
Sample records for sangramiento digestivo primer

  1. Caracterización clínico-terapéutica del sangramiento digestivo alto: Hospital "Dr. Salvador Allende". Primer semestre 2006 Clinicotherapeutical characterization of upper digestive bleeding: "Dr. Salvador Allende" Hospital. First semester 2006

    Directory of Open Access Journals (Sweden)

    José de Jesús Rego Hernández


    Full Text Available La hemorragia digestiva constituye una de las principales causas de ingreso hospitalario por enfermedades del tracto gastrointestinal, En la mayoría de casos se presenta de forma aguda y con importantes repercusiones sistémicas, por lo que obliga a adoptar medidas urgentes para estabilizar a los pacientes y permitir efectuar un tratamiento específico adecuado, Esta entidad sigue ocasionando una mortalidad elevada, que se acumula en determinados grupos de riesgo como son los pacientes con edad avanzada y enfermedades graves asociadas, por lo que se decide realizar la caracterización clínico-terapéutica del sangramiento digestivo alto en el Hospital "Dr, Salvador Allende" durante el primer semestre del 2006 mediante un estudio descriptivo que tomó como fuente la revisión de las 161 historias clínicas de los pacientes egresados con este diagnóstico en ese período, El 73,3 % de los pacientes con sangramiento digestivo alto fueron mayores de 60 años de edad; no existieron diferencias en cuanto al sexo; el café y el tabaquismo fueron los hábitos tóxicos más reportados; los antiinflamatorios no esteroides, el grupo farmacológico más relacionado con esta entidad y dentro de ellos, el ácido acetilsalicílico, y la melena, la manifestación clínica más frecuente, En el 91,9 % la pauta de tratamiento fue adecuada, así como el tratamiento en general; hubo solo la asociación irracional de un inhibidor de la bomba de protones con un anti-H2Digestive haemorrhage is one of the main cause of hospital admission due to gastrointestinal tract diseases. In most of the cases, it appears in an acute form, and with important systemic repercussions that lead to the adoption of emergency measures to stabilize the patients and to apply an adequate specific treatment. This entity is still causing a high mortality that is accumulated in certain risk groups as the elderly patients with severe associated diseases. That's why, it was decided to make the

  2. Esclerodermia como causa de sangramiento digestivo alto: A propósito de un caso

    Directory of Open Access Journals (Sweden)

    Armando Leal Mursulí


    Full Text Available La esclerosis sistémica o esclerodermia es una enfermedad crónica que afecta la piel y el resto de los sistemas de órganos, entre éstos uno de los más comúnmente dañados es el esófago, donde se manifiesta una esofagitis péptica crónica que raramente produce complicaciones letales como el sangramiento masivo ocurrido en el caso clínico que se presentó en nuestro centro, donde se hizo necesaria la intervención quirúrgica de urgencia, y en la cual se realizó una esofagectomía subtotal con sustitución gástrica (técnica de Ivor-Lewis. La literatura médica revisada indica la infrecuencia de estos casos complicados, pero sí la alta incidencia de los daños ocasionados por esta enfermedadSystemic sclerosis or scleroderma is a chronic disease affecting the skin and the rest of the systems of organs. One of the most commonly damaged is the esophagus, where a chronic peptic esophagitis occurs that rarely produces lethal complicated as the massive bleeding observed in the clinical case that received attention in our center. An urgent operation was necessary and subtotal esophagectomy with gastric substitution (Ivor-Lewis technique was performed. A review of the medical literature showed that these complicated cases are unusual, but that the incidence of damages caused by this disease is high

  3. Caracterización de pacientes con sangramiento digestivo alto Characterization of patients presenting with high digestive bleeding

    Directory of Open Access Journals (Sweden)

    Jean Le'Clerc Nicolás


    Full Text Available INTRODUCCIÓN. El sangramiento digestivo alto continúa siendo un problema de salud, y junto al abdomen agudo, las heridas y los traumatismos es prácticamente la razón de ser de una guardia de cirugía. MÉTODOS. Se realizó un estudio observacional, descriptivo y de corte transversal, cuyo universo estuvo constituido por todos los pacientes con este diagnóstico ingresados en el Hospital Docente Clinicoquirúrgico «Joaquín Albarrán», entre enero del 2006 y diciembre del 2007 (2 años. RESULTADOS. Las edades más frecuentes estuvieron entre los 70 y 79 años, y fue más frecuente el sexo masculino y el antecedente de enfermedad cardiovascular. La melena fue la principal manifestación clínica. La endoscopia solo se realizó en el 25,16 % de los casos, y en ella se observó principalmente duodenitis y gastritis. Como medidas terapéuticas más comunes se practicaron la hidratación y el uso sondas de Levine. Solo el 20,48 % de los pacientes recibieron tratamiento contra Helicobacter pylori. La estadía hospitalaria promedio fue de 6 días o más. CONCLUSIONES. Las medidas generales de apoyo hemodinámico y la estrecha vigilancia de los pacientes pueden lograr salvaguardar sus vidas aunque no se disponga de un diagnóstico certero. La infección por Helicobacter pylori y su asociación a lesiones erosivas o ulcerosas de la mucosa gastroduodenal no ha sido totalmente asimilada en el pensamiento médico de los cirujanos. La función de la cirugía es cada vez menor en la terapéutica del sangramiento digestivo alto, a pesar de ser uno de los pilares fundamentales para enfrentarlo.INTRODUCTION. High digestive bleeding remains as health problem and together with acute abdomen, wounds and traumatisms is practically the main responsibility of a surgery rounds. METHODS. A cross-sectional, descriptive and observational study was conducted in a sample including all patients with this diagnosis admitted in "Joaquín Albarrán" Clinical Surgical

  4. Sangramiento gingival y flora bacteriana en la gingivitis y la periodontitis

    Directory of Open Access Journals (Sweden)

    Iriam Baldemira Rodríguez


    Full Text Available Se estudiaron 30 sitios o áreas periodontales que presentaban gingivitis y 30 con periodontitis, con el objetivo de determinar la relación existente entre el sangramiento gingival y la flora microbiana presente en la gingivitis y la periodontitis. Los pacientes seleccionados no presentaban antecedentes de enfermedad general y no habían recibido medicación antimicrobiana ni tratamiento periodontal en los útimos 6 meses; en el caso de las mujeres, no podían estar embarazadas. En los dientes seleccionados se procedió a tomar la muestra cumpliendo con los requisitos establecidos; luego se examinó inmediatamente en el microscopio de campo oscuro. Los resultados obtenidos indican que no hubo relación entre los morfotipos microbianos y los diferentes valores del índice de sangramiento gingival.Thirty periodontal sites presenting with gingivitis and 30 with periodontitis were studied with the aim of determining the relation between gingival bleeding and microflora present in gingivitis and periodontitis. Patients selected for the study did not present with a history of systemic diseases and received neither antimicrobial medication nor periodontal treatment during the last 6 months, in the case of women it was required that they were not pregnant. The sample was taken in the teeth chosen in compliance with the requirements established; then the sample was immediately examined in the dark field microscope. Results obtained suggest that there was no relationship between microbial morphological types and the different values of the gingival bleeding index.

  5. Viviendo con un estoma digestivo: la importancia del apoyo familiar

    Directory of Open Access Journals (Sweden)

    Candela Bonill de las Nieves


    Full Text Available Objetivo principal: Describir la relación y participación de la familia percibida por personas con estomas digestivos. Metodología: Estudio cualitativo descriptivo con 21 personas con estomas digestivos de las provincias de Málaga y Granada (España. La selección se hizo siguiendo los criterios de adecuación y diversidad mediante un muestreo intencional. La recogida de datos se realizó a través de entrevistas semiestructuradas. Se realizó un análisis del contenido, obteniéndose como categoría central el apoyo familiar. Resultados principales: Para las personas ostomizadas la familia se convierte en un recurso terapéutico esencial a lo largo de todo el proceso. Que el entorno familiar acepte esta nueva situación es fundamental para favorecer el reencuentro de la persona con su nueva realidad corporal. La implicación familiar en el proceso de aprendizaje de los cuidados desde el inicio es fundamental para la consecución de la autonomía. Contar con la aceptación y el apoyo de la pareja influye positivamente en el restablecimiento de las relaciones sexuales. Conclusión principal: La familia se convierte en un recurso terapéutico esencial a lo largo de todo el proceso, desde la toma de decisión acerca de la realización de la ostomía y durante el proceso de aceptación y adaptación del estoma.

  6. TICs Aplicadas a la Enseñanza del Aparato Digestivo


    Algieri, Rubén Daniel; Mazzoglio y Nabar, Martín Javier; Dogliotti, Claudia Gabriela; Gazzotti, Andrea


    Las Tecnologías de la Información y de la Comunicación (TICs) son tecnologías digitales para almacenamiento, transmisión y recepción de informaciones. La sociedad cambió y la educación universitaria debe adecuarse a la presencia de la informática y otras TICs. Las formas de estudio y abordajes del sistema digestivo, sumados a la importancia de sus relaciones anatómicas, lo constituyen un vasto campo para la implementación de TICs. El objetivo de este trabajo fue evaluar la importancia de las ...

  7. Conceções dos alunos do 1.º Ciclo do Ensino Básico sobre o sistema digestivo


    Moreira, Dalila; Almeida, Liliana; Lopes, Mónica; Veiga, Vânia; Cavadas, Bento


    Este estudo exploratório teve como objetivo determinar os conhecimentos dos alunos do 1º Ciclo do Ensino Básico (1.º CEB) sobre o sistema digestivo. Usou-se uma adaptação do método seguido por Dantas (2006). O instrumento de recolha de dados utilizado foi o desenho. Solicitou-se a 69 alunos (37 raparigas e 32 rapazes) do 4.º ano, de quatro escolas do distrito de Santarém, que elaborassem um desenho sobre a constituição do aparelho digestivo humano. Os alunos fizeram os desenhos em sala de aul...

  8. Estudio Histológico del Tracto Digestivo del Neón Cardenal Paracheirodon axelrodi (Characidae)


    Gómez-Ramírez, E; Obando, M. J; Tovar, M. O; Caldas, M. L; Hurtado, H


    Paracheirodon axelrodi es el pez ornamental que más se exporta en Colombia. Sin embargo, se desconocen varios aspectos de su biología básica. Se estudió la histología del tracto digestivo. Se sacrificaron 15 ejemplares (MS 222, 0,5 g/L), fijados en formaldehído al 4 % y decalcificados con ácido nítrico 7 %. Se siguió el procedimiento para H&E. El tracto digestivo de P. axelrodi presentó cuatro capas constitutivas: mucosa, submucosa, muscular y serosa. La mucosa de la boca presentó un epitelio...

  9. Desenvolvimento do trato digestivo de bezerros leiteiros criados em sistema de aleitamento fracionado

    Directory of Open Access Journals (Sweden)

    Rafael A. Azevedo


    Full Text Available Para avaliar o efeito do sistema de aleitamento fracionado no desenvolvimento ruminal de bezerros leiteiros holandeses, foram utilizados 12 animais, com peso corporal inicial médio de 37,0 kg, alojados individualmente em baias. O tratamento convencional constituiu-se de quatro litros de leite diários durante 60 dias e o fracionado, de seis litros do 6º ao 25º dia; quatro litros dos dias 26 a 45 e dois litros de 46 a 59 dias de vida, além de concentrado, feno de Cynodon sp., água e suplemento mineral, oferecidos livremente. O consumo dos alimentos foi monitorado diariamente e os animais, pesados semanalmente, após o fornecimento da dieta líquida, pela manhã. Aos 60 dias de vida, os animais foram abatidos e realizaram-se pesagens do trato digestivo e medidas histológicas das papilas ruminais. O sistema de aleitamento não interferiu significativamente no consumo de concentrado, de feno, de matéria seca total e no peso corporal final vazio. O aleitamento fracionado resultou em maior peso corporal final, pesos absolutos do trato digestivo, do ruminorretículo, do omaso e dos intestinos, de pesos relativos do omaso e dos intestinos e maior índice mitótico das papilas ruminais. O sistema de aleitamento fracionado pode ser alternativa para melhorar o desenvolvimento ruminal e o desempenho de bezerros.

  10. Organogénesis del sistema digestivo del pez Pterophylum scalare (Perciformes: Cichlidae

    Directory of Open Access Journals (Sweden)

    Mireya Ávila Botello


    Full Text Available Debido a la poca información sobre el desarrollo de sistemas orgánicos en el pez Pterophylum scalare (Liechtenstein 1823 estudiamos yiempo neto de desarrollo de cada estadio de la organogénesis, tiempo acumulado y diferenciación de estructuras características de cada estadio. Se obtuvo un total de 8 estadios en la organogénesis del sistema digestivo, comprendidos entre la gástrula y la reabsorción total del saco vitelino. La duración de la organogénesis del sistema digestivo fue de 119 horas 44 minutos.Organogenesis of the digestive system of the fish Pterophylum scalare (Perciformes: Cichlidae. There is little knowledge on the development of the angelfish Pterophyllum scalare (Liechtenstein 1823, a species of economical and biological value for inland water ecosystems. We recorded net development time of each organogenetic stage, cumulative time and characteristic structure differentiation for each stage. We found eight organogenetic stages for the digestive system, between the gastrula and the total re-adsorption of the vitelin sack. The total time for the organogenetic development of the digestive system was 119 hours and 44 minutes. Rev. Biol. Trop. 56 (4: 1857-1870. Epub 2008 December 12.

  11. Metamorfosis del aparato digestivo de larvas carnívoras de Ceratophrys cranwelli (Anura: Leptodactylidae

    Directory of Open Access Journals (Sweden)

    Ulloa Kreisel, Zandra E.


    Full Text Available Las larvas carnívoras de Ceratophrys cranwelli presentan un tubo digestivo más corto que la mayoría de las larvas de anuros, tiene 6 veces la longitud del cuerpo del renacuajo y se caracteriza también por tener un estómago larval. El presente trabajo tiene como objetivo el determinar el grado de transformaciones en la cavidad bucofaríngea y tubo digestivo en larvas de esta especie durante la metamorfosis y comparar las estructuras digestivas estudiadas en otras especies de Leptodactylidae de la subfamilia Ceratophryinae y especies con otros hábitos alimenticios. Carnivorous larvae from Ceratophrys cranwelli present a digestive tube shorter than most of the anuran larvae, have 6 times a tadpole’s body length and they are also characterized by the presence of a larval stomach. The aim of this work is determine the grade of transformations in the buccopharyngeal cavity and digestive tube during the metamorphosis in larvae of this species and compare the digestive structures studied in other species of Leptodactylidae of the subfamily Ceratophryinae and another species with different diets.

  12. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.


    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  13. Digestive tract microbiota in healthy volunteers Microbiota no trato digestivo em voluntários saudáveis

    Directory of Open Access Journals (Sweden)

    Bruno Zilberstein


    Full Text Available PURPOSE: The aim of this study was to standardize the methods of sample collection of mucus from the digestive tract and to determine the microbiota in healthy volunteers from Brazil, collecting samples from the mouth, esophagus, stomach, duodenum, jejunum, ileum, colon, and rectum. METHODS: Microbiota of selected healthy volunteers from the oral cavity (n=10, the esophagus (n=10, the upper digestive tract (n=20, and the lower digestive tract (n=24 were evaluated through distinct collection methods. Collection methods took into account the different sites, using basic scraping and swabbing techniques, stimulated saliva from the oral cavity, irrigation-aspiration with sterile catheters especially designed for the esophagus, a probe especially designed for upper digestive tract, and a special catheter for the lower digestive tract. RESULTS: (i Mixed microbiota were identified in the oral cavity, predominantly Gram-positive aerobic and anaerobic cocci; (ii transitional flora mainly in the esophagus; (iii Veillonella sp, Lactobacillus sp, and Clostridium sp in the stomach and duodenum; (iv in the jejunum and upper ileum, we observed Bacteroides sp, Proteus sp, and Staphylococcus sp, in addition to Veillonella sp; (v in the colon, the presence of "nonpathogenic" anaerobic bacteria Veillonella sp (average 10(5 UFC indicates the existence of a low oxidation-reduction potential environment, which suggests the possibility of adoption of these bacteria as biological markers of total digestive tract health. CONCLUSIONS: The collection methods were efficient in obtaining adequate samples from each segment of the total digestive tract to reveal the normal microbiota. These procedures are safe and easily reproducible for microbiological studies.OBJETIVO: Padronizar os métodos de coleta do muco do trato digestivo e determinar a microbiota, em voluntários saudáveis no Brasil, coletando amostras da boca, esôfago, estômago, duodeno, jejunos e íleo, c

  14. Polyacid macromolecule primers (United States)

    Sugama, Toshifumi.


    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.


    Directory of Open Access Journals (Sweden)

    VJ Atencio


    Full Text Available El objetivo del estudio fue la descripción del tubo digestivo de juveniles de Rubio Salminus affinis. Se analizaron cinco juveniles con 23,6±2,6 cm de longitud total y 142,8±62,5 g de peso. Se realizó descripción topográfica y morfológica de los órganos y cortes histológicos con tinción H-E. El esófago es un órgano tubular corto de pared gruesa que representa el 7,8% de la longitud total del tubo digestivo, presenta pliegues internos que ofrecen gran capacidad de distensión permitiendo el paso de presas de gran tamaño. El estómago es una bolsa asimétrica en forma de “Y”, grande y musculosa, amplio en la porción anterior y estrecho hacia el fondo; el número de ciegos pilóricos varió entre 13 y 23 pudiendo ser monotubulares y ramificados. El intestino, con tres asas, se extiende desde el esfínter pilórico hasta el ano. Histológicamente el tubo digestivo está formado por cuatro capas: mucosa, submucosa, muscular y serosa; el epitelio de revestimiento del esófago es estratificado plano no queratinizado con células caliciformes, cambiando a simple cilíndrico mucosecretor llegando al estómago; en el estómago se encuentra epitelio simple cilíndrico mucosecretor y los ciegos pilóricos e intestino son revestidos por epitelio simple cilíndrico con células caliciformes. Tanto el valor promedio del coeficiente intestinal (0,58, como la pared distensible del estómago sugieren que el Rubio tiene un tubo digestivo propio de carnívoro y sus características histológicas presentan similitud con la mayoría de vertebrados superiores.

  16. HISTOLOGÍA DEL SISTEMA DIGESTIVO DE Didelphis albiventris (LUND, 1840

    Directory of Open Access Journals (Sweden)

    C. Moreno-Durán1


    Full Text Available Didelphis albiventris es un marsupial que se encuentra en Colombia en la región Andina desde los 1800 hasta 4000 m.s.n.m (Cuartas - Calle 2003. Su importancia ecológica radica en que es una especie quecontrola poblaciones de roedores, e insectos y contribuye a la dispersión de las semillas.Se llevó a cabo un estudio histológico del sistema digestivo de marsupiales de Didelphis albiventris, provenientes del municipio de Sotaquirá (Boyacá, Colombia. Los órganos se fijaron en formol buferizado al 10%, y se tiñeron con Hematoxilina - Eosina de acuerdo a la técnica de Propath 1992.Se realizaron descripciones histológicas, desde la cavidad oral hasta el intestino grueso. En la lengua se observaron papilas filiformes y tres papilas circunvaladas dispuestas en forma de triángulo en la parte posterior de la lengua, con botones gustativos. El estómago del marsupial se dividió en varias zonas: cardial, fúndica, del cuerpo y pilórica las cuales presentan características similares a la mayoría de mamíferos. En la primera porción del intestino delgado, se observó el duodeno con ausencia de glándulas de Brunner, la disposición de las fibras musculares lisas presentó variación a nivel de duodeno y cloaca, caracterizándose por poseer una muscular circular externa y una muscular longitudinal interna. No se observaron diferenciassignificativas con respecto a otros mamíferos, como roedores y el hombre en hígado, páncreas, vesícula biliar y glándulas salivares por lo cual no se incluyen en el presente trabajo. Se encontraron diferencias con respecto a los mamíferos en la ubicación de las glándulas de Brunner en el íleon y no en el duodeno y la distribución de nódulos linfoides dentro de la lámina propia de la mucosa de todo el tracto gastrointestinal.

  17. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur


    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  18. Nanotechnology: A Policy Primer (United States)


    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  19. Efeitos do centeio na utilização digestiva dos nutrientes e no trânsito digestivo do frango


    Mourão, J.L.; Silva, A.B


    Estudo com o fim de conhecer os efeitos de níveis elevados de centeio na dieta do frango de carne e da sua suplementação com um complexo enzimático com atividade xilanase na digestibilidade e transito digestivo

  20. Histología y morfometría del sistema digestivo del silúrido bagre tigrito (pimelodus pictus)


    Olaya, C. M.; Ovalle, C. H.; Gómez Ramírez, E.; Rodríguez Caicedo, D.; Caldas Martínez, M. L.; Hurtado Giraldo, H.


    El bagre tigrito Pimelodus pictus es un pez ornamental con gran aceptación en el mercado acuarista internacional, sin embargo, se desconocen muchos aspectos de la biología básica de esta especie. Por tal motivo, se realizó un estudio histológico y morfométrico del sistema digestivo a Àn de contribuir al diseño de futuras dietas. Se sacriÀcaron 7 individuos adultos de P. pictus de 10 ± 0,5 cm de longitud total con una sobredosis de MS-222 (0,5 g/l). Los especímenes se Àjaron en formaldehído al...

  1. The Los Alamos primer

    CERN Document Server

    Serber, Robert


    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  2. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  3. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van


    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a


    Directory of Open Access Journals (Sweden)

    CM Olaya


    Full Text Available El bagre tigrito Pimelodus pictus es un pez ornamental con gran aceptación en el mercado acuarista internacional, sin embargo, se desconocen muchos aspectos de la biología básica de esta especie. Por tal motivo, se realizó un estudio histológico y morfométrico del sistema digestivo a Àn de contribuir al diseño de futuras dietas. Se sacriÀcaron 7 individuos adultos de P. pictus de 10 ± 0,5 cm de longitud total con una sobredosis de MS-222 (0,5 g/l. Los especímenes se Àjaron en formaldehído al 4%, durante cinco días a 4 °C. Luego se siguió el procedimiento para técnica en paraÀna. Se realizaron cortes de 5 μm de espesor y se colo-rearon con H&E. El sistema digestivo presentó cuatro capas: mucosa, submucosa, muscular y serosa. En el esófago la mucosa estaba compuesta por epitelio plano estratiÀcado con gran número de células caliciformes, y una submucosa de tejido conectivo laxo, seguida por músculo estriado esquelético con dos orientaciones (circular y longitudinal. En todos los órganos evaluados la capa serosa fue muy delgada. En el estómago se identiÀcaron dos regiones, la pilórica y la cardíaca, encontrándose glándulas gástricas en esta última, ambas regiones presentaban una mucosa con epitelio cilíndrico simple, una submucosa de tejido conectivo laxo, y una capa de músculo liso con dos orientaciones (circular y longitudinal así mismo, este órgano fue el que exhibió el mayor espesor en la capa mucosa y muscular. La histología de la mucosa, la submucosa y la capa muscular del intestino fue similar a lo presentado por el estómago, aunque morfométricamente esta región fue la que exhibió los menores valores en todas las capas evaluadas. El estómago bien deÀnido y el intestino con pocos ciegos pilóricos hace suponer que P. pictus es de hábitos omnívoros con preferencia de los alimentos de origen animal.

  5. Defense Primer: DOD Contractors (United States)


    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  6. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  7. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.


    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  8. MethPrimer: designing primers for methylation PCRs. (United States)

    Li, Long-Cheng; Dahiya, Rajvir


    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.


    Directory of Open Access Journals (Sweden)

    Jessica Quijada P


    Full Text Available Objetivo. Determinar la prevalencia, cargas parasitarias y distribución de las infecciones naturales con estróngilos digestivos dentro de rebaños bovinos de una zona ganadera del Estado Falcón en Venezuela Materiales y métodos. Se evaluaron cuatro fincas de bovinos doble propósito. Los animales son tipo “Carora” (mestizaje de razas: Holstein, Pardo Suizo, Cebuínos. Durante siete meses se analizaron (Técnica de Mc Master un total de 1140 muestras. La muestra de cada finca se estratificó en cuatro grupo etarios (1: Becerros 0-6 meses; 2: Mautes 7-12; 3: Novillas 13-24 y 4: Adultos >25 meses. Resultados. Los valores de prevalencia promedio fueron: 31.06-50.36%. Se halló diferencia estadística (p<0,05 entre los niveles de prevalencia entre fincas y entre grupos etarios. Las infecciones se distribuyeron de forma sobredispersada en cada rebaño, evidenciado por los bajos valores de K (0.001-0.01. Conclusiones. Los valores de abundancia se afectaron más por el número de animales con altas cargas que por la prevalencia. La mayoría de las infecciones no revistió importancia clínica, las altas cargas parasitarias representaron 1.75-28.56% de todas las infecciones.

  10. Estudio histológico del sistema digestivo en diferentes estadios de desarrollo de la cachama blanca (Piaractus brachypomus

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Mendoza R.


    Full Text Available La cachama blanca (Piaractus brachypomus es la segunda fuente de producción piscícola en Colombia, después de la tilapia roja (Oreochomi ssp. y antes de la trucha arcoíris (Oncorhynchus mykiss. Se destaca, además, como una de las especies con mayor potencial productivo en el país. Se realizó el estudio histológico del sistema digestivo de la Piaractus brachypomus a fin determinar la morfología normal en diferentes estadios de desarrollo. Para ello se clasificaron los animales según la edad, el tamaño y el peso en ovas embrionadas, larvas con saco vitelino, alevinos después de reabsorción de saco vitelino, juveniles (3-5 cm, 5-7 cm, 10 cm, 15 cm y adultos (300 g. La fijación de los tejidos se realizó en formaldehído al 3,7 % y se describió microscópicamente cavidad bucal, faringe, esófago, estómago, ciegos pilóricos, intestinos y las glándulas anexas, hígado y páncreas. Por último, se describió macroscópicamente la organización anatómica de este sistema.

  11. A Quantum Groups Primer (United States)

    Majid, Shahn


    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  12. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn


    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  13. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom


    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  14. Math primer for engineers

    CERN Document Server

    Cryer, CW


    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  15. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto


    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  16. A primer on water (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil


    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  17. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)


    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  18. Metabolomics: A Primer. (United States)

    Liu, Xiaojing; Locasale, Jason W


    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. A Brief Taxometrics Primer (United States)

    Beauchaine, Theodore P.


    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  20. Relación de la función masticatoria con los trastornos digestivos Relation of the masticatory function to the digestive disorders

    Directory of Open Access Journals (Sweden)

    Martha Concepción Ibáñez Castillo


    Full Text Available Se realizó una investigación en la que se relaciona la función masticatoria con los trastornos digestivos en pacientes que acudieron al chequeo médico en el Hospital Militar Docente "Dr. Joaquín Castillo Duany", en Santiago de Cuba, de enero de 2004 al 2005, mediante un estudio descriptivo y transversal con 199 pacientes de uno y otro sexo y diversos grupos de edades. Se confeccionó un formulario, se agruparon las tablas y se realizó el análisis estadístico. Se observó un predominio de trastornos digestivos en el grupo de 60 años y más, con presencia de desdentamiento y función masticatoria deficiente, por lo que se concluyó que existe una significativa relación entre la función masticatoria y los trastornos digestivos. Se recomienda extender el estudio a todas las áreas de salud, con el fin de utilizar nuestros conocimientos en beneficio de los pacientes.An investigation was carried out to connect the masticatory function with the digestive disorders in patients that had the medical check-up at "Dr. Joaquín Castillo Duany" Military Teaching Hospital, in Santiago de Cuba, from January 2004 to January 2005, by a descriptive cross-sectional study of 199 patients of both sexes and different ages. A questionnaire was designed, tables were grouped and a statistical analysis was made. It was observed a predominance of digestive disorders in the age group 60 and over, with lack of teeth and deficient masticatory function. It was concluded that there was a significant relation between the masticatory function and the digestive disorders. It was recommended to extend the study to all the health areas so as to use our knowledge for the benefit of the patients.

  1. Desarrollo de una propuesta de aula para lograr un aprendizaje significativo del sistema digestivo por medio de las analogías


    Ramírez Rincón, Rubén Arnulfo


    En este trabajo se desarrolló una estrategia de aula basada en el uso de las analogías. El tema seleccionado es el sistema digestivo, en el cual se utilizan cuatro clases de seres vivos para hacer las comparaciones correspondientes y alcanzar un aprendizaje significativo en los estudiantes de grado séptimo del Instituto Comercial Ruperto Aguilera León del municipio de Nemocón, Cundinamarca. Las especies son: Ameba, Esponja de Mar, Humano y Bovino. Las diversas actividades planteadas se diseña...

  2. Ontogenia e histoquímica funcional de los sistemas digestivo y visual y de otros órganos durante el desarrollo larvario de la liseta, Chelon labrosus.


    Sarasquete, Carmen; Ortiz-Delgado, Juan B.; Martos-Sitcha, J. Antonio; de las Heras, Verónica; Yúfera, Manuel; Martínez-Rodríguez, Gonzalo


    El objetivo del trabajo se centró en describir los principales cambios ontogénicos y funcionales de los sistemas digestivo y visual de Chelon labrosus, durante los primeros tres meses de vida larvaria, desde la fertilización hasta 99 dias después de eclosionar (dde). Se observó un largo periodo de reducido crecimiento (3.93%) durante las tres primeras semanas de vida, y una amplia fase de alimentación endo-exotrófica (hasta 13 dde). La mayoría de sistemas, órganos y estructuras tisulares (ojo...

  3. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.


    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  4. Flora bacteriana aeróbica del tracto digestivo del vampiro común, Desmodus rotundus (Chiroptera: Phyllostomidae

    Directory of Open Access Journals (Sweden)

    Gloriana Chaverri


    Full Text Available El objetivo de esta investigación fue determinar la flora bacteriana del vampiro común (Desmodus rotundus primordialmente debido a que los datos al respecto están desactualizados, y además por la gran importancia económica de esta especie de murciélago. Veintiún murciélagos fueron recolectados y su flora bacteriana identificada separadamente a nivel de estómago e intestino. Las bacterias fueron identificadas con el Analytical Profile Index (API, y los resultados analizados con el paquete APILAB. Un total de treinta especies fueron aisladas en 16 hembras y cinco machos. Las especies más comunes fueron Escherichia coli y Staphylococcus aureus, aunque otras especies, como Acinetobacter johnsonii, Enterobacter sakazakii, Staphylococcus chromogenes, S. hyicus y S. xylosus también se aislaron con frecuencia. El número de especies identificadas en el estómago y el intestino fue significativamente diferente, siendo el intestino más diverso. Esto ha sido encontrado anteriormente en otros mamíferos, y se atribuye probablemente a la reducción en acidez. Asimismo, la mayoría de las especies identificadas en este estudio forman parte de la flora bacteriana normal del tracto digestivo de mamíferos, aunque también se encontraron otras bacterias comunes en la piel de mamíferos y en ambientes acuáticos Las bacterias de la piel podrían estar colonizando el estómago y/o intestino del vampiro cuando éste tiene contacto con sus presas, lo que sugiere que el hábito alimentario de esta especie facilita su colonización por microorganismos que no se encontrarían comúnmente en su tracto digestivo. Ya que también se identificaron bacterias comunes en ambientes acuáticos, es probable que D. rotundus consuma agua cuando esté disponible, lo que respalda los resultados de otros investigadores, y sugiere que esta podría ser una fuente adicional de invasión microbiana.Aerobic bacterial flora from the digestive tract of the common vampire bat

  5. Freqüência de sintomas digestivos em pacientes brasileiros com Diabetes Mellitus Digestive symptoms in Brazilian patients with Diabetes Mellitus

    Directory of Open Access Journals (Sweden)



    Full Text Available Sintomas sugestivos do comprometimento do tubo digestivo são comuns em pacientes diabéticos, mas estudos comparando as freqüências destes sintomas com as da população geral são escassos e não existem trabalhos dessa natureza com diabéticos brasileiros. OBJETIVO: Determinar as freqüências de diferentes sintomas digestivos em amostra não selecionada de pacientes diabéticos, em comparação às encontradas em pessoas da comunidade. MÉTODOS: A ocorrência de 13 diferentes sintomas digestivos foi investigada por meio da aplicação de um questionário padronizado, especificamente estruturado, em 153 diabéticos dos tipos 1 e 2 e em 50 pessoas aparentemente sadias, tomadas como controles. RESULTADOS: A freqüência de diabéticos com pelo menos um sintoma digestivo foi significativamente superior à verificada no grupo controle (70% vs 36%, p = 0,01. Freqüências elevadas de plenitude gástrica (30% vs 36%, pirose (30% vs 34% e de constipação (17% vs 12%, foram observadas tanto entre os diabéticos como nos controles. No entanto, somente a freqüência de um único sintoma, a disfagia, foi significativamente maior entre os diabéticos, em relação ao grupo controle (13% vs 2%, p = 0,02. CONCLUSÃO: Estes resultados indicam que a freqüência de sintomas digestivos em diabéticos, apesar de elevada, não difere da verificada na população geral, exceto para a disfagia. As freqüências dos diferentes sintomas estiveram próximas das faixas relatadas em estudos do hemisfério Norte, o que não apóia a hipótese de que fatores inerentes ao meio afetam a ocorrência de queixas digestivas em diabéticos.PURPOSE: To determine the frequencies of digestive symptoms in an unselected sample of Brazilian diabetics, in comparison to those verified in the general population. METHODS: The frequencies of 13 digestive symptoms were determined in 153 type 1 and type 2 diabetics and in 50 apparently healthy controls, utilizing a structured

  6. Prevalência da microbiota no trato digestivo de fêmeas de Lutzomyia longipalpis (Lutz & Neiva, 1912 (Diptera: Psychodidae provenientes do campo

    Directory of Open Access Journals (Sweden)

    Oliveira Sandra Maria Pereira de


    Full Text Available No presente trabalho foram dissecados o trato digestivo de 245 fêmeas de Lutzomyia longipalpis originários da Gruta da Lapinha, Município de Lagoa Santa, MG, formando 7 grupos de 35 flebotomíneos. Das 8 espécies de bactérias isoladas houve uma predominância de bactérias Gram negativas (BGN pertencentes ao grupo de não fermentadoras de açúcar das seguintes espécies: Acinetobacter lowffii, Stenotrophomonas maltophhilia, Pseudomonas putida e Flavimonas orizihabitans. No grupo das fermentadoras tivemos: Enterobacter cloacae e Klebsiella ozaenae. No grupo dos Gram positivos foram identificados Bacillus thuringiensis e Staphylococcus spp.

  7. Freshwater Wetlands: A Citizen's Primer. (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  8. A Hearing Aid Primer 1 (United States)

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  9. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  10. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.


    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  11. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)


    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  12. 30 CFR 56.6304 - Primer protection. (United States)


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  13. A Primer to Slow Light


    Leonhardt, U.


    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  14. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam


    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  15. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J


    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads


    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  17. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded


    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  18. A Primer on Observational Measurement. (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F


    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  19. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo


    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  20. Fungal flora of the digestive tract of Triatoma infestans (Hemiptera: Reduviidae from Argentina Flora fúngica de tractos digestivos en Triatoma infestans (Hemiptera: Reduviidae en Argentina

    Directory of Open Access Journals (Sweden)

    G. A. Marti

    Full Text Available A survey of the fungal microbiota of the digestive tract of Triatoma infestans (Klug (Hemiptera: Reduviidae adults was carried out. Insects captured in the field from different provinces in Argentina, as well as individuals reared in artificial colonies, were used for dissection. Axenic cultures of the fungal species were identified and were deposited with mycological collections at La Plata , Argentina. A total of 33 fungal species, with the exception of three that were mycelia sterilia, belonging to 11 genera were identified. Thirty two species belonged to Ascomycota (Eurotiomycetes and Sordariomycetes and one to Zygomycota (Zygomycetes. The genera with the greatest number of species were Penicillium (15, Aspergillus (5, and Cladosporium (2. Among the isolated fungi, some of the species were entomopathogenic or pathogens of humans and other animals.En el presente estudio se realizó un relevamiento de la flora fúngica microbiana en tractos digestivos de adultos de Triatoma infestans (Klug (Hemiptera: Reduviidae. Se disecaron insectos capturados del campo en diferentes provincias Argentinas, así como también se utilizaron individuos de una colonia artificial. Fueron realizados cultivos axénicos de las especies fúngicas aisladas, los que fueron identificados y luego depositados en las colecciones de hongos entomopatógenos del CEPAVE La Plata , Argentina. Fueron identificadas 33 especies fúngicas perteneciente a 11 géneros. Treinta y dos especies pertenecen a Ascomycota (Eurotiomycetes y Sordariomycetes y una a Zygomycota (Zygomycetes. Los géneros con mayor número de especies fueron Penicillium (15, Aspergillus (5, y Cladosporium (2. Entre los aislamientos fúngicos, algunas de las especies encontradas son entomopatogénicas o patógenas de humanos y otros animales.

  1. Descripción histológica comparativa del desarrollo del sistema digestivo y visual de larvas de chame Dormitator latifrons (Pisces: Eleotridae

    Directory of Open Access Journals (Sweden)

    Vanesa V López-López


    Full Text Available Se realizó la descripción del desarrollo de larvas de uno a seis días post-eclosión (dpe, para generar información que ayude a comprender la capacidad alimenticia en etapas tempranas. Las larvas se obtuvieron mediante la inducción hormonal de reproductores, utilizando implantes de análogos sintéticos de GnRH durante la temporada de septiembre-noviembre de 2010. Las muestras fueron incluídas en historesina y teñidas con hematoxilina-eosina. Una vez eclosionada, la larva presenta gran cantidad de vitelo que absorbe gradualmente (1° a 3° dpe. Al 4° dpe, existe una cavidad bucal abierta con estructuras dentales, en este estadio se ha completado el desarrollo ocular, que presenta pigmentación. Se observa la formación de las hendiduras branquiales y se diferencia el intestino en anterior y posterior y se distingue la presencia de vacuolas digestivas en el intestino anterior. En el 5° dpe, se observaron los paquetes de fibras musculares y se distinguió una estructura estomacal. En el 6° dpe, el páncreas, pliegues intestinales y membrana de borde de cepillo son visibles y se observaron partículas de alimento y bacterias dentro del intestino. En base a lo anterior, se concluye que las larvas de D. latifrons han desarrollado completamente el tracto digestivo y órganos asociados que le ayudarán a la búsqueda de alimento, entonces a partir del 4° dpe son capaces de iniciar la alimentación exógena.

  2. 30 CFR 57.6304 - Primer protection. (United States)


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  3. Primer3_masker: integrating masking of template sequence with primer design software. (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido


    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at (standalone version for Linux and macOS) and at (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at Supplementary data are available at Bioinformatics online.

  4. Ultramorphology of digestive tract of Anticarsia gemmatalis (Hübner, 1818 (Lepidoptera: Noctuidae at final larval development/ Ultramorfologia do trato digestivo de Anticarsia gemmatalis (Hübner, 1818 (Lepidoptera: Noctuidae no final do desenvolvimento larval

    Directory of Open Access Journals (Sweden)

    Luis Antônio Toledo


    Full Text Available The digestive tract of insects is an important natural, physical, and chemical defense barrier against pathogen invasion. Certain lepidopteran caterpillars are serious pests of agricultural crops and their biology has received much attention, but little is known about the larval noctuid gut. The morphological analysis of the digestive tract in Anticarsia gemmatalis under scanning electron microscopy (SEM is a good model for studies about its defense mechanism. The material was fixed (2,5% glutaraldehyde solution; 0.1M-phosphate buffer, pH 7.3, post-fixed (1% osmium tetroxide in the same buffer, dried at critical point, gold coated and analyzed in a SEM 515-Philips. A. gemmatalis digestive tract consists of a straight duct of varying length and diameter, subdivided in three main regions: the foregut formed by the oral cavity, pharynx, esophagus, and crop; the midgut that is the largest portion of the digestive tract without noticeable morphological differentiation along its length; and the hindgut that is morphologically differentiated in pylorus, ileum, colon, and rectum. Although the general morphology of the A. gemmatalis digestive tract is quite similar to the other Lepidoptera species, the anatomical array of the crop muscular layers is quite different comparing with the description for other larval insect.O trato digestivo dos insetos constitui uma importante barreira físico-química natural contra invasão de patógenos. Algumas larvas de lepidópteros são consideradas pragas agrícolas potenciais e sua biologia tem recebido muita atenção; no entanto, pouco se sabe sobre a morfologia do sistema digestivo. A análise morfológica do trato digestivo de Anticarsia gemmatalis em nível ultraestrutural é um método bastante eficaz para o estudo dos seus mecanismos de defesa. Os materiais foram fixados (solução de glutaraldeído 2,5%; 0.1M tampão fosfato, pH 7.3, pós-fixados (tetróxido de ósmio 1% no mesmo tampão, desidratados em


    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati


    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  6. Morfologia de órgãos digestivos e não digestivos de suínos de linhagens modernas durante as fases de crescimento, terminação e pós-terminação = Morphology of digestive and non-digestive organs of pigs from modern lineages during growth, finishing and post-finishing phases

    Directory of Open Access Journals (Sweden)

    Jacinta Diva Ferrugem Gomes


    Full Text Available O melhoramento genético de suínos levou ao surgimento de diversas linhagens suínas que apresentam elevada capacidade de desenvolvimento de massa muscular. Entretanto, pouco se sabe cientificamente sobre a morfologia de órgãos destes animais, conhecimento que ajuda a elucidar características relacionadas ao desempenho zootécnico como ganho de peso e conversão alimentar em carne magra. Objetivou-se, assim, comparar a morfologia dos órgãos digestivos e não-digestivos de suínos de linhagens modernas ao final das fases de Crescimentos Ie II, Terminação e Pós-terminação. O peso dos órgãos em relação ao peso vivo diminuiu significativamente (p The genetic market makes use of various modern swine genotypes that present high capacity for muscular mass development. These genetic lines have been used in swine production without existing scientificinformation about morphology, knowledge that can elucidate factors related to growth performance, such as weight gain and food conversion in lean meat yield. The aim of this experiment was to compare the morphology of digestive and non-digestive organs of moderngenotypes. At the end of the phases: Growing I, Growing II, Finishing and Post-finishing, the pigs were slaughtered and the organs were weighed. The weight of the organs decreased (p < 0.01 with body development, in agreement with the biological growth of the animals. The morphology of the digestive organs were different (p < 0.06 among lineages, which showed that differences can exist, mainly regarding digestive capacity and, possibly, food intake and efficiency. The length of the small intestine was different (p < 0.06 among lines, which can be an indicative of increased body development due to an extended food exposition area to intestinalcells. The scientific knowledge of swine lines morphology is important because this information can contribute to animal growth performance.

  7. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H


    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  8. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae. (United States)

    Yofe, Ido; Schuldiner, Maya


    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: Copyright © 2013 John Wiley & Sons, Ltd.

  9. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)


    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  10. A practical primer on geostatistics (United States)

    Olea, Ricardo A.


    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  11. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly


    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  12. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)


    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  13. Hexavalent Chromium IV-Free Primer Development (United States)

    Alldredge, Michael J.; Buck, Amy L.


    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  14. Quantitative Microbial Risk Assessment Tutorial - Primer (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  15. Menopause 101: A Primer for the Perimenopausal (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  16. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W


    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  17. VizPrimer: a web server for visualized PCR primer design based on known gene structure. (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang


    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0).;

  18. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.


    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  19. Climate Change, Health, and Communication: A Primer. (United States)

    Chadwick, Amy E


    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  20. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)


    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ


    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. Dominant culturable bacterial microbiota in the digestive tract of the American black vulture (Coragyps atratus Bechstein 1793 and search for antagonistic substances Microbiota bacteriana dominante cultivável no trato digestivo do urubu (Coragyps atratus Bechstein 1793

    Directory of Open Access Journals (Sweden)

    Lydston Rodrigues de Carvalho


    Full Text Available Strict and facultative culturable anaerobic bacteria from the digestive tract of six American black vultures (Coragyps atratus Bechstein 1793 were isolated and identified. After capture, the birds received a non-contaminated diet for one week to eliminate possible allochthonous microorganisms. Then, specimens collected from tongue, stomach and intestines were weighed, submitted to decimal dilution in an anaerobic chamber, inoculated into culture media and incubated aerobically and anaerobically at 37ºC for enumeration, isolation and identification. Isolated bacteria were submitted to tests to detect possible antagonisms between them. The total bacterial population along the digestive tract ranged from 3.46 ± 0.39 log CFU/g in the stomach to 10.75 ± 0.37 log CFU/g in the distal intestine. Some bacteria were isolated for the first time from the digestive tract of C. atratus: Actinomyces bovis, Lactobacillus cellobiosus, Micrococcus luteus, Neisseria sicca, Clostridium bifermentans, Enterobacter agglomerans, Peptostreptococcus sp., Sarcina sp., Serratia odorifera, and Shigella flexneri. Associations between microorganisms were observed during isolation on two occasions, one involving A. bovis and N. sicca, and the other involving A. bovis and a Gram-negative rod. Hetero-, iso- and autoantagonisms were observed, suggesting the ecological role of these indigenous microorganisms in terms of population auto-control and environmental barrier in the digestive tract of carrion-feeding birds.As bactérias anaeróbias estritas e facultativas cultiváveis do trato digestivo de seis urubus (Coragyps atratus Bechstein 1793 foram isoladas e identificadas. Após a captura, as aves receberam uma alimentação de baixa contaminação durante uma semana para eliminar possíveis microorganismos alóctonos. A seguir, amostras colhidas na língua, estomago e intestinos foram pesadas, submetidas a diluições decimais numa câmara anaeróbia, inoculadas em meios de

  3. A primer on motor vehicle air pollution. (United States)


    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  4. A Primer on Basic Effect Size Concepts. (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  5. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.


    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  6. Forest Interpreter's Primer on Fire Management. (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  7. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  8. Rust transformation/rust compatible primers (United States)

    Emeric, Dario A.; Miller, Christopher E.


    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  9. Economics : pricing, demand, and economic efficiency : a primer. (United States)


    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  10. Primer on consumer marketing research : procedures, methods, and tools (United States)


    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  11. Pesquisaje activo de sospechas de reacciones adversas a medicamentos en el Hospital "Dr. Salvador Allende: Primer semestre 2006 Active screening of suspicions of adverse reactions to drugs in "Dr. Salvador Allende" Hospital: First semester 2006

    Directory of Open Access Journals (Sweden)

    José de Jesús Rego Hernández


    Full Text Available Se realizó un estudio descriptivo mediante la revisión diaria del movimiento hospitalario, obtenido en el Departamento de Registros Médicos del Hospital "Dr. Salvador Allende" desde enero hasta junio de 2006 a fin de poder identificar los ingresos susceptibles de ser reacciones adversas a medicamentos, con el objetivo de detectar la frecuencia de ingresos por sospechas de reacciones adversas a medicamentos, así como de caracterizar a estos pacientes. Se llenó una planilla de notificación para cada sospecha de reacción adversa y se analizaron los datos contenidos en las historias clínicas respectivas. Se utilizó una base de Excel diseñada al efecto por el Centro para el Desarrollo de la Farmacoepidemiología. Ingresaron 6 201 pacientes, de los cuales 384 eran susceptibles de tener una reacción adversa a medicamentos (6,2 % y finalmente, se consideraron 57 pacientes cuyo motivo de ingreso se relacionó con algún medicamento (0,9 %. El 66,7 % de los casos eran mayores de 60 años de edad, sin diferencias en cuanto al sexo. Los grupos farmacológicos con mayores afectaciones fueron los analgésicos no opiodes (59,7 % y los antibacterianos (19,4 %. El sangramiento digestivo alto resultó la reacción adversa que más se encontró (57,9 %, con predominio en mayores de 60 años de edad (72,7 %; el ácido acetilsalicílico estuvo presente en el 66,7 % de los casos con este diagnóstico. En el75,5 % de los casos la reacción se consideró como graveA descriptive study was conducted by the daily revision of hospital movement obtained in the Department of Medical Registries of "Dr. Salvador Allende" Hospital from January to June, 2006, aimed at identifying the admissions susceptible to adverse reactions to drugs to detect the frequency of admissions due to suspicions of adverse reactions to drugs, as well as to characterize these patients. A notification form was filled in per each suspicion of adverse reaction, and the data contained in the

  12. Upper gastrointestinal bleeding in a Brazilian hospital: a retrospective study of endoscopic records Sangramento digestivo alto em um hospital brasileiro: estudo retrospectivo de registros endoscópicos

    Directory of Open Access Journals (Sweden)

    Cyrla ZALTMAN


    attributed to a higher prevalence of variceal bleeding and underlying liver disease.Racional - A hemorragia digestiva alta é complicação comum e grave da maioria das doenças do trato gastrointestinal superior. A endoscopia tem papel fundamental no diagnóstico e no tratamento da hemorragia digestiva, mas os dados epidemiológicos a esse respeito ainda são precários em nosso meio. Objetivos - Determinar as características clínicas, a acurácia endoscópica, a eficácia do tratamento e a evolução clínica dos pacientes admitidos no setor de endoscopia digestiva do Hospital Universitário da Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, com sangramento digestivo alto. Pacientes e Métodos - Estudo retrospectivo de registros consecutivos de pacientes com hemorragia digestiva alta submetidos a endoscopia de urgência, em período de 2 anos. Resultados - A maioria dos pacientes era do sexo masculino (68.7% com idade média de 54,5 ± 17,5 anos. O sítio de sangramento foi identificado em 75.6% dos pacientes. A acurácia diagnóstica da endoscopia foi maior quando realizada nas primeiras 24 horas do início do sangramento e quando da presença de hematêmese. A úlcera péptica foi a principal causa de hemorragia digestiva alta (35%. A prevalência de sangramento varicoso (20,45% indica freqüência alta de hepatopatia subjacente. O tratamento endoscópico foi realizado em 23,86% dos pacientes. Hemostasia permanente foi alcançada em 86% dos pacientes após a primeira intervenção endoscópica e em 62,5% dos pacientes após ressangramento. Cirurgia de emergência foi raramente necessária. A quantidade de unidades de sangue utilizada foi em média 1,44 ± 1,99 por paciente. O tempo médio de internação hospitalar foi de 7,71 ± 12,2 dias. Ressangramento foi observado em 9,1% dos pacientes. A taxa de mortalidade de 15,34% foi significativamente relacionada com a presença de doença hepática prévia. Conclusões - A acurácia diagnóstica foi

  13. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  14. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system. (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei


    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  15. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei


    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  16. Low-copy nuclear primers and ycf1 primers in Cactaceae. (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R


    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  17. Analysis of digestive tract content of the larvae of Polybia scutellaris (White (Hymenoptera, Vespidae Análise do conteúdo do trato digestivo das larvas de Polybia scutellaris (White (Hymenoptera, Vespidae

    Directory of Open Access Journals (Sweden)

    Victoria Lilian Fernández Corujo


    Full Text Available Polybia scutellaris (White, 1841 is a social wasp of biological interest for its role as pollinator and maybe as biological control agent of sanitary and agricultural pests. This study examines the digestive tract contents of the larvae of P. scutellaris from four nests in Magdalena (Buenos Aires province, Argentina. Contents included both animal (arthropod parts and plant (pollen, leaf and fruit epidermis parts. The pollen content analysis showed that the wasps visited 19 different taxa of plants during the last active period of the colony before the nests had been collected. The range of sources used by P. scutellaris allows us characterizing the species as a generalist flower visitor. Wasps visited both native and exotic plants located nearby the nest. Most of the epidermal plant remains found in the larval digestive tract belonged to Malvaceae, a family not exploited by the studied colonies as pollen source.Polybia scutellaris (White, 1841 é uma vespa social de interesse biológico devido ao seu papel como polinizador e possível agente de controle biológico de pragas sanitárias e agrícolas. O presente estudo analisou o conteúdo do trato digestivo de larvas de P. scutellaris de quatros ninhos em Magdalena (província de Buenos Aires, Argentina. O conteúdo inclui restos animais (partes de artrópodos e vegetais (pólen, epiderme de folhas e frutos. A análise do conteúdo polínico mostrou que as vespas visitaram 19 táxons durante o último período ativo da colônia antes dos ninhos serem coletados. A diversidade de recursos utilizados por P. scutellaris permite caracterizá-la como um visitante generalista de flores. As vespas visitaram plantas nativas e exóticas localizados nas proximidades do ninho. A maioria dos restos de epiderme encontradas no trato digestivo das larvas pertence às Malvaceae, uma família não explorada pelas colônias estudadas como fonte de pólen.

  18. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson


    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  19. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D


    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  20. An iterative method for selecting degenerate multiplex PCR primers. (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong


    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  1. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)


    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  2. Bayesian models: A statistical primer for ecologists (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.


    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  3. Medium Caliber Lead-Free Electric Primer. Version 2 (United States)


    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  4. High-speed measurement of firearm primer blast waves


    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy


    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  5. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  6. Great Lakes rivermouths: a primer for managers (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul


    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  7. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  8. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  9. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius


    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  11. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.


    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  12. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.


    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  13. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers. (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  14. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  15. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik


    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  16. Utilización del Tisuacryl® en la anastomosis del esófago con otros segmentos del tubo digestivo Use of Tisuacryl® in esophagus anastomosis with other segments of the digestive tube

    Directory of Open Access Journals (Sweden)

    Rosalba Roque González


    Full Text Available Las dehiscencias y fístulas de las anastomosis del esófago con segmentos pediculados del tubo digestivo son complicaciones frecuentes en la cirugía del esófago. En diversas estadísticas recientes, nacionales y extranjeras, se ha registrado una incidencia de hasta el 40 %. Este hecho, unido a las ventajas reportadas en la utilización de los adhesivos sintéticos del tipo del Tisuacryl®, hace interesante realizar un estudio clínico para extender el uso del producto al reforzamiento de las suturas en la anastomosis del esófago con otros segmentos del tubo digestivo, con el fin de prevenir las dehiscencias. Se realizó un ensayo clínico de fase II, prospectivo, controlado, aleatorizado, multicéntrico, a simple ciegas, que se extendió desde enero de 1998 hasta febrero de 2005. En él se incluyeron pacientes que ingresaron en los hospitales «Calixto García» y «Miguel Enríquez» con el diagnóstico de enfermedades esofágicas. Se logró la introducción en el país de una nueva aplicación para el adhesivo tisular Tisuacryl® y se demostró que la utilización del producto es una opción significativamente más ventajosa que el procedimiento convencional sólo con sutura, ya que se obtuvo una eficacia del 93 % en el grupo experimental respecto al 64 % en el grupo control. Uno y otro grupo eran homogéneos respecto a las variables de control. El tratamiento con Tisuacryl® disminuyó la frecuencia de aparición de fístulas esofágicas y no se reportaron eventos adversos en relación con la aplicación del producto.The dehiscences and fistulae of esophagus anastomosis with pedicular segments of the digestive tube are frequent complications in esophagus surgery. In various recent national and foreign statistics, an incidence of even 40 % has been registered. This fact, together with the advantages reported on the use of synthetic adhesives like Tisuacryl® made us to take an interest in conducting a clinical study to extend the use of

  17. Upper gastrointestinal findings detected by capsule endoscopy in obscure gastrointestinal bleeding Hallazgos digestivos altos de la cápsula endoscópica en la hemorragia digestiva de origen oscuro

    Directory of Open Access Journals (Sweden)

    B. Velayos


    Full Text Available Objective: we analyzed our experience with the use of capsule endoscopy in areas that can be explored with gastroscopy to justify obscure bleeding, as well as the outcome after a new recommended gastroscopy in order to determine if a second gastroscopy before the capsule study can provide any benefit in the management of this disease. Methods: we retrospectively studied 82 patients who were explored with capsule endoscopy for obscure gastrointestinal bleeding who had undergone previously only one gastroscopy. Findings in the zones which were accessible by gastroscopy were normal, mild/known and severe/unknown. In the latter cases we recommended a second gastroscopy, and their treatment and outcome were subjected to further study. Results: capsule endoscopy did not find any unknown esophageal findings. In 63% of cases, no gastric or duodenal lesions were shown; in 20%, lesions were mild or had been previously diagnosed, and in 17%, a new gastroscopy was recommended due to the discovery of an unknown condition which could be the cause of the obscure bleeding. This new information brought about a change in treatment for 78% of patients in this group, all of whom improved from their illness. Capsule endoscopy found significant intercurrent alterations in the small intestine in only 14% of cases. Conclusions: the performance of a second gastroscopy, previous to capsule endoscopy, in the study of obscure gastrointestinal bleeding can offer benefits in diagnostic terms and may introduce therapeutic changes. A detailed analysis of the upper tract frames in intestinal capsule endoscopy studies is mandatory since it may provide relevant information with clinical impact on the management of these patients.Objetivo: hemos analizado los hallazgos que la cápsula endoscópica aportó de las zonas accesibles a una gastroscopia que podrían justificar un sangrado digestivo oscuro, así como la evolución de estos enfermos tras la nueva gastroscopia recomendada

  18. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A


    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  19. Value for money assessment for public-private partnerships : a primer. (United States)


    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  20. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J


    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  1. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  2. A primer on systematic reviews in toxicology. (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya


    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  3. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  4. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples. (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G


    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  5. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini


    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  6. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande


    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  7. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron


    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  8. Fungal flora of the digestive tract of Rhodnius prolixus, Rhodnius neglectus, Diptelanogaster maximus and Panstrongylus megistus, vectors of Trypanosoma cruzi, Chagas, 1909 Flora fúngica do trato digestivo de Rhodnius prolixus, Rhodnius neglectus, Diptelanogaster maximus e Panstrongylus megistus vetores de Trypanosoma cruzi, Chagas 1909

    Directory of Open Access Journals (Sweden)

    Aurea Maria Lage de Moraes


    Full Text Available This paper reports a study on the mycobiota in the digestive tract of four important species of triatomines: Rhodnius prolixus, R. neglectus, Diptelanogaster maximus and Panstrongylus megistus. The digestive tracts of 90 adults and 425 nymphs of these four triatomine species were studied and 365 fungal strains were isolated. The genera with the greatest number of species were Aspergillus, Penicillium (14 species in each genus, Acremonium and Cladosporium (three species in each genus, and the most frequent species, in decreasing order, were Aspergillus awamori, Penicillium corylophilum, Cladosporium herbarum and Aspergillus niger. It was concluded that, among the isolated fungi, Aspergillus niger and Penicillium corylophilum might be part of the natural flora of the digestive tract of triatomines.Um estudo da micobiota do trato digestivo de quatro importantes espécies de triatomíneos, Rhodnius prolixus, R. neglectus, Diptelanogaster maximus e Panstrongylus megistus, foi realizado. Foram examinados os tratos digestivos de 90 adultos e 425 ninfas destas espécies de triatomíneos e 365 cepas fúngicas foram isoladas. Os gêneros com o maior número de espécies encontradas foram Aspergillus, Penicillium (14 espécies cada, Acremonium e Cladosporium (3 espécies cada e as espécies mais freqüentes, em ordem decrescente, foram Aspergillus awamori, Penicillium corylophilum, Cladosporium herbarum e Aspergillus niger. Dentre os fungos isolados, concluímos que Aspergillus niger e Penicillium corylophilum possam fazer parte da flora natural do trato digestivo destes triatomíneos.

  9. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim


    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  10. Designing for transportation management and operations : a primer. (United States)


    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  11. Primer design for a prokaryotic differential display RT-PCR. (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H


    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  12. Simple sequence repeat marker loci discovery using SSR primer. (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David


    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at

  13. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T


    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  14. Técnicas de sutura do tubo digestivo em plano único com nós atados no lume, em cães: pontos simples totais versus pontos extramucosos

    Directory of Open Access Journals (Sweden)

    Azevedo João Luiz Moreira Coutinho


    Full Text Available OBJETIVO: Comparar a anastomose do tubo digestivo em plano único com nós atados no lume por sutura com pontos totais versus pontos extramucosos. MÉTODOS: Foram operados seis cães, com realização de duas secções transversas do jejuno a 30 cm e a 70 cm da flexura duodenojejunal e sutura, na face posterior com pontos extramucosos atados sobre a submucosa, e na face anterior com pontos totais atados sobre a mucosa. No 7º PO foram avaliadas, na face posterior, as aderências na linha de sutura e feitos exames macroscópico e microscópico. RESULTADOS: As aderências peritoneais foram mais profusas nas suturas extramucosas com tecido aderencial sobre a linha de sutura, sem reconstituição da serosa, ou com a deformidade cicatricial das serosas dos cotos angulando a anastomose. A serosa teve boa reconstituição nas suturas totais. O epitélio mucoso reconstituiu-se perfeitamente nas extramucosas, mas não nas totais. Nas suturas totais houve focos residuais de inflamação aguda.O realinhamento, a reestruturação e a regeneração das camadas (exceto a serosa, cuja regeneração foi prejudicada por aderências foi melhor na sutura extramucosa que na total. A muscular da mucosa não se regenerou em nenhuma anastomose. Os polimorfonucleares, os macrófagos, os fibroblastos e as fibras colágenas foram mais numerosos (significância estatística na sutura total. CONCLUSÃO: As suturas totais da parede posterior da anastomose com nós atados no lume, sobre a mucosa, são seguras, apesar da inflamação maior. A sutura extramucosa da parede posterior, com nós atados no lume, sobre a submucosa, propicia a formação de aderências peritoneais, devendo ser evitada.

  15. Usefulness of endoscopic ultrasonography in the preoperative diagnosis of submucosal digestive tumours Utilidad de la encoendoscopia en el diagnóstico preoperatorio de malignidad de los tumores submucosos digestivos

    Directory of Open Access Journals (Sweden)

    D. Martínez-Ares


    last three factors were considered independent predictive factors for malignancy. Conclusions: endoscopic ultrasonography has a great sensitivity and specificity in the diagnosis of malignancy regarding submucosal lesions. The irregularity of lesion borders, a heterogeneous ultrasonographic pattern, and the presence of cystic areas above 2 mm in size were considered independent predictive factors for malignancy.Introducción: el diagnóstico preoperatorio de las lesiones submucosas del tubo digestivo puede ser complicado. La endoscopia convencional no permite establecer claramente un diagnóstico y no valora adecuadamente el tamaño de las lesiones. Además, la biopsia endoscópica no suele ser diagnóstica. La citología obtenida por medio de la punción con aguja fina tampoco presenta la suficiente sensibilidad y especificidad como para ser considerada como el patrón oro en el diagnóstico de estas lesiones. Evaluamos a continuación la utilidad de la ultrasonografía endoscópica en el estudio de los tumores submucosos digestivos. Material y métodos: hemos recogido de forma prospectiva los estudios ultrasonográficos de todos los pacientes con tumores submucosos tratados quirúrgicamente en nuestro centro. Se ha evaluado la sensibilidad y especificidad de esta técnica en el diagnóstico de malignidad de estas lesiones, así como los factores que con mayor fiabilidad predicen el comportamiento maligno. También se valoró la fiabilidad de la ecoendoscopia en la valoración del tamaño y en identificar la capa de la pared en que se localizan las lesiones. Los resultados del estudio anatomopatológico fueron considerados el patrón oro en el diagnóstico. Resultados: el tamaño medio de las lesiones medido por ecoendoscopia no presenta diferencias significativas con el de la pieza quirúrgica. Sin embargo, la endoscopia convencional infravalora el tamaño de las lesiones. La ultrasonografía endoscópica estableció adecuadamente la capa de origen de las lesiones en

  16. Endoscopic ultrasound-assisted endoscopic resection of carcinoid tumors of the gastrointestinal tract Resección endoscópica asistida por ecoendoscopia de tumores carcinoides del aparato digestivo

    Directory of Open Access Journals (Sweden)

    D. Martínez-Ares


    in 2 cases (8.3% after ligating the lesion with elastic bands. In all cases the resection was complete, with no recurrence during the follow-up period, and no major complications, except for a single case in which a post-polypectomy hemorrhage occurred that was endoscopically solved. Conclusions: in properly selected patients, the endoscopic resection of carcinoid tumors is a safe and effective technique that permits a complete resection in all cases with few complications. Endoscopic ultrasonography is the technique of choice for selecting the patients who are candidates for endoscopic resection.Introducción: los carcinoides son los tumores neuroendocrinos más frecuentes, representado el tracto digestivo una de sus localizaciones más habituales. La mayoría de las lesiones se localizan en áreas poco accesibles para la endoscopia convencional (intestino delgado y apéndice; los carcinoides localizados en el tracto gastroduodenal y en el intestino grueso pueden ser estudiados endoscópicamente; en estos casos, si se confirma una enfermedad localizada, el tratamiento local mediante resección endoscópica puede ser el tratamiento de elección. Dado que la ecoendoscopia se ha mostrado como la técnica de elección en el estudio de los tumores de crecimiento submucoso, la selección de los pacientes candidatos a una resección local segura y efectiva ha de basarse en esta técnica. Pacientes y método: se han seleccionado los pacientes con tumores carcinoides digestivos tratados endoscópicamente entre 1997 y 2002. Se consideraron subsidiarios de resección endoscópica aquellos pacientes con tumores menores de 10 mm, que respetan la muscular propia y con un estudio de extensión negativo. Los objetivos finales del estudio fueron la evaluación de la eficacia (resección completa y seguridad (complicaciones de la técnica. El seguimiento consistió en biopsias de la escara al mes y los 12 meses de la resección. Resultados: en el periodo referido hemos resecado

  17. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L


    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling. (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G


    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  19. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  20. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo


    Castillo Canales, Braulio


    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.


    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  2. Primers As Socializing Agents in American and Finnish Schools. (United States)

    Hyona, Jukka; And Others


    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  3. Bond strength of compomers to dentin using acidic primers. (United States)

    Tate, W H; You, C; Powers, J M


    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  4. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)


    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  5. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes


    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  6. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)



    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  7. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  8. Blood Donation and Transfusion: A Primer for Health Educators. (United States)

    Felts, W. Michael; Glascoff, Mary A.


    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  9. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias


    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  10. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites. (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe


    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  11. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)


    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  12. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya


    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  13. Controlling Air Pollution; A Primer on Stationary Source Control Techniques. (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  14. Morfologia de órgãos digestivos e não digestivos de suínos de linhagens modernas durante as fases de crescimento, terminação e pós-terminação - DOI: 10.4025/actascianimsci.v29i3.553 Morphology of digestive and non-digestive organs of pigs from modern lineages during growth, finishing and post-finishing phases - DOI: 10.4025/actascianimsci.v29i3.553

    Directory of Open Access Journals (Sweden)

    Mariane de Paula Ishi


    Full Text Available O melhoramento genético de suínos levou ao surgimento de diversas linhagens suínas que apresentam elevada capacidade de desenvolvimento de massa muscular. Entretanto, pouco se sabe cientificamente sobre a morfologia de órgãos destes animais, conhecimento que ajuda a elucidar características relacionadas ao desempenho zootécnico como ganho de peso e conversão alimentar em carne magra. Objetivou-se, assim, comparar a morfologia dos órgãos digestivos e não-digestivos de suínos de linhagens modernas ao final das fases de Crescimentos I e II, Terminação e Pós-terminação. O peso dos órgãos em relação ao peso vivo diminuiu significativamente (p The genetic market makes use of various modern swine genotypes that present high capacity for muscular mass development. These genetic lines have been used in swine production without existing scientific information about morphology, knowledge that can elucidate factors related to growth performance, such as weight gain and food conversion in lean meat yield. The aim of this experiment was to compare the morphology of digestive and non-digestive organs of modern genotypes. At the end of the phases: Growing I, Growing II, Finishing and Post-finishing, the pigs were slaughtered and the organs were weighed. The weight of the organs decreased (p < 0.01 with body development, in agreement with the biological growth of the animals. The morphology of the digestive organs were different (p < 0.06 among lineages, which showed that differences can exist, mainly regarding digestive capacity and, possibly, food intake and efficiency. The length of the small intestine was different (p < 0.06 among lines, which can be an indicative of increased body development due to an extended food exposition area to intestinal cells. The scientific knowledge of swine lines morphology is important because this information can contribute to animal growth performance.

  15. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)



    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  16. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology. (United States)

    Galkiewicz, Julia P; Kellogg, Christina A


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  17. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿


    Galkiewicz, Julia P.; Kellogg, Christina A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  18. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿ (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  19. Utilidad de la ecografía en el diagnóstico de los pacientes con sospecha de neoplasias del tubo digestivo Uselfulness of ultrasonography in diagnosing patients suspect for digestive tract neoplasms

    Directory of Open Access Journals (Sweden)

    D. Martínez Ares


    Full Text Available Introducción: el valor predictivo positivo de síntomas y signos en el diagnóstico del cáncer de colon y gástrico es bajo. Además, muchos pacientes son remitidos para descartar una neoplasia digestiva, sin síntomas que sugieran su localización, siendo el VPP de la clínica aún menor. En este trabajo evaluamos la utilidad de la ecografía como primera aproximación diagnóstica. Material y método: se han reclutado 79 pacientes (48 varones, edad media 69,3 años. En todos ellos se realiza una ecografía antes de la endoscopia. Se evalúa la precisión en el diagnóstico del cáncer de colon y gástrico, los diagnósticos ecográficos y el número de endoscopias que se evitarían. También se buscan factores predictivos de la localización de la neoplasia. Resultados: se han diagnosticado 5 neoplasias gástricas (6,3% y 12 de colon (19%, 3 cáncer de páncreas (3,8%, 2 neoplasias uterinas (2,5% y 2 hipernefromas (2,5%. Las cifras de sensibilidad, especificidad, VPP, VPN y precisión de la ecografía fueron 80%, 98,6%; 80%; 98,6%; y 97,4% respectivamente en el diagnóstico del cáncer gástrico, y del 100%, 94,5%; 80%; 100% y 95,5% respectivamente en el diagnóstico del cáncer de colon. La ecografía permitió evitar el 10% de las endoscopias. El único dato que orienta la localización de la neoplasia es la presencia de anemia, que se asocia con mayor frecuencia al diagnóstico de cáncer de colon: 30,4 versus 4,3% (p = 0,033. Conclusiones: en los pacientes remitidos para descartar una neoplasia digestiva, con síntomas inespecíficos, se diagnostica con frecuencia de patología neoplásica ajena al tubo digestivo. Si consideramos, además, la elevada precisión diagnóstica de la ecografía, esta podría ser una muy buena primera aproximación diagnóstica.Background: the Positive Predictive Value (PPV of signs and symptoms for the diagnosis of colon and gastric cancer is low. Furthermore, many patients are referred to us to discard a

  20. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  3. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis


    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli


    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  4. A primer on the mortgage market and mortgage finance


    Daniel J. McDonald; Daniel L. Thornton


    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  5. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Transient Heat Transfer Model for Car Body Primer Curing


    D. Zabala; N. Sánchez; J. Pinto


    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  7. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas


    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  8. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés


    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  9. Effect of oligonucleotide primers in determining viral variability within hosts. (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando


    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  10. Sensory reception of the primer pheromone ethyl oleate (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang


    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  11. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  12. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species. (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R


    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  13. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere


    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  14. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh


    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  15. Gut size flexibility in rodents: what we know, and don't know, after a century of research Flexibilidad en el tamaño del tracto digestivo en roedores: qué sabemos, y qué no sabemos, después de un siglo de investigación

    Directory of Open Access Journals (Sweden)



    specific absorption (e.g., during highly demanding periods. (6 The qualities of an energetic demand (e.g., its relative intensity rather than simply its presence or absence can affect the amount of digestive flexibility. (7 Quantitative comparisons of the existing data are difficult due to several factors, such as the disparity of experimental treatments and differences in the types of data collected. At the end of this review, further directions for the study of digestive flexibility in rodents are presented.La plasticidad fenotípica constituye un concepto medular en el entendimiento de cómo los organismos interactúan con su ambiente y, por tanto, un tema central en ecología y evolución. Un caso particular de la plasticidad fenotípica es la flexibilidad fenotípica, la cual refiere a los cambios reversibles en un organismo producto de cambios en las condiciones ambientales. La flexibilidad en los rasgos digestivos ha sido estudiada por más de un siglo en diversas especies y contextos. Para el caso de los roedores, los estudios sobre la flexibilidad en el tamaño del tracto digestivo han sido desarrollados principalmente desde dos áreas de la biología, la fisiología y la ecología. Sin embargo, como ha ocurrido con muchos tópicos relacionados con la fisiología ecológica, ambos tipos de estudios se desarrollaron por vías separadas. En este trabajo se intenta evaluar de forma conjunta la información proveniente de ambas áreas. Las principales conclusiones alcanzadas son: (1 la flexibilidad en el tamaño del tracto digestivo puede ser considerada un mecanismo fisiológico ampliamente distribuido, existiendo un clara congruencia entre los ajustes en la morfología digestiva y los cambios en las condiciones ambientales. (2 Los factores experimentales más investigados han sido la calidad de la dieta, el estatus reproductivo, la temperatura ambiental y el ayuno para las especies de laboratorio y la calidad de la dieta y la temperatura para las especies salvajes

  16. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N


    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  17. Plan de negocio de una escuela infantil (primer ciclo)


    San Román Gómez, Ana de


    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  18. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli


    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.


    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  20. [Design of primers to DNA of lactic acid bacteria]. (United States)

    Lashchevskiĭ, V V; Kovalenko, N K


    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  1. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I


    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  2. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D


    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  3. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W


    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  4. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter


    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  5. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F


    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  6. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024 (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  7. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per


    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  8. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.


    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  9. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti


    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  10. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz


    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  11. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo


    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  12. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin


    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  13. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology (United States)

    Galkiewicz, J.P.; Kellogg, C.A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  14. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.


    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  15. Design of a Percussion and Electric Primer Gun Firing Power Supply (United States)


    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  16. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing


    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael


    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  17. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates. (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis


    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)


    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  20. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  1. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.


    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  2. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin


    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  3. Primer Vector Optimization: Survey of Theory, new Analysis and Applications (United States)


    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  4. Primer and interviews: The dynamic stem cell niche. (United States)

    Kiefer, Julie C


    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  5. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria


    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  6. Primer Part 1-The building blocks of epilepsy genetics. (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C


    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  7. ITS primers for the identification of marketable Boletus. (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola


    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  8. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)


    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  9. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.


    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  10. 40 CFR 63.745 - Standards: Primer and topcoat application operations. (United States)


    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  11. Sediment transport primer: estimating bed-material transport in gravel-bed rivers (United States)

    Peter Wilcock; John Pitlick; Yantao Cui


    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  12. Móvil remisión de V. cinta del primer móvil.



    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  13. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej


    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  14. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  16. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.


    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  17. A database of PCR primers for the chloroplast genomes of higher plants (United States)

    Heinze, Berthold


    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  18. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati. (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y


    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  19. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold


    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  20. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying


    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  1. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR. (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart


    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at Database URL:

  2. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp


    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  3. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  4. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson


    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  5. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers. (United States)

    Caetano-Anollés, G; Gresshoff, P M


    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  6. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  7. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation. (United States)

    Cheng, Yu-Huei


    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  8. Sintomas do trato digestivo superior e distúrbios motores do esôfago em pacientes portadores da forma indeterminada da doença de Chagas crônica Upper gastrointestinal symptoms and esophageal motility disorders in indeterminate Chagas’ disease patients

    Directory of Open Access Journals (Sweden)

    Rafaela de Liz P. Sanchez-Lermen


    Full Text Available O estudo descreve os sintomas referidos por portadores da forma indeterminada da doença de Chagas crônica e avalia sua associação com alterações da motilidade esofágica. Manometria do esôfago foi realizada em 50 pacientes, medindo-se a extensão e a pressão do esfíncter inferior do esôfago, o peristaltismo e a amplitude de contração do corpo esofágico. Oito (16% pacientes apresentaram relaxamento parcial do esfíncter inferior, 13 (26% apresentaram aperistalse parcial e 20 (40% apresentaram hipocontratilidade no esôfago distal. Sintomas digestivos altos foram referidos por 24 (48% pacientes, sendo mais freqüentes a pirose, a regurgitação e o desconforto intermitente à deglutição. Esses sintomas foram referidos por 17 (51,5% de 33 pacientes com alterações motoras do esôfago e por 7 (41,2% de 17 pacientes com manometria normal, diferença essa não estatisticamente significante (p=0,69. Esses achados sugerem que portadores da FCI apresentam sintomas inespecíficos do trato digestivo superior que podem dificultar a sua classificação com base apenas no exame clínico e radiológico, e que é alta a freqüência de portadores desta forma que apresentam distúrbios motores do esôfago.This study describes the symptoms reported by patients with the indeterminate form of chronic Chagas’ disease and evaluates associations between these symptoms and alterations in esophageal motility. Esophageal manometry was performed on 50 patients, with measurements of the length and pressure of the lower esophageal sphincter, peristaltism and the amplitude of contractions of the esophageal body. Eight (16% patients presented partial relaxation of the lower sphincter, 13 (26% presented partial lack of peristalsis and 20 (40% presented hypocontractility of the distal esophagus. Upper digestive symptoms were reported by 24 (48% patients, and the most frequent of these were heartburn, regurgitation and intermittent discomfort when swallowing

  9. Parâmetros digestivos, produção e qualidade do leite de cabras Saanen recebendo rações com casca do grão de soja em substituição ao milho = Digestive parameters, production and quality of milk from Saanen goats fed rations with soybean hulls as a replacement for ground corn

    Directory of Open Access Journals (Sweden)

    Maximiliane Alavarse Zambom


    Full Text Available O experimento objetivou avaliar os parâmetros digestivos, produção e qualidade do leite de cabras Saanen, recebendo rações com casca do grão de soja (CGS, em três níveis de substituição ao milho moído (0% CGS, 50% CGS e 100% CGS. Foram utilizadas três cabras Saanen (52,35 kg ± 7,46, primíparas, confinadas, distribuídas em quadrado latino 3 x 3. As rações apresentaram em média 14,70% de PB e 2,23 Mcal de EM kg-1 de MS ingerida. Foi realizado o controle diário da ingestão e produção de leite. As fezes foram coletadas para determinação da digestibilidade da matéria seca e dos nutrientes, e o líquido ruminal para determinação dos parâmetros ruminais. O leite foi coletado para análises físico-químicas e perfil de ácidos graxos. A maior (p 0,05 na digestibilidade da matéria seca e dos nutrientes, nem na produção e qualidade físico-química do leite. O tratamento 100% CGS proporcionou maior concentração de acetato ruminal, maior razão acetato:propionato e menores concentrações de propionato e butirato ruminal. Os tratamentos não alteraram (p > 0,05 o N-amoniacal e pH ruminal. O perfil de ácidos graxos do leite oscilou em função dos tratamentos. A casca do grão de soja pode substituir o milho moído em rações para cabras Saanen em lactação, sem alterações no processo digestivo, na produção e na qualidade do leite.The objective of this study was to evaluate digestive parameters, production and quality of milk from Saanen goats fed rations with soybean hulls (SBH as a replacement for ground corn. Three Saanen does (52.35 kg ± 7.46, confined and first-kidding, were allocated in a 3 x 3 Latin square. Treatments consisted of replacement levels of ground corn for SBH (0% SBH, 50% SBH and 100% SBH, with 14.70% of CP and 2.23 Mcal of ME kg-1 DMI as mean values. Intake and milk production were recorded daily. Feces were sampled for the determination of dry matter and nutrient digestibility, and ruminal

  10. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido


    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  11. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez


    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  12. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.


    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  13. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  14. Genetic analysis of presbycusis by arrayed primer extension. (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris


    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  15. The corrosion mechanisms for primer coated 2219-T87 aluminum (United States)

    Danford, Merlin D.; Knockemus, Ward W.


    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  16. A primer on on-demand polymerase chain reaction technology. (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise


    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  17. Níveis decrescentes de proteína em dietas suplementadas com complexo enzimático, para coelhos em crescimento. 2. Parâmetros digestivos e composição química do conteúdo cecal

    Directory of Open Access Journals (Sweden)

    Santiago G.S.


    Full Text Available Estudou-se o efeito da redução do nível protéico da dieta, com e sem suplementação enzimática, sobre as características digestivas e composição do conteúdo cecal de coelhos em crescimento. Usou-se um delineamento inteiramente ao acaso, com 54 coelhos da raça Nova Zelândia Branco, de ambos os sexos, desmamados com 35 dias de idade, e divididos em cinco grupos (tratamentos, quatro de 11 e um de 10 coelhos. Os tratamentos constituíram-se de dietas calculadas como isoenergéticas e isoaminoacídicas, com 17, 16, 15 e 14% de proteína bruta (PB, suplementadas com 0,05% de um complexo enzimático comercial (Vegproâ com atividades de protease e celulase e uma dieta controle com 17% PB sem adição do complexo enzimático. Os pesos do trato digestivo cheio, ceco cheio, ceco vazio e conteúdo cecal foram significativamente afetados pelo nível de PB da dieta. Das frações químicas do conteúdo cecal (matéria seca, proteína bruta, fibra em detergente ácido, matéria orgânica e nitrogênio amoniacal, matéria orgânica, nitrogênio amoniacal e proporções molares dos ácidos acético e propiônico foram significativamente afetadas pelo nível de PB da dieta. Os resultados permitem concluir que a redução do nível de PB da dieta para 14 % não influenciou negativamente as características estudadas.

  18. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus


    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  19. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.


    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated


    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani


    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  1. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva


    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  2. Do we need primer for orthodontic bonding? A randomized controlled trial. (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R


    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  3. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.


    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  4. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine


    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  5. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002


    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia


    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  6. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  7. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)


    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  8. Pharmacological chaperoning: a primer on mechanism and pharmacology. (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G


    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  9. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García


    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  10. Making the connection: advancing traffic incident management in transportation planning : a primer. (United States)


    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  11. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication. (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J


    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  12. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage. (United States)

    Prunier, Rachel; Latimer, Andrew


    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  13. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018 (United States)


    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  14. Routes to effective evacuation planning primer series : evacuating populations with special needs. (United States)


    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  15. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer. (United States)


    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  16. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn


    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  17. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean


    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  18. Incorporating travel-time reliability into the congestion management process : a primer. (United States)


    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  19. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray


    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  20. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito


    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  1. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft (United States)


    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  2. Comparison of shear bond strength of orthodontic brackets using various zirconia primers. (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju


    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  3. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia. (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong


    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)


    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  5. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design. (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong


    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  6. UniPrime2: a web service providing easier Universal Primer design. (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C


    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  7. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis. (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G


    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  8. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry


    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  9. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul


    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  10. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database. (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela


    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  11. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton


    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  12. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  13. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.


    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  14. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani


    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  15. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  16. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)


    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  17. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto


    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  18. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea) (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok


    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  19. The effect of various primers on shear bond strength of zirconia ceramic and resin composite. (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat


    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  20. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode. (United States)

    Françoso, E; Arias, M C


    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  1. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers. (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko


    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim


    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online

  3. Genus-Specific Primers for Study of Fusarium Communities in Field Samples (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna


    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  4. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek


    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  5. Real-time PCR (qPCR) primer design using free online software. (United States)

    Thornton, Brenda; Basu, Chhandak


    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  6. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio


    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  7. Primer sets for cloning the human repertoire of T cell Receptor Variable regions. (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele


    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  8. Temas de Física para Ingeniería: Primer principio de la termodinámica


    Beléndez Vázquez, Augusto


    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  9. Tumores del músculo liso del tracto digestivo


    Tejada, Antonio; Capitan-Morales, Luis-Cristobal; Suelves, C.; Linares, E.; Rivera Hueto, F.; Fernández, F.; Méndez, J.; Jiménez-García, Antonio; Ortega, J.; Cantillana, J.


    Propósito: Los tumores de estirpe muscular son raros en el tracto esofágico y gastrointestinal. En este trabajo presentamos nuestra experiencia reciente en su manejo. Material y métodos: Hemos incluido en estudio los pacientes tratados de estas neoplasias en el Servicio de Cirugía General y Digestiva del Hospital Virgen Macarena de Sevilla (Prof. Cantillana Martínez) desde 1991 a 1996, analizando la clínica, los métodos diagnósticos empleados y la terapéutica utilizada. Resul...

  10. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.


    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  11. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan


    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  12. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding. (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J


    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  13. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae). (United States)

    Glennon, Kelsey L; Cron, Glynis V


    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  14. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1 (United States)

    Glennon, Kelsey L.; Cron, Glynis V.


    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  15. GST-PRIME: an algorithm for genome-wide primer design. (United States)

    Leister, Dario; Varotto, Claudio


    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  16. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik


    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  17. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan


    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  18. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony


    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  19. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari


    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  20. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti


    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  1. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X


    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  2. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V


    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  3. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema


    Johnston, Nessa


    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  4. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben


    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  5. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa


    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  6. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.


    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  7. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji


    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  8. Hemorragias obstétricas en el primer y segundo trimestre del embarazo


    García Rodríguez, Blanca


    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  9. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.


    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  10. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)



    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  11. A primer on polymer nomenclature: Structure-based, sourced-based and trade names (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  12. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)



    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  13. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools. (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce


    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  14. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta


    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  15. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  16. Targeted reduction of highly abundant transcripts using pseudo-random primers. (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles


    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  17. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li


    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  18. What Are the Odds of that? A Primer on Understanding Logistic Regression (United States)

    Huang, Francis L.; Moon, Tonya R.


    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  19. A Web-Based Adaptive Tutor to Teach PCR Primer Design (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.


    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  20. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.


    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  1. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.


    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  2. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.


    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero


    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  5. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.


    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  6. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda


    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  7. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton


    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  8. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  9. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.


    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  10. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.


    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  11. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.


    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  12. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW


    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  13. The astrobiology primer: an outline of general knowledge--version 1, 2006. (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S


    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  14. Fatores preditivos da transfusão de concentrado de hemácias em pacientes submetidos a cirurgias eletivas do aparelho digestivo: uma análise interinstitucional Predictive factors associated with packed red cell transfusions in patients submitted to elective surgery of the digestive tract: an inter-institutional analysis

    Directory of Open Access Journals (Sweden)

    Antonio Sergio Barcala Jorge


    Full Text Available O objetivo desse estudo foi compreender os fatores determinantes da prática transfusional de concentrado de hemácias em cirurgias eletivas do aparelho digestivo em quatro unidades hospitalares em Montes Claros, Minas Gerais, Brasil. Foi realizado um estudo descritivo, analítico e retrospectivo através do levantamento de dados em prontuários clínicos de quatro unidades hospitalares de onde foram catalogados os dados de pacientes a partir de junho de 2007 a dezembro de 2008, referentes às cirurgias citadas. Os resultados evidenciaram 81 casos, sendo 42% do gênero feminino e 58% do masculino. A idade média foi de 55,5 anos (±19,11 anos. As enfermidades de base reportadas mais comuns foram os processos neoplásicos (42%. Desses 81 pacientes, 38 (47% foram hemotransfundidos no pré-operatório imediato, 28 (18% foram transfundidos no transcirúrgico e 37 (45,7% no pós-operatório imediato. Na análise univariada houve diferenças entre a prática transfusional pré-cirúrgica interinstitucional. Na fase cirúrgica houve relação entre a prática transfusional com a citação de motivos, fator RH (Rhesus, prática institucional e doença de base. Na fase pós-cirúrgica não foram demonstradas relações. Em todas as fases, não houve associação da prática transfusional com os tipos de procedimentos cirúrgicos, com o índice ASA (American Society of Anesthesiology e valores de hemoglobina e hematócrito. Concluindo, esse estudo revelou que a prática transfusional foi heterogênea entre instituições hospitalares, careceu de valores laboratoriais específicos, relacionou-se com a patologia de base mas não com o tipo de procedimento cirúrgico e foi norteada pelo critério de escolha do profissional.The objective of this study was to understand the determinative factors for packed red cell transfusions in elective digestive tract surgeries in four hospital units in Montes Claros, Minas Gerais, Brazil. Retrospective analyses were

  15. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil. (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie


    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  16. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet


    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  17. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David


    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  18. In vivo effect of a self-etching primer on dentin. (United States)

    Milia, E; Lallai, M R; García-Godoy, F


    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  19. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer. (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev


    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  20. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics. (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas


    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  1. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences. (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou


    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  2. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events. (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J


    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at

  3. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species. (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E


    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  4. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA. (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S


    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries. (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong


    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  6. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson


    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  7. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.


    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual





    Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

  9. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika


    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  10. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome. (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh


    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL:

  11. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.


    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  12. Demonstration Of A Nanomaterial-Modified Primer For Use In Corrosion-Inhibiting Coating Systems (United States)


    resin packages/binders, can cause a high-build coating thickness that can be prone to chipping and “mud cracking ” if not properly applied. The...for all non-magnetic coatings on a ferrous (magnetic) substrate, e.g. paint, plastic, enamel , powder, rubber, ceramic, galvanising, zinc, sprayed... cracking during the scribing process due to the brittle coating system on the intermediate primer coupons (16 and 22) as well as coupon 11. Mildew

  13. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus) (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  14. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre


    Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera


    Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

  15. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise


    Robertson, Amber L.; Phillips, Allison R.


    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  16. Facebook targeted advertisement for research recruitment: A primer for nurse researchers. (United States)

    Carter-Harris, Lisa


    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona. (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M


    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  18. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  19. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems. (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui


    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones. (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis


    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)


    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  2. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang


    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  3. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)


    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  4. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.


    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  5. Application of hierarchical oligonucleotide primer extension (HOPE) to assess relative abundances of ammonia- and nitrite-oxidizing bacteria

    KAUST Repository

    Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying


    for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study


    Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 A in thickness) were deposited onto 6111-T4 aluminum substrates in radio frequency and microwave powered reactors and used as primers for structural adhesive bonding. Processing variables such as substrate pre-treatment,...

  7. Regional transportation operations collaboration and coordination : a primer for working together to improve transportation safety, reliability, and security (United States)


    This primer was written for transportation professionals and public safety officials from cities, counties, and States who are responsible for day-to-day management and operations within a metropolitan region. It is intended to help agencies and orga...

  8. Bond strength of primer/cement systems to zirconia subjected to artificial aging. (United States)

    Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke


    Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

  9. Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

    Directory of Open Access Journals (Sweden)

    Julio J. Masquijo


    Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

  10. Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets (United States)

    Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G


    Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

  11. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)


    Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

  12. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková


    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  13. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    International Nuclear Information System (INIS)

    Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo


    Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

  14. EZCA primer

    International Nuclear Information System (INIS)

    Karonis, N.T.


    This document provides a quick introduction to EZCA, a library that was designed to provide an easy to use interface to Channel Access (CA). As such, this document is not a user's manual, where a more detailed explanation of EZCA can be found. In short, this document is designed to get users to a state where they can be writing EZCA code as quickly as possible. It is not a document that answers all EZCA questions

  15. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.


    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  16. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker


    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  17. Telecommunications Primer


    Joseph Becker


    A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.


    Directory of Open Access Journals (Sweden)

    Marco Suárez


    Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

  19. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui


    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  20. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.


    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  1. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail:; Hill, Vincent R.


    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da


    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  3. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)


    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  4. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  5. Erro médico em cirurgia do aparelho digestivo: contribuição para o estudo das provas técnicas, periciais e documentais e suas implicações jurídicas Medical malpractice in digestive system surgeries: a contribution to the study of technical, expertise and documentary evidence and its legal implications

    Directory of Open Access Journals (Sweden)

    João Batista Opitz Jr.


    Full Text Available RACIONAL: A preocupação dos indivíduos em relação aos erros médicos tem aumentado ultimamente entre os brasileiros e muitas vezes processos podem ser evitados com medidas racionais preventivas no relacionamento médico-paciente. OBJETIVO: Analisar processos judiciais, que tramitam pelos fóruns regionais cíveis do Estado de São Paulo, capital e interior e instituições periciais da capital para definir as principais causas e documentos juntados ao mesmo e conseqüências de cada condição. MÉTODOS: Trinta processos foram analisados onde se fez a extração individualizada de dados. Iniciou-se pela importância prática do tema para efeito de evolução médico-social. Buscou-se estudar a visão da relação médico-paciente, mesmo durante a demanda, a informação ao paciente e seus familiares dos procedimentos e limitadores do ato médico; o documental técnico jurídico juntado ao processo; o preparo técnico-jurídico do médico e, se, a propositura de ação dependia da formação e especialização do profissional. Foram analisados processos judiciais de primeira instância no período de 1996 a 2002 correlacionados às operações do aparelho digestivo. Usou-se como parâmetro de análise exclusivamente os documentos juntados aos autos onde buscou-se a existência clara da quebra da relação médico-paciente, a existência de consentimento informado, a verificação do documental juntado à defesa pelas partes ou solicitação judicial e a qualificação do profissional envolvido nas ações. RESULTADOS: Em 93,34% dos casos houve quebra da relação médico-paciente. Era visível das partes a animosidade no petitório. Em 10% dos casos existia consentimento informado, porém, apenas um foi usado e considerado pelo magistrado por descrever e orientar especificadamente sobre o risco que a posteriori originou a demanda. Dois eram genéricos, sendo que não foram considerados, ao ver do julgador, por hiposuficiência do paciente

  6. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  7. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching. (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl


    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at and the online Java version at .

  8. In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin

    Directory of Open Access Journals (Sweden)

    Reena Vora


    Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.

  9. Effect of a whitening agent application on enamel bond strength of self-etching primer systems. (United States)

    Miyazaki, Masashi; Sato, Hikaru; Sato, Tomomi; Moore, B Keith; Platt, Jeffrey A


    Though reduction in bond strength after tooth whitening has been reported, little is known about it's effect on enamel bond strength of two-step bonding systems that exclude phosphoric acid etching prior to bonding agent application. The purpose of this study was to determine the effect of whitening procedure using an in-office whitening agent on enamel bond strength of self-etching primer systems. Three self-etching primer systems, Imperva Fluoro Bond, Mac Bond II, Clearfil SE Bond, and a one-bottle adhesive system Single Bond as a control material, were used. Bovine mandibular incisors were mounted in self-curing resin and the facial enamel or dentin surfaces were ground wet on 600-grit SiC paper. An in-office whitening agent, Hi-Lite was applied on the tooth surface according to the manufacturer's instruction. Bonding procedures were done soon after rinsing off the whitening agent or after 24 hours storage in distilled water. Specimens without whitening procedure were prepared as controls. Fifteen specimens per test group were stored in 37 degrees C distilled water for 24 hours, then shear tested at a crosshead speed of 1.0 mm/minute. One-way ANOVA followed by Duncan multiple range test were used for statistical analysis of the results. For the specimens made soon after rinsing off the whitening agent, a significant decrease in enamel bond strength was observed for all the bonding systems used. For the specimens made after 24 hours storage in water, a small decrease in enamel bond strength was observed and no significant differences were found compared to those of controls (without whitening). From the results of this study, enamel bond strengths of the self-etching primer systems might be affected to a lesser degree after rinsing with water followed by 24 hours storage in water.

  10. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    Directory of Open Access Journals (Sweden)

    Harold Castañeda-Peña


    Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

  11. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera. (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin


    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  12. Christiaan Barnard: 40 años del primer transplante de corazón humano.


    Jorge Reynolds; Juan Fernando Cediel; César Payán


    Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

  13. Primer caso de canibalismo registrado para el gecko de Lima, Phyllodactylus sentosus (Reptilia, Phyllodactylidae)


    Valdez, Fernando; Cossios, E. Daniel


    Se reporta un caso de canibalismo en el gecko de Lima, Phyllodactylus sentosus Dixon & Huey, 1970 donde un macho adulto devoró a un juvenil. Tras una búsqueda de literatura, no se encontró casos reportados en otras especies del mismo género, por lo que se considera que este es el primer reporte de canibalismo en Phyllodactylus. We report a case of cannibalism for the Lima leaf-toed gecko, Phyllodactylus sentosus, in which an adult male devoured a juvenile. No reported cases were found in o...

  14. The compleat strategyst being a primer on the theory of games of strategy

    CERN Document Server

    Williams, J D


    When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has

  15. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.


    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  16. Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional


    Gonzalez-Soto, L.; Orozco-Morales, A.R.


    Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

  17. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno


    González Capitel, Antón


    1. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno l. l. Un Wright renovado. Talleres y residencias l. l. l. Nuevas casas de Wright en su segunda «edad de oro»: un neoplasticismo orgánico en la casa de la Cascada l. l. 2. Geometrías y disposiciones alternativas l. 2. Arquitectura y ciudad orgánicas 1. 2. 1. El desarrollo de la arquitectura orgánica 1. 3. Arquitecturas relacionadas con la de Frank Lloyd Wright entre los emigrados europeos: Schindler y...

  18. Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Irma Suriyani


    Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

  19. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...


    Directory of Open Access Journals (Sweden)

    José Bernardo Navarrete Cedeño


    Full Text Available Diaphorina citri (Hemiptera: Liviidae, conocido como el psílido asiático de los cítricos, es considerada una plaga clave de la citricultura mundial, debido a que es vector de la bacteria “Candidatus Liberibacter”, agente causal de la enfermedad “Huanglongbing”, que tiene efectos letales sobre vegetales dentro de la familia Rutaceae. En este documento se reporta la presencia de D. citri infestando Murraya spp., un arbusto de la familia Rutaceae, en la zona urbana del cantón Portoviejo. Este es el primer reporte de la plaga en la provincia de Manabí-Ecuador

  1. Enzyme Treatment-Free and Ligation-Independent Cloning Using Caged Primers in Polymerase Chain Reactions

    Directory of Open Access Journals (Sweden)

    Akinori Kuzuya


    Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.

  2. The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin. (United States)

    Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K


    To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

  3. Linfoma T Intestinal Monomórfico CD56+. Primer Caso Informado en Colombia y Revisión de la Literatura

    Directory of Open Access Journals (Sweden)

    Orlando Ricaurte G


    Full Text Available Mujer de 80 años con hallazgo incidental de masa abdominal en mesogastrio, a quien le realizan resección de intestino delgado por sospecha de absceso con síndrome adherencial. El estudio patológico de la pieza quirúrgica demostró compromiso por  linfoma no Hodgkin T monomórfico CD56+. Los linfomas T del tubo digestivo son inusuales, correspondiendo a 5% de las neoplasias linfoides de esta localización. El linfoma intestinal T monomórfico CD56+, corresponde a 10 - 20% de los linfomas T intestinales, se presenta en regiones donde la enfermedad celiaca es infrecuente y no se asocia a enteropatía. Su curso es agresivo y habitualmente se manifiesta como una emergencia quirúrgica por obstrucción o perforación intestinal.

  4. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers. (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing


    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett


    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  6. Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading (United States)

    Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.


    Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

  7. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.


    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  8. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.


    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  9. Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

    Directory of Open Access Journals (Sweden)

    Lucero López-Díaz


    Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

  10. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  11. Moessbauer spectroscopic study of corrosion products beneath primer coating containing anticorrosive pigments

    International Nuclear Information System (INIS)

    Kumar, A.V.R.; Nigam, R.K.


    The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)

  12. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo


    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi:

  13. Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

    Directory of Open Access Journals (Sweden)

    Retno Asti Werdhani


    Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were


    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary


    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  15. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis. (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor


    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  16. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  17. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

    Directory of Open Access Journals (Sweden)

    Laura Navarro-Sampedro


    Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

  18. Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive. (United States)

    Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won


    The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

  19. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs. (United States)

    Rockne, Karl J; Strand, Stuart E


    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  20. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders


    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  1. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  2. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth


    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  3. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  4. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P


    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  5. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction. (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P


    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  6. Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia. (United States)

    Pitta, João; Branco, Teresa C; Portugal, Jaime


    Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

  7. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai


    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  8. Lactancia materna, alimentación artificial y el primer contacto con azúcar

    Directory of Open Access Journals (Sweden)

    Fabian Calixto Fraiz


    Full Text Available Objetivo: Este estudio evaluó los cambios en el patrón de lactancia materna, alimentación artificial y en la introducción de azúcar en la dieta de niños de 0 a 36 meses, a través de dos estudios, con un intervalo de 13 años en la ciudad de Curitiba, Paraná, Brasil. Material y métodos: Poblaciones semejantes de una misma región geográfica fueron evaluadas a través de un cuestionario, en los años de 1993 y 2006, envolviendo, respectivamente, las madres de 180 y 94 niños. Introducción de azúcar en la dieta fue considerada precoz cuando ocurrió antes del 6º mes completo de vida. Los datos fueron analizados estadísticamente a través del test de qui-cuadrado y test exacto de Fisher (α= 0,05. Resultados: Hubo diferencias en la frecuencia del primer contacto con azúcar (p <0,001, que ocurrió en el primer mes de vida en 61,7% de los niños del primer estudio y en sólo 3,2% de los niños del segundo estudio. Hubo diferencias en el patrón de lactancia materna (p = 0,02, siendo la prevalencia de niños amamantados mayor en el segundo estudio. No fueron encontradas diferencias estadísticamente significativas en la prevalencia de uso de biberón, uso de biberón durante la noche y lactancia materna durante la noche, así como en el uso de biberón conteniendo azúcar. Conclusiones: Estos resultados indican que la lactancia materna puede, además de sus varias ventajas, también promover el aplazamiento de la introducción de azúcar en la dieta infantil. Nuevas investigaciones son necesarias para confirmar esta hipótesis.

  9. Genetics on the Fly: A Primer on the Drosophila Model System (United States)

    Hales, Karen G.; Korey, Christopher A.; Larracuente, Amanda M.; Roberts, David M.


    Fruit flies of the genus Drosophila have been an attractive and effective genetic model organism since Thomas Hunt Morgan and colleagues made seminal discoveries with them a century ago. Work with Drosophila has enabled dramatic advances in cell and developmental biology, neurobiology and behavior, molecular biology, evolutionary and population genetics, and other fields. With more tissue types and observable behaviors than in other short-generation model organisms, and with vast genome data available for many species within the genus, the fly’s tractable complexity will continue to enable exciting opportunities to explore mechanisms of complex developmental programs, behaviors, and broader evolutionary questions. This primer describes the organism’s natural history, the features of sequenced genomes within the genus, the wide range of available genetic tools and online resources, the types of biological questions Drosophila can help address, and historical milestones. PMID:26564900

  10. An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner (United States)

    Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei


    One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

  11. Eduardo Krapf (1901-1963: Primer Presidente de la Sociedad Interamericana de Psicología

    Directory of Open Access Journals (Sweden)

    Hugo Klappenbach


    Full Text Available El trabajo, de carácter historiográfico, examina la trayectoria de Eduardo Krapf, quien se recibió de médico en Alemania y posteriormente revalidó su titulo en la Argentina. Se analiza su inserción en la Asociación Psicoanalítica Argentina y sus trabajos sobre psiquiatría y psicología al promediar el siglo XX. En particular, se analizan los intereses que condujeron a Eduardo Krapf a vincularse con la psicología y en particular con la Sociedad Interamericana de Psicología, de la que fue Primer Presidente en 1951. Metodológicamente, se han obtenido los datos principalmente de fuentes primarias, particularmente textos y documentos de archivo existentes en la Facultad de Ciencias Médicas de la Universidad de Buenos Aires

  12. Using social media to facilitate knowledge transfer in complex engineering environments: a primer for educators (United States)

    Murphy, Glen; Salomone, Sonia


    While highly cohesive groups are potentially advantageous they are also often correlated with the emergence of knowledge and information silos based around those same functional or occupational clusters. Consequently, an essential challenge for engineering organisations wishing to overcome informational silos is to implement mechanisms that facilitate, encourage and sustain interactions between otherwise disconnected groups. This paper acts as a primer for those seeking to gain an understanding of the design, functionality and utility of a suite of software tools generically termed social media technologies in the context of optimising the management of tacit engineering knowledge. Underpinned by knowledge management theory and using detailed case examples, this paper explores how social media technologies achieve such goals, allowing for the transfer of knowledge by tapping into the tacit and explicit knowledge of disparate groups in complex engineering environments.

  13. The replisome uses mRNA as a primer after colliding with RNA polymerase. (United States)

    Pomerantz, Richard T; O'Donnell, Mike


    Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

  14. Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

    Directory of Open Access Journals (Sweden)

    Rodríguez Rebollo, Ángel


    Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

  15. Review of The Atheist’s Primer and Atheism for Beginners

    Directory of Open Access Journals (Sweden)

    Andrew J Bissette


    Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

  16. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies


    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  17. Bolívar, primer diplomático de la libertad americana

    Directory of Open Access Journals (Sweden)

    Rafael Gómez Hoyos


    Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.

  18. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system. (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B


    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  19. Microsatellite Primers Identified by 454 Sequencing in the Floodplain Tree Species Eucalyptus victrix (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Paul G. Nevill


    Full Text Available Premise of the study: Microsatellite primers were developed for Eucalyptus victrix (Myrtaceae to evaluate the population and spatial genetic structure of this widespread northwestern Australian riparian tree species, which may be impacted by hydrological changes associated with mining activity. Methods and Results: 454 GS-FLX shotgun sequencing was used to obtain 1895 sequences containing putative microsatellite motifs. Ten polymorphic microsatellite loci were identified and screened for variation in individuals from two populations in the Pilbara region. Observed heterozygosities ranged from 0.44 to 0.91 (mean: 0.66 and the number of alleles per locus ranged from five to 25 (average: 11. Conclusions: These microsatellite loci will be useful in future studies of population and spatial genetic structure in E. victrix, and inform the development of seed sourcing strategies for the species.

  20. Cancer of the Esophagus and Esophagogastric Junction: An Eighth Edition Staging Primer (United States)

    Rice, Thomas W.; Ishwaran, Hemant; Ferguson, Mark K.; Blackstone, Eugene H.; Goldstraw, Peter


    This primer for eighth edition staging of esophageal and esophagogastric epithelial cancers presents separate classifications for the clinical (cTNM), pathologic (pTNM), and postneoadjuvant pathologic (ypTNM) stage groups, which are no longer shared. For pTNM, pT1 has been subcategorized as pT1a and pT1b for the subgrouping pStage I adenocarcinoma and squamous cell carcinoma. A new, simplified esophagus-specific regional lymph node map has been introduced. Undifferentiated histologic grade (G4) has been eliminated; additional analysis is required to expose histopathologic cell type. Location has been removed as a category for pT2N0M0 squamous cell cancer. The definition of the esophagogastric junction has been revised. ypTNM stage groups are identical for both histopathologic cell types, unlike those for cTNM and pTNM. PMID:27810391

  1. Testing of Model Water Chiller System with Hidrokarbon as a Primer Refrigeran

    Directory of Open Access Journals (Sweden)

    Nengah Suarnadwipa


    Full Text Available Now days, there are two issues that give a negative impact on the environment due to the uses of synthetic refrigerant on therefrigeration system and air conditioning system. The first issue was the Ozon Layer Depletion and the second issue was theGlobal Warming. Regarding those condition, it will be investigated the design and examination of performance the use of thesplit type AC system as water chiller system and using hydrocarbon as a primer refrigerant. As a result, in the examination ofthe standard split type AC system using refrigerant R-22, it founded that the cooling rate of 1958 Watt and COP of 5.29.While the examination on the modified split type AC system into water chiller system using hydrocarbon (hycool 22, hasgiven cooling rate of 1832 Watt and COP of 4.19. Finally, it could be councluded that the split type AC system could be usedas water chiller system.

  2. An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum (United States)

    Danford, M. D.; Higgins, R. H.


    The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.

  3. Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1. (United States)

    Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D


    Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.

  4. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)



    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.


    Directory of Open Access Journals (Sweden)

    reni heryani


    Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

  6. Los paisajes de Carlos V : primer viaje a España (1517-1518

    Directory of Open Access Journals (Sweden)

    Pilar Bosqued Lacambra


    Full Text Available Laurent Vital escribió la Relación del primer viaje de Carlos V a España, que inició en 1517 cuando salió de Gante para embarcar en Flesinga y emprender por mar la travesía hasta España, donde llegó a Asturias. Durante el verano de aquel año Carlos V disfrutó del paisaje de su tierra natal y recorrió durante el primer mes del otoño una parte de la cornisa cantábrica, desde Villaviciosa hasta San Vicente de la Barquera. Siguiendo el relato, se analizan y describen los paisajes que recorrió y las situaciones y sensaciones que vivió a lo largo del mencionado trayecto, tanto en sus territorios flamencos como en tierras españolas, a las que vino para ser proclamado como rey.Laurent Vital wrote the report of the first journey of Carlos V to Spain, that started in 1517 when he departed from Ghent to embark in Vlissingen and undertake through sea the crossing until Spain, arriving in Asturias. During that year’s summer, Carlos V enjoyed the landscape of his native land and roamed part of the Cantabric coast during the first month of that year’s Autumn , from Villaviciosa to San Vicente de la Barquera. In the story, the landscapes that he travelled through were analysed and described as well as the situations and feelings that he lived during the mentioned travel through his Flemish territories and Spanish grounds to which he became appointed as king.

  7. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers. (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José


    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.


    Directory of Open Access Journals (Sweden)

    Orzuza, Gloria Beatriz


    Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

  9. Primer Certamen Frenopático Español (1883: estructura asistencial y aspectos administrativos

    Directory of Open Access Journals (Sweden)

    Villasante Armas, Olga


    Full Text Available In the latter part of the XIX century, an important group of physicians worked in Nueva Belén, a Mental Hospital located near Barcelona. Juan Giné y Partagás, the Director of Nueva Belén and his colleagues undertook investigation, clinical and academic work. This group organized the most important scientific meeting on Psychiatry in the last century in Spain, although Psychiatry had not yet been recognized as an independent science. The present article describes the organization and contents of the "Primer Certamen Frenopático Español" using the original records. It is mainly focused on the Congress communications which deal with administrative and asistencial aspects of that time.

    En el último tercio del siglo XIX un grupo de profesionales de la Medicina trabajaba en Nueva-Belén, hospital psiquiátrico localizado en las proximidades de Barcelona. Juan Giné y Partagás, director de este manicomio, y sus colaboradores, realizaban una labor clínica, académica y de investigación. Fue este grupo el que organizó la reunión más importante sobre Psiquiatría que tuvo lugar en el pasado siglo en España, en un momento en el que la especialidad no era, aún, reconocida como una disciplina científica independiente del resto de la Medicina. El presente artículo describe la organización y contenidos del "Primer Certamen Frenopático Español" utilizando como material las actas originales del Congreso. Se centra en el análisis de las comunicaciones presentadas, cuyos contenidos temáticos son los aspectos administrativos y asistenciales de la frenopatología de la época.


    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani


    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  11. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

    NARCIS (Netherlands)

    Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.


    Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

  12. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants. (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da


    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari


    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  14. 454-Pyrosequencing analysis of bacterial communities from autotrophic nitrogen removal bioreactors utilizing universal primers : Effect of annealing temperature

    NARCIS (Netherlands)

    Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.


    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S

  15. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature. (United States)

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus


    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  16. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard


    Using a comparative approach, the web program PriFi ( designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  17. El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

    Directory of Open Access Journals (Sweden)

    Fernanda Martins Castro


    Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

  18. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla


    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  19. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi


    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  20. Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

    Directory of Open Access Journals (Sweden)

    Ana Paula Morales Cobra Carvalho


    Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.


    Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 Å in thickness) were deposited onto aluminum substrates (6111-T4 alloy) in radio frequency (RF) and microwave (MW) powered reactors to be used as primers for structural adhesive bonding. Processing variables such as sub...

  2. Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement. (United States)

    Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi


    We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

  3. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27. (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki


    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  4. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    Directory of Open Access Journals (Sweden)

    Alejandro Gonzalez-Martinez


    Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  5. Impedance evaluation of permeability and corrosion of Al-2024 aluminum alloy coated with a chromate free primer

    NARCIS (Netherlands)

    Foyet, A; Wu, T.H.; Kodentsov, A.; Ven, van der L.G.J.; With, de G.; Benthem, van R.A.T.M.


    The corrosion of AA-2024 aluminum alloy protected with a chromate free primer is investigated afterimmersion in a 0.5MNaCl aqueous solution. Thewater uptake by the coating increases continuouslywhenthe film, applied on an aluminum AA-2024 substrate, is placed in the 0.5MNaCl solution. This increase

  6. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira


    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  7. Differential transferability of EST-SSR primers developed from diploid species Pseudoroegneria spicata, Thinopyrum bessarabicum, and Th. elongatum (United States)

    Simple sequence repeat technology based on expressed sequence tag (EST-SSR) is a useful genomic tool for genome mapping, characterizing plant species relationships, elucidating genome evolution, and tracing genes on alien chromosome segments. EST-SSR primers developed from three perennial diploid T...

  8. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

    Directory of Open Access Journals (Sweden)

    Denilce Meneses Lopes


    Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  9. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae). (United States)

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia


    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  10. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer (United States)

    Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu


    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

  11. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods. (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N


    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  12. An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum (United States)

    Mendrek, M. J.


    A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

  13. A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer (United States)

    Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.


    The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

  14. Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

    Directory of Open Access Journals (Sweden)

    Anderson Pinheiro de Freitas


    Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

  15. Un análisis retrospectivo de cavernomatosis de la vena porta en Chile: II. Hemorragia, tratamiento y pronóstico


    Harris D., Paul; Brinck M., Patricio


    Objetivo: El tratamiento de la hipertensión portal de origen prehepático en niños es motivo de controversia. El objetivo de este estudio retrospectivo fue analizar la evolución, tratamiento y morbimortalidad de 34 niños con cavermomatosis de la vena porta. Pacientes y método: Se analizó la evolución antropométrica y hematológica, las características del sangramiento digestivo, el tratamiento médico, endoscópico y quirúrgico, y la morbimortalidad. Resultados: El 74% de los niños presentó uno o...

  16. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system. (United States)

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi


    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  17. NASA and ESA Collaboration on Hexavalent Chrome Alternatives - Pretreatments with Primers Screening Final Test Report (United States)

    Rothgeb, Matthew J.; Kessel, Kurt R.


    safety, while typically specifying that performance must be equal to or greater than existing systems. The overall objective of the collaborative effort between NASA TEERM and ESA is to test and evaluate coating systems (pretreatments, pretreatments with primer, and pretreatments with primer and topcoat) as replacements for hexavalent chrome coatings in aerospace applications. This objective will be accomplished by testing promising coatings identified from previous NASA, ESA, Department of Defense (DOD), and other project experience. Additionally, several new materials will be analyzed according to ESA-identified specifications.

  18. Quality assurance and quality control of geochemical data—A primer for the research scientist (United States)

    Geboy, Nicholas J.; Engle, Mark A.


    interpreting results. This primer has been developed to provide basic information and guidance about developing QA/QC protocols for geochemical studies. It is not intended to be a comprehensive guide but rather an introduction to key concepts tied to a list of relevant references for further reading. The guidelines are presented in stepwise order beginning with presampling considerations and continuing through final data interpretation. The goal of this primer is to outline basic QA/QC practices that scientists can use before, during, and after chemical analysis to ensure the validity of the data they collect with the goal of providing defendable results and conclusions.

  19. Control Basado en Eventos de Sistemas de Primer Orden Con Retardo

    Directory of Open Access Journals (Sweden)

    Ángel Ruiz


    Full Text Available Resumen: La teoría de control PID en su vertiente discreta, apoyándose en una gestión periódica de los muestreos (eventos planificados en tiempo se considera un área madura dentro del paradigma del control automático. Por el contrario, la planificación por eventos deriva, casi inevitablemente, en muestreos asíncronos planteando, problemas adicionales que necesitan ser caracterizados y estudiados. Bajo este escenario, aspectos como la sintonía de los controladores y las condiciones para la estabilidad global o la ausencia de ciclos límite siguen siendo temas que todavía están lejos de ser completamente resueltos. Con el trabajo actual se presenta un nuevo esquema de muestreo y control basado en eventos para sistemas de primer orden con retardo para el que se han analizado los aspectos anteriores. El esquema se basa en el Predictor de Smith para la compensación de los retardos, y en el algoritmo de muestreo SSOD (Symmetric Send- On-Delta para la generación de los eventos. En base a este esquema, se desarrolla el análisis de estabilidad y se propone una metodología de sintonía con una interpretación intuitiva y eficaz. Abstract: PID control theory based on periodic managing of samples has become a well-known area in automatic control. Asynchronous sampling inherent to event-based scheduling causes non-linear dynamics. Under this situation, complex problems arise that must be studied. Issues such as controller tuning, conditions for global stability and the absence of limit cycles are topics that are far from being fully solved yet. In this work, a new event-based scheme of sampling and control for FOPTD processes is presented. The scheme is based on the Smith Predictor structure for delay compensation and the SSOD (Symmetric-Send-On- Delta scheme for events generation. By means of the proposed scheme, a stability analysis is addressed and a simple tuning methodology with effective interpretation is proposed. Palabras clave

  20. Effectiveness of different adhesive primers on the bond strength between an indirect composite resin and a base metal alloy. (United States)

    Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos


    There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed

  1. Comparative evaluation of self-etching primers and phosphoric acid effectiveness on composite to enamel bond: an in vitro study. (United States)

    Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay


    The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.

  2. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  3. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam


    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  4. Solar energetic particles a modern primer on understanding sources, acceleration and propagation

    CERN Document Server

    Reames, Donald V


    This concise primer introduces the non-specialist reader to the physics of solar energetic particles (SEP) and systematically reviews the evidence for the two main mechanisms which lead to the so-called impulsive and gradual SEP events. More specifically, the timing of the onsets, the longitude distributions, the high-energy spectral shapes, the correlations with other solar phenomena (e.g. coronal mass ejections), as well as the all-important elemental and isotopic abundances of SEPs are investigated. Impulsive SEP events are related to magnetic reconnection in solar flares and jets. The concept of shock acceleration by scattering on self-amplified Alfvén waves is introduced, as is the evidence of reacceleration of impulsive-SEP material in the seed population accessed by the shocks in gradual events. The text then develops processes of transport of ions out to an observer. Finally, a new technique to determine the source plasma temperature in both impulsive and gradual events is demonstrated. Last but not ...

  5. Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia

    Directory of Open Access Journals (Sweden)

    Jhon Carlos Castaño


    Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.

  6. Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.

    Directory of Open Access Journals (Sweden)

    Jesse J Chen

    Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.

  7. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    Energy Technology Data Exchange (ETDEWEB)

    Naus, Dan J [ORNL


    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.

  8. Electrochemical investigation of powder coatings and their application to magnesium-rich primers for corrosion protection (United States)

    Orgon, Casey Roy

    Corrosion is the decomposition of metal and metal alloys which threatens the integrity of man-made structures. One of the more efficient methods of delaying the corrosion process in metals is by coatings. In this work, the durability of two polyester powder coatings were investigated for corrosion protection of AA-2024-T3. Polyester powder coatings crosslinked by either triglycidyl isocyanurate (TGIC) or beta-hydroxyalkyl amide (HAA) compounds were prepared and investigated for barrier protection of metal substrates by electrochemical impedance spectroscopy (EIS). Polyester-TGIC coatings were found to provide better long-term protection, which can be attributed to the increased mechanical strength and higher concentration of crosslinking in the coating films. Additionally, the polyester powder coatings, along with a fusion bonded epoxy (FBE) were investigated for their compatibility as a topcoat for magnesium-rich primers (MgRP). Under proper application conditions, powder topcoats were successfully applied to cured MgRP while corrosion protection mechanisms of each system were maintained.

  9. Empresas nanotecnológicas en México: hacia un primer inventario

    Directory of Open Access Journals (Sweden)

    Edgar Záyago Lau


    Full Text Available En este artículo presentamos un inventario inicial de compañías mexicanas que venden productos que son manufacturados a partir de nanotecnología, o que utilizan nanotecnología en sus operaciones. El inventario permite a los interesados identificar el número de empresas, su ubicación geográfica y los sectores industriales en los que se insertan. Esto es, de hecho, un primer acercamiento para el análisis los vínculos productivos de la nanotecnología en México. Los resultados muestran una alta concentración de empresas en dos estados: Nuevo León y la ciudad de México. Esto sucede en un contexto donde no hay una iniciativa nacional, ni una política pública específica ni datos disponibles públicamente o bases de datos que contienen información relevante.


    Directory of Open Access Journals (Sweden)

    A. E. Akay


    Full Text Available Primer transportation is one of the most costly and time consuming forestry activities in extraction of timber from forest lands. Transportation methods are essentially determined based on terrain characteristics, especially ground slope. Besides, unsuitable machine selection and unplanned operations may cause ecological damages such as soil disturbance. Soil damage can lead to long term impacts on forest ecosystem. Thus, the optimum transportation methods should be determined by considering not only economic factors but also topographical factors and soil conditions. In recent decades, some of the advanced features of Geographical Information System (GIS assist decision makers to solve such complex transportation problems with various constraints. In this study, it was aimed to plan forest transportation operation by using GIS integrated Analytical Hierarchy Process (AHP method, considering ground slope, soil type, and available transportation equipment in the region. This method was implemented within the border of İnegöl Forest Enterprise Chief in the city of Bursa in Turkey. Alternative transportation method included cable system, chute system, skidder, and farm tractor. GIS-based method integrated with AHP found that skidder was the optimal transportation method for about 60% of the study area, while farm tractor was the second most suitable method with 25% ground cover. The results indicated that GIS-based decision support systems can be effectively used as rational, quick, and economic tool for forest transportation planning.

  11. Metabarcoding Analysis of Phytophthora Diversity Using Genus-Specific Primers and 454 Pyrosequencing. (United States)

    Prigigallo, Maria I; Abdelfattah, Ahmed; Cacciola, Santa O; Faedda, Roberto; Sanzani, Simona M; Cooke, David E L; Schena, L


    A metabarcoding method based on genus-specific primers and 454 pyrosequencing was utilized to investigate the genetic diversity of Phytophthora spp. in soil and root samples of potted plants, from eight nurseries. Pyrosequencing enabled the detection of 25 Phytophthora phylotypes distributed in seven different clades and provided a much higher resolution than a corresponding cloning/Sanger sequencing approach. Eleven of these phylotypes, including P. cactorum, P. citricola s.str., P. palmivora, P. palmivora-like, P. megasperma or P. gonapodyides, P. ramorum, and five putative new Phytophthora species phylogenetically related to clades 1, 2, 4, 6, and 7 were detected only with the 454 pyrosequencing approach. We also found an additional 18 novel records of a phylotype in a particular nursery that were not detected with cloning/Sanger sequencing. Several aspects confirmed the reliability of the method: (i) many identical sequence types were identified independently in different nurseries, (ii) most sequence types identified with 454 pyrosequencing were identical to those from the cloning/Sanger sequencing approach and/or perfectly matched GenBank deposited sequences, and (iii) the divergence noted between sequence types of putative new Phytophthora species and all other detected sequences was sufficient to rule out sequencing errors. The proposed method represents a powerful tool to study Phytophthora diversity providing that particular attention is paid to the analysis of 454 pyrosequencing raw read sequences and to the identification of sequence types.

  12. Las relaciones entre Chile y Suecia durante el primer gobierno de Olof Palme, 1969-1976

    Directory of Open Access Journals (Sweden)

    Fernando Camacho Padilla


    Full Text Available Durante el primer gobierno del socialdemócrata Olof Palme, las relaciones bilaterales entre Chile y Suecia fueron las más intensas de toda su historia, tanto en cercanía como en conflictividad. La razón la encontramos en los distintos fenómenos políticos que vivió Chile en ese periodo, puesto que Palme coincidió temporalmente con tres gobiernos claramente diferenciados: la Democracia Cristiana, la Unidad Popular y el Régimen Militar. Si las relaciones sueco-chilenas tuvieron su mejor momento durante el mandato de Salvador Allende, el golpe de Estado significó todo lo contrario. El compromiso que tuvo el embajador de Suecia, Harald Edelstam, por quienes eran perseguidos en Chile le llevó a su expulsión, lo que se tradujo en un claro deterioro de las relaciones y el inicio de una nueva etapa marcada por el gran contingente de exiliados que comenzaron a llegar a Suecia. Este trabajo analiza los principales acontecimientos diplomáticos ocurridos entre Chile y Suecia así como las consecuencias que tuvieron durante el gobierno de Olof Palme.

  13. Primer registro de la cotorra argentina (Myiopsitta monachus en Chihuahua, México

    Directory of Open Access Journals (Sweden)

    Ricardo Abel Soto-Cruz


    Full Text Available Reportamos el primer registro de la cotorra argentina (Myiopsitta monachus en las ciudades de Chihuahua y Delicias en Chihuahua, México. Observamos cinco individuos de esta especie de junio a diciembre de 2011 en las instalaciones de la Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua; grupos de 2 a 12 individuos en el área urbana de la ciudad de Chihuahua durante 2012, y cuatro individuos en ciudad Delicias, a 80 km al sureste de la ciudad de Chihuahua, en el 2013. Previamente, en enero de 2011, se reportó, en el portal electrónico de aVerAves, el avistamiento de un individuo en el noroeste del estado. Dada la presencia de nidos activos en las ciudades de Chihuahua y Delicias, la especie podría estar ya establecida en esta parte del país. Recomendamos dar seguimiento a las poblaciones existentes de esta especie a fin de documentar los posibles riesgos a los ecosistemas en la región.

  14. Aut Caesar, aut nihil! La presencia de la romanitas en el primer escrito de Hegel

    Directory of Open Access Journals (Sweden)

    Valerio Rocco Lozano


    Full Text Available El rol conceptual desempeñado por el mundo romano en la obra de Hegel, y en concreto en los escritos dejuventud, constituye una dimensión necesaria no sólo para comprender su recepción de la cultura clásicay su reacción a determinados acontecimientos de la época, como la Revolución francesa, sino tambiénpara explicar su evolución política desde posiciones republicanas y francófi las hasta el pensamiento demadurez. La Unterredung zwischen Dreien, el primer texto de Hegel, infl uido por las lecturas juvenilesde Shakespeare, Schiller y Rousseau, y comprometido con los valores del republicanismo prerrevolucionario,es el más claro ejemplo de la importante presencia de las refl exiones sobre Roma en el autorde la Fenomenología.

  15. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers. (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos


    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  16. Real-time locating systems (RTLS) in healthcare: a condensed primer. (United States)

    Kamel Boulos, Maged N; Berry, Geoff


    Real-time locating systems (RTLS, also known as real-time location systems) have become an important component of many existing ubiquitous location aware systems. While GPS (global positioning system) has been quite successful as an outdoor real-time locating solution, it fails to repeat this success indoors. A number of RTLS technologies have been used to solve indoor tracking problems. The ability to accurately track the location of assets and individuals indoors has many applications in healthcare. This paper provides a condensed primer of RTLS in healthcare, briefly covering the many options and technologies that are involved, as well as the various possible applications of RTLS in healthcare facilities and their potential benefits, including capital expenditure reduction and workflow and patient throughput improvements. The key to a successful RTLS deployment lies in picking the right RTLS option(s) and solution(s) for the application(s) or problem(s) at hand. Where this application-technology match has not been carefully thought of, any technology will be doomed to failure or to achieving less than optimal results.

  17. Quality improvement primer part 1: Preparing for a quality improvement project in the emergency department. (United States)

    Chartier, Lucas B; Cheng, Amy H Y; Stang, Antonia S; Vaillancourt, Samuel


    Emergency medicine (EM) providers work in a fast-paced and often hectic environment that has a high risk for patient safety incidents and gaps in the quality of care. These challenges have resulted in opportunities for frontline EM providers to play a role in quality improvement (QI) projects. QI has developed into a mature field with methodologies that can dramatically improve the odds of having a successful project with a sustainable impact. However, this expertise is not yet commonly taught during professional training. In this first of three articles meant as a QI primer for EM clinicians, we will introduce QI methodology and strategic planning using a fictional case study as an example. We will review how to identify a QI problem, define components of an effective problem statement, and identify stakeholders and core change team members. We will also describe three techniques used to perform root cause analyses-Ishikawa diagrams, Pareto charts and process mapping-and how they relate to preparing for a QI project. The next two papers in this series will focus on the execution of the QI project itself using rapid-cycle testing and on the evaluation and sustainability of QI projects.

  18. Sexual health and religion: a primer for the sexual health clinician (CME). (United States)

    Kellogg Spadt, Susan; Rosenbaum, Talli Y; Dweck, Alyssa; Millheiser, Leah; Pillai-Friedman, Sabitha; Krychman, Michael


    Sexual health is an integral part of the multifaceted human experience that is driven both by biological factors and psychological facets. Religion may provide a moral code of conduct or a sexual compass as to sexual norms and behaviors. The aim of this study was to summarize the integration of sexuality and religion. A review of published literature and religious texts was conducted. The integration of religion with country or state politics and laws is a complicated dilemma and will not be discussed in the scope of this article. The extent to which an individual incorporates their religious doctrine into their sexual life is a personal and individualized choice. The sexual medicine health professional will likely encounter a diverse patient population of distinct religious backgrounds, and a primer on religion and sexuality is a much needed adjunctive tool for the clinician. Because religion can influence sexuality and dictate, in part, the behavioral and medical treatments for sexual complaints, the clinician should be familiar with religious guidelines regarding sexuality, and treatment should be customized and individualized. Failure to do so can impact compliance with the therapeutic interventions. Religious awareness also solidifies the therapeutic alliance between clinician and patient as it demonstrates respect and acknowledgment for patient's beliefs and autonomy. © 2014 International Society for Sexual Medicine.

  19. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    International Nuclear Information System (INIS)

    Naus, Dan J.


    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program

  20. Reseña del Primer Encuentro Internacional de Institutos de Medicina Tropical 2013

    Directory of Open Access Journals (Sweden)

    Jorge O Alarcón


    Full Text Available El Primer Encuentro Internacional de Institutos de Medicina Tropical, llevado a cabo en Lima, fue la actividad principal del cincuentenario de la fundación del Instituto de Medicina Tropical Daniel A. Carrión (1963-2013, de la Facultad de Medicina de la UNMSM. Participaron en su organización las principales instituciones científicas del país relacionadas a la investigación y atención de los problemas de salud que afectan a las regiones tropicales y subtropicales. Asistieron alrededor de mil personas. Los temas tratados fueron salud infantil en los trópicos, salud internacional, VIH/sida, dengue, malaria, leishmaniosis, tuberculosis, enfermedad de Carrión y enfermedades emergentes y reemergentes. Los representantes de los nueve institutos de Medicina Tropical de la región, asistentes al evento, suscribieron una declaración, en la que acordaron, entre otros puntos, promover en sus países las recomendaciones adoptadas en la Asamblea Mundial de la Salud y Organización Panamericana de la Salud en relación a enfermedades desatendidas, investigación en salud y recursos humanos en salud; desarrollar programas de posgrado regionales en medicina tropical, epidemiología y salud pública; articular las acciones de este encuentro con otras iniciativas regionales y subregionales, y realizar el Segundo Encuentro Internacional de Institutos de Medicina Tropical en dos años.