know what you think ! Leave a comment...September–October 2015 | 99 COMMENTARY Col John Boyd’s Innovative DNA Col Houston R. Cantwell, USAF Surprisingly, few Airmen have heard of Col John

  10. John locke on personal identity. (United States)

    Nimbalkar, Namita


    John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self) to be founded on consciousness (viz. memory), and not on the substance of either the soul or the body.

  11. John locke on personal identity

    Directory of Open Access Journals (Sweden)

    Nimbalkar Namita


    Full Text Available John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self to be founded on consciousness (viz. memory, and not on the substance of either the soul or the body.

  12. John locke on personal identity

    Directory of Open Access Journals (Sweden)

    Namita Nimbalkar


    Full Text Available John Locke speaks of personal identity and survival of consciousness after death. A criterion of personal identity through time is given. Such a criterion specifies, insofar as that is possible, the necessary and sufficient conditions for the survival of persons. John Locke holds that personal identity is a matter of psychological continuity. He considered personal identity (or the self to be founded on consciousness (viz. memory, and not on the substance of either the soul or the body.

  13. The contributions of anthropology and mitochondrial DNA analysis to the identification of the human skeletal remains of the Australian outlaw Edward 'Ned' Kelly. (United States)

    Blau, S; Catelli, L; Garrone, F; Hartman, D; Romanini, C; Romero, M; Vullo, C


    This paper details the anthropological and genetic analyses that contributed to the identification of the notorious Australian outlaw ('bushranger') Edward ('Ned') Kelly. In 1880 at the age of 25, Kelly was hanged and buried at the former Melbourne Gaol in Victoria, Australia. In 1929, the remains of executed prisoners (including those of Kelly) were haphazardly disinterred following the demolition of parts of the Melbourne Gaol and haphazardly reinterred in three distinct "pits" at the Pentridge Prison. In 1999 the Pentridge Prison was sold for commercial development and subsequently in 2008 and 2009 the human remains of prisoners were recovered. A total of 41 cases of unidentified human skeletal remains from Pentridge were examined using traditional anthropological techniques. At least one representative sample from each of the remains (mostly clavicles) from all three pits was selected for DNA analysis. Comparative ante-mortem reference samples were also located. Given the antiquity and condition of remains recovered from Pentridge, and the 130 years that had passed since Kelly's execution, mitochondrial DNA analysis was chosen as a suitable DNA analysis tool to examine the Pentridge cases to assist in the inclusion or exclusion of remains as being those of Ned Kelly. Only one of the Pentridge cases (Pen14) matched the HV1/HV2 mitochondrial DNA haplotype of the reference sample. Additional anthropological analyses indicated a number of pathological features that provided support that the remains of Pen14 are those of Edward ("Ned") Kelly.

  14. The Sub-keV Atom Reflecting Analyzer (SARA) Experiment Aboard Chandrayaan-1 Mission: Instrument and Observations

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Barabash, Stas; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura


    SARA experiment aboard the first Indian lunar mission Chandrayaan-1 had the objective to explore the solar wind-lunar interaction using energetic neutral atoms (ENA) from the lunar surface as diagnostic tool. SARA consisted of an ENA imaging mass analyzer CENA (Chandrayaan-1 Energetic Neutral Analyzer) and an ion mass analyser SWIM (Solar Wind Monitor), along with a digital processing unit (DPU) which commands and controls the sensors and provides the interface to the spacecraft. Both sensors have provided excellent observational data. CENA has observed ENAs from the lunar surface and found that ~20% of the incident solar wind ions get backscattered as ENAs from the lunar surface. This is contrary to the previous assumptions of almost complete absorption of solar wind by the lunar surface. The observation is relevant for other airless bodies in the solar system.

  15. Holocene environment changes around the Sara Us River, northern China, revealed by optical dating of lacustrine-aeolian sediments (United States)

    Zhao, Hui; Sheng, Yongwei; Li, Bo; Fan, Yuxin


    The Sara Us River is located along the boundary of the Mu Us Desert and the Chinese Loess Plateau in northern China. The river has cut down through Quaternary sediments creating 70-80 m deep valleys with thick lacustrine/aeolian sequences exposed. We applied optical stimulated luminescence on sediments from a Holocene section of aeolian sand/lacustrine deposits in the top of the river valley. The dating results show that a humid period existed from 7.1 to 2.0 ka ago as evidenced by two layers of peat and lacustrine sediments. However, compared to other published Holocene sections in the Sara Us River valleys close to the section under studying, the local environment experienced very complicated changes during the Holocene. All of the sections recorded a period with drought and/or cold before the Holocene at around 13 ka, and an episode of aridity after about 2 ka ago as evidenced by the layers of aeolian sand. However, the ages of the lacustrine and peat layers in these sections are substantially different. Geomorphological analysis by digital elevation models does not support the existence of a mega lake covering the study area at 2 ka. The intricate environmental changes may have been caused by the meandering of the Sara Us River. Environmental changes also strongly affected human migration in this area, which is documented by Chinese historical records.

  16. SARA: a self-adaptive and resource-aware approach towards secure wireless ad hoc and sensor networks (United States)

    Chigan, Chunxiao; Li, Leiyuan


    Providing security is essential for mission critical Wireless Ad Hoc and Sensor Networks (WAHSN) applications. Often a highly secure mechanism inevitably consumes a rather large amount of system resources, which in turn may unintentionally cause a Security Service Denial of Service (SSDoS) attack. This paper proposes a self-adaptive resource-aware (SARA) security provisioning approach for WAHSNs. For resource scarce WAHSNs, SARA strives to provide the optimal tradeoff between the sufficient security (which is reflected by the Security Index (SI)) and the acceptable network performance degradation (which is reflected by the Performance Index (PI)). With the support of the offline optimal secure protocol selection module and the online self-adaptive security control module, SARA is capable of employing different combinations of secure protocol sets to satisfy different security need at different condition for different applications. To determine the security index SI of a secure protocol set, a heuristic cross-layer security-service mapping mechanism is presented. Furthermore, we evaluate performance index PI of a secure protocol set via simulation followed by Analysis of Variance (ANOVA). Consequently, the proposed self-adaptive security provisioning based on both SI and PI achieves the maximum overall network security services and network performance services, without causing the SSDoS attack. Furthermore, this self-adaptive mechanism is capable of switching from one secure protocol set to another while keeping similar level of security and performance, it thus provides additional security by security service hopping.

  17. Saras Cranes in Palwal District in Southern Haryana are Asking for Immediate Attention for Their Last Rescue Effort

    Directory of Open Access Journals (Sweden)

    Tirshem Kumar Kaushik


    Full Text Available Saras Cranes Grus antigone are endangered birds of open wetlands with highly worrying depletion trends being witnessed related with disappearance of marshy and shallow perennial, expansive wetlands throughout northern India. Alongside, massive hunting in 18th, 19th and 20th centuries and even today is another serious cause for their worrisome deterioration. Also, destruction of nests, eggs, fledglings and adults by aboriginals indeliberately or deliberately is causing these cranes to perish sooner than latter, completely. Now, Saras Cranes are found in limited number and domain as four populations in the entire world including India, China, Burma, South East Asia and northern Australia. The population of Indian Saras Crane is pitiably restricted to Etawa and Mainpuri districts of Uttar Pradesh. Stray birds of this species are restricted to Kanha National Park in Madhya Pradesh and in some parts of Gujarat and Assam. It is interesting to note that few pairs have been seen in Faridabad and Palwal districts in southern Haryana, India. These need to be protected and conserved.

  18. Studying the Lunar-Solar Wind Interaction with the SARA Experiment aboard the Indian Lunar Mission Chandrayaan-1

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Wieser, Martin; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura; 10.1063/1.3395916


    The first Indian lunar mission Chandrayaan-1 was launched on 22 October 2008. The Sub-keV Atom Reflecting Analyzer (SARA) instrument onboard Chandrayaan-1 consists of an energetic neutral atom (ENA) imaging mass analyzer called CENA (Chandrayaan-1 Energetic Neutrals Analyzer), and an ion-mass analyzer called SWIM (Solar wind Monitor). CENA performed the first ever experiment to study the solar wind-planetary surface interaction via detection of sputtered neutral atoms and neutralized backscattered solar wind protons in the energy range ~0.01-3.0 keV. SWIM measures solar wind ions, magnetosheath and magnetotail ions, as well as ions scattered from lunar surface in the ~0.01-15 keV energy range. The neutral atom sensor uses conversion of the incoming neutrals to positive ions, which are then analyzed via surface interaction technique. The ion mass analyzer is based on similar principle. This paper presents the SARA instrument and the first results obtained by the SWIM and CENA sensors. SARA observations suggest...

  19. Titular Tilting in John Ashbery

    DEFF Research Database (Denmark)

    Balle, Søren Hattesen


    Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production. Their occurre......Among the numerous poems published by the American poet John Ashbery since his debut in 1956 one finds a few that specifically deal with the issue of entitlement. These poems do not appear in one single of his volumes, but are disseminated throughout Ashbery’s career and production....... Their occurrence neither follows any particular plan, nor do they form part of a larger poetic or thematic whole in the volumes where they have been published. Rather, they are perhaps better characterized as “typically atypical of Ashbery’s poetry” – to put it in paradoxical terms used by John Shoptaw in his 1994...

  20. Is John Locke a democrat?

    DEFF Research Database (Denmark)

    Svensson, Palle

      Over recent years there has been a tendency to present John Locke as an equalitarian democrat (Ashcraft) and being close to the political views of the levellers (Waldron). This is not a completely new interpretation (Kendall, 1941), but contrasts with the prevalent view presented in textbooks...... (Holden, Held, Ball and Dagger) and monographs on Locke (Dunn, Parry, Marshall). In this paper a new approach to the democratic character of John Locke's political theory is suggested, as his Second Treatise is analysed with Robert A. Dahl's conceptual framework on assumptions for a democratic order...

  1. MINI John Cooper Works Convertible

    Institute of Scientific and Technical Information of China (English)


    这辆名字巨长的迷你古巴其实和MINI CooperS没什么太大区别,最大的不同点就是MINI John Cooper Works Convertible采用软顶敞篷,而动力部分则是由John Cooper Works精心调校的那台1.6L排量双涡轮增压发动机.这台发动机与MINI Challenge赛车上使用的完全相同,拥有211hp和280Nm的动力输出。

  2. TRADE instructional materials for SARA/OSHA training. Volume 2, Managers and supervisors training

    Energy Technology Data Exchange (ETDEWEB)


    This document provides instructional materials for an eight-hour training course for managers and supervisors of hazardous waste sites. It is one of three volumes of course materials TRADE is preparing to help DOE contractor training staff comply with 29 CFR 1910.120, the Occupational Health and Safety Administration (OSHA) rule that implements Title I of the Superfund Amendments and Reauthorization Act (SARA) of 1986. OSHA`s final rule for hazardous waste operators was published in the Federal Register of March 6, 1989 (54 FR 9294). Combined with the materials in Volumes I and III and with appropriate site-specific information, these materials will help DOE contractors to meet the requirements of 1910.120 (e) that ``on-site management and supervisors directly responsible for, or who supervise employees engaged in, hazardous waste operations`` receive the same initial training as that of the employees they supervise and at least eight additional hours of specialized training in managing hazardous waste operations.

  3. La difesa della donna ebrea: Sara Copio Sullam e Debora Ascarelli

    Directory of Open Access Journals (Sweden)

    Umberto Fortis


    Full Text Available Sara Copio Sullam and Debora Ascarelli, the best-known Jewish women poets of the age of the Italian ghetto, have often been studied with a focus on the distinctive features of their writing: the former as a translator of sacred texts, the latter as the author of original verses, sometimes written as a risposta per le rime (reply through rhymes or in defence of her orthodoxy. They share, however, a common theme, which has often been neglected: the defence of the Jewish woman, which is overt in some of Copio’s sonnets and prose, whereas it has not yet been properly pointed out in some of Ascarelli’s verses. This paper aims at bringing this theme to the fore not only in Copio, through a rereading of some passages of her Manifesto, but also in Debora Ascarelli, through an analysis of her few original verses. These hendecasyllables certainly reflect the Petrarchan and classicistic atmosphere of the late 16th century in Rome, but they are far from the mainstream modes of women’s poetry of the age. They allow us, therefore, to highlight, besides the differences, the similarities between the two poetesses; their commitment, in the late 16th and early 17th century, to the intellectual and moral defence of the Jewish woman, in a context of general depreciation of women, but also in the background of the claim to the “nobility and excellence of women”.

  4. John James Audubon & the Turkey (United States)

    Hinshaw, Craig


    In the first half of the 1800s, John James Audubon roamed the wilds of America attempting to draw all the birds in their natural habitat. He published his life-sized paintings in a huge book entitled "Birds of America." Audubon developed a unique system of depicting the birds in natural poses, such as flying. After shooting the bird, he would wire…

  5. John Dewey, Gothic and Modern (United States)

    Kaminsky, James S.


    It is argued here that understanding John Dewey's thought as that of a prodigal liberal or a fellow traveller does not capture the complexity of his work. It is also important to recognise the portion of his work that is "historie morale." In the very best sense it is epic, encapsulating the hopes and dreams of a history of the American people in…

  6. Dr. John Marburger visits DESY

    CERN Multimedia


    Dr. John Marburger, Director of the United States Office of Science and Technology Policy, visited the research center DESY in Hamburg. The American physicist wanted to inform himself about the status of the TESLA X-ray laser and the TESLA linear collider as well as the international collaboration at DESY (1/2 page).

  7. John Knox Stuart, accoucheur extraordinaire. (United States)

    Dow, D A


    John Knox Stuart of Glasgow epitomises the kind of 19th-century medical entrepreneur whose activities were intended to be curbed by the 1858 Medical Act. Druggist, obstetrician, builder, lecturer, poet and philanderer, his career was a chequered and eventful one.

  8. John Dewey, Gothic and Modern (United States)

    Kaminsky, James S.


    It is argued here that understanding John Dewey's thought as that of a prodigal liberal or a fellow traveller does not capture the complexity of his work. It is also important to recognise the portion of his work that is "historie morale." In the very best sense it is epic, encapsulating the hopes and dreams of a history of the American people in…

  9. An Interview with John Liontas (United States)

    Sadeghi, Karim


    John I. Liontas, Ph.D. is an associate professor of foreign languages, English for speakers of other languages (ESOL), and technology in education and second language acquisition (TESLA), and director and faculty of the TESLA doctoral program at the University of South Florida. Dr. Liontas is a distinguished thought leader, author, and…

  10. John Rawls and Affirmative Action. (United States)

    Nagel, Thomas


    Discusses the philosophy of John Rawls, asserting that although Rawls never wrote about affirmative action, his ideas are relevant to the issue. Rawls concentrated on "ideal theory," which he believed was the theory of what constituted a truly just society. He considered slavery and racial segregation paradigms of injustice. His ideal…

  11. John Milton Oskison and Assimilation (United States)

    Larre, Lionel


    John Milton Oskison (1874-1947) was a Cherokee writer, journalist, and activist and the author of novels and biographies as well as numerous short stories, essays, and articles about a great variety of subjects. Oskison thought of himself as "an interpreter to the world, of the modern, progressive Indian." The kind of representation Oskison gave…

  12. Abelprijs 2010 voor John Tate

    NARCIS (Netherlands)

    Oort, F.


    De Amerikaanse wiskundige John Tate ontving op 25 mei 2010 de Abelprijs uit handen van koning Harald V van Noorwegen. De Abelprijs bestaat sinds 2003 en wordt jaarlijks toegekend aan een zeer verdienstelijk wiskundige. Het Abelprijscomité roemt Tate vanwege de grote invloed die zijn werk heeft op de

  13. John Swales: Some Personal Reminiscences. (United States)

    Bhatia, Vijay


    The first doctoral student of linguist John Swales comments on three aspects of their advisor/advisee relationship: the relaxed atmosphere in which work was done; the collegial style of interaction; and the advisor's active participation with the student in the research process. (MSE)

  14. The Poetry of John Dewey (United States)

    Williams, Jerry L.


    This essay examines the poetry of John Dewey, 101 poems in total. Characteristic of the rhymed and metered poetry of the period, they show a very human side of Dewey. This analysis argues that many of his poems deal with existential themes--love, finitude, and God, for example. On a deeper level these poems are also show connections to Dewey's…

  15. John Webster: a personal perspective. (United States)

    Fisher, Peter J


    A personal perspective of John Webster, with an emphasis of studies of aero-aquatic hyphomycetes and the techniques pioneered to enable them to be studied, illustrated by examples particularly from the genera with helicoid conidia, Helicodendron and Helicoon, showing flotation devices.

  16. John N Bahcall (1934 2005) (United States)

    Bergström, Lars; Botner, Olga; Carlson, Per; Hulth, Per Olof; Ohlsson, Tommy


    John Norris Bahcall, passed away on August 17, 2005, in NewYork City, USA. He was born on December 30, 1934, in Shreveport, Louisiana, USA. He was Richard Black Professor of Astrophysics in the School of Natural Sciences at the Institute forAdvanced Study (IAS) in Princeton, New Jersey, USA and a recipient of the National Medal of Science. In addition, he was President of the American Astronomical Society, President-Elect of the American Physical Society, and a prominent leader of the astrophysics community. John had a long and prolific career in astronomy and astrophysics, spanning five decades and the publication of more than five hundred technical articles, books, and popular papers. John's most recognized scientific contribution was the novel proposal in 1964, together with Raymond Davis Jr, that scientific mysteries of our Sun `how it shines, how old it is, how hot it is' could be examined by measuring the number of neutrinos arriving on Earth from the Sun. Measuring the properties of these neutrinos tests both our understanding of how stars shine and our understanding of fundamental particle physics. However, in the 1960s and 1970s, the observations by Raymond Davis Jr showed a clear discrepancy between John's theoretical predictions, based on standard solar and particle physics models, and what was experimentally measured. This discrepancy, known as the `Solar Neutrino Problem', was examined by hundreds of physicists, chemists, and astronomers over the subsequent three decades. In the late 1990s through 2002, new large-scale neutrino experiments in Japan, Canada, Italy, and Russia culminated in the conclusion that the discrepancy between John's theoretical predictions and the experimental results required a modification of our understanding of particle physics: neutrinos must have a mass and `oscillate' among different particle states. In addition to neutrino astrophysics, John contributed to many areas of astrophysics including the study of dark matter in

  17. Foreword: Sir John Pendry FRS Sir John Pendry FRS (United States)

    Inglesfield, John; Echenique, Pedro


    John Pendry John Inglesfield and Pedro Echenique write: John Pendry's 65th birthday is on 4 July 2008, and this issue of the Journal of Physics: Condensed Matter is dedicated to him, with articles by friends, colleagues, and former students. By any standards, John Pendry is a great scientist, who has made—and continues to make—an enormous contribution to physics; the wide range of his interests is reflected in the scope of these articles. Not many scientists can establish a completely new and unexpected area of research, but this has been John's achievement in the last few years in the field of metamaterials, materials whose electromagnetic properties depend on their structure rather than the materials of which the structure is built. In this way, structures with effectively negative electrical permittivity and negative magnetic permeability can be constructed, demonstrating negative refraction; through metamaterials scientists now have access to properties not found in nature, and never previously explored experimentally. Never a week goes by without a potential new application of metamaterials, whether it is perfect lensing, or the cloak of invisibility. This has certainly led to tremendous visibility for John himself, with guest lectures all over the world, and radio and television appearances. John Pendry's first paper was published exactly 40 years ago, 'Analytic properties of pseudopotentials' [1], and since then he has published 310 articles at the latest count. But this first paper already reflected something of the way John works. His PhD project, with Volker Heine at the Cavendish Laboratory, was to interpret the scattering of low energy electrons from surfaces, the technique of LEED which was to become the method of choice for determining surface structure. Although the energy of the electrons in LEED is relatively low—say 50 eV—it is much higher than the energy of the conduction electrons, for which pseudopotentials had been devised, and John

  18. John Cleese kom til Nyborg

    DEFF Research Database (Denmark)

    Buhl, Rikke


    Sektion vedr. heste havde stilet højt på Dyrlægefaglig Uge og havde fået en af verdens førende dernatologer til Nyborg. Dr. Derek Knottenbelt fra University of Liverpool er en fremragende dermatolog med sin helt personlige stil, som uvilkårligt får tilhørerne til at tænke på John Cleese......Sektion vedr. heste havde stilet højt på Dyrlægefaglig Uge og havde fået en af verdens førende dernatologer til Nyborg. Dr. Derek Knottenbelt fra University of Liverpool er en fremragende dermatolog med sin helt personlige stil, som uvilkårligt får tilhørerne til at tænke på John Cleese...

  19. Overview of Johne's disease immunology

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa


    Full Text Available Johne's disease or paratuberculosis is one of the most economically important diseases of the livestock. Most of the economiclosses associated with paratuberculosis are related to decreased milk production, reduced fertility and higher rates of culling.Understanding the immunology of the disease is very important for better understanding of the interplay between the host andthe causative agent, Mycobacterium avium subsp. paratuberculosis (MAP. After uptake of MAPby macrophages residing inhost's intestinal tissue, two possible scenarios may emerge; MAP may be destroyed or may establish persistent infectionwithin the macrophages. If MAPpersists in the infected macrophage, it continuously modulates adaptive immune responsesof the animal. In this short review we describe the host-pathogen interactions in Johne's disease and highlights potentialprotective mechanisms in order for future design of more effective diagnostic method and vaccine.

  20. John Glenn Biomedical Engineering Consortium (United States)

    Nall, Marsha


    The John Glenn Biomedical Engineering Consortium is an inter-institutional research and technology development, beginning with ten projects in FY02 that are aimed at applying GRC expertise in fluid physics and sensor development with local biomedical expertise to mitigate the risks of space flight on the health, safety, and performance of astronauts. It is anticipated that several new technologies will be developed that are applicable to both medical needs in space and on earth.

  1. Mit John Dewey im Kino



    Im Jahr 1934 veröffentlicht John Dewey "Art as Experience". Im Rahmen dieser pragmatistischen Kunsttheorie versucht Dewey die verbindung zwischen Kunst und alltäglichem erleben/Erfahren ("Experience") wieder herzustellen. Zu diesem Zweck formuliert Dewey eine Rezeptionsästhetik in der die klare Trennung zwischen KünstlerIn - BetrachterIn - Kunstobjekt aufgehoben wird im Prozess des eigentlichen Kunsterlebens ("Work of Art"). In einem zweiten Schritt formuliert Dewey eine (neo-)formalistische ...

  2. Charles Darwin and John Herschel (United States)

    Warner, B.


    The influence of John Herschel on the philosophical thoughts of Charles Darwin, both through the former's book, Natural Philosophy, and through their meeting in 1836 at the Cape of Good Hope, is discussed. With Herschel having himself speculated on evolution just a few months before he met Darwin, it is probable that he stimulated at least the beginnings of the latter's lifelong work on the subject.

  3. Is John Locke a democrat?

    DEFF Research Database (Denmark)

    Svensson, Palle

    (Holden, Held, Ball and Dagger) and monographs on Locke (Dunn, Parry, Marshall). In this paper a new approach to the democratic character of John Locke's political theory is suggested, as his Second Treatise is analysed with Robert A. Dahl's conceptual framework on assumptions for a democratic order......, criteria for a democratic process, and the institutions of polyarchy. The conclusion has implications for the relationship between political liberalism and constitutionalism on the one hand and democracy on the other....

  4. John Strong - 1941-2006

    CERN Multimedia


    Our friend and colleague John Strong was cruelly taken from us by a brain tumour on 31 July, a few days before his 65th birthday. John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers. He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such h...

  5. Upper esophageal web due to a ring formed by a squamocolumnar junction with ectopic gastric mucosa (another explanation of the Paterson-Kelly, Plummer-Vinson syndrome). (United States)

    Weaver, G A


    A patient is presented with Barrett's esophagus (lower esophagus lined with columnar epithelium) who also has a band of columnar epithelium in the upper esophagus separated from that below by normal squamous epithelium in the midesophagus. The upper most squamocolumnar junction coincided with or formed a mucosal ring as seen at endoscopy. This ring, which was first seen on barium swallow, has the radiographic appearance of that associated with the Paterson-Kelly syndrome. This patient's unique findings may provide further insight into the etiology of upper esophageal webs or rings (Paterson-Kelly syndrome).

  6. Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. (United States)

    Sambanthamoorthy, Karthik; Smeltzer, Mark S; Elasri, Mohamed O


    The staphylococcal accessory regulator (sarA) plays a central role in the regulation of virulence in Staphylococcus aureus. To date, studies involving sarA have focused on its activity as a global regulator that modulates transcription of a wide variety of genes (>100) and its role in virulence. However, there is also evidence to suggest the existence of accessory elements that modulate SarA production and/or function. A reporter system was developed to identify such elements, and a new gene, msa (SA1233), mutation of which results in reduced expression of SarA, was identified and characterized. Additionally, it was shown that mutation of msa resulted in altered transcription of the accessory gene regulator (agr) and the genes encoding several virulence factors including alpha toxin (hla) and protein A (spa). However, the impact of mutating msa was different in the laboratory strain RN6390 and the clinical isolate UAMS-1. For instance, mutation of msa caused a decrease in spa and hla transcription in RN6390 but had a different effect in UAMS-1. The strain-dependent effects of the msa mutation were similar to those observed previously, which suggests that msa may modulate the production of specific virulence factors through its impact on sarA. Interestingly, sequence analysis of Msa suggests that it is a putative membrane protein with three membrane-spanning regions, indicating that Msa might interact with the environment. The findings show that msa is involved in the expression of SarA and several virulence factors.

  7. Defamiliarization in John Donne’s Poetry

    Institute of Scientific and Technical Information of China (English)



    As the representative figure of Metaphysical Poetry, John Donne’s poetry is characterized by unconventional forms, pe⁃culiar images, and abundant conceits. Though John Donne’s poems were ignored in his time, yet they have catered for the taste of modern writers and readers. This paper aims to study John Donne’s poetry in terms of Victor Shklovsky’s theory of defamiliariza⁃tion, hoping to enrich the discussions of John Donne.

  8. Decomposition and Removability Properties of John Domains

    Indian Academy of Sciences (India)

    M Huang; S Ponnusamy; X Wang


    In this paper we characterize John domains in terms of John domain decomposition property. In addition, we also show that a domain in $\\mathbb{R}^n$ is a John domain if and only if $D\\backslash P$ is a John domain, where is a subset of containing finitely many points of . The best possibility and an application of the second result are also discussed.

  9. John Dalton (1766-1844). (United States)

    Emery, A E


    There is no doubt that John Dalton ranks among the great names in science, a position which rests on his enunciation of the Atomic Theory. However, his very first scientific paper in 1798 was concerned with his own affliction of colour blindness and was in fact the first clear description of the disorder. This publication stimulated much subsequent research into the pathophysiology and genetics of the condition. His recorded observations on colour blindness are detailed and precise and betoken the approach which was to characterise all his later research in chemistry.

  10. John Donne no Brasil John Donne no Brasil

    Directory of Open Access Journals (Sweden)

    Jose Garcez Ghirardi


    Full Text Available O leitor fica sem saber a troco do que John Donne lhe surge de repente, num virar de página, e através de períodos que parecem responder a uma pergunta que não foi formulada.(... Ninguém, nem o Sr. Afrânio Coutinho falara, até então, de John Donne,(.... Simplesmente, esse trecho, como inúmeros outros (quase todos do livro, revela que leituras apaixonantes obrigaram o professor Afrânio Coutinho a tomar em seu caderno alguns apontamentos eruditos. (MARTINS 1983 vol.I: 621 A citação acima, extraída de um artigo de Wilson Martins (in O Estado de São Paulo, 25/02/54, ilustra bem a posição reservada a John Donne, até então, por aqueles que, no Brasil, se dedicavam aos estudos de literatura. “A troco do que” - perguntava o autor - deveria ser o leitor de Correntes Cruzadas confrontado com o nome de Donne? Quem, até aquele momento, dele se ocupara? Ninguém, respondia o erudito articulista (nem mesmo o Sr. Afrânio Coutinho, embora reconhecendo que o nome do poeta pudesse ter sido fonte de algumas “leituras apaixonantes” . Interessava-lhe apontar enfaticamente, porém, que a lembrança de Donne surgia de maneira gratuita, desligada de qualquer argumentação ou contexto que a preparas se ou justificasse. Não apenas Afrânio Coutinho silenciara sobre a obra de Donne em seu livro; ninguém, de fato, havia, até aquele momento, dedicado, ao poeta, qualquer atenção mais demorada. Curiosamente, o próprio artigo, assim como o livro nele discutido, atestava, no entanto, que o esquecimento do nome de Donne estava por findar.

  11. John Strong 1941-2006

    CERN Multimedia


    John started his career and obtained his PhD in a group from Westfield College, initially working on experiments at Rutherford Appleton Laboratory (RAL). From the early 1970s onwards, however, his research was focused on experiments in CERN, with several particularly notable contributions. The Omega spectrometer adopted a system John had originally developed for experiments at RAL using vidicon Cameras (a type of television camera) to record the sparks in the spark chambers. This highly automated system allowed Omega to be used in a similar way to bubble chambers.  He contributed to the success of NA1 and NA7, where he became heavily involved in the electronic trigger systems. In these experiments the Westfield group joined forces with Italian colleagues to measure the form factors of the pion and the kaon, and the lifetime of some of the newly discovered charm particles. Such has been the lasting impact of these measurements that the paper on the pion form-factor had been cited 323 times up to the time of J...

  12. John Greenleaf's life of science. (United States)

    Watenpaugh, Donald E


    This article summarizes the life and career of John E. Greenleaf, PhD. It complements an interview of Dr. Greenleaf sponsored by the American Physiological Society Living History Project found on the American Physiological Society website. Dr. Greenleaf is a "thought leader" and internationally renowned physiologist, with extensive contributions in human systems-level environmental physiology. He avoided self-aggrandizement and believed that deeds rather than words define one's legacy. Viewed another way, however, Greenleaf's words define his deeds: 48% of his 185 articles are first author works, which is an unusually high proportion for a scientist of his stature. He found that writing a thorough and thoughtful discussion section often led to novel ideas that drove future research. Beyond Greenleaf's words are the many students, postdocs, and collaborators lucky enough to have worked with him and thus learn and carry on his ways of science. His core principles included the following: avoid research "fads," embrace diversity, be the first subject in your own research, adhere to rules of fiscal responsibility, and respect administrative forces-but never back down from them when you know you are right. Greenleaf's integrity ensured he was usually right. He thrived on the axiom of many successful scientists: avoid falling in love with hypotheses, so that when unexpected findings appear, they arouse curiosity instead of fear. Dr. Greenleaf's legacy will include the John and Carol Greenleaf Award for prolific environmental and exercise-related publication in the Journal of Applied Physiology.

  13. St. John's wort - an overview. (United States)

    Linde, Klaus


    This article aims to summarize the current state of knowledge on St. John's wort (Hypericum perforatum L.) which is one of the oldest and best investigated medicinal herbs. Dried alcoholic extracts are the most important preparations on the market although a variety of other preparations are available. Depressive disorders according to modern diagnostic standards are the best known and most widely investigated indication although the more traditional, broader indication of 'psycho-vegetative disorders, depressive disorders, anxiety and/or nervous agitation', including diagnoses such as somatoform disorders, might more adequately describe what Hypericum extracts are actually used for by many practitioners. The exact mechanisms of action are still unclear, but the available research clearly shows that various bioactive constituents contribute to the clinical effects reported, often in a synergistic manner. Hypericum extracts have consistently shown activity in pharmacological models related to antidepressant effects. Randomized clinical trials show that Hypericum extracts are more effective than placebo and similarly effective as standard antidepressants while having better tolerability in the acute treatment of major depressive episodes. The most important risk associated with Hypericum extracts are interactions with other drugs. Therefore, physicians need to be informed whether their patients take St. John's wort products. If the risk of interactions is adequately taken into account, high quality Hypericum extracts are an effective and safe tool in the hand of qualified health profession-als in primary care.

  14. [Dilation of stenoses of the oral part of the esophagus in the Kelly-Paterson syndrome (Plummer-Vinson)]. (United States)

    Bohutová, J; Pokorný, M; Sram, F


    The dilatation of oesophagus oral portion in the Kelly-Paterson (Plummer Vinson) syndrome was made in two female patients at the age of 58 and 81 years. For the extreme stenosis (2 and 3 mm) of the lumen the dilatation was first performed by the Grüntzig Catheter and after extension above 5 mm special oesophageal catheters with a balloon of 15 mm diameter (Cook) were used. The dilatation proved successful in both patients. The dilatation in the K.-P. syndrome must be performed with care beginning with catheters of small diameter and narrow end with a step-wise slow filling of the balloon. A good anesthesia of upper respiratory pathways and swallowing passages is required.

  15. Cystostomie percutanée à la pince de Kelly: indications, technique et résultats (United States)

    Diabaté, Ibrahima; Ouédraogo, Bouréima; Sow, Ibrahima; Bâ, Aliou


    Introduction La dérivation urinaire sus-pubienne est pratiquée dans différentes circonstances. Cette étude vise à décrire la technique de cystostomie percutanée (CPC) pratiquée à l'aide d'une pince de Kelly pour la pose d'une sonde de Foley, à définir les indications de cette technique et à rapporter les résultats. Méthodes Du 1er janvier 2005 au 31 décembre 2014, il a été réalisé 194 CPC à la pince de Kelly dans notre service, en urgence, sous anesthésie locale, chez des patients en rétention vésicale. Cette technique, dérivée de la cystostomie par ponction au trocart vise à placer dans la vessie une sonde de Foley après incision cutanée et aponévrotique (de 1 cm sur la ligne médiane, à 1,5 - 2 cm au-dessus de la symphyse pubienne) et la ponction vésicale à la pince de Kelly à travers cette incision. Résultats Les 194 patients étaient tous de sexe masculin, âgés en moyenne de 50 ans ± 21 (extrêmes de 17 ans et 86 ans). Les pathologies à l'origine des rétentions vésicales étaient: les rétrécissements urétraux (n=119), les hypertrophies bénignes de la prostate (n=47), les cancers de prostate (n=21), les traumatismes de l'urètre (n=7). Tous les patients ont été opérés avec succès par cette méthode et les suites ont été simples. Le temps de réalisation était de 6 minutes ± 1. Les sondes de Foley mises en place étaient de charrière 16 (n=59), charrière 18 (n=116) et charrière 20 (n=19). La cicatrisation du trajet de la CPC après l'ablation de la sonde de Foley n'a posée aucun problème chez 146 patients suivis, les 48 autres ayant été perdus de vue. Conclusion La CPC à la pince de Kelly est une technique simple, rapide et pas onéreuse. Ses indications sont les mêmes que pour toute CPC et elle représente une alternative à la cystostomie par chirurgie ouverte. PMID:26893798

  16. Implications in the Theories of Lev Vygotsky, Jean Piaget, George Kelly and Erik Erikson for the Assessment of Instruction in College Reading. (United States)

    Chaplin, Miriam Thomas

    The interpretation a mature reader gleans from written language is a reflection of his linguistic, cognitive, emotional, and experiential level. In providing adequate instruction, therefore, instructors must be knowledgeable about the developmental sequences characteristic of each of these domains. The theories of L.S. Vygotsky, George Kelly, Jean…

  17. Ettevõtted : kulud kolitusele järgmisel aastal ei vähene / Kristi Sinisaar, Ülle Filin, Priit Põiklik, Kelli Toss...[jt.

    Index Scriptorium Estoniae


    Küsimusele, kas ja milliseid muudatusi plaanite järgmise aasta koolituseelarvesse, vastavad Veho Eesti personalitöötaja Kristi Sinisaar, Tele2 Eesti personalijuht Ülle Filin, Saku Õlletehase kommunikatsioonijuht Priit Põiklik, Eesti Energia koolitus- ja arendusjuht Kelli Toss ja Estraveli personalidirektor Katrin Alujev

  18. Storms, hanged pirates, anemia, exsanguination: the contributions of Monro, Kellie and Abercrombie in understanding intracranial blood circulation

    Directory of Open Access Journals (Sweden)

    Pasquale De Bonis


    Full Text Available The so-called Monro-Kellie doctrine states that with an intact skull, the sum of the volume of the brain plus the cerebrospinal fluid volume plus the intracranial blood volume is constant. Therefore an increase in one should cause a reduction in one or both of the remaining two. The researcher who expressed the doctrine in such a way was indeed Harvey Cushing in 1925, during a lecture in Edinburgh. The original Monro-Kellie doctrine is the result of observations on autopsies and several animal experiments. What the original doctrine states is a dynamic explanation of the intracranial system, aimed at explaining how a pulsatile and continuous perfusion may occur in a closed-non-expandable and fully filled system. During each cardiac cycle the quantity of blood within the head must be the same: during the systole, the brain arteries dilate, and, in the mean time, a quantity of blood, equal to that which is dilating them, is passing out of the head through the veins. During the succeeding diastole, the quantity which dilated the brain arteries passes into the corresponding veins and, at the same time, as much passes from the sinuses out of the head, as enters into the head from the arteries situated between the heart and the head. Monro implicitly states that the blood coming out from the cerebral veins into the sinuses must be pulsatile and (almost synchronous with the arteries. That is deeply different from the concept of a constant content of a rigid case, as expressed by Cushing.

  19. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation (United States)

    Godwin, Allison; Potvin, Geoff


    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  20. Impact of individual extracellular proteases on Staphylococcus aureus biofilm formation in diverse clinical isolates and their isogenic sarA mutants. (United States)

    Loughran, Allister J; Atwood, Danielle N; Anthony, Allison C; Harik, Nada S; Spencer, Horace J; Beenken, Karen E; Smeltzer, Mark S


    We demonstrate that the purified Staphylococcus aureus extracellular proteases aureolysin, ScpA, SspA, and SspB limit biofilm formation, with aureolysin having the greatest impact. Using protease-deficient derivatives of LAC, we confirmed that this is due to the individual proteases themselves. Purified aureolysin, and to a lesser extent ScpA and SspB, also promoted dispersal of an established biofilm. Mutation of the genes encoding these proteases also only partially restored biofilm formation in an FPR3757 sarA mutant and had little impact on restoring virulence in a murine bacteremia model. In contrast, eliminating the production of all of these proteases fully restored both biofilm formation and virulence in a sarA mutant generated in the closely related USA300 strain LAC. These results confirm an important role for multiple extracellular proteases in S. aureus pathogenesis and the importance of sarA in repressing their production. Moreover, purified aureolysin limited biofilm formation in 14 of 15 methicillin-resistant isolates and 11 of 15 methicillin-susceptible isolates, while dispersin B had little impact in UAMS-1, LAC, or 29 of 30 contemporary isolates of S. aureus. This suggests that the role of sarA and its impact on protease production is important in diverse strains of S. aureus irrespective of their methicillin resistance status.

  1. John Bowlby and couple psychotherapy. (United States)

    Clulow, Christopher


    The centenary of John Bowlby's birth provides a context for considering the policy, research and practice legacies that he left for practitioners working in many different fields supporting couples and families. Part historical, and part forwardlooking, this paper considers the links between attachment in the infant-parent dyad that was at the heart of Bowlby's concern and the nature of the affective ties that bind couples together in adult romantic relationships. An overview of the influence of his theory on family policy and adult attachment research is followed by an appreciation of its significance for the practice of couple psychotherapy. The paper concludes with a comment on the implications of current neuroscience knowledge for therapeutic technique.

  2. WIT Diversity Talk with John Ellis

    CERN Document Server

    CERN. Geneva; Ellis, Jonathan R.


    Sudeshna Datta Cockerill, CERN Ombudsperson, will interview John Ellis, a renown British theoretical physicist with a long career both at CERN and externally. John Ellis has also been awarded several prizes for his work in physics. Among many other outstanding roles and positions, he was Division Leader of the Theory Division at CERN from 1988-1994. John Ellis is currently Clerk Maxwell Professor of Theoretical Physics at King's College London.

  3. Eulogy John Ludbrook: surgeon, physiologist and biostatistician. (United States)

    Evans, Roger G; Johnston, Colin I


    On the morning of Friday June 9, Professor John Ludbrook died peacefully in his sleep at the age of 87. John will be deeply missed by his family, friends and colleagues. John Ludbrook had a long and distinguished career as a teacher, educator, surgeon, physiologist and lastly as a statistician. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Memoria de la guerra civil española. Entre el sol y la tormenta de Sara Berenguer

    Directory of Open Access Journals (Sweden)

    Helena López


    Full Text Available En este artículo pretendo analizar dos cuestiones en relación con las memorias de guerra de la militante anarquista Sara Berenguer. En primer lugar, quiero atender a las estrategias discursivas (clase, género, sexualidad de construcción de la subjetividad en este texto. Además, me interesa indagar cómo estos discursos se interseccionan con la posición espacio-temporal (tiempo de la memoria y tiempo-espacio del exilio del sujeto autobiográfico. Mi objetivo principal es proponer una problematización de los conceptos de “memoria colectiva” y de “experiencia femenina” y reivindicar, por lo tanto, la relevancia tanto teórica como política de análisis críticos basados en narrativas personales.

  5. Medicine in John Locke's philosophy. (United States)

    Sanchez-Gonzalez, M A


    John Locke's philosophy was deeply affected by medicine of his times. It was specially influenced by the medical thought and practice of Thomas Sydenham. Locke was a personal friend of Sydenham, expressed an avid interest in his work and shared his views and methods. The influence of Sydenham's medicine can be seen in the following areas of Locke's philosophy: his "plain historical method"; the emphasis on observation and sensory experience instead of seeking the essence of things; the rejection of hypotheses and principles; the refusal of research into final causes and inner mechanisms; the ideal of irrefutable evidence and skepticism on the possibilities of certainty in science. The science which for Locke held the highest paradigmatic value in his theory of knowledge was precisely medicine. To a great extent, Locke's Essay on Human Understanding can be understood as an attempt to justify, substantiate, and promote Sydenham's medical method. This method, generalized, was then proposed as an instrument for the elaboration of all natural sciences.

  6. A conversation with John Sulston. (United States)

    Sulston, John


    Sir John Sulston was a co-winner of the Nobel Prize for Medicine in 2002. He won the prize for his discoveries concerning "genetic regulation of organ development and programmed cell death," along with his colleagues sydney Brenner and H. Robert Horvitz. Dr. Sulston was founding director of the Sanger Centre, Cambridge, England, which he headed from 1992 to 2000. From 1993 to 2000, he led the British arm of the international team selected to work on the Human Genome Project. He is co-author of the book The Common Thread: A Story of Science, Politics, Ethics, and the Human Genome, published by Joseph Henry Press in 2002.This interview was conducted on December 20, 2002, shortly after Dr. Sulston was awarded his Nobel Prize and was originally broadcast on that date on radio station WPKN-FM in Bridgeport, Connecticut. The interview was conducted by Valerie Richardson, the Managing Editor of The Yale Journal of Biology and Medicine.Dr. Sulston has been an outspoken advocate against letting the data from the Human Genome Project become property of commercial interests that would charge the world's scientific community for its use. Since leaving the Sanger Institute, he has worked with OxFam, the Oxford Campaign for Famine Relief.

  7. A to Z with Jasper Johns (United States)

    Kirker, Sara Schmickle


    One contemporary artist that kindergarten students can easily relate to is Jasper Johns. In this article, the author discusses how she introduced John's numeric and alphabetic paintings to her kindergarten students. The young artists were amazed that art can be created from the familiar symbols that they are learning to make in their regular…

  8. John Smithi kaks palet / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-


    Näitus "John Smith. Marko ja Kaido" Tallinna Kunstihoones. Kaido Ole ja Marko Mäetamm esindavad rühmitusena "John Smith" Eestit 2003. a. Veneetsia biennaalil. Ilmunud ka kogumikus "Päevast päeva", lk. 90-96

  9. El derecho de propiedad en John Locke

    Directory of Open Access Journals (Sweden)

    Jorge Luis Toyama Miyagusuku


    Full Text Available El tema que abordaremos en esta monografía se contrae en determinar los principales aspectos de la teoría sobre el derecho de propiedad del inglés John Locke (Wrington, 1632-1704, en su obra«Segundo Ensayo sobre el GobiernoCivil».John

  10. John Brown and the Abolitionist Ministry. (United States)

    Knee, Stuart


    John Brown's death did not cause the Civil War; it precipitated the conflict. Many ministers anticipated the war and hurried its outbreak by canonizing a fanatic. By 1859, the abolitionists needed a martyr to infuse new emotion into their cause and seized upon John Brown to fill this role. (Author/GC)

  11. John of Salisbury on Aristotelian Science

    DEFF Research Database (Denmark)

    Bloch, David

    The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science.......The First substantial treatment of John of Salisbury's views on Aristotelian science. Important for our understanding of the reception of Aristotle's works and for the history of theories of science....

  12. John Smithi kaks palet / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-


    Näitus "John Smith. Marko ja Kaido" Tallinna Kunstihoones. Kaido Ole ja Marko Mäetamm esindavad rühmitusena "John Smith" Eestit 2003. a. Veneetsia biennaalil. Ilmunud ka kogumikus "Päevast päeva", lk. 90-96

  13. A to Z with Jasper Johns (United States)

    Kirker, Sara Schmickle


    One contemporary artist that kindergarten students can easily relate to is Jasper Johns. In this article, the author discusses how she introduced John's numeric and alphabetic paintings to her kindergarten students. The young artists were amazed that art can be created from the familiar symbols that they are learning to make in their regular…

  14. El derecho de propiedad en John Locke



    El tema que abordaremos en esta monografía se contrae en determinar los principales aspectos de la teoría sobre el derecho de propiedad del inglés John Locke (Wrington, 1632-1704), en su obra«Segundo Ensayo sobre el GobiernoCivil».John

  15. John Kotter on Leadership, Management and Change. (United States)

    Bencivenga, Jim


    Excerpts from interview with John Kotter, Konosuke Matsushita Professor of Leadership at the Harvard Business School, about his thoughts on the role of the superintendent as leader and manager. Describes his recent book "John P. Kotter on What Leaders Really Do," 1999. Lists eight-step change process from his book "Leading Change," 1996. (PKP)

  16. Literatura e debate pós-colonial em A história do bando de Kelly, de Peter Carey



    O escritor australiano Peter Carey promove, em seu romance True History of the Kelly Gang, cuja primeira publicação ocorreu em 2000, a reinterpretação de um período histórico e também de um personagem da época, que se tornou uma figura forte na cultura australiana. A tradução desta obra foi publicada no Brasil em 2002 com o título A história do bando de Kelly. Esta dissertação tem como objetivo analisar os efeitos que o estabelecimento de uma colônia penal causou na cultura e na literatura au...

  17. John Bahcall and the Solar Neutrino Problem (United States)

    Bahcall, Neta


    ``I feel like dancing'', cheered John Bahcall upon hearing the exciting news from the SNO experiment in 2001. The results confirmed, with remarkable accuracy, John's 40-year effort to predict the rate of neutrinos from the Sun based on sophisticated Solar models. What began in 1962 by John Bahcall and Ray Davis as a pioneering project to test and confirm how the Sun shines, quickly turned into a four-decade-long mystery of the `Solar Neutrino Problem': John's models predicted a higher rate of neutrinos than detected by Davis and follow-up experiments. Was the theory of the Sun wrong? Were John's calculations in error? Were the neutrino experiments wrong? John worked tirelessly to understand the physics behind the Solar Neutrino Problem; he led the efforts to greatly increase the accurately of the solar model, to understand its seismology and neutrino fluxes, to use the neutrino fluxes as a test for new physics, and to advocate for important new experiments. It slowly became clear that none of the then discussed possibilities --- error in the Solar model or neutrino experiments --- was the culprit. The SNO results revealed that John's calculations, and hence the theory of the Solar model, have been correct all along. Comparison of the data with John's theory demanded new physics --- neutrino oscillations. The Solar Neutrino saga is one of the most amazing scientific stories of the century: exploring a simple question of `How the Sun Shines?' led to the discovery of new physics. John's theoretical calculations are an integral part of this journey; they provide the foundation for the Solar Neutrino Problem, for confirming how the Sun shines, and for the need of neutrino oscillations. His tenacious persistence, dedication, enthusiasm and love for the project, and his leadership and advocacy of neutrino physics over many decades are a remarkable story of scientific triumph. I know John is smiling today.

  18. Feminism and Faith: Exploring Christian Spaces in the Writing of Sara Maitland and Michèle Roberts

    Directory of Open Access Journals (Sweden)



    Full Text Available En 1983, les féministes britanniques Sara Maitland et Jo Garcia ont publié Walking on the Water (London : Virago, une collection d’essais, de récits, de poèmes et de photos produits par des femmes sur le thème de la spiritualité. Les contributrices ont été en particulier invitées à explorer la relation entre leur identité féministe et leurs croyances religieuses. Le ton de ces contributions varie fortement, allant de l’envie passionnée de concilier les objectifs du féminisme avec le christianisme à un rejet total de l’Eglise comme institution patriarcale suprême. Cet article met en dialogue des récits diamétralement opposés du rapport entre christianisme et féminisme en s’intéressante plus particulièrement à deux des contributrices, Sara Maitland (1950 - et Michèle Roberts (1949 - . Ces deux écrivaines, qui se sont activement impliquées dans les mouvements féministes des années 1970, ont toutes deux lutté pour se réconcilier avec leur héritage chrétien. Néanmoins, alors que Maitland tente essentiellement de revisiter le christianisme en y incorporant les points essentiels d’une idéologie féministe, Roberts sent le besoin impérieux de se défaire de son identité religieuse afin de devenir indépendante ; en effet, dans son autobiographie Paper Houses (2007 elle décrit son éducation catholique comme “autoritaire et misogyne” (16. Cet article explore les façons dont l’identité spirituelle se construit dans le jeu complexe des interactions entre féminisme et foi. Il se propose, dans une perspective comparatiste, d’analyser d’une part le recueil de nouvelles de Sara Maitland intitulé A Book of Spells, et d’autre part, le roman acclamé de Michèle Roberts, Daughters of the House. Dans ces écrits, Maitland et Roberts ont un objectif commun qui est de renégocier la place des femmes dans l’histoire chrétienne dont elles reconnaissent – il est vrai à partir de perspectives diff

  19. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis‐dependent release of eDNA

    DEFF Research Database (Denmark)

    Christner, Martin; Heinze, Constanze; Busch, Michael;


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant‐associated infections. Nonetheless, large proportions of invasive Staphylococcus epidermidis isolates fail to form a biofilm in vitro. We here tested the hypothesis that this apparent paradox is related...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via overexpression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  20. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Diego O Andrey

    Full Text Available Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1, encoded by tst(H, and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1, RNAIII, rot, and the alternative stress sigma factor sigB (σB. By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  1. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus. (United States)

    Andrey, Diego O; Jousselin, Ambre; Villanueva, Maite; Renzoni, Adriana; Monod, Antoinette; Barras, Christine; Rodriguez, Natalia; Kelley, William L


    Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1), encoded by tst(H), and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1), RNAIII, rot, and the alternative stress sigma factor sigB (σB). By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  2. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014). Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.


    Florencia Henshaw


    This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  3. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014. Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.

    Directory of Open Access Journals (Sweden)

    Florencia Henshaw


    Full Text Available This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  4. Women Empowerment in the Realms of Institutionalized Religion and Patriarchy: El Saadawi’s Firdaus and Yezierska’s Sara as Examples

    Directory of Open Access Journals (Sweden)

    Abdullah K. Shehabat


    Full Text Available This paper explains how the two protagonists, Firdaus and Sara, successfully paved their own ways in search of self-liberation despite the authoritarian patriarchy and institutionalized religions that plagued them. El Saadawi's Woman at Point Zero and Yezierska’s Bread Givers represent the fruitful struggle these protagonists experienced as they come to forge an identity and be themselves. The paper argues that the protagonists manage to free themselves, establish their own spiritual homes at their own homes and assert the potentials of their femininity despite their endings. Empowered by the powers of reading, strong will and meticulous work, the protagonists were able to realize their own material independence and achieve their lifelong ambitions. However, through Firdaus' and Sara's journeys of breaking their silence, they were subject to different patterns of self-annihilation. While Firdaus was sentenced to death for killing a pimp, Sara embraced living under the hegemony of an authoritarian husband.      Keywords: Women empowerment, authoritarian patriarchy, institutionalized and/or gendered religion, spiritual feminist homes

  5. 2008 St. Johns County, FL Countywide Lidar (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Airborne terrestrial LiDAR was collected for St. Johns County, FL. System Parameters/Flight Plan. The LiDAR system acquisition parameters were developed based on a...

  6. the Cecil John Adams Travelling Fellowship

    African Journals Online (AJOL)


    Sep 14, 1994 ... founded the Cecil John Adams Travelling Fellowship Trust in 1945. (photograph taken .... awards have been made to 137 people. ... Dr Alexander (Sandy) A. Brown. He and Dr T. .... think of a suitable means of achieving this.

  7. John Bell and the Identical Twins

    CERN Multimedia


    A biographical profile of John S.Bell is presented based on extensive interviews the author had with Bell. Bell’s vierws on the quantum theory are presented along with a simple explanation of his idenity.

  8. St. John Shallow Water Accuracy Assessment Transects (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Benthic habitat maps of the nearshore marine environment of St. John, U.S. Virgin Islands were created by visual interpretation of remotely sensed imagery. The...

  9. The Scientific Life Of John Bahcall

    CERN Document Server

    Haxton, W C


    This article follows the scientific life of John Norris Bahcall, including his tenacious pursuit of the solar neutrino problem, his contributions to our understanding of galaxies, quasars, and their emissions, and his leadership of and advocacy for astronomy and astrophysics.

  10. Obituary: John Louis Perdrix (1926-2005) (United States)

    Orchiston, W.


    On 27 June 2005 the Journal of Astronomical History and Heritage lost its founder and Australia lost one of its leading historians of astronomy when John Louis Perdrix died in Dubai after a brief battle with cancer.

  11. John Peter Zenger, Battler for Freedom (United States)

    Wallerstein, Gerry


    Examines the freedom of the press precedent set by the John Peter Zenger case in 1743 and considers its application to such current events as the jailing of reporters for not disclosing news sources. (RB)

  12. Who made John Snow a hero? (United States)

    Vandenbroucke, J P; Eelkman Rooda, H M; Beukers, H


    This paper describes how and why John Snow's investigation of the transmission of cholera grew into an epidemiologic classic. The evolution of the interpretation of the work of John Snow was first studied in depth in the Dutch medical literature, and thereafter traced more superficially in the bacteriologic, hygienic, and epidemiologic literature of Germany, the United Kingdom, and the United States. From the oral tradition of teaching, as well as from the written sources, it is concluded that US epidemiologist W. H. Frost was responsible for the revival of the work of John Snow in the 1930s. Besides the obvious and enjoyable clarity of thinking and reasoning, epidemiologically and medically, of the writings of John Snow, his example well suited epidemiology of the 1930s since his convictions came very close to the bacteriologic paradigm of the day.

  13. 2004 St. Johns County, Florida Lidar (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset is the bare earth lidar data for St. Johns County, Florida, acquired in early January and February of 2004. This data was collected to develop...

  14. John Wheeler, relativity, and quantum information


    Misner, Charles W.; Thorne, Kip S.; Zurek, Wojciech H.


    In spring 1952, as John Wheeler neared the end of design work for the first thermonuclear explosion, he plotted a radical change of research direction: from particles and atomic nuclei to general relativity.

  15. 2004 St. Johns County, Florida Lidar (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset is the bare earth lidar data for St. Johns County, Florida, acquired in early January and February of 2004. This data was collected to develop...

  16. Johns Hopkins Particulate Matter Research Center (United States)

    Federal Laboratory Consortium — The Johns Hopkins Particulate Matter Research Center will map health risks of PM across the US based on analyses of national databases on air pollution, mortality,...

  17. Alle soglie dell'osceno. Poetiche della profanazione in Sara de Ibáñez e Alejandra Pizarnik

    Directory of Open Access Journals (Sweden)

    Luca Salvi


    Full Text Available Moving from Adorno’s statement about the enigmatic nature of modern aesthetics, this paper aims to analyse the forms the enigma takes in the works of the Uruguayan and Argentinian poets Sara de Ibáñez and Alejandra Pizarnik. The essay will consider the figures and the shapes of the enigma as they appear in both poetries. Proper of the revelation of the enigma through its profanation by the poetic language is, in fact, the never-ending and mutual reflection of two different states of the being. Through Martin Heidegger and Giorgio Agamben’s studies on language and negativity, the way in which the enigmatic word appears continuously in its constitutive suspension between infancy and adulthood, absence of time and history, language and silence, the Self and the Other will be revealed. Through the resulting dichotomy of matter and form, emerging from a passage of Agostino’s De natura boni, it will be possible, in conclusion, to recognise in the silent form of the enigma the embryonic proposal of a poetical ethics of writing.

  18. John Twysden and John Palmer: 17th-century Northamptonshire astronomers (United States)

    Frost, M. A.


    John Twysden (1607-1688) and John Palmer (1612-1679) were two astronomers in the circle of Samuel Foster (circa 1600-1652), the subject of a recent paper in this journal. John Twysden qualified in law and medicine and led a peripatetic life around England and Europe. John Palmer was Rector of Ecton, Northamptonshire and later Archdeacon of Northampton. The two astronomers catalogued observations made from Northamptonshire from the 1640s to the 1670s. In their later years Twysden and Palmer published works on a variety of topics, often astronomical. Palmer engaged in correspondence with Henry Oldenburg, the first secretary of the Royal Society, on topics in astronomy and mathematics.

  19. Obituary: John W. Firor (1927-2007) (United States)

    Gilman, Peter A.


    John W. Firor, a former Director of the High Altitude Observatory and the National Center for Atmospheric Research, and a founder of the Solar Physics Division of the American Astronomical Society, died of Alzheimer's disease in Pullman, Washington on November 5, 2007, he was 80. He was born in Athens Georgia on October 18, 1927, where his father was a professor of agricultural economics. John had an unusually diverse scientific career. His interest in physics and astrophysics began while serving in the army, during which time he was assigned to the Los Alamos National Laboratory, where he guarded highly radioactive materials (many have heard him describe how informal the protections were compared to later times). After his service he returned to college and graduated in physics from Georgia Tech in 1949. He received his Ph.D. from the University of Chicago in 1954, writing his thesis on cosmic rays under John Simpson. John Firor would later remark that: "If you needed cosmic rays to actually do anything, you are sunk." That thought, partly in jest, may help explain his motivation for moving to so many new scientific and management pursuits. John moved from cosmic ray physics to radio astronomy (particularly of the Sun) when he began work at the Carnegie Institution of Washington's Department of Terrestrial Magnetism, where he remained until 1961. During this time, he met Walter Orr Roberts, then the Director of the High Altitude Observatory (HAO) in Boulder, Colorado. HAO was then affiliated with the University of Colorado. In 1959, a movement began to upgrade the atmospheric sciences in the United States by establishing a National Center, where the largest, most important atmospheric research problems could be addressed. Roberts became the first Director of NCAR, as well as the first president of the University Corporation for Atmospheric Research (UCAR), the consortium of universities that was commissioned to manage and staff the new Center. HAO became a

  20. Muudatused õigusaktides / Kelli Ristal

    Index Scriptorium Estoniae

    Ristal, Kelli


    Ülevaade muudatustest õigusaktides: töölepingu seaduse ja sellega seonduvalt teiste seaduste muutmise seadus (RT I, 10.02.2012, 1); tolliseaduse muutmise seadus (RT I, 10.02.2012, 1); riigihangete seaduse muutmise seadus (RT I, 14.02.2012, 1) jt. Riigikohtu lahendist 3-4-1-24-11

  1. Revisiting fracture gradient: Comments on “A new approaching method to estimate fracture gradient by correcting Matthew–Kelly and Eaton's stress ratio”

    KAUST Repository

    Hakiki, Farizal


    A study performed by Marbun et al. [1] claimed that “A new methodology to predict fracture pressure from former calculations, Matthew–Kelly and Eaton are proposed.” Also, Marbun et al.\\'s paper stated that “A new value of Poisson\\'s and a stress ratio of the formation were generated and the accuracy of fracture gradient was improved.” We found those all statements are incorrect and some misleading concepts are revealed. An attempt to expose the method of fracture gradient determination from industry practice also appears to solidify that our arguments are acceptable to against improper Marbun et al.\\'s claims.

  2. Kelly Who Refreshing the JAG Recollection on the Media, the Air Force, and the First Court-Martial of Public Opinion (United States)


    Richard H. Kohn, ed., “The Early Retirement of Gen Ronald R. Fogelman, Chief of Staff, United States Air Force,” Aerospace Power Journal, Spring 2001, 10...this comment after his resignation and in response to Dr. Kohn’s question, “General Fogelman, why did you decide to ask for early retirement .” Ibid... Early Retirement of Gen Ronald R. Fogelman, Chief of Staff, United States Air Force,” Aerospace Power Journal, Spring 2001. Flinn, Kelly, Proud to Be

  3. Conceptions of Childhood in the Educational Philosophies of John Locke and John Dewey (United States)

    Bynum, Gregory Lewis


    This article compares progressive conceptions of childhood in the educational philosophies of John Locke and John Dewey. Although the lives of the two philosophers were separated by an ocean and two centuries of history, they had in common the following things: (1) a relatively high level of experience working with, and observing, children that is…

  4. Obituary: John Louis Perdrix, 1926-2005 (United States)

    Orchiston, D. Wayne


    John Perdrix, astronomical historian and co-founder of the Journal of Astronomical History and Heritage, died on 27 June 2005. John Louis Perdrix was born in Adelaide, Australia, on 30 June 1926. After studying chemistry at Melbourne Technical College and working in industry, he joined the Commonwealth Scientific and Industrial Research Organisation's Division of Minerals and Geochemistry. In 1974 the Division relocated to the Western Australian capital, Perth, and John spent the rest of his working life there involved in geochemical research. From his teenage years John had a passion for astronomy, which he fine-tuned through the Astronomical Society of Victoria and the Victorian Branch of the British Astronomical Association. He was very active in both groups, serving as President of the former and Secretary/Treasurer of the latter. He was also an FRAS, and a member of the AAS, the BAA parent body, and the IAU (Commission 41)?no mean feat for an Australian amateur astronomer. Throughout his life, he was a strong advocate of close amateur-professional relations. John's main research interest was history of astronomy, and over the years he wrote a succession of research papers, mainly about aspects of Australian astronomy. His well-researched and neatly-illustrated papers on the Melbourne Observatory and the Great Melbourne Telescope are classics, and when the Observatory's future was in the balance they played a key role in the State Government's decision to convert this unique facility into a museum precinct. To support his research activities, John built up an amazing library that developed its own distinctive personality and quickly took over his house and garage before invading commercial storage facilities! Apart from writing papers, John had an even greater passion for editing and publishing. From 1985 to 1997 he produced the Australian Journal of Astronomy, and in 1998 this was replaced by the Journal of Astronomical History and Heritage (JAH2). Both

  5. Beta-lactams interfering with PBP1 induce Panton-Valentine leukocidin expression by triggering sarA and rot global regulators of Staphylococcus aureus. (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression.

  6. β-Lactams Interfering with PBP1 Induce Panton-Valentine Leukocidin Expression by Triggering sarA and rot Global Regulators of Staphylococcus aureus ▿ (United States)

    Dumitrescu, Oana; Choudhury, Priya; Boisset, Sandrine; Badiou, Cédric; Bes, Michele; Benito, Yvonne; Wolz, Christiane; Vandenesch, François; Etienne, Jerome; Cheung, Ambrose L.; Bowden, Maria Gabriela; Lina, Gerard


    Previous articles reported that beta-lactam antibiotics increase the expression of Staphylococcus aureus Panton-Valentine leukocidin (PVL) by activating its transcription. We investigated the mechanisms underlying the inductor effect of beta-lactams on PVL expression by determining targets and regulatory pathways possibly implicated in this process. We measured PVL production in the presence of oxacillin (nonselective), imipenem (penicillin-binding protein 1 [PBP1] selective), cefotaxime (PBP2 selective), cefaclore (PBP3 selective), and cefoxitin (PBP4 selective). In vitro, we observed increased PVL production consistent with luk-PV mRNA levels that were 20 to 25 times higher for community-acquired methicillin-resistant S. aureus (CA-MRSA) cultures treated with PBP1-binding oxacillin and imipenem than for cultures treated with other beta-lactams or no antibiotic at all. This effect was also observed in vivo, with increased PVL mRNA levels in lung tissues from CA-MRSA-infected mice treated with imipenem but not cefoxitin. To confirm the involvement of PBP1 inhibition in this pathway, PBP1 depletion by use of an inducible pbp1 antisense RNA showed a dose-dependent relationship between the level of pbp1 antisense RNA and the luk-PV mRNA level. Upon imipenem treatment of exponential-phase cultures, we observed an increased sarA mRNA level after 30 min of incubation followed by a decreased rot mRNA level after 1 to 4 h of incubation. Unlike the agr and saeRS positive regulators, which were nonessential for PVL induction by beta-lactams, the sarA (positive) and rot (negative) PVL regulators were necessary for PVL induction by imipenem. Our results suggest that antibiotics binding to PBP1 increase PVL expression by modulating sarA and rot, which are essential mediators of the inductor effect of beta-lactams on PVL expression. PMID:21502633

  7. The comparison of naturally weathered oil and artificially photo-degraded oil at the molecular level by a combination of SARA fractionation and FT-ICR MS

    Energy Technology Data Exchange (ETDEWEB)

    Islam, Ananna; Cho, Yunju [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Yim, Un Hyuk; Shim, Won Joon [Oil and POPs Research Group, Korea Institute of Ocean Science and Technology, Geoje 656-834 (Korea, Republic of); Kim, Young Hwan [Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of); Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Sunghwan, E-mail: [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of)


    Highlights: • Weathered oils from the Hebei Spirit oil spill and photo degraded oils are compared. • We investigate changes of polar species at the molecular level by 15T FT-ICR MS. • Significant reduction of sulfur class compounds in saturates fraction is observed. • The relative abundance of protonated compounds (presumably basic nitrogen compounds) increase after degradation. • Changes of polar compounds occurred by natural and photo degradation are similar. -- Abstract: Two sets of oil samples, one obtained from different weathering stages of the M/V Hebei Spirit oil spill site and the other prepared by an in vitro photo-degradation experiment, were analyzed and compared at the molecular level by atmospheric pressure photo-ionization coupled with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS). For a more detailed comparison at the molecular level, the oil samples were separated into saturate, aromatic, resin, and asphaltene (SARA) fractions before MS analysis. Gravimetric analysis of the SARA fractions revealed a decreased weight percentage of the aromatic fraction and an increased resin fraction in both sets of samples. Molecular-level investigations of the SARA fractions showed a significant reduction in the S{sub 1} class in the saturate fraction and increase of S{sub 1}O{sub 1} class compounds with high DBE values in resin fraction. Levels of N{sub 1} and N{sub 1}O{sub 1} class compounds resulting in protonated ions (presumably basic nitrogen compounds) increased after degradation compared to compounds generating molecular ions (presumably non-basic nitrogen compounds). This study revealed changes occurring in heteroatom polar species of crude oils such as sulfur and nitrogen containing compounds that have not been easily detected with conventional GC based techniques.

  8. Obituary: John Leroy Climenhaga, 1916-2008 (United States)

    Scarfe, Colin


    John Leroy Climenhaga was born on 7 November 1916 on a farm some 10 km from Delisle, a small town on the Canadian prairies, located about 50 km south-west of Saskatoon, Saskatchewan, and died at his home in Victoria, British Columbia, on 27 May 2008. His parents, Reuben and Elizabeth (nee Bert) Climenhaga, were farming folk, and he carried their honest and open attitude to the world throughout his life. John was the seventh born, and last to die, of their ten children. His father also served as an ordained minister of the Brethren in Christ. In early adulthood, John worked on his father's farm, but then attended the University of Saskatchewan, obtaining a B.A. with Honors in Mathematics and Physics and an M.A. in Physics, in 1945 and 1949 respectively. Between these events he worked as a Physics Instructor at Regina College from 1946 to 1948. In 1949 Climenhaga joined the faculty of Victoria College, as one of only two physicists in a small institution that was then part of the University of British Columbia. He remained in Victoria for the rest of his career, playing a major role in the College's growth into a full-fledged university, complete with thriving graduate programs in physics and astronomy as well as in many other fields. He served as Head of the Physics Department during the 1960s, a period which saw the College become the University of Victoria, with a full undergraduate program in Physics, and campaigned successfully for the establishment of a program in Astronomy, which began in 1965. From 1969 until 1972 he held the position of Dean of Arts and Science, and championed the university's participation in the Tri-University Meson Facility, whose high-current medium-energy beam was ideal for the production and study of mesons and their physics. That period was a turbulent one in the university's history, but John's integrity and his balanced and fair-minded approach to conflicts were of immeasurable importance in steering the young institution through it

  9. John Smith - eesti kunstnik / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-


    Marko Mäetamme ja Kaido Ole kollektiivsest loomingust, mida esitatakse John Smithi autorinime all, mõnda ka salapärase J. Smithi nn. biograafiast. Illustratsiooniks J. Smith'i "Jumalate maailm I (fragment). Õli, lõuend, 2002. Erakogu

  10. John Dewey's Conundrum: Can Democratic Schools Empower? (United States)

    Shutz, Aaron


    Examines John Dewey's vision of and concerns for democratic education, arguing that his approach failed to equip students to act effectively in the world as it was (and still is) and that his model of democracy, while extremely useful, is nonetheless inadequate to serve the varied needs of students living in a diverse and contentious society. (SM)

  11. Capitalism in Six Westerns by John Ford (United States)

    Braun, Carlos Rodriguez


    The economic and institutional analysis of capitalism can be illustrated through John Ford's Westerns. This article focuses on six classics by Ford that show the move toward modern order, the creation of a new society, and the rule of law. Economic features are pervading, from property rights and contracts to markets, money, and trade. Ford has…

  12. Jean Piaget's Debt to John Dewey (United States)

    Tanner, Daniel


    Jean Piaget became a veritable institution unto himself in education and psychology, largely as the result of his developmental-stage theory advanced over the second quarter of the twentieth century. Not until Piaget was 73 did he make mention of John Dewey's work at Dewey's laboratory school, founded in 1894 at the University of Chicago. But here…

  13. Speaking Personally--With John Seely Brown (United States)

    American Journal of Distance Education, 2008


    This article presents an interview with John Seely Brown, a visiting scholar at the University of Southern California and a former chief scientist of Xerox Corporation and director of its Palo Alto Research Center (PARC)--a position he held for nearly two decades. While head of PARC, Brown expanded the role of corporate research to include such…




  15. Interview with Abel Laureate John Tate

    DEFF Research Database (Denmark)

    Raussen, Martin; Skau, Christian


    John Tate is the recipient of the 2009 Abel Prize of the Norwegian Academy of Science and Letters. This interview took place on May 25, 2010, prior to the Abel Prize celebration in Oslo, and originally appeared in the September 2010 issue of the "Newletter of the European Mathematical Society"...

  16. Jean Piaget's Debt to John Dewey (United States)

    Tanner, Daniel


    Jean Piaget became a veritable institution unto himself in education and psychology, largely as the result of his developmental-stage theory advanced over the second quarter of the twentieth century. Not until Piaget was 73 did he make mention of John Dewey's work at Dewey's laboratory school, founded in 1894 at the University of Chicago. But here…

  17. John Hull and the Money Culture (United States)

    Attfield, David


    John Hull's recent educational writings have included several on what he calls the "money culture". This is analysed and criticised in this article. Hull offers a Marxist and a neo-Marxist account of the role of money in western societies utilising the labour theory of value, false consciousness and the materialist interpretation of history. It is…

  18. El último libro de John Strachey

    Directory of Open Access Journals (Sweden)

    Helcías Martán Góngora


    Full Text Available Fue muy largo el sendero ideológico que hubo de recorrer el inglés John Strachey en la busqueda íntima de una respuesta a su inquirir constante. En su viaje interior escuchó, a la siniestra, también la voz de las sirenas socialistas.

  19. The Life and Work of John Snow (United States)

    Melville, Wayne; Fazio, Xavier


    Due to his work to determine how cholera was spread in the 18th century, John Snow (1813-1858) has been hailed as the father of modern epidemiology. This article presents an inquiry model based on his life and work, which teachers can use to develop a series of biology lessons involving the history and nature of science. The lessons presented use…

  20. John B. Watson's Legacy: Learning and Environment. (United States)

    Horowitz, Frances Degen


    Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)

  1. Bathymetry (2011) for Coral Bay, St. John (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Coral Bay, St. John in the U.S. Virgin Islands (USVI). The...

  2. John Newbery, "Friend of All Mankind." (United States)

    Hearn, Michael Patrick


    Recounts the life of John Newbery, the 18th-century London bookseller who did more than anyone to establish the children's book trade, and for whom the prestigious Newbery Award is named. States that Newbery published many books, including a line of books called the Juvenile Library, entertaining but also didactic, in the manner of the times. (PA)

  3. John Hull and the Money Culture (United States)

    Attfield, David


    John Hull's recent educational writings have included several on what he calls the "money culture". This is analysed and criticised in this article. Hull offers a Marxist and a neo-Marxist account of the role of money in western societies utilising the labour theory of value, false consciousness and the materialist interpretation of history. It is…

  4. The Life and Work of John Snow (United States)

    Melville, Wayne; Fazio, Xavier


    Due to his work to determine how cholera was spread in the 18th century, John Snow (1813-1858) has been hailed as the father of modern epidemiology. This article presents an inquiry model based on his life and work, which teachers can use to develop a series of biology lessons involving the history and nature of science. The lessons presented use…

  5. Capitalism in Six Westerns by John Ford (United States)

    Braun, Carlos Rodriguez


    The economic and institutional analysis of capitalism can be illustrated through John Ford's Westerns. This article focuses on six classics by Ford that show the move toward modern order, the creation of a new society, and the rule of law. Economic features are pervading, from property rights and contracts to markets, money, and trade. Ford has…

  6. John Dewey on Philosophy and Childhood (United States)

    Gregory, Maughn; Granger, David


    John Dewey was not a philosopher of education in the now-traditional sense of a doctor of philosophy who examines educational ends, means, and controversies through the disciplinary lenses of epistemology, ethics, and political theory, or of agenda-driven schools such as existentialism, feminism, and critical theory. Rather, Dewey was both an…

  7. John Smith - eesti kunstnik / Ants Juske

    Index Scriptorium Estoniae

    Juske, Ants, 1956-2016


    Marko Mäetamme ja Kaido Ole kollektiivsest loomingust, mida esitatakse John Smithi autorinime all, mõnda ka salapärase J. Smithi nn. biograafiast. Illustratsiooniks J. Smith'i "Jumalate maailm I (fragment). Õli, lõuend, 2002. Erakogu

  8. John Forbes (ca. 1568-1634)

    NARCIS (Netherlands)

    Jong, Christiaan George Frederik de


    This book deals sith the life and work of the Scotsman John Forbes (c.1568-1634), who studied at the University of Saint Andrews and then served as a minister of the Church of Scotland (1593-1605). During his ministy he witnessed and later became a victim of the fierce battle between the Calvinistic

  9. John Buridan's Sophismata and interval temporal semantics

    NARCIS (Netherlands)

    Uckelman, S.L.; Johnston, S.


    In this paper we look at the suitability of modern interval-based temporal logic for modeling John Buridan’s treatment of tensed sentences in his Sophismata. Building on the paper [Øhrstrøm 1984], we develop Buridan’s analysis of temporal logic, paying particular attention to his notions of negation

  10. We, John Dewey's Audience of Today (United States)

    da Cunha, Marcus Vinicius


    This article suggests that John Dewey's "Democracy and Education" does not describe education in an existing society, but it conveys a utopia, in the sense coined by Mannheim: utopian thought aims at instigating actions towards the transformation of reality, intending to attain a better world in the future. Today's readers of Dewey (his…

  11. Bathymetry (2011) for Fish Bay, St. John (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a LiDAR (Light Detection & Ranging) 0.3x0.3 meter resolution depth surface for Fish Bay, St. John in the U.S. Virgin Islands (USVI). The...

  12. John Dewey and Adult Learning in Museums (United States)

    Monk, David F.


    The objective of this article is to investigate learning in museums through the lens of John Dewey's philosophy of education and experiential learning. The influence of Dewey's philosophy of education is widespread and resounding. In this article, I examine the experiential qualities of Dewey's philosophy and compare it with the objectives of the…


    Institute of Scientific and Technical Information of China (English)



    @@ "JOHN DEERE"代表着我们的承诺,"JOHN DEERE"代表着美好的体验."JOHN DEERE"代表着我们的声誉,我们的高标准,以及推动我们公司发展的所有价值观念.创立企业的品牌形象是我们每一位成员的神圣职责的永远的追求.

  14. Triple A: la recuperación de la democracia abre instancias de investigación : Guillermo Patricio Kelly involucra al dirigente sindical Lorenzo Miguel en los crímenes de la organización paramilitar


    Kelly, Guillermo Patricio; Miguel, Lorenzo


    Radio Universidad Nacional de La Plata cubre la audiencia judicial en la que declara el dirigente sindical Lorenzo Miguel, acusado por el periodista víctima de secuestro Guillermo Patricio Kelly, de asociación ilícita en relación a la organización paramilitar Triple A. Se escucha tanto la acusación de Kelly ante el periodismo, como las declaraciones de Miguel al abandonar los tribunales. El sindicalista y titular del Partido Justicialista se desvincula de la Triple A y opina sobre la derrota ...

  15. A New Reading of Shakespeare's King John. (United States)

    Usher, Peter D.


    Shakespeare wrote King John c.1594, six years after the defeat of the Spanish Armada, and ~ 50 years after publication of the Copernican heliocentric hypothesis. It is said to be the most unhistorical of the History Plays, ``anomalous'', ``puzzling'', and ``odd'', and as such it has engendered far more than the customary range of interpretive opinion. I suggest that the play alerts Elizabethans not just to military and political threats, but to a changing cosmic world view, all especially threatening as they arise in Catholic countries. (a) Personification characterizes the play. John personifies the old order, while Arthur and the Dauphin's armies personify the new. I suggest that Shakespeare decenters King John just as Copernicus decentered the world. (b) Hubert menaces Arthur's eyes for a whole scene (4.1), but the need for such cruelty is not explained and is especially odd as Arthur is already under sentence of death (3.3.65-66). This hitherto unexplained anomaly suggests that the old order fears what the new might see. (c) Eleanor's confession is made only to Heaven and to her son the King (1.1.42-43), yet by echoing and word play the Messenger from France later reveals to John that he is privy to it (4.2.119-124). This circumstance has not been questioned heretofore. I suggest that the Messenger is like the wily Hermes (Mercury), chief communicator of the gods and patron of the sciences; by revealing that he moves in the highest circles, he tells John that he speaks with an authority that transcends even that of a king. The message from on high presages more than political change; it warns of a new cosmic and religious world order (d) Most agree that John is a weak king, so Shakespeare must have suspected flaws in the old ways. He would have known that Tycho Brahe's new star of 1572, the comet of 1577, and the 1576 model of his compatriot Thomas Digges, were shattering old ideas. (e) The tensions of the play are not resolved because in 1594 the new order was

  16. Attachment theory and John Bowlby: some reflections. (United States)

    Stevenson-Hinde, Joan


    The 100th anniversary of Edward John Mostyn Bowlby's birth (February 26th, 1907) was celebrated at the Tavistock Clinic in London by his family and colleagues, with presentations of ongoing research as well as reflections on both the person and his theory. My own reflections include the influence of ethological thinking on the development of attachment theory, Bowlby's focus on observations followed by explanation, his appreciation of emotional communication as well as behavior, and his recognition of the role of the family as well as the child/caregiver dyad. While always remaining open to new avenues of research, John Bowlby was firmly insistent on the precise use of attachment terminology, and quite rightly too!

  17. Quasiconformal Mappings and Weakly John Domains

    Institute of Scientific and Technical Information of China (English)



    @@ Let D be a bounded domain in R2 and c (≥ 1) be a constant. We say that D is a c-Johndomain if there exists x0 ∈ D such that for any x ∈ D, there must be a rectifiable curve γ C D,which joins x and x0, satisfying l(γ(x, y)) ≤ cd(y, D) for any y ∈γ, where l(γ(x, y)) denotesthe Euclidean length of the subcurve γ between x and y, d(y, D) is the Euclidean distance fromy to the boundary D of D. We say that D is a John domain if D is a c-John domain for somec (≥ 1).

  18. John Banister: an Elizabethan surgeon in Brazil. (United States)

    Mello, Amílcar D'Avila de


    In Brazil's sixteenth-century history, very few references are made to health professionals. On the expedition of Edward Fenton, dispatched by the English Crown in 1582 to set up a trading post in Asia, was the famous barber-surgeon and physician John Banister. The naval squadron, diverted from its original route to repeat the feats of Sir Francis Drake, stopped over in Africa, crossed the Atlantic and anchored off the Santa Catarina coast in Brazil. In these waters, the expedition degenerated into piracy and returned unsuccessful to Europe. John Banister is considered the person who liberated English anatomy from mediaeval slavery, shedding upon it the light of the Renaissance. It was the first time that anyone of this importance in the area of health had visited these latitudes.

  19. 65 Year Birthday Celebration's Prof. John Ellis.

    CERN Multimedia

    Benoit Jeannet


    On 13 September, physicists from around the world joined John Ellis at a colloquium to celebrate his 65th birthday, and as he ended his long career as a distinguished CERN staff member and joins King’s College London. Here he is in the audience with fellow theorists, Nobel laureate Gerard ’t Hooft and Chris Llewellyn Smith, former director-general of CERN.

  20. Speakable and unspeakable after John Bell

    CERN Document Server

    Percival, I C


    `Philosophy' was speakable for John Bell but is not for many physicists. The border between philosophy and physics is here illustrated through Brownian motion and Bell experiments. `Measurement', however, was unspeakable for Bell. His insistence that the physics of quantum measurement should not be confined to the laboratory and that physics is concerned with the big world outside leads us to examples from zoology, meteorology and cosmology.

  1. Mr.John Gong: Technology Innovation

    Institute of Scientific and Technical Information of China (English)

    Richard Zhu


    @@ From a student who traveled across the ocean to have further study in the U.S., with only 53 dollars in his pocket, to the founder of his own business in the U.S.; from studying the artificial intelligence, to manufacturing high-tech robotics products including satellite tracking system, macro wave brake system and other high tech systems.He is Mr.John Gong, Chairman of American ICP Inc.and President of To Pacific Inc.

  2. John Potts, The New Time and Space


    Murat, Jean-Christophe


    John Potts, Professor of Media at Macquarie University, Australia, is no newcomer to the domain of media studies. Some of his outstanding publications, like Radio in Australia (New South Wales University Press, 1989), Culture and Technology (with Andrew Murphie, Palgrave Macmillan, 2002) and Technologies of Magic (co-edited with Edward Scheer, Sydney: Power Publications, 2011), have established his credentials and revealed the versatility of his knowledge in the field. The New Time and Space,...

  3. STS-100 Crew Interview: John Phillips (United States)


    STS-100 Mission Specialist John Phillips is seen being interviewed. He answers questions about his inspiration to become an astronaut and his career path. He gives details on the mission's goals and significance, the rendezvous and docking of Endeavour with the International Space Station (ISS), the mission's spacewalks, and installation and capabilities of the Space Station robotic arm, UHF antenna, and Rafaello Logistics Module. Phillips then discusses his views about space exploration as it becomes an international collaboration.

  4. In Memoriam: Dr. Frank John Fenner

    Centers for Disease Control (CDC) Podcasts


    This podcast reflects on one of the greatest pioneers in virology, Dr. Frank John Fenner. Dr. Frederick Murphy, a member of EID's editorial board and the Institute of Medicine, and professor of Pathology at the University of Texas Medical Branch in Galveston, shares professional and personal stories of Dr. Frank Fenner.  Created: 4/22/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/26/2011.

  5. John J. Bergan, 1927-2014

    Directory of Open Access Journals (Sweden)

    Paolo Zamboni


    Full Text Available John Bergan was born on August 4, 1927 and graduated in Medicine at the University of Indiana in 1954. He spent the residency in surgery at the Chicago Wesley Memorial Hospital and in 1960 was certified in the American Board of Surgery. The body of his academic career took place at the North Western University in Chicago, where he devoted himself to vascular surgery and also to its applications in transplantation surgery. Scrolling through the records of the North-Western Registry, it turns out that John performed his first kidney transplant as the first operator in 1964, and was Director of the program till 1976. However, for the European phlebologist John was the ambassador of Phlébologie in the United States of America. Two were his key meetings in the field. The first was with Geza de Takats, a forerunner of the modern Phlebology, who operated for long time in Chicago. John was in strong contact with this Mentor, to the point that he wrote the obituary on Surgery in 1986, when he died. The second was the stellar conjunction with James S. T. Yao at the NorthWestern University. Together they released the first complete text-book of Phlebology in the United States, Venous Problems, at the end of the 70’s. In the 80’s, he was one of the Founding Fathers of the American Venus forum, at the famous first meeting at the hotel of Coronado, and, subsequently, President. But he also served as President the American College of Phlebology. This because was an eclectic and multi-core phlebologist, equally interested and curious about the new features in outpatient practice, as well as in cutting-edge research applied to the venous system. The last years of his academic career were actively spent in a climate much more favourable compared to Illinois, at the University of California San Diego, in La Jolla, where he continued to work and publish on veins. Few years ago Claude Franceschi and me taught venous haemodynamics, at a course organised in

  6. Obituary: John Daniel Kraus, 1910-2004 (United States)

    Kraus, John D., Jr.; Marhefka, Ronald J.


    John Daniel Kraus, 94, of Delaware, Ohio, director of the Ohio State University "Big Ear" Radio Observatory, physicist, inventor, and environmentalist died 18 July 2004 at his home in Delaware, Ohio. He was born on 28 June 1910 in Ann Arbor, Michigan. He received a Bachelor of Science in 1930, a Master of Science in 1931, and a PhD in physics in 1933 (at 23 years of age), all from the University of Michigan, Ann Arbor. During the 1930s at Michigan, he was involved in physics projects, antenna consulting, and in atomic-particle-accelerator research using the University of Michigan's premier cyclotron. Throughout the late 1920s and the 1930s, John was an avid radio amateur with call sign W8JK. He was back on the air in the 1970s. In 2001 the amateur radio magazine CQ named him to the inaugural class of its Amateur Radio Hall of Fame. He developed many widely used innovative antennas. The "8JK closely spaced array" and the "corner reflector" were among his early designs. Edwin H. Armstrong wrote John in July 1941 indicating in part, "I have read with interest your article in the Proceedings of the Institute on the corner reflector...Please let me congratulate you on a very fine piece of work." Perhaps John's most famous invention, and a product of his intuitive reasoning process, is the helical antenna, widely used in space communications, on global positioning satellites, and for other applications. During World War II, John was in Washington, DC as a civilian scientist with the U.S. Navy responsible for "degaussing" the electromagnetic fields of steel ships to make them safe from magnetic mines. He also worked on radar countermeasures at Harvard University's Radio Research Laboratory. He received the U.S. Navy Meritorious Civilian Service Award for his war work. In 1946 he took a faculty position at Ohio State University, becoming professor in 1949, and retiring in 1980 as McDougal Professor Emeritus of Electrical Engineering and Astronomy. Even so, he never retired

  7. Obituary: John J. Hillman, 1938-2006 (United States)

    Chanover, Nancy


    John J. Hillman, a dedicated NASA civil servant, spectroscopist, astrophysicist, planetary scientist, and mentor, died on February 12, 2006 of ocular melanoma at his home in Columbia, Maryland. His professional and personal interests were wide-reaching and varied, and he devoted his career to the advancement of our understanding of the beauty and wonder in the world around us. His love of nature, art, and science made him a true Renaissance man. John was born in Fort Jay, New York, on November 22, 1938, and was raised in Washington, D.C. He received his B.S., M.S., and Ph.D. degrees in Physics from American University in 1967, 1970, and 1975, respectively. He began working at NASA's Goddard Space Flight Center, then in its infancy, in 1969, juggling a full-time position as a Research Physicist, the completion of his M.S. and Ph.D. degrees, and a young family. His background in molecular spectroscopy enabled him to apply his skills to numerous disciplines within NASA: infrared and radio astronomy; electronic, vibrational, and rotational structure of interstellar molecules; solar and stellar atmospheres; and planetary atmospheres. He published more than 70 journal papers in these disciplines. He was a frequent contributor to the Ohio State University International Symposium on Molecular Spectroscopy, and possessed a rare ability to bridge the gap between laboratory and remote sensing spectroscopy, bringing scientists from different disciplines together to understand our Universe. The last fifteen years of John's career were devoted to the development of acousto-optic tunable filter (AOTF) cameras. He championed this technology as a low-cost, low-power alternative to traditional imaging cameras for in situ or remotely sensed planetary exploration. It was within this context that I got to know John, and eventually worked closely with him on the demonstration and application of this technology for planetary science using ground-based telescopes in New Mexico, California

  8. The staphylococcal accessory regulator, SarA, is an RNA-binding protein that modulates the mRNA turnover properties of late-exponential and stationary phase Staphylococcus aureus cells

    Directory of Open Access Journals (Sweden)

    John M Morrison


    Full Text Available The modulation of mRNA turnover is gaining recognition as a mechanism by which Staphylococcus aureus regulates gene expression, but the factors that orchestrate alterations in transcript degradation are poorly understood. In that regard, we previously found that 138 mRNA species, including the virulence factors protein A (spa and collagen binding protein (cna, are stabilized in a sarA-dependent manner during exponential phase growth, suggesting that SarA protein may directly or indirectly effect the RNA turnover properties of these transcripts. Herein, we expanded our characterization of the effects of sarA on mRNA turnover during late exponential and stationary phases of growth. Results revealed that the locus affects the RNA degradation properties of cells during both growth phases. Further, using gel mobility shift assays and RIP-ChIP, it was found that SarA protein is capable of binding mRNA species that it stabilizes both in vitro and within bacterial cells. Taken together, these results suggest that SarA post-transcriptionally regulates S. aureus gene expression in a manner that involves binding to and consequently altering the mRNA turnover properties of target transcripts.

  9. John Paul College: The Professional Renewal Journey

    Directory of Open Access Journals (Sweden)

    Pauline Mundie


    Full Text Available John Paul College, a K-12 School in Queensland, Australia, recognises the centrality of classroom teachers to the ongoing improvement of student outcomes. The college has implemented a multi-tiered professional renewal and assessment process. These changes of emphasis are the result of significant research and subsequent/associated professional discussion and were supported during the EBA decision-making in 2012. The professional renewal process at John Paul College guides teachers through a cycle of goal setting (related to any aspect of teacher practice which aims to improve student learning and achievement; ongoing discussion between the teacher and a mentor which determines actions; directed classroom observations (3 per term and associated pre and post reflection/discussion; leading to application of changed practice toward achieving the criteria of the goals. The principles of the professional renewal program are to:  enhance development along accepted school-wide, team and department goals;  encourage professional pedagogical reflections and conversations with a colleague/mentor;  motivate improved performance and highlight the next steps in a teacher’s development. Through the introduction of professional renewal, attestation and exemplary teacher processes, the leadership and teachers of John Paul College have achieved an appropriate and innovative balance between self-directed, peer supported/directed and college-wide, strategic initiatives. Each member of the teaching team, from graduate to senior leaders are actively engaged in personalised programs of professional growth which is specifically aimed at improved learning and outcomes of the college’s students.

  10. John Vetch and the Egyptian ophthalmia. (United States)

    Feibel, R M


    During the Napoleonic Wars from 1798-1815, severe epidemics of keratoconjunctivitis affected the military and civilian populations of Western Europe. This disease was known as the Egyptian ophthalmia because it was first described in troops stationed in Egypt. Most physicians believed this condition was not infectious, but caused by various climatological factors. John Vetch, a British physician, emphasized that this disease was spread by direct conveyance of pus from the diseased to the healthy eye. His insistence that the ophthalmia was contagious, and his suggestions for prevention and treatment were milestones in the history of ophthalmology.

  11. John Muir and “Godful” Nature

    Directory of Open Access Journals (Sweden)

    Raymond Barnett


    Full Text Available John Muir, America’s most influential conservationist, held a special view of Nature, one that treated Nature as “Godful” and “unredeemed” because, unlike humankind, Nature has not “fallen”. It is a view that asks us to adopt a gaiacentric, not anthropocentric, perspective on our place in the universe. This article explores the meaning and development of that view and how it came to define Muir’s faith and serve his noble purpose of preserving the Wilderness.

  12. The chemistry of John Dalton's color blindness. (United States)

    Hunt, D M; Dulai, K S; Bowmaker, J K; Mollon, J D


    John Dalton described his own color blindness in 1794. In common with his brother, he confused scarlet with green and pink with blue. Dalton supposed that his vitreous humor was tinted blue, selectively absorbing longer wavelengths. He instructed that his eyes should be examined after his death, but the examination revealed that the humors were perfectly clear. In experiments presented here, DNA extracted from his preserved eye tissue showed that Dalton was a deuteranope, lacking the middlewave photopigment of the retina. This diagnosis is shown to be compatible with the historical record of his phenotype, although it contradicts Thomas Young's belief that Dalton was a protanope.

  13. Part Twelve: The Voyages of John Matthias


    Printz-Påhlson, Göran


    In August 1974, when the Watergate scandal was moving into its last phase, the American poet John Matthias returned to his home, in South Bend, Indiana, after a year’s stay in England, traveling on the Polish ocean-liner Stefan Bathory. In June of 1976 he set out to sea again, this time on a Russian ship, the Mikhail Lermontov, in order to spend another year in England, as a Visiting Fellow in Poetry in Clare Hall, Cambridge. The voyages took approximately nine days each, and on both ships he...

  14. Gifts from Mary Ainsworth and John Bowlby. (United States)

    Crittenden, Patricia M


    Attachment theory has developed over many decades - and continues to develop. Its roots lie in several seminal publications of John Bowlby (the basis of attachment theory) and Mary D. S. Ainsworth (the notion of individual differences in attachment). This paper identifies the prescient contributions of these early publications and two processes (a long-term dialogue and reflection on discrepancy) that underlay emergent theory. Because I was a student of Ainsworth when both attachment theory and individual differences in attachment organization were becoming better known, I offer some of my recollections of that period, suggesting how that period may have affected current work in attachment.

  15. John Ellard Gore: of immensity and minuteness

    CERN Document Server

    Shears, Jeremy


    John Ellard Gore FRAS, MRIA (1845-1910) was an Irish amateur astronomer and prolific author of popular astronomy books. His main observational interest was variable stars, of which he discovered several, and he served as the first Director of the BAA Variable Star Section. He was also interested in binary stars, leading him to calculate orbital elements of many such systems. He demonstrated that the companion of Sirius, thought by many to be a dark body, was in fact self luminous. In doing so he provided the first indication of the immense density of what later became known as white dwarfs.

  16. The healing philosopher: John Locke's medical ethics. (United States)

    Short, Bradford William


    This article examines a heretofore unexplored facet of John Locke's philosophy. Locke was a medical doctor and he also wrote about medical issues that are controversial today. Despite this, Locke's medical ethics has yet to be studied. An analysis of Locke's education and his teachers and colleagues in the medical profession, of the 17th century Hippocratic Oath, and of the reaction to the last recorded outbreak of the bubonic plague in London, shines some light on the subject of Locke's medical ethics. The study of Locke's medical ethics confirms that he was a deontologist who opposed all suicide and abortion through much of pregnancy.

  17. John Haught on original sin: A conversation

    Directory of Open Access Journals (Sweden)

    Ernst M. Conradie


    Full Text Available This article engages with John Haught’s views on original sin. It offers a brief orientation todiscourse on sin in the context of theological debates on human evolution. This is followed bya thick description of Haught’s so-called note on original sin. A series of five observations andquestions regarding Haught’s position is offered. It is observed that Haught’s way of tellingthe story of sin and salvation follows a classic Roman Catholic plot, namely one based on graceelevating nature. This is contrasted with the more typically reformed plot of restoration.

  18. John Stuart Mill: Law, Morality, and Liberty


    Jones, H S


    Ever since the resurgence of the sub-discipline in the 1960s, the foremost achievements of the history of political thought have dealt with the early modern period. The classics of the genre—Laslett's edition of Locke, Pocock's Machiavellian Moment, Skinner's Foundations—have all dealt with that period, and it is hard to think of any works on the nineteenth century that have quite the same stature. Of all the canonical political thinkers, John Stuart Mill is perhaps the one who has proved res...

  19. The John Zink Hamworthy combustion handbook

    CERN Document Server

    Baukal, Charles E


    Despite the length of time it has been around, its importance, and vast amounts of research, combustion is still far from being completely understood. Issues regarding the environment, cost, and fuel consumption add further complexity, particularly in the process and power generation industries. Dedicated to advancing the art and science of industrial combustion, The John Zink Hamworthy Combustion Handbook, Second Edition: Volume 3 - Applications offers comprehensive, up-to-date coverage of equipment used in the process and power generation industries. Under the leadership of Charles E. Baukal

  20. Nutritional Models of Experimentally-Induced Subacute Ruminal Acidosis (SARA) Differ in Their Impact on Rumen and Hindgut Bacterial Communities in Dairy Cows (United States)

    Plaizier, Jan C.; Li, Shucong; Tun, Hein M.; Khafipour, Ehsan


    Effects of subacute ruminal acidosis (SARA) challenges on the bacteria in rumen fluid, cecal digesta, and feces of dairy cows were determined using 16S rRNA gene pyrosequencing and real-time quantitative PCR. Six non-lactating Holstein cows with cannulas in the rumen and cecum were used in a 3 × 3 Latin square arrangement of treatments. During the first 3 wk of each experimental period, cows received a control diet containing 70% forages on a dry matter (DM) basis. In wk 4 of each period, cows received one of three diets: (1) the control diet; (2) a diet in which 34% of the dietary DM was replaced with pellets of ground wheat and barley (GBSC); or (3) a diet in which 37% of dietary DM was replaced with pellets of ground alfalfa (APSC). Rumen fluid, cecal digesta and feces were collected on d 5 of wk 4 of each period and the composition of the bacterial community was studied. Rumen fermentation responses were reported in a companion study. Both SARA-inducing challenges resulted in similar digesta pH depressions (as shown by the companion study), and reduced bacterial richness and diversity in rumen fluid, but GBSC had the larger effect. None of the challenges affected these measures in cecal digesta, and only GBSC reduced bacterial richness and diversity in feces. Only GBSC reduced the abundance of Bacteroidetes in rumen fluid. Abundances of limited number of bacterial genera identified by 16S rRNA gene sequencing in the rumen, cecum and feces were affected by the GBSC. The APSC did not affect any of these abundances. Both challenges increased the abundances of several starch, pectin, xylan, dextrin, lactate, succinate, and sugar fermenting bacterial species in the rumen, cecum, and feces as determined by qPCR. Only GBSC increased that of Megasphaera elsdenii in the rumen. Both challenges decreased the abundance of Streptococcus bovis, and increased that of Escherichia coli, in cecal digesta and feces, with GBSC having the larger effect. These results showed that

  1. The Trieste Lecture of John Stewart Bell (United States)

    Bassi, Angelo; Carlo Ghirardi, Gian


    Delivered at Trieste on the occasion of the 25th Anniversary of the International Centre for Theoretical Physics, 2 November 1989 The video of this lecture is available here. Please see the PDF for the transcript of the lecture. General remarks by Angelo Bassi and GianCarlo Ghirardi During the autumn of 1989 the International Centre for Theoretical Physics, Trieste, celebrated the 25th anniversary of its creation. Among the many prestigious speakers, who delivered extremely interesting lectures on that occasion, was the late John Stewart Bell. All lectures have been recorded on tape. We succeeded in getting a copy of John's lecture. In the lecture, many of the arguments that John had lucidly stressed in his writings appear once more, but there are also extremely interesting new remarks which, to our knowledge, have not been presented elsewhere. In particular he decided, as pointed out by the very choice of the title of his lecture, to call attention to the fact that the theory presents two types of difficulties, which Dirac classified as first and second class. The former are those connected with the so-called macro-objectification problem, the latter with the divergences characterizing relativistic quantum field theories. Bell describes the precise position of Dirac on these problems and he stresses appropriately how, contrary to Dirac's hopes, the steps which have led to a partial overcoming of the second class difficulties have not helped in any way whatsoever to overcome those of the first class. He then proceeds to analyse the origin and development of the Dynamical Reduction Program and draws attention to the problems that still affect it, in particular that of a consistent relativistic generalization. When the two meetings Are there quantum jumps? and On the present status of Quantum Mechanics were organized in Trieste and Losinj (Croatia), on 5 10 September 2005, it occurred to us that this lecture, which has never been published, might represent an

  2. John Napier life, logarithms, and legacy

    CERN Document Server

    Havil, Julian


    John Napier (1550–1617) is celebrated today as the man who invented logarithms—an enormous intellectual achievement that would soon lead to the development of their mechanical equivalent in the slide rule: the two would serve humanity as the principal means of calculation until the mid-1970s. Yet, despite Napier’s pioneering efforts, his life and work have not attracted detailed modern scrutiny. John Napier is the first contemporary biography to take an in-depth look at the multiple facets of Napier’s story: his privileged position as the eighth Laird of Merchiston and the son of influential Scottish landowners; his reputation as a magician who dabbled in alchemy; his interest in agriculture; his involvement with a notorious outlaw; his staunch anti-Catholic beliefs; his interactions with such peers as Henry Briggs, Johannes Kepler, and Tycho Brahe; and, most notably, his estimable mathematical legacy. Julian Havil explores Napier’s original development of logarithms, the motivations for his approa...

  3. Translating The Infinities by John Banville

    Directory of Open Access Journals (Sweden)

    Irene Abigail Piccinini


    Full Text Available Abstract - John Banville’s talent as a prose stylist is widely recognized. The polished elegance of his phrases constitutes a continuing and fascinating challenge for his translator, due to the intricacies of the source text, its manifold registers and lexical choices. In his novel The Infinities, in Italian Teoria degli Infiniti, John Banville takes cue from Kleist’s Amphytrion to devise a novel where classicality interweaves with science and science fiction through the invention of a world where the ancient gods intermingle with the humans while waiting for the death of Adam Godley, a famous mathematician who explained how an infinity of worlds exist and interact with each other. To translate this book I had not only to work extensively on lexis and style, but also to do considerable research to render the many literary and non literary references. Some examples of these struggles with the source text during the translation process are given in the present paper. Riassunto - John Banville, autore irlandese noto per la sua prosa raffinata, scrive in una lingua che rappresenta una sfida continua e affascinante per chi lo traduce. La sua complessità stilistica, che sfrutta molteplici registri linguistici e si avvale di scelte lessicali cui spesso è arduo trovare un traducente italiano soddisfacente, costringe il traduttore a fare ricorso a tutte le sottigliezze del proprio mestiere per restituire quanto più possibile l’eleganza dell’originale nella propria lingua. Nel romanzo The Infinities, tradotto in italiano come Teoria degli infiniti (Guanda, Parma 2011, Banville prende spunto dall’Anfitrione di Kleist per costruire un romanzo che guarda alla classicità sconfinando in un misto di scienza e fantascienza con la concezione di un’infinità di mondi paralleli teorizzata dal matematico Adam Godley, il protagonista morente al cui capezzale si radunano uomini e antichi dei in attesa che il cerchio della vita e della morte si compia

  4. URobotics--Urology Robotics at Johns Hopkins. (United States)

    Stoianovici, D


    URobotics (Urology Robotics) is a program of the Urology Department at the Johns Hopkins Medical Institutions dedicated to the development of new technology for urologic surgery ( urobotics). The program is unique in that it is the only academic engineering program exclusively applied to urology. The program combines efforts and expertise from the medical and engineering fields through a close partnership of clinical and technical personnel. Since its creation in 1996, the URobotics lab has created several devices, instruments, and robotic systems, several of which have been successfully used in the operating room. This article reviews the technology developed in our laboratory and its surgical applications, and highlights our future directions.

  5. John M. Wilcox 1925”1983 (United States)

    Roberts, Walter Orr; Schatten, Kenneth Howard

    John Marsh Wilcox, Director of the Stanford Solar Observatory, died while swimming in surf in the Sea of Cortez near Puerto Penasco, Mexico, on October 14, 1983. He was 58 years old.A solar physicist specializing in the study of magnetic fields at the solar surface and in the interplanetary medium, Wilcox authored or coauthored over 100 scientific publications. Over the past decade, working with various associates, Wilcox found that there is a yet unexplained connection between the sector boundaries of the interplanetary magnetic field and the areas of strong vorticity in the circulation of the earth's atmosphere at the lower boundary of the stratosphere. The effect, though small and of changeable magnitude, is of great theoretical interest.

  6. El constitucionalismo según John Rawls

    Directory of Open Access Journals (Sweden)

    Roberto Gargarella


    Full Text Available El término “democracia” se encuentra completamente ausente del famoso libro de John Rawls, Teoría de la justicia. En Liberalismo político, en cambio, Rawls discute varios de los muchos temas sobre los que el concepto de democracia nos invita a reflexionar. En este escrito concentro mi atención en una de esas discusiones: la tensión entre constitucionalismo y democracia. Más específicamente, procuro examinar de qué modo Rawls trata de afirmar el doble compromiso que toda constitución quiere honrar, esto es, el compromiso con el ideal de la autonomía individual, y el compromiso con el ideal del auto-gobierno colectivo.

  7. General Relativity and John Archibald Wheeler

    CERN Document Server

    Ciufolini, Ignazio


    Observational and experimental data pertaining to gravity and cosmology are changing our view of the Universe. General relativity is a fundamental key for the understanding of these observations and its theory is undergoing a continuing enhancement of its intersection with observational and experimental data. These data include direct observations and experiments carried out in our solar system, among which there are direct gravitational wave astronomy, frame dragging and tests of gravitational theories from solar system and spacecraft observations. This book explores John Archibald Wheeler's seminal and enduring contributions in relativistic astrophysics and includes: the General Theory of Relativity and Wheeler's influence; recent developments in the confrontation of relativity with experiments; the theory describing gravitational radiation, and its detection in Earth-based and space-based interferometer detectors as well as in Earth-based bar detectors; the mathematical description of the initial value pro...

  8. John Locke and the right to resistance

    Directory of Open Access Journals (Sweden)

    Jovanov Ilija D.


    Full Text Available John Locke was a great thinker and many works have been devoted to clear up his theories. One of the most significant, stated in his principal work, Two Treatises of Government, is the theory of the right to resistance. It was a bit revolutionary then, and to a large extent it is today. Domination of legal positivism is negation of that, by Locke, natural right. However, the fact is that in recent times the resistance to the established power occurs in a number of countries and in different forms, so that the idea of the right to resistance becomes live question again. In this regard it is interesting to consider Locke's viewpoint on this important issue and to determine whether his theory on the resistance is applicable in modern societies.

  9. John Dewey and early Chicago functionalism. (United States)

    Backe, A


    John Dewey and James Angell are regarded respectively as the founder and systematizer of the Chicago school of functional psychology. The early Chicago school traditionally has been portrayed as a unified theoretical approach based primarily on William James's naturalist theory of mental processes. It is argued in this article that although the psychology systematized by Angell bore a close affinity to James's naturalism, Dewey's own psychology was based primarily on the neo-Hegelian philosophy of Thomas Hill Green. Through a review of a number of Dewey's major writings, Green's neo-Hegelian philosophy is shown to have influenced Dewey's views on psychological concepts such as reaction, emotion, and perception during the formative period of the Chicago school. The interpretation of Dewey's psychology developed in this article leads to the conclusion that early Chicago functionalism should not be regarded as a unified theoretical approach.

  10. John Adams and CERN: Personal Recollections

    CERN Document Server

    Brianti, Giorgio


    By any standards, John Adams had a most remarkable career. He was involved in three important, emerging technologies, radar, particle accelerators and controlled fusion, and had an outstanding impact on the last two. Without a university education, he attained hierarchical positions of the highest level in prestigious national and international organizations. This article covers the CERN part of his career, by offering some personal insights into the different facets of his contributions to major accelerator projects, from the first strong-focusing synchrotron, the PS, to the SPS and its conversion to a proton–antiproton collider. In particular, it outlines his abilities as a leader of an international collaboration, which has served as an example for international initiatives in other disciplines.

  11. John Hejduk's Pursuit of an Architectural Ethos

    DEFF Research Database (Denmark)

    Søberg, Martin


    of architectural drawing; a method which, when approached on a more general and conceptual level, might even have the potential to inform design-based architectural research today. The author argues that the conceptual framework of such a method is not a theoretical pursuit of logos, but more a matter of character......Reflected, artistic practices and design-based research are drastically expanding fields within architectural academia. However, the interest in uniting theory and practice is not entirely new. Just a few decades ago, before a ‘death of theory’ was proclaimed, questions of architectural...... epistemology, of the language(s) of architecture, were indeed of profound interest to the discipline. This essay returns to and examines the investigatory practices of John Hejduk in an attempt to identify a poetic method asserting difference through repetition and primarily grounded in the medium...

  12. John Ruskin and the Savage Gothic

    Directory of Open Access Journals (Sweden)

    Frances S. Connelly


    Full Text Available John Ruskin’s provocative theories concerning Gothic art and architecture bear serious consideration in light of the formative debates concerning “primitive” art and its relation to modern European society. Like many primitivists, Ruskin’s advocacy for the medieval was motivated by a reformist zeal concerning the state of modern industrial Europe. He differs markedly in his ideas concerning the value and uses of the "savage” Gothic for modern audiences. Ruskin rejected the random borrowing of stylistic elements, stressing instead the artisanal process and the communal role of Gothic monuments. It is also significant that Ruskin problematises the relationship between “primitive” and modern by repeatedly acknowledging his position as a modern viewer and emphasising the process through which he makes (artisan-like his interpretive history of the Gothic. Rejecting the mastering gaze, Ruskin constantly reminds readers that their view of this pre-modern work is fragmentary and disjunctive.

  13. Luhmann Receives 2007 John Adam Fleming Medal (United States)

    Russell, Christopher T.; Luhmann, Janet G.


    This year's John Adam Fleming medalist quickly established a reputation as an innovative and productive scientist with a broad range of interests. She made early and seminal contributions to aeronomy, cosmic rays, and magnetospheric and planetary physics. She contributed importantly to the understanding of the interaction of the solar wind with the atmosphere and magnetic fields of Mercury, Venus, Earth, and Mars. She has examined the behavior of planetary rings, the interaction of interstellar neutrals with heliospheric plasmas, as well as the interaction of planetary neutrals with the heliosphere. She has led in the study of the interaction of the moon Titan with the Saturn magnetosphere, and most recently she developed a vigorous solar physics effort, leading the implementation of the IMPACT particle and field package on the twin STEREO mission, now entering its second year of successful operation.

  14. John Bryant Curtis: neurosurgeon, leader and mentor. (United States)

    Lai, Leon; Kaye, Andrew H; Buckley, Penelope


    In every generation of neurosurgeons, there are those whose judgment and professional accomplishments gain distinction among their peers. Such exceptional leaders often exhibit unique talent and inevitably, they exert a lasting influence on their field of endeavour. John Bryant Curtis was one of these. Rising from humble roots, Curtis made his impact in neurosurgery starting at the age of 36. A legendary and a master neurosurgeon for his period, he became the second director of Neurosurgery at The Royal Melbourne Hospital, succeeding R. S. Hooper in 1967. Like Hooper, Curtis had undertaken a three years Fellowship in Oxford at the Radcliffe Infirmary to train under Sir Hugh Cairns in 1947. On his return to Australia in 1950, he was among the pioneers in introducing percutaneous angiography into the country, which earned him the honourable Hunterian Professorship at the Royal College of Surgeons of England in 1958. This was in recognition for his contribution to the investigation of intracranial aneurysms. Among the many neurosurgeons whom John Bryant Curtis trained at the Royal Melbourne Hospital and at the Prince Henry Hospital, he was considered, by a few, a controversial figure. Others found the experience very positive. He was a distinguished neurosurgeon with expert clinical judgment, but simultaneously a stern and formidable character who demanded only the best from his staff and trainees. He was contrastingly thoughtful and gentle to his patients. Behind every great leader, there is a personal side, often more gentle and vulnerable than the public persona. Curtis was a generous, loving, funny, although at times eccentric human being. Although he died in 1989, ironically from metastatic brain tumours, his dynamic personality and work ethic imprinted a lasting impression on those who had met him.

  15. Caruso St John y Robert Smithson: Interferencias

    Directory of Open Access Journals (Sweden)

    Emilia Hernández Pezzi


    Full Text Available Resumen Los discursos cruzados son el soporte común del presente número de Cuadernos. El cruce que planteamos tiene como protagonistas al artista Robert Smithson y a los arquitectos Adam Caruso y Peter St John. Estos últimos hacen mención del trabajo del artista norteamericano para explicar su proyecto de remodelación de Stortorget, la plaza de la catedral en el centro de Kalmar, Suecia. A partir de aquí, comenzamos una exploración del trabajo y las preocupaciones de ambos que nos permite dibujar convergencias y sintonías procesuales por encima de las diferencias temáticas, ideológicas y estilísticas. Al disponer en paralelo la obra de Smithson y Caruso St John descubrimos vibraciones y resonancias que muestran una interacción productiva de sus preocupaciones. La materia se convierte en sus propuestas en un objeto activo y sensible, un depósito energético con el que operar. El traslado de piedras en Stortorget convoca la memoria de la ciudad del mismo modo que el basalto y la sal del Spiral Jetty, erosionados por el tiempo, nos hablan de procesos abiertos. El tiempo y la memoria pasan a ser soportes estratégicos con los que construyen sus miradas. Los objetos se disuelven en las relaciones que establecen con su entorno produciendo equilibrios frágiles e instantáneos. De esta manera el artículo pretende generar un vórtice de reflexión, una espiral en cuyo recorrido se manifiesten las tensiones parciales del cruce propuesto, sus fijezas momentáneas.

  16. Acoustic development of a neonatal beluga whale (Delphinapterus leucas) at the John G. Shedd Aquarium (United States)

    Carneiro, Brooke Elizabeth

    the same adult beluga whales recorded by Melissa Kelly (2009) at the John G. Shedd Aquarium in 2008. The first recorded sound produced by the calf was a low frequency, pulsed signal which was extremely weak in amplitude and almost seven times lower in frequency compared to similar sounds from a male beluga calf born at the Vancouver Aquarium in 2002. As he grew, the calf steadily increased the complexity and adult-like characteristics in all sound types. He decreased the peak frequency of tones, but increased the peak frequency of noise and noise with tones sounds. Using analysis of variance, sounds produced during the younger age class (0 to 6 months) were significantly longer in duration than during the older age class (6 to 12 months). There was no statistical difference in peak frequency of tones or tones with noise between the two age groups. The peak frequencies of both tones and tones with noise were significantly higher during agonistic contexts compared to non-agonistic contexts. Finally, the age at which the calf was first recorded using echolocation was at about five months. Future studies on the underwater acoustic behavior of beluga whale calves are necessary to identify developmental milestones in their repertoire.

  17. From John Lee to John Gottman: Recognizing Intra- and Interpersonal Differences to Promote Marital Satisfaction

    Directory of Open Access Journals (Sweden)

    Claire Kimberly


    Full Text Available Since Extension agents work with a variety of families, there is a desperate need to further our understanding of how to educate diverse communities on a family-related topic. Focused on assisting those teaching marital education to a diverse population, this study attempts to understand how individual differences impact relationship satisfaction and marital communication. Based on John Gottman’s research on marital communication and John Lee’s six loves styles, 653 participants completed a survey to further understanding of the relationship between inter- and intrapersonal variables. Results revealed that marital communication and love styles accounted for 54.6% of the variance in marital satisfaction regardless of difference in demographics. Results of this study provide a resource for educators and practitioners to use with diverse clientele, while also emphasizing the need to understand both intra- and interpersonal variables when working with families.

  18. Obituary: John Norris Bahcall, 1934-2005 (United States)

    Striker, Jeremiah P.; Bahcall, Neta A.


    John Norris Bahcall, one of the most creative and influential astrophysicists of his generation — a scientist who helped prove what makes the Sun shine and helped make the Hubble Space Telescope a reality — passed away in Pasadena, California, on 17 August 2005. Bahcall died peacefully in his sleep from a rare blood disorder. For the past 35 years, Bahcall was the Richard Black Professor of Natural Sciences at the Institute for Advanced Study in Princeton, New Jersey, where he created one of the leading astrophysics programs in the world. Active and working to the end, Bahcall said that he was always grateful for a full and happy life that exceeded his wildest expectations. Bahcall died as he lived, surrounded by the family he loved, embracing life to its fullest, happy, working and joking to the end. Bahcall's stellar career encompassed seminal contributions in numerous fields of astrophysics as well as extraordinary leadership on behalf of the scientific community, including the American Astronomical Society, the American Physical Society, the National Academy of Sciences, NASA, and Congress. Bahcall's contributions made him one of the scientific leaders of his time. He had been recognized by numerous awards including the 1998 National Medal of Science from President Clinton, the Gold Medal of the Royal Astronomical Society, the Medal of the Swedish Royal Academy, the Dan David Award, the Fermi Award, the first Hans Bethe Prize, the Franklin Medal, the Comstock Prize in physics, NASA's Exceptional Scientific Achievement Medal, NASA's Distinguished Public Service Medal, and the top awards of the American Astronomical Society — including the Russell Award, the Heineman Prize, and the Warner Prize. Bahcall was elected to the National Academy of Sciences in 1976 and to the American Philosophical Society in 2001. He was the recipient of Honorary Degrees from numerous universities around the world. Bahcall's scientific interests and expertise ranged from neutrino

  19. 永远的草莓田--John Lennon%Forever Strawberry Field--John Lennon

    Institute of Scientific and Technical Information of China (English)


    @@ 只把John Lennon看作是甲壳虫乐队的一员是远远不够的,他和Bob Dylan还有其他一些有思想的音乐家们运用他们的声望,改变着社会和政治的状况,为促进和平作出了很大的贡献.

  20. John Stuart Mill, John Rawls y Amartya Sen, los tres nombres de la equidad

    Directory of Open Access Journals (Sweden)

    María Teresa Lopera


    Full Text Available Tres autores como John Stuart Mill, John Rawls y Amartia Sen son objeto de análisis en este artículo que estudia el tema de la equidad en un contexto que se caracteriza por el abandono casi generalizado del estudio de los valores en relación a los grandes problemas económicos; el artículo defiende como necesaria la recuperación de las preocupaciones éticas en la ciencia económica. La segunda parte, presenta una bibliografía reciente presentada como respuesta a la obra de John Rawls a partir de 1985, cuando este autor da el llamado giro desde su teoría de la justicia como equidad hacia un reciente liberalismo político, período de gran interés para comprender las discusiones actuales de la filosofía política y el futuro de la discusión interdisciplinaria con la economía.

  1. 凯莉·克莱森:我的地盘我做主%Kelly Clarkson:I MAKE THE RULES

    Institute of Scientific and Technical Information of China (English)



    凯莉·克莱森微笑着指着她的第13个新纹身——这个纹身印在她的胸前。“它靠近我的心脏,是用摩斯电码写的,意思是‘什么不会葬送我’。”她说,她认为这些纹身能够提醒自己她所经历过的一切。“我觉得这个纹身很有趣,具有讽刺意味,因为有时候我觉得现在的这份工作真的会葬送我!”,%Kelly Clarkson smiles as she points to the new tattoo--her 13th--that's drawn around the top half of her body. "It saysWhat doesn't kill you in Morse code near my heart," she says, noting her tattoos are reminders of what she'd been through. "I thought this one would be funny and ironic, because sometimes I think this job will kill me!"

  2. Pulse-Width Saturation and Kelly-Sideband Shift in a Graphene-Nanosheet Mode-Locked Fiber Laser with Weak Negative Dispersion (United States)

    Yang, Chun-Yu; Lin, Yung-Hsiang; Chi, Yu-Chieh; Wu, Chung-Lun; Lo, Jui-Yung; Lin, Gong-Ru


    The optimized soliton mode locking of the erbium-doped fiber laser (EDFL) and its pulse-shortening dynamic with the graphene nanosheet is demonstrated by precisely detuning the weakly negative group-delay dispersion (GDD) and maintaining strong self-phase-modulation (SPM), to obtain the shortest pulse width of 449 fs with a spectral linewidth of 6.02 nm. The pulse evolution with the mode-locking mechanism changing from the self-amplitude-modulation of the saturable absorber, to the soliton compression caused by the GDD and SPM is experimentally and numerically investigated in detail. Under high pumping powers, the enlarged up-chirp inside the EDFL cavity can induce a significant Kelly-sideband shift of up to 0.5 nm. The passively-mode-locked EDFL pulse width is controllable by detuning the GDD and SPM parameters, so that the pulse width can be compressed from 642 to 449 fs while reducing the negative GDD from -0.354 to -0.154 ps2 . The compression ratio can be also improved by strengthening the SPM at this stage.

  3. Perbandingan Konsepsi Epistemologi Empirisisme Ibnu Taymiyyah dan John Locke

    National Research Council Canada - National Science Library

    Rido Kurnianto


    This paper examined the epistemological empiricism conception of Ibn Taimiyyah and John Locke based on the comparative analysis to obtain the complete description of epistemological empiricism thought...

  4. PREFACE: John Desmond Bernal: Science and Society (United States)

    Casey, Vincent


    This meeting, held in the Limerick Institute of Technology, on Thursday 1 June 2006, was organised by the Munster Group of the Institute of Physics in Ireland to commemorate the life and work of John Desmond Bernal. Bernal, was born in Nenagh in 1901. Alan Mackay, who worked with Bernal at Birkbeck College coins the word 'Polytropic' to describe Bernal. He was active and hugely influential in a wide range of areas such as science, politics and society, and was instrumental in the creation of whole new areas of intellectual endeavour such as the 'science of science', molecular biology, and operations research. Andrew Brown's analogy for Bernal's mind is that 'it was like a diamond—beautifully structured, multifaceted and dazzling to behold'. In relation to Bernal, Helena Sheehan states that: 'His legacy is complex. All the more so because he was marxist in philosophy, communist in politics, polyamorous in sexuality.'. Like religion, these are areas that conventional scientists tend to shy away from or at the very least consign to very separate and often neglected 'compartments'. According to Sheehan, 'Bernal came to marxism seriously and intelligently. He found in its philosophical framework a structure in which he could live, think, create, pursue science, act politically and develop further. It opened him radically to the world, rather than closing him down or constricting him, as critics imply.'. And his contributions to science and to society are significant and enduring. Just two areas of 'his science' were addressed in some detail at this meeting. Martin Caffrey treats the area of structural biology in the context of modern developments but focusing on Bernal's role in its evolution. John Finney gives an account of Bernal's 'two bouts of activity' on the structure of water and as Bernal's last PhD student he gives unique insights on how Bernal worked and why he 'did science'. Bernal writes in response to a well wisher on his 70th birthday: 'I am sure that

  5. Breathing Silence. An interview with John Palmer

    Directory of Open Access Journals (Sweden)

    Cristina Scuderi


    Full Text Available The interview focuses on some aspects of the composer’s work with electronics. Palmer, described by the critics as «undoubtedly the most visionary composer of his generation» speaks about the composers and musical works that have had a major impact on him. He also mentions the friendship with John Cage, his numerous travels – with particular emphasis on Japan – and the influence of Eastern culture on his musical mind. The composer discusses the notion of causality explored in Renge-Kyo, the meditative nature of Transient and Inwards, and spirituality as the central theme of both acousmatic works In the Temple and I Am. The electronic medium is also por- trayed as a mirror of an intense and vivid preoccupation for intimacy and perpetual search for timbral qualities that by now characterize most of his music. Another important aspect of Palmer’s work mentioned in the interview is the collaboration with some established performers and its importance for the realization of a musical work.

  6. John Calvin – Verbi Divini Minister

    Directory of Open Access Journals (Sweden)

    P. Potgieter


    Full Text Available Ministering the Word of God was a first priority for John Calvin. Through researching his frequent references to the ministry in his sermons and Bible commentaries, it was possible to arrive at a better understanding of his views on the office of pastor and teacher (pastor et doctor. Although the ministry is no imperium, the people of God should honour the servants of Christ on the ground of the dignity of their Master. The ministry is a servitude, but not without authority, so that by it the glory of God may excel among his people and in the world. This is also the ultimate goal of the minister’s preaching, and to this end it should be clear and to the point. This article particularly pursues Calvin’s views on the requirements for a sound proclamation of the Gospel. It is argued that Calvin’s particular consideration of the broader context of a biblical passage in his exegesis points to the fact that he had already established the sound hermeneutic rule of ascertaining the intention of the author and the understanding of the first readers to get to the true meaning. Thus, in his preaching the application of Biblical truths was topical and to the point.

  7. My Teacher Mr. John C. Green

    Institute of Scientific and Technical Information of China (English)

    曹伟铭; 崔蓉


    My Treacher r. John C. Green(两篇)系英一学生完成于堂内的习作。它们与本刊已发表的英二学生的习作相比,明显地让人感到“略输文采”,然其稚嫩的文笔却显示了文通句顺的基本功。外籍教师Ian Wood通览了习作,现将其简略点评附于文后;The Power of Humour出自英三学生之手,具有相当的可读性。我们有幸请杨立义教授对它作点评,杨教授在肯定这篇习作的同时,以其素有的严谨不苟的治学精神对该习作作了7点点评,现一并发表,供广大读者参考。同时,读者也可从中了解外籍教师与中国教授审读学生习作的不同着眼点。

  8. John Dique: dialysis pioneer and political advocate. (United States)

    George, Charles R P


    John Dique (1915-1995) epitomized the internationalism of medicine, the intellectual and manual dexterity of many pioneers of dialysis, and the social concern evinced by many nephrologists. Born in Burma of French, German, British and Indian ancestry; educated in India; an Anglo-Indian who described himself as British without ever having visited Britain; he moved to Australia in 1948 to escape the murderous inter-ethnic conflict that befell multicultural India as it and Pakistan became independent. Settling in Brisbane, he pioneered several novel medical techniques. After inventing some simple equipment to facilitate intravenous therapy, he established a neonatal exchange blood transfusion programme. Then, between 1954 and 1963, he personally constructed and operated two haemodialysis machines with which to treat patients suffering from acute renal failure, the first such treatment performed in Australasia. His patients survival results were, for the era, remarkable. He subsequently helped found the Royal Australasian College of Pathologists and went on to establish a successful private pathology practice. The latter years of his life, however, saw him become a social and political advocate. He fiercely opposed the emerging ideologies of multiculturalism and social liberalism that, he predicted, would seriously damage the national fabric of Western society. Public vilification ensued, his medical achievements disregarded. It does seem likely, however, that in none of the areas that he touched - whether medical, social, or political - has the last word yet been said.

  9. A Conversation with John McKetta. (United States)

    McKetta, John J; Truskett, Thomas M


    John J. McKetta, Jr. is a foundational figure in chemical engineering education and energy policy in the United States. An authority on the thermodynamic properties of hydrocarbons and an energy adviser to several US presidents, McKetta helped to educate and mentor thousands of students at the University of Texas at Austin for over 40 years, many of whom became leading figures in the energy and petrochemical industries, as well as in academia. As dean of the College of Engineering, McKetta helped to establish a bioengineering program, which later became the Biomedical Engineering Department, at the University of Texas at Austin, and was a tireless advocate for excellence and a focus on the student. At age 100, McKetta recalls the challenges and opportunities he faced in childhood, his memories of the emergence of petrochemical engineering, and his views on chemical engineering education and the people it has impacted in the United States over the past 100 years.

  10. John Snow: the first hired gun? (United States)

    Lilienfeld, D E


    The 1854 English cholera outbreak led to reform of Victorian public health legislation, including the Nuisances Removal and Diseases Prevention Act. The reforms threatened the closure of many factories whose fumes were considered hazardous to the public's health. The second witness to appear before the Parliamentary committee considering the reforms was Dr. John Snow. Snow testified on behalf of the manufacturers threatened by the reforms. He stated that the fumes from such establishments were not hazardous. He contended that the workers in these factories did not become ill as a result of their exposures, and therefore these fumes could not be a hazard to the general public's health. Snow also presented data from the 1854 cholera outbreak as the basis for his belief that epidemic diseases were transmitted by water, not air. Although the data concerned cholera, Snow extended the inference to all epidemic diseases. When the committee's report was published, The Lancet chastised Snow in a stinging editorial. Parliament subsequently revised the bill in favor of the manufacturers and passed it into law. The implications of this particular episode in the history of epidemiology are discussed.

  11. John Snow's legacy: epidemiology without borders. (United States)

    Fine, Paul; Victora, Cesar G; Rothman, Kenneth J; Moore, Patrick S; Chang, Yuan; Curtis, Val; Heymann, David L; Slutkin, Gary; May, Robert M; Patel, Vikram; Roberts, Ian; Wortley, Richard; Torgerson, Carole; Deaton, Angus


    This Review provides abstracts from a meeting held at the London School of Hygiene and Tropical Medicine, on April 11-12, 2013, to celebrate the legacy of John Snow. They describe conventional and unconventional applications of epidemiological methods to problems ranging from diarrhoeal disease, mental health, cancer, and accident care, to education, poverty, financial networks, crime, and violence. Common themes appear throughout, including recognition of the importance of Snow's example, the philosophical and practical implications of assessment of causality, and an emphasis on the evaluation of preventive, ameliorative, and curative interventions, in a wide variety of medical and societal examples. Almost all self-described epidemiologists nowadays work within the health arena, and this is the focus of most of the societies, journals, and courses that carry the name epidemiology. The range of applications evident in these contributions might encourage some of these institutions to consider broadening their remits. In so doing, they may contribute more directly to, and learn from, non-health-related areas that use the language and methods of epidemiology to address many important problems now facing the world.

  12. John Wheeler, 1933 - 1959: Particles and Weapons (United States)

    Ford, Kenneth


    During the early part of his career, John Archibald Wheeler made an astonishing number of contributions to nuclear and particle physics, as well as to classical electrodynamics, often in collaboration with another physicist. He was also a major contributor to the Manhattan Project (in Chicago and Hanford rather than Los Alamos), and, following World War II, became an influential scientific cold warrior. His early achievements in physics include the calculated scattering of light by light (with Gregory Breit), the prediction of nuclear rotational states (with Edward Teller), the theory of fission (with Niels Bohr), action-at-a-distance electrodynamics (with Richard Feynman), the theory of positronium, the universal weak interaction (with Jayme Tiomno), and the proposed use of the muon as a nuclear probe particle. He gained modest fame as the person who identified xenon 135 as a reactor poison. His Project Matterhorn contributed significantly to the design of the H bomb, and his Project 137, which he had hoped would flower into a major defense lab, served as the precursor to the Jason group.

  13. Did John B. Watson Really "Found" Behaviorism? (United States)

    Malone, John C


    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  14. The life and works of John Napier

    CERN Document Server

    Rice, Brian; Corrigan, Alexander


    For the first time, all five of John Napier’s works have been brought together in English in a single volume, making them more accessible than ever before. His four mathematical works were originally published in Latin: two in his lifetime (1550–1617), one shortly after he died, and one over 200 years later. The authors have prepared three introductory chapters, one covering Napier himself, one his mathematical works, and one his religious work. The former has been prepared by one of Napier’s descendants and contains many new findings about Napier’s life to provide the most complete biography of this enigmatic character, whose reputation has previously been overshadowed by rumour and speculation. The latter has been written by an academic who was awarded a PhD for his thesis on Napier at the University of Edinburgh, and it provides the most lucid and coherent coverage available of this abstruse and little understood work. The chapter on Napier’s mathematical texts has been authored by an experienced...

  15. John Stuart Mill on socialism and accountability

    Directory of Open Access Journals (Sweden)

    Francisco José Sales Rocha


    Full Text Available artigo mostra que o tipo de socialismo proposto por John Stuart Mill é marcado por uma forte preocupação com a controlabilidade do poder econômico e político. Ele rejeitou enfaticamente os modelos centralistas de socialismo por entender que eles levam a uma grande concentração de poder que compromete a liberdade. Para J. S. Mill, o socialismo deve ser implantado lentamente a partir de reformas amplamente discutidas que favoreçam a cidadania econômica dos trabalhadores, promovam a participação deles nas decisões referentes ao processo produtivo e em associações voluntárias. J. S. Mill acreditava que a competição econômica é essencial para o adequado funcionamento de uma economia socialista. Ele não esperava que tal economia se tornasse uma realidade em um futuro próximo.

  16. John Beebe in conversation with Beverley Zabriskie. (United States)

    Beebe, John; Zabriskie, Beverley


    John Beebe speaks with Beverley Zabriskie about the central motifs of his life and depth psychological experience, and how these informed his choice of vocation as psychiatrist, Jungian analyst, educator and author. Dr. Beebe narrates how he moved beyond the fate assigned the son of a needy mother and abandoning father. He illustrates how the role his family expected him to fill constellated archetypal motifs--the magical or divine curative child, the whiz kid--from which he had then to disidentify for the sake of becoming an individual with a personal voice and capacity to express his own true values. He tells of his differentiation and search for completion through the perspective of Jung's psychological types theory. He also reflects on the evolution of Jungian analytic theory and practice generally, his editorship of the JAP and the San Francisco Jung Institute Library Journal, his confrontation with analytic homophobia, and the emerging quality of professional and personal relationships in relation to ethics and to love. He assesses Jung's courage and integrity as displayed through the release of Jung's Red Book, and his own quest for an organic and psychological moral stance expressed in his benchmark book, Integrity in Depth.

  17. Aculturación y diferencias en las creencias irracionales sobre el rol femenino tradicional (O'Kelly Women Beliefs Scale en mujeres colombianas residentes en su país de origen y en Estados Unidos

    Directory of Open Access Journals (Sweden)



    Full Text Available La Escala de Creencias de las Mujeres de O'Kelly (O'Kelly Women Beliefs Scale., O'Kelly, en prensa; Ellis, 1958 fue aplicada a colombianas residentes en Cali, Colombia, colombianas residentes en el noreste de los Estados Unidos y sus contrapartes estadounidenses (20 madres y 20 hijas mayores de 17" años en cada grupo. Se encontró que existen diferencias transcultu- rales en los puntajes totales de los tres grupos. Comparaciones posthoc (LSD indicaron que las diferencias significativas seencuentran en las hijas colombianas residentes en Estados Unidos, comparadas con las madres colombianas residentes en Colombia y las madres e hijas estadounidenses. No existen diferencias entre madres e hijas colombianas residentes en Estados Unidos. Los resultados sugieren que el patrón de aculturación de los colombianos en los Estados Unidos es el de asimilación al país de adopción conservando aspectos de la tradición y la cultura del país de origen.

  18. La herencia igualitarista de John Rawls

    Directory of Open Access Journals (Sweden)

    Puyol González, Ángel


    Full Text Available One of the indisputable achievements of John Rawls work has been the revitalisation of the concept of equality in the ethics and political philosophy of the last few years. He has removed it from the monopoly of the ideologies that have had better or worse luck throughout the entire twentieth century and returned it to the analytical and conceptual rigor of philosophy. Moreover, he has done so with the added virtue of harmonising the value of equality with the values of freedom and efficiency, which is an effort that is not always valued with sufficient understanding. There is no doubt about the influence of Rawls theory of justice on current egalitarian thinking that, in some way, has been, and is still being, built -following -or diverging from the wake opened by the philosopher from Harvard. In this article, I analyse the main debates that are going on about Rawlsian egalitarianism and I point out some possible future orientation. In the first place, I set out the two great egalitarian arguments in Rawls work stemming, respectively, from a person's moral conception and the moral arbitrariness of the individual' s social and natural contingencies. Afterwards, I explore the problems of both arguments insisting, on one hand, on the inadequacy of the Kantian moral personality as a foundation for an egalitarian theory and, on the other hand, on the inconsistency of luck egalitarianism as an egalitarian extension of Rawls theory. In third place, I demonstrate that the main egalitarian problem in Rawls work comes from the concept of equality and equity void of solidarity. I conclude, finally, that justice as fairness should be contrasted with justice as fraternity.

    Uno de los logros indiscutibles de la obra de John Rawls ha sido la revitalización del concepto de igualdad en la ética y la filosofía política de los últimos años, desmonopolizándolo de las ideologías que han recorrido con mejor o peor fortuna todo el siglo xx y devolvi

  19. John Frassanito &Associates: Designer for Space Travel (United States)

    Zukowsky, John


    When most people think of design for space travel they think immediately of engineers and scientists, not architects or industrial designers. Yet, one of those arts professionals has been at the center of creating "space" in space for almost four decades. John Frassanito (born 1941) is an industrial designer who trained at the Art Center (now the famous Art Center College of Design in Pasadena) in the mid 1960s. After graduation in 1968, he began his design career by working with Raymond Loewy and William Snaith at the same time that Loewy's office was designing the interiors of Skylab, America's first space station (launched 1973). Frassanito worked on Skylab while at the Loewy firm until the early 1970s, when he was hired as a designer within the Computer Terminal Corporation where, in 1972, he designed the Datapoint 2000 -- the computer that the journal Invention and Technology (Fall 1994) called the "direct ancestor of today's PC." Frassanito started his own firm in 1983, where he continued to design computers as well as products for companies such as Sani-Fresh and Scott Paper. But he has made his mark on design for space travel since the mid-1980s, where he has been an outside contractor who has worked on a variety of NASA projects through today. These include 1980s works such as interior configuration and design for Space Station Freedom, as well as concepts for inflatable TransHab structures, through 1990s computer- generated animations for NASA missions, real and conceptual. In fact, Frassanito's high quality of design and animated imaging has been consistently utilized by NASA over the past decade to present mission realities and future concepts to scientists, engineers, lawmakers, and the general public alike. A survey of his work will be the subject of this paper in an effort to document the essential role that visual arts professionals play in designing "space" for space.

  20. A Lifetime of Service: Dr. John Arthur Henschke (United States)

    Cooper, Mary


    John Henschke is a lifelong learner who studied with Malcolm Knowles and who interviewed and knew such adult educators as Cyril Houle and his contemporaries. John has devoted his life to service both in the ministry and in education; he has traveled the globe with a view to encouraging lifelong learning and the concepts of andragogy for all. His…