
Sample records for sara duff abstract

  1. Duff reaction on phenols: Characterization of non steam volatile products

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Bhattacharya, J.

    New products having structures 1 and 2 have been characterized in the Duff reaction thymol arid carvacrol. These products have been identified as 2.6'-dithymylmethane 1 and 5.5' -dicarvacryl methane 2 respectively on the basis of spectral data...

  2. Abstract

    Institute of Scientific and Technical Information of China (English)


    Cognitive Structure of Scientific Theory in the Scientist-Philosopher's Eyes、Two Theories of Scientific Abstraction Centered on Practices、Many-worlds Interpretation in Quantum Measurement and Its Meaning、Scientific Instrument: Paradigm Shift from Instrumentalism to Realism and Phenomenology

  3. Abstracts

    Institute of Scientific and Technical Information of China (English)


    [ Abstract] Interaction between China and the international system has been a highlighted is- sue and drawing a great deal of attention all over the world. It has been approached from structural point of view and in a way of a conflicting pair of self and the other, which is the prevailing ontological perspective of IR studies. Contrary to it, processual

  4. Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Western Theories of War Ethics and Contemporary Controversies Li Xiaodong U Ruijing (4) [ Abstract] In the field of international relations, war ethics is a concept with distinct westem ideological color. Due to factors of history and reality, the in

  5. Abstracts

    Institute of Scientific and Technical Information of China (English)


    China' s Dual-identity Dilemma and Its Countermeasm'es Li Shaojun(4) [ Abstract] The international system, as the overall structure for interactions among actors, is the environment and stage for implementation of China' s foreign policy. In this system, identity is a fundamental factor determining China' s international position and interests, and how to achieve them. China has long stressed that it is a "developing country,"


    Institute of Scientific and Technical Information of China (English)


    Abstract: The ethylene plant at SINOPEC Shanghai Petrochemical Company Limited ranked in the middle among SINOPEC subsidiaries in terms of ethylene and propylene yields, technical economical indicator and so on, and its performance ranking went no further in chemical sector. By means of feedstock optimization, steam optimization, and energy saving and consumption reduction, the company enhanced its competitiveness in the market and improved its efficiency. In addition, some ideas were put forward on performance improvement of the ethylene plant in the future.

  7. Abstracts

    Institute of Scientific and Technical Information of China (English)


    [ Abstract ] The global resurgence of religion and the return of religion from the so-call "Westphalia Exile" to the central stage of international religions have significantly trans- formed the viewpoints of both media and academia toward the role of religion in IR, and the challenges posed by religion to the contemporary international relations are often described as entirely subversive. The author argues that as a second-tier factor in most countries' for- eign policies and international affairs,

  8. Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Research of the Subsistent States of the Artists Living in Guilin During the Anti-Japanese Period;A Brief History of Calligraphy Art of Chongqing as Provisional Capital during the Anti-Japanese Period;The Endless Stream and Terraced Mountains:on the Analysisof Spacein Chinese Landscape Painting of Gongxian;Political Vanguard in the Perspective View of the Formalism Aesthetic: 1980s Abstract Painting in China;Comparison of the Early-Stage Spreading of Western Pre-Modem Style Painting and Its Influence in China and Japan.


    Institute of Scientific and Technical Information of China (English)


    (1) Lenin's "Unity of Three Dialectics": Notes Science of Logic and The Capital on Philosophy in the Dual Contexts of Sun Zhengyu 4 Lenin's dialectics in Notes on Philosophy is essentially a unity of materialistic logic, dialectics and epistemology that has arisen from interactions between Hegel' s Science of Logic and Marx' s The Capital. Due to a lack of understanding of Lenin' s "unity of three dialectics," people tend to misunderstand his dialectics for the meeting of two extremes of the "sum total of living instances" and "abstract methods,


    Institute of Scientific and Technical Information of China (English)


    --Based on of Marx's Economic Philosophy Manuscripts of 1844 HE Jian-jin (Philosophy Department, Fujian Provincial Committee Party School, Fuzhou, Fujian 350012, China) Abstract: Socialism with Chinese characteristics has a close relationship with the return and growth of capital in China. To implement the scientific concept of development, we must confront the problem of scientifically controlling the capital. In Economic and Philosophical Manuscripts of 1844, Marx criticized the three old philosophical thinking of treating capital: Object-oriented thinking, intuitive thinking, purely spiritual abstract thinking, and he established his own unique understanding of the capital that is to understand the capital from the human perceptual activities and practical activities. Contemporary Chinese society exist the problem of underdevelopment and abnormal development, and the three heterogeneity problems of pre-modern, modern, postmodern concurrent. In order to implement the scientific concept of development, we must reject any abstract positive or negative to modern basic principles under the guidance of the capital, against the eternal capital theory and capital theory of evil, and we must oppose the thinking that the capital is eternal or evil. Key words: socialism with Chinese characteristics; capital; national economics; scientific concept of development


    Institute of Scientific and Technical Information of China (English)


    Discussion on main hydraulic performance parameters' model acceptance test of mixed flow pump turbine YU Ji-xing, LI Jin-wei, CHEN Liu, REN Shao-cheng, JIANG Ming-li, LI Hai-ling (China Institute of Water Resources and Hydropower Research, Beijing 100038, China) Abstract: Model acceptance test content and main performance parameter' acceptance mode of mixed flow pump turbine were introduced, main hydraulic performance parameters, such as hump of pump high lift region and S unstable region during turbine starting, were discussed, after that, frequency characteristic of pressure fluctuation beside guide blade area were presented in briefly. Key words: pump turbine; model acceptance test; hump region; "S" region; pressure fluctuation


    Institute of Scientific and Technical Information of China (English)


    Spiritual Construction and Its Ideological Sources in Contemporary China The spiritual construction in contemporary China is an important ideological task proposed by the historical practice of China. Modernized development often entails the meaning of entering into " modern civilization. " Nevertheless, an abstract understanding of this civilization has covered up its essential stipulation and historical nature. China has pursued its development on a different historical prerequisite from the west, and therefore, only partially belongs to modern capitalist modernization. The practical prospects of Chinese development imply a transformation and remodeling of the general lifestyle, life attitudes and values, which inevitably calls for a new form of philosophy. The ideological sources for this new philosophy are: Chinese philosophy, Western integration of them may point to philosophy and Marxist philosophy. A creative a potentially new type of civilization.


    Institute of Scientific and Technical Information of China (English)


    On Rousseau's Equality and Freedom GONG Qun Abstract:Equality and freedom are the two core concepts of political philosophy and Rousseau~s political philosophy is no exception. Freedom and equality in Rousseau in- cludes two levels: natural state and social state under social contract, and among them, there is one state of un-equality. The relationship between the two concepts here is that equality is a necessary precondition of freedom, and that there is no equality, there is no freedom. The achievement of Rousseau~s equality is by one contractual behavior that all the members transfer their rights, especially property rights, and form of the Community. Freedom in Rousseau's mind is through the people's sovereignty in the Community to achieve freedom.


    Institute of Scientific and Technical Information of China (English)


    (1) ASEAN Security Community: Power Containment and Norm Construction --From the Perspective of Realist-Constructivism Zheng Ying-qin . 11 . Abstract:Combined of realism and constructivism, realist-constructivism emphasizes the interactions between power and identity through norms and their influence on international relations. From the perspective of realist-con- structivism, this article analyses the construction of ASEAN security community and figures out two main clues in the n of ASEAN : the containment of power system that facilitate the strategic cooperation of ASEAN and norms which promotes the cooperation. ASEAN has made achievements in security cooperation but security community. There are still lots of problems ASEAN needs to tackle, for example, to con- institution as well as to strengthen the regional economic interdependence. The possible way to pro- mote the ASEAN security community may start from the area of non-traditional security cooperation Key Wwords: ASEAN security community ; Realist-Constructivism ; power; norm


    Institute of Scientific and Technical Information of China (English)


    On the Construction of Water Conservancy during 1930s in Hubei Yu Tao ( 1 ) Abstract: Two extra-large floods in the 1930s had drawn the National Government's attention to introspect itself. After those disasters, the government had made some progress by a series of measures like repairing the dike, completing water conservancy institutions and enacting regulations in order to strengthen the water conservancy construction in Hubei. The government took water conservancy construction as a complex system project so that they had a relatively comprehensive consideration. It reflects the advancement of modern government to mobilize local people and put such social power into the unified planning. However, thelimitations of the government's policy implementation weakened the effect of water conservancy construction. Keywords: flood; government; water conservancy construction; effect

  16. Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Shift of World Center and the Change of the International System Yan Xuetong Abstract: The power transition caused by China' s rise will not only change the international configuration, but could also result in the world cen- ter shifting from Europe to Asia. However, neither a change in the interna- tional configuration nor the shift of the world center implies a change of the type of the international system. The international system is composed of three elements: international actors, international configuration and interna- tional norms. It will be neither possible to distinguish international system from its components nor clarify relations between components and system if changes in one element are treated as change of types of international system.

  17. Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Western Characteristics of the Pardims of International Studies in America:With the Huaxla System as a Counterexample Ye Zicheng (4)[ Abstract ] Three flaws are obvious in the three paradigms of International Studies in America. Specifically, their arguments are based on the assumption that the world is anarchic ; they go too far in employing the scientific and rational methodology; they pay little attention to the humans. Hence, the three paradigms of international studies in America aren' t necessarily useful for the explanation of China' s history and culture as well as its relations with the outside world. The Huaxia system, for example, is anarchic but also apparently hierarchical; the approach of pursuing security in understanding the rise of western powers may be meaningless, for the hegemony in the Huaxia System needn't worry about its security; the theory of power-balancing seemingly couldn' t explain why Qin ended up in defeating the alliance of the other six states in the Warring-states period. The Huaxia system is quite open, and has free movement of people, goods, and ideas. Some interstate regimes and institutions were formed through Huimeng (alliance-making) among states. However, this kind of limited and fragile interdependence and cooperation soon came to an end after the hegemonies of Qi, Jin and Wei. There does exit the identity problem among states in the Huaxia System, but this problem doesn't play such a great role as the constructivists expect it would.

  18. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Strategic Realism: An Option for China' s Grand Strategy Song Dexing (4) [ Abstract] As a non-Western emerging power, China should positively adapt its grand strategy to the strategic psychological traits in the 21st century, maintain a realist tone consistent with the national conditions of China, and avoid adventurist policies while awaring both strategic strength and weakness. In the 21st century, China' s grand strategy should be based on such core values as security, development, peace and justice, especially focusing on development in particular, which we named "strategic realism". Given the profound changes in China and the world, strategic realism encourages active foreign policy to safe- guard the long-term national interests of China. Following the self-help logic and the fun- damental values of security and prosperity, strategic realism concerns national interests as its top-priority. It advocates smart use of power, and aims to achieve its objectives by optimizing both domestic and international conditions. From the perspective of diplomatic phi- losophy, strategic realism is not a summarization of concrete policies but a description of China' s grand strategy orientations in the new century. [ Key Words] China, grand strategy, strategic realism [ Author]Song Dexing, Professor, Ph.D. Supervisor, and Director of the Center for International Strategic Studies, University of International Studies of PLA.


    Institute of Scientific and Technical Information of China (English)


    Discussions of Design Highlights for Tailgas Treatment in Sulphuric Acid Plant Using New Technology for Flue Gas Desulfurization Through Catalytic Reduction LI Xin , CAO Long-wen , YIN Hua-qiang , El Yue-li , LI Jian-iun ( 1 ,College of Architecture and Environment, Sichuan University, Chengdu 610065, China;2 ,Daye Nonferrous Metals Co., Ltd., Huangshi 435000, China; 3 ,Tile Sixth Construction Company Ltd. of China National Chemical Engineering Corp., Xiangfan 441021, China) Abstract : For the present situation of tailgas treatment in current sulphuric acid plants and existing problems with commonly used technologies, the fun- damental working principle, process flow and reference project for a new technology for flue gas desulfurization through catalytic redaction which is used for tailgas treatment in a sulphuric acid plant and recovery of sulphur resource are outlined. The design highlights of this technology are analyzed and the are proposed. Compared to conventional technologies, this new technology offers high desulfurization efficiency and unique technology, which can effectively tackle the difficuhies of tailgas treatment in sulphuric acid plants after enforcement of the new standard. This new technology is thought to be significant economic benefit, environmental benefit, as well as a promising future of application.

  20. Abstracts

    Institute of Scientific and Technical Information of China (English)


    [Abstract] The essay analyzed the action logic of hegemon with a power approach. Hegemony can be classified as benign or malignant. A benign hegemon should be pro- ductive, inclusive and maintain procedure justice when it uses its power. The power of hegemon can be categorized into two types: the hard power, which is the use of coer- cion and payment and can be measured by public products, and the soft power, which shows the ability to attract and co-opt and can be measured by the relationship-specific investments. The relationship between the input of public products and the relationship -specific investments is not positively correlative. Confusing with the public products and the soft power might lead to strategic misleading. A country rich in power re- sources should comply with the following principles if it wanted to improve its hard power and soft power: first, analyze the scope of the existing hegemon's soft power and avoid investing public products in the scope; second, maintain honesty in a long term and continue to increase others' benefits following the rule of neutral Pareto im- provement; third, provide both public goods and public bads; fourth, be more patient to obtain soft power. [ Key Words] hegemon, soft power, relationship-specific investment, strategic misleading [Authors]Feng Weijiang, Ph.D., Associate Professor, Institute of World Economics and Politics, Chinese Academy of Social Science; Yu Jieya, Master, PBC Shanghai Headquarters.

  1. using SARA analysis

    Directory of Open Access Journals (Sweden)

    Oscar Ramirez


    Full Text Available La solubilidad del CO2 en un crudo pesado colombiano fue calculada usando la ecuación cúbica de estado de Peng-Robinson y la correlación de Lee-Kesler. El crudo fue representado como una mezcla de pseudo-componentes y para cada uno de ellos se calcularon las propiedades termodinámicas y críticas. Los resultados obtenidos en la representación del crudo con cuatro, cinco y seis pseudocomponentes muestran que todas las representaciones producen resultados similares y por lo tanto el uso de cuatro pseudo-componentes es suficiente y tiene un costo computacional más bajo. Fueron obtenidos excelentes resultados al comparar los datos experimentales y calculados. Para este sistema es suficiente tener una completa caracterización del análisis SARA y usar cuatro pseudo-componentes para modelar adecuadamente el equilibrio líquido-vapor de CO2-crudo pesado.

  2. 2012 SARA Students Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Briccetti, Angelo [Los Alamos National Laboratory; Lorei, Nathan [Los Alamos National Laboratory; Yonkings, David [Los Alamos National Laboratory; Lorio, David [Los Alamos National Laboratory; Goorley, John T. [Los Alamos National Laboratory; Sood, Avneet [Los Alamos National Laboratory


    The Service Academy Research Associates (SARA) program provides an opportunity for Midshipmen and Cadets from US Service Academies to participate in research at Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL), and Sandia National Laboratory for several weeks during the summer as part of their summer training assignments. During the summer of 2012, three Midshipmen were assigned to work with the XCP Division at LANL for approximately 5-6 weeks. As one of the nation's top national security science laboratories, LANL stretches across 36 square miles, has over 2,100 facilities, and employs over 9,000 individuals including a significant number of students and postdocs. LANL's mission is to 'apply science and technology to: ensure the safety, security, and reliability of the US nuclear deterrent, reduce global threats, and solve other emerging national security challenges.' While LANL officially operates under the US Department of Energy (DoE), fulfilling this mission requires mutual cooperation with the US Department of Defense (DoD) as well. LANL's high concentration of knowledge and experience provides interns a chance to perform research in many disciplines, and its connection with the DoD in both operation and personnel gives SARA students insight to career possibilities both during and after military service. SARA students have plenty of opportunity to enjoy hiking, camping, the Los Alamos YMCA, and many other outdoor activities in New Mexico while staying at the Buffalo Thunder Resort, located 20 miles east of the lab. XCP Division is the Computational Physics division of LANL's Weapons Department. Working with XCP Division requires individuals to be Q cleared by the DoE. This means it is significantly more convenient for SARA students to be assigned to XCP Division than their civilian counterparts as the DoD CNWDI clearance held by SARA students is easily transferred to the lab prior to the

  3. Sharing AIS Related Anomalies (SARA) (United States)


    misconfiguration and intentional misuse. These unintended behaviours generate an abundance of anomalies that the security community has an interest in monitoring...Lastly, the feedback loop formed with clients is essential to SARA’s advancement. The more SARA is exposed, the better and faster it can be end-user needs and thus be adopted by them. This section is organised as follows : • Section 2.1 describes the strategy used to identify potential

  4. The SARA REU Site Program (United States)

    Wood, M. A.; Oswalt, T. D.; SARA Collaboration


    We present an overview of the Research Experiences for Undergraduates (REU) Site Program hosted by the Southeastern Association for Research in Astronomy (SARA) for the past 6 years. SARA is a consortium of the six universities: Florida Institute of Technology, East Tennessee State University, Florida International University, The University of Georgia, Valdosta State University, and Clemson University. We host 10-11 student interns per year out of an application pool of ~150-200. Recruiting flyers are sent to the ~3400 undergraduate institutions in the United States, and we use a web-based application form and review process. We are a distributed REU Site, but come together for group meetings at the beginning and end of the summer program and stay in contact in between using email list manager software. Interns complete a research project working one-on-one with a faculty mentor, and each intern travels to observe at the SARA Observatory at Kitt Peak National Observatory. Interns give both oral and display presentations of their results at the final group meeting. In addition, all interns write a paper for publication in the IAPPP Communications, an international amateur-professional journal, and several present at professional meetings and in refereed publications. We include in the group meetings a ``how-to'' session on giving talks and posters, an Ethics Session, and a session on Women in Astronomy. This work was supported by the NSF Research Experiences for Undergraduates (REU) Site Program through grant AST 96169939 to The Florida Institute of Technology.

  5. Particle crossing versus field crossing; a corrective response to Duff's recent account of string theory

    CERN Document Server

    Schroer, Bert


    Using recent results of advanced quantum field theory, we confute some of M. Duff's claims [arXiv:1112.0788] about string theory which he wrote as an invited paper to the project "Forty Years Of String Theory: Reflecting on the Foundations"

  6. Mixed Conifer Forest Duff Consumption during Prescribed Fires: Tree Crown Impacts

    NARCIS (Netherlands)

    Hille, M.G.; Stephens, S.L.


    Fire suppression has produced large forest floor fuel loads in many coniferous forests in western North America. This study describes spatial patterns of duff consumption in a mixed-conifer forest in the north-central Sierra Nevada, California. Overstory crown coverage was correlated to spatial patt

  7. Exon: CBRC-SARA-01-0866 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0866 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  8. Exon: CBRC-SARA-01-0862 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CCAGGGGGTCACCGGTGTCTGGGTCAGTGGGAccatctctggagtcatgcatACGGCAGTTACTTATCCCATTCACTTCTGTGCCCCCCGcatcattcaccagttcttctgtgacatcCTCCAAGTCCTCCTGCTCTAG ... ...CBRC-SARA-01-0862 atgctcatcatcaccaccacttccctggatgacagtctccagtcccccatgtatttcttcctgaa

  9. Experience with the SARA OSL method

    DEFF Research Database (Denmark)

    Mejdahl, V.; Bøtter-Jensen, L.


    on the added dose is shown. Advantages of the SARA method is discussed and results obtained using this method for 15 archaeological samples are compared with TL results. A correlation coefficient of 0.967 was found. The test also included comparison of a SARA dare with an archaeomagnetic date for a brick kiln....... Identical results were obtained (1795 +/- 20 AD and 1800 +/- 20 AD, respectively). Similarly. SARA results for 14 sediments are compared with results obtained by TL and IRSL (multiple aliquots)and here the resulting correlation coefficient was 0.983. (C) 1997 Elsevier Science Ltd....

  10. Litter and duff bulk densities in the southern United States; Joint Fire Science Program Project #04-2-1-49 (United States)

    US Fish and Wildlife Service, Department of the Interior — The organic layer (i.e., litter and duff) can represent the majority of the fuels in southeastern forest ecosystems. Measurements of organic layer mass (or loading)...

  11. Heat Pipe Powered Stirling Conversion for the Demonstration Using Flattop Fission (DUFF) Test (United States)

    Gibson, Marc A.; Briggs, Maxwell H.; Sanzi, James L.; Brace, Michael H.


    Design concepts for small Fission Power Systems (FPS) have shown that heat pipe cooled reactors provide a passive, redundant, and lower mass option to transfer heat from the fuel to the power conversion system, as opposed to pumped loop designs typically associated with larger FPS. Although many systems have been conceptually designed and a few making it to electrically heated testing, none have been coupled to a real nuclear reactor. A demonstration test named DUFF Demonstration Using Flattop Fission, was planned by the Los Alamos National Lab (LANL) to use an existing criticality experiment named Flattop to provide the nuclear heat source. A team from the NASA Glenn Research Center designed, built, and tested a heat pipe and power conversion system to couple to Flattop with the end goal of making electrical power. This paper will focus on the design and testing performed in preparation for the DUFF test.

  12. Severe Accident Recriticality Analyses (SARA)

    Energy Technology Data Exchange (ETDEWEB)

    Frid, W. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Hoejerup, F. [Risoe National Lab. (Denmark); Lindholm, I.; Miettinen, J.; Puska, E.K. [VTT Energy, Helsinki (Finland); Nilsson, Lars [Studsvik Eco and Safety AB, Nykoeping (Sweden); Sjoevall, H. [Teoliisuuden Voima Oy (Finland)


    Recriticality in a BWR has been studied for a total loss of electric power accident scenario. In a BWR, the B{sub 4}C control rods would melt and relocate from the core before the fuel during core uncovery and heat-up. If electric power returns during this time-window unborated water from ECCS systems will start to reflood the partly control rod free core. Recriticality might take place for which the only mitigating mechanisms are the Doppler effect and void formation. In order to assess the impact of recriticality on reactor safety, including accident management measures, the following issues have been investigated in the SARA project: 1. the energy deposition in the fuel during super-prompt power burst, 2. the quasi steady-state reactor power following the initial power burst and 3. containment response to elevated quasi steady-state reactor power. The approach was to use three computer codes and to further develop and adapt them for the task. The codes were SIMULATE-3K, APROS and RECRIT. Recriticality analyses were carried out for a number of selected reflooding transients for the Oskarshamn 3 plant in Sweden with SIMULATE-3K and for the Olkiluoto 1 plant in Finland with all three codes. The core state initial and boundary conditions prior to recriticality have been studied with the severe accident codes SCDAP/RELAP5, MELCOR and MAAP4. The results of the analyses show that all three codes predict recriticality - both superprompt power bursts and quasi steady-state power generation - for the studied range of parameters, i. e. with core uncovery and heat-up to maximum core temperatures around 1800 K and water flow rates of 45 kg/s to 2000 kg/s injected into the downcomer. Since the recriticality takes place in a small fraction of the core the power densities are high which results in large energy deposition in the fuel during power burst in some accident scenarios. The highest value, 418 cal/g, was obtained with SIMULATE-3K for an Oskarshamn 3 case with reflooding

  13. Expression, purification, and functional characterization of recombinant PTD-SARA

    Institute of Scientific and Technical Information of China (English)

    Chen Huang; Rui Du; Peng Zhang; Hua Meng; Huiwei Jia; Yang Song; Man Li; Yingqi Zhang; Shiren Sun


    The Smad anchor for receptor activation (SARA) protein is a binding partner for Smad2/3 that plays an important role in the fibrotic promoting signaling pathway initiated by transforming growth factor-β1 (TGF-β1). The C-terminal 665-750 aa of SARA comprises the Smad-binding domain (SBD). By direct interaction through the SBD, SARA inhibits Smad2/3 phosphorylation and blocks the interaction between Smad2/3 and Smad4, thereby restrains the process of fibrosis.In this study, we constructed a SARA peptide aptamer based on the SBD sequence. The recombinant SARA aptamer,fused with a protein transduction domain (PTD-SARA), was cloned, purified from E. coli, and characterized for the first time. The full-length PTD-SARA coding sequence, created with E. coli favored codons, was cloned into a pQE-30 vector,and the recombinant plasmid was transformed into an M15 strain. After Isopropyl β-D-1-Thiogalactopyranoside (IPTG) induction and Ni2+ affinity purification, recombinant PTD-SARA was further identified by immunobiotting and protein N-terminal sequencing. Epifluorescence microscopy revealed that the recombinant PTD-SARA was transferred into the cytoplasm and nucleus more efficiently than SARA.Moreover, the recombinant PTD-SARA was found to up-regulate the level of E-cadherin and down-regulate the levels of α-SMA and phospho-Smad3 more efficiently than SARA (P< 0.05). Our work explored a method to obtain recombinant PTD-SARA protein. The recombinant PTDSARA fusion protein could enter HK2 cells (an immortalized proximal tubule epithelial cell line) more efficiently than the SARA protein and reverse the renal epithelial-to-mesenchymal transdifferentiation process that was induced by TGF-β1 more effectively than the SARA protein. Recombinant PDT-SARA is likely to be a potential candidate for clinical prevention and treatment of renal fibrosis.

  14. Exon: CBRC-SARA-01-1228 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1228 ATGTGgttttgctgttgttcttttctactgtggggatcaagcctgggtctccTATATGCAAGCCA...TAATATGCCCCGCCCTGCAGCTgtgtttttccctccctccctcccagctttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttccttcctgccttccttcctgccttcctgccttccttcctccctcccttcctcccttccttcctgccttccttcctccctcc...cttcctcccttccttcctccctcccttccttccttccttccttccttccttccttccttccttccttccttccttccttcc...ttccttccttccttccttccttccttcctcccttcctgccttcctgccttttttccttttttctttttcttcctgtctgtctgt

  15. Aqueous SARA ATRP using Inorganic Sulfites. (United States)

    Abreu, Carlos M R; Fu, Liye; Carmali, Sheiliza; Serra, Arménio C; Matyjaszewski, Krzysztof; Coelho, Jorge F J


    Aqueous supplemental activator and reducing agent atom transfer radical polymerization (SARA ATRP) using inorganic sulfites was successfully carried out for the first time. Under optimized conditions, a well-controlled poly[oligo(ethylene oxide) methyl ether acrylate] (POEOA) was obtained with sulfites (e.g. Na2S2O4) were continuously fed into the reaction mixture. The mechanistic studies proved that these salts can activate alkyl halides directly and regenerate the activator complex. The effects of the feeding rate of the SARA agent (inorganic sulfites), ligand and its concentration, halide salt and its concentration, sulfite used, and copper concentration, were systematically studied to afford fast polymerizations rates while maintaining the control over polymerization. The kinetic data showed linear first-order kinetics, linear evolution of molecular weights with conversion, and polymers with narrow molecular weight distributions (Đ ~1.2) during polymerization even at relatively high monomer conversions (~80%). "One-pot" chain extension and "one-pot" block copolymerization experiments proved the high chain-end functionality. The polymerization could be directly regulated by starting or stopping the continuous feeding of the SARA agent. Under biologically relevant conditions, the aqueous SARA ATRP using inorganic sulfites was used to synthesize a well-defined protein-polymer hybrid by grafting of P(OEOA480) from BSA-O-[iBBr]30.

  16. Duff mound consumption and cambium injury for centuries-old western larch from prescribed burning in western Montana (United States)

    Michael G. Harrington


    Western larch is one of the most fire-adapted conifers in western North America. Its historical perpetuation depended upon regular fire disturbances, which creates open stand conditions and mineral seedbeds. A stand of 200- to 500-year-old larch in western Montana with deep duff mounds resulting from an unusually long 150-year fire-free period was mechanically thinned...

  17. Graph model of behavior simulator. [Interactive simulator developed as part of UCLA SARA system

    Energy Technology Data Exchange (ETDEWEB)

    Razouk, R.R.; Estrin, G.


    An interactive simulator developed at UCLA as part of the SARA system is described. This simulator, in conjunction with other design tools of the SARA system, allows the user to model the behavior of the system being designed at various levels of detail. The models which drive the simulator are control graphs and associated data graphs. The simulator uses the control graph to express synchronization of sequences of events. Initiation of any control node triggers the simulator to call on the data graph model to provide interpretation of a process at a desired level of abstraction. The simulator gives the user the capability to examine, or modify, the state of the control and data graphs during a simulation. 8 figures.

  18. SARA: a server for function annotation of RNA structures. (United States)

    Capriotti, Emidio; Marti-Renom, Marc A


    Recent interest in non-coding RNA transcripts has resulted in a rapid increase of deposited RNA structures in the Protein Data Bank. However, a characterization and functional classification of the RNA structure and function space have only been partially addressed. Here, we introduce the SARA program for pair-wise alignment of RNA structures as a web server for structure-based RNA function assignment. The SARA server relies on the SARA program, which aligns two RNA structures based on a unit-vector root-mean-square approach. The likely accuracy of the SARA alignments is assessed by three different P-values estimating the statistical significance of the sequence, secondary structure and tertiary structure identity scores, respectively. Our benchmarks, which relied on a set of 419 RNA structures with known SCOR structural class, indicate that at a negative logarithm of mean P-value higher or equal than 2.5, SARA can assign the correct or a similar SCOR class to 81.4% and 95.3% of the benchmark set, respectively. The SARA server is freely accessible via the World Wide Web at

  19. Sara endosomes and the asymmetric division of intestinal stem cells. (United States)

    Montagne, Chrystelle; Gonzalez-Gaitan, Marcos


    Tissue homeostasis is maintained by adult stem cells, which self-renew and give rise to differentiating cells. The generation of daughter cells with different fates is mediated by signalling molecules coming from an external niche or being asymmetrically dispatched between the two daughters upon stem cell mitosis. In the adult Drosophila midgut, the intestinal stem cell (ISC) divides to generate a new ISC and an enteroblast (EB) differentiating daughter. Notch signalling activity restricted to the EB regulates intestinal cell fate decision. Here, we show that ISCs divide asymmetrically, and Sara endosomes in ISCs are specifically dispatched to the presumptive EB. During ISC mitosis, Notch and Delta traffic through Sara endosomes, thereby contributing to Notch signalling bias, as revealed in Sara mutants: Sara itself contributes to the control of the ISC asymmetric division. Our data uncover an intrinsic endosomal mechanism during ISC mitosis, which participates in the maintenance of the adult intestinal lineage.

  20. Sensor Activation and Radius Adaptation (SARA) in Heterogeneous Sensor Networks

    CERN Document Server

    Bartolini, Novella; la Porta, Thomas; Petrioli, Chiara; Silvestri, Simone


    In this paper we address the problem of prolonging the lifetime of wireless sensor networks (WSNs) deployed to monitor an area of interest. In this scenario, a helpful approach is to reduce coverage redundancy and therefore the energy expenditure due to coverage. We introduce the first algorithm which reduces coverage redundancy by means of Sensor Activation and sensing Radius Adaptation (SARA)in a general applicative scenario with two classes of devices: sensors that can adapt their sensing range (adjustable sensors) and sensors that cannot (fixed sensors). In particular, SARA activates only a subset of all the available sensors and reduces the sensing range of the adjustable sensors that have been activated. In doing so, SARA also takes possible heterogeneous coverage capabilities of sensors belonging to the same class into account. It specifically addresses device heterogeneity by modeling the coverage problem in the Laguerre geometry through Voronoi-Laguerre diagrams. SARA executes quickly and is guarante...

  1. Gene : CBRC-SARA-01-1782 [SEVENS

    Lifescience Database Archive (English)


  2. Gene : CBRC-SARA-01-1760 [SEVENS

    Lifescience Database Archive (English)


  3. UCLA SARA (System Architect's Apprentice) demonstration

    Energy Technology Data Exchange (ETDEWEB)

    Fenchel, R.S.; Razouk, R.R.


    A sample session with the SARA system is given. The system is a set of design and modeling tools which are implemented on the MIT-Multics computer system. This demonstration is intended to acquaint all interested persons with the state of implementation of the SARA system and the flavor of its use. The system is currently under implementation; however, all the demonstrated tools are available to any user with access to the MIT-Multics system. Additional tools will soon be available.

  4. The relationship between SARA fractions and crude oil stability

    Directory of Open Access Journals (Sweden)

    Siavash Ashoori


    Full Text Available Asphaltene precipitation and deposition are drastic issues in the petroleum industry. Monitoring the asphaltene stability in crude oil is still a serious problem and has been subject of many studies. To investigate crude oil stability by saturate, aromatic, resin and asphaltene (SARA analysis seven types of crudes with different components were used. The applied methods for SARA quantification are IP-143 and ASTM D893-69 and the colloidal instability index (CII is computed from the SARA values as well. In comparison between CII results, the values of oil compositions demonstrated that the stability of asphaltenes in crude oils is a phenomenon that is related to all these components and it cannot be associated only with one of them, individually.

  5. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  6. Gene : CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)


  7. Det udstødtes poesi hos Sara Stridsberg

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk


    Det synes at være et gennemgående projekt i Sara Stridsbergs forfatterskab at genoprejse en række upopulære, eller i hvert fald tvivlsomme og angribelige, kvindeskikkelser – hvad enten vi taler om historiske personer eller fiktive karakterer: Sally Bauer, Valerie Solanas, Medea, Lolita. Artiklen...

  8. Apocalipsis XX di Sara de Ibáñez

    Directory of Open Access Journals (Sweden)

    Stefano Tedeschi


    Full Text Available Rewriting the text of Saint John, Sara de Ibáñez uses a kind of style innovative and away from schools and trends in vogue: is thus able able to evoke the tragic experiences of the twentieth century, but the date of publication of the book (1970 reveals that it advances in themes and forms the concrete apocalypse lived by Uruguay and Latin America in the seventies. However, far from political themes and motifs, Sara de Ibáñez is able to express the absolute horror of contemporary tragedies and to propose a poetic reflection of great quality. This article suggests a rediscovery of this twentieth-century poetic voice, unjustly forgotten, through her 'apocalyptic' text.

  9. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich

    Directory of Open Access Journals (Sweden)

    Paula Daniela Bianchi


    Full Text Available The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  10. Placeres, amores y viajes en Demasiado amor de Sara Sefchovich


    Paula Daniela Bianchi


    The purpose of this paper is to investigate the construction of the prostitute female body where we analyze some strands of the circulation of pleasure, bodies, money and sexual intercourse in Demasiado amor (1990, Agustín Yáñez) by Mexican writer Sara Sefchovich. Starting from a journey, of the protagonist of the novel, as nomadism and as a geographical corporal and internal displacement, the journey is seen as a deterritorialization of the body and the subjectivity.

  11. Subacute ruminal acidosis (SARA) challenge, ruminal condition and cellular immunity in cattle. (United States)

    Sato, Shigeru


    Subacute ruminal acidosis (SARA) is characterized by repeated bouts of low ruminal pH. Cows with SARA often develop complications or other diseases, and associate physiologically with immunosuppression and inflammation. Ruminal free lipopolysaccharide (LPS) increases during SARA and translocates into the blood circulation activating an inflammatory response. Ruminal fermentation and cellular immunity are encouraged by supplementing hay with calf starter during weaning. SARA calves given a 5-day repeated administration of a bacteria-based probiotic had stable ruminal pH levels (6.6-6.8). The repeated administration of probiotics enhance cellular immune function and encourage recovery from diarrhea in pre-weaning calves. Furthermore, the ruminal fermentation could guard against acute and short-term feeding changes, and changes in the rumen microbial composition of SARA cattle might occur following changes in ruminal pH. The repeated bouts of low ruminal pH in SARA cattle might be associated with depression of cellular immunity.

  12. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers...... for the diagnosis of SARA are needed. The goal of this study was to evaluate clinical signs of SARA and to investigate the use of blood, faecal and urinary parameters as indicators of SARA. Six lactating, rumen cannulated, Danish Holstein cows were used in a cross-over study with three periods. The first and second...... periods included two cows on control diet and two cows on nutritional SARA challenge. The third period only included two cows on SARA challenge. Control diet was a conventional total mixed ration [45.5% dry matter (DM), 17.8% crude protein, 43.8% neutral detergent fibre, and 22.5% acid detergent fibre (DM...

  13. Teologi Politik Berbalu SARA Antara Ambisi dan Konspirasi

    Directory of Open Access Journals (Sweden)

    M. Sidi Ritau'din


    Full Text Available In a multi-cultural democracy based on Pancasila philosophy of independence, ethnic, religious, racial and intergroup issues it call (SARA are political indicators that can trigger conflict and division. If the player is ambitious and power-hungry, then he will not hesitate to do everything he can to gain power, even build a big conspiracy using SARA as a tool to divide the ummah, then he emerges as a unifier and presents programs prestigious sympathetic, there Imaging actions and slogans of the pro poor people, but essentially no more as political deceit, a false gift of hope, it familiar said (PHP that never realized, only reap the political advantage in the game of SARA, even not hesitate to shout thief when he Itself is a thieving thief based on greed and greed where the horizontal relations of fellow human beings deny the bond of faith as the foundation. Political conspiracy based on political interests and abuse of power, an action of political pathology that is not civilized that has become a trend of contemporary politics and globalization.

  14. SarA positively controls bap-dependent biofilm formation in Staphylococcus aureus. (United States)

    Trotonda, María Pilar; Manna, Adhar C; Cheung, Ambrose L; Lasa, Iñigo; Penadés, José R


    The biofilm-associated protein Bap is a staphylococcal surface protein involved in biofilm formation. We investigated the influence of the global regulatory locus sarA on bap expression and Bap-dependent biofilm formation in three unrelated Staphylococcus aureus strains. The results showed that Bap-dependent biofilm formation was diminished in the sarA mutants by an agr-independent mechanism. Complementation studies using a sarA clone confirmed that the defect in biofilm formation was due to the sarA mutation. As expected, the diminished capacity to form biofilms in the sarA mutants correlated with the decreased presence of Bap in the bacterial surface. Using transcriptional fusion and Northern analysis data, we demonstrated that the sarA gene product acts as an activator of bap expression. Finally, the bap promoter was characterized and the transcriptional start point was mapped by the rapid amplification of cDNA ends technique. As expected, we showed that purified SarA protein binds specifically to the bap promoter, as determined by gel shift and DNase I footprinting assays. Based on the previous studies of others as well as our work demonstrating the role for SarA in icaADBC and bap expression, we propose that SarA is an essential regulator controlling biofilm formation in S. aureus.

  15. Gene : CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ctin receptor 1 isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin... receptor 1 isoform 4 [Macaca mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin re...ceptor 1 isoform 5 [Macaca mulatta] ref|XP_001105878.1| PREDICTED: similar to adiponectin... receptor 1 isoform 6 [Macaca mulatta] ref|XP_001105957.1| PREDICTED: similar to adiponectin recepto...CBRC-SARA-01-1167 Novel UN B UNKNOWN ADR1_HUMAN 1e-139 67% ref|XP_001105680.1| PREDICTED: similar to adipone

  16. Factors contributing to the biofilm-deficient phenotype of Staphylococcus aureus sarA mutants.

    Directory of Open Access Journals (Sweden)

    Laura H Tsang

    Full Text Available Mutation of sarA in Staphylococcus aureus results in a reduced capacity to form a biofilm, but the mechanistic basis for this remains unknown. Previous transcriptional profiling experiments identified a number of genes that are differentially expressed both in a biofilm and in a sarA mutant. This included genes involved in acid tolerance and the production of nucleolytic and proteolytic exoenzymes. Based on this we generated mutations in alsSD, nuc and sspA in the S. aureus clinical isolate UAMS-1 and its isogenic sarA mutant and assessed the impact on biofilm formation. Because expression of alsSD was increased in a biofilm but decreased in a sarA mutant, we also generated a plasmid construct that allowed expression of alsSD in a sarA mutant. Mutation of alsSD limited biofilm formation, but not to the degree observed with the corresponding sarA mutant, and restoration of alsSD expression did not restore the ability to form a biofilm. In contrast, concomitant mutation of sarA and nuc significantly enhanced biofilm formation by comparison to the sarA mutant. Although mutation of sspA had no significant impact on the ability of a sarA mutant to form a biofilm, a combination of protease inhibitors (E-64, 1-10-phenanthroline, and dichloroisocoumarin that was shown to inhibit the production of multiple extracellular proteases without inhibiting growth was also shown to enhance the ability of a sarA mutant to form a biofilm. This effect was evident only when all three inhibitors were used concurrently. This suggests that the reduced capacity of a sarA mutant to form a biofilm involves extracellular proteases of all three classes (serine, cysteine and metalloproteases. Inclusion of protease inhibitors also enhanced biofilm formation in a sarA/nuc mutant, with the combined effect of mutating nuc and adding protease inhibitors resulting in a level of biofilm formation with the sarA mutant that approached that of the UAMS-1 parent strain. These results

  17. Low energy neutral atom imaging on the Moon with the SARA instrument aboard Chandrayaan-1 mission

    Indian Academy of Sciences (India)

    Anil Bhardwaj; Stas Barabash; Yoshifumi Futaana; Yoichi Kazama; Kazushi Asamura; David McCann; R Sridharan; Mats Holmstrom; Peter Wurz; Rickard Lundin


    This paper reports on the Sub-keV Atom Reflecting Analyzer (SARA)experiment that will be flown on the first Indian lunar mission Chandrayaan-1.The SARA is a low energy neutral atom (LENA)imaging mass spectrometer,which will perform remote sensing of the lunar surface via detection of neutral atoms in the energy range from 10 eV to 3 keV from a 100 km polar orbit.In this report we present the basic design of the SARA experiment and discuss various scientific issues that will be addressed.The SARA instrument consists of three major subsystems:a LENA sensor (CENA),a solar wind monitor (SWIM),and a digital processing unit (DPU).SARA will be used to image the solar wind –surface interaction to study primarily the surface composition and surface magnetic anomalies and associated mini-magnetospheres.Studies of lunar exosphere sources and space weathering on the Moon will also be attempted.SARA is the first LENA imaging mass spectrometer of its kind to be flown on a space mission.A replica of SARA is planned to fly to Mercury onboard the BepiColombo mission.

  18. Staphylococcus aureus sarA regulates inflammation and colonization during central nervous system biofilm formation.

    Directory of Open Access Journals (Sweden)

    Jessica N Snowden

    Full Text Available Infection is a frequent and serious complication following the treatment of hydrocephalus with CSF shunts, with limited therapeutic options because of biofilm formation along the catheter surface. Here we evaluated the possibility that the sarA regulatory locus engenders S. aureus more resistant to immune recognition in the central nervous system (CNS based on its reported ability to regulate biofilm formation. We utilized our established model of CNS catheter-associated infection, similar to CSF shunt infections seen in humans, to compare the kinetics of bacterial titers, cytokine production and inflammatory cell influx elicited by wild type S. aureus versus an isogenic sarA mutant. The sarA mutant was more rapidly cleared from infected catheters compared to its isogenic wild type strain. Consistent with this finding, several pro-inflammatory cytokines and chemokines, including IL-17, CXCL1, and IL-1β were significantly increased in the brain following infection with the sarA mutant versus wild type S. aureus, in agreement with the fact that the sarA mutant displayed impaired biofilm growth and favored a planktonic state. Neutrophil influx into the infected hemisphere was also increased in the animals infected with the sarA mutant compared to wild type bacteria. These changes were not attributable to extracellular protease activity, which is increased in the context of SarA mutation, since similar responses were observed between sarA and a sarA/protease mutant. Overall, these results demonstrate that sarA plays an important role in attenuating the inflammatory response during staphylococcal biofilm infection in the CNS via a mechanism that remains to be determined.

  19. System Analysis and Risk Assessment system (SARA) Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Sattison, M B; Russell, K D; Skinner, N L [EG and G Idaho, Inc., Idaho Falls, ID (United States)


    This NUREG is the tutorial for the System Analysis and Risk Assessment System (SARA) Version 4.0, a microcomputer-based system used to analyze the safety issues of a family (i.e., a power plant, a manufacturing facility, any facility on which a probabilistic risk assessment (PRA) might be performed). A series of lessons are provided that walk the user through some basic steps common to most analyses performed with SARA. The example problems presented in the lessons build on one another, and in combination, lead the user through all aspects of SARA sensitivity analysis.

  20. SarA influences the sporulation and secondary metabolism in Streptomyces coelicolor M145

    Institute of Scientific and Technical Information of China (English)

    Xijun Ou; Bo Zhang; Lin Zhang; Kai Dong; Chun Liu; Guoping Zhao; Xiaoming Ding


    The filamentous bacteria Streptomyces exhibit a complex life cycle involving morphological differentiation and secondary metabolism. A putative membrane protein gene sarA (sco4069), sporulation and antibiotic production related gene A, was partially characterized in Streptomyces coelicolor M145. The gene product had no characterized functional domains and was highly conserved in Streptomyces. Compared with the wild-type M145, the sarA mutant accelerated sporulation and dramatically decreased the production of actinorhodin and undecylprodigiosin.Reverse transcription-polymerase chain reaction analysis showed that SarA influenced antibiotic production by controlling the abundance of actll-orf4 and redZ messenger RNA.

  1. Sara, a patient with borderline personality structure: A "crisis" management

    Directory of Open Access Journals (Sweden)

    Paola Marinelli


    Full Text Available In this article the author examines some significant passages of his treatment of a patient with borderline personality structure, with the intention of giving a formative contribution to the delicate issue of the search for congruence between theory and clinic operations. This reflection is therefore an opportunity to integrate these aspects. The individualization of the therapeutic relationship in the theoretical framework of group analysis allowed the emotional investment in the person of the therapist, which is useful in the construction of a meaningful relationship on the human, emotional and cognitive plane; a space within which it has become increasingly possible for Sara, share and process emotions, re-build, contact parts of the self frustrated and disappointed, perceive less and less the void and become less vulnerable, being able to pull over to the original trauma. 

  2. PDB: CBRC-SARA-01-0838 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0838 3ODU,3OE0,3OE6,3OE8,3OE9, Region:8-324(Identity=89%) PDB:3ODU Chain:A (X-ray Resolution...=2.5),Region:8-324(Identity=89%) PDB:3OE0 Chain:A (X-ray Resolution=2.9),Region:8-330(...Identity=90%) PDB:3OE6 Chain:A (X-ray Resolution=3.2),Region:8-324(Identity=89%) PDB:3OE8 Chain:A (X-ray Resolution...=3.1),Region:8-324(Identity=89%) PDB:3OE9 Chain:A (X-ray Resolution=3.1), ...

  3. Depression of biofilm formation and antibiotic resistance by sarA disruption in Staphylococcus epidermidis

    Institute of Scientific and Technical Information of China (English)

    Ju-Hong Tao; Chang-Sheng Fan; Shan-E Gao; Hai-Jiao Wang; Guo-Xin Liang; Qing Zhang


    AIM: To study the effects of disruption of sarA gene on biofilm formation and antibiotic resistance of Staphylococcus epidermidis (S. epidermidis ).METHODS: In order to disrupt sarA gene, the doublecrossover homologous recombination was applied in S. epidermidis RP62A, and tetracycline resistance gene (tet) was used as the selective marker which was amplified by PCR from the pBR322 and inserted into the locus between sarA upstream and downstream,resulting in pBT2△sarA. By electroporation, the plasmid pBT2△sarA was transformed into S. epidermidis.Gene transcription was detected by real-time reverse transcription-PCR (RT-PCR). Determination of biofilm was performed in 96-well flat-bottomed culture plates, and antibiotic resistance was analyzed with test tube culture by spectrophotometry at 570 nm respectively.RESULTS: A sarA disrupted strain named S. epidermidis RP62A△sarA was constructed, which was completely defective in biofilm formation, while the sarA complement strain RP62A△sarA (pHPS9sarA) restored the biofilm formation phenotype. Additionally, the knockout of sarA resulted in decreased erythromycin and kanamycin resistance of S. epidermidis RP62A. Compared to the original strain, S. epidermidis RP62A△sarA had an increase of the sensitivity to erythromycin at 200-400 μg/mL and kanamycin at 200-800 μg/mL respectively.CONCLUSION: The knockout of sarA can result in the defect in biofilm formation and the decreased erythromycin and kanamycin resistance in S. epidermidis RP62A.

  4. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus. (United States)

    Valle, Jaione; Toledo-Arana, Alejandro; Berasain, Carmen; Ghigo, Jean-Marc; Amorena, Beatriz; Penadés, José R; Lasa, Iñigo


    Staphylococcus aureus biofilm formation is associated with the production of the polysaccharide intercellular adhesin (PIA/PNAG), the product of the ica operon. The staphylococcal accessory regulator, SarA, is a central regulatory element that controls the production of S. aureus virulence factors. By screening a library of Tn917 insertions in a clinical S. aureus strain, we identified SarA as being essential for biofilm development. Non-polar mutations of sarA in four genetically unrelated S. aureus strains decreased PIA/PNAG production and completely impaired biofilm development, both in steady state and flow conditions via an agr-independent mechanism. Accordingly, real-time PCR showed that the mutation in the sarA gene resulted in downregulation of the ica operon transcription. We also demonstrated that complete deletion of sigmaB did not affect PIA/PNAG production and biofilm formation, although it slightly decreased ica operon transcription. Furthermore, the sarA-sigmaB double mutant showed a significant decrease of ica expression but an increase of PIA/PNAG production and biofilm formation compared to the sarA single mutant. We propose that SarA activates S. aureus development of biofilm by both enhancing the ica operon transcription and suppressing the transcription of either a protein involved in the turnover of PIA/PNAG or a repressor of its synthesis, whose expression would be sigmaB-dependent.

  5. Selected Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Three - Stage Interaction Model of Lexicon - Syntax Interface Liu Yuhong (80) The Three -Stage Interaction Model maintains that the interactions at the lexicon -syntax interface are divisible into three levels, namely, the interaction between lexical meaning and lexical grammar that determines syntactic items, the interaction among lexical items that determines syntactic structure, and the interaction between abstract syntactic structure (i. e. construction) and temporary syntactic combinations that determines and coerces grammaticality of the latter. The Three - Stage Interaction Model is hierarchical, complete and bidirectional in language comprehension. It also testifies to the varying abstractness between grammar (syntax) and semantics, and between the five grammatical cases. According to this model, temporary syntactic combination is sanctioned by abstract syntactic structure, therefore the conventional linguistic significance of P600 is maintained without coining contradictory new terms.

  6. Abstract algebra

    CERN Document Server

    Garrett, Paul B


    Designed for an advanced undergraduate- or graduate-level course, Abstract Algebra provides an example-oriented, less heavily symbolic approach to abstract algebra. The text emphasizes specifics such as basic number theory, polynomials, finite fields, as well as linear and multilinear algebra. This classroom-tested, how-to manual takes a more narrative approach than the stiff formalism of many other textbooks, presenting coherent storylines to convey crucial ideas in a student-friendly, accessible manner. An unusual feature of the text is the systematic characterization of objects by universal

  7. Single-access retroperitoneoscopic adrenalectomy (SARA) versus conventional retroperitoneoscopic adrenalectomy (CORA): a case-control study. (United States)

    Walz, Martin K; Groeben, Harald; Alesina, Piero F


    Stimulated by the concept of Natural Orifice Transluminal Endoscopic Surgery (NOTES), minimizing the access even further has become a new trend in minimally invasive surgery. We compare our recently described new method of endoscopic single-access adrenalectomy with the conventional retroperitoneoscopic approach in a matched-pairs study. Fifty single-access retroperitoneoscopic adrenalectomies (SARA) were performed in 47 selected patients suffering from Conn's adenomas (n = 20), pheochromocytomas (n = 15), Cushing's adenomas (n = 6), and other diseases (n = 6). For SARA, a single 2-cm skin incision beneath the 12th rib was used. Following creation of the retroperitoneal space with the rigid endoscope, dissection was carried out single-handed. Another 47 patients served as control group; they were treated by the traditional retroperitoneoscopic three-port approach (CORA). Patients were matched with respect to gender, body mass index, diagnoses, tumor size, and tumor site. Mortality was zero and no major complications occurred in both groups. SARA was completed in 41 cases (86%). The overall complication rate was 8.5% in SARA and 6.4% in CORA. Operative time was longer for SARA (56 +/- 28 min) than for CORA (40 +/- 12 min) (P CORA patients (P = 0.01). Mean hospital stay was 2.4 +/- 0.7 days (SARA) and 3.1 +/- 1.2 days (CORA) (P < 0.01). Because feasibility and safety of SARA could be demonstrated in a large group of selected patients, this surgical technique may represent a new milestone in minimally invasive endocrine surgery.


    Institute of Scientific and Technical Information of China (English)


    Ideological Critique of Marx and Philosophical Transformation This paper addresses a tendency today that tries to reinterpret the Marxist transformation in philosophy with a "non-ideological" perspective. It explicates the leap that Marx achieved from abstract human spirit and state reason to the proletariat world view, as well as the overall withdrawal from the abstract universalism. Such a leap and withdrawal is not only the key to the materialistic inversion of the Hegelian dialectics, but also the foundation for sticking to and enriching the Marxist philosophy. Without sticking to this direction, we will not be able to clearly understand Marxism as the successor and promoter of the magnificent cultural achievements of mankind, including the enlightenment thoughts and classical German philosophy, nor will we fully understand the value and strength of Marxist philosophy today.

  9. Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. (United States)

    Kressmann, Sabine; Campos, Claudia; Castanon, Irinka; Fürthauer, Maximilian; González-Gaitán, Marcos


    Asymmetric division of neural precursor cells contributes to the generation of a variety of neuronal types. Asymmetric division is mediated by the asymmetric inheritance of fate determinants by the two daughter cells. In vertebrates, asymmetric fate determinants, such as Par3 and Mib, are only now starting to be identified. Here we show that, during mitosis of neural precursors in zebrafish, directional trafficking of Sara endosomes to one of the daughters can function as such a determinant. In asymmetric lineages, where one daughter cell becomes a neuron (n cell) whereas the other divides again to give rise to two neurons (p cell), we found that the daughter that inherits most of the Sara endosomes acquires the p fate. Sara endosomes carry an endocytosed pool of the Notch ligand DeltaD, which is thereby itself distributed asymmetrically. Sara and Notch are both essential for cell fate assignation within asymmetric lineages. Therefore, the Sara endosome system determines the fate decision between neuronal differentiation and mitosis in asymmetric lineages and thereby contributes to controlling the number of neural precursors and differentiated neurons during neurogenesis in a vertebrate.

  10. Inventory Abstraction

    Energy Technology Data Exchange (ETDEWEB)

    C. Leigh


    The purpose of the inventory abstraction as directed by the development plan (CRWMS M&O 1999b) is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M&O 1999c, 1999d). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) (NRC 1999) key technical issue (KTI): ''The rate at which radionuclides in SNF [Spent Nuclear Fuel] are released from the EBS [Engineered Barrier System] through the oxidation and dissolution of spent fuel'' (Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest contributors to the dose given a release to the accessible environment. The inventory abstraction is important in


    Energy Technology Data Exchange (ETDEWEB)

    G. Ragan


    The purpose of the inventory abstraction, which has been prepared in accordance with a technical work plan (CRWMS M&O 2000e for ICN 02 of the present analysis, and BSC 2001e for ICN 03 of the present analysis), is to: (1) Interpret the results of a series of relative dose calculations (CRWMS M&O 2000c, 2000f). (2) Recommend, including a basis thereof, a set of radionuclides that should be modeled in the Total System Performance Assessment in Support of the Site Recommendation (TSPA-SR) and the Total System Performance Assessment in Support of the Final Environmental Impact Statement (TSPA-FEIS). (3) Provide initial radionuclide inventories for the TSPA-SR and TSPA-FEIS models. (4) Answer the U.S. Nuclear Regulatory Commission (NRC)'s Issue Resolution Status Report ''Key Technical Issue: Container Life and Source Term'' (CLST IRSR) key technical issue (KTI): ''The rate at which radionuclides in SNF [spent nuclear fuel] are released from the EBS [engineered barrier system] through the oxidation and dissolution of spent fuel'' (NRC 1999, Subissue 3). The scope of the radionuclide screening analysis encompasses the period from 100 years to 10,000 years after the potential repository at Yucca Mountain is sealed for scenarios involving the breach of a waste package and subsequent degradation of the waste form as required for the TSPA-SR calculations. By extending the time period considered to one million years after repository closure, recommendations are made for the TSPA-FEIS. The waste forms included in the inventory abstraction are Commercial Spent Nuclear Fuel (CSNF), DOE Spent Nuclear Fuel (DSNF), High-Level Waste (HLW), naval Spent Nuclear Fuel (SNF), and U.S. Department of Energy (DOE) plutonium waste. The intended use of this analysis is in TSPA-SR and TSPA-FEIS. Based on the recommendations made here, models for release, transport, and possibly exposure will be developed for the isotopes that would be the highest

  12. The comparison of naturally weathered oil and artificially photo-degraded oil at the molecular level by a combination of SARA fractionation and FT-ICR MS

    Energy Technology Data Exchange (ETDEWEB)

    Islam, Ananna; Cho, Yunju [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Yim, Un Hyuk; Shim, Won Joon [Oil and POPs Research Group, Korea Institute of Ocean Science and Technology, Geoje 656-834 (Korea, Republic of); Kim, Young Hwan [Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of); Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Sunghwan, E-mail: [Kyungpook National University, Department of Chemistry, Daegu 702-701 (Korea, Republic of); Division of Mass Spectrometry Research and Center for Analytical Research in Disease Sciences, Korea Basic Science Institute, Ochang 863-883 (Korea, Republic of)


    Highlights: • Weathered oils from the Hebei Spirit oil spill and photo degraded oils are compared. • We investigate changes of polar species at the molecular level by 15T FT-ICR MS. • Significant reduction of sulfur class compounds in saturates fraction is observed. • The relative abundance of protonated compounds (presumably basic nitrogen compounds) increase after degradation. • Changes of polar compounds occurred by natural and photo degradation are similar. -- Abstract: Two sets of oil samples, one obtained from different weathering stages of the M/V Hebei Spirit oil spill site and the other prepared by an in vitro photo-degradation experiment, were analyzed and compared at the molecular level by atmospheric pressure photo-ionization coupled with Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS). For a more detailed comparison at the molecular level, the oil samples were separated into saturate, aromatic, resin, and asphaltene (SARA) fractions before MS analysis. Gravimetric analysis of the SARA fractions revealed a decreased weight percentage of the aromatic fraction and an increased resin fraction in both sets of samples. Molecular-level investigations of the SARA fractions showed a significant reduction in the S{sub 1} class in the saturate fraction and increase of S{sub 1}O{sub 1} class compounds with high DBE values in resin fraction. Levels of N{sub 1} and N{sub 1}O{sub 1} class compounds resulting in protonated ions (presumably basic nitrogen compounds) increased after degradation compared to compounds generating molecular ions (presumably non-basic nitrogen compounds). This study revealed changes occurring in heteroatom polar species of crude oils such as sulfur and nitrogen containing compounds that have not been easily detected with conventional GC based techniques.


    Directory of Open Access Journals (Sweden)

    Sulistyastuti Sutomo


    Full Text Available Not only does art   have   self-fullfillment, but  it also has axiological  benefits both socially, culturally, religiously, and economiclally.  So does Sara Douda dance.  Sara Douda aesthetics  is first contained  in its whole dance movements. In addition, it  can also be found in the whole dance equipments.  Moreover,  this dance aesthetics  may  also be contained in the verbal symbols in the speech forms  prior to the dance performance. However,  both verbal and non-verbal aesthetical forms are incorporated by the pieces of socio-cultural and  religious values in the Loli community about  their honoring their ancestors,  having social harmony, and  highly respecting each other among the community members. This study uses a cultural linguistic approach to find out and to review the aesthetics of Sara Douda dance.   Seni memang memiliki kepenuhan dalam dirinya sendiri. Tetapi ia juga sekaligus punya faedah aksiologis, baik secara sosial, kultural, religius maupun secara ekonomis. Tarian Sara Douda pun demikian. Estetika Sara Douda pertama-tama ada dalam semua gerak tariannya. Juga dalam seluruh perlengkapan tarian tersebut. Bukan itu saja, estetika tarian ini juga ada dalam simbol-simbol verbal berupa tuturan menjelang tarian. Tetapi baik bentuk-bentuk estetisasi nonverbal maupun verbal, sama-sama disatukan oleh kepingan-kepingan nilai-nilai sosio-kultural dan religius masyarakat Loli tentang penghormatan kepada leluhur, tentang harmoni sosial, dan tentang penghargaan yang tinggi terhadap satu sama lain. Penelitian ini menggunakan pendekatan linguistik kebudayaan demi menemukan dan menelaah estetika dalam tarian Sara Douda

  14. Selected Abstracts

    Institute of Scientific and Technical Information of China (English)


    The Elasticity of Vague Language Abstract:This paper develops an overarching theoretical framework for dealing with the strategic elastic- ity of vague language. Employing the metaphor of a slingshot, it describes how the vague language (VL) is stretched to meet the needs of communication. Drawing attention to the positive and effective role played by VL, the study further looks into how the VL theory is derived from real - life data of ten- sion -prone encounters. The empirical evidence validates the theory~ main maxim and its four specific maxims, and lends support to the following findings: 1 ) the pragmatic functions which VL performs, their linguistic realizations, and the pragmatic maxims they conform to are interconnected; 2) the dom- inant factor in the functioning of VL is the communicative goal; and 3 ) stretching on a continuum of polarities, between soft and tough, firm and flexible, cooperative and uncooperative, shows the versa- tility and elasticity of VL. An important implication of this study is that while VL~ vagueness is context -governed and culture- denendent it~ nll A ~1.o~;.;~.. ; :

  15. 杜夫海纳论审美体验的主要特征%The main characteristics of Duff Hainer on aesthetic experience

    Institute of Scientific and Technical Information of China (English)



    Duff Heiner think that the most prominent feature of the aesthetic experience is that the aesthetic subject in aesthetic experience is devoted and coordination and unity in the aesthetic experience in aesthetic subject and aesthetic object. This feature can be simply summarized as the integrity and fusion of aesthetic experience. The overall performance of the level is the fusion, It mainly refers to the coordination and unity in the aesthetic experience between the aesthetic subject and aesthetic object.%杜夫海纳认为,审美体验最突出的特征就是处于审美体验中的审美主体是全身心投入以及审美主体和审美对象在审美体验中的协调和统一,这一特征可以简单地概括为审美体验的整体性和融合性。整体性的层面表现是融合性,它主要是指审美主体和审美对象在审美体验中的协调性和统一性。

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|YP_001391163.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langel...and] gb|ABS40017.1| hypothetical protein CLI_1905 [Clostridium botulinum F str. Langeland] YP_001391163.1 3.1 34% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1177 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1177 ref|XP_592012.3| PREDICTED: similar to Sphingomyelin phosphodiest...erase 3 (Neutral sphingomyelinase 2) (Neutral sphingomyelinase II) (nSMase2) (nSMase-2) (Confluent 3Y1 cell-associated protein 1) isoform 1 [Bos taurus] XP_592012.3 7.4 33% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1323 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1323 ref|NP_001008277.1| rhodopsin [Canis lupus familiaris] ref|XP_855...608.1| PREDICTED: rhodopsin [Canis familiaris] emb|CAA70209.1| unnamed protein product [Canis familiaris] NP_001008277.1 2e-62 94% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|YP_857334.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK35937.1| exopolyphosphatase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_857334.1 5.5 42% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1116 gb|AAC62470.1| chemokine receptor CCR5 [Cercocebus torquatus torq...uatus] gb|AAC62473.1| chemokine receptor CCR5 [Cercocebus torquatus torquatus] AAC62470.1 3e-72 86% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0200 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0200 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0834 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0834 ref|NP_036900.1| dopamine receptor D5 [Rattus norvegicus] sp|P25115|DRD5_RAT D(1B) dopamin...e receptor (D(5) dopamine receptor) gb|AAA41072.1| dopamine D1B receptor NP_036900.1 3e-47 59% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_776833.1| opioid receptor, mu 1 [Bos taurus] sp|P79350|OPRM_BOVIN Mu-type opioid... receptor (MOR-1) gb|AAB49477.2| mu opioid receptor [Bos taurus] NP_776833.1 0.0 91% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1766 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1766 ref|NP_001029087.1| opioid receptor, mu 1 [Pan troglodytes] sp|Q5...IS39|OPRM_PANTR Mu-type opioid receptor (MOR-1) gb|AAV74327.1| opioid receptor MU-1 [Pan troglodytes] NP_001029087.1 0.0 90% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0854 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0854 gb|EAW79490.1| calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal...eptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism), isoform CRA_c [Homo sapiens] EAW79490.1 0.0 90% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_001125845.1| hypothetical protein GTNG_1736 [Geobacillus thermoden...itrificans NG80-2] gb|ABO67100.1| Conserved hypothetical protein [Geobacillus thermodenitrificans NG80-2] YP_001125845.1 0.47 23% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|NP_965427.1| hypothetical protein LJ1621 [Lactobacillus johnson...ii NCC 533] gb|AAS09393.1| hypothetical protein LJ_1621 [Lactobacillus johnsonii NCC 533] NP_965427.1 0.12 24% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1366 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1366 gb|AAI40135.1| Olfactory receptor 1239 [synthetic construct] gb|A...AI40175.1| Olfactory receptor 1239 [synthetic construct] gb|AAI43150.1| Olfactory receptor 1239 [synthetic construct] AAI40135.1 2e-80 82% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0832 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0832 ref|ZP_01035526.1| exopolysaccharide biosynthesis domain protein [Roseo...varius sp. 217] gb|EAQ25691.1| exopolysaccharide biosynthesis domain protein [Roseovarius sp. 217] ZP_01035526.1 1.0 26% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0489 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0489 ref|ZP_01585795.1| Polyphosphate kinase [Dinoroseobacter shibae D...FL 12] gb|ABV92485.1| Polyphosphate kinase [Dinoroseobacter shibae DFL 12] ZP_01585795.1 1.8 28% ...

  13. Indicators of induced subacute ruminal acidosis (SARA) in Danish Holstein cows

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Li, Shucong; Andersen, Pia H.;


    BACKGROUND: The prevalence of subacute ruminal acidosis (SARA) in dairy cows is high with large impact on economy and welfare. Its current field diagnosis is based on point ruminal pH measurements by oral probe or rumenocentesis. These techniques are invasive and inaccurate, and better markers fo...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0590 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0590 ref|NP_297344.1| hypothetical protein XF0051 [Xylella fastidiosa ...9a5c] gb|AAF82864.1|AE003859_5 hypothetical protein XF_0051 [Xylella fastidiosa 9a5c] NP_297344.1 8e-19 51% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0430 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0430 ref|NP_878187.1| NADH dehydrogenase subunit 1 [Fejervarya limnoch...aris] gb|AAO12107.1| NADH dehydrogenase subunit 1 [Fejervarya limnocharis] NP_878187.1 2.5 29% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1095 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1095 ref|XP_001231930.1| PREDICTED: similar to claudin 14b [Gallus gal...lus] ref|XP_001231960.1| PREDICTED: similar to claudin 14b [Gallus gallus] XP_001231930.1 6e-34 37% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1648 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1648 ref|NP_694727.1| histamine H4 receptor [Mus musculus] gb|AAK97380.1|AF358859_1 histamine... H4 receptor [Mus musculus] gb|EDL01579.1| histamine H4 receptor [Mus musculus] NP_694727.1 1e-129 61% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1089 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1089 ref|ZP_00518636.1| Major facilitator superfamily [Crocosphaera watson...ii WH 8501] gb|EAM48279.1| Major facilitator superfamily [Crocosphaera watsonii WH 8501] ZP_00518636.1 1.3 32% ...

  19. Rumen Microbiome Composition in Cattle during Grain-Induced Subacute Ruminal Acidosis (SARA)

    DEFF Research Database (Denmark)

    Danscher, Anne Mette; Derakshani, Hooman; Li, Shucong


    day of the control period, and first and last day of full SARA-feeding. DNA was extracted and V4 region of bacterial 16S rRNA amplified and subjected to Illumina sequencing. Data was analyzed using QIIME pipelines and resultant operational taxonomic units (OTUs) were aligned to Greengenes database...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1804 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1804 ref|ZP_00743402.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO52327.1| Sensory box/GGDEF family protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00743402.1 0.20 36% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0256 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0256 ref|ZP_00739965.1| Integral membrane protein [Bacillus thuringiensis serovar israel...ensis ATCC 35646] gb|EAO55770.1| Integral membrane protein [Bacillus thuringiensis serovar israelensis ATCC 35646] ZP_00739965.1 1.3 24% ...

  2. The new species of Mysidacea (Crustacea), Anchialina labatus and Gastrosaccus sarae, from south west Australia

    Digital Repository Service at National Institute of Oceanography (India)

    Panampunnayil, S.U.

    Descriptions of two new sepcies Anchialina labatus and Gastrosaccus sarae, are give. A. lobatus is distinguished from the other species of the genus by the presence of a hairy lobe on the first segment of the antennule, by the modified setae...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001003037.1| melanin-concentrating hormone receptor 2 [ lupus familiaris] gb|AAM51852.1| melanin-concentrating hormone receptor subtype 2 [Canis familiaris] NP_001003037.1 1e-126 73% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1922 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1922 ref|NP_001038074.1| putative melanin concentrating hormone recept...or 2 [Sus scrofa] emb|CAJ55683.1| putative melanin concentrating hormone receptor 2 [Sus scrofa] NP_001038074.1 1e-129 73% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_001337495.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumonia...e MGH 78578] gb|ABR79228.1| hypothetical protein KPN_03841 [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001337495.1 0.93 29% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0303 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0303 ref|YP_001109469.1| valine-pyruvate aminotransferase [Saccharopol...yspora erythraea NRRL 2338] emb|CAM06544.1| valine-pyruvate aminotransferase [Saccharopolyspora erythraea NRRL 2338] YP_001109469.1 5.0 33% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_873218.1| chitinase. Glycosyl Hydrolase family 18. [Acidot...hermus cellulolyticus 11B] gb|ABK53232.1| chitinase. Glycosyl Hydrolase family 18. [Acidothermus cellulolyticus 11B] YP_873218.1 9.3 29% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01788010.1| multidrug resistance protein [Haemophilus influenza...e 3655] gb|EDJ93712.1| multidrug resistance protein [Haemophilus influenzae 3655] ZP_01788010.1 0.22 27% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01792636.1| multidrug resistance protein [Haemophilus influenza...e PittHH] gb|EDK09769.1| multidrug resistance protein [Haemophilus influenzae PittHH] ZP_01792636.1 0.22 27% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01797490.1| multidrug resistance protein [Haemophilus influenza...e R3021] gb|EDK13267.1| multidrug resistance protein [Haemophilus influenzae 22.4-21] ZP_01797490.1 0.22 27% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01785759.1| multidrug resistance protein [Haemophilus influenza...e 22.4-21] gb|EDJ91681.1| multidrug resistance protein [Haemophilus influenzae R3021] ZP_01785759.1 0.22 27% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|ZP_01789776.1| multidrug resistance protein [Haemophilus influenza...e PittAA] gb|EDK08502.1| multidrug resistance protein [Haemophilus influenzae PittAA] ZP_01789776.1 0.22 27% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0775 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0775 ref|YP_248596.1| multidrug resistance protein [Haemophilus influenza...e 86-028NP] gb|AAX87936.1| multidrug resistance protein [Haemophilus influenzae 86-028NP] YP_248596.1 0.22 27% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_026098.1| NADH dehydrogenase subunit 5 [Habronattus oregon...ensis] gb|AAT02495.1| NADH dehydrogenase subunit 5 [Habronattus oregonensis] YP_026098.1 0.032 22% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0491 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0491 ref|YP_001517065.1| hypothetical protein AM1_2749 [Acaryochloris marina... MBIC11017] gb|ABW27749.1| conserved hypothetical protein [Acaryochloris marina MBIC11017] YP_001517065.1 2e-13 45% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1485 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1485 ref|YP_001518234.1| pentapeptide repeat domain protein [Acaryochloris marina... MBIC11017] gb|ABW28917.1| pentapeptide repeat domain protein [Acaryochloris marina MBIC11017] YP_001518234.1 1.9 43% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0594 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0594 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 3e-10 35% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1578 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1578 ref|NP_001077100.1| cOR52N9 olfactory receptor family 52 subfamily N-like [Canis lupus... familiaris] gb|ABO36681.1| 52N9 olfactory receptor protein [Canis lupus familiaris] NP_001077100.1 1e-146 78% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1392 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1392 sp|Q9BDS7|GPR15_MACFA G-protein coupled receptor 15 gb|AAK25741.1...|AF291670_1 orphan seven transmembrane receptor GPR15 [Macaca fascicularis] Q9BDS7 1e-169 81% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|ZP_01666375.1| conserved hypothetical protein 374 [Thermosinus... carboxydivorans Nor1] gb|EAX47725.1| conserved hypothetical protein 374 [Thermosinus carboxydivorans Nor1] ZP_01666375.1 0.86 31% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_001499570.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae... MTU5] gb|ABV85023.1| Peptidyl-tRNA hydrolase [Rickettsia massiliae MTU5] YP_001499570.1 4.7 36% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1560 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1560 ref|YP_984227.1| filamentous haemagglutinin family outer membrane... protein [Polaromonas naphthalenivorans CJ2] gb|ABM39306.1| filamentous haemagglutinin family outer membrane protein [Polaromonas naphthalenivorans CJ2] YP_984227.1 2.9 30% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-0844 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0844 ref|NP_949451.1| putative conjugal transfer protein trbI [Rhodopseudomonas... palustris CGA009] emb|CAE29556.1| putative conjugal transfer protein trbI [Rhodopseudomonas palustris CGA009] NP_949451.1 0.38 29% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1393 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1393 ref|NP_946691.1| hypothetical protein RPA1341 [Rhodopseudomonas p...alustris CGA009] emb|CAE26784.1| conserved hypothetical protein [Rhodopseudomonas palustris CGA009] NP_946691.1 2.4 28% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 9e-19 40% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1960 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1960 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogen...ic archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-22 39% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1273 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1273 ref|YP_001111321.1| hypothetical protein GrBNV_gp54 [Gryllus bima...culatus nudivirus] gb|ABO45387.1| unknown [Gryllus bimaculatus nudivirus] YP_001111321.1 0.001 35% ...

  8. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow (United States)

    Fletcher, Jack M.; Morris, Robin D.


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow's long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the…

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_848356.1| PREDICTED: similar to adiponectin receptor 1 iso...form 2 [Canis familiaris] ref|XP_537118.2| PREDICTED: similar to adiponectin receptor 1 isoform 1 [Canis familiaris] XP_848356.1 1e-138 67% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1030 ref|NP_001015581.1| chemokine binding protein 2 [Bos taurus] gb|A...AX46341.1| chemokine binding protein 2 [Bos taurus] gb|AAX46675.1| chemokine binding protein 2 [Bos taurus] NP_001015581.1 1e-170 79% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1688 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1688 emb|CAH72617.1| chromosome 10 open reading frame 18 [Homo sapiens...] emb|CAI13368.1| chromosome 10 open reading frame 18 [Homo sapiens] CAH72617.1 1e-103 49% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ensis HTE831] sp|Q8EQA1|PRSW_OCEIH Protease prsW (Protease responsible for activating sigma-W) dbj|BAC13763....CBRC-SARA-01-0522 ref|NP_692728.1| hypothetical protein OB1807 [Oceanobacillus ihey

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0991 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0991 ref|YP_574775.1| transcriptional regulator, LysR family [Chromohalobacter salex...igens DSM 3043] gb|ABE60076.1| transcriptional regulator, LysR family [Chromohalobacter salexigens DSM 3043] YP_574775.1 9.3 31% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0831 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0831 ref|XP_001526559.1| hypothetical protein LELG_01387 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK43209.1| hypothetical protein LELG_01387 [Lodderomyces elongisporus NRRL YB-4239] XP_001526559.1 2.8 51% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0106 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0106 ref|XP_001524609.1| hypothetical protein LELG_04581 [Lodderomyces... elongisporus NRRL YB-4239] gb|EDK46400.1| hypothetical protein LELG_04581 [Lodderomyces elongisporus NRRL YB-4239] XP_001524609.1 3e-17 39% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0566 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0566 sp|Q91ZI0|CELR3_MOUSE Cadherin EGF LAG seven-pass G-type receptor... 3 precursor gb|AAL25099.1|AF427498_1 cadherin EGF LAG seven-pass G-type receptor [Mus musculus] Q91ZI0 0.0 74% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_438659.1| alcohol dehydrogenase, zinc-containing [Burkholderia thail...andensis E264] gb|ABC35120.1| alcohol dehydrogenase, zinc-containing [Burkholderia thailandensis E264] YP_438659.1 0.69 35% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0383 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0383 ref|XP_361721.2| hypothetical protein MGG_04195 [Magnaporthe gris...ea 70-15] gb|EDJ99501.1| hypothetical protein MGG_04195 [Magnaporthe grisea 70-15] XP_361721.2 1.4 24% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_001009331.1| cannabinoid receptor 1 [Felis catus] sp|O02777|CNR1_FELCA Canna...binoid receptor 1 (CB1) (CB-R) gb|AAB53440.1| CB1 cannabinoid receptor [Felis catus] NP_001009331.1 0.0 96% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0175 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0175 ref|NP_603288.1| hypothetical protein FN0384 [Fusobacterium nucle...atum subsp. nucleatum ATCC 25586] gb|AAL94587.1| Hypothetical protein [Fusobacterium nucleatum subsp. nucleatum ATCC 25586] NP_603288.1 9.0 32% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0415 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0415 ref|YP_547770.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS...666] gb|ABE42872.1| NADH dehydrogenase (quinone) [Polaromonas sp. JS666] YP_547770.1 4.6 26% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|YP_468056.1| phosphate ABC transporter, permease protein [Rhizobium... etli CFN 42] gb|ABC89329.1| phosphate ABC transporter, permease protein [Rhizobium etli CFN 42] YP_468056.1 1.1 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1549 ref|YP_001101288.1| twin-arginine translocase subunit, sec-indepe...ndent protein export [Herminiimonas arsenicoxydans] emb|CAL63167.1| twin-arginine translocase subunit, sec-i

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1142 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1142 ref|NP_787448.1| twin-arginine translocase TatC component [Trophe...ryma whipplei str. Twist] gb|AAO44417.1| twin-arginine translocase TatC component [Tropheryma whipplei str. Twist] NP_787448.1 0.17 24% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0268 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0268 ref|XP_566600.1| hypothetical protein [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW40781.1| expressed protein [Cryptococcus neoformans var. neoformans JEC21] XP_566600.1 0.017 30% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|XP_572921.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neo...formans JEC21] gb|AAW45614.1| hypothetical protein CNI03200 [Cryptococcus neoformans var. neoformans JEC21] XP_572921.1 0.90 26% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0348 ref|XP_001586881.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN97385.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001586881.1 2.4 28% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|XP_001588188.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN94760.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001588188.1 4.6 34% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-1986 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1986 ref|NP_223335.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter... pylori J99] gb|AAD06197.1| INTEGRASE-RECOMBINASE PROTEIN (XERCD FAMILY) [Helicobacter pylori J99] NP_223335.1 5.2 32% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1253 ref|YP_264377.1| hypothetical protein Psyc_1092 [Psychrobacter 273-4] gb|AAZ18943.1| conserved hypothetical protein [Psychrobacter arcticus 273-4] YP_264377.1 1.2 25% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0873 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0873 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.36 25% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|ZP_01187451.1| conserved hypothetical protein [Bacillus weihenstep...hanensis KBAB4] gb|EAR73176.1| conserved hypothetical protein [Bacillus weihenstephanensis KBAB4] ZP_01187451.1 0.78 25% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1099 ref|YP_708759.1| hypothetical protein RHA1_ro10412 [Rhodococcus s...p. RHA1] gb|ABH00601.1| conserved hypothetical protein [Rhodococcus sp. RHA1] YP_708759.1 2.7 25% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1967 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1967 ref|ZP_00370594.1| Predicted DNA repair exonuclease [Campylobacter upsalien...sis RM3195] gb|EAL53370.1| Predicted DNA repair exonuclease [Campylobacter upsaliensis RM3195] ZP_00370594.1 0.047 31% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_001015622.1| prostacyclin receptor [Bos taurus] sp|P79393|PI2R_BOVIN Prostacy...clin receptor (Prostanoid IP receptor) (PGI receptor) (Prostaglandin I2 receptor) emb|CAB07510.1| prostacyclin receptor [Bos taurus] NP_001015622.1 1e-113 86% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|YP_001302962.1| putative flippase [Parabacteroides distasonis... ATCC 8503] gb|ABR43340.1| putative flippase [Parabacteroides distasonis ATCC 8503] YP_001302962.1 5.1 26% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0459 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0459 ref|YP_001297164.1| hypothetical protein FP2308 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44363.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001297164.1 7.3 30% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1901 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1901 ref|ZP_01733372.1| hypothetical protein FBBAL38_03440 [Flavobacte...ria bacterium BAL38] gb|EAZ96441.1| hypothetical protein FBBAL38_03440 [Flavobacteria bacterium BAL38] ZP_01733372.1 4.4 19% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0253 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0253 ref|NP_001038089.1| G protein-coupled receptor 54 [Sus scrofa] gb...|ABE73452.1| G protein-coupled receptor 54 [Sus scrofa] gb|ABE73453.1| G protein-coupled receptor 54 [Sus scrofa] NP_001038089.1 3e-51 67% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0420 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0420 ref|ZP_00588106.1| Bile acid:sodium symporter [Pelodictyon phaeocl...athratiforme BU-1] gb|EAN26387.1| Bile acid:sodium symporter [Pelodictyon phaeoclathratiforme BU-1] ZP_00588106.1 0.33 29% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available moniae subsp. pneumoniae MGH 78578] gb|ABR77598.1| putative H+/gluconate symporter ...and related permeases [Klebsiella pneumoniae subsp. pneumoniae MGH 78578] YP_001335828.1 1.8 26% ... ...CBRC-SARA-01-1117 ref|YP_001335828.1| putative H+/gluconate symporter and related permeases [Klebsiella pneu

  2. NCBI nr-aa BLAST: CBRC-SARA-01-1572 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1572 ref|NP_652753.1| NADH dehydrogenase subunit 5 [Tigriopus japonicu...s] dbj|BAB97224.1| NADH dehydrogenase subunit 5 [Tigriopus japonicus] NP_652753.1 0.14 27% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1999 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1999 ref|YP_126627.1| hypothetical protein lpl1277 [Legionella pneumop...hila str. Lens] emb|CAH15517.1| hypothetical protein [Legionella pneumophila str. Lens] YP_126627.1 0.38 21% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-1615 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1615 ref|XP_001683626.1| formin, putative [Leishmania major] emb|CAJ04...769.1| formin, putative [Leishmania major] gb|ABQ43162.1| formin B [Leishmania major] XP_001683626.1 0.52 46% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-2040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2040 ref|NP_001075253.1| 5-hydroxytryptamine (serotonin) receptor 2A [Equus caba...llus] dbj|BAF32954.1| 5-hydroxytryptamine receptor 2A [Equus caballus] NP_001075253.1 1e-128 87% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-0322 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0322 ref|ZP_01459778.1| conserved hypothetical protein [Stigmatella aura...ntiaca DW4/3-1] gb|EAU69359.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01459778.1 5.2 34% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-0796 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0796 ref|ZP_01774245.1| conserved hypothetical protein [Geobacter bemi...djiensis Bem] gb|EDJ80432.1| conserved hypothetical protein [Geobacter bemidjiensis Bem] ZP_01774245.1 3e-33 39% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001029253.1| progestin and adipoQ receptor family member V...II [Rattus norvegicus] gb|AAY67652.1| progestin membrane receptor alpha [Rattus norvegicus] NP_001029253.1 1e-167 82% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_001033642.1| progestin and adipoQ receptor family member V...II [Bos taurus] gb|AAI11285.1| Progestin and adipoQ receptor family member VII [Bos taurus] NP_001033642.1 1e-180 87% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1656 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1656 ref|NP_001034958.1| bitter taste receptor Modo-T2R7B [Monodelphis... domestica] dbj|BAE80368.1| bitter taste receptor [Monodelphis domestica] NP_001034958.1 2e-39 43% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1755 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1755 ref|NP_001034947.1| bitter taste receptor Modo-T2R25 [Monodelphis... domestica] dbj|BAE80373.1| bitter taste receptor [Monodelphis domestica] NP_001034947.1 1e-40 35% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-0389 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0389 ref|NP_001034959.1| bitter taste receptor Modo-T2R41 [Monodelphis... domestica] dbj|BAE80381.1| bitter taste receptor [Monodelphis domestica] NP_001034959.1 1e-101 60% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1309 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1309 ref|YP_033365.1| hypothetical protein BH05300 [Bartonella hensela...e str. Houston-1] emb|CAF27338.1| hypothetical protein [Bartonella henselae str. Houston-1] YP_033365.1 0.47 19% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.40 27% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.53 28% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01068559.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni CF93-6] gb|EAQ56421.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni CF93-6] ZP_01068559.1 0.67 27% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1189 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1189 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.53 28% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01099747.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 84-25] gb|EAQ95323.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 84-25] ZP_01099747.1 0.52 27% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0337 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0337 ref|ZP_01069237.1| arsenical pump membrane protein [Campylobacter... jejuni subsp. jejuni 260.94] gb|EAQ59437.1| arsenical pump membrane protein [Campylobacter jejuni subsp. jejuni 260.94] ZP_01069237.1 0.67 27% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1348 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1348 ref|NP_001028103.1| cholinergic receptor, muscarinic 5 [Macaca mu...latta] sp|P56490|ACM5_MACMU Muscarinic acetylcholine receptor M5 gb|AAB95159.1| muscarinic receptor [Macaca mulatta] NP_001028103.1 0.0 88% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_898010.1| phosphatidylserine synthase [Francisella tularen...sis subsp. novicida U112] gb|ABK89256.1| phosphatidylserine synthase [Francisella tularensis subsp. novicida U112] YP_898010.1 3.0 27% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0378 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0378 ref|NP_693392.1| glycerol-3-phosphate dehydrogenase [ iheyensis HTE831] dbj|BAC14427.1| glycerol-3-phosphate dehydrogenase [Oceanobacillus iheyensis HTE831] NP_693392.1 8.7 23% ...

  3. NCBI nr-aa BLAST: CBRC-SARA-01-1651 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1651 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.5 19% ...

  4. NCBI nr-aa BLAST: CBRC-SARA-01-2020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2020 ref|NP_203162.1|ND5_15766 NADH dehydrogenase subunit 5 [Tribolium... castaneum] emb|CAC51706.1| NADH dehydrogenase subunit 5 [Tribolium castaneum] NP_203162.1 5.5 32% ...

  5. NCBI nr-aa BLAST: CBRC-SARA-01-0795 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0795 ref|NP_203156.1|ND2_15766 NADH dehydrogenase subunit 2 [Tribolium... castaneum] emb|CAC51700.1| NADH dehydrogenase subunit 2 [Tribolium castaneum] NP_203156.1 1.8 19% ...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_001039945.1| opioid receptor, kappa 1 [Bos taurus] sp|Q2KIP6|OPRK_BOVIN opioid receptor (KOR-1) gb|AAI12562.1| Opioid receptor, kappa 1 [Bos taurus] NP_001039945.1 9e-80 92% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|XP_001221542.1| hypothetical protein CHGG_05447 [Chaetomium globo...sum CBS 148.51] gb|EAQ88828.1| hypothetical protein CHGG_05447 [Chaetomium globosum CBS 148.51] XP_001221542.1 0.21 28% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1012 ref|XP_001229383.1| hypothetical protein CHGG_02867 [Chaetomium globo...sum CBS 148.51] gb|EAQ90932.1| hypothetical protein CHGG_02867 [Chaetomium globosum CBS 148.51] XP_001229383.1 4.1 30% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0179 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0179 ref|XP_001226930.1| predicted protein [Chaetomium globosum CBS 14...8.51] gb|EAQ84989.1| predicted protein [Chaetomium globosum CBS 148.51] XP_001226930.1 1e-04 40% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0522 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0522 ref|YP_913161.1| ATP synthase F0 subunit 6 [Romanomermis culicivo...rax] gb|ABL11588.1| ATP synthase F0 subunit 6 [Romanomermis culicivorax] YP_913161.1 0.33 24% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1697 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1697 ref|YP_913162.1| NADH dehydrogenase subunit 5 [Romanomermis culic...ivorax] gb|ABL11589.1| NADH dehydrogenase subunit 5 [Romanomermis culicivorax] YP_913162.1 0.62 35% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1085 ref|NP_829355.1| hypothetical protein CCA00489 [Chlamydophila cav...iae GPIC] gb|AAP05233.1| conserved hypothetical protein [Chlamydophila caviae GPIC] NP_829355.1 0.26 23% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008277.1| hypothetical protein pc1278 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24002.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008277.1 0.89 28% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0159 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0159 ref|YP_008619.1| hypothetical protein pc1620 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24344.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008619.1 7.8 27% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-2026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-2026 ref|YP_008281.1| hypothetical protein pc1282 [Candidatus Protochlamydia... amoebophila UWE25] emb|CAF24006.1| conserved hypothetical protein [Candidatus Protochlamydia amoebophila UWE25] YP_008281.1 3.4 25% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1753 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1753 ref|YP_001476411.1| amino acid permease-associated region [Serratia proteam...aculans 568] gb|ABV39283.1| amino acid permease-associated region [Serratia proteamaculans 568] YP_001476411.1 0.83 35% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1462 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1462 ref|YP_300930.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyt...icus ATCC 15305] dbj|BAE17985.1| accessory gene regulator C [Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305] YP_300930.1 0.020 25% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1236 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1236 ref|YP_213442.1| putative iron transport, fusion membrane protein... [Bacteroides fragilis NCTC 9343] emb|CAH09534.1| putative iron transport, fusion membrane protein [Bacteroides fragilis NCTC 9343] YP_213442.1 1.8 26% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1386 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1386 ref|XP_001165973.1| PREDICTED: prokineticin receptor 2 isoform 1 ...[Pan troglodytes] ref|XP_001166012.1| PREDICTED: prokineticin receptor 2 isoform 2 [Pan troglodytes] XP_001165973.1 1e-115 91% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1868 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1868 ref|NP_067356.2| prokineticin receptor 1 [Mus musculus] gb|AAH59003.1| Prokinetic...2080.1| unnamed protein product [Mus musculus] gb|EDK99210.1| prokineticin receptor 1 [Mus musculus] NP_067356.2 2e-55 77% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_001100989.1| non imprinted in Prader-Willi/Angelman 1 homolog [Rattus norvegicus] gb|EDL86455.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) (predicted) [Rattus norvegicus] NP_001100989.1 1e-113 80% ...

  2. SARA (System ARchitects Apprentice): Modeling, analysis, and simulation support for design of concurrent systems

    Energy Technology Data Exchange (ETDEWEB)

    Estrin, G.; Fenchel, R.S.; Razouk, R.R.; Vernon, M.K.


    An environment to support designers in the modeling, analysis and simulation of concurrent systems is described. It is shown how a fully nested structure model supports multilevel design and focuses attention on the interfaces between the modules which serve to encapsulate behavior. Using simple examples the paper indicates how a formal graph model can be used to model behavior in three domains: control flow, data flow, and interpretation. The effectiveness of the explicity environment model in SARA is discussed and the capability to analyze correctness and evaluate performance of a system model are demonstrated. A description of the integral help designed into SARA shows how the designer can be offered consistent use of any new tool introduced to support the design process.

  3. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA)

    CERN Document Server

    Keel, William C; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA), a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofisica de Canarias. SARA observatories comprise a 0.96m telescope at Kitt Peak, Arizona; a 0.6m instrument on Cerro Tololo, Chile; and the 1m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for f...

  4. Serum acute phase proteins in cows with SARA (Subacute Ruminal Acidosis suspect

    Directory of Open Access Journals (Sweden)

    C. Cannizzo


    Full Text Available The aim of this study was to evaluate the variations of Acute Phase Proteins (APPs and other blood constituents during the onset of the sub-acute ruminal acidosis (SARA pathological status. A total of 108 cows from 12 dairy herds were randomly selected and divided into three Groups of 36 animals each. All animals were subjected to a rumenocentesis. Group A was composed by subjects with a rumen pH>5.8, Group B was composed by subjects with a rumen pH ≤5.5≤5.8 and Group C was composed by subjects with a rumen pH<5.5. Blood samples were collected by jugular venipuncture and Haptoglobin (Hp, Serum Amyloid A (SAA, Total Proteins, Albumin and White Blood Cells (WBC were determined. One-way ANOVA showed a statistical significance on Rumen pH, Hp, SAA. SARA seems not stimulate the APPs production from liver.

  5. Reading, Laterality, and the Brain: Early Contributions on Reading Disabilities by Sara S. Sparrow


    Fletcher, Jack M.; Morris, Robin D


    Although best known for work with children and adults with intellectual disabilities and autism spectrum disorders, training in speech pathology and a doctorate in clinical psychology and neuropsychology was the foundation for Sara Sparrow’s long-term interest in reading disabilities. Her first papers were on dyslexia and laterality, and the maturational lag theory of developmental dyslexia proposed with Paul Satz, her mentor. The research program that emerged from this work had a wide impact...

  6. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_999614.1| luteinizing hormone/choriogonadotropin receptor ...[Sus scrofa] sp|P16582|LSHR_PIG Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAA31062.1| luteinizing hormone receptor precursor NP_999614.1 0.0 65% ...

  7. NCBI nr-aa BLAST: CBRC-SARA-01-1423 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1423 ref|NP_776806.1| luteinizing hormone/choriogonadotropin receptor ...[Bos taurus] sp|Q28005|LSHR_BOVIN Lutropin-choriogonadotropic hormone receptor precursor (LH/CG-R) (LSH-R) (Lute...inizing hormone receptor) gb|AAC24012.1| luteinizing hormone receptor [Bos taurus] NP_776806.1 0.0 65% ...

  8. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_776826.1| neuropeptide Y receptor Y2 [Bos taurus] sp|P79113|NPY2R_BOVIN Neurope...ptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAB40600.1| type 2 neuropeptide Y receptor NP_776826.1 0.0 85% ...

  9. NCBI nr-aa BLAST: CBRC-SARA-01-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0123 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 1e-120 70% ...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_653200.2| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Homo sapiens] sp|Q7RTP0|NIPA1_HUMAN Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 tpg|...DAA01477.1| TPA_exp: non-imprinted in Prader-Willi/Angelman syndrome 1 [Homo sapiens] NP_653200.2 1e-113 81% ...

  11. NCBI nr-aa BLAST: CBRC-SARA-01-0466 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0466 dbj|BAF32759.1| taste receptor, type 1, member 3 [Sus scrofa domestic...a] dbj|BAF32761.1| taste receptor, type 1, member 3 [Sus scrofa domestica] dbj|BAF32762.1| taste recepto...r, type 1, member 3 [Sus scrofa domestica] dbj|BAF32763.1| taste receptor, type 1, member 3 [Sus scrofa domestica] BAF32759.1 3e-32 71% ...

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1400 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1400 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sapie...ns] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 4e-34 52% ...

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1193 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1193 ref|NP_776427.1| calcium-sensing receptor [Bos taurus] sp|P35384|...CASR_BOVIN Extracellular calcium-sensing receptor precursor (CaSR) (Parathyroid Cell calcium-sensing recepto...r) gb|AAB29171.1| Ca(2+)-sensing receptor [Bos taurus] prf||2002360A Ca-sensing receptor NP_776427.1 0.0 86% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-1360 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1360 ref|NP_599155.1| trace-amine-associated receptor 1 [Rattus norveg...icus] gb|AAL65137.1|AF421352_1 trace amine receptor 1 [Rattus norvegicus] gb|AAV70127.1| trace amine associa...ted receptor 1 [Rattus norvegicus] gb|EDL87747.1| trace-amine-associated receptor 1 [Rattus norvegicus] NP_599155.1 1e-145 74% ...

  15. NCBI nr-aa BLAST: CBRC-SARA-01-0585 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0585 ref|NP_001071387.1| hypothetical protein LOC514131 [Bos taurus] r...ef|XP_001254537.1| PREDICTED: hypothetical protein LOC514131 [Bos taurus] dbj|BAF36506.1| p97Bucentaur-2 [Bos tau...rus] gb|AAI49203.1| P97Bucentaur-2 [Bos taurus] NP_001071387.1 4e-12 32% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|NP_001029267.1| tubulin, alpha, ubiquitous [Pan troglodytes] ...sp|Q5R1W4|TBA1B_PANTR Tubulin alpha-1B chain (Tubulin alpha-ubiquitous chain) (Alpha-tubulin ubiquitous) (Tu...bulin K-alpha-1) dbj|BAD74034.1| ubiquitous alpha-tubulin [Pan troglodytes verus] NP_001029267.1 1e-136 86% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-1488 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1488 ref|YP_001474562.1| DNA internalization-related competence protei...n ComEC/Rec2 [Shewanella sediminis HAW-EB3] gb|ABV37434.1| DNA internalization-related competence protein ComEC/Rec2 [Shewanella sediminis HAW-EB3] YP_001474562.1 1.7 33% ...

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0675 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0675 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-136 76% ...

  19. NCBI nr-aa BLAST: CBRC-SARA-01-1437 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1437 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-123 71% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0312 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0312 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-137 76% ...

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1238 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1238 ref|NP_667223.1| olfactory receptor 1047 [Mus musculus] gb|AAL60739.1| olfactory... receptor MOR188-3 [Mus musculus] gb|AAP71493.1| olfactory receptor Olfr1047 [Mus musculus] emb|CAM18161.1| olfactory... receptor 1047 [Mus musculus] gb|EDL27358.1| olfactory receptor 1047 [Mus musculus] NP_667223.1 1e-116 72% ...

  2. NCBI nr-aa BLAST: CBRC-SARA-01-0756 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0756 gb|AAW70053.1| MRGX2 [Homo sapiens] gb|AAW70054.1| MRGX2 [Homo sa...piens] gb|AAW70055.1| MRGX2 [Homo sapiens] gb|AAW70070.1| MRGX2 [Homo sapiens] gb|AAW70083.1| MRGX2 [Homo sapiens] AAW70053.1 1e-66 52% ...

  3. The Remote Observatories of the Southeastern Association for Research in Astronomy (SARA) (United States)

    Keel, William C.; Oswalt, Terry; Mack, Peter; Henson, Gary; Hillwig, Todd; Batcheldor, Daniel; Berrington, Robert; De Pree, Chris; Hartmann, Dieter; Leake, Martha; Licandro, Javier; Murphy, Brian; Webb, James; Wood, Matt A.


    We describe the remote facilities operated by the Southeastern Association for Research in Astronomy (SARA) , a consortium of colleges and universities in the US partnered with Lowell Observatory, the Chilean National Telescope Allocation Committee, and the Instituto de Astrofísica de Canarias. SARA observatories comprise a 0.96 m telescope at Kitt Peak, Arizona; one of 0.6 m aperture on Cerro Tololo, Chile; and the 1 m Jacobus Kapteyn Telescope at the Roque de los Muchachos, La Palma, Spain. All are operated using standard VNC or Radmin protocols communicating with on-site PCs. Remote operation offers considerable flexibility in scheduling, allowing long-term observational cadences difficult to achieve with classical observing at remote facilities, as well as obvious travel savings. Multiple observers at different locations can share a telescope for training, educational use, or collaborative research programs. Each telescope has a CCD system for optical imaging, using thermoelectric cooling to avoid the need for frequent local service, and a second CCD for offset guiding. The Arizona and Chile telescopes also have fiber-fed echelle spectrographs. Switching between imaging and spectroscopy is very rapid, so a night can easily accommodate mixed observing modes. We present some sample observational programs. For the benefit of other groups organizing similar consortia, we describe the operating structure and principles of SARA, as well as some lessons learned from almost 20 years of remote operations.

  4. Innovative Stormwater Quality Tools by SARA for Holistic Watershed Master Planning (United States)

    Thomas, S. M.; Su, Y. C.; Hummel, P. R.


    Stormwater management strategies such as Best Management Practices (BMP) and Low-Impact Development (LID) have increasingly gained attention in urban runoff control, becoming vital to holistic watershed master plans. These strategies can help address existing water quality impairments and support regulatory compliance, as well as guide planning and management of future development when substantial population growth and urbanization is projected to occur. However, past efforts have been limited to qualitative planning due to the lack of suitable tools to conduct quantitative assessment. The San Antonio River Authority (SARA), with the assistance of Lockwood, Andrews & Newnam, Inc. (LAN) and AQUA TERRA Consultants (a division of RESPEC), developed comprehensive hydrodynamic and water quality models using the Hydrological Simulation Program-FORTRAN (HSPF) for several urban watersheds in the San Antonio River Basin. These models enabled watershed management to look at water quality issues on a more refined temporal and spatial scale than the limited monitoring data. They also provided a means to locate and quantify potential water quality impairments and evaluate the effects of mitigation measures. To support the models, a suite of software tools were developed. including: 1) SARA Timeseries Utility Tool for managing and processing of large model timeseries files, 2) SARA Load Reduction Tool to determine load reductions needed to achieve screening levels for each modeled constituent on a sub-basin basis, and 3) SARA Enhanced BMP Tool to determine the optimal combination of BMP types and units needed to achieve the required load reductions. Using these SARA models and tools, water quality agencies and stormwater professionals can determine the optimal combinations of BMP/LID to accomplish their goals and save substantial stormwater infrastructure and management costs. The tools can also help regulators and permittees evaluate the feasibility of achieving compliance

  5. Reactivity of Athabasca residue and of its SARA fractions during residue hydroconversion

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, J.; Danial-Fortain, P.; Gauthier, T.; Merdrignac, I. [IFP-Lyon, Vermaison (France); Budzinski, H. [Bordeaux Univ. (France). ISM-LPTC, UMR CNRS


    Residue conversion processes are becoming increasingly important because of the declining market for residual fuel oil and a greater demand for middle distillates. Ebullated-bed hydroconversion is a commercially proven technology for converting heavy feedstocks with high amounts of impurities. The process enables the conversion of atmospheric or vacuum residues at temperatures up to 440 degrees C, and at liquid hourly space velocity (LHSV) conditions in the range of 0.15 to 0.5 per hour. A 540 degrees C conversion of up to 80 weight per cent can be achieved under these conditions. This paper reported on a research study conducted at IFP Lyon in which the residue hydroconversion in a large-scale ebullated bed bench unit was investigated to determine the impact of operating conditions and feed properties on yield and product qualities. Hydrogen was added to the feed in the bench units to keep a high hydrogen partial pressure and favour the catalytic hydroconversion reactions. In a typical test, the reactor was fed with 50 g of feedstock and 0.45 g of crushed equilibrium industrial NiMo catalyst, pressurized hydrogen and quickly heated at the reaction temperature. This paper also discussed the conversion of Athabasca bitumen residue in the large-scale pilot plant and also in the small scale batch reactor. The effect of operating temperature and space velocity was examined. The reactivity of the saturates, aromatics, resins and asphaltenes (SARA) fractions of the bitumen was studied separately in order to better understand the conversion mechanisms and reactivities. The Athabasca bitumen feed and SARA fractions were also analyzed in terms of standard petroleum analysis, SARA fractionation, elemental analysis, size exclusion chromatography (SEC) and 13C NMR. Hydroconversion experiments were conducted in the batch unit at different reaction temperatures and reaction times. A comparison of small-scale batch results with those obtained with the continuous large-scale bench

  6. From Abstract Art to Abstracted Artists

    Directory of Open Access Journals (Sweden)

    Romi Mikulinsky


    Full Text Available What lineage connects early abstract films and machine-generated YouTube videos? Hans Richter’s famous piece Rhythmus 21 is considered to be the first abstract film in the experimental tradition. The Webdriver Torso YouTube channel is composed of hundreds of thousands of machine-generated test patterns designed to check frequency signals on YouTube. This article discusses geometric abstraction vis-à-vis new vision, conceptual art and algorithmic art. It argues that the Webdriver Torso is an artistic marvel indicative of a form we call mathematical abstraction, which is art performed by computers and, quite possibly, for computers.

  7. Impact of subacute ruminal acidosis (SARA) adaptation and recovery on the density and diversity of bacteria in the rumen of dairy cows

    NARCIS (Netherlands)

    Hook, S.E.; Steele, M.A.; Northwood, K.S.; Dijkstra, J.; France, J.; Wright, A.G.; McBride, B.W.


    Subacute ruminal acidosis (SARA) is characterized by ruminal pH depression and microbial perturbation. The impact of SARA adaptation and recovery on rumen bacterial density and diversity was investigated following high-grain feeding. Four ruminally cannulated dairy cows were fed a hay diet, transiti

  8. PLS models for determination of SARA analysis of Colombian vacuum residues and molecular distillation fractions using MIR-ATR

    Directory of Open Access Journals (Sweden)

    Jorge A. Orrego-Ruiz


    Full Text Available In this work, prediction models of Saturates, Aromatics, Resins and Asphaltenes fractions (SARA from thirty-seven vacuum residues of representative Colombian crudes and eighteen fractions of molecular distillation process were obtained. Mid-Infrared (MIR Attenuated Total Reflection (ATR spectroscopy in combination with partial least squares (PLS regression analysis was used to estimate accurately SARA analysis in these kind of samples. Calibration coefficients of prediction models were for saturates, aromatics, resins and asphaltenes fractions, 0.99, 0.96, 0.97 and 0.99, respectively. This methodology permits to control the molecular distillation process since small differences in chemical composition can be detected. Total time elapsed to give the SARA analysis per sample is 10 minutes.

  9. SARAS: a precision system for measurement of the Cosmic Radio Background and signatures from the Epoch of Reionization

    CERN Document Server

    Patra, Nipanjana; Raghunathan, A; Shankar, N Udaya


    SARAS is a correlation spectrometer purpose designed for precision measurements of the cosmic radio background and faint features in the sky spectrum at long wavelengths that arise from redshifted 21-cm from gas in the reionization epoch. SARAS operates in the octave band 87.5-175 MHz. We present herein the system design arguing for a complex correlation spectrometer concept. The SARAS design concept provides a differential measurement between the antenna temperature and that of an internal reference termination, with measurements in switched system states allowing for cancellation of additive contaminants from a large part of the signal flow path including the digital spectrometer. A switched noise injection scheme provides absolute spectral calibration. Additionally, we argue for an electrically small frequency-independent antenna over an absorber ground. Various critical design features that aid in avoidance of systematics and in providing calibration products for the parametrization of other unavoidable s...

  10. NCBI nr-aa BLAST: CBRC-SARA-01-0144 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0144 ref|YP_104995.1| alcohol dehydrogenase, zinc-containing [Burkholder...ia mallei ATCC 23344] ref|YP_111924.1| alcohol dehydrogenase [Burkholderia pseudomallei K96243] ref|ZP_004...40487.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei GB8 horse 4] ref|YP_336176.1| alc...ohol dehydrogenase, zinc-containing [Burkholderia pseudomallei 1710b] ref|ZP_0093...0750.1| COG1064: Zn-dependent alcohol dehydrogenases [Burkholderia mallei FMH] ref|ZP_00934487.1| COG1064: Z

  11. NCBI nr-aa BLAST: CBRC-SARA-01-1695 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1695 sp|Q9NYW0|T2R10_HUMAN Taste receptor type 2 member 10 (T2R10) (Taste... receptor family B member 2) (TRB2) gb|AAH69089.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AA...U21148.1| taste receptor T2R10 [Homo sapiens] gb|AAI01763.1| Taste receptor, type 2, member 10 [Homo sapiens] gb|AAI01765.1| Taste

  12. NCBI nr-aa BLAST: CBRC-SARA-01-1608 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1608 ref|NP_001832.1| cannabinoid receptor 2 (macrophage) [Homo sapien...s] sp|P34972|CNR2_HUMAN Cannabinoid receptor 2 (CB2) (CB-2) (CX5) emb|CAA52376.1| CB2 (peripheral) cannabinoid... receptor [Homo sapiens] emb|CAD22548.1| peripheral cannabinoid receptor CB2 [Homo sapiens] emb|CAD22549.1| peripheral cannabinoid... receptor CB2 [Homo sapiens] gb|AAO92299.1| cannabinoid r...eceptor 2 [Homo sapiens] emb|CAI14799.1| cannabinoid receptor 2 (macrophage) [Homo sapiens] emb|CAJ42137.1| cannabinoid

  13. NCBI nr-aa BLAST: CBRC-SARA-01-0195 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0195 ref|NP_036916.1| cannabinoid receptor 1 (brain) [Rattus norvegicu...s] sp|P20272|CNR1_RAT Cannabinoid receptor 1 (CB1) (CB-R) (Brain-type cannabinoid receptor) emb|CAA39332.1| CB1 cannabinoid... receptor [Rattus norvegicus] gb|AAA99067.1| neuronal cannabinoid receptor gb|EDL98589.1| cannabinoid... receptor 1 (brain) [Rattus norvegicus] prf||1613453A cannabinoid receptor NP_036916.1 0.0 97% ...

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0921 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0921 ref|NP_003292.1| thyrotropin-releasing hormone receptor [Homo sap...iens] sp|P34981|TRFR_HUMAN Thyrotropin-releasing hormone receptor (TRH-R) (Thyroliberin receptor) emb|CAA52965.1| thyrotropin-releasi...BAA04120.1| human thyrotropin-releasing hormone receptor [Homo sapiens] gb|AAB32222.1| hormone receptor; TRH receptor [Homo sapiens] dbj|BAA12796.1| thyrotropin-releasing... hormone receptor [Homo sapiens] gb|AAR84356.1| thyrotropin-releasing hormone receptor [Homo sapiens] gb|

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|XP_001105680.1| PREDICTED: similar to adiponectin receptor 1 ...isoform 3 [Macaca mulatta] ref|XP_001105751.1| PREDICTED: similar to adiponectin receptor 1 isoform 4 [Macac...a mulatta] ref|XP_001105805.1| PREDICTED: similar to adiponectin receptor 1 isoform 5 [Macaca mulatta] ref|X...P_001105878.1| PREDICTED: similar to adiponectin receptor 1 isoform 6 [Macaca mul...atta] ref|XP_001105957.1| PREDICTED: similar to adiponectin receptor 1 isoform 7 [Macaca mulatta] XP_001105680.1 1e-138 67% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1167 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1167 ref|NP_057083.2| adiponectin receptor 1 [Homo sapiens] ref|XP_514107.1| PREDICTED: adipone...ctin receptor 1 isoform 7 [Pan troglodytes] ref|XP_001152270.1| PREDICTED: adiponectin... receptor 1 isoform 1 [Pan troglodytes] ref|XP_001152338.1| PREDICTED: adiponectin receptor 1 isoform 2 [...Pan troglodytes] ref|XP_001152393.1| PREDICTED: adiponectin receptor 1 isoform 3 ...[Pan troglodytes] ref|XP_001152460.1| PREDICTED: adiponectin receptor 1 isoform 4 [Pan troglodytes] ref|XP_0

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0033 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0033 ref|NP_000951.1| prostaglandin I2 (prostacyclin) receptor (IP) [ I2 receptor) dbj|BAA05008.1| prostacyclin receptor [Homo sapiens] gb|AAA36448.1| prostanoid IP receptor dbj|BAA06110.1| pros...tacyclin receptor [Homo sapiens] dbj|BAA07325.1| prostacyclin ...receptor [Homo sapiens] gb|AAO92301.1| prostaglandin I2 (prostacyclin) receptor [Homo sapiens] gb|AAH75814.1| Prostaglandin I2 (pros...tacyclin) receptor (IP) [Homo sapiens] gb|EAW57432.1| prostaglandin I2 (prostacyclin

  18. NCBI nr-aa BLAST: CBRC-SARA-01-0259 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0259 ref|XP_001107503.1| PREDICTED: tubulin, alpha, ubiquitous isoform... 10 [Macaca mulatta] ref|XP_001107562.1| PREDICTED: tubulin, alpha, ubiquitous isoform 11 [Macaca mulatta] r...ef|XP_001107624.1| PREDICTED: tubulin, alpha, ubiquitous isoform 12 [Macaca mulatta] ref|XP_001107684.1| PRE...| PREDICTED: tubulin, alpha, ubiquitous isoform 14 [Macaca mulatta] ref|XP_001107805.1| PREDICTED: tubulin, alpha, ubiquitous... isoform 15 [Macaca mulatta] ref|XP_001107870.1| PREDICTED: tubulin, alpha, ubiquitous isof

  19. NCBI nr-aa BLAST: CBRC-SARA-01-0771 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0771 ref|NP_848509.1| progestin and adipoQ receptor family member VII ...[Homo sapiens] sp|Q86WK9|MPRA_HUMAN Membrane progestin receptor alpha (mPR alpha) (Progestin and adipoQ rece...ptor family member VII) gb|AAO47233.1|AF313620_1 putative membrane steroid receptor [Homo sapiens] gb|AAR08373.1| progesti...1| hCG1642829 [Homo sapiens] emb|CAM12867.1| progestin and adipoQ receptor family member VII [Homo sapiens] NP_848509.1 1e-178 87% ...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-0900 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0900 ref|YP_001122232.1| CDP-alcohol phosphatidyltransferase [Francise...lla tularensis subsp. tularensis WY96-3418] ref|YP_001427783.1| CDP-alcohol phosphatidyltransferase [Francis...ella tularensis subsp. holarctica FTA] gb|ABO47111.1| CDP-alcohol phosphatidyltransferase [Francisella tular...ensis subsp. tularensis WY96-3418] gb|EDN35713.1| phosphatidylserine synthase [Francis...ella tularensis subsp. novicida GA99-3549] gb|EDN37179.1| hypothetical protein FTDG_01588 [Francisella

  1. NCBI nr-aa BLAST: CBRC-SARA-01-1750 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1750 gb|ABR53744.1| opsin 1 short-wavelength senstive protein [Daubent...onia madagascariensis] gb|ABR53745.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensi...s] gb|ABR53746.1| opsin 1 short-wavelength senstive protein [Daubentonia madagascariensis] gb|ABR53747.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53748.1| opsin 1 short-wave...length senstive protein [Daubentonia madagascariensis] gb|ABR53749.1| opsin 1 short-wave

  2. saeRS and sarA act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Lara N Mrak

    Full Text Available Mutation of the staphylococcal accessory regulator (sarA limits biofilm formation in diverse strains of Staphylococcus aureus, but there are exceptions. One of these is the commonly studied strain Newman. This strain has two defects of potential relevance, the first being mutations that preclude anchoring of the fibronectin-binding proteins FnbA and FnbB to the cell wall, and the second being a point mutation in saeS that results in constitutive activation of the saePQRS regulatory system. We repaired these defects to determine whether either plays a role in biofilm formation and, if so, whether this could account for the reduced impact of sarA in Newman. Restoration of surface-anchored FnbA enhanced biofilm formation, but mutation of sarA in this fnbA-positive strain increased rather than decreased biofilm formation. Mutation of sarA in an saeS-repaired derivative of Newman (P18L or a Newman saeRS mutant (ΔsaeRS resulted in a biofilm-deficient phenotype like that observed in clinical isolates, even in the absence of surface-anchored FnbA. These phenotypes were correlated with increased production of extracellular proteases and decreased accumulation of FnbA and/or Spa in the P18L and ΔsaeRS sarA mutants by comparison to the Newman sarA mutant. The reduced accumulation of Spa was reversed by mutation of the gene encoding aureolysin, while the reduced accumulation of FnbA was reversed by mutation of the sspABC operon. These results demonstrate that saeRS and sarA act synergistically to repress the production of extracellular proteases that would otherwise limit accumulation of critical proteins that contribute to biofilm formation, with constitutive activation of saeRS limiting protease production, even in a sarA mutant, to a degree that can be correlated with increased enhanced capacity to form a biofilm. Although it remains unclear whether these effects are mediated directly or indirectly, studies done with an sspA::lux reporter suggest they

  3. PRISMA for Abstracts

    DEFF Research Database (Denmark)

    Beller, Elaine M; Glasziou, Paul P; Altman, Douglas G;


    Elaine Beller and colleagues from the PRISMA for Abstracts group provide a reporting guidelines for reporting abstracts of systematic reviews in journals and at conferences.......Elaine Beller and colleagues from the PRISMA for Abstracts group provide a reporting guidelines for reporting abstracts of systematic reviews in journals and at conferences....

  4. Illness, everyday life and narrative montage: the visual aesthetics of cancer in Sara Bro's Diary. (United States)

    Henriksen, Nina; Tjørnhøj-Thomsen, Tine; Hansen, Helle Ploug


    This article presents a study of Sara Bro's Diary (2004), a book montage of images and texts recording the experiences of a Danish breast cancer survivor, Sara Bro. It examines two montages of photography and text, drawing on Roland Barthes' concept of 'the third meaning' to explain and discuss the effect of the layered meanings in the montage alongside their multi-medium and self-referential expression. The discussion is centred on the aesthetic practices that are invited by Bro's book montage. The article considers how the juxtaposition of images and texts are experienced and co-created by the reader. It points to the effect of the aesthetics of disguise and carnival implicit in the visual-verbal montage and argues that these generate a third meaning. This meaning is associated with the breast cancer experience but is not directly discernible in the montage. The article concludes by discussing how Bro's montage acts as an ideological statement, subverting or 'poaching on' the health care system.

  5. First Results on the Epoch of Reionization from First Light with SARAS 2 (United States)

    Singh, Saurabh; Subrahmanyan, Ravi; Udaya Shankar, N.; Sathyanarayana Rao, Mayuri; Fialkov, Anastasia; Cohen, Aviad; Barkana, Rennan; Girish, B. S.; Raghunathan, A.; Somashekar, R.; Srivani, K. S.


    Long-wavelength spectral distortions in the cosmic microwave background arising from the 21 cm transition in neutral hydrogen are a key probe of the Cosmic Dawn and the Epoch of Reionization. These features may reveal the nature of the first stars and ultra-faint galaxies that transformed the spin temperature and ionization state of the primordial gas. SARAS 2 is a spectral radiometer purposely designed for the precision measurement of these monopole or all-sky global 21 cm spectral distortions. We use 63 hr nighttime observations of the radio background in the frequency band 110-200 MHz, with the radiometer deployed at the Timbaktu Collective in Southern India, to derive likelihoods for plausible redshifted 21 cm signals predicted by theoretical models. First light with SARAS 2 disfavors the class of models that feature weak X-ray heating (with {f}X≤slant 0.1) and rapid reionization (with peak \\tfrac{{{dT}}b}{{dz}}≥slant 120 mK per unit redshift interval).

  6. Should Community College Be Free? Forum. "Education Next" Talks with Sara Goldrick-Rab and Andrew P. Kelly (United States)

    Goldrick-Rab, Sara; Kelly, Andrew P.


    In this article, "Education Next" talks with Sara Goldrick-Rab and Andrew Kelly. President Obama's proposal for tuition-free community college, seems to have laid down a marker for the Democratic Party. Vermont senator Bernie Sanders is touting his plan for free four-year public college on the primary trail; Massachusetts senator…

  7. A Different Curriculum of Preparation for Work: Commentary on Mike Rose, Sara Goldrick-Rab, Kris Gutierrez and Norton Grubb (United States)

    Worthen, Helena Harlow


    The January 2012 issue of "Mind, Culture, and Activity" published the Invited Presidential Address "Rethinking Remedial Education and the Academic-Vocational Divide," given by Mike Rose at the 2011 meeting of the American Educational Research Association in New Orleans, along with responses and commentary by Sara Goldrick-Rab, Kris Gutierrez, and…

  8. Changes in Microbiota in Rumen Digesta and Feces Due to a Grain-Based Subacute Ruminal Acidosis (SARA) Challenge. (United States)

    Plaizier, Jan C; Li, Shucong; Danscher, Anne Mette; Derakshani, Hooman; Andersen, Pia H; Khafipour, Ehsan


    The effects of a grain-based subacute ruminal acidosis (SARA) challenge on bacteria in the rumen and feces of lactating dairy cows were determined. Six lactating, rumen-cannulated Danish Holstein cows were used in a cross-over study with two periods. Periods included two cows on a control diet and two cows on a SARA challenge. The control diet was a total mixed ration containing 45.5% dry matter (DM), 43.8% DM neutral detergent fiber, and 19.6% DM starch. The SARA challenge was conducted by gradually substituting the control diet with pellets containing 50% wheat and 50% barley over 3 days to reach a diet containing 55.6% DM, 31.3% DM neutral detergent fiber, and 31.8% DM starch, which was fed for four more days. Rumen fluid samples were collected at day 7 and 10 of experimental periods. Feces samples were collected on days 8 and 10 of these periods. Extracted DNA from the rumen and feces samples was analyzed to assess their bacterial communities using MiSeq Illumina sequencing of the V4 region of the 16S rRNA gene. The induction of SARA reduced the richness, diversity, and stability of bacterial communities and resulted in distinctly different microbiota in the rumen and feces. Bacteroidetes and Firmicutes were the most abundant phyla and, combined, they represented 76.9 and 94.4% of the bacterial community in the rumen fluid and the feces, respectively. Only the relative abundance of Firmicutes in the rumen was increased by the SARA challenge. In rumen fluid and feces, the abundances of nine out of the 90 and 25 out of the 89 taxa, respectively, were affected by the challenge. Hence, SARA challenge altered the composition of the bacterial community at the lower taxonomical level in the feces and therefore also likely in the hindgut, as well as in the rumen. However, only reductions in the bacterial richness and diversity in the rumen fluid and feces were in agreement with those of other studies and had a biological basis. Although the composition of the

  9. Introduction to abstract algebra

    CERN Document Server

    Nicholson, W Keith


    Praise for the Third Edition ". . . an expository masterpiece of the highest didactic value that has gained additional attractivity through the various improvements . . ."-Zentralblatt MATH The Fourth Edition of Introduction to Abstract Algebra continues to provide an accessible approach to the basic structures of abstract algebra: groups, rings, and fields. The book's unique presentation helps readers advance to abstract theory by presenting concrete examples of induction, number theory, integers modulo n, and permutations before the abstract structures are defined. Readers can immediately be

  10. Abstraction and Consolidation (United States)

    Monaghan, John; Ozmantar, Mehmet Fatih


    The framework for this paper is a recently developed theory of abstraction in context. The paper reports on data collected from one student working on tasks concerned with absolute value functions. It examines the relationship between mathematical constructions and abstractions. It argues that an abstraction is a consolidated construction that can…

  11. Abstraction and Problem Reformulation (United States)

    Giunchiglia, Fausto


    In work done jointly with Toby Walsh, the author has provided a sound theoretical foundation to the process of reasoning with abstraction (GW90c, GWS9, GW9Ob, GW90a). The notion of abstraction formalized in this work can be informally described as: (property 1), the process of mapping a representation of a problem, called (following historical convention (Sac74)) the 'ground' representation, onto a new representation, called the 'abstract' representation, which, (property 2) helps deal with the problem in the original search space by preserving certain desirable properties and (property 3) is simpler to handle as it is constructed from the ground representation by "throwing away details". One desirable property preserved by an abstraction is provability; often there is a relationship between provability in the ground representation and provability in the abstract representation. Another can be deduction or, possibly inconsistency. By 'throwing away details' we usually mean that the problem is described in a language with a smaller search space (for instance a propositional language or a language without variables) in which formulae of the abstract representation are obtained from the formulae of the ground representation by the use of some terminating rewriting technique. Often we require that the use of abstraction results in more efficient .reasoning. However, it might simply increase the number of facts asserted (eg. by allowing, in practice, the exploration of deeper search spaces or by implementing some form of learning). Among all abstractions, three very important classes have been identified. They relate the set of facts provable in the ground space to those provable in the abstract space. We call: TI abstractions all those abstractions where the abstractions of all the provable facts of the ground space are provable in the abstract space; TD abstractions all those abstractions wllere the 'unabstractions' of all the provable facts of the abstract space are

  12. Psyche’s Daughter of Today: Sara Jeannette Duncan and the New Woman

    Directory of Open Access Journals (Sweden)

    Michelle Gadpaille


    Full Text Available The Canadian novelist Sara Jeannette Duncan (1861-1922 constructed a New Woman heroine in the fin-de- siecle novel; A Daughter of Today (1894. Written in the popular mode of the transatlantic novel; the work engages in debate on the appropriate construction of femininity in art and public life. The heroine; Elfrida Bell; descends from artist; to muse; to model; to painted image—a descent framed by a rival male artist and a hostile London art scene. Represented as Psyche; the heroine undergoes a quest and failure similar to the mythical one. Adaptation of the Psyche myth clarifies the position of Duncan in the spectrum of gender ideologies of the fin-de- siecle.

  13. NCBI nr-aa BLAST: CBRC-SARA-01-1066 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1066 ref|NP_473371.1| MAS-related GPR, member X2 [Homo sapiens] sp|Q96...LB1|MRGX2_HUMAN Mas-related G-protein coupled receptor member X2 gb|AAK91805.1| G protein-coupled receptor [Homo sapie...ns] dbj|BAB89339.1| putative G-protein coupled receptor [Homo sapiens] dbj|BAC06030.1| seven trans...membrane helix receptor [Homo sapiens] gb|AAH63450.1| MAS-related GPR, member X2 [Homo sapie...ns] gb|AAW70056.1| MRGX2 [Homo sapiens] gb|AAW70057.1| MRGX2 [Homo sapiens] gb|AAW70058.1| MRGX2 [Homo sapie

  14. NCBI nr-aa BLAST: CBRC-SARA-01-0185 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0185 ref|NP_000852.1| histamine receptor H1 [Homo sapiens] ref|NP_001091681.1| histamine... receptor H1 [Homo sapiens] ref|NP_001091682.1| histamine receptor H1 [Homo sapiens] ref|NP_001091683.1| histamine... receptor H1 [Homo sapiens] sp|P35367|HRH1_HUMAN Histamine H1 receptor emb|CAA54182.1| histamine... H1 receptor [Homo sapiens] dbj|BAA05840.1| histamine H1 receptor [ sapiens] emb|CAA84380.1| Human histamine H1 receptor [Homo sapiens] dbj|BAA03319.1| histamine H1 receptor

  15. NCBI nr-aa BLAST: CBRC-SARA-01-1746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1746 ref|NP_705806.1| non-imprinted in Prader-Willi/Angelman syndrome ...1 [Mus musculus] sp|Q8BHK1|NIPA1_MOUSE Non-imprinted in Prader-Willi/Angelman syndrome region protein 1 homo...log gb|AAM34534.1| non-imprinted in Prader-Willi/Angelman syndrome 1 [Mus musculus] dbj|BAC32809.1| unnamed ...protein product [Mus musculus] gb|AAH55828.1| Non imprinted in Prader-Willi/ syndrome 1 homolog (human) [Mus musculus] gb|EDL21870.1| non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human) [Mus musculus] NP_705806.1 1e-113 81% ...

  16. NCBI nr-aa BLAST: CBRC-SARA-01-1199 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1199 ref|NP_035141.1| opioid receptor, kappa 1 [Mus musculus] sp|P33534|OPRK_MOUSE opioid receptor (KOR-1) (MSL-1) gb|AAA39363.1| kappa opioid receptor gb|AAB34130.2| opioid receptor; KOR [Mus sp.] gb|AAP32232.1| kappa-opioid receptor [Mus sp.] gb|AAI16796.1| Opioid receptor, 1 [Mus musculus] gb|AAI19027.1| Opioid receptor, kappa 1 [Mus muscu...lus] gb|EDL14259.1| opioid receptor, kappa 1, isoform CRA_a [Mus musculus] NP_035141.1 1e-78 92% ...

  17. NCBI nr-aa BLAST: CBRC-SARA-01-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-0004 ref|NP_000900.1| neuropeptide Y receptor Y1 [Homo sapiens] sp|P25929|NPY1R_HUMAN Neurope...ptide Y receptor type 1 (NPY1-R) gb|AAA73215.1| [Human neuropeptide Y peptide YY rece...ptor mRNA, complete cds.], gene product gb|AAA59947.1| neuropeptide Y receptor Y1 gb|AAH36657.1| Neuropeptid...e Y receptor Y1 [Homo sapiens] gb|AAS55647.1| neuropeptide Y1 receptor [Homo sapiens] gb|AAH71720.1| Neuro...peptide Y receptor Y1 [Homo sapiens] gb|EAX04841.1| neuropeptide Y receptor Y1 [Hom

  18. NCBI nr-aa BLAST: CBRC-SARA-01-1215 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1215 ref|NP_000901.1| neuropeptide Y receptor Y2 [Homo sapiens] ref|NP_001012655.1| neurope...ptide Y receptor Y2 [Pan troglodytes] sp|P49146|NPY2R_HUMAN Neuropeptide Y receptor typ...e 2 (NPY2-R) (NPY-Y2 receptor) sp|Q5IS62|NPY2R_PANTR Neuropeptide Y receptor type 2 (NPY2-R) (NPY-Y2 receptor) gb|AAC50281.1| neurope...ptide Y/peptide YY Y2 receptor gb|AAB04120.1| y2 receptor gb|AAC51115.1| type 2 neuropeptide Y receptor gb|AAO92062.1| neuropeptide Y receptor Y2 [Homo

  19. SarA is a negative regulator of Staphylococcus epidermidis biofilm formation

    DEFF Research Database (Denmark)

    Martin, Christer; Heinze, C.; Busch, M.


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant-associated infections. Nonetheless, large proportions of invasive S. epidermidis isolates fail to show accumulative biofilm growth in vitro. We here tested the hypothesis that this apparent paradox is related...... to the existence of superimposed regulatory systems suppressing a multi-cellular biofilm life style in vitro. Transposon mutagenesis of clinical significant but biofilm-negative S. epidermidis 1585 was used to isolate a biofilm positive mutant carrying a Tn917 insertion in sarA,chief regulator of staphylococcal...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via over-expression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  20. NCBI nr-aa BLAST: CBRC-SARA-01-1942 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-SARA-01-1942 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenerg...ic receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AA...B59487.1| alpha 1a/d adrenergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenerg

  1. Escribiendo el silencio: la contemplación poética de Sara Pujol

    Directory of Open Access Journals (Sweden)

    Gala, Candelas


    Full Text Available Reading Sara Pujol Russell's El fuego tiende su aire (1999 and Intacto asombro de la luz del silencio (2001, is entering into a poetic world whose content and form are both innovative and complex. This poetry invites the reader into a state of meditative contemplation that seeks correspondences among different elements in reality as the key to access a superior type of knowledge. Pujol's writing moves in the fringes between voice and silence, art and nature, meaning and nothingness, identity and difference, it seeks to surpass its own verbal texture while only in that texture does it find articulation and only through it does transcendence becones accessible. The focus of the present reading centers on the point where Pujol's language seeks to transcend the disjunction between sign and surrounding, the point where synthesis is fusion about to dissolve.La lectura de El fuego tiende su aire (1999 e Intacto asombro en la luz del silencio (2001 de Sara Pujol Russell, supone la entrada en un discurso poético innovador y complejo tanto en contenido como en forma. Esta poesía invita a una contemplación meditativa que busca las correspondencias entre los diversos elementos de la realidad como clave para acceder a un conocimiento superior. Su escritura se mueve en los bordes entre la voz y el silencio, el arte y la naturaleza, el sentido y el vacío, la identidad y la diferencia, buscando trascender lo que está más allá de su misma urdimbre verbal pero que sólo en ella se configura, y sólo desde ella se puede acceder. En el movimiento de esta escritura por superar la disyunción entre signo y entorno, en esa síntesis a punto de disolverse, es donde se enfoca la lectura en este ensayo.

  2. Abstracts--Citations (United States)

    Occupational Mental Health, 1972


    Provides abstracts and citations of journal articles and reports dealing with aspects of mental health. Topics include absenteeism, alcoholism, drug abuse, leisure, disadvantaged, job satisfaction, and others. (SB)

  3. Computational Abstraction Steps

    DEFF Research Database (Denmark)

    Thomsen, Lone Leth; Thomsen, Bent; Nørmark, Kurt


    and class instantiations. Our teaching experience shows that many novice programmers find it difficult to write programs with abstractions that materialise to concrete objects later in the development process. The contribution of this paper is the idea of initiating a programming process by creating......In this paper we discuss computational abstraction steps as a way to create class abstractions from concrete objects, and from examples. Computational abstraction steps are regarded as symmetric counterparts to computational concretisation steps, which are well-known in terms of function calls...

  4. Functional impairment in patients with myotonic dystrophy type 1 can be assessed by an ataxia rating scale (SARA). (United States)

    DiPaolo, Giovanni; Jimenez-Moreno, Cecilia; Nikolenko, Nikoletta; Atalaia, Antonio; Monckton, Darren G; Guglieri, Michela; Lochmüller, Hanns


    Myotonic dystrophy type 1 (DM1) is not characterised by ataxia per se; however, DM1 and ataxia patients show similar disturbances in movement coordination often experiencing walking and balance difficulties, although caused by different underlying pathologies. This study aims to investigate the use of a scale previously described for the assessment and rating of ataxia (SARA) with the hypothesis that it could have utility in DM1 patients as a measure of disease severity and risk of falling. Data from 54 DM1 patients were pulled from the PHENO-DM1 natural history study for analysis. Mean SARA score in the DM1 population was 5.45 relative to the maximum score of eight. A flooring effect (score 0) was observed in mild cases within the sample. Inter-rater and test-retest reliability was high with intraclass coefficients (ICC) of 0.983 and 1.00, respectively. Internal consistency was acceptable as indicated by a Cronbach's alpha of 0.761. Component analysis revealed two principle components. SARA correlated with: (1) all measures of muscle function tested, including quantitative muscle testing of ankle dorsiflexion (r = -0.584*), the 6 min walk test (r = -0.739*), 10 m walk test (r = 0.741*), and the nine hole peg test (r = 0.602*) and (2) measures of disease severity/burden, such as MIRS (r = 0.718*), MDHI (r = 0.483*), and DM1-Activ (r = -0.749*) (*p < 0.001). The SARA score was predicted by an interaction between modal CTG repeat length and age at sampling (r = 0.678, p = 0.003). A score of eight or above predicted the use of a walking aid with a sensitivity of 100% and a specificity of 85.7%. We suggest that further research is warranted to ascertain whether SARA or components of SARA are useful outcome measures for clinical trials in DM1. As a tool, it can be used for gathering information about disease severity/burden and helping to identify patients in need of a walking aid, and can potentially be applied in both research and healthcare

  5. Truthful Monadic Abstractions

    DEFF Research Database (Denmark)

    Brock-Nannestad, Taus; Schürmann, Carsten


    indefinitely, finding neither a proof nor a disproof of a given subgoal. In this paper we characterize a family of truth-preserving abstractions from intuitionistic first-order logic to the monadic fragment of classical first-order logic. Because they are truthful, these abstractions can be used to disprove...

  6. Completeness of Lyapunov Abstraction

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Sloth, Christoffer


    This paper addresses the generation of complete abstractions of polynomial dynamical systems by timed automata. For the proposed abstraction, the state space is divided into cells by sublevel sets of functions. We identify a relation between these functions and their directional derivatives along...

  7. Knowledge-Based Abstracting. (United States)

    Black, William J.


    Discussion of automatic abstracting of technical papers focuses on a knowledge-based method that uses two sets of rules. Topics discussed include anaphora; text structure and discourse; abstracting techniques, including the keyword method and the indicator phrase method; and tools for text skimming. (27 references) (LRW)

  8. Completeness of Lyapunov Abstraction

    Directory of Open Access Journals (Sweden)

    Rafael Wisniewski


    Full Text Available In this work, we continue our study on discrete abstractions of dynamical systems. To this end, we use a family of partitioning functions to generate an abstraction. The intersection of sub-level sets of the partitioning functions defines cells, which are regarded as discrete objects. The union of cells makes up the state space of the dynamical systems. Our construction gives rise to a combinatorial object - a timed automaton. We examine sound and complete abstractions. An abstraction is said to be sound when the flow of the time automata covers the flow lines of the dynamical systems. If the dynamics of the dynamical system and the time automaton are equivalent, the abstraction is complete. The commonly accepted paradigm for partitioning functions is that they ought to be transversal to the studied vector field. We show that there is no complete partitioning with transversal functions, even for particular dynamical systems whose critical sets are isolated critical points. Therefore, we allow the directional derivative along the vector field to be non-positive in this work. This considerably complicates the abstraction technique. For understanding dynamical systems, it is vital to study stable and unstable manifolds and their intersections. These objects appear naturally in this work. Indeed, we show that for an abstraction to be complete, the set of critical points of an abstraction function shall contain either the stable or unstable manifold of the dynamical system.

  9. Designing for Mathematical Abstraction (United States)

    Pratt, Dave; Noss, Richard


    Our focus is on the design of systems (pedagogical, technical, social) that encourage mathematical abstraction, a process we refer to as "designing for abstraction." In this paper, we draw on detailed design experiments from our research on children's understanding about chance and distribution to re-present this work as a case study in designing…

  10. Completeness of Lyapunov Abstraction

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Sloth, Christoffer


    This paper addresses the generation of complete abstractions of polynomial dynamical systems by timed automata. For the proposed abstraction, the state space is divided into cells by sublevel sets of functions. We identify a relation between these functions and their directional derivatives along...

  11. Data Abstraction in GLISP. (United States)

    Novak, Gordon S., Jr.

    GLISP is a high-level computer language (based on Lisp and including Lisp as a sublanguage) which is compiled into Lisp. GLISP programs are compiled relative to a knowledge base of object descriptions, a form of abstract datatypes. A primary goal of the use of abstract datatypes in GLISP is to allow program code to be written in terms of objects,…

  12. Nuclear medicine. Abstracts; Nuklearmedizin 2000. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    This issue of the journal contains the abstracts of the 183 conference papers as well as 266 posters presented at the conference. Subject fields covered are: Neurology, psychology, oncology, pediatrics, radiopharmacy, endocrinology, EDP, measuring equipment and methods, radiological protection, cardiology, and therapy. (orig./CB) [German] Die vorliegende Zeitschrift enthaelt die Kurzfassungen der 183 auf der Tagung gehaltenen Vortraege sowie der 226 praesentierten Poster, die sich mit den folgenden Themen befassten: Neurologie, Psychiatrie, Onkologie, Paediatrie, Radiopharmazie, Endokrinologie, EDV, Messtechnik, Strahlenschutz, Kardiologie sowie Therapie. (MG)

  13. The Sub-keV Atom Reflecting Analyzer (SARA) Experiment Aboard Chandrayaan-1 Mission: Instrument and Observations

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Barabash, Stas; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura


    SARA experiment aboard the first Indian lunar mission Chandrayaan-1 had the objective to explore the solar wind-lunar interaction using energetic neutral atoms (ENA) from the lunar surface as diagnostic tool. SARA consisted of an ENA imaging mass analyzer CENA (Chandrayaan-1 Energetic Neutral Analyzer) and an ion mass analyser SWIM (Solar Wind Monitor), along with a digital processing unit (DPU) which commands and controls the sensors and provides the interface to the spacecraft. Both sensors have provided excellent observational data. CENA has observed ENAs from the lunar surface and found that ~20% of the incident solar wind ions get backscattered as ENAs from the lunar surface. This is contrary to the previous assumptions of almost complete absorption of solar wind by the lunar surface. The observation is relevant for other airless bodies in the solar system.

  14. Holocene environment changes around the Sara Us River, northern China, revealed by optical dating of lacustrine-aeolian sediments (United States)

    Zhao, Hui; Sheng, Yongwei; Li, Bo; Fan, Yuxin


    The Sara Us River is located along the boundary of the Mu Us Desert and the Chinese Loess Plateau in northern China. The river has cut down through Quaternary sediments creating 70-80 m deep valleys with thick lacustrine/aeolian sequences exposed. We applied optical stimulated luminescence on sediments from a Holocene section of aeolian sand/lacustrine deposits in the top of the river valley. The dating results show that a humid period existed from 7.1 to 2.0 ka ago as evidenced by two layers of peat and lacustrine sediments. However, compared to other published Holocene sections in the Sara Us River valleys close to the section under studying, the local environment experienced very complicated changes during the Holocene. All of the sections recorded a period with drought and/or cold before the Holocene at around 13 ka, and an episode of aridity after about 2 ka ago as evidenced by the layers of aeolian sand. However, the ages of the lacustrine and peat layers in these sections are substantially different. Geomorphological analysis by digital elevation models does not support the existence of a mega lake covering the study area at 2 ka. The intricate environmental changes may have been caused by the meandering of the Sara Us River. Environmental changes also strongly affected human migration in this area, which is documented by Chinese historical records.

  15. SARA: a self-adaptive and resource-aware approach towards secure wireless ad hoc and sensor networks (United States)

    Chigan, Chunxiao; Li, Leiyuan


    Providing security is essential for mission critical Wireless Ad Hoc and Sensor Networks (WAHSN) applications. Often a highly secure mechanism inevitably consumes a rather large amount of system resources, which in turn may unintentionally cause a Security Service Denial of Service (SSDoS) attack. This paper proposes a self-adaptive resource-aware (SARA) security provisioning approach for WAHSNs. For resource scarce WAHSNs, SARA strives to provide the optimal tradeoff between the sufficient security (which is reflected by the Security Index (SI)) and the acceptable network performance degradation (which is reflected by the Performance Index (PI)). With the support of the offline optimal secure protocol selection module and the online self-adaptive security control module, SARA is capable of employing different combinations of secure protocol sets to satisfy different security need at different condition for different applications. To determine the security index SI of a secure protocol set, a heuristic cross-layer security-service mapping mechanism is presented. Furthermore, we evaluate performance index PI of a secure protocol set via simulation followed by Analysis of Variance (ANOVA). Consequently, the proposed self-adaptive security provisioning based on both SI and PI achieves the maximum overall network security services and network performance services, without causing the SSDoS attack. Furthermore, this self-adaptive mechanism is capable of switching from one secure protocol set to another while keeping similar level of security and performance, it thus provides additional security by security service hopping.

  16. Saras Cranes in Palwal District in Southern Haryana are Asking for Immediate Attention for Their Last Rescue Effort

    Directory of Open Access Journals (Sweden)

    Tirshem Kumar Kaushik


    Full Text Available Saras Cranes Grus antigone are endangered birds of open wetlands with highly worrying depletion trends being witnessed related with disappearance of marshy and shallow perennial, expansive wetlands throughout northern India. Alongside, massive hunting in 18th, 19th and 20th centuries and even today is another serious cause for their worrisome deterioration. Also, destruction of nests, eggs, fledglings and adults by aboriginals indeliberately or deliberately is causing these cranes to perish sooner than latter, completely. Now, Saras Cranes are found in limited number and domain as four populations in the entire world including India, China, Burma, South East Asia and northern Australia. The population of Indian Saras Crane is pitiably restricted to Etawa and Mainpuri districts of Uttar Pradesh. Stray birds of this species are restricted to Kanha National Park in Madhya Pradesh and in some parts of Gujarat and Assam. It is interesting to note that few pairs have been seen in Faridabad and Palwal districts in southern Haryana, India. These need to be protected and conserved.

  17. Studying the Lunar-Solar Wind Interaction with the SARA Experiment aboard the Indian Lunar Mission Chandrayaan-1

    CERN Document Server

    Bhardwaj, Anil; Dhanya, M B; Wieser, Martin; Yoshifumi, Futaana; Holmstrom, Mats; Sridharan, R; Wurz, Peter; Schaufelberger, Audrey; Kazushi, Asamura; 10.1063/1.3395916


    The first Indian lunar mission Chandrayaan-1 was launched on 22 October 2008. The Sub-keV Atom Reflecting Analyzer (SARA) instrument onboard Chandrayaan-1 consists of an energetic neutral atom (ENA) imaging mass analyzer called CENA (Chandrayaan-1 Energetic Neutrals Analyzer), and an ion-mass analyzer called SWIM (Solar wind Monitor). CENA performed the first ever experiment to study the solar wind-planetary surface interaction via detection of sputtered neutral atoms and neutralized backscattered solar wind protons in the energy range ~0.01-3.0 keV. SWIM measures solar wind ions, magnetosheath and magnetotail ions, as well as ions scattered from lunar surface in the ~0.01-15 keV energy range. The neutral atom sensor uses conversion of the incoming neutrals to positive ions, which are then analyzed via surface interaction technique. The ion mass analyzer is based on similar principle. This paper presents the SARA instrument and the first results obtained by the SWIM and CENA sensors. SARA observations suggest...

  18. Abstracts of SIG Sessions. (United States)

    Proceedings of the ASIS Annual Meeting, 1997


    Presents abstracts of SIG Sessions. Highlights include digital collections; information retrieval methods; public interest/fair use; classification and indexing; electronic publication; funding; globalization; information technology projects; interface design; networking in developing countries; metadata; multilingual databases; networked…

  19. Computational Abstraction Steps

    DEFF Research Database (Denmark)

    Thomsen, Lone Leth; Thomsen, Bent; Nørmark, Kurt


    and class instantiations. Our teaching experience shows that many novice programmers find it difficult to write programs with abstractions that materialise to concrete objects later in the development process. The contribution of this paper is the idea of initiating a programming process by creating......In this paper we discuss computational abstraction steps as a way to create class abstractions from concrete objects, and from examples. Computational abstraction steps are regarded as symmetric counterparts to computational concretisation steps, which are well-known in terms of function calls...... or capturing concrete values, objects, or actions. As the next step, some of these are lifted to a higher level by computational means. In the object-oriented paradigm the target of such steps is classes. We hypothesise that the proposed approach primarily will be beneficial to novice programmers or during...

  20. Mathematical games, abstract games

    CERN Document Server

    Neto, Joao Pedro


    User-friendly, visually appealing collection offers both new and classic strategic board games. Includes abstract games for two and three players and mathematical games such as Nim and games on graphs.

  1. Abstract sectional category

    CERN Document Server

    Diaz, F; Garcia, P; Murillo, A; Remedios, J


    We study, in an abstract axiomatic setting, the notion of sectional category of a morphism. From this, we unify and generalize known results about this invariant in different settings as well as we deduce new applications.

  2. Abstracts of contributed papers

    Energy Technology Data Exchange (ETDEWEB)


    This volume contains 571 abstracts of contributed papers to be presented during the Twelfth US National Congress of Applied Mechanics. Abstracts are arranged in the order in which they fall in the program -- the main sessions are listed chronologically in the Table of Contents. The Author Index is in alphabetical order and lists each paper number (matching the schedule in the Final Program) with its corresponding page number in the book.

  3. TRADE instructional materials for SARA/OSHA training. Volume 2, Managers and supervisors training

    Energy Technology Data Exchange (ETDEWEB)


    This document provides instructional materials for an eight-hour training course for managers and supervisors of hazardous waste sites. It is one of three volumes of course materials TRADE is preparing to help DOE contractor training staff comply with 29 CFR 1910.120, the Occupational Health and Safety Administration (OSHA) rule that implements Title I of the Superfund Amendments and Reauthorization Act (SARA) of 1986. OSHA`s final rule for hazardous waste operators was published in the Federal Register of March 6, 1989 (54 FR 9294). Combined with the materials in Volumes I and III and with appropriate site-specific information, these materials will help DOE contractors to meet the requirements of 1910.120 (e) that ``on-site management and supervisors directly responsible for, or who supervise employees engaged in, hazardous waste operations`` receive the same initial training as that of the employees they supervise and at least eight additional hours of specialized training in managing hazardous waste operations.

  4. La difesa della donna ebrea: Sara Copio Sullam e Debora Ascarelli

    Directory of Open Access Journals (Sweden)

    Umberto Fortis


    Full Text Available Sara Copio Sullam and Debora Ascarelli, the best-known Jewish women poets of the age of the Italian ghetto, have often been studied with a focus on the distinctive features of their writing: the former as a translator of sacred texts, the latter as the author of original verses, sometimes written as a risposta per le rime (reply through rhymes or in defence of her orthodoxy. They share, however, a common theme, which has often been neglected: the defence of the Jewish woman, which is overt in some of Copio’s sonnets and prose, whereas it has not yet been properly pointed out in some of Ascarelli’s verses. This paper aims at bringing this theme to the fore not only in Copio, through a rereading of some passages of her Manifesto, but also in Debora Ascarelli, through an analysis of her few original verses. These hendecasyllables certainly reflect the Petrarchan and classicistic atmosphere of the late 16th century in Rome, but they are far from the mainstream modes of women’s poetry of the age. They allow us, therefore, to highlight, besides the differences, the similarities between the two poetesses; their commitment, in the late 16th and early 17th century, to the intellectual and moral defence of the Jewish woman, in a context of general depreciation of women, but also in the background of the claim to the “nobility and excellence of women”.

  5. Metacognition and abstract reasoning. (United States)

    Markovits, Henry; Thompson, Valerie A; Brisson, Janie


    The nature of people's meta-representations of deductive reasoning is critical to understanding how people control their own reasoning processes. We conducted two studies to examine whether people have a metacognitive representation of abstract validity and whether familiarity alone acts as a separate metacognitive cue. In Study 1, participants were asked to make a series of (1) abstract conditional inferences, (2) concrete conditional inferences with premises having many potential alternative antecedents and thus specifically conducive to the production of responses consistent with conditional logic, or (3) concrete problems with premises having relatively few potential alternative antecedents. Participants gave confidence ratings after each inference. Results show that confidence ratings were positively correlated with logical performance on abstract problems and concrete problems with many potential alternatives, but not with concrete problems with content less conducive to normative responses. Confidence ratings were higher with few alternatives than for abstract content. Study 2 used a generation of contrary-to-fact alternatives task to improve levels of abstract logical performance. The resulting increase in logical performance was mirrored by increases in mean confidence ratings. Results provide evidence for a metacognitive representation based on logical validity, and show that familiarity acts as a separate metacognitive cue.

  6. Monadic abstract interpreters

    DEFF Research Database (Denmark)

    Sergey, Ilya; Devriese, Dominique; Might, Matthew;


    -bounding to be independent of any particular semantics. Monads become the unifying agent between these concepts and between semantics. For instance, by plugging the same “context-insensitivity monad” into a monadicallyparameterized semantics for Java or for the lambda calculus, it yields the expected context......-insensitive analysis. To achieve this unification, we develop a systematic method for transforming a concrete semantics into a monadically-parameterized abstract machine. Changing the monad changes the behavior of the machine. By changing the monad, we recover a spectrum of machines—from the original concrete...... semantics to a monovariant, flow- and context-insensitive static analysis with a singly-threaded heap and weak updates. The monadic parameterization also suggests an abstraction over the ubiquitous monotone fixed-point computation found in static analysis. This abstraction makes it straightforward...

  7. Monadic abstract interpreters

    DEFF Research Database (Denmark)

    Sergey, Ilya; Devriese, Dominique; Might, Matthew


    -bounding to be independent of any particular semantics. Monads become the unifying agent between these concepts and between semantics. For instance, by plugging the same “context-insensitivity monad” into a monadicallyparameterized semantics for Java or for the lambda calculus, it yields the expected context...... semantics to a monovariant, flow- and context-insensitive static analysis with a singly-threaded heap and weak updates. The monadic parameterization also suggests an abstraction over the ubiquitous monotone fixed-point computation found in static analysis. This abstraction makes it straightforward...... to instrument an analysis with high-level strategies for improving precision and performance, such as abstract garbage collection and widening. While the paper itself runs the development for continuationpassing style, our generic implementation replays it for direct-style lambda-calculus and Featherweight Java...

  8. The deleuzian abstract machines

    DEFF Research Database (Denmark)

    Werner Petersen, Erik


    production. In Kafka: Toward a Minor Literature, Deleuze and Guatari gave the most comprehensive explanation to the abstract machine in the work of art. Like the war-machines of Virilio, the Kafka-machine operates in three gears or speeds. Furthermore, the machine is connected to spatial diagrams...

  9. ARM : abstract rewriting machine

    NARCIS (Netherlands)

    J.F.T. Kamperman; H.R. Walters (Pum)


    textabstractTerm rewriting is frequently used as implementation technique for algebraic specifications. In this paper we present the abstract term rewriting machine (ARM), which has an extremely compact instruction set and imposes no restrictions on the implemented TRSs. Apart from standard

  10. Abstraction and art. (United States)

    Gortais, Bernard


    In a given social context, artistic creation comprises a set of processes, which relate to the activity of the artist and the activity of the spectator. Through these processes we see and understand that the world is vaster than it is said to be. Artistic processes are mediated experiences that open up the world. A successful work of art expresses a reality beyond actual reality: it suggests an unknown world using the means and the signs of the known world. Artistic practices incorporate the means of creation developed by science and technology and change forms as they change. Artists and the public follow different processes of abstraction at different levels, in the definition of the means of creation, of representation and of perception of a work of art. This paper examines how the processes of abstraction are used within the framework of the visual arts and abstract painting, which appeared during a period of growing importance for the processes of abstraction in science and technology, at the beginning of the twentieth century. The development of digital platforms and new man-machine interfaces allow multimedia creations. This is performed under the constraint of phases of multidisciplinary conceptualization using generic representation languages, which tend to abolish traditional frontiers between the arts: visual arts, drama, dance and music. PMID:12903659

  11. SPR 2015. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The volume contains the abstracts of the SPR (society for pediatric radiology) 2015 meeting covering the following issues: fetal imaging, muscoskeletal imaging, cardiac imaging, chest imaging, oncologic imaging, tools for process improvement, child abuse, contrast enhanced ultrasound, image gently - update of radiation dose recording/reporting/monitoring - meaningful or useless meaning?, pediatric thoracic imaging, ALARA.

  12. The Abstraction Engine

    DEFF Research Database (Denmark)

    Fortescue, Michael David

    The main thesis of this book is that abstraction, far from being confined to higher forms of cognition, language and logical reasoning, has actually been a major driving force throughout the evolution of creatures with brains. It is manifest in emotive as well as rational thought. Wending its way...


    Institute of Scientific and Technical Information of China (English)


    Study on Optimization of Enzymic Preparation of Collagen Polypeptide from Skin of Gadous macrocephaius Liu Chun-e et al. (1) Abstract Enzymolysis was used to prepare collagen peptide. The optimum condition was determined based on one way ANOVA and orthogonal experimental design. The result indicated that use alkaline protease on the concentration of 4.5%,

  14. Parent Education: Abstract Bibliography. (United States)

    Kremer, Barbara, Comp.

    This bibliography has been compiled to alert educators to parent education documents found in the ERIC microfiche collection and in journal literature. Abstracts of selected documents have been taken from "Research in Education (RIE)", and journal article citations from the "Current Index to Journals in Education (CIJE)". Included are published…


    Institute of Scientific and Technical Information of China (English)


    Study on the Long-distance Transportation of Argopecten irridians concentricus ShenQin-long(1) Abstract The experiment was carried out in order to improve the survival rate of the scallop. The result indicated that keeping the water temperature at 4℃ was reasonable for the long-distance transportation of the scallop with oxygenated bags.

  16. Full Abstraction for HOPLA

    DEFF Research Database (Denmark)

    Nygaard, Mikkel; Winskel, Glynn


    A fully abstract denotational semantics for the higher-order process language HOPLA is presented. It characterises contextual and logical equivalence, the latter linking up with simulation. The semantics is a clean, domain-theoretic description of processes as downwards-closed sets of computation...

  17. Abstracts of SIG Sessions. (United States)

    Proceedings of the ASIS Annual Meeting, 1995


    Presents abstracts of 15 special interest group (SIG) sessions. Topics include navigation and information utilization in the Internet, natural language processing, automatic indexing, image indexing, classification, users' models of database searching, online public access catalogs, education for information professions, information services,…

  18. Abstraction through Game Play (United States)

    Avraamidou, Antri; Monaghan, John; Walker, Aisha


    This paper examines the computer game play of an 11-year-old boy. In the course of building a virtual house he developed and used, without assistance, an artefact and an accompanying strategy to ensure that his house was symmetric. We argue that the creation and use of this artefact-strategy is a mathematical abstraction. The discussion…

  19. Beyond the abstractions?

    DEFF Research Database (Denmark)

    Olesen, Henning Salling


      The anniversary of the International Journal of Lifelong Education takes place in the middle of a conceptual landslide from lifelong education to lifelong learning. Contemporary discourses of lifelong learning etc are however abstractions behind which new functions and agendas for adult education...

  20. Reasoning abstractly about resources (United States)

    Clement, B.; Barrett, A.


    r describes a way to schedule high level activities before distributing them across multiple rovers in order to coordinate the resultant use of shared resources regardless of how each rover decides how to perform its activities. We present an algorithm for summarizing the metric resource requirements of an abstract activity based n the resource usages of its potential refinements.

  1. Incremental Bisimulation Abstraction Refinement

    DEFF Research Database (Denmark)

    Godskesen, Jens Christian; Song, Lei; Zhang, Lijun


    an abstraction refinement approach for the probabilistic computation tree logic (PCTL), which is based on incrementally computing a sequence of may- and must-quotient automata. These are induced by depth-bounded bisimulation equivalences of increasing depth. The approach is both sound and complete, since...

  2. Seismic Consequence Abstraction

    Energy Technology Data Exchange (ETDEWEB)

    M. Gross


    The primary purpose of this model report is to develop abstractions for the response of engineered barrier system (EBS) components to seismic hazards at a geologic repository at Yucca Mountain, Nevada, and to define the methodology for using these abstractions in a seismic scenario class for the Total System Performance Assessment - License Application (TSPA-LA). A secondary purpose of this model report is to provide information for criticality studies related to seismic hazards. The seismic hazards addressed herein are vibratory ground motion, fault displacement, and rockfall due to ground motion. The EBS components are the drip shield, the waste package, and the fuel cladding. The requirements for development of the abstractions and the associated algorithms for the seismic scenario class are defined in ''Technical Work Plan For: Regulatory Integration Modeling of Drift Degradation, Waste Package and Drip Shield Vibratory Motion and Seismic Consequences'' (BSC 2004 [DIRS 171520]). The development of these abstractions will provide a more complete representation of flow into and transport from the EBS under disruptive events. The results from this development will also address portions of integrated subissue ENG2, Mechanical Disruption of Engineered Barriers, including the acceptance criteria for this subissue defined in Section of the ''Yucca Mountain Review Plan, Final Report'' (NRC 2003 [DIRS 163274]).


    Institute of Scientific and Technical Information of China (English)


    Study on the Enrichment Regularity of Semicarbazide in Algae Tian Xiu-hui eta1. (1) Abstract Semicarbazide (SEM) in three kinds of representative algae (Nitzschia closterium, Tetraselmis chui and Dicrateria sp) and seawater was determined using ultra performance liquid chromatogram tandem mass spectrometry in this work. Accumulation of semicarbazide (SEM) in algae under laboratory conditions was studied.

  4. Metaphors in Abstract Thought

    NARCIS (Netherlands)

    I. Boot (Inge)


    textabstractThe aim of the dissertation was to investigate the Conceptual Metaphor Theory (CMT, Lakoff & Johnson, 1980, 1999).The CMT proposes that abstract concepts are partly structured by concrete concepts through the mechanism of metaphorical mapping. In Chapter 2 we wanted to investigate the

  5. 2002 NASPSA Conference Abstracts. (United States)

    Journal of Sport & Exercise Psychology, 2002


    Contains abstracts from the 2002 conference of the North American Society for the Psychology of Sport and Physical Activity. The publication is divided into three sections: the preconference workshop, "Effective Teaching Methods in the Classroom;" symposia (motor development, motor learning and control, and sport psychology); and free…

  6. ESPR 2014. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The Proceedings on ESPR 2014 include abstracts concerning the following topics: pediatric imaging: thorax, cardiovascular system, CT-technique, head and neck, perinatal imaging, molecular imaging; interventional imaging; specific focus: muscoskeletal imaging in juvenile idiopathic arthritis; radiation protection; oncology; molecular imaging - nuclear medicine; uroradiology and abdominal imaging.

  7. Cambridge Scientific Abstracts

    Institute of Scientific and Technical Information of China (English)


    正Meteorological and Environmental Research has been included by Cambridge Scientific Abstracts (CSA) since 2011. CSA is a retrieval system published by Cambridge Information Group. CSA was founded in the late 1950's,and became part of the CIG family in 1971. CSA's original mission was publishing secondary source materials relating to the physical sciences. Completely

  8. Cambridge Scientific Abstracts

    Institute of Scientific and Technical Information of China (English)


    Meteorological and Environmental Research has been included by Cambridge Scientific Abstracts (CSA) since 2011. CSA is a retrieval system published by Cambridge Information Group. CSA was founded in the late 1950’s,and became part of the CIG family in 1971. CSA’s original mission was publishing secondary source materials relating to the physical sciences. Completely

  9. Impredicative concurrent abstract predicates

    DEFF Research Database (Denmark)

    Svendsen, Kasper; Birkedal, Lars


    We present impredicative concurrent abstract predicates { iCAP { a program logic for modular reasoning about concurrent, higher- order, reentrant, imperative code. Building on earlier work, iCAP uses protocols to reason about shared mutable state. A key novel feature of iCAP is the ability to dene...

  10. EBS Radionuclide Transport Abstraction

    Energy Technology Data Exchange (ETDEWEB)

    R. Schreiner


    The purpose of this work is to develop the Engineered Barrier System (EBS) radionuclide transport abstraction model, as directed by a written development plan (CRWMS M&O 1999a). This abstraction is the conceptual model that will be used to determine the rate of release of radionuclides from the EBS to the unsaturated zone (UZ) in the total system performance assessment-license application (TSPA-LA). In particular, this model will be used to quantify the time-dependent radionuclide releases from a failed waste package (WP) and their subsequent transport through the EBS to the emplacement drift wall/UZ interface. The development of this conceptual model will allow Performance Assessment Operations (PAO) and its Engineered Barrier Performance Department to provide a more detailed and complete EBS flow and transport abstraction. The results from this conceptual model will allow PA0 to address portions of the key technical issues (KTIs) presented in three NRC Issue Resolution Status Reports (IRSRs): (1) the Evolution of the Near-Field Environment (ENFE), Revision 2 (NRC 1999a), (2) the Container Life and Source Term (CLST), Revision 2 (NRC 1999b), and (3) the Thermal Effects on Flow (TEF), Revision 1 (NRC 1998). The conceptual model for flow and transport in the EBS will be referred to as the ''EBS RT Abstraction'' in this analysis/modeling report (AMR). The scope of this abstraction and report is limited to flow and transport processes. More specifically, this AMR does not discuss elements of the TSPA-SR and TSPA-LA that relate to the EBS but are discussed in other AMRs. These elements include corrosion processes, radionuclide solubility limits, waste form dissolution rates and concentrations of colloidal particles that are generally represented as boundary conditions or input parameters for the EBS RT Abstraction. In effect, this AMR provides the algorithms for transporting radionuclides using the flow geometry and radionuclide concentrations

  11. Building Safe Concurrency Abstractions

    DEFF Research Database (Denmark)

    Madsen, Ole Lehrmann


    Concurrent object-oriented programming in Beta is based on semaphores and coroutines and the ability to define high-level concurrency abstractions like monitors, and rendezvous-based communication, and their associated schedulers. The coroutine mechanism of SIMULA has been generalized...... into the notions of concurrent and alternating objects. Alternating objects may be used to start a cooperative thread for each possible blocking communication and is thus an alternative to asynchronous messages and guarded commands. Beta like SIMULA, the first OO language, was designed as a language for modeling...... as well as programming, and we describe how this has had an impact on the design of the language. Although Beta supports the definition of high-level concurrency abstractions, the use of these rely on the discipline of the programmer as is the case for Java and other mainstream OO languages. We introduce...

  12. Abstracts of Main Essays

    Institute of Scientific and Technical Information of China (English)


    The Position of Capitalist Study in Marx's Social Formation Theory Yang Xue-gong Xi Da-min The orientation and achievements of Marx's study of Capitalism or bourgeois society is the foundation of his social formation theory. On the base of his scientific study of capitalism, Marx evolves his concept of eco- nomic social formation, the scientific methodology of researching other social formations or social forms, the clues of the development of social formations, the abstraction of the general laws as well as his reflection on this abstraction. A full evaluation and acknowledgement of the position of capitalist study in Marx's social formation theory is crucial for revising Marx's social formation theory in the new era and for solving some controversial issues in the research of social formation theory.

  13. An Abstract Data Interface (United States)

    Allan, D. J.

    The Abstract Data Interface (ADI) is a system within which both abstract data models and their mappings on to file formats can be defined. The data model system is object-oriented and closely follows the Common Lisp Object System (CLOS) object model. Programming interfaces in both C and \\fortran are supplied, and are designed to be simple enough for use by users with limited software skills. The prototype system supports access to those FITS formats most commonly used in the X-ray community, as well as the Starlink NDF data format. New interfaces can be rapidly added to the system---these may communicate directly with the file system, other ADI objects or elsewhere (e.g., a network connection).

  14. Introduction to abstract analysis

    CERN Document Server

    Goldstein, Marvin E


    Developed from lectures delivered at NASA's Lewis Research Center, this concise text introduces scientists and engineers with backgrounds in applied mathematics to the concepts of abstract analysis. Rather than preparing readers for research in the field, this volume offers background necessary for reading the literature of pure mathematics. Starting with elementary set concepts, the treatment explores real numbers, vector and metric spaces, functions and relations, infinite collections of sets, and limits of sequences. Additional topics include continuity and function algebras, Cauchy complet

  15. DEGRO 2017. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The volume includes abstracts of the Annual DEGRO Meeting 2017 covering lectures and poster sessions with the following issues: lymphoma, biology, physics, radioimmunotherapy, sarcomas and rare tumors, prostate carcinoma, lung tumors, benign lesions and new media, mamma carcinoma, gastrointestinal tumors, quality of life, care science and quality assurance, high-technology methods and palliative situation, head-and-neck tumors, brain tumors, central nervous system metastases, guidelines, radiation sensitivity, radiotherapy, radioimmunotherapy.

  16. SPR 2014. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The proceedings of the SPR 2014 meeting include abstracts on the following topics: Body imaging techniques: practical advice for clinic work; thoracic imaging: focus on the lungs; gastrointestinal imaging: focus on the pancreas and bowel; genitourinary imaging: focus on gonadal radiology; muscoskeletal imaging; focus on oncology; child abuse and nor child abuse: focus on radiography; impact of NMR and CT imaging on management of CHD; education and communication: art and practice in pediatric radiology.

  17. Research Abstracts of 1982. (United States)


    Activity in Hamsters (Abstract #667) 9. L. SIMONSON*, B. LAMBERTS, E. PEDERSON and D. REIHER’--*gEffect of Saliva and Sucrose on Adherence of S.. mutans to...presence of osteosclerosis and/or enlargement of periodontal ligament space; pain duration greater than one hour and spontaneous or severe pain; no...Unstimulated whole saliva was collected in chilled containers from 29 CF and 29 CA recruits, along with data on smoking habits. Flow rate, pH, OSCN

  18. Generalized Abstract Symbolic Summaries (United States)

    Person, Suzette; Dwyer, Matthew B.


    Current techniques for validating and verifying program changes often consider the entire program, even for small changes, leading to enormous V&V costs over a program s lifetime. This is due, in large part, to the use of syntactic program techniques which are necessarily imprecise. Building on recent advances in symbolic execution of heap manipulating programs, in this paper, we develop techniques for performing abstract semantic differencing of program behaviors that offer the potential for improved precision.

  19. Towards Composable Concurrency Abstractions

    Directory of Open Access Journals (Sweden)

    Janwillem Swalens


    Full Text Available In the past decades, many different programming models for managing concurrency in applications have been proposed, such as the actor model, Communicating Sequential Processes, and Software Transactional Memory. The ubiquity of multi-core processors has made harnessing concurrency even more important. We observe that modern languages, such as Scala, Clojure, or F#, provide not one, but multiple concurrency models that help developers manage concurrency. Large end-user applications are rarely built using just a single concurrency model. Programmers need to manage a responsive UI, deal with file or network I/O, asynchronous workflows, and shared resources. Different concurrency models facilitate different requirements. This raises the issue of how these concurrency models interact, and whether they are composable. After all, combining different concurrency models may lead to subtle bugs or inconsistencies. In this paper, we perform an in-depth study of the concurrency abstractions provided by the Clojure language. We study all pairwise combinations of the abstractions, noting which ones compose without issues, and which do not. We make an attempt to abstract from the specifics of Clojure, identifying the general properties of concurrency models that facilitate or hinder composition.

  20. EBS Radionuclide Transport Abstraction

    Energy Technology Data Exchange (ETDEWEB)

    J. Prouty


    The purpose of this report is to develop and analyze the engineered barrier system (EBS) radionuclide transport abstraction model, consistent with Level I and Level II model validation, as identified in Technical Work Plan for: Near-Field Environment and Transport: Engineered Barrier System: Radionuclide Transport Abstraction Model Report Integration (BSC 2005 [DIRS 173617]). The EBS radionuclide transport abstraction (or EBS RT Abstraction) is the conceptual model used in the total system performance assessment (TSPA) to determine the rate of radionuclide releases from the EBS to the unsaturated zone (UZ). The EBS RT Abstraction conceptual model consists of two main components: a flow model and a transport model. Both models are developed mathematically from first principles in order to show explicitly what assumptions, simplifications, and approximations are incorporated into the models used in the TSPA. The flow model defines the pathways for water flow in the EBS and specifies how the flow rate is computed in each pathway. Input to this model includes the seepage flux into a drift. The seepage flux is potentially split by the drip shield, with some (or all) of the flux being diverted by the drip shield and some passing through breaches in the drip shield that might result from corrosion or seismic damage. The flux through drip shield breaches is potentially split by the waste package, with some (or all) of the flux being diverted by the waste package and some passing through waste package breaches that might result from corrosion or seismic damage. Neither the drip shield nor the waste package survives an igneous intrusion, so the flux splitting submodel is not used in the igneous scenario class. The flow model is validated in an independent model validation technical review. The drip shield and waste package flux splitting algorithms are developed and validated using experimental data. The transport model considers advective transport and diffusive transport

  1. Identification and characterization of msa (SA1233), a gene involved in expression of SarA and several virulence factors in Staphylococcus aureus. (United States)

    Sambanthamoorthy, Karthik; Smeltzer, Mark S; Elasri, Mohamed O


    The staphylococcal accessory regulator (sarA) plays a central role in the regulation of virulence in Staphylococcus aureus. To date, studies involving sarA have focused on its activity as a global regulator that modulates transcription of a wide variety of genes (>100) and its role in virulence. However, there is also evidence to suggest the existence of accessory elements that modulate SarA production and/or function. A reporter system was developed to identify such elements, and a new gene, msa (SA1233), mutation of which results in reduced expression of SarA, was identified and characterized. Additionally, it was shown that mutation of msa resulted in altered transcription of the accessory gene regulator (agr) and the genes encoding several virulence factors including alpha toxin (hla) and protein A (spa). However, the impact of mutating msa was different in the laboratory strain RN6390 and the clinical isolate UAMS-1. For instance, mutation of msa caused a decrease in spa and hla transcription in RN6390 but had a different effect in UAMS-1. The strain-dependent effects of the msa mutation were similar to those observed previously, which suggests that msa may modulate the production of specific virulence factors through its impact on sarA. Interestingly, sequence analysis of Msa suggests that it is a putative membrane protein with three membrane-spanning regions, indicating that Msa might interact with the environment. The findings show that msa is involved in the expression of SarA and several virulence factors.

  2. IPR 2016. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The volume on the meeting of pediatric radiology includes abstract on the following issues: chest, cardiovascular system, neuroradiology, CT radiation DRs (diagnostic reference levels) and dose reporting guidelines, genitourinary imaging, gastrointestinal radiology, oncology an nuclear medicine, whole body imaging, fetal/neonates imaging, child abuse, oncology and hybrid imaging, value added imaging, muscoskeletal imaging, dose and radiation safety, imaging children - immobilization and distraction techniques, information - education - QI and healthcare policy, ALARA, the knowledge skills and competences for a technologist/radiographer in pediatric radiology, full exploitation of new technological features in pediatric CT, image quality issues in pediatrics, abdominal imaging, interventional radiology, MR contrast agents, tumor - mass imaging, cardiothoracic imaging, ultrasonography.

  3. ESPR 2015. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The volume includes the abstracts of the ESPR 2015 covering the following topics: PCG (post graduate courses): Radiography; fluoroscopy and general issue; nuclear medicine, interventional radiology and hybrid imaging, pediatric CT, pediatric ultrasound; MRI in childhood. Scientific sessions and task force sessions: International aspects; neuroradiology, neonatal imaging, engineering techniques to simulate injury in child abuse, CT - dose and quality, challenges in the chest, cardiovascular and chest, muscoskeletal, oncology, pediatric uroradiology and abdominal imaging, fetal and postmortem imaging, education and global challenges, neuroradiology - head and neck, gastrointestinal and genitourinary.


    Institute of Scientific and Technical Information of China (English)


    Establishment of a Method for Content Determination of Polysaccharide in Membranous milkveteh root Applied in Fisheries Yu Xiao-qing et al. (1) Abstract Some chemical component in the traditional Chinese medicine Membranous milkvetch root can improve the ability of disease-prevention of animal and it can be applied in fisheries. In the paper, the method about content determination of polysaccharide in the root was established based on orthogonal experimental design Key words medicine; polysaccharide in Membranous milkvetch root; method of determination

  5. Abstracts of Major Articles

    Institute of Scientific and Technical Information of China (English)


    On Problems in Fujian's Present Health Insurance Professionals and Related Suggestions LIN Deng-hui,WU Xiao-nan (School of Public Health, Fujian Medical University, Fuzhou 350108, China) Abstract:Based on a statistical analysis of questionnaire survey data collected from practitioners in Fu- jian's medical insurance management system, the paper discusses the problems relevant to the staff's qua lity structure in this industry as well as mechanisms for continuing education and motivation. Finally, the authors advance such suggestions as increasing the levels of practitioner's expertise and working capacity by developing disciplinary education and continuing motivated with a well-established motivation system. education, and encouraging employees to get highly

  6. SPR 2017. Abstracts

    Energy Technology Data Exchange (ETDEWEB)



    The conference proceedings SPR 2017 include abstracts on the following issues: gastrointestinal radiography - inflammatory bowel diseases, cardiovascular CTA, general muscoskeletal radiology, muscoskeletal congenital development diseases, general pediatric radiology - chest, muscoskeletal imaging - marrow and infectious disorders, state-of-the-art body MR imaging, practical pediatric sonography, quality and professionalism, CT imaging in congenital heart diseases, radiographic courses, body MT techniques, contrast enhanced ultrasound, machine learning, forensic imaging, the radiation dos conundrum - reconciling imaging, imagining and managing, the practice of radiology, interventional radiology, neuroradiology, PET/MR.

  7. Elements of abstract algebra

    CERN Document Server

    Clark, Allan


    This concise, readable, college-level text treats basic abstract algebra in remarkable depth and detail. An antidote to the usual surveys of structure, the book presents group theory, Galois theory, and classical ideal theory in a framework emphasizing proof of important theorems.Chapter I (Set Theory) covers the basics of sets. Chapter II (Group Theory) is a rigorous introduction to groups. It contains all the results needed for Galois theory as well as the Sylow theorems, the Jordan-Holder theorem, and a complete treatment of the simplicity of alternating groups. Chapter III (Field Theory)

  8. Building Safe Concurrency Abstractions

    DEFF Research Database (Denmark)

    Madsen, Ole Lehrmann


    into the notions of concurrent and alternating objects. Alternating objects may be used to start a cooperative thread for each possible blocking communication and is thus an alternative to asynchronous messages and guarded commands. Beta like SIMULA, the first OO language, was designed as a language for modeling...... as well as programming, and we describe how this has had an impact on the design of the language. Although Beta supports the definition of high-level concurrency abstractions, the use of these rely on the discipline of the programmer as is the case for Java and other mainstream OO languages. We introduce...

  9. Abstract Storage Devices

    CERN Document Server

    Koenig, Robert; Tessaro, Stefano


    A quantum storage device differs radically from a conventional physical storage device. Its state can be set to any value in a certain (infinite) state space, but in general every possible read operation yields only partial information about the stored state. The purpose of this paper is to initiate the study of a combinatorial abstraction, called abstract storage device (ASD), which models deterministic storage devices with the property that only partial information about the state can be read, but that there is a degree of freedom as to which partial information should be retrieved. This concept leads to a number of interesting problems which we address, like the reduction of one device to another device, the equivalence of devices, direct products of devices, as well as the factorization of a device into primitive devices. We prove that every ASD has an equivalent ASD with minimal number of states and of possible read operations. Also, we prove that the reducibility problem for ASD's is NP-complete, that t...

  10. EBS Radionuclide Transport Abstraction

    Energy Technology Data Exchange (ETDEWEB)

    J.D. Schreiber


    The purpose of this report is to develop and analyze the engineered barrier system (EBS) radionuclide transport abstraction model, consistent with Level I and Level II model validation, as identified in ''Technical Work Plan for: Near-Field Environment and Transport: Engineered Barrier System: Radionuclide Transport Abstraction Model Report Integration'' (BSC 2005 [DIRS 173617]). The EBS radionuclide transport abstraction (or EBS RT Abstraction) is the conceptual model used in the total system performance assessment for the license application (TSPA-LA) to determine the rate of radionuclide releases from the EBS to the unsaturated zone (UZ). The EBS RT Abstraction conceptual model consists of two main components: a flow model and a transport model. Both models are developed mathematically from first principles in order to show explicitly what assumptions, simplifications, and approximations are incorporated into the models used in the TSPA-LA. The flow model defines the pathways for water flow in the EBS and specifies how the flow rate is computed in each pathway. Input to this model includes the seepage flux into a drift. The seepage flux is potentially split by the drip shield, with some (or all) of the flux being diverted by the drip shield and some passing through breaches in the drip shield that might result from corrosion or seismic damage. The flux through drip shield breaches is potentially split by the waste package, with some (or all) of the flux being diverted by the waste package and some passing through waste package breaches that might result from corrosion or seismic damage. Neither the drip shield nor the waste package survives an igneous intrusion, so the flux splitting submodel is not used in the igneous scenario class. The flow model is validated in an independent model validation technical review. The drip shield and waste package flux splitting algorithms are developed and validated using experimental data. The transport

  11. Writing a successful research abstract. (United States)

    Bliss, Donna Z


    Writing and submitting a research abstract provides timely dissemination of the findings of a study and offers peer input for the subsequent development of a quality manuscript. Acceptance of abstracts is competitive. Understanding the expected content of an abstract, the abstract review process and tips for skillful writing will improve the chance of acceptance.


    Institute of Scientific and Technical Information of China (English)


    Determination of the Estrogen Alkylphenols and Bisphenol A in Marine Sediments by Gas Chromatography-Mass Spectrometry Deng Xu-xiu et al. (1) Abstract Octylphenol, nonylphenol and bisphenol A are recognized environmental endocrine disruptors. A quantitative method was established for the simultaneous determination of octylphenol, nonylphenol and bisphenol A in marine sediments by gas chromatography-mass spectrometry. The test sample was extracted by methanol with ultrasonic technique, purified with copper powder and carbon solid phase extraction column, and derived with heptafluorobutyric anhydride. Then the analytes were separated on HP-5ms column and determined by gas chromatography-mass. The recovery of the method was between 84.3% and 94.5%, and the LOQ of 4-N- octylphenol, nonylphenol and bisphenol A was 0.25 g/kg, 0.15 g/kg and 0.15 g/kg. Key words octylphenol; nonylphenol; bisphenol A; gas chromatography-mass spectrometry

  13. A LARI Experience (Abstract) (United States)

    Cook, M.


    (Abstract only) In 2012, Lowell Observatory launched The Lowell Amateur Research Initiative (LARI) to formally involve amateur astronomers in scientific research by bringing them to the attention of and helping professional astronomers with their astronomical research. One of the LARI projects is the BVRI photometric monitoring of Young Stellar Objects (YSOs), wherein amateurs obtain observations to search for new outburst events and characterize the colour evolution of previously identified outbursters. A summary of the scientific and organizational aspects of this LARI project, including its goals and science motivation, the process for getting involved with the project, a description of the team members, their equipment and methods of collaboration, and an overview of the programme stars, preliminary findings, and lessons learned is presented.


    Institute of Scientific and Technical Information of China (English)


    Acute Toxicity Test of Four Drugs to Perch Fries Zhu You-fang et al(1) Abstract Acute toxicity test of four drugs to perch Lateolabrax maculates were studied. The results showed: (1)The LC50 values of perch to copper sulfate was 4.58 mg/L(24h), 2.93 mg/ L(48h), 1.81 mg/L(72h) and 0.78 mg/L (96h) respectively; to SHA CHONG WEI was 35.11 mg/ L(24h), 15.81 mg/L(48h), 11.20 mg/L(72h), 9.36 mg/ L (96h)respectively;

  15. Abstracts of Selected Papers

    Institute of Scientific and Technical Information of China (English)


    On the Social Solidarity of Organization An Empirical Analysis Li Hanlin Abstract: Based on the 2002 survey data, this paper tries to measure solidarity in organization. The operationalization for this measurement goes from two points of view. One is from the degree of cohesion and another one is from the degree of vulnerability. To observe and measure the degree of cohesion three subscales like social support, vertical integration and organizational identity have been used. To observe and measure the degree of vulnerability other three subscales like dissatisfaction, relative deprivation and anomie have been used. The paper tries to explore finally under which condition the organization behavior and behavior orientation could go to the similarity or make some difference. Key words: Organization Cohesion Vulnerability Organization Behavior

  16. Contents and Abstracts

    Institute of Scientific and Technical Information of China (English)


    [Ancient Mediterranean Civilizations] Title: On Poseidon's Image in Homeric Epics Author: Zhu Yizhang, Lecturer, School of History and Culture, Shandong University, Jinan, Shandong, 250100, China. Abstract: Poseidon was an important role in religion, myth and literature of ancient Greece. His religious functions, and status in mythical image in literature were mainly established by Homeric Epics. Poseidon doesn't only appear frequently in the Homeric Epics but also influences the development of the plots directly; therefore, he could be seen as one of the most important gods in the Epics. But Homeric Epics do not introduce his basic image clearly. In Homeric Epics, Poseidon carries the deity and humanity aspect of the figure, and the latter was emphasized, which implied his archetype was a mortal wanax.

  17. Problems in abstract algebra

    CERN Document Server

    Wadsworth, A R


    This is a book of problems in abstract algebra for strong undergraduates or beginning graduate students. It can be used as a supplement to a course or for self-study. The book provides more variety and more challenging problems than are found in most algebra textbooks. It is intended for students wanting to enrich their learning of mathematics by tackling problems that take some thought and effort to solve. The book contains problems on groups (including the Sylow Theorems, solvable groups, presentation of groups by generators and relations, and structure and duality for finite abelian groups); rings (including basic ideal theory and factorization in integral domains and Gauss's Theorem); linear algebra (emphasizing linear transformations, including canonical forms); and fields (including Galois theory). Hints to many problems are also included.

  18. Pushing and Pulling Sara: A Case Study of the Contrasting Influences of High School and University Experiences on Engineering Agency, Identity, and Participation (United States)

    Godwin, Allison; Potvin, Geoff


    This manuscript reports a longitudinal case study of how one woman, Sara, who had previously considered dropping out of high school, authored strong mathematics and science identities and purposefully exhibited agency through her experiences in high school science. These experiences empowered her to choose an engineering major in college; however,…

  19. Impact of individual extracellular proteases on Staphylococcus aureus biofilm formation in diverse clinical isolates and their isogenic sarA mutants. (United States)

    Loughran, Allister J; Atwood, Danielle N; Anthony, Allison C; Harik, Nada S; Spencer, Horace J; Beenken, Karen E; Smeltzer, Mark S


    We demonstrate that the purified Staphylococcus aureus extracellular proteases aureolysin, ScpA, SspA, and SspB limit biofilm formation, with aureolysin having the greatest impact. Using protease-deficient derivatives of LAC, we confirmed that this is due to the individual proteases themselves. Purified aureolysin, and to a lesser extent ScpA and SspB, also promoted dispersal of an established biofilm. Mutation of the genes encoding these proteases also only partially restored biofilm formation in an FPR3757 sarA mutant and had little impact on restoring virulence in a murine bacteremia model. In contrast, eliminating the production of all of these proteases fully restored both biofilm formation and virulence in a sarA mutant generated in the closely related USA300 strain LAC. These results confirm an important role for multiple extracellular proteases in S. aureus pathogenesis and the importance of sarA in repressing their production. Moreover, purified aureolysin limited biofilm formation in 14 of 15 methicillin-resistant isolates and 11 of 15 methicillin-susceptible isolates, while dispersin B had little impact in UAMS-1, LAC, or 29 of 30 contemporary isolates of S. aureus. This suggests that the role of sarA and its impact on protease production is important in diverse strains of S. aureus irrespective of their methicillin resistance status.

  20. Stellar Presentations (Abstract) (United States)

    Young, D.


    (Abstract only) The AAVSO is in the process of expanding its education, outreach and speakers bureau program. powerpoint presentations prepared for specific target audiences such as AAVSO members, educators, students, the general public, and Science Olympiad teams, coaches, event supervisors, and state directors will be available online for members to use. The presentations range from specific and general content relating to stellar evolution and variable stars to specific activities for a workshop environment. A presentation—even with a general topic—that works for high school students will not work for educators, Science Olympiad teams, or the general public. Each audience is unique and requires a different approach. The current environment necessitates presentations that are captivating for a younger generation that is embedded in a highly visual and sound-bite world of social media, twitter and U-Tube, and mobile devices. For educators, presentations and workshops for themselves and their students must support the Next Generation Science Standards (NGSS), the Common Core Content Standards, and the Science Technology, Engineering and Mathematics (STEM) initiative. Current best practices for developing relevant and engaging powerpoint presentations to deliver information to a variety of targeted audiences will be presented along with several examples.

  1. Exoplanets and Multiverses (Abstract) (United States)

    Trimble, V.


    (Abstract only) To the ancients, the Earth was the Universe, of a size to be crossed by a god in a day, by boat or chariot, and by humans in a lifetime. Thus an exoplanet would have been a multiverse. The ideas gradually separated over centuries, with gradual acceptance of a sun-centered solar system, the stars as suns likely to have their own planets, other galaxies beyond the Milky Way, and so forth. And whenever the community divided between "just one' of anything versus "many," the "manies" have won. Discoveries beginning in 1991 and 1995 have gradually led to a battalion or two of planets orbiting other stars, very few like our own little family, and to moderately serious consideration of even larger numbers of other universes, again very few like our own. I'm betting, however, on habitable (though not necessarily inhabited) exoplanets to be found, and habitable (though again not necessarily inhabited) universes. Only the former will yield pretty pictures.

  2. Automated Supernova Discovery (Abstract) (United States)

    Post, R. S.


    (Abstract only) We are developing a system of robotic telescopes for automatic recognition of Supernovas as well as other transient events in collaboration with the Puckett Supernova Search Team. At the SAS2014 meeting, the discovery program, SNARE, was first described. Since then, it has been continuously improved to handle searches under a wide variety of atmospheric conditions. Currently, two telescopes are used to build a reference library while searching for PSN with a partial library. Since data is taken every night without clouds, we must deal with varying atmospheric and high background illumination from the moon. Software is configured to identify a PSN, reshoot for verification with options to change the run plan to acquire photometric or spectrographic data. The telescopes are 24-inch CDK24, with Alta U230 cameras, one in CA and one in NM. Images and run plans are sent between sites so the CA telescope can search while photometry is done in NM. Our goal is to find bright PSNs with magnitude 17.5 or less which is the limit of our planned spectroscopy. We present results from our first automated PSN discoveries and plans for PSN data acquisition.

  3. Judgement of abstract paintings

    Directory of Open Access Journals (Sweden)

    Dakulović Sandra


    Full Text Available In two experiments the judgement of twenty one abstract paintings was investigated. In Experiment 1, subjects were asked to make similarity judgements of 210 pairs of paintings on a 7 step bipolar scale (similar-dissimilar. The Multi-dimensional scaling (MDS method was used for data analysis. The distribution of paintings within MDS 2-D space suggested two grouping criteria: colorfullness (e.g. from Klee to Kline and geometrization (e.g. from Vasarely to Kandinsky. In Experiment 2, subjects were asked to judge the same paintings on three factors of the instrument SDF 9 (Marković et al., 2002b: Evaluation, Arousal and Regularity. The purpose of this experiment was to specify the subjective criteria on which the (dissimilarity judgements were based. In the regression analysis the three factors of SDF 9 were defined as predictors, whereas the x and y coordinates of MDS 2-D space were defined as dependent variables. The results have shown that the dimension x was reducible to the Evaluation factor, and dimension y is reducible to the Regularity factor.

  4. Abstraction of Drift Seepage

    Energy Technology Data Exchange (ETDEWEB)

    J.T. Birkholzer


    This model report documents the abstraction of drift seepage, conducted to provide seepage-relevant parameters and their probability distributions for use in Total System Performance Assessment for License Application (TSPA-LA). Drift seepage refers to the flow of liquid water into waste emplacement drifts. Water that seeps into drifts may contact waste packages and potentially mobilize radionuclides, and may result in advective transport of radionuclides through breached waste packages [''Risk Information to Support Prioritization of Performance Assessment Models'' (BSC 2003 [DIRS 168796], Section 3.3.2)]. The unsaturated rock layers overlying and hosting the repository form a natural barrier that reduces the amount of water entering emplacement drifts by natural subsurface processes. For example, drift seepage is limited by the capillary barrier forming at the drift crown, which decreases or even eliminates water flow from the unsaturated fractured rock into the drift. During the first few hundred years after waste emplacement, when above-boiling rock temperatures will develop as a result of heat generated by the decay of the radioactive waste, vaporization of percolation water is an additional factor limiting seepage. Estimating the effectiveness of these natural barrier capabilities and predicting the amount of seepage into drifts is an important aspect of assessing the performance of the repository. The TSPA-LA therefore includes a seepage component that calculates the amount of seepage into drifts [''Total System Performance Assessment (TSPA) Model/Analysis for the License Application'' (BSC 2004 [DIRS 168504], Section]. The TSPA-LA calculation is performed with a probabilistic approach that accounts for the spatial and temporal variability and inherent uncertainty of seepage-relevant properties and processes. Results are used for subsequent TSPA-LA components that may handle, for example, waste package

  5. Memoria de la guerra civil española. Entre el sol y la tormenta de Sara Berenguer

    Directory of Open Access Journals (Sweden)

    Helena López


    Full Text Available En este artículo pretendo analizar dos cuestiones en relación con las memorias de guerra de la militante anarquista Sara Berenguer. En primer lugar, quiero atender a las estrategias discursivas (clase, género, sexualidad de construcción de la subjetividad en este texto. Además, me interesa indagar cómo estos discursos se interseccionan con la posición espacio-temporal (tiempo de la memoria y tiempo-espacio del exilio del sujeto autobiográfico. Mi objetivo principal es proponer una problematización de los conceptos de “memoria colectiva” y de “experiencia femenina” y reivindicar, por lo tanto, la relevancia tanto teórica como política de análisis críticos basados en narrativas personales.

  6. Using abstract language signals power. (United States)

    Wakslak, Cheryl J; Smith, Pamela K; Han, Albert


    Power can be gained through appearances: People who exhibit behavioral signals of power are often treated in a way that allows them to actually achieve such power (Ridgeway, Berger, & Smith, 1985; Smith & Galinsky, 2010). In the current article, we examine power signals within interpersonal communication, exploring whether use of concrete versus abstract language is seen as a signal of power. Because power activates abstraction (e.g., Smith & Trope, 2006), perceivers may expect higher power individuals to speak more abstractly and therefore will infer that speakers who use more abstract language have a higher degree of power. Across a variety of contexts and conversational subjects in 7 experiments, participants perceived respondents as more powerful when they used more abstract language (vs. more concrete language). Abstract language use appears to affect perceived power because it seems to reflect both a willingness to judge and a general style of abstract thinking.

  7. Modal abstractions of concurrent behavior

    DEFF Research Database (Denmark)

    Nielson, Flemming; Nanz, Sebastian; Nielson, Hanne Riis


    We present an effective algorithm for the automatic construction of finite modal transition systems as abstractions of potentially infinite concurrent processes. Modal transition systems are recognized as valuable abstractions for model checking because they allow for the validation as well...... as refutation of safety and liveness properties. However, the algorithmic construction of finite abstractions from potentially infinite concurrent processes is a missing link that prevents their more widespread usage for model checking of concurrent systems. Our algorithm is a worklist algorithm using concepts...

  8. Mechanical Engineering Department technical abstracts

    Energy Technology Data Exchange (ETDEWEB)

    Denney, R.M. (ed.)


    The Mechanical Engineering Department publishes listings of technical abstracts twice a year to inform readers of the broad range of technical activities in the Department, and to promote an exchange of ideas. Details of the work covered by an abstract may be obtained by contacting the author(s). Overall information about current activities of each of the Department's seven divisions precedes the technical abstracts.

  9. Hedonism in Abstract Art: Minimalist digital abstract photography

    Directory of Open Access Journals (Sweden)

    Srdjan Jovanović


    Full Text Available In this piece of writing the writer/artist puts forward the view that art can be understood and taken in as sometimes purely hedonistic. By drawing upon the theories pertaining to hedonism, he applies this view to minimalist digital abstract photography and tries to justify his point of view with the help of three abstract photographs.

  10. Feminism and Faith: Exploring Christian Spaces in the Writing of Sara Maitland and Michèle Roberts

    Directory of Open Access Journals (Sweden)



    Full Text Available En 1983, les féministes britanniques Sara Maitland et Jo Garcia ont publié Walking on the Water (London : Virago, une collection d’essais, de récits, de poèmes et de photos produits par des femmes sur le thème de la spiritualité. Les contributrices ont été en particulier invitées à explorer la relation entre leur identité féministe et leurs croyances religieuses. Le ton de ces contributions varie fortement, allant de l’envie passionnée de concilier les objectifs du féminisme avec le christianisme à un rejet total de l’Eglise comme institution patriarcale suprême. Cet article met en dialogue des récits diamétralement opposés du rapport entre christianisme et féminisme en s’intéressante plus particulièrement à deux des contributrices, Sara Maitland (1950 - et Michèle Roberts (1949 - . Ces deux écrivaines, qui se sont activement impliquées dans les mouvements féministes des années 1970, ont toutes deux lutté pour se réconcilier avec leur héritage chrétien. Néanmoins, alors que Maitland tente essentiellement de revisiter le christianisme en y incorporant les points essentiels d’une idéologie féministe, Roberts sent le besoin impérieux de se défaire de son identité religieuse afin de devenir indépendante ; en effet, dans son autobiographie Paper Houses (2007 elle décrit son éducation catholique comme “autoritaire et misogyne” (16. Cet article explore les façons dont l’identité spirituelle se construit dans le jeu complexe des interactions entre féminisme et foi. Il se propose, dans une perspective comparatiste, d’analyser d’une part le recueil de nouvelles de Sara Maitland intitulé A Book of Spells, et d’autre part, le roman acclamé de Michèle Roberts, Daughters of the House. Dans ces écrits, Maitland et Roberts ont un objectif commun qui est de renégocier la place des femmes dans l’histoire chrétienne dont elles reconnaissent – il est vrai à partir de perspectives diff

  11. sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis‐dependent release of eDNA

    DEFF Research Database (Denmark)

    Christner, Martin; Heinze, Constanze; Busch, Michael;


    Biofilm formation is essential for Staphylococcus epidermidis pathogenicity in implant‐associated infections. Nonetheless, large proportions of invasive Staphylococcus epidermidis isolates fail to form a biofilm in vitro. We here tested the hypothesis that this apparent paradox is related...... virulence. Genetic analysis revealed that inactivation of sarA induced biofilm formation via overexpression of the giant 1 MDa extracellular matrix binding protein (Embp), serving as an intercellular adhesin. In addition to Embp, increased extracellular DNA (eDNA) release significantly contributed...

  12. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Diego O Andrey

    Full Text Available Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1, encoded by tst(H, and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1, RNAIII, rot, and the alternative stress sigma factor sigB (σB. By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  13. Impact of the Regulators SigB, Rot, SarA and sarS on the Toxic Shock Tst Promoter and TSST-1 Expression in Staphylococcus aureus. (United States)

    Andrey, Diego O; Jousselin, Ambre; Villanueva, Maite; Renzoni, Adriana; Monod, Antoinette; Barras, Christine; Rodriguez, Natalia; Kelley, William L


    Staphylococcus aureus is an important pathogen manifesting virulence through diverse disease forms, ranging from acute skin infections to life-threatening bacteremia or systemic toxic shock syndromes. In the latter case, the prototypical superantigen is TSST-1 (Toxic Shock Syndrome Toxin 1), encoded by tst(H), and carried on a mobile genetic element that is not present in all S. aureus strains. Transcriptional regulation of tst is only partially understood. In this study, we dissected the role of sarA, sarS (sarH1), RNAIII, rot, and the alternative stress sigma factor sigB (σB). By examining tst promoter regulation predominantly in the context of its native sequence within the SaPI1 pathogenicity island of strain RN4282, we discovered that σB emerged as a particularly important tst regulator. We did not detect a consensus σB site within the tst promoter, and thus the effect of σB is likely indirect. We found that σB strongly repressed the expression of the toxin via at least two distinct regulatory pathways dependent upon sarA and agr. Furthermore rot, a member of SarA family, was shown to repress tst expression when overexpressed, although its deletion had no consistent measurable effect. We could not find any detectable effect of sarS, either by deletion or overexpression, suggesting that this regulator plays a minimal role in TSST-1 expression except when combined with disruption of sarA. Collectively, our results extend our understanding of complex multifactorial regulation of tst, revealing several layers of negative regulation. In addition to environmental stimuli thought to impact TSST-1 production, these findings support a model whereby sporadic mutation in a few key negative regulators can profoundly affect and enhance TSST-1 expression.

  14. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014). Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.


    Florencia Henshaw


    This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  15. Beaudrie, Sara, Ducar, Cynthia, & Potowski, Kim (2014. Heritage language teaching: Research and practice. New York State, New York: McGraw Hill.

    Directory of Open Access Journals (Sweden)

    Florencia Henshaw


    Full Text Available This review introduces readers to Heritage language teaching: Research and practice, by Sara Beaudrie, Cynthia Ducar, and Kim Potowski, which is part of the “Directions in Second Language Learning” series. This handbook offers a comprehensive overview of key concepts, research findings, and pedagogical strategies to better meet the needs of heritage learners, and it underscores the importance of sociolinguistic issues and phenomena in heritage language instruction.

  16. Abstract concepts in grounded cognition

    NARCIS (Netherlands)

    Lakens, D.


    When people think about highly abstract concepts, they draw upon concrete experiences to structure their thoughts. For example, black knights in fairytales are evil, and knights in shining armor are good. The sensory experiences black and white are used to represent the abstract concepts of good and

  17. Modal abstractions of concurrent behavior

    DEFF Research Database (Denmark)

    Nielson, Flemming; Nanz, Sebastian; Nielson, Hanne Riis


    We present an effective algorithm for the automatic construction of finite modal transition systems as abstractions of potentially infinite concurrent processes. Modal transition systems are recognized as valuable abstractions for model checking because they allow for the validation as well as re...

  18. Vague Language in Conference Abstracts (United States)

    Cutting, Joan


    This study examined abstracts for a British Association for Applied Linguistics conference and a Sociolinguistics Symposium, to define the genre of conference abstracts in terms of vague language, specifically universal general nouns (e.g. people) and research general nouns (e.g. results), and to discover if the language used reflected the level…

  19. Food Science and Technology Abstracts. (United States)

    Cohen, Elinor; Federman, Joan


    Introduces the reader to the Food Science and Technology Abstracts, a data file that covers worldwide literature on human food commodities and aspects of food processing. Topics include scope, subject index, thesaurus, searching online, and abstracts; tables provide a comparison of ORBIT and DIALOG versions of the file. (JD)

  20. Abstract models of transfinite reductions

    DEFF Research Database (Denmark)

    Bahr, Patrick


    We investigate transfinite reductions in abstract reduction systems. To this end, we study two abstract models for transfinite reductions: a metric model generalising the usual metric approach to infinitary term rewriting and a novel partial order model. For both models we distinguish between...

  1. Technical abstracts: Mechanical engineering, 1990

    Energy Technology Data Exchange (ETDEWEB)

    Broesius, J.Y. (comp.)


    This document is a compilation of the published, unclassified abstracts produced by mechanical engineers at Lawrence Livermore National Laboratory (LLNL) during the calendar year 1990. Many abstracts summarize work completed and published in report form. These are UCRL-JC series documents, which include the full text of articles to be published in journals and of papers to be presented at meetings, and UCID reports, which are informal documents. Not all UCIDs contain abstracts: short summaries were generated when abstracts were not included. Technical Abstracts also provides descriptions of those documents assigned to the UCRL-MI (miscellaneous) category. These are generally viewgraphs or photographs presented at meetings. An author index is provided at the back of this volume for cross referencing.

  2. Abstract algebra structure and application

    CERN Document Server

    Finston, David R


    This text seeks to generate interest in abstract algebra by introducing each new structure and topic via a real-world application. The down-to-earth presentation is accessible to a readership with no prior knowledge of abstract algebra. Students are led to algebraic concepts and questions in a natural way through their everyday experiences. Applications include: Identification numbers and modular arithmetic (linear) error-correcting codes, including cyclic codes ruler and compass constructions cryptography symmetry of patterns in the real plane Abstract Algebra: Structure and Application is suitable as a text for a first course on abstract algebra whose main purpose is to generate interest in the subject, or as a supplementary text for more advanced courses. The material paves the way to subsequent courses that further develop the theory of abstract algebra and will appeal to students of mathematics, mathematics education, computer science, and engineering interested in applications of algebraic concepts.

  3. Women Empowerment in the Realms of Institutionalized Religion and Patriarchy: El Saadawi’s Firdaus and Yezierska’s Sara as Examples

    Directory of Open Access Journals (Sweden)

    Abdullah K. Shehabat


    Full Text Available This paper explains how the two protagonists, Firdaus and Sara, successfully paved their own ways in search of self-liberation despite the authoritarian patriarchy and institutionalized religions that plagued them. El Saadawi's Woman at Point Zero and Yezierska’s Bread Givers represent the fruitful struggle these protagonists experienced as they come to forge an identity and be themselves. The paper argues that the protagonists manage to free themselves, establish their own spiritual homes at their own homes and assert the potentials of their femininity despite their endings. Empowered by the powers of reading, strong will and meticulous work, the protagonists were able to realize their own material independence and achieve their lifelong ambitions. However, through Firdaus' and Sara's journeys of breaking their silence, they were subject to different patterns of self-annihilation. While Firdaus was sentenced to death for killing a pimp, Sara embraced living under the hegemony of an authoritarian husband.      Keywords: Women empowerment, authoritarian patriarchy, institutionalized and/or gendered religion, spiritual feminist homes


    Institute of Scientific and Technical Information of China (English)


    Wu Jie and Duan Yanchao. The current line drawing of Laterolog and its application. PI, 2011, 25(4) : 1 - 4 The current line plays an important role in the directly understanding the characteristics of Laterolog tool. A method of drawing current lines for the discrete potential data based on the Finite Element calculation is studied. It solves a series of key problems, including the selection of step length, the identification of direction, treatment of nmtation point and the control of stop. A drawing program is written by MATLAB software. Taking the current line drawing of the dual Laterolog logging as an example, we analyze the tool's investigation characteristics in the several formations such as homogeneous, low or high invasion, and invasion with shoulder. These results verify the effectiveness of the new method. The method can be applied to the other kinds of Laterolog tools to draw their current lines and analyze their investigation characteristics.


    Institute of Scientific and Technical Information of China (English)


    Through-bit-logging (TBL) technology is developed corporately by Shell and Reeves Oil Company. It can replace standard cable logging and logging while drilling technology. It has characteristics of saving cost and convenient operation.The principle is to transmit the logging tool into borehole through drill rod with a special bit. The acquired formation evaluation data are read on surface from the wire line tool or stored in the tool before pulling out the hole.The paper introduces the principle of work, advantages and development trend of TBL, and cases of its application in rough borehole in North Sea fields. Finally development of TBL technology is summarized. Keywords: TBL; logging while drilling wireline logging


    Institute of Scientific and Technical Information of China (English)


    Liu Diren, Xie Weibiao, Yin Qiuli and Zhou Liyan. Study on the Influence of induction logging response on tool eccentricity in horizontal well. Jiang Yiqing, Xu Lin, Wang Jianmin and Du Hui. Simulation of time spectrum by oxygen activation logging.Zhang Jiawei, Song Gongpu, Sai Fang, Xue Zhibo. Design of simulator based on NMR downhole tools.


    Institute of Scientific and Technical Information of China (English)


    Zhang Xionghui, You Chang, Tang Jie, Zhou Qizhi, Xu Feng, Li Ganghan and Ma Yan. Development of a series of logging tool long-time working under high temperature and high pressure condition. PI, 2012,26 (3) : 1-3


    Institute of Scientific and Technical Information of China (English)


    1.APPLICATION OF VSP TECHNOLOGY OF GREAT WALL DRILLING COMPANY IN OIL AND GAS EXPLORATION ABROAD/Du Xudong., Huang Daqin, Zhao Qihui.2011 (6)8-13 ( Interpretation Research Center of Great Wall Drilling Engineering Company ) Development and perfection of VSP technology have close relationship with the requirements of production. The paper presents 6 aspects of application about VSP technology in oil and gas exploration abroad: lproviding high-precision interpretation result----high-precision time-depth;


    Institute of Scientific and Technical Information of China (English)


    Overview of the development of the hybrid locomotive at home and abroad TIAN Rui, KANG Yi-nan (Dalian Locomotive Research Institute Co., Ltd., Dalian 116021, China ) Abstract: This paper analyzes the structure principle and classification feature of hybrid locomotive from the perspective of energy saving and emission reduction, discussing the key technology and summarizing its development and application at home and abroad. On this basis, the development prospect and problems to be solved of hybrid locomotive are analyzed. Key words: hybrid locomotive; principle; classification; application; prospect


    African Journals Online (AJOL)

    identification of the poor and their characteristics; they should be given a chance to ... established to help eradicate the poverty, which include the People Empowerment ... Welfare Service Scheme has programmes like: Special Education ...


    Institute of Scientific and Technical Information of China (English)


    A Representative work that Vainly Attempts to Westernize China On Yang Ji.sheng's Paper "My View of Chinese Pattern" XU Chong-wenAbstract: Mr. Yang Ji-sheng calls economic connotation of Chinese pattern "market economy of power" with all sorts of drawbacks, it is to take the problems that Chinese model deliberately struggles with and even the objects must be resolutely eliminated as the parts of Chinese pattern, thus they are absolute nonsense; he boils down political connotation of Chinese pattern to "authority politics" of "thoroughly denying modem democratic system",

  12. Abstracts

    National Research Council Canada - National Science Library


    ... , Abduljaleel Al Alwan 1,2 , Abeer Ibrahim 4 , Hadi Kuriry 3 , Ali Albenmousa 6 1 Department of Hepatobiliary Sciences, Division of Hepatology, King Abdulaziz Medical City, National Guard Health Affairs, 2...

  13. Abstract

    Institute of Scientific and Technical Information of China (English)


    Representation or Construction? An Interpretation of Quantum Field Theory Abstract: In this essay, I argue that the basic entities in the causality organized hierarchy of entities that quantum field theory describes are not particles but fields. Then I


    Institute of Scientific and Technical Information of China (English)


    On the Logic of Heart and the Intuitive Approach: An Outline of Modern Idealism Linked Chinese and Western Philosophical Ideas,A Reflection and Analogical Interpretation of Active Justice,Channel of the Effectiveness of Public Policy in the Perspective of Social Equality: A Theoretical Analysis of the Efficacy of Public Policy


    Institute of Scientific and Technical Information of China (English)


    Chinese foreign trade enterprises enter the crucial period of transformation and upgrade The global economy is likely into a long-term downturn and recovery is difficult. For a long time, the foreign trade development environment is difficult to be improved obviously. Many negative factors are overlaid and will bring the foreign trade greater challenge. Impacted by the dual factors of intemational market fluctuation, domestic economic environment tightening,

  16. Abstract

    African Journals Online (AJOL)


    per week; processed in a team work, and finalized by a local work shop accommodating the ... biological, health sciences, social sciences ... the new education and training policy of Ethiopia ...... schools were budget, staff shortage, classrooms ...


    Institute of Scientific and Technical Information of China (English)


    Effect of Coolant Temperature on Fuel Consumption and Emissions in YC6A220C Diesel Engine;Optimizing NOx emission performance for 16V280ZC diesel engine;CA3-13 coupler of DFsBI diesel locomotive exported to Iran;Mixed traction technology with LOCOTROL system;


    Institute of Scientific and Technical Information of China (English)


    Design of the LabVIEW-based test stand for diesel engine hydraulic governor ZHANG Wei-dong1, LIU Li-hua2, ZONG Ya-ping1 ( 1. Air Force Radar Academy, Wuhan 430019, China; 2. Second Artillery Command College, Wuhan 430019, China)Abstract: the test stand The structure for diesel engine and working principle of hydraulic governor were introduced. The user interface, speed governing curves display and data analysis were realized by IabVIEW to conduct calibration and draulic governor diagnosis for diesel engine hy-


    Institute of Scientific and Technical Information of China (English)


    Application of UIC standards to Chinese railway traction diesel engine industry WANG Xian (Dalian Locomotive Research Institute Co., Ltd., Dalian 116021, China) Abstract: The development, main contents and the practical application of the standards for type test for Chinese railway traction diesel engine were discussed. Key words: UIC standards; locomotive diesel en- gine; type test


    Institute of Scientific and Technical Information of China (English)


    Solving the vibration problem of diesel engine and its peripheral equipments with MK II PAK analysis system,Quality situation and analysis of copper radiator for diesel locomotive,Development of cooling system for GMC-96 rail grinding car


    Institute of Scientific and Technical Information of China (English)


    Development status of domestic and foreign hydraulic transmissions;Effect of advance angle of fuel supply on exhaust emissions for a diesel engine with EGR technology;Effect on noise of diesel engine under different atmospheric preessure and biodiesel blends;Application of digital governing system to V280/285 series marine diesel engine;

  2. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Post-Western International System and the Rise of the East;Hegemonlc Dependence and the Logic in the Declining Asceudance of Leading Powers;Constructive Leadership and China's Diplomatic Transformation;The Bargaining Model of International Mediation Onset:A Quantitative Test;The Imnact of Gender Differences on National Military Expenditure

  3. Abstract

    Institute of Scientific and Technical Information of China (English)


    The Establishment and Distribution of the Police Stations in the Public Concessions in Modern Shanghai -Also on the Substitution Index of the Expansion of City Space WU Heng By analyzing relevant materials, this paper finds that the total number of police stations and the population is closely related to each other and regards it as the substitution index of city expansion. The author thinks that the urbanization of the public concessions can be divided into three phases, while this process is not in synchronization with the expansion of the land expansion of public concessions.


    Institute of Scientific and Technical Information of China (English)


    South Korea's strategy and the economic and trade relations with China South Korea in a relatively short period of time has obtained the economic fast boom, creating "the Han River Miracle" remarkably. Due to the typical export-oriented economy, the South Korea is very sensitive to the international situation.

  5. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Changing the Means of Structural Adjustment for Transformation of Development Pattern SONG Ze Abstract: History of China's reform and opening up has proven that government-led industrial structural adjustment is unsuccessful. Facing the new situation and economic development tasks, new ideas of industrial restructuring should be clearly put forward that the government will create conditions to adjust the structure by the market. During the Twelve-Five Years, the most priority should be how to reform the way how to change the structural adjustment. If the "structural adjustment" approach, especially in the manufacturing sector can not be changed, many goals on economic transition are likely to fall again. Under the circumstance it is necessary to accelerate the development of a unified, open and orderly modern market system, and effectively implement the market-pushed industrial restructuring approach, and strengthen the intermediary function of finance and inner trade and create good policy environment conducive to promoting the services sector in the process of structural adjustment and industrial upgrading. Key Words:industrial structure; adjustment approach


    Institute of Scientific and Technical Information of China (English)


    Probe into The Production of Songhua Inkstone in Kangxi period and His Bestowing Them upon His Subjects;A Study of Kiln-Firing Production for Construction of Beijing in The Ming Dynasty: Focus on The Changes of Kiln Sites, Product Structure and Manufacture System of Supplies;More on The Design of The Large Timbers in The Structure of Daxiong Dian(Hall) of Fengguo Temple of Yi County with The Enlightenment from The Latest Research Available;


    Institute of Scientific and Technical Information of China (English)


    Energy transformation is the only way of the transformation of the world economy Describing and explaining from different view of the world from the angle of political, economic, cultural and environmental development, the presentation of the transformation, change, adjustment, conversion and a series of concept reflects that the current world situation is undergoing profound changes, multi-polarization and globalization. The global problems such as financial crisis, recession, climate change, energy transformation and the environment change,


    Institute of Scientific and Technical Information of China (English)


    "Strategic communication" refers to practices involving the widespreaddissemination of information as well as contact activities for the purpose of nationalstrategic interest and objectives. Though people currently do not have a clearcomprehension of its definition, they are deepening their understanding. There is stillroom for its development in terms of theoretical research and practice. We shouldactively carry out research on mechanism building, communication targets and strategiccommunication content in order to serve our national strategies.

  9. Abstract

    African Journals Online (AJOL)

    The AIDS epidemic has infected more than 50 million and claimed the lives of more than .... or preventive vaccine trials, as well as of HIV-positive women presenting as ... The lack of public understanding of doctors' and/or of scientific methods'.


    Institute of Scientific and Technical Information of China (English)


    Look in the Mirror of Personality Left by Liang Qichao The New Preface to His Reflecting Moral This article is my new foreword of Reflecting Moral, which had been edited and written by Liang Qichao in 1905, and has just been recommended as one of the moral readers of Tsinghua Academy of Chinese Learning. I point that the exhortation of our univer- sity proposed by Liang Qichao has its original determination in his mind himself, which had already been compiled in Reflecting Moral more than a century ago.


    Institute of Scientific and Technical Information of China (English)


    Summary of Construction of a Hz S-based Sulphuric Acid Unit for a Large-sized Synthetic Ammonia Plant/Development and Application of New Process for Yellow Phosphorus Filtration during Yellow Phosphorus Production/Review of the Low-temperature Heat Recovery System of 250 kt/a Sulpharic Acid Plant of Shandong Bofeng/Technology for Combined Production in Compound Phosphate Fertilizer Plant of SHCCIG/Practice of Fouling Removal with Sulphuric Acid in the Cooling Water System of 400 kt/aSulfuric Acid Plant Based on Sulphur Burning/Production of Nitro-compound Fertilizer with Nitric Acid and Sulphuric Acid Method/Application of Tantalum Heat Exchanger and Glass Equipment in Spent Sulphuric Acid Concentration


    African Journals Online (AJOL)

    Effect of rural-urban migration of youths on agricultural labour supply in. Umuahia north local .... range of 50-61 years above, only 15% were below 40 years. This means that ... Family labour. 45. 49 ... under severe pressure. CONCLUSION ...


    Institute of Scientific and Technical Information of China (English)


    When discussing the maturation of Chinese sociology, one has to reconsider the relationsbetween Western sociology and Chinese sociology and distinguish the flows from their sources ifone wants to find a way forward for Chinese sociology. Chinese sociology should view theresources of homegrown sociological tradition as a "source, " which is represented by "qunxue"(literally the study of groups).


    Institute of Scientific and Technical Information of China (English)


    Case Studies of The New Young Man at Ministry of Organization's Editing Li Pin The editing of The New Young Man at Ministry of Organization wins its fame in the modern history of Chinese editing and pub- lishing for its conscious intensification of anti-bureaucracy theme, and its embodiment of the editing pursuit of Qin Zhaoyang, Peo- ple's Literature's executive editor-in-chief. After Mao Zedong's proposal of public criticism, China Writers Association persisted in editing reason, discussed related theoretical and practical problems in the form of panel, and brought forward the title of unknown heroes for editors, which means a milestone in the modern history of Chinese editing principles.


    Institute of Scientific and Technical Information of China (English)


    Mud logging subject and its speciality construction is an important practical issue in the field of mud logging engineering and accurately positioning mud logging subject and reasonably setting mud logging speciality have an important significance for promoting and guiding the rapid development of mud logging technology.


    Institute of Scientific and Technical Information of China (English)


    The establishment of spectroscopy logging theory and application prospects. Zhu Genqing. Mud Logging Engineering, 2011,22(3) :2-6,28 Based on a lot of research and years' practice and set ting out from the purpose of enriching the basic theory of mud logging technology, the author described several spectroscopic methods and theories commonly used in mud logging technology and explored the concept of the spectroscopy logging and the views to establish mud logging theory svstem.


    Institute of Scientific and Technical Information of China (English)


    Discussion on the Training Model of Training the Nursing Humanistic Quality by Employing the College English Teaching Li Hongfeng (Nursing College of Zhengzhou University, Zhenghou, Herman, 450052) Read and Write Periodica,vol.8, No.11,27,2011(ISSN1672-1578,in,Chinese) Abstract: The college English, as one of the most important public humanities courses in the curriculum system of collegiate nursing education, its teaching has positive orientation of human values and strong function in humanistic quality education.


    Institute of Scientific and Technical Information of China (English)


    A bus line inquiry algorithm based on set theory is proposed,and the design flow of transfer algorithm is presented. A plan for improving the efficiency of the inquiry algorithm is put forward. The bus line inquiry algorithm is simple and effective, and it can help user select optimal bus line.

  19. Abstract

    Directory of Open Access Journals (Sweden)

    Alexandre Costa Quintana


    Full Text Available The purpose of this article is to show the importance of the Cash Flow Statement and the Value Added Statement as effective instruments of financial management, due to the information that these statements can provide. To demonstrate this, a financial analysis of the principal financial statements of the Empresa Transmissora de Energia Elétrica do Sul do Brasil S.A. – Eletrosul – was made and in particular, a detailed analysis of the Cash Flow Statement and the Value Added Statement. To do this, the financial statements published by the company were obtained. First, liquidity ratios from the Balance Sheet were calculated and, subsequently, an analysis of the Cash Flow Statement and the Value Added Statement was made. This was done to demonstrate that the information obtained from the Balance Sheet could be better detailed by the use of the referenced statements, showing in the end that alterations in the liquidity of the company can be explained by the changes in the ways in which the company used its cash resources.

  20. Abstract

    Institute of Scientific and Technical Information of China (English)


    Function Ascriptions of Technical Artifacts (p.1) CHEN Fan, XU Jia (Research Center for Philosophy of Science and Technology, Northeastern University, Shenyang, Liaoning, 110004) Abstract: The function of technical artifacts is mind dependent. It is an ontologicaUy subjective entity and an epistemologically objective judgment. Function ascription is a general form of technical function in the epistemological sense. Function ascriptions may be taken in a descriptive and in a performative sense. The former can be called function ascriptions for short and the latter function assignments. The mind dependency of the function of technical artifacts is grounded in performative function ascriptions instead of descriptive function ascriptions. Key Words: Function ascriptions; Descriptive function ascriptions; Performative function ascriptions; Function assignments


    African Journals Online (AJOL)

    agricultural extension practitioners should intensify efforts in educating rural farmers ... disease caused by Human immuno-deficiency Virus (HIV), usually found in ... Health experts put Nigeria prevalence rate at 5.4% ranging from a low 1.9% to .... income may increase food and livelihood insecurity and severely undermine ...

  2. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Beliefs and Establishment of Their Orders —— From Sociological Theory Perspectives of Chinese Beliefs LI Xiang-ping Abstract: To understand the "harmonious" phenomena of China's history and culture and their concepts, the key is to understand and recognize its beliefs. Chinese beliefs and their social practice are closely related to establishment of harmonious social, historical and cultural orders in China. In fact, Harmony can refer to either a value target or a social reality, and it is also a kind of belief. The establishment of harmony based on certain beliefs, moral orders, political orders and power orders are basic components of social and cultural harmony. This article, from a sociological theory perspective of beliefs, discusses the positions and roles of different beliefs in building harmonious cultural orders in China, and it then aims to find out some rules of dual changes in Chinese society and Chinese beliefs. Key words: belief; order; harmony; sociological perspectives of belief

  3. Abstracts

    Institute of Scientific and Technical Information of China (English)


    China gradually got rid of foreign controls and finally became one of Great Powers from the "Sick man of East Asia" during the Republican era. During this period, intellectuals played significant roles both from the perspective of knowledge building and from the practical perspective. With respect to knowledge building, intellectuals initiatively introduced western knowledge and constructed a new knowledge framework about international relations based on the Chinese tradition in order to counter the shock of external knowledge and reduce the frustration from the collapse of Tributary System, which made China deal with the New world with much more self-confidence. The progress on knowledge building also provide theoretical foundation of foreign attitude and shape the Chinese, especially the elites' perceptions towards international affairs. Meanwhile, intellectuals attempted to deliver Chinese voices through diverse international platforms,


    Institute of Scientific and Technical Information of China (English)


    (1) New Forms of the "Production of Social Relations" under the Scrutiny of Social Engineering Tian Pengying In the Marxist perspective, the production and reproduction of social relations constitute the basic prerequisite and guarantee for human existence and development, and the establishment of an orderly and harmonious modern social relationship that promotes the coordinated development of material production and spiritual production is an important symbol of man's self-conscientiousness to adapt to, rely on and transform the society. The development, transformation and evolution of social relations is both a natural historical process and a creative process in which social subjects participate, design and construct.


    Institute of Scientific and Technical Information of China (English)


    Be Independent from Autocracy: a Comparison Between Wang Yuanhua and Gong Zizhen Also on the Depth of Wang Yuanhua's Thinking on the Eve of the Ideological Emancipation Movement Xia Zhongyi In 1977 ,Wang Yuanhua began to appreciate Gong Zizhen, not only because they were similar in temperament, context and situation, but also because Wang Yuanhua had found out the element of personal liberation in Gong zizhen's saying Be Independent from Autocracy, which shows that Wang Yuanhua's realization of the personal value was earlier than Li Zehou ( who established the Subjectivity Outline in a Kant's Way in 1979 ) and Wang Ruoshui (who proposed that personal value is the basis of Marxism in 1981 ) , and Wang Yuanhua's contribution in study Chinese by Chinese experience.


    Institute of Scientific and Technical Information of China (English)


    Fold distribution, offset distribution and azi- muth distribution in a bin have direct effects on ge- ometry attributes in 3D seismic survey design. If two adjacent bins have the same fold but different offsets, this non-uniform offset distribution brings some stack amplitude diversity in the adjacent bins. At present, 3D geometry attribute uniformi- ty of the most analytical methods is expressed by qualitative analysis chart. We introduce in this pa- per a uniformity quantitative analysis method for offset distribution by average value, square devia- tion and weighting factor. The paper analyses effects on offset distribution uniformity of different 3D geometry parameters by the proposed uniformi- ty quantitative analysis method. Furthermore, the paper analyses effects on seismic stack amplitude or frequency uniformity of different 3D geometry parameters by the seismic wave modeling. The re- suits show that offset distribution uniformity is in good agreement with seismic stack amplitude or frequency uniformity. Therefore this improved method can be considered as a useful tool for ana- lyzing and evaluating 3D geometry attribute uni- formity.


    African Journals Online (AJOL)

    administrative interference in staff work and a reasonable reduction in the work load of ... Traditional definition of attitude contains a slightly conception of its meaning. Definitions ..... Conditions for the Design and Management Of. Agricultural ...

  8. Abstracts

    Institute of Scientific and Technical Information of China (English)


    1.Changes Come from Turmoils, Hopes Reside in Stagnancy,by Zhu Feng a professor at the Schobl ofInternational t/elations, t'eklng University, anu a member oi ecutorlai Doaro oi Peaceand Development and a gust researcher of CDPS. In 2011, "the Arab Spring" changed the geopolitical ecology of the Middle East and North Africa. The U.S. stepped up readjustment to its global strategy with a high-sounding voice proclaimed its "return to Asia Pacific". A great surge was felt in the political trend of thoughts in the world, and the world was still faced with various terrorist threats.


    Institute of Scientific and Technical Information of China (English)


    Analysis of importance of TG Water CultureQuest Yang Bin Fan Lingling ( 1 ) Abstract: The awareness of quest constitutes the essence and demonstrates the basic characteristic of the water culture in the Three Gorges areas. The legend of King Yu controlling floods by dredging the Three Gorges marked the budding of this spirit. Qu Yuan fully demonstrated the essence of the spirit by a frequently quoted saying, "yet high and low I will search with my will unbending", "I will not regret a thousand death to die". The inscription of White Crane Ridge displayed the ancient fashion of the spirit. The construction of the Three Gorges Project interpreted the spirit of exploring of the Three Gorges water culture. The local higher education institution, with its motto "quest", can be taken as a model in carrying forward the spirit of"constant exploration". Key words: awareness of quest; the Three Gorges; water culture


    Institute of Scientific and Technical Information of China (English)


    On Chen Xianzhang's Moral Culture Blending Confucianism and Daoism (by ZHANG Yun-- hua) Abstract: Chen Xianzhang, who experienced and witnessed the social changes during the Ming Dynasty, achieved direction change of the scholarship and culture of his time from the rationalistic attitude to the idealistic philosophy through shattering the fetters and bold innovation in order to redeem people's spirit, save society, and rebuild the moral subject philosophy. Chen's elaboration of life and death, suffering and happiness, fame and gain, and retreat and withdrawal in this cultural shift reveals the characteristics of his moral culture blending Confucianism and Daoisrn. Key words: Chen Xianzhang; life and death; suffering and happiness; fame; gain; retreat


    Institute of Scientific and Technical Information of China (English)


    Mao Zedong' s "Three World Theory" underwent three stages of development: the "One Intermediate Zone" thought, the embryonic form of the theory, was put forward in the 1940s-50s; the "Two Intermediate Zones" thought, taking shape in the 1960s, was the rudimentary form; and the early 1970s witnessed the perfection of the theory. Mao Zedong developed the "Three World Theory" with sovereignty and national interests as the logical starting point, the theory of unity of opposites as the philosophical foundation, the Cold War as the historical background, and fighting against hegemonism as the major diplomatic strategy.


    Institute of Scientific and Technical Information of China (English)


    Development and Application of Three-stage and Four-layer Fluorine Removal Technology for Purification of Smelting Flue Gas Removal of fluorine from fluorine-containing smelting gas during the sulphurie acid production provides effective protection for the equipment in the system, and it is al~ a necessary measure to maintain normal prodluetion. For the equipment features and resource conditions in a sulphuric acid plant, the concept of three-stage and four layer fluorine removal is proposed, and the purification technology for fluorine removal is developed through optimization of the process design. Practice has shown that by utilizing the three-stage and four-layer fluorine removal technology, it offers advantages like higher efficiency of fluorine removal, shorter process flow, less equipment investment, easier operation, and offers certain value for promotion.

  13. Abstract

    DEFF Research Database (Denmark)

    Tafdrup, Oliver


    Udgivet som en del af Tidskrifts specialudgivelse om Adorno. som en del af Tidskrifts specialudgivelse om Adorno.


    Institute of Scientific and Technical Information of China (English)


    Critique of Contemporary Anti-Marxism Ideologies --Based on Thoughts of the "Four Major Boundaries";The Conflict on Public Ownership: A Comparison between the Socialist Market Economic Theory and the Theory of Market Socialism of British Labour Party;On The Germination of Marxist Theory of Property;Aesthetic Transformation of Mass Media for Socialist Core Value System;


    Institute of Scientific and Technical Information of China (English)


    Plato on Political Rhetoric Generally, Plato was regarded as being hostile to rhetoric. However, I will show that in Plato's some important political dialogues he still verifies the significance of rhetoric or persuasion. Then, I list the attacks of Plato on his contemporary rhetoric, which is called in the essay as "politician rhetoric". On the other hand, Plato also articu- lates the characteristics of true rlhetoric, which I name as "dialectical rhetoric. " In order to elaborate "dialectical rhetoric", I take Pericles as an example to show how the dialectic rhetoric could work in the real political world. Finally, I point out that dialectical rhetoric still can give some reflection for today's political rhetoric. It contains the ideal of the good, caring the soul of the audience, speaking the truth, insisting the right thing with reason, etc.


    Institute of Scientific and Technical Information of China (English)


    As a representative kind of "new diplomacy", the Silk Road Economic Beltand 21st Century Maritime Initiatives have aroused different responses at homeand abroad. They are important initiatives about co-building the Belt and Road,and give full play to China's strengths in the era of globalization. It is an importantopportunity to promote public diplomacy. The crux of the Initiatives lies in ourefforts in enhancing the awareness of cooperation, strengthening investigation andresearch, promoting mutual understanding, highlighting advantages and shunningdisadvantages for mutual benefit and win-win results through responding to theneeds of all parties.


    Institute of Scientific and Technical Information of China (English)


    Ma Xiwu' s trial mode is a model of adjudication in the Shaanxi-Gansu-Ningxia Border Region, resulting from the joint forces of the border region' s specific wartime environment, local environment, the border region' s social transformation and judicial reform as well as many other factors.


    Institute of Scientific and Technical Information of China (English)


    (1) The Narrative Structure and Mode of Realization of Marx's Theory of Human Emancipation Liu Tongfang Understanding the inherent logic of the ideas in the classic Marxist texts and revealing the narrative structure and mode of realization of Marx's theory of human emancipation is an important intellectual approach to the extension of Marxist theoretical research. As a scientific theory of the history of society, the narrative structure of human emancipation involves three aspects: historical materialism, multi-dimensional forms of emancipation, and communist movements. It offers a comprehensive analysis of the basic way of perceiving human society, the fundamental path to human emancipation and the ultimate aim of the evolution of social forms. It reflects the thorough-going revolutionary nature of Marx's theory of human emancipation and its close relationship with the real life of society. It would thus be academically significant to reflect on Western Marxism, Soviet-type socialism and the socialist road with Chinese characteristics from the viewpoint of the narrative structure of Marx's theory of human emancipation, so as to extend the Marxist theory of human emancipation and explore its specific mode of realization

  19. abstract

    Directory of Open Access Journals (Sweden)

    abstract abstract


    Full Text Available Introduction: Strawberry (fragaria×ananassa Duch. fruit characterized by short storage life, often estimated last less than one week even under optimum conditions at 8°C. The loss of fruit quality is often caused by gray mold (Botrytis cinerea that is the most frequent reported postharvest disease in strawberry during storage (6. In recent years, considerable attention has given to elimination of synthetic chemical and fungicides application and development of various alternative strategies for controlling fruit and vegetables diseases (2. One strategy is replacement of natural products with plant origin such as essential oil and methyl salicylate (MeSA. Essential oils are volatile, natural and complex compounds characterized by a strong odor formed by aromatic plants in form of secondary metabolites. In nature, essential similar oils that extract from lavender (Lavandula angustifolia play an important role in protection of the plants against pathogen incidence that can be replaced by synthetic fungicides (1, 4 and 14. MeSA is also a volatile natural compound synthesized from salicylic acid which has an important role in the plant defense-mechanism, as well as plant growth and development (5, 19 and 20. Therefore, the main objective of this research was to study the effects of MeSA and lavender essential oil (LEO on decay control caused by Botrytis cinerea as well as post-harvest quality indices of strawberry fruits during cold storage. Material and Methods: First, antifungal activity was studied by using a contact assay (in vitro, which produces hyphal growth inhibition. Briefly, potato dextrose agar (PDA plates were prepared using 8 cm diameter glass petri dishes and inhibitory percentage was determined. For in-vivo assessment of LEO and MeSA effects on Botrytis-caused fungal disease control, the experiment was conducted as factorial in completely randomized design (CRD with 3 replicates. The treatments were 3 concentration of LEO including 0, 500 and 1000 µl L-1 and 3 level of MeSA including 0, 0.1 and 0.2 mM. After treatment, the fruits were inoculated by Botrytis suspension and transferred to storage and quality parameters were evaluated after 7, 14 and 21 days. At each sampling time, disease incidence, weight loss, titratable acidity, pH, soluble solids content, vitamin C and antioxidant activity were measured. Results and Discussion: The results showed that both LEO and MeSA treatments had significant effects on inhibition of mycelium growth within in-vitro condition (p < 0.05. Inhibition rate of mycelium growth significantly improved by LEO and MeSA concentration increase of, (Table 1. At in-vivo assessment, diseases incidence of treated fruits with 500 µl L-1 LEO and 0.1 mM MeSA were 32% and 64% lower than untreated fruits, respectively (Fig. 1 and 2. During storage period, the percentage of infected fruits increased. In addition, LEO and MeSA treatments affected quality parameters of strawberry fruits including titratable acidity, soluble solids content, vitamin C and antioxidant activity. Treated fruits had a high content of soluble solids, vitamin C and antioxidant activity in comparison to untreated fruits (Table 3 and 4. Probably ascorbic acid decreased through fungal infection duo to cell wall break down during storage. Any factors such as essential oil and salicylate that inhibit fungal growth can help preserving vitamin C in stored products. High level of vitamin C and antioxidant activity was observed in treated fruits with 0.1 mM MeSA and 500 µl L-1 LEO. In controlling weight loss of fruits, 0.2 mM of MeSA and 500 µl L-1 of LEO had significant effects, although MeSA was more effective than LEO treatments, possibly due to elimination of respiration rates and fungi infection (Table 4. Therefore, LEO and MeSA with fungicide effects could be replaced with synthetic fungicides in controlling fungal diseases of strawberry and maintain fruits quality during storage. Conclusion: In conclusion, our results showed that LEO and MeSA treatments could be safe and used to prevent infection of strawberry during storage, although LEO was more effective than MeSA treatments. Concentration of 500 μl L-1 of LEO and 0.1 mM MeSA could control fungal infection of fruits during storage. Also, LEO and MeSA treatments can extend shelf life for over the minimum period required to transit strawberries to foreign markets and without affecting quality, adversely. However, future studies are necessary to fully understand the mechanisms by which LEO and MeSA treatments may act as a fungicide and increase their postharvest life.


    Institute of Scientific and Technical Information of China (English)


    ( 1 )How does China Appraise the Rising of India Zhao Can-cheng · 1 · Abstract: The rising of India has become an important topic in Chinese Media in the 21st century,and how does China appraise the rising of India is worth discussion. According to the recognition of Chinese official, media and schol- ars on India, this paper discusses the possible impact on China following India's rise and make a prediction on Sino-In- dia relationships. Key Words: China; Appraise ; Rising of India


    Institute of Scientific and Technical Information of China (English)


    Shortly after the People's Republic of China was founded in 1949, it wasnecessary and in its interest for China to join the socialist camp led by the SovietUnion. In 1954, China proposed the five principles of "peaceful coexistence". Atthe Bandung Conference in 1955, China, India and Myanmar jointly advocated thefive principles as a means of good governance in Asia and the whole world. Earlyin the 21st century, China proposed a new concept of "win-win cooperation" as animportant principle for international relations in the new global era.


    Institute of Scientific and Technical Information of China (English)


    Balance and Loss of Balance in Human Rights Law;The Socialist Legal System with Chinese Characteristics: Its Structure, Features and Trends;Historical Materialism and Contemporary Socio-historical Reality;Rousseau, Kant and Marx in the Lineage of "Moral P

  3. Abstract


    Kucrová, Veronika


    My thesis deals with the legal aspects of counterfeit trademarks, the competence of Customs Administration in the control of intellectual property rights, labor courts and CTI. My work describe the basic concepts and legal rules governing intellectual property rights. All rights and duties, regulations, agreements and treaties in the field of legal protection designation.


    Institute of Scientific and Technical Information of China (English)


    On Law Theory of Public Interest : An Analysis Based on the Need Spill Theory;The Theory of the Nature of Harming Society : Its Fate in Contemporary China;Criminal Law Fiction : An Analysis of Its Function and Application Rules;How to Define Illegal Financing : A Critique of Legal Interpretation of Illegal Financing by Supreme Court;

  5. Abstract

    Directory of Open Access Journals (Sweden)

    Maria Jose Carvalho de Souza Domingues


    Full Text Available The practice of teaching, in actuality, shows the necessity of teachers and students coming together to form a behavior that is different from the traditional model of teaching. The unity formed from various types of knowledge and the relation between theory and practice show themselves to be fundamental. Starting in 2002, and in search of this unity, a project that hoped to unify the disciplines taught in the second semester of the course in Administration was implemented. During the semester, a single work sought to relate the theories studied with the reality of an organization. Each professor evaluated the works from the point of view of his discipline, as well as the presentation, in general, of the group. It can be affirmed that seeking to bring together various types of knowledge necessarily passes to a rethinking of the postures of teachers and students.


    Institute of Scientific and Technical Information of China (English)


    4 Introduction of the Methods Generalized from Mineral Exploration HU Kui (Consulting & Research Center Ministry of Land & Resources, Beijing 100035, China) Abstract: This paper focuses on the introduction of prospecting methods generalized from mineral exploration, these include: prospecting in deep part of the deposit based on shallow deposit, and periphery prospecting within the ore district; finding other type ( kind ) of deposit according to this type; lean ore is the base for rich deposit; small rich ore can depends on large lean ore; the dependence of economical mineral resource is uneconomical mineral resource; prospecting mineral deposit on the basis of different minerals; following outcrop mine to find blind ore; and with marks to explore ore.


    Institute of Scientific and Technical Information of China (English)


    Research on the Theory and Standard of Peasants" Life Cycle Pension Compensation Mu Huaizhong Shen Yi· 2 · Thedifficulties of full coverage in pension system lie in rural farmers. In this paper, we put forward a "dual agricultural welfare difference" theory and apply it to the issues regarding peasants' life cycle pension compensation. Taking differential between equilib- rium and biased agricultural incomes as the key indicator, we build mathematical models of "dual agricultural welfare balance" and measure the size from 1953 to 2009. Our finding shows that China's "dual agricultnral welfare difference" has a fluctuation ranged be- tween 0.4 and 0.6. Based on life cycle characteristics, such as natural life cycle, policy and institutional life cycle, our suggestion is to compensate peasants' primary pension with a balance of "dual agriculture welfare difference" and other countermeasures.

  8. Abstract

    Institute of Scientific and Technical Information of China (English)


    Scientific Culture and Cultural Science (p.1) Today science advances at an astonishingly high speed, and driven by the ideological and industrial revolutions, it even becomes a dominant culture in the society and is respected as the supreme authority. However, the scientific culture, which plays the leading role in the industrial civilization, turns out to be more and more alienated from culture and humanity, resulting in the so-called cultural confusions and loss of humanity. This article, investigating the phenomenon deeply, argues that science has no privileged position over the other cultural traditions, and suggests that science identify itself as a member equal with the other cultural patterns in the society in order to restore its cultural connotations. It is believed that by establishing the cultural science, we can bring culture and humanity back to science.


    Institute of Scientific and Technical Information of China (English)


    Research on the Necessity of Building Intercity Transit System within Changsha-Zhuzhou-Xiangtan Metropolitan Huang Weili 4 To plan and build intercity transit network within Changsha-Zhuzhou-Xiangtan metropolitan will not only meet the rapidly increasing demand for passenger transport service and promoting the integration and urbanization of the metropolitan, but is also the necessary measures to build energy-saving and environmental-friendly society, and realize sustainable development.


    Institute of Scientific and Technical Information of China (English)


    @@CONCURRENT SESSION: FOOD AND WATERBORNE DISEASES      Chair  Prof. Liu Xiu-mei, Institute of Nutrition and Food Hygiene (CAPM), China   Co-chair   Dr. Jorgen Schlundt, World Health Organization, Switzerland   1530-1545 hrs Emerging Foodborne Disearse: An Evolving Public Health Challenge   Robert Baldwin, Center for Disease Control, USA   1545-1600 hrs Food Poisoning Typicality in Food Safety Vulnerable Area of Indonesia   Adil Basuki Abza, Bogor Agricultural University, Indonesia   1600-1615 hrs The Management of Food Poisoning in China   Li Tai-ran, Institute of Food Safety Control and Inspection, Ministry of Health, China   1615-1630 hrs Detection of Campylobacter Species Using a Fluorogenic Real-Time PCR Detection System   Hai-yan Wang, Bureau of Microbial Hazards, Health Canada, Canada   1630-1645 hrs An Overview on Bongkrekic Acid Food Poisoning   Liu Xiu-mei, Institute of Nutrition and Food Hygiene (CAPM), China   1645-1700 hrs Screening Procedure from Cattle Feces and the Prevalence of Escherichia coli O157 in Taiwan Dairy Cattle   Chin-Cheng Chou, Taiwan University, Taibei, China


    Institute of Scientific and Technical Information of China (English)


    4The Current Trends in Global Mineral Exploration and Development LIU Shucken (Information Center of Ministry of Land and Resources, Beijing 100812, China) Abstract: This paper introduces the main issues that the global mineral exploration and development are faced with. The main issues of focus include: the mineral exploration has rapidly recovered from the short depression caused by the effects of global financial crisis; most of the important mineral reserves have continued to grow; there has been continued rapid growth in mining development investment; the supply capacity of mineral products has increased; mergers and acquisitions of mining company are stirring, and multinational mergers & acquisitions has become mainstream,


    Institute of Scientific and Technical Information of China (English)




    Institute of Scientific and Technical Information of China (English)


    THE MAIN SAFETY MEASURES AND VISTA OF THE SUCCESSFUL EXPLORATION AND DEVELOPMENT OF THE " THREE HIGH" GAS FIELD IN NORTH-EAST OF SICHUAN PROVINCE[ 1] Peng Guosheng (SINOPEC Safety & Environmental Protection Bureau, Beijing , 100728) Abstract: Based on the special safety risk of "Three High" gas field in north-east of Sichuan province, this paper makes a systematic analysis on the necessity of special supervising and managing measures taken by SINOPEC during exploration and development.


    Institute of Scientific and Technical Information of China (English)


    Reliability validation studies of locomotive engine turbocharger LI Yu (Dalian Locomotive Research Institute Co., Ltd., Dalian 116021, China) Abstract: Considering the use features of the locomotive diesel engine turbocharger and combining the finite element simulation with experiment, the validation method of tile turbocharger has been studied. In this way, the number of tests can be reduced and the success rate of the test can be increased. And the turbocharger relia- bility assessment can be ahead of the schedule. Key words: turbocharger; reliability; validation test

  15. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Determining Dynamic Rese-rve of Gas R e~servoir by Improved Pressure Drop Method; Mechanical Analysis for Completion String and Its Engineering Applications;Performance Prediction of Natural Depleting Development of Condensate Reservoir with High Gas Condensate Content with a Single Well.


    Institute of Scientific and Technical Information of China (English)


    Adhesive traction test of HXD3 locomotive under simulated rain conditions HAN Chang-hu1, LIU Jie-min2, XU Hao-dong1, SONG Yu-ping1 (1. West Jinan Locomotive Depot, Jinan 250117, China; 2. Jinan Railway Administration, Jinan 250001, China)Abstract: To study the impact of severe weather on HXD3 locomotive adhesive traction force, Jinan Rail- way Administration conducted a adhesive traction test of HXD3 locomotive under simulated rain conditions and accumulated large amount of data for reference.


    Institute of Scientific and Technical Information of China (English)


    Based on engineering practice, this paper applies the finite element method to model the SAC test results of bolted endplate connection. The ductility capacity of a new extended bolted end-plate connection for industrial buildings and structures is analyzed, and the analysis results can be used in engineering design and the development of specifications concerned.

  18. Abstract

    African Journals Online (AJOL)

    Dr Osondu


    Oct 26, 2011 ... Ethiopian Journal of Environmental Studies and Management Vol. 4 No.3 2011 ... networks, distribution systems, and other social facilities (Handler and ... water, healthcare, education, sanitation and security. However, the ...

  19. Abstract

    Institute of Scientific and Technical Information of China (English)


    Power, Space and Inner Structure of Blocks--on Rue Massenet of Shanghai MA Xue - qiang This paper dwells on the formation and change of Rue Massenet in modern Shanghai, and studies Rue Massenet' s history as a road as well as a block. It also investigates the structure of the block and reveals its inner function features. The analysis of Rue Massenet which is regarded as a "sample" of modern block type helps expand and deepen the researches of urban history research.


    African Journals Online (AJOL)

    their job performance in Imo state agricultural development programme, Nigeria. ... The blocks are made up of many communities with the block extension .... detailed to rural areas to probably execute government policies and decisions. ... office for about 7 times during the past 12 months, listened to agrie radio talk for ...


    African Journals Online (AJOL)

    showed that the per capita calorie intake of the people is 1990 kcal/day while the average household size and dependency ratio were found to be 9 persons and 0.77 .... staple food, and large number of female controlled households suggest.


    Institute of Scientific and Technical Information of China (English)


    In order to study the state development of fuel-spray in the combustion chamber of TBD620 diesel engine, a spray visualization system was construc-ted by the method of flash photography capturing images of fuel spray at different times. Fuel injection characteris-tics changes were studied by changing the fuel injection pressure and the spray wall-impingement was discovered, which provides a basis of structural optimization for the combustion chamber.


    Institute of Scientific and Technical Information of China (English)


    This paper introduces the main steps of typical QRA through application of QRA to the risk management of petrochemical construction projects. It explores the limitations of QRA method and points out the role of QRA in risk management of construction proje


    African Journals Online (AJOL)

    livestock feeds and diet (RRIN, 1985b). So also is the ... growing on kernels impact their various colours to the seeds (Igeleke and Ekpebor, 1986). Biochemical ... Rotting and caking seed meal (Heating, and production of mycotoxins).Heating ...


    Institute of Scientific and Technical Information of China (English)


    Practice and experience on key equipment localization for Longtan project Abstract: Longtan Hydropower Station is the second largest hydropower station after Three Gorges in those have put into production in China. Based on the idea of "objective, practical and economic", an exploratory investigation to promote the key equipment localization and the national industry revitalization was conducted. The localization of key equipment such as 700MW hydraulic generating unit, 500kV three-phase composite transformer, 500kV crosslinked polyethylene insulated cable and monitoring system for giant hydropower stations was realized successfully. The experience is using for reference in after hydropower projects.

  6. Abstract

    African Journals Online (AJOL)


    entrepreneurial attitude (that is measured through achievement and innovation) and .... As such, indigenous entrepreneurial attitudes toward innovation will be restricted ..... 05-2005.html.

  7. Abstracts

    Institute of Scientific and Technical Information of China (English)


    International Norms, Group Identity and Domestic Institutional Re- form: The Case of China's Entrance to FATF Lie Xinghua Abstract: International norms are the collection of binding rules governing the international community. International norms with high levels of legitimacy result in norm groups. Such norm groups directly affect the space for and effectiveness of behavior. In order to enter a norm group and obtain membership status within the group, states must engage in domestic institu- tional reforms in order to meet standards of admission. In order to enter FATF, China studied the principles of the 40+ 9 Recommendations, and ad- vanced comprehensive domestic reforms to counter money laundering.

  8. Abstract

    Institute of Scientific and Technical Information of China (English)


    Concept Construction and Empirical Analysis of Social Integration for Rural-Urban Migrants in China; Under the Dual Structure of the Triple Migration Model: A Shortage of Migrant Workers, a New Research Framework;Cultural Meanings of Chinese Guanxi: A Viewpoint of Management Scholars;Determinants of Banking Efficiency: Cross-Country Evidence;


    Institute of Scientific and Technical Information of China (English)


    Analysis and forecast of the world economy The pace of global economic recovery has slowed down markedly and the risk of a sagging world economy has been increasing in 2011. However, the economic slowdown was taking place at different speeds in different categories of economies. The momentum of economic recovery in the developed economies is clearly insufficient, and its economic growth rate is far lower than the rate of the emerging economies and has declined much more than that of emerging economies. Many big developed economies are facing very severe employment situation now, while the space of the their fiscal and monetary policies have been compressed by the upgrade of the sovereign debt crisis and long-term low interest rates, which are associated with the turmoil in international financial markets, the sluggish growth of international trade and investment, fluctuations in international commodity prices, and aggravated social problems.


    Institute of Scientific and Technical Information of China (English)


    As the institutional quality audit is being conducted in some pilot provinces,different interpretations of it have occurred,some of which appear to be misleading.This paper is to redefine it in terms of thematic focus,role,value and method to facilitate its implementation.It proposes that the institutional quality audit should keep consistently focused on internal quality assurance,in-volve various stakeholders,enhance its empowerment function and develop itself into a comprehen-sive and systematic approach to continuous quality improvement.

  11. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Analyses and Suggestions on Coordinated Regional Development of Insurance Industry in China GUO Jin-long Abstract: Through studies on the coordinated development status between insurance industry and social economy in China from 2005 to 2009, it is found that the coordination between insurance and economy remains slightly imbalanced in most of the provinces and cities in China, with only a few provinces and cities showing low-degree coordination in 2007. As a whole,

  12. Abstract

    Institute of Scientific and Technical Information of China (English)


    Models of Reduction and Functionalism: Comments on Kim's Reductive Physicalism CHEN Xiaoping (Research Center of System Science and System Management, School of Public Administration, South China Normal University, Guangzhou, Guangdong, 510006) Abstra

  13. Abstract

    Institute of Scientific and Technical Information of China (English)


    Philosophical Analysis of the Essential Characteristics of Transgenic Technology: Based on the Comparative Studies of Different Breeding Ways (p.1);Public Recognition of the Issue of Technology Ethics of GM Corn in Contemporary China (p.7);Uncertainty of Commercializing GM Crops in China (p.13);Analysis of the Public's Perception of and Attitude to GM Rice and Guidance to Their Behavior: Based on the Data from Social Survey in Hubei Province (p.18)

  14. Abstract

    Institute of Scientific and Technical Information of China (English)


    The Subject of Research, Methodology and Research Paradigm of ‘Das Kapital'; ‘Das Kapital' and the Scientific View of Marx on Wealth;The Way of Capitalism in the Background of Global Financial Crisis;



    ÇELİK, Hilal


    Discourse analysis takes its place within a larger body of social and cultural researchthat is concerned with the production of meaning through talk and texts. In this study generalprinciples of discourse analysis and how discourse analysis is used in qualitative research arementioned. Theoretical background of discourse analysis based on different fields in socialsciences such as sociology, politic, linguistic, media, psychology, etc... Each of them usediscourse analysis according to their o...

  16. Abstract

    Institute of Scientific and Technical Information of China (English)


    The Characteristics of Modern Tianjin Salt Merchants Culture As a new commercial culture in modern China, Tianjin salt merchants culture has its own different characteristics, such as luxury consumption culture, political culture, religious scholar culture and moral culture. In these cultures behind embodies the Salter group's behavior pattern and psychological structure.


    Institute of Scientific and Technical Information of China (English)


    The paper summarized the status of foreign mud log- ging technology from geological logging, engineering logging and mud logging informalization and put forward the future development direction of mud logging technique. The abroad geological logging focuses on micro-nalysis, in which the cutting CT scan, laser element analysis and field gamma scan are used as important means of setting up the geological profiles.


    Institute of Scientific and Technical Information of China (English)


    COSCO Shipping semi-sub veseis POOL achieving new progress On August 8, 2012, the second member China Zhejiang Xiazhiyuan Ship Management Co., Ltd. joined the semi-submersible vessels POOL created by COSCO Shipping Co., Ltd. (COSCOL) earlier this year. The new member comes after the Guangzhou Salvage Bureau of the Ministry of Communications, who joined the semi-submersible vessels POOL in February. The capacity structure of the COSCO Shipping's semi-submersible vessel POOL can be further optimized in 20000, 30000, 40000 and 50000 DWT and achieved universal coverage, which powerfully promoting the brand of appeal. COSCO Shipping Co., Ltd. owns and operates nearly 100 ships including semi-submersible, heavy lift, multi-purpose, ro-ro/Io-lo, general cargo ships and pure car carriers. Among them, semi-submersible vessels are the leading.P18


    Institute of Scientific and Technical Information of China (English)


    Severe Damage of Absorbing Foreign Capital Must Be Correctly Observed Accelerating Transformation of Economic Development;Lenin Had Never Set Forth a "National Syndicate" Pattern;Talent Allocation for Undertaking Service Outsourcing of China;Preliminary Management for "Urban Disease" during British Industrialization;Comprehensive Review on Review on Risk Management of Sports Tourism in China;


    Institute of Scientific and Technical Information of China (English)


    Current Situation and Prospect of Urban Transit Development in Mainland China The paper reviews the development of urban transit construction, networking operation and diversified technology systems in mainland China during the last 40 years. The paper also presents the short-term planning of urban transit in mainland China and the solutions for financing, construction period and operational cost etc.

  1. Abstracts

    Institute of Scientific and Technical Information of China (English)


    China's roles in the rice cultivation culture in the world---the inventor of artificial cultivation of rice; Zhuang nationality's roles in the artificial cultivation of rice in China--the earliest inventor of artificial cultivation of rice; Longan County's roles in the rice cultivation culture of Zhuang nationality---the most concentrated and most splendid exhibition place and the biggest highlight for the rice cultivation culture of Zhuang nationality. Key words: Longan County; rice cultivation culture; biggest highlight


    Institute of Scientific and Technical Information of China (English)


    STUDY ON THE FEATURES OF DIFFERENT REFLECTION IN TAHE OILFIELD PALEOCAVES RESERVOIR/Jianfeng Wang, Pei Jin, Xinhua, Li et al. Northwest Oilfield Company of SINOPEC, Urumqi, Xinfiang ,830011/Xinfiang ShiYou TianRan Qi ,2011,7 ( 3 ) : 1 - 5 Abstract:In This paper, in the light of Seismic migration section and tectonic analysis data, seismic echo styles of Tahe oilfield paleocaves reservoir in time migration are summed up; different reflection features are classified. In the meantime, the classification criteria of quantizing identification with reservoir seismic echo model is established. With those methods above, the paleocaves reservoirs forecasting degree and well arrangement ratio are improved, the risk of developmental drilling is reduced and efficiency is reduced. The high development efficiency in Ordovician paleocaves reservoir is fulfilled. Key Words : Tahe Oilfield ; Paleocaves Reservoir; Reflection features ; Quantizing identification ; Reservoirs forecasting

  3. abstract

    Directory of Open Access Journals (Sweden)

    . user


    Full Text Available Introduction: One of the microbiological preparations used for this study was Effective Microorganisms (EM, being a commercial mixture of photosynthesizing bacteria, Actinomycetes, lactic acid bacteria, yeasts and fermenting fungi. The microbiological composition of the EM concentrateincludesStreptomyces albus, Propioni bacterium freudenreichil, Streptococcus lactis, Aspergillus oryzae, Mucor hiemalis, Saccharomycescerevisiae and Candida utilis. Moreover, EM also contains an unspecified amount of Lactobacillus sp. Rhodo pseudomonas sp. and Streptomyces griseus. Effective Microorganisms have a positive effect on the decomposition of organic matter, limiting putrefaction, increasing nitrogen content in the root medium of plants, phosphorus, improving soil fertility and as a result contributing to the growth and development of the root systems of plants. Selection of almond vegetative rootstocks for water stress tolerance is important for almond crop production in arid and semi-arid regions. The study of the eco-morphological characteristics that determine the success of a rootstock in a particular environment is a powerful tool for both agricultural management and breeding purposes. The aim of this work was to select the new rootstocks for water shortage tolerance, impact of water stress as well as Effective Microorganism (EM on morphological characteristics of almond rootstocks. Materials and Methods: In order to select the new rootstocks for water shortage tolerance, impact of water stress as well as EMonmorphologicalcharacteristics of almondrootstocks were studiedin thedepartment ofHorticulture, Ferdowsi University of Mashhad, in 2011-2012. The experiment was carried out with four replications in a completely random blockdesign to study the effects of two concentrations of EM (0 and 1%, three irrigation levels (normal irrigation 100%-control-and irrigation after depletion of 33 and 66% of available water, and four almond rootstocks including GF677 and selected natural hybrid of peach × almond (H1and H2, and almond vegetative rootstock (local control.In this study,EMtreatments for 60 days before stress treatments were applied so that in each irrigation, EM solution to a concentration of one percent was given to half of the experiment pots. Other pots were irrigated equally with normal water. Stress levels were applied from July as follow: full irrigation, watering after unloading 33% and 66% soil moisture availability. In order to evaluate the performance, seedling survival, plant growth, number of leaves, leaf area, root fresh and dry weight and leaves and root length were measured. Results and Discussion: Analysis of variance showed that between rootstock levels across all treatments were significantly differences at 0.01 level of probability. Comparison of means showed that the highest fresh and dry weight and leaf are awere observed forGF677and H1.Rootstockannualgrowth rate was also different. Most of the growth was related to the H1 Rootstocks. Thes urvival ratewas significantly different from the Rootstocks ofGF677,andH1showedthe highestpercentage of survival. The degree of adaptation to drought in varieties of almonds is different. The results showed that changes ingrowthparametersinGF677and H1were observed less often than other rootstocks. Because of strong roots,GF677and H1continue to attract more minerals under stress conditions. Analysis of variance showed that the between irrigation levels for all treatments were significantly different at 0.01 level of probability. Comparison of means showed that among the study traits, the highest amount was obtained from complete irrigation, while irrigationat66 percenthad the least amount. Water stress may directly affect photosyn thesis, through leaf photochemicalprocessorindirectly,byclosing stomata, reducingleaf area and growth. The results showed that the levels of(EM on the leaf surface, leaf number, annual growth, root dry weight and volume were significantly different (p


    Institute of Scientific and Technical Information of China (English)


    ( 1 ) Overview on the Political and Economic Situation in Southeast Asia in 2011 Wang Shi-lu · 1 · Abstract: Being affected by negative factors home and abroad, all countries of Southeast Asia faced pressure in maintaining stability and pushing development in 2011. Despite all that, the relatively stable politics, better economic situation as a whole in Southeast Asia remained. Though security situation was grim, all governments took proper measures to resolve crisis. Meanwhile, regional cooperation was pushed forward in Southeast Asia , and achieved some results.


    Institute of Scientific and Technical Information of China (English)


    Academic progress and innovation depend on the development and change of researchparadigms. In order to lay a foundation for research based on "Chinese discourse, " scholars inChina must develop their own academic paradigms based on realities of their country. A review ofvillager self-administration research indicates that, the practice of villager self-administration inChina has once again become a focus of its political science, among others. Not only has a "valuesystem" paradigm been created, but also its change into a new one of "form-condition" hascompleted, the process of which is of universal value.


    Institute of Scientific and Technical Information of China (English)


    Judicature, Public Opinion, and Politics at An Age of Disordered Legal World View :A Study Centered on the Case of Li Changkui The Case of L/Changkui represents a kind of simple "hard case", in which whatever the judge made a de- cision, result of the case failed to gain good social and legal effects, and the causation, however, rested on the internal system of judicature. The Case of Li reflects an age at which legal world view is deficient in coherence and integration. Although it's not an exclusive problem for China that judicature, public opinion and politics in- teract complicatedly, and the society shows distustt upon the criminal justice system, it reveals that, in the case of Li, some judicial personnel and academics hold an uni-dimensional and prejudiced understanding on the credi- bility, legitimacy and stability of judicature.


    Institute of Scientific and Technical Information of China (English)


    Another Cost of Rights : State Identification and Its Western Experience OU Shujun The Western Experience of State Identification shows that identification is another cost of rights, a prerequisite for constructing the rule of law and good governance. Identification is the most infrastructural public goods that should be supplied by the government, and its publicness comes through in that it almost is a precondition for all state institutions, so it can be called the most infrastructural power of national governance system. In the fourfold-building process of one country under the rule of law, a state rule by law, a tax state, a welfare state and a regulatory state, a modem state increasingly needs to enhance the state identification capacity, so that the majority can be involved in the state identification system, which in turn will accelerate the process of state-building, make law and policies more effective, minimize the intermediate cost of communication between states and individuals, and eventually realize good governance by focusing on the expectations of the majority and serving for the majority. The people seeking a strong democratic country under the rule of law must face up to the fact that identification as a kind of govemmentality has been institutiona/ized and routinized in advanced indnstrial democracies.


    Institute of Scientific and Technical Information of China (English)


    Since labor resources are a key factor in economic development, the difference of their allocation efficiency has aggravated the imbalance of China's regional economic development. Based on the formula of per capital GDP, this paper constructs an interpretation model of demographic bonus containing influence factors of human capital and material capital accumulation. Subsequently, using data envelopment analysis model we have measured and decomposed relative efficiency of demographic bonus in each region of China during 2006-2010. We have also accounted for the technical efficiency and scale efficiency by using Tobit model. Empirical analysis shows that the relative efficiency of demographic bonus in the Eastern region is higher than those in the middle and west areas. The technical efficiency is mainly affected by education level, aggregation effect of labor force and its participation rate, with influence radios of 0.0102 and 0.0149. Meanwhile, The scale efficiency is mainly affected by education level, aggregation effect of labor force, industrial environment of capital accumulation and generation effect of material capital, with influence radios of 0.1549, 0.1234 and 0.0371. Finally, this paper puts forward suggestions related to the findings.

  9. Abstracts

    National Research Council Canada - National Science Library


    ... المؤسسات إرشادات بشأن أفضل المُمارسات، يوضح هذا البحث مُمارسات الباحثين في إدارة البيانات، والنتائج الأولية لمشروع تم تنفيذه في جامعة جريفيث لتطبيق إطارًا مفاهيميًا...

  10. Abstracts

    National Research Council Canada - National Science Library


    ... والتي تتضمن إدارة النظم المكتبية والموارد الإلكترونية والمُعدات الرقمية والاستفادة من مواقع التواصل الاجتماعي في جذب المُستخدمين. دول الكومنولث: كيف شكلت نماذج...


    Institute of Scientific and Technical Information of China (English)


    A Discussion on Theme Slogan and Logo of Tourism Image Beautiful Hubei also on Hubei Tourist Attractions and Branding :Cao Shitu Han Guowei (2) Abstract: The paper analyzes the deficiencies of the existing theme slogan and logo of tounsm, image Beaufil Hube by using the methodology of tourism image-building, and then puts forward new theme slogan and logo Magnincent Huoei Door to Magical Landscape and Romantic Culture"as well as the idea of b uildingtouri"brand "Magical and Romantic Tour".


    Institute of Scientific and Technical Information of China (English)


    4 Thoughts and Suggestion about Rural Collective Land System Reform YAN Zhiyao (Ministry of Land and Resources, Beijing 100812, China) Abstract: The imperfect rural collective land property right system has caused the difficulties in increasing the income of farmers, surplus migrant workers, laborer shortage, and sharp conflict for land requisition, which has become the biggest bottleneck in the current development and stability. This paper argues that the rural land property rights institution and land requisition system are the core and key for rural economic breakout and the harmonious development of urban and rural economy,


    Institute of Scientific and Technical Information of China (English)


    Old local government documents are an important basis for studying ancient villages and clan cultures. From the Xinhui County Gazetteer, it is known that the development of the Tangxia Basin where Liangxi is located had started by the beginning of the Ming Dynasty. By the Kangxi reign period in the beginning of the Qing Dynasty, the village and its clan had received considerable government attention. By' the end of the Qing Dynasty, the village had been sanctified. It is a notewor- thy phenomenon that a clan could have attained such an important cultural position.


    Institute of Scientific and Technical Information of China (English)


    Applications of converted-wave anisotropic prestack time migration in LMD area. Zhang Liyan1, Li AngI, Pei Jiangyun1 and Song Zongpingz. OGP, 2012, 47(5): 683-689 Media anisotropy affects greatly converted- wave imaging for large offset gather. Based on non-hyperbolic NMO equations of converted-wave anisotropy, we propose a simple and practical high precision Gamma (Average velocity ratio of P and S wave) field building method and a structure ve- locity scanning method in this paper. These two methods can obtain accurate Gamma field and con- verted-wave RMS velocity field. Migration travel time can be calculated by anisotropy double square root scattering travel time equation. The applica- tion of the methods on 3D3C data in LMD area,


    Institute of Scientific and Technical Information of China (English)


    Peace is one of humanity's eternal pursuits; conflict, however, is a part of humandestiny. In the course of pursuing peace, religion, as a major practical form of publicdiplomacy, has played an important role in averting conflicts between differentcivilizations. By upholding the ultimate goal of promoting mutual understanding andtrust between different countries and peoples and world peace, the Charhar Institutehas since its founding actively facilitated a religious peace movement focusing onexchanges between the Buddhists of China and South Korea. Serving as a typicalexample of public diplomacy, this has been an important element of the institute'sactivity, and achieved fruitful results. The integration of public diplomacy and religionhas proved itself to be good for the peace effort sof humanity.

  16. Abstract

    African Journals Online (AJOL)

    unique firstlady

    To capture impact of subsidy removal on domestic consumption of petroleum product ... curtains, detergents, records, plastic toys and toothpaste. Crude oil got from ... This implies uncondensable gases, methane, ethane, and ethylene, which ...


    Institute of Scientific and Technical Information of China (English)


    DESIGN OF ANTI-LIGHTENING AND GROUNDING SYSTEM FOR COMPRESSOR SHELTER AND LARGE WAREHOUSE IN REFINERY AND PETROCHEMICAL PLANT[1] Wang Zongjing (SINOPEC Engineering Incorporation, Beijing, 100101) Abstract:With the rapid development of national economy, petrochemical industry plays a more and more important role in national economy. Since most of the process medium in various units in refineries and petrochemical plants are flammable and explosive hazardous substances, high requirements are imposed on the reliability, continuity and stability of each link and facility in the production. Most of the compressor shelters and large warehouses, which are the core buildings in refin- ery and petrochemical plant, are closed or semi-open, so that the atmospheric diffusion of explosive gas mixture is restrained and explosion hazard concentration is kept within a certain period of time. In case of ignition, the enormous explosion pressure will result in damage to equipment and buildings. Therefore, the anti-lightening design of compressor shelter and large warehouse is especially important for the anti-lightening security of refineries and petrochemical plants.


    Institute of Scientific and Technical Information of China (English)


    An Exploration of the Origin of the Yue People in Lingnan (by BAI Bing) Abstract: Investigations into the origin of the Yue people in Lingnan based on reliable archaeological data, literature, and data concerning nationalities, and by means of periodation, backward inference, and paleographic knowledge show that the Maba people living 129,000 years ago were probably the main body of the ~ue people. From their ancient ancestry to the Warring States period, the ~ue people underwent continuous evolution. They were probably aboriginals of local origin. There were continuous exchanges between the various tribes of the Yue people and they incorporated each other. Key words: Lingnan; the Yue people; origin

  19. Abstracts

    Institute of Scientific and Technical Information of China (English)


    Research of Theory & Method Miscible Flooding Well Test Model With Carbon Dioxide Injection and Its Pressure Analysis. 2011,20(4):1 -4 Zhu Jianwei, Shao Changjin, Liao Xinwei, Yang Zhenqing( China University of Petroleum (Beijing) ) Based on miscible flooding well test analysis theory with carbon dioxide injection, the diffusion model of mixture components when carbon dioxide miscible with the oil and variation law of the temperature and viscosity are analyzed,


    Institute of Scientific and Technical Information of China (English)


    How can an ordinary Chinese do better in contributing to national reputationthrough public diplomacy? All they need to do is to tell stories of their own and ofothers' around them in an appropriate way. These stories are from the daily life, theyare real, rich, natural, vivid, lively and easy to understand, but not so rhetoric. They canmove people deeply and improve the image of China and Chinese people successfully.


    African Journals Online (AJOL)

    to select 243 yam growing women farmers from the three agricultural zones of the State. .... adoption, benefits and problems of adoption of yam minisett technology. .... farmer's previous experience with other innovations will likely influence her ...

  2. Abstract

    African Journals Online (AJOL)


    1 Department of Biochemistry and Biotechnology, Avinashilingam University, ... traditional Indian medicinal systems which has a very important role in indicating ... obstructive disorders, diabetes, leprosy, respiratory disorders and certain skin ...


    African Journals Online (AJOL)

    gathered through the use of interview schedule. Percentages and ... processing equipment that will reduce both the time on each operation and the tedious .... required for the processor to measure water into the cassava tuber container.

  4. Abstract

    African Journals Online (AJOL)


    students of different disciplines as it will help them to learn their respective subjects with ease. Keywords: ... areas or those that faces difficulties with real ..... International Journals of English Studies, Monograph issue 2: New trends in computer ...


    Institute of Scientific and Technical Information of China (English)


    CONTROL SIGNAL POWERING & WIRING DESIGN OF INTELLIGENT MOTOR OPERATED VALVE ACTU- ATOR [1] Fan Zonghai , J ia Tiehu ( S INOPEC Engineering Incorporation, Beijing, I00101) AbstractzThis article introduces the application of Motor Operated Valve (MOV) actuator, the problems in its control unit wiring, as well as its main technical parameters and control functions. The powering and wiring design of MOV actuator are explained based on application examples, and the advantages, disadvantages and selection principles of two powering design methods, i.e.

  6. Abstract

    African Journals Online (AJOL)

    published more than 80 peer-reviewed articles and book chapters on topics .... In reviewing the literature, we found no studies that addressed .... self based on HIV status, 5 items, alpha = 0.906; (iii) health care ..... Disclosure of HIV status:.


    African Journals Online (AJOL)

    , formed and operated along democratic lines for the purpose of ... water, good roads, communication, electricity and hospital constitute a rural area. Finally, ..... Ijere M.O. (1988) The Role of Cooperatives in Agricultural Technology Transfer, In.


    Institute of Scientific and Technical Information of China (English)


    The wisdom of practice exists in its conceptual form as an inherent part of man and functions in the process of practice. It coheres as the quality of virtue expressed in value orientation and contains cognitive experience of the world and of man himself. The two permeate man's actual capacities or powers. Aiming at completion of the self and of things, the wisdom of practice integrates theoretical and practical reason and reflects the unity of understandinl~ the world and transforming the world.


    African Journals Online (AJOL)

    Honeys with more than 19% have a tendency to ferment. As a general rule ... pollen contents, Agwu and Akanbi (1985) recommended alcohol or water dilution technique ... is also a product factor of the type of pollen collected by honey bees.


    Institute of Scientific and Technical Information of China (English)


    Commemorating the 100th Anniversary of the Revolution of 1911 Promoting the Deep Development of the CPC History and National History by the Research and Publication of the History of the Revolution of …………1911 Zhu Jiamu (4)


    Institute of Scientific and Technical Information of China (English)


    The Relational Capital, the Institutional Environment and the Validity of the Payment by Fiscal Transfers;The Framing of the Clauses of the Company Regulations, the Protection of the Law for the Right of Investors, and the Company Governance: Evidences f


    Institute of Scientific and Technical Information of China (English)


    Kong Jie, Li Shurong and Wang Weibo. ARMA model of MEMS acceleration detector and its characteristic analysis. PI, 2011, 25(5): 1 - 3 Impulse response datum of MEMS acceleration detector is got by the vibro-bench experiment. The ARMA model of this detector is built through the Steiglitz-McBride iteration method with impulse response datum. And the orders of ARMA model is evaluated using Hankel matrix rank. The simulation shows that the ARMA model built is very accurate. In the end, the amplitude frequency characteristics of this detector are analyzed according to the ARMA model.


    Institute of Scientific and Technical Information of China (English)


    The Introduction of Western Learning to the East and the Sinicization of Marxist Philosophy The introduction of western learning to the east objectively promoted the dissemination of Marxist philosophy in China, forming an important historical prerequisite for the sinicization of Marxist philosophy. Moreover, it also triggered a great transformation in the historical development of Chinese philosophy and facilitated its transition from ancient to early modern traditions, thereby establishing through sinicization a link between Marxist philosophy, which originated in the western philosophical tradition, and the Chinese tradition of philosophy, and rendering Marxist philosophy Chinese. This offered the possibility that sinicized Marxist philosophy would play a positive guiding role in the development of modern Chinese philosophy. Therefore, we may say that without the introduction of western learning to the east, there would be no sinicization of Marxist Ichilosophy; and without in-depth research on the relationship between the introduction of western learning to the east and the sinicization of Marxist philosophy, there would be no real understanding of the sinicization of Marxist philosophy. However, the close links between the sinicization of Marxist philosophy and the introduction of western learning do not indicate that the sinicization of Marxist philosophy is part of the history of the introduction of western learning to the east. The sinicization of Marxist philosophy does not itself belong to the category of the spread of western learning to the east. This is because Marxist philosophy is essentially different from all other commonly known western sciences; its sinicization differs from the eastward spread of western learning in terms of its goals, social nature, results and effects on society.


    Institute of Scientific and Technical Information of China (English)


    STUDY ON THE NATURAL GAS ACCUMULATION IN LOW RELIEF STRUCTURE RESERVOIR AT MIDDLE PORTION OF CHARZHOU STEPS IN AMUDARY BASIN Abstract: This paper focuses on the Hydrocarbon accumulation in low relief structure based on the comprehensive studies of seismic data, regional stratum, sedimentary facies, abundance of hydrocarbon and the character of petroleum geology of the Karakul territory in Chardjou step of Amudarya Basin. A reservoir geological model was established and the Potential zones of oil and gas accumulation were recommended by means of analysis well data, seismic data and three existing low relief gas deposits in the Karakul.


    Institute of Scientific and Technical Information of China (English)


    Practice and Discussion to Achieve p( SO2 ) ≤400 mg/m3 in Tailgas Emitted from Sulphuric Acid Plant Using New AS Series Catalyst;Progress and Prospect for Application of Lithium Iron Phosphate Modification Technology in China;Technological Progress in Wet-process Phosphoric Acid Concentration Plant of China;


    Institute of Scientific and Technical Information of China (English)


    Conbating Poverty and Inequality: Structural Change, Social Policy and Politics United Nations Research Institute for Social Development As UNRISD's latest reflection upon poverty alleviation and inequality, this report advocates an approach that pu


    African Journals Online (AJOL)

    between gender, age, marital status, number of wives, education and constraints to ... identified as affecting feedback provision on forestry related ... Only farm size it- value = -3.31 ... contract with extension agent (t- value =3.84, p<0.05) has significant .... (occupation) and years of farming experience while section В consists.


    Institute of Scientific and Technical Information of China (English)


    Type-selection design of axle box bearing for high-speed passenger car bogie LIANG Yun, XIA Chun-jing (Changchun Railway Vehicle Co., Ltd., Chang- chun 130062, China) Abstract: This paper elaborates type-selection analysis of axle box bearings for high-speed passenger ear bogie and introduces the main influence factors of type- selection and life calculation of bearings.

  19. Abstract

    Directory of Open Access Journals (Sweden)

    Newton Carneiro Affonso da Costa Junior


    Full Text Available The present study has the objective of verifying if simultaneous investments in several international stock markets are more attractive than in only one national stock market, in other words, if the first ones present a superior risk-return relationship. It can be admitted that if there is a total integration among the analyzed countries, there is little advantage in the international diversification, but if the countries are less integrated, the diversification would bring advantages in risk-return terms. The empirical work is based on Markowitz portfolio theory, CAPM and in the portfolio performance measures of Sharpe, Treynor, and Jensen. The analysis was made for the period of February 1993 to January 2003, based in the most liquid stocks negotiated in the stock market of the main countries of Latin America. The results showed that portfolio diversification in international markets is a better approach.

  20. Abstracts

    Institute of Scientific and Technical Information of China (English)


    The flue gas flow in entrance of electrostatic precipitator was simulated by Fluent software. Base on the simulation result, a new corona wires arrangement method was proposed for better gas flow distribution. The results indicated that when the corona wires in entrance of two adjacent flues arranged in parallel, the high speed ion airflow occurred in strong electric field would hamper the even distribution of flow, while when the corona wires was staggered arranged, it would benefit to the even distribution of gas flow in precipitator and further improve the dust removal efficiency. This result can provide very important guidance to the transformation and the design of electrostatic precipitator.