Mars Sample Return Landed with Red Dragon

Science.gov (United States)

Stoker, Carol R.; Lemke, Lawrence G.

2013-01-01

A Mars Sample Return (MSR) mission is the highest priority science mission for the next decade as recommended by the recent Decadal Survey of Planetary Science. However, an affordable program to carry this out has not been defined. This paper describes a study that examined use of emerging commercial capabilities to land the sample return elements, with the goal of reducing mission cost. A team at NASA Ames examined the feasibility of the following scenario for MSR: A Falcon Heavy launcher injects a SpaceX Dragon crew capsule and trunk onto a Trans Mars Injection trajectory. The capsule is modified to carry all the hardware needed to return samples collected on Mars including a Mars Ascent Vehicle (MAV), an Earth Return Vehicle (ERV) and Sample Collection and Storage hardware. The Dragon descends to land on the surface of Mars using SuperSonic Retro Propulsion (SSRP) as described by Braun and Manning [IEEEAC paper 0076, 2005]. Samples are acquired and deliverd to the MAV by a prelanded asset, possibly the proposed 2020 rover. After samples are obtained and stored in the ERV, the MAV launches the sample-containing ERV from the surface of Mars. We examined cases where the ERV is delivered to either low Mars orbit (LMO), C3 = 0 (Mars escape), or an intermediate energy state. The ERV then provides the rest of the energy (delta V) required to perform trans-Earth injection (TEI), cruise, and insertion into a Moon-trailing Earth Orbit (MTEO). A later mission, possibly a crewed Dragon launched by a Falcon Heavy (not part of the current study) retrieves the sample container, packages the sample, and performs a controlled Earth re-entry to prevent Mars materials from accidentally contaminating Earth. The key analysis methods used in the study employed a set of parametric mass estimating relationships (MERs) and standard aerospace analysis software codes modified for the MAV class of launch vehicle to determine the range of performance parameters that produced converged

Mars Sample Return: Mars Ascent Vehicle Mission and Technology Requirements

Science.gov (United States)

Bowles, Jeffrey V.; Huynh, Loc C.; Hawke, Veronica M.; Jiang, Xun J.

2013-01-01

A Mars Sample Return mission is the highest priority science mission for the next decade recommended by the recent Decadal Survey of Planetary Science, the key community input process that guides NASAs science missions. A feasibility study was conducted of a potentially simple and low cost approach to Mars Sample Return mission enabled by the use of developing commercial capabilities. Previous studies of MSR have shown that landing an all up sample return mission with a high mass capacity lander is a cost effective approach. The approach proposed is the use of an emerging commercially available capsule to land the launch vehicle system that would return samples to Earth. This paper describes the mission and technology requirements impact on the launch vehicle system design, referred to as the Mars Ascent Vehicle (MAV).

Mars Sample Return Architecture Assessment Study

Science.gov (United States)

Centuori, S.; Hermosín, P.; Martín, J.; De Zaiacomo, G.; Colin, S.; Godfrey, A.; Myles, J.; Johnson, H.; Sachdev, T.; Ahmed, R.

2018-04-01

Current paper presents the results of ESA funded activity "Mars Sample Return Architecture Assessment Study" carried-out by DEIMOS Space, Lockheed Martin UK Ampthill, and MDA Corporation, where more than 500 mission design options have been studied.

Multiple Smaller Missions as a Direct Pathway to Mars Sample Return

Science.gov (United States)

Niles, P. B.; Draper, D. S.; Evans, C. A.; Gibson, E. K.; Graham, L. D.; Jones, J. H.; Lederer, S. M.; Ming, D.; Seaman, C. H.; Archer, P. D.;

Poor Man's Asteroid Sample Return Missions

Science.gov (United States)

Landis, R. R.; Graham, L. D.

2018-02-01

A cislunar platform at a Near-Rectilinear [Halo] Orbit in the vicinity of the Moon could provide an opportunity for a small NEA sample return mission at relatively low cost. There are a couple potential small ( 1m) object target dynamical groups.

International cooperation for Mars exploration and sample return

Science.gov (United States)

Levy, Eugene H.; Boynton, William V.; Cameron, A. G. W.; Carr, Michael H.; Kitchell, Jennifer H.; Mazur, Peter; Pace, Norman R.; Prinn, Ronald G.; Solomon, Sean C.; Wasserburg, Gerald J.

1990-01-01

The National Research Council's Space Studies Board has previously recommended that the next major phase of Mars exploration for the United States involve detailed in situ investigations of the surface of Mars and the return to earth for laboratory analysis of selected Martian surface samples. More recently, the European space science community has expressed general interest in the concept of cooperative Mars exploration and sample return. The USSR has now announced plans for a program of Mars exploration incorporating international cooperation. If the opportunity becomes available to participate in Mars exploration, interest is likely to emerge on the part of a number of other countries, such as Japan and Canada. The Space Studies Board's Committee on Cooperative Mars Exploration and Sample Return was asked by the National Aeronautics and Space Administration (NASA) to examine and report on the question of how Mars sample return missions might best be structured for effective implementation by NASA along with international partners. The committee examined alternatives ranging from scientific missions in which the United States would take a substantial lead, with international participation playing only an ancillary role, to missions in which international cooperation would be a basic part of the approach, with the international partners taking on comparably large mission responsibilities. On the basis of scientific strategies developed earlier by the Space Studies Board, the committee considered the scientific and technical basis of such collaboration and the most mutually beneficial arrangements for constructing successful cooperative missions, particularly with the USSR.

COMPASS Final Report: Near Earth Asteroids Rendezvous and Sample Earth Returns (NEARER)

Science.gov (United States)

Oleson, Steven R.; McGuire, Melissa L.

2009-01-01

In this study, the Collaborative Modeling for Parametric Assessment of Space Systems (COMPASS) team completed a design for a multi-asteroid (Nereus and 1996 FG3) sample return capable spacecraft for the NASA In-Space Propulsion Office. The objective of the study was to support technology development and assess the relative benefits of different electric propulsion systems on asteroid sample return design. The design uses a single, heritage Orion solar array (SA) (approx.6.5 kW at 1 AU) to power a single NASA Evolutionary Xenon Thruster ((NEXT) a spare NEXT is carried) to propel a lander to two near Earth asteroids. After landing and gathering science samples, the Solar Electric Propulsion (SEP) vehicle spirals back to Earth where it drops off the first sample s return capsule and performs an Earth flyby to assist the craft in rendezvousing with a second asteroid, which is then sampled. The second sample is returned in a similar fashion. The vehicle, dubbed Near Earth Asteroids Rendezvous and Sample Earth Returns (NEARER), easily fits in an Atlas 401 launcher and its cost estimates put the mission in the New Frontier s (NF's) class mission.

Mars Sample Return: Do Australians trust NASA?

Science.gov (United States)

Joyce, S.; Tomkins, C. S.; Weinstein, P.

2008-09-01

Mars Sample Return (MSR) represents an important scientific goal in space exploration. Any sample return mission will be extremely challenging from a scientific, economic and technical standpoint. But equally testing, will be communicating with a public that may have a very different perception of the mission. A MSR mission will generate international publicity and it is vital that NASA acknowledge the nature and extent of public concern about the mission risks and, perhaps equally importantly, the public’s confidence in NASA’s ability to prepare for and manage these risks. This study investigated the level of trust in NASA in an Australian population sample, and whether this trust was dependent on demographic variables. Participants completed an online survey that explored their attitudes towards NASA and a MSR mission. The results suggested that people believe NASA will complete the mission successfully but have doubts as to whether NASA will be honest when communicating with the public. The most significant finding to emerge from this study was that confidence in NASA was significantly (p communication.

Mars Sample Return Using Solar Sail Propulsion

Science.gov (United States)

Johnson, Les; Macdonald, Malcolm; Mcinnes, Colin; Percy, Tom

2012-01-01

Many Mars Sample Return (MSR) architecture studies have been conducted over the years. A key element of them is the Earth Return Stage (ERS) whose objective is to obtain the sample from the Mars Ascent Vehicle (MAV) and return it safely to the surface of the Earth. ERS designs predominantly use chemical propulsion [1], incurring a significant launch mass penalty due to the low specific impulse of such systems coupled with the launch mass sensitivity to returned mass. It is proposed to use solar sail propulsion for the ERS, providing a high (effective) specific impulse propulsion system in the final stage of the multi-stage system. By doing so to the launch mass of the orbiter mission can be significantly reduced and hence potentially decreasing mission cost. Further, solar sailing offers a unique set of non-Keplerian low thrust trajectories that may enable modifications to the current approach to designing the Earth Entry Vehicle by potentially reducing the Earth arrival velocity. This modification will further decrease the mass of the orbiter system. Solar sail propulsion uses sunlight to propel vehicles through space by reflecting solar photons from a large, mirror-like surface made of a lightweight, reflective material. The continuous photonic pressure provides propellantless thrust to conduct orbital maneuvering and plane changes more efficiently than conventional chemical propulsion. Because the Sun supplies the necessary propulsive energy, solar sails require no onboard propellant, thus reducing system mass. This technology is currently at TRL 7/8 as demonstrated by the 2010 flight of the Japanese Aerospace Exploration Agency, JAXA, IKAROS mission. [2

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

Advanced Curation: Solving Current and Future Sample Return Problems

Science.gov (United States)

Fries, M.; Calaway, M.; Evans, C.; McCubbin, F.

2015-01-01

Advanced Curation is a wide-ranging and comprehensive research and development effort at NASA Johnson Space Center that identifies and remediates sample related issues. For current collections, Advanced Curation investigates new cleaning, verification, and analytical techniques to assess their suitability for improving curation processes. Specific needs are also assessed for future sample return missions. For each need, a written plan is drawn up to achieve the requirement. The plan draws while upon current Curation practices, input from Curators, the analytical expertise of the Astromaterials Research and Exploration Science (ARES) team, and suitable standards maintained by ISO, IEST, NIST and other institutions. Additionally, new technologies are adopted on the bases of need and availability. Implementation plans are tested using customized trial programs with statistically robust courses of measurement, and are iterated if necessary until an implementable protocol is established. Upcoming and potential NASA missions such as OSIRIS-REx, the Asteroid Retrieval Mission (ARM), sample return missions in the New Frontiers program, and Mars sample return (MSR) all feature new difficulties and specialized sample handling requirements. The Mars 2020 mission in particular poses a suite of challenges since the mission will cache martian samples for possible return to Earth. In anticipation of future MSR, the following problems are among those under investigation: What is the most efficient means to achieve the less than 1.0 ng/sq cm total organic carbon (TOC) cleanliness required for all sample handling hardware? How do we maintain and verify cleanliness at this level? The Mars 2020 Organic Contamination Panel (OCP) predicts that organic carbon, if present, will be present at the "one to tens" of ppb level in martian near-surface samples. The same samples will likely contain wt% perchlorate salts, or approximately 1,000,000x as much perchlorate oxidizer as organic carbon

X-Ray Computed Tomography: The First Step in Mars Sample Return Processing

Science.gov (United States)

Welzenbach, L. C.; Fries, M. D.; Grady, M. M.; Greenwood, R. C.; McCubbin, F. M.; Zeigler, R. A.; Smith, C. L.; Steele, A.

2017-01-01

The Mars 2020 rover mission will collect and cache samples from the martian surface for possible retrieval and subsequent return to Earth. If the samples are returned, that mission would likely present an opportunity to analyze returned Mars samples within a geologic context on Mars. In addition, it may provide definitive information about the existence of past or present life on Mars. Mars sample return presents unique challenges for the collection, containment, transport, curation and processing of samples [1] Foremost in the processing of returned samples are the closely paired considerations of life detection and Planetary Protection. In order to achieve Mars Sample Return (MSR) science goals, reliable analyses will depend on overcoming some challenging signal/noise-related issues where sparse martian organic compounds must be reliably analyzed against the contamination background. While reliable analyses will depend on initial clean acquisition and robust documentation of all aspects of developing and managing the cache [2], there needs to be a reliable sample handling and analysis procedure that accounts for a variety of materials which may or may not contain evidence of past or present martian life. A recent report [3] suggests that a defined set of measurements should be made to effectively inform both science and Planetary Protection, when applied in the context of the two competing null hypotheses: 1) that there is no detectable life in the samples; or 2) that there is martian life in the samples. The defined measurements would include a phased approach that would be accepted by the community to preserve the bulk of the material, but provide unambiguous science data that can be used and interpreted by various disciplines. Fore-most is the concern that the initial steps would ensure the pristine nature of the samples. Preliminary, non-invasive techniques such as computed X-ray tomography (XCT) have been suggested as the first method to interrogate and

Communications Relay and Human-Assisted Sample Return from the Deep Space Gateway

Science.gov (United States)

Cichan, T.; Hopkins, J. B.; Bierhaus, B.; Murrow, D. W.

2018-02-01

The Deep Space Gateway can enable or enhance exploration of the lunar surface through two capabilities: 1. communications relay, opening up access to the lunar farside, and 2. sample return, enhancing the ability to return large sample masses.

An Internationally Coordinated Science Management Plan for Samples Returned from Mars

Science.gov (United States)

Haltigin, T.; Smith, C. L.

2015-12-01

Mars Sample Return (MSR) remains a high priority of the planetary exploration community. Such an effort will undoubtedly be too large for any individual agency to conduct itself, and thus will require extensive global cooperation. To help prepare for an eventual MSR campaign, the International Mars Exploration Working Group (IMEWG) chartered the international Mars Architecture for the Return of Samples (iMARS) Phase II working group in 2014, consisting of representatives from 17 countries and agencies. The overarching task of the team was to provide recommendations for progressing towards campaign implementation, including a proposed science management plan. Building upon the iMARS Phase I (2008) outcomes, the Phase II team proposed the development of an International MSR Science Institute as part of the campaign governance, centering its deliberations around four themes: Organization: including an organizational structure for the Institute that outlines roles and responsibilities of key members and describes sample return facility requirements; Management: presenting issues surrounding scientific leadership, defining guidelines and assumptions for Institute membership, and proposing a possible funding model; Operations & Data: outlining a science implementation plan that details the preliminary sample examination flow, sample allocation process, and data policies; and Curation: introducing a sample curation plan that comprises sample tracking and routing procedures, sample sterilization considerations, and long-term archiving recommendations. This work presents a summary of the group's activities, findings, and recommendations, highlighting the role of international coordination in managing the returned samples.

Sample Curation in Support of the OSIRIS-REx Asteroid Sample Return Mission

Science.gov (United States)

Righter, Kevin; Nakamura-Messenger, Keiko

2017-01-01

The OSIRIS-REx asteroid sample return mission launched to asteroid Bennu Sept. 8, 2016. The spacecraft will arrive at Bennu in late 2019, orbit and map the asteroid, and perform a touch and go (TAG) sampling maneuver in July 2020. After sample is stowed and confirmed the spacecraft will return to Earth, and the sample return capsule (SRC) will land in Utah in September 2023. Samples will be recovered from Utah [2] and then transported and stored in a new sample cleanroom at NASA Johnson Space Center in Houston [3]. The materials curated for the mission are described here. a) Materials Archive and Witness Plate Collection: The SRC and TAGSAM were built between March 2014 and Summer of 2015, and instruments (OTES,OVIRS, OLA, OCAMS, REXIS) were integrated from Summer 2015 until May 2016. A total of 395 items were received for the materials archive at NASA-JSC, with archiving finishing 30 days after launch (with the final archived items being related to launch operations)[4]. The materials fall into several general categories including metals (stainless steel, aluminum, titanium alloys, brass and BeCu alloy), epoxies, paints, polymers, lubricants, non-volatile-residue samples (NVR), sapphire, and various miscellaneous materials. All through the ATLO process (from March 2015 until late August 2016) contamination knowledge witness plates (Si wafer and Al foil) were deployed in the various cleanrooms in Denver and KSC to provide an additional record of particle counts and volatiles that is archived for current and future scientific studies. These plates were deployed in roughly monthly increments with each unit containing 4 Si wafers and 4 Al foils. We archived 128 individual witness plates (64 Si wafers and 64 Al foils); one of each witness plate (Si and Al) was analyzed immediately by the science team after archiving, while the remaining 3 of each are archived indefinitely. Information about each material archived is stored in an extensive database at NASA-JSC, and key

OSIRIS-REx: Sample Return from Asteroid (101955) Bennu

Science.gov (United States)

Lauretta, D. S.; Balram-Knutson, S. S.; Beshore, E.; Boynton, W. V.; Drouet d'Aubigny, C.; DellaGiustina, D. N.; Enos, H. L.; Golish, D. R.; Hergenrother, C. W.; Howell, E. S.; Bennett, C. A.; Morton, E. T.; Nolan, M. C.; Rizk, B.; Roper, H. L.; Bartels, A. E.; Bos, B. J.; Dworkin, J. P.; Highsmith, D. E.; Lorenz, D. A.; Lim, L. F.; Mink, R.; Moreau, M. C.; Nuth, J. A.; Reuter, D. C.; Simon, A. A.; Bierhaus, E. B.; Bryan, B. H.; Ballouz, R.; Barnouin, O. S.; Binzel, R. P.; Bottke, W. F.; Hamilton, V. E.; Walsh, K. J.; Chesley, S. R.; Christensen, P. R.; Clark, B. E.; Connolly, H. C.; Crombie, M. K.; Daly, M. G.; Emery, J. P.; McCoy, T. J.; McMahon, J. W.; Scheeres, D. J.; Messenger, S.; Nakamura-Messenger, K.; Righter, K.; Sandford, S. A.

2017-10-01

In May of 2011, NASA selected the Origins, Spectral Interpretation, Resource Identification, and Security- Regolith Explorer (OSIRIS-REx) asteroid sample return mission as the third mission in the New Frontiers program. The other two New Frontiers missions are New Horizons, which explored Pluto during a flyby in July 2015 and is on its way for a flyby of Kuiper Belt object 2014 MU69 on January 1, 2019, and Juno, an orbiting mission that is studying the origin, evolution, and internal structure of Jupiter. The spacecraft departed for near-Earth asteroid (101955) Bennu aboard an United Launch Alliance Atlas V 411 evolved expendable launch vehicle at 7:05 p.m. EDT on September 8, 2016, on a seven-year journey to return samples from Bennu. The spacecraft is on an outbound-cruise trajectory that will result in a rendezvous with Bennu in November 2018. The science instruments on the spacecraft will survey Bennu to measure its physical, geological, and chemical properties, and the team will use these data to select a site on the surface to collect at least 60 g of asteroid regolith. The team will also analyze the remote-sensing data to perform a detailed study of the sample site for context, assess Bennu's resource potential, refine estimates of its impact probability with Earth, and provide ground-truth data for the extensive astronomical data set collected on this asteroid. The spacecraft will leave Bennu in 2021 and return the sample to the Utah Test and Training Range (UTTR) on September 24, 2023.

An integrated and accessible sample data library for Mars sample return science

Science.gov (United States)

Tuite, M. L., Jr.; Williford, K. H.

2015-12-01

Over the course of the next decade or more, many thousands of geological samples will be collected and analyzed in a variety of ways by researchers at the Jet Propulsion Laboratory (California Institute of Technology) in order to facilitate discovery and contextualize observations made of Mars rocks both in situ and here on Earth if samples are eventually returned. Integration of data from multiple analyses of samples including petrography, thin section and SEM imaging, isotope and organic geochemistry, XRF, XRD, and Raman spectrometry is a challenge and a potential obstacle to discoveries that require supporting lines of evidence. We report the development of a web-accessible repository, the Sample Data Library (SDL) for the sample-based data that are generated by the laboratories and instruments that comprise JPL's Center for Analysis of Returned Samples (CARS) in order to facilitate collaborative interpretation of potential biosignatures in Mars-analog geological samples. The SDL is constructed using low-cost, open-standards-based Amazon Web Services (AWS), including web-accessible storage, relational data base services, and a virtual web server. The data structure is sample-centered with a shared registry for assigning unique identifiers to all samples including International Geo-Sample Numbers. Both raw and derived data produced by instruments and post-processing workflows are automatically uploaded to online storage and linked via the unique identifiers. Through the web interface, users are able to find all the analyses associated with a single sample or search across features shared by multiple samples, sample localities, and analysis types. Planned features include more sophisticated search and analytical interfaces as well as data discoverability through NSF's EarthCube program.

Carbon Isotopic Ratios of Amino Acids in Stardust-Returned Samples

Science.gov (United States)

Elsila, Jamie E.; Glavin, Daniel P.; Dworkin, Jason P.

2009-01-01

NASA's Stardust spacecraft returned to Earth samples from comet 81P/Wild 2 in January 2006. Preliminary examinations revealed the presence of a suite of organic compounds including several amines and amino acids, but the origin of these compounds could not be identified. Here. we present the carbon isotopic ratios of glycine and E-aminocaproic acid (EACH), the two most abundant amino acids observed, in Stardust-returned foil samples measured by gas chromatography-combustion-isotope ratio crass spectrometry coupled with quadrupole mass spectrometry (GC-QMS/IRMS).

Technology Development and Advanced Planning for Curation of Returned Mars Samples

Science.gov (United States)

Lindstrom, David J.; Allen, Carlton C.

2002-01-01

NASA Johnson Space Center (JSC) curates extraterrestrial samples, providing the international science community with lunar rock and soil returned by the Apollo astronauts, meteorites collected in Antarctica, cosmic dust collected in the stratosphere, and hardware exposed to the space environment. Curation comprises initial characterization of new samples, preparation and allocation of samples for research, and clean, secure long-term storage. The foundations of this effort are the specialized cleanrooms (class 10 to 10,000) for each of the four types of materials, the supporting facilities, and the people, many of whom have been doing detailed work in clean environments for decades. JSC is also preparing to curate the next generation of extraterrestrial samples. These include samples collected from the solar wind, a comet, and an asteroid. Early planning and R\\&D are underway to support post-mission sample handling and curation of samples returned from Mars. One of the strong scientific reasons for returning samples from Mars is to search for evidence of current or past life in the samples. Because of the remote possibility that the samples may contain life forms that are hazardous to the terrestrial biosphere, the National Research Council has recommended that all samples returned from Mars be kept under strict biological containment until tests show that they can safely be released to other laboratories. It is possible that Mars samples may contain only scarce or subtle traces of life or prebiotic chemistry that could readily be overwhelmed by terrestrial contamination . Thus, the facilities used to contain, process, and analyze samples from Mars must have a combination of high-level biocontainment and organic / inorganic chemical cleanliness that is unprecedented. JSC has been conducting feasibility studies and developing designs for a sample receiving facility that would offer biocontainment at least the equivalent of current maximum containment BSL-4 (Bio

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Advances in Astromaterials Curation: Supporting Future Sample Return Missions

Science.gov (United States)

Evans, C. A.; Zeigler, R. A.; Fries, M. D..; Righter, K.; Allton, J. H.; Zolensky, M. E.; Calaway, M. J.; Bell, M. S.

2015-01-01

NASA's Astromaterials, curated at the Johnson Space Center in Houston, are the most extensive, best-documented, and leastcontaminated extraterrestrial samples that are provided to the worldwide research community. These samples include lunar samples from the Apollo missions, meteorites collected over nearly 40 years of expeditions to Antarctica (providing samples of dozens of asteroid bodies, the Moon, and Mars), Genesis solar wind samples, cosmic dust collected by NASA's high altitude airplanes, Comet Wild 2 and interstellar dust samples from the Stardust mission, and asteroid samples from JAXA's Hayabusa mission. A full account of NASA's curation efforts for these collections is provided by Allen, et al [1]. On average, we annually allocate about 1500 individual samples from NASA's astromaterials collections to hundreds of researchers from around the world, including graduate students and post-doctoral scientists; our allocation rate has roughly doubled over the past 10 years. The curation protocols developed for the lunar samples returned from the Apollo missions remain relevant and are adapted to new and future missions. Several lessons from the Apollo missions, including the need for early involvement of curation scientists in mission planning [1], have been applied to all subsequent sample return campaigns. From the 2013 National Academy of Sciences report [2]: "Curation is the critical interface between sample return missions and laboratory research. Proper curation has maintained the scientific integrity and utility of the Apollo, Antarctic meteorite, and cosmic dust collections for decades. Each of these collections continues to yield important new science. In the past decade, new state-of-the-art curatorial facilities for the Genesis and Stardust missions were key to the scientific breakthroughs provided by these missions." The results speak for themselves: research on NASA's astromaterials result in hundreds of papers annually, yield fundamental

A Review of New and Developing Technology to Significantly Improve Mars Sample-Return Missions

Science.gov (United States)

Carsey, F.; Brophy, J.; Gilmore, M.; Rodgers, D.; Wilcox, B.

2000-07-01

A JPL development activity was initiated in FY 1999 for the purpose of examining and evaluating technologies that could materially improve future (i.e., beyond the 2005 launch) Mars sample return missions. The scope of the technology review was comprehensive and end-to-end; the goal was to improve mass, cost, risk, and scientific return. A specific objective was to assess approaches to sample return with only one Earth launch. While the objective of the study was specifically for sample-return, in-situ missions can also benefit from using many of the technologies examined.

Sample Return Mission to the South Pole Aitken Basin

Science.gov (United States)

Duke, M. B.; Clark, B. C.; Gamber, T.; Lucey, P. G.; Ryder, G.; Taylor, G. J.

1999-01-01

The South Pole Aitken Basin (SPA) is the largest and oldest observed feature on the Moon. Compositional and topographic data from Galileo, Clementine, and Lunar Prospector have demonstrated that SPA represents a distinctive major lunar terrane, which has not been sampled either by sample return missions (Apollo, Luna) or by lunar meteorites. The floor of SPA is characterized by mafic compositions enriched in Fe, Ti, and Th in comparison to its surroundings. This composition may represent melt rocks from the SPA event, which would be mixtures of the preexisting crust and mantle rocks. However, the Fe content is higher than expected, and the large Apollo basin, within SPA, exposes deeper material with lower iron content. Some of the Fe enrichment may represent mare and cryptomare deposits. No model adequately accounts for all of the characteristics of the SPA and disagreements are fundamental. Is mantle material exposed or contained as fragments in melt rock and breccias? If impact melt is present, did the vast sheet differentiate? Was the initial mantle and crust compositionally different from other regions of the Moon? Was the impact event somehow peculiar, (e.g., a low-velocity impact)? The precise time of formation of the SPA is unknown, being limited only by the initial differentiation of the Moon and the age of the Imbrium event, believed to be 3.9 b.y. The questions raised by the SPA can be addressed only with detailed sample analysis. Analysis of the melt rocks, fragments in breccias, and basalts of SPA can address several highly significant problems for the Moon and the history of the solar system. The time of formation of SPA, based on analysis of melt rocks formed in the event. would put limits on the period of intense bombardment of the Moon, which has been inferred by some to include a "terminal cataclysm." If close to 3.9 Ga, the presumed age of the Imbrium Basin, the SPA date would confirm the lunar cataclysm. This episode, if it occurred, would have

Spatial Mapping of Organic Carbon in Returned Samples from Mars

Science.gov (United States)

Siljeström, S.; Fornaro, T.; Greenwalt, D.; Steele, A.

2018-04-01

To map organic material spatially to minerals present in the sample will be essential for the understanding of the origin of any organics in returned samples from Mars. It will be shown how ToF-SIMS may be used to map organics in samples from Mars.

Catching Stardust and Bringing it Home: The Astronomical Importance of Sample Return

Science.gov (United States)

Brownlee, D.

2002-12-01

The return of lunar samples by the Apollo program provided the first opportunity to perform detailed laboratory studies of ancient solid materials from a known astronomical body. The highly detailed study of the samples, using the best available laboratory instruments and techniques, revolutionized our understanding of the Moon and provided fundamental insight into the remarkable and violent processes that occur early in the history of moons and terrestrial planets. This type of astronomical paleontology is only possible with samples and yet the last US sample return was made by Apollo 17- over thirty years ago! The NASA Stardust mission, began a new era of sample missions with its 1999 launch to retrieve samples from the short period comet Wild 2. Genesis (a solar wind collector) was launched in 2001, the Japanese MUSES-C asteroid sample return mission will launch in 2003 and Mars sample return missions are under study. All of these missions will use sophisticated ground-based instrumentation to provide types of information that cannot be obtained by astronomical and spacecraft remote sensing methods. In the case of Stardust, the goal is to determine the fundamental nature of the initial solid building blocks of solar systems at atomic-scale spatial resolution. The samples returned by the mission will be samples from the Kuiper Belt region and they are probably composed of submicron silicate and organic materials of both presolar and nebular origin. Unlocking the detailed records contained in the elemental, chemical, isotopic and mineralogical composition of these tiny components can only be appropriately explored with full power, precision and flexibility of laboratory instrumentation. Laboratory instrumentation has the advantage that is state-of-the-art and is not limited by serious considerations of power, mass, cost or even reliability. The comparison of the comet sample, accumulated beyond Neptune, with asteroidal meteorites that accumulated just beyond the

Mars Sample Return - Launch and Detection Strategies for Orbital Rendezvous

Science.gov (United States)

Woolley, Ryan C.; Mattingly, Richard L.; Riedel, Joseph E.; Sturm, Erick J.

2011-01-01

This study sets forth conceptual mission design strategies for the ascent and rendezvous phase of the proposed NASA/ESA joint Mars Sample Return Campaign. The current notional mission architecture calls for the launch of an acquisition/cache rover in 2018, an orbiter with an Earth return vehicle in 2022, and a fetch rover and ascent vehicle in 2024. Strategies are presented to launch the sample into a coplanar orbit with the Orbiter which facilitate robust optical detection, orbit determination, and rendezvous. Repeating ground track orbits exist at 457 and 572 km which provide multiple launch opportunities with similar geometries for detection and rendezvous.

Mars Sample Return: Launch and Detection Strategies for Orbital Rendezvous

Science.gov (United States)

Woolley, Ryan C.; Mattingly, Richard L.; Riedel, Joseph E.; Sturm, Erick J.

2011-01-01

This study sets forth conceptual mission design strategies for the ascent and rendezvous phase of the proposed NASA/ESA joint Mars Sample Return Campaign. The current notional mission architecture calls for the launch of an acquisition/ caching rover in 2018, an Earth return orbiter in 2022, and a fetch rover with ascent vehicle in 2024. Strategies are presented to launch the sample into a nearly coplanar orbit with the Orbiter which would facilitate robust optical detection, orbit determination, and rendezvous. Repeating ground track orbits existat 457 and 572 km which would provide multiple launch opportunities with similar geometries for detection and rendezvous.

A core handling device for the Mars Sample Return Mission

Science.gov (United States)

Gwynne, Owen

1989-01-01

A core handling device for use on Mars is being designed. To provide a context for the design study, it was assumed that a Mars Rover/Sample Return (MRSR) Mission would have the following characteristics: a year or more in length; visits by the rover to 50 or more sites; 100 or more meter-long cores being drilled by the rover; and the capability of returning about 5 kg of Mars regolith to Earth. These characteristics lead to the belief that in order to bring back a variegated set of samples that can address the range of scientific objetives for a MRSR mission to Mars there needs to be considerable analysis done on board the rover. Furthermore, the discrepancy between the amount of sample gathered and the amount to be returned suggests that there needs to be some method of choosing the optimal set of samples. This type of analysis will require pristine material-unaltered by the drilling process. Since the core drill thermally and mechanically alters the outer diameter (about 10 pct) of the core sample, this outer area cannot be used. The primary function of the core handling device is to extract subsamples from the core and to position these subsamples, and the core itself if needed, with respect to the various analytical instruments that can be used to perform these analyses.

Potential High Priority Subaerial Environments for Mars Sample Return

Science.gov (United States)

iMOST Team; Bishop, J. L.; Horgan, B.; Benning, L. G.; Carrier, B. L.; Hausrath, E. M.; Altieri, F.; Amelin, Y.; Ammannito, E.; Anand, M.; Beaty, D. W.; Borg, L. E.; Boucher, D.; Brucato, J. R.; Busemann, H.; Campbell, K. A.; Czaja, A. D.; Debaille, V.; Des Marais, D. J.; Dixon, M.; Ehlmann, B. L.; Farmer, J. D.; Fernandez-Remolar, D. C.; Fogarty, J.; Glavin, D. P.; Goreva, Y. S.; Grady, M. M.; Hallis, L. J.; Harrington, A. D.; Herd, C. D. K.; Humayun, M.; Kleine, T.; Kleinhenz, J.; Mangold, N.; Mackelprang, R.; Mayhew, L. E.; McCubbin, F. M.; Mccoy, J. T.; McLennan, S. M.; McSween, H. Y.; Moser, D. E.; Moynier, F.; Mustard, J. F.; Niles, P. B.; Ori, G. G.; Raulin, F.; Rettberg, P.; Rucker, M. A.; Schmitz, N.; Sefton-Nash, E.; Sephton, M. A.; Shaheen, R.; Shuster, D. L.; Siljestrom, S.; Smith, C. L.; Spry, J. A.; Steele, A.; Swindle, T. D.; ten Kate, I. L.; Tosca, N. J.; Usui, T.; Van Kranendonk, M. J.; Wadhwa, M.; Weiss, B. P.; Werner, S. C.; Westall, F.; Wheeler, R. M.; Zipfel, J.; Zorzano, M. P.

2018-04-01

The highest priority subaerial environments for Mars Sample Return include subaerial weathering (paleosols, periglacial/glacial, and rock coatings/rinds), wetlands (mineral precipitates, redox environments, and salt ponds), or cold spring settings.

Electron Spin Resonance (ESR) studies of returned comet nucleus samples

International Nuclear Information System (INIS)

Tsay, Fundow; Kim, S.S.; Liang, R.H.

1989-01-01

The most important objective of the Comet Nucleus Sample Returm Mission is to return samples which could reflect formation conditions and evolutionary processes in the early solar nebula. It is expected that the returned samples will consist of fine-grained silicate materials mixed with ices composed of simple molecules such as H 2 O, NH 3 , CH 4 as well as organics and/or more complex compounds. Because of the exposure to ionizing radiation from cosmic-ray, gamma-ray, and solar wind protons at low temperature, free radicals are expected to be formed and trapped in the solid ice matrices. The kind of trapped radical species together with their concentration and thermal stability can be used as a dosimeter as well as a geothermometer to determine thermal and radiation histories as well as outgassing and other possible alternation effects since the nucleus material was formed. Since free radicals that are known to contain unpaired electrons are all paramagnetic in nature, they can be readily detected and characterized in their native form by the Electron Spin Resonance (ESR) method. In fact, ESR has been shown to be a non-destructive, highly sensitive tool for the detection and characterization of paramagnetic, ferromagnetic, and radiation damage centers in terrestrial and extraterrestrial geological samples. The potential use of ESR as an effective method in the study of returned comet nucleus samples, in particular, in the analysis of fine-grained solid state icy samples is discussed

Is Mars Sample Return Required Prior to Sending Humans to Mars?

Science.gov (United States)

Carr, Michael; Abell, Paul; Allwood, Abigail; Baker, John; Barnes, Jeff; Bass, Deborah; Beaty, David; Boston, Penny; Brinkerhoff, Will; Budney, Charles;

Building on the Cornerstone: Destinations for Nearside Sample Return

Science.gov (United States)

Lawrence, S. J.; Jolliff, B. L.; Draper, D.; Stopar, J. D.; Petro, N. E.; Cohen, B. A.; Speyerer, E. J.; Gruener, J. E.

2016-01-01

Discoveries from LRO (Lunar Reconnaissance Orbiter) have transformed our knowledge of the Moon, but LRO's instruments were originally designed to collect the measurements required to enable future lunar surface exploration. Compelling science questions and critical resources make the Moon a key destination for future human and robotic exploration. Lunar surface exploration, including rovers and other landed missions, must be part of a balanced planetary science and exploration portfolio. Among the highest planetary exploration priorities is the collection of new samples and their return to Earth for more comprehensive analysis than can be done in-situ. The Moon is the closest and most accessible location to address key science questions through targeted sample return. The Moon is the only other planet from which we have contextualized samples, yet critical issues need to be addressed: we lack important details of the Moon's early and recent geologic history, the full compositional and age ranges of its crust, and its bulk composition.

78 FR 49296 - Centennial Challenges 2014 Sample Return Robot Challenge

Science.gov (United States)

2013-08-13

... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION [Notice 13-093] Centennial Challenges 2014 Sample... Centennial Challenges 2014 Sample Return Robot Challenge. SUMMARY: This notice is issued in accordance with... compete may register. Centennial Challenges is a program of prize competitions to stimulate innovation in...

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

Science.gov (United States)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

The Importance of Contamination Knowledge in Curation - Insights into Mars Sample Return

Science.gov (United States)

Harrington, A. D.; Calaway, M. J.; Regberg, A. B.; Mitchell, J. L.; Fries, M. D.; Zeigler, R. A.; McCubbin, F. M.

2018-01-01

The Astromaterials Acquisition and Curation Office at NASA Johnson Space Center (JSC), in Houston, TX (henceforth Curation Office) manages the curation of extraterrestrial samples returned by NASA missions and shared collections from international partners, preserving their integrity for future scientific study while providing the samples to the international community in a fair and unbiased way. The Curation Office also curates flight and non-flight reference materials and other materials from spacecraft assembly (e.g., lubricants, paints and gases) of sample return missions that would have the potential to cross-contaminate a present or future NASA astromaterials collection.

Cleaning and Cleanliness Verification Techniques for Mars Returned Sample Handling

Science.gov (United States)

Mickelson, E. T.; Lindstrom, D. J.; Allton, J. H.; Hittle, J. D.

2002-01-01

Precision cleaning and cleanliness verification techniques are examined as a subset of a comprehensive contamination control strategy for a Mars sample return mission. Additional information is contained in the original extended abstract.

The Importance of Meteorite Collections to Sample Return Missions: Past, Present, and Future Considerations

Science.gov (United States)

Welzenbach, L. C.; McCoy, T. J.; Glavin, D. P.; Dworkin, J. P.; Abell, P. A.

2012-01-01

While much of the scientific community s current attention is drawn to sample return missions, it is the existing meteorite and cosmic dust collections that both provide the paradigms to be tested by these missions and the context for interpreting the results. Recent sample returns from the Stardust and Hayabusa missions provided us with new materials and insights about our Solar System history and processes. As an example, Stardust sampled CAIs among the population of cometary grains, requiring extensive and unexpected radial mixing in the early solar nebula. This finding would not have been possible, however, without extensive studies of meteoritic CAIs that established their high-temperature, inner Solar System formation. Samples returned by Stardust also revealed the first evidence of a cometary amino acid, a discovery that would not have been possible with current in situ flight instrument technology. The Hayabusa mission provided the final evidence linking ordinary chondrites and S asteroids, a hypothesis that developed from centuries of collection and laboratory and ground-based telescopic studies. In addition to these scientific findings, studies of existing meteorite collections have defined and refined the analytical techniques essential to studying returned samples. As an example, the fortuitous fall of the Allende CV3 and Murchison CM2 chondrites within months before the return of Apollo samples allowed testing of new state-of-the-art analytical facilities. The results of those studies not only prepared us to better study lunar materials, but unanticipated discoveries changed many of our concepts about the earliest history and processes of the solar nebula. This synergy between existing collections and future space exploration is certainly not limited to sample return missions. Laboratory studies confirmed the existence of meteorites from Mars and raised the provocative possibility of preservation of ancient microbial life. The laboratory studies in

EURO-CARES: European Roadmap for a Sample Return Curation Facility and Planetary Protection Implications.

Science.gov (United States)

Brucato, John Robert

2016-07-01

A mature European planetary exploration program and evolving sample return mission plans gathers the interest of a wider scientific community. The interest is generated from studying extraterrestrial samples in the laborato-ry providing new opportunities to address fundamental issues on the origin and evolution of the Solar System, on the primordial cosmochemistry, and on the nature of the building blocks of terrestrial planets and on the origin of life. Major space agencies are currently planning for missions that will collect samples from a variety of Solar Sys-tem environments, from primitive (carbonaceous) small bodies, from the Moon, Mars and its moons and, final-ly, from icy moons of the outer planets. A dedicated sample return curation facility is seen as an essential re-quirement for the receiving, assessment, characterization and secure preservation of the collected extraterrestrial samples and potentially their safe distribution to the scientific community. EURO-CARES is a European Commission study funded under the Horizon-2020 program. The strategic objec-tive of EURO-CARES is to create a roadmap for the implementation of a European Extraterrestrial Sample Cu-ration Facility. The facility has to provide safe storage and handling of extraterrestrial samples and has to enable the preliminary characterization in order to achieve the required effectiveness and collaborative outcomes for the whole international scientific community. For example, samples returned from Mars could pose a threat on the Earth's biosphere if any living extraterrestrial organism are present in the samples. Thus planetary protection is an essential aspect of all Mars sample return missions that will affect the retrival and transport from the point of return, sample handling, infrastructure methodology and management of a future curation facility. Analysis of the state of the art of Planetary Protection technology shows there are considerable possibilities to define and develop

OHB's Exploration Capabilities Overview Relevant to Mars Sample Return Mission

Science.gov (United States)

Jaime, A.; Gerth, I.; Rohrbeck, M.; Scheper, M.

2018-04-01

The presentation will give an overview to all the OHB past and current projects that are relevant to the Mars Sample Return (MSR) mission, including some valuable lessons learned applicable to the upcoming MSR mission.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

OSIRIS-REx Asteroid Sample Return Mission Image Analysis

Science.gov (United States)

Chevres Fernandez, Lee Roger; Bos, Brent

2018-01-01

NASA’s Origins Spectral Interpretation Resource Identification Security-Regolith Explorer (OSIRIS-REx) mission constitutes the “first-of-its-kind” project to thoroughly characterize a near-Earth asteroid. The selected asteroid is (101955) 1999 RQ36 (a.k.a. Bennu). The mission launched in September 2016, and the spacecraft will reach its asteroid target in 2018 and return a sample to Earth in 2023. The spacecraft that will travel to, and collect a sample from, Bennu has five integrated instruments from national and international partners. NASA's OSIRIS-REx asteroid sample return mission spacecraft includes the Touch-And-Go Camera System (TAGCAMS) three camera-head instrument. The purpose of TAGCAMS is to provide imagery during the mission to facilitate navigation to the target asteroid, confirm acquisition of the asteroid sample and document asteroid sample stowage. Two of the TAGCAMS cameras, NavCam 1 and NavCam 2, serve as fully redundant navigation cameras to support optical navigation and natural feature tracking. The third TAGCAMS camera, StowCam, provides imagery to assist with and confirm proper stowage of the asteroid sample. Analysis of spacecraft imagery acquired by the TAGCAMS during cruise to the target asteroid Bennu was performed using custom codes developed in MATLAB. Assessment of the TAGCAMS in-flight performance using flight imagery was done to characterize camera performance. One specific area of investigation that was targeted was bad pixel mapping. A recent phase of the mission, known as the Earth Gravity Assist (EGA) maneuver, provided images that were used for the detection and confirmation of “questionable” pixels, possibly under responsive, using image segmentation analysis. Ongoing work on point spread function morphology and camera linearity and responsivity will also be used for calibration purposes and further analysis in preparation for proximity operations around Bennu. Said analyses will provide a broader understanding

Integrated science and engineering for the OSIRIS-REx asteroid sample return mission

Science.gov (United States)

Lauretta, D.

2014-07-01

Introduction: The Origins, Spectral Interpretation, Resource Identification, and Security-Regolith Explorer (OSIRIS-REx) asteroid sample return mission will survey near-Earth asteroid (101955) Bennu to understand its physical, mineralogical, and chemical properties, assess its resource potential, refine the impact hazard, and return a sample of this body to the Earth [1]. This mission is scheduled for launch in 2016 and will rendezvous with the asteroid in 2018. Sample return to the Earth follows in 2023. The OSIRIS-REx mission has the challenge of visiting asteroid Bennu, characterizing it at global and local scales, then selecting the best site on the asteroid surface to acquire a sample for return to the Earth. Minimizing the risk of exploring an unknown world requires a tight integration of science and engineering to inform flight system and mission design. Defining the Asteroid Environment: We have performed an extensive astronomical campaign in support of OSIRIS-REx. Lightcurve and phase function observations were obtained with UA Observatories telescopes located in southeastern Arizona during the 2005--2006 and 2011--2012 apparitions [2]. We observed Bennu using the 12.6-cm radar at the Arecibo Observatory in 1999, 2005, and 2011 and the 3.5-cm radar at the Goldstone tracking station in 1999 and 2005 [3]. We conducted near-infrared measurements using the NASA Infrared Telescope Facility at the Mauna Kea Observatory in Hawaii in September 2005 [4]. Additional spectral observations were obtained in July 2011 and May 2012 with the Magellan 6.5-m telescope [5]. We used the Spitzer space telescope to observe Bennu in May 2007 [6]. The extensive knowledge gained as a result of our telescopic characterization of Bennu was critical in the selection of this object as the OSIRIS-REx mission target. In addition, we use these data, combined with models of the asteroid, to constrain over 100 different asteroid parameters covering orbital, bulk, rotational, radar

Phobos/Deimos sample return via solar sail.

Science.gov (United States)

Matloff, Gregory L; Taylor, Travis; Powell, Conley; Moton, Tryshanda

2005-12-01

A sample-return mission to the Martian satellites using a con-temporary solar sail for all post-Earth-escape propulsion is proposed. The 0.015 kg/m(2) areal mass-thickness sail unfurls after launch and injection onto a Mars-bound Hohmann-transfer ellipse. Structure and payload increase spacecraft areal mass thickness to 0.028 kg/m(2). During the Mars encounter, the sail functions as a parachute in the outer atmosphere of Mars to accomplish aerocapture. On-board thrusters or the sail maneuver the spacecraft into an orbit with periapsis near Mars and apoapsis near Phobos. The orbit is circularized for Phobos-rendezvous; surface samples are collected. The sail then raises the orbit for Deimos-rendezvous and sample collection. The sail next places the spacecraft on an Earth-bound Hohmann-transfer ellipse. During Earth encounter, the sail accomplishes Earth-aerocapture or partially decelerates the sample container for entry into the Earth's atmosphere. Mission mass budget is about 218 grams and mission duration is less than five years.

JSC Advanced Curation: Research and Development for Current Collections and Future Sample Return Mission Demands

Science.gov (United States)

Fries, M. D.; Allen, C. C.; Calaway, M. J.; Evans, C. A.; Stansbery, E. K.

2015-01-01

Curation of NASA's astromaterials sample collections is a demanding and evolving activity that supports valuable science from NASA missions for generations, long after the samples are returned to Earth. For example, NASA continues to loan hundreds of Apollo program samples to investigators every year and those samples are often analyzed using instruments that did not exist at the time of the Apollo missions themselves. The samples are curated in a manner that minimizes overall contamination, enabling clean, new high-sensitivity measurements and new science results over 40 years after their return to Earth. As our exploration of the Solar System progresses, upcoming and future NASA sample return missions will return new samples with stringent contamination control, sample environmental control, and Planetary Protection requirements. Therefore, an essential element of a healthy astromaterials curation program is a research and development (R&D) effort that characterizes and employs new technologies to maintain current collections and enable new missions - an Advanced Curation effort. JSC's Astromaterials Acquisition & Curation Office is continually performing Advanced Curation research, identifying and defining knowledge gaps about research, development, and validation/verification topics that are critical to support current and future NASA astromaterials sample collections. The following are highlighted knowledge gaps and research opportunities.

Investigating the Geological History of Asteroid 101955 Bennu Through Remote Sensing and Returned Sample Analyses

Science.gov (United States)

Messenger, S.; Connolly, H. C., Jr.; Lauretta, D. S.; Bottke, W. F.

2014-01-01

The NASA New Frontiers Mission OSRIS-REx will return surface regolith samples from near-Earth asteroid 101955 Bennu in September 2023. This target is classified as a B-type asteroid and is spectrally similar to CI and CM chondrite meteorites [1]. The returned samples are thus expected to contain primitive ancient Solar System materials that formed in planetary, nebular, interstellar, and circumstellar environments. Laboratory studies of primitive astromaterials have yielded detailed constraints on the origins, properties, and evolutionary histories of a wide range of Solar System bodies. Yet, the parent bodies of meteorites and cosmic dust are generally unknown, genetic and evolutionary relationships among asteroids and comets are unsettled, and links between laboratory and remote observations remain tenuous. The OSIRIS-REx mission will offer the opportunity to coordinate detailed laboratory analyses of asteroidal materials with known and well characterized geological context from which the samples originated. A primary goal of the OSIRIS-REx mission will be to provide detailed constraints on the origin and geological and dynamical history of Bennu through coordinated analytical studies of the returned samples. These microanalytical studies will be placed in geological context through an extensive orbital remote sensing campaign that will characterize the global geological features and chemical diversity of Bennu. The first views of the asteroid surface and of the returned samples will undoubtedly bring remarkable surprises. However, a wealth of laboratory studies of meteorites and spacecraft encounters with primitive bodies provides a useful framework to formulate priority scientific questions and effective analytical approaches well before the samples are returned. Here we summarize our approach to unraveling the geological history of Bennu through returned sample analyses.

Precautionary Principle and Mars Sample Return

Science.gov (United States)

Arnould, Jacques

Many space missions have today as an aim the exploration and the knowledge of the planet Mars; consequently, the return of Martian samples seems one of the next possible stages, at the horizon of about fifteen years. Devoted in the search of traces of life, passed or presents, such a mission presents a true stake not only from the scientific point of view but also from the ethical. Right now, the COSPAR specified the precautions to be taken to avoid or, at the very least, to limit the risk of contamination of the terrestrial biosphere by pathogenic the hitherto unknown ones. Are these recommendations sufficient? Do they concern only the scientific prudence or take truly counts of the good of humanity and the life on Earth? In the final analysis, is the incurred risk, even weak, to endanger this life worth the sorrow of it? Hitherto confined with the scientific circles of astronomy and astrobiology, this questioning could move the public opinion and this one would undoubtedly call some with the principle of precaution. In what this recourse would be relevant? The precaution aims indeed the hypothetical risks, not yet confirmed scientifically, but of which the possibility can be identified starting from empirical and scientific knowledge; such is well the case. But is it for as much possible to apply this principle to the case of the Martian samples, insofar as the objective of such a mission remains for the strictly scientific moment? Is it possible to manage the risks in the same manner when it is a question of appropriation and exploitation of the natural resources and energy (GMO, nuclear energy, etc.) and when it acts, in the case of Mars, that only search of the knowledge? How to manage the fundamental difference between the risks voluntarily taken and arbitrarily imposed, clarified and keep silent? The case of the return of the samples leads to the borders of the contemporary interrogations on the stakes and the benefits of science, on the share of risk

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

77 FR 70835 - Centennial Challenges 2013 Sample Return Robot Challenge

Science.gov (United States)

2012-11-27

... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION Centennial Challenges 2013 Sample Return Robot... Challenge is scheduled and teams that wish to compete may register. Centennial Challenges is a program of... Challenge, please visit: http://challenge.wpi.edu . For general information on the NASA Centennial...

Quantitative Planetary Protection for Sample Return from Ocean Worlds

Science.gov (United States)

Neveu, Marc; Takano, Yoshinori; Porco, Carolyn; McKay, Christopher P.; Glavin, Daniel; Anbar, Ariel; Sherwood, Brent; Yano, Hajime

2016-07-01

Volcanism on ocean worlds [1,2] facilitates ocean sample return missions, enabling uniquely flexible, sensitive, and specific laboratory analyses on Earth to study how far chemistry has evolved in presumably habitable oceans [3,4]. Such mission concepts have yet to quantitatively address planetary protection (PP) for ocean worlds [3,4]. These harbor liquid water [5,6], metabolically useful energy [7], and organic matter to support life [8]. Ocean temperatures may not exceed the limit for life as we know it [9,10], they are shielded from exogenic radiation by kilometers of ice, and their material has likely not been naturally exchanged with Earth [11]. The above factors would place sample return missions in Cat. V - Restricted Earth Return [12,13]. Forward PP requirements for Europa [13] and other ocean worlds [14] require that the probability of "introduction of a single viable terrestrial microorganism into a liquid-water environment" be lower than 10 ^{-4}. This probability should be estimated from (F1) "bioburden at launch," (F2) "cruise survival for contaminating organisms," (F3) "organism survival in the radiation environment adjacent to the target," (F4) "the probability of encountering […] the target," (F5) "the probability of surviving landing/impact on the target," (F6) "mechanisms and timescales of transport to the subsurface," and (F7) "survival […] after subsurface transfer" [13,14]. The compliance of specific designs of known cost could be evaluated from measurements of molecular contaminants as robust and universal proxies for microbial particulates [15] (F1); known microbial radiation tolerance [16] and planetary radiation budgets [17] (F2-F3); trajectory design (F4); projected impact velocities [18] (F5); ice transport timescales [19] (F6), and biomass growth rates in ice [20] (F7). In contrast, current backward PP requirements are only qualitative. Current policy [13,15] prohibits "destructive impact upon return," and requires that (B1) "unless

PlanetVac: Sample Return with a Puff of Gas

Science.gov (United States)

Zacny, K.; Mueller, R.; Betts, B. H.

2014-12-01

PlanetVac is a regolith sample acquisition mission concept that uses compressed gas to blow material from the surface up a pneumatic tube and directly into a sample return container. The PlanetVac sampling device is built into the lander legs to eliminate cost and complexity associated with robotic arms and scoops. The pneumatic system can effectively capture fine and coarse regolith, including small pebbles. It is well suited for landed missions to Mars, asteroids, or the Moon. Because of the low pressures on all those bodies, the technique is extremely efficient. If losses are kept to minimum, 1 gram of compressed gas could efficiently lift 6000 grams of soil. To demonstrate this approach, the PlanetVac lander with four legs and two sampling tubes has been designed, integrated, and tested. Vacuum chamber testing was performed using two well-known planetary regolith simulants: Mars Mojave Simulant (MMS) and lunar regolith simulant JSC-1A. One of the two sampling systems was connected to a mockup of an earth return rocket while the second sampling system was connected to a lander deck mounted instrument (clear box for easy viewing). The tests included a drop from a height of approximately 50 cm onto the bed of regolith, deployment of sampling tubes into the regolith, pneumatic acquisition of sample into an instrument (sample container) and the rocket, and the launch of the rocket. The demonstration has been successful and can be viewed here: https://www.youtube.com/watch?v=DjJXvtQk6no. In most of the tests, 20 grams or more of sample was delivered to the 'instrument' and approximately 5 grams of regolith was delivered into a sampling chamber within the rocket. The gas lifting efficiency was calculated to be approximately 1000:1; that is 1 gram of gas lofted 1000 grams of regolith. Efficiencies in lower gravity environments are expected to be much higher. This successful, simple and lightweight sample capture demonstration paves the way to using such sampling system

Dynamic Acquisition and Retrieval Tool (DART) for Comet Sample Return : Session: 2.06.Robotic Mobility and Sample Acquisition Systems

Science.gov (United States)

Badescu, Mircea; Bonitz, Robert; Kulczycki, Erick; Aisen, Norman; Dandino, Charles M.; Cantrell, Brett S.; Gallagher, William; Shevin, Jesse; Ganino, Anthony; Haddad, Nicolas;

Backward Planetary Protection Issues and Possible Solutions for Icy Plume Sample Return Missions from Astrobiological Targets

Science.gov (United States)

Yano, Hajime; McKay, Christopher P.; Anbar, Ariel; Tsou, Peter

The recent report of possible water vapor plumes at Europa and Ceres, together with the well-known Enceladus plume containing water vapor, salt, ammonia, and organic molecules, suggests that sample return missions could evolve into a generic approach for outer Solar System exploration in the near future, especially for the benefit of astrobiology research. Sampling such plumes can be accomplished via fly-through mission designs, modeled after the successful Stardust mission to capture and return material from Comet Wild-2 and multiple, precise trajectory controls of the Cassini mission to fly through Enceladus’ plume. The proposed LIFE (Life Investigation For Enceladus) mission to Enceladus, which would sample organic molecules from the plume of that apparently habitable world, provides one example of the appealing scientific return of such missions. Beyond plumes, the upper atmosphere of Titan could also be sampled in this manner. The SCIM mission to Mars, also inspired by Stardust, would sample and return aerosol dust in the upper atmosphere of Mars and thus extends this concept even to other planetary bodies. Such missions share common design needs. In particular, they require large exposed sampler areas (or sampler arrays) that can be contained to the standards called for by international planetary protection protocols that COSPAR Planetary Protection Policy (PPP) recommends. Containment is also needed because these missions are driven by astrobiologically relevant science - including interest in organic molecules - which argues against heat sterilization that could destroy scientific value of samples. Sample containment is a daunting engineering challenge. Containment systems must be carefully designed to appropriate levels to satisfy the two top requirements: planetary protection policy and the preserving the scientific value of samples. Planning for Mars sample return tends to center on a hermetic seal specification (i.e., gas-tight against helium escape

A Draft Science Management Plan for Returned Samples from Mars: Recommendations from the International Mars Architecture for the Return of Samples (iMARS) Phase II Working Group

Science.gov (United States)

Haltigin, T.; Lange, C.; Mugnuolo, R.; Smith, C.

2018-04-01

This paper summarizes the findings and recommendations of the International Mars Architecture for the Return of Samples (iMARS) Phase II Working Group, an international team comprising 38 members from 16 countries and agencies.

Planning Related to the Curation and Processing of Returned Martian Samples

Science.gov (United States)

McCubbin, F. M.; Harrington, A. D.

2018-04-01

Many of the planning activities in the NASA Astromaterials Acquisition and Curation Office at JSC are centered around Mars Sample Return. The importance of contamination knowledge and the benefits of a mobile/modular receiving facility are discussed.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Overview of the Mars Sample Return Earth Entry Vehicle

Science.gov (United States)

Dillman, Robert; Corliss, James

2008-01-01

NASA's Mars Sample Return (MSR) project will bring Mars surface and atmosphere samples back to Earth for detailed examination. Langley Research Center's MSR Earth Entry Vehicle (EEV) is a core part of the mission, protecting the sample container during atmospheric entry, descent, and landing. Planetary protection requirements demand a higher reliability from the EEV than for any previous planetary entry vehicle. An overview of the EEV design and preliminary analysis is presented, with a follow-on discussion of recommended future design trade studies to be performed over the next several years in support of an MSR launch in 2018 or 2020. Planned topics include vehicle size for impact protection of a range of sample container sizes, outer mold line changes to achieve surface sterilization during re-entry, micrometeoroid protection, aerodynamic stability, thermal protection, and structural materials selection.

The CanMars Analogue Mission: Lessons Learned for Mars Sample Return

Science.gov (United States)

Osinski, G. R.; Beaty, D.; Battler, M.; Caudill, C.; Francis, R.; Haltigin, T.; Hipkin, V.; Pilles, E.

2018-04-01

We present an overview and lessons learned for Mars Sample Return from CanMars — an analogue mission that simulated a Mars 2020-like cache mission. Data from 39 sols of operations conducted in the Utah desert in 2015 and 2016 are presented.

O2/CO Ignition System for Mars Sample Return Missions, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Returning a geological sample from the surface of Mars will require an ascent propulsion system with a comparatively large velocity change (delta-V) capability due...

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

CHOMIK -Sampling Device of Penetrating Type for Russian Phobos Sample Return Mission

Science.gov (United States)

Seweryn, Karol; Grygorczuk, Jerzy; Rickmann, Hans; Morawski, Marek; Aleksashkin, Sergey; Banaszkiewicz, Marek; Drogosz, Michal; Gurgurewicz, Joanna; Kozlov, Oleg E.; Krolikowska-Soltan, Malgorzata; Sutugin, Sergiej E.; Wawrzaszek, Roman; Wisniewski, Lukasz; Zakharov, Alexander

Measurements of physical properties of planetary bodies allow to determine many important parameters for scientists working in different fields of research. For example effective heat conductivity of the regolith can help with better understanding of processes occurring in the body interior. Chemical and mineralogical composition gives us a chance to better understand the origin and evolution of the moons. In principle such parameters of the planetary bodies can be determined based on three different measurement techniques: (i) in situ measurements (ii) measurements of the samples in laboratory conditions at the Earth and (iii) remote sensing measurements. Scientific missions which allow us to perform all type of measurements, give us a chance for not only parameters determination but also cross calibration of the instruments. Russian Phobos Sample Return (PhSR) mission is one of few which allows for all type of such measurements. The spacecraft will be equipped with remote sensing instruments like: spectrometers, long wave radar and dust counter, instruments for in-situ measurements -gas-chromatograph, seismometer, thermodetector and others and also robotic arm and sampling device. PhSR mission will be launched in November 2011 on board of a launch vehicle Zenit. About a year later (11 months) the vehicle will reach the Martian orbit. It is anticipated that it will land on Phobos in the beginning of 2013. A take off back will take place a month later and the re-entry module containing a capsule that will hold the soil sample enclosed in a container will be on its way back to Earth. The 11 kg re-entry capsule with the container will land in Kazakhstan in mid-2014. A unique geological penetrator CHOMIK dedicated for the Phobos Sample Return space mis-sion will be designed and manufactured at the Space Mechatronics and Robotics Laboratory, Space Research Centre Polish Academy of Sciences (SRC PAS) in Warsaw. Functionally CHOMIK is based on the well known MUPUS

The Rosetta Stones of Mars — Should Meteorites be Considered as Samples of Opportunity for Mars Sample Return?

Science.gov (United States)

Tait, A. W.; Schröder, C.; Ashley, J. W.; Velbel, M. A.; Boston, P. J.; Carrier, B. L.; Cohen, B. A.; Bland, P. A.

2018-04-01

We summarize insights about Mars gained from investigating meteorites found on Mars. Certain types of meteorites can be considered standard probes inserted into the martian environment. Should they be considered for Mars Sample Return?

Advanced Ignition System for Hybrid Rockets for Sample Return Missions, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — To return a sample from the surface of Mars or any of the larger moons in the solar system will require a propulsion system with a comparatively large delta-V...

Role of impact cratering for Mars sample return

International Nuclear Information System (INIS)

Schultz, P.H.

1988-01-01

The preserved cratering record of Mars indicates that impacts play an important role in deciphering Martian geologic history, whether as a mechanism to modify the lithosphere and atmosphere or as a tool to sample the planet. The various roles of impact cratering in adding a broader understanding of Mars through returned samples are examined. Five broad roles include impact craters as: (1) a process in response to a different planetary localizer environment; (2) a probe for excavating crustal/mantle materials; (3) a possible localizer of magmatic and hydrothermal processes; (4) a chronicle of changes in the volcanic, sedimentary, atmospheric, and cosmic flux history; and (5) a chronometer for extending the geologic time scale to unsampled regions. The evidence for Earth-like processes and very nonlunar styles of volcanism and tectonism may shift the emphasis of a sampling strategy away from equally fundamental issues including crustal composition, unit ages, and climate history. Impact cratering not only played an important active role in the early Martian geologic history, it also provides an important tool for addressing such issues

Sample Return in Preparation for Human Mission on the Surface of Mars

Science.gov (United States)

Yun, P.

2018-04-01

Returned samples of martian regolith will help the science community make an informed decision in choosing the final human landing site and develop a better human mission plan to meet science criteria and IRSU and civil engineering criteria.

A Rover Mobility Platform with Autonomous Capability to Enable Mars Sample Return

Science.gov (United States)

Fulford, P.; Langley, C.; Shaw, A.

2018-04-01

The next step in understanding Mars is sample return. In Fall 2016, the CSA conducted an analogue deployment using the Mars Exploration Science Rover. An objective was to demonstrate the maturity of the rover's guidance, navigation, and control.

The Opera Instrument: An Advanced Curation Development for Mars Sample Return Organic Contamination Monitoring

Science.gov (United States)

Fries, M. D.; Fries, W. D.; McCubbin, F. M.; Zeigler, R. A.

2018-01-01

Mars Sample Return (MSR) requires strict organic contamination control (CC) and contamination knowledge (CK) as outlined by the Mars 2020 Organic Contamination Panel (OCP). This includes a need to monitor surficial organic contamination to a ng/sq. cm sensitivity level. Archiving and maintaining this degree of surface cleanliness may be difficult but has been achieved. MSR's CK effort will be very important because all returned samples will be studied thoroughly and in minute detail. Consequently, accurate CK must be collected and characterized to best interpret scientific results from the returned samples. The CK data are not only required to make accurate measurements and interpretations for carbon-depleted martian samples, but also to strengthen the validity of science investigations performed on the samples. The Opera instrument prototype is intended to fulfill a CC/CK role in the assembly, cleaning, and overall contamination history of hardware used in the MSR effort, from initial hardware assembly through post-flight sample curation. Opera is intended to monitor particulate and organic contamination using quartz crystal microbalances (QCMs), in a self-contained portable package that is cleanroom-compliant. The Opera prototype is in initial development capable of approximately 100 ng/sq. cm organic contamination sensitivity, with additional development planned to achieve 1 ng/sq. cm. The Opera prototype was funded by the 2017 NASA Johnson Space Center Innovation Charge Account (ICA), which provides funding for small, short-term projects.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

I. T. - R. O. C. K. S. Comet Nuclei Sample Return Mission

Science.gov (United States)

Dalcher, N.

2009-04-01

Ices, organics and minerals recording the chemical evolution of the outer regions of the early solar nebula are the main constituents of comets. Because comets maintain the nearly pristine nature of the cloud where they formed, the analyses of their composition, structure, thermodynamics and isotope ratios will increase our understanding of the processes that occurred in the early phases of the solar system as well as the Interstellar Medium (ISM) Cloud that predated the formation of the solar nebula [1]. While the deep impact mission aimed at determining the internal structure of comet Temple1's nuclei [e.g. 3], the stardust mission sample return has dramatically increased our understanding of comets. Its first implications indicated that some of the comet material originated in the inner solar system and was later transported outward beyond the freezing line [4]. A wide range of organic compounds identified within different grains of the aerogel collectors has demonstrated the heterogeneity in their assemblages [5]. This suggests either many histories associated with these material or possibly analytical constraints imposed by capture heating of Wild2 material in silica aerogel. The current mission ROSETTA, will further expand our knowledge about comets considerably through rigorous in situ analyses of a Jupiter Family Comet (JFC). As the next generation of comet research post ROSETTA, we present the comet nuclei sample return mission IT - ROCKS (International Team - Return Of Comet's Key Samples) to return several minimally altered samples from various locations of comet 88P/Howell, a typical JFC. The mission scenario includes remote sensing of the comet's nucleus with onboard instruments similar to the ROSETTA instruments [6, 7, 8] (VIS, IR, Thermal IR, X-Ray, Radar) and gas/dust composition measurements including a plasma science package. Additionally two microprobes [9] will further investigate the physical properties of the comet's surface. Retrieving of the

Analysis of the Touch-And-Go Surface Sampling Concept for Comet Sample Return Missions

Science.gov (United States)

Mandic, Milan; Acikmese, Behcet; Bayard, David S.; Blackmore, Lars

2012-01-01

This paper studies the Touch-and-Go (TAG) concept for enabling a spacecraft to take a sample from the surface of a small primitive body, such as an asteroid or comet. The idea behind the TAG concept is to let the spacecraft descend to the surface, make contact with the surface for several seconds, and then ascend to a safe location. Sampling would be accomplished by an end-effector that is active during the few seconds of surface contact. The TAG event is one of the most critical events in a primitive body sample-return mission. The purpose of this study is to evaluate the dynamic behavior of a representative spacecraft during the TAG event, i.e., immediately prior, during, and after surface contact of the sampler. The study evaluates the sample-collection performance of the proposed sampling end-effector, in this case a brushwheel sampler, while acquiring material from the surface during the contact. A main result of the study is a guidance and control (G&C) validation of the overall TAG concept, in addition to specific contributions to demonstrating the effectiveness of using nonlinear clutch mechanisms in the sampling arm joints, and increasing the length of the sampling arms to improve robustness.

Model Complexity and Out-of-Sample Performance: Evidence from S&P 500 Index Returns

NARCIS (Netherlands)

Kaeck, Andreas; Rodrigues, Paulo; Seeger, Norman J.

We apply a range of out-of-sample specification tests to more than forty competing stochastic volatility models to address how model complexity affects out-of-sample performance. Using daily S&P 500 index returns, model confidence set estimations provide strong evidence that the most important model

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Lower-Cost, Relocatable Lunar Polar Lander and Lunar Surface Sample Return Probes

Science.gov (United States)

Amato, G. Michael; Garvin, James B.; Burt, I. Joseph; Karpati, Gabe

2011-01-01

Key science and exploration objectives of lunar robotic precursor missions can be achieved with the Lunar Explorer (LEx) low-cost, robotic surface mission concept described herein. Selected elements of the LEx concept can also be used to create a lunar surface sample return mission that we have called Boomerang

Planetary Protection Requirements for Mars Sample Return Missions: Recommendations from a 2009 NRC Report

Science.gov (United States)

Race, Margaret; Farmer, Jack

A 2009 report by the National Research Council (NRC) reviewed a previous study on Mars Sample Return (1997) and provided updated recommendations for future sample return mis-sions based on our current understanding about Mars and its biological potential, as well as advances in technology and analytical capabilities. The committee* made 12 specific recommen-dations that fall into three general categories—one related to current scientific understanding, ten based on changes in the technical and/or policy environment, and one aimed at public com-munication. Substantive changes from the 1997 report relate mainly to protocols and methods, technology and infrastructure, and general oversight. This presentation provides an overview of the 2009 report and its recommendations and analyzes how they may impact mission designs and plans. The full report, Assessment of Planetary Protection Requirements for Mars Sample Return Missions is available online at: http://www.nap.edu/catalog.php?recordi d = 12576 * Study participants: Jack D. Farmer, Arizona State University (chair) James F. Bell III, Cornell University Kathleen C. Benison, Central Michigan University William V. Boynton, University of Arizona Sherry L. Cady, Portland State University F. Grant Ferris, University of Toronto Duncan MacPherson, Jet Propulsion Laboratory Margaret S. Race, SETI Institute Mark H. Thiemens, University of California, San Diego Meenakshi Wadhwa, Arizona State University

Restricted by Whom? A Historical Review of Strategies and Organization for Restricted Earth Return of Samples from NASA Planetary Missions

Science.gov (United States)

Pugel, Betsy

2017-01-01

This presentation is a review of the timeline for Apollo's approach to Planetary Protection, then known as Planetary Quarantine. Return of samples from Apollo 11, 12 and 14 represented NASA's first attempts into conducting what is now known as Restricted Earth Return, where return of samples is undertaken by the Agency with the utmost care for the impact that the samples may have on Earth's environment due to the potential presence of microbial or other life forms that originate from the parent body (in this case, Earth's Moon).

Constraining the Source Craters of the Martian Meteorites: Implications for Prioritiziation of Returned Samples from Mars

Science.gov (United States)

Herd, C. D. K.; Tornabene, L. L.; Bowling, T. J.; Walton, E. L.; Sharp, T. G.; Melosh, H. J.; Hamilton, J. S.; Viviano, C. E.; Ehlmann, B. L.

2018-04-01

We have made advances in constraining the potential source craters of the martian meteorites to a relatively small number. Our results have implications for Mars chronology and the prioritization of samples for Mars Sample Return.

Planning for the Collection and Analysis of Samples of Martian Granular Materials Potentially to be Returned by Mars Sample Return

Science.gov (United States)

Carrier, B. L.; Beaty, D. W.

2017-12-01

NASA's Mars 2020 rover is scheduled to land on Mars in 2021 and will be equipped with a sampling system capable of collecting rock cores, as well as a specialized drill bit for collecting unconsolidated granular material. A key mission objective is to collect a set of samples that have enough scientific merit to justify returning to Earth. In the case of granular materials, we would like to catalyze community discussion on what we would do with these samples if they arrived in our laboratories, as input to decision-making related to sampling the regolith. Numerous scientific objectives have been identified which could be achieved or significantly advanced via the analysis of martian rocks, "regolith," and gas samples. The term "regolith" has more than one definition, including one that is general and one that is much more specific. For the purpose of this analysis we use the term "granular materials" to encompass the most general meaning and restrict "regolith" to a subset of that. Our working taxonomy includes the following: 1) globally sourced airfall dust (dust); 2) saltation-sized particles (sand); 3) locally sourced decomposed rock (regolith); 4) crater ejecta (ejecta); and, 5) other. Analysis of martian granular materials could serve to advance our understanding areas including habitability and astrobiology, surface-atmosphere interactions, chemistry, mineralogy, geology and environmental processes. Results of these analyses would also provide input into planning for future human exploration of Mars, elucidating possible health and mechanical hazards caused by the martian surface material, as well as providing valuable information regarding available resources for ISRU and civil engineering purposes. Results would also be relevant to matters of planetary protection and ground-truthing orbital observations. We will present a preliminary analysis of the following, in order to generate community discussion and feedback on all issues relating to: What are the

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

The Proposed Mars Astrobiology Explorer - Cacher [MAX-C] Rover: First Step in a Potential Sample Return Campaign

Science.gov (United States)

Allen, Carlton C.; Beaty, David W.

2010-01-01

Sample return from Mars has been advocated by numerous scientific advisory panels for over 30 years, most prominently beginning with the National Research Council s [1] strategy for the exploration of the inner solar system, and most recently by the Mars Exploration Program Analysis Group (MEPAG s) Next Decade Science Analysis Group [2]. Analysis of samples here on Earth would have enormous advantages over in situ analyses in producing the data quality needed to address many of the complex scientific questions the community has posed about Mars. Instead of a small, predetermined set of analytical techniques, state of the art preparative and instrumental resources of the entire scientific community could be applied to the samples. The analytical emphasis could shift as the meaning of each result becomes better appreciated. These arguments apply both to igneous rocks and to layered sedimentary materials, either of which could contain water and other volatile constituents. In 2009 MEPAG formed the Mid-Range Rover Science Analysis Group (MRR-SAG) to formulate a mission concept that would address two general objectives: (1) conduct high-priority in situ science and (2) make concrete steps towards the potential return of samples to Earth. This analysis resulted in a mission concept named the Mars Astrobiology Explorer-Cacher (MAX-C), which was envisioned for launch in the 2018 opportunity. After extensive discussion, this group concluded that by far the most definitive contribution to sample return by this mission would be to collect and cache, in an accessible location, a suite of compelling samples that could potentially be recovered and returned by a subsequent mission. This would have the effect of separating two of the essential functions of MSR, the acquisition of the sample collection and its delivery to martian orbit, into two missions.

Enabling Global Lunar Sample Return and Life-Detection Studies Using a Deep-Space Gateway

Science.gov (United States)

Cohen, B. A.; Eigenbrode, J. A.; Young, K. E.; Bleacher, J. E.; Trainer, M. E.

2018-02-01

The Deep Space Gateway could uniquely enable a lunar robotic sampling campaign that would provide incredible science return as well as feed forward to Mars and Europa by testing instrument sterility and ability to distinguish biogenic signals.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Sample Analysis at Mars (SAM) and Mars Organic Molecule Analyzer (MOMA) as Critical In Situ Investigation for Targeting Mars Returned Samples

Science.gov (United States)

Freissinet, C.; Glavin, D. P.; Mahaffy, P. R.; Szopa, C.; Buch, A.; Goesmann, F.; Goetz, W.; Raulin, F.; SAM Science Team; MOMA Science Team

2018-04-01

SAM (Curiosity) and MOMA (ExoMars) Mars instruments, seeking for organics and biosignatures, are essential to establish taphonomic windows of preservation of molecules, in order to target the most interesting samples to return from Mars.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Seeking Signs of Life on Mars: The Importance of Sedimentary Suites as Part of Mars Sample Return

Science.gov (United States)

iMOST Team; Mangold, N.; McLennan, S. M.; Czaja, A. D.; Ori, G. G.; Tosca, N. J.; Altieri, F.; Amelin, Y.; Ammannito, E.; Anand, M.; Beaty, D. W.; Benning, L. G.; Bishop, J. L.; Borg, L. E.; Boucher, D.; Brucato, J. R.; Busemann, H.; Campbell, K. A.; Carrier, B. L.; Debaille, V.; Des Marais, D. J.; Dixon, M.; Ehlmann, B. L.; Farmer, J. D.; Fernandez-Remolar, D. C.; Fogarty, J.; Glavin, D. P.; Goreva, Y. S.; Grady, M. M.; Hallis, L. J.; Harrington, A. D.; Hausrath, E. M.; Herd, C. D. K.; Horgan, B.; Humayun, M.; Kleine, T.; Kleinhenz, J.; Mackelprang, R.; Mayhew, L. E.; McCubbin, F. M.; McCoy, J. T.; McSween, H. Y.; Moser, D. E.; Moynier, F.; Mustard, J. F.; Niles, P. B.; Raulin, F.; Rettberg, P.; Rucker, M. A.; Schmitz, N.; Sefton-Nash, E.; Sephton, M. A.; Shaheen, R.; Shuster, D. L.; Siljestrom, S.; Smith, C. L.; Spry, J. A.; Steele, A.; Swindle, T. D.; ten Kate, I. L.; Usui, T.; Van Kranendonk, M. J.; Wadhwa, M.; Weiss, B. P.; Werner, S. C.; Westall, F.; Wheeler, R. M.; Zipfel, J.; Zorzano, M. P.

2018-04-01

Sedimentary, and especially lacustrine, depositional environments are high-priority geological/astrobiological settings for Mars Sample Return. We review the detailed investigations, measurements, and sample types required to evaluate such settings.

System for Packaging Planetary Samples for Return to Earth

Science.gov (United States)

Badescu, Mircea; Bar-Cohen, Yoseph; Backes, paul G.; Sherrit, Stewart; Bao, Xiaoqi; Scott, James S.

2010-01-01

A system is proposed for packaging material samples on a remote planet (especially Mars) in sealed sample tubes in preparation for later return to Earth. The sample tubes (Figure 1) would comprise (1) tubes initially having open tops and closed bottoms; (2) small, bellows-like collapsible bodies inside the tubes at their bottoms; and (3) plugs to be eventually used to close the tops of the tubes. The top inner surface of each tube would be coated with solder. The side of each plug, which would fit snugly into a tube, would feature a solder-filled ring groove. The system would include equipment for storing, manipulating, filling, and sealing the tubes. The containerization system (see Figure 2) will be organized in stations and will include: the storage station, the loading station, and the heating station. These stations can be structured in circular or linear pattern to minimize the manipulator complexity, allowing for compact design and mass efficiency. The manipulation of the sample tube between stations is done by a simple manipulator arm. The storage station contains the unloaded sample tubes and the plugs before sealing as well as the sealed sample tubes with samples after loading and sealing. The chambers at the storage station also allow for plug insertion into the sample tube. At the loading station the sample is poured or inserted into the sample tube and then the tube is topped off. At the heating station the plug is heated so the solder ring melts and seals the plug to the sample tube. The process is performed as follows: Each tube is filled or slightly overfilled with sample material and the excess sample material is wiped off the top. Then, the plug is inserted into the top section of the tube packing the sample material against the collapsible bellowslike body allowing the accommodation of the sample volume. The plug and the top of the tube are heated momentarily to melt the solder in order to seal the tube.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Strategies for Distinguishing Abiotic Chemistry from Martian Biochemistry in Samples Returned from Mars

Science.gov (United States)

Glavin, D. P.; Burton, A. S.; Callahan, M. P.; Elsila, J. E.; Stern, J. C.; Dworkin, J. P.

2012-01-01

A key goal in the search for evidence of extinct or extant life on Mars will be the identification of chemical biosignatures including complex organic molecules common to all life on Earth. These include amino acids, the monomer building blocks of proteins and enzymes, and nucleobases, which serve as the structural basis of information storage in DNA and RNA. However, many of these organic compounds can also be formed abiotically as demonstrated by their prevalence in carbonaceous meteorites [1]. Therefore, an important challenge in the search for evidence of life on Mars will be distinguishing between abiotic chemistry of either meteoritic or martian origin from any chemical biosignatures from an extinct or extant martian biota. Although current robotic missions to Mars, including the 2011 Mars Science Laboratory (MSL) and the planned 2018 ExoMars rovers, will have the analytical capability needed to identify these key classes of organic molecules if present [2,3], return of a diverse suite of martian samples to Earth would allow for much more intensive laboratory studies using a broad array of extraction protocols and state-of-theart analytical techniques for bulk and spatially resolved characterization, molecular detection, and isotopic and enantiomeric compositions that may be required for unambiguous confirmation of martian life. Here we will describe current state-of-the-art laboratory analytical techniques that have been used to characterize the abundance and distribution of amino acids and nucleobases in meteorites, Apollo samples, and comet- exposed materials returned by the Stardust mission with an emphasis on their molecular characteristics that can be used to distinguish abiotic chemistry from biochemistry as we know it. The study of organic compounds in carbonaceous meteorites is highly relevant to Mars sample return analysis, since exogenous organic matter should have accumulated in the martian regolith over the last several billion years and the

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

Strategic Map for Enceladus Plume Biosignature Sample Return

Science.gov (United States)

Sherwood, B.

2014-12-01

The discovery of jets emitting salty water from the interior of Saturn's small moon Enceladus is one of the most astounding results of the Cassini mission to date. The measured presence of organic species in the resulting plume, the finding that the jet activity is valved by tidal stretching at apocrone, the modeled lifetime of E-ring particles, and gravitational inference of a long-lived, deep, large water reservoir all indicate that the textbook conditions for habitability are met at Enceladus today: liquid water, biologically available elements, source of energy, and longevity of conducive conditions. Enceladus may be the best place in our solar system to search for direct evidence of biomarkers, and the plume provides a way to sample, analyze, and even return them to Earth for detailed analysis. For example, it is straightforward to define a Stardust-like, fly-through, plume ice-particle, dust, and gas collection mission. Concept engineering and evaluation indicate that the associated technical, programmatic, regulatory, and cost issues are quite unlike the Stardust precedent however, not least because of such a mission's Category-V, Restricted Earth Return, classification. The poster presents a strategic framework for systematic integration of the enabling issues: cultivation of science advocacy, resolution of diverse stakeholder concerns, development of verifiable and affordable technical solutions, validation of cost estimation methods, alignment with other candidate astrobiology missions, complementarity of international agency goals, and finally the identification of appropriate research and flight-mission opportunities. A strategic approach is essential if we are to know the astrobiological state of Enceladus in our lifetime, and two international teams are already dedicated to implementing key steps on this roadmap.

The Use of Returned Martian Samples to Evaluate the Possibility of Extant Life on Mars

Science.gov (United States)

iMOST Team; ten Kate, I. L.; Mackelprang, R.; Rettberg, P.; Smith, C. L.; Altieri, F.; Amelin, Y.; Ammannito, E.; Anand, M.; Beaty, D. W.; Benning, L. G.; Bishop, J. L.; Borg, L. E.; Boucher, D.; Brucato, J. R.; Busemann, H.; Campbell, K. A.; Carrier, B. L.; Czaja, A. D.; Debaille, V.; Des Marais, D. J.; Dixon, M.; Ehlmann, B. L.; Farmer, J. D.; Fernandez-Remolar, D. C.; Fogarty, J.; Glavin, D. P.; Goreva, Y. S.; Grady, M. M.; Hallis, L. J.; Harrington, A. D.; Hausrath, E. M.; Herd, C. D. K.; Horgan, B.; Humayun, M.; Kleine, T.; Kleinhenz, J.; Mangold, N.; Mayhew, L. E.; McCoy, J. T.; McCubbin, F. M.; McLennan, S. M.; McSween, H. Y.; Moser, D. E.; Moynier, F.; Mustard, J. F.; Niles, P. B.; Ori, G. G.; Raulin, F.; Rucker, M. A.; Schmitz, N.; Sefton-Nash, E.; Sephton, M. A.; Shaheen, R.; Shuster, D. L.; Siljestrom, S.; Spry, J. A.; Steele, A.; Swindle, T. D.; Tosca, N. J.; Usui, T.; Van Kranendonk, M. J.; Wadhwa, M.; Weiss, B. P.; Werner, S. C.; Westall, F.; Wheeler, R. M.; Zipfel, J.; Zorzano, M. P.

2018-04-01

The astrobiological community is highly interested in interrogating returned martian samples for evidence of extant life. A single observation with one method will not constitute evidence of extant life — it will require a suite of investigations.

Mars Sample Return: The Critical Need for Planning a Meaningful and Participatory Public Engagement Program

Science.gov (United States)

Klug Boonstra, S.

2018-04-01

The Mars Sample Return campaign offers the prospect of an historical leap forward in the understanding of the science of Mars, and an unprecedented opportunity to engage our citizenry in one of the enduring questions of humanity, "Are we alone?".

LIFE: Life Investigation For Enceladus A Sample Return Mission Concept in Search for Evidence of Life.

Science.gov (United States)

Tsou, Peter; Brownlee, Donald E; McKay, Christopher P; Anbar, Ariel D; Yano, Hajime; Altwegg, Kathrin; Beegle, Luther W; Dissly, Richard; Strange, Nathan J; Kanik, Isik

2012-08-01

Life Investigation For Enceladus (LIFE) presents a low-cost sample return mission to Enceladus, a body with high astrobiological potential. There is ample evidence that liquid water exists under ice coverage in the form of active geysers in the "tiger stripes" area of the southern Enceladus hemisphere. This active plume consists of gas and ice particles and enables the sampling of fresh materials from the interior that may originate from a liquid water source. The particles consist mostly of water ice and are 1-10 μ in diameter. The plume composition shows H(2)O, CO(2), CH(4), NH(3), Ar, and evidence that more complex organic species might be present. Since life on Earth exists whenever liquid water, organics, and energy coexist, understanding the chemical components of the emanating ice particles could indicate whether life is potentially present on Enceladus. The icy worlds of the outer planets are testing grounds for some of the theories for the origin of life on Earth. The LIFE mission concept is envisioned in two parts: first, to orbit Saturn (in order to achieve lower sampling speeds, approaching 2 km/s, and thus enable a softer sample collection impact than Stardust, and to make possible multiple flybys of Enceladus); second, to sample Enceladus' plume, the E ring of Saturn, and the Titan upper atmosphere. With new findings from these samples, NASA could provide detailed chemical and isotopic and, potentially, biological compositional context of the plume. Since the duration of the Enceladus plume is unpredictable, it is imperative that these samples are captured at the earliest flight opportunity. If LIFE is launched before 2019, it could take advantage of a Jupiter gravity assist, which would thus reduce mission lifetimes and launch vehicle costs. The LIFE concept offers science returns comparable to those of a Flagship mission but at the measurably lower sample return costs of a Discovery-class mission.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Advanced Curation Protocols for Mars Returned Sample Handling

Science.gov (United States)

Bell, M.; Mickelson, E.; Lindstrom, D.; Allton, J.

Introduction: Johnson Space Center has over 30 years experience handling precious samples which include Lunar rocks and Antarctic meteorites. However, we recognize that future curation of samples from such missions as Genesis, Stardust, and Mars S mple Return, will require a high degree of biosafety combined witha extremely low levels of inorganic, organic, and biological contamination. To satisfy these requirements, research in the JSC Advanced Curation Lab is currently focused toward two major areas: preliminary examination techniques and cleaning and verification techniques . Preliminary Examination Techniques : In order to minimize the number of paths for contamination we are exploring the synergy between human &robotic sample handling in a controlled environment to help determine the limits of clean curation. Within the Advanced Curation Laboratory is a prototype, next-generation glovebox, which contains a robotic micromanipulator. The remotely operated manipulator has six degrees-of- freedom and can be programmed to perform repetitive sample handling tasks. Protocols are being tested and developed to perform curation tasks such as rock splitting, weighing, imaging, and storing. Techniques for sample transfer enabling more detailed remote examination without compromising the integrity of sample science are also being developed . The glovebox is equipped with a rapid transfer port through which samples can be passed without exposure. The transfer is accomplished by using a unique seal and engagement system which allows passage between containers while maintaining a first seal to the outside environment and a second seal to prevent the outside of the container cover and port door from becoming contaminated by the material being transferred. Cleaning and Verification Techniques: As part of the contamination control effort, innovative cleaning techniques are being identified and evaluated in conjunction with sensitive cleanliness verification methods. Towards this

In Situ Pre-Selection of Return Samples with Bio-Signatures by Combined Laser Mass Spectrometry and Optical Microscopy

Science.gov (United States)

Wiesendanger, R.; Wurz, P.; Tulej, M.; Wacey, D.; Neubeck, A.; Grimaudo, V.; Riedo, A.; Moreno, P.; Cedeño-López, A.; Ivarsson, M.

2018-04-01

The University of Bern developed instrument prototypes that allow analysis of samples on Mars prior to bringing them back to Earth, allowing to maximize the scientific outcome of the returned samples. We will present the systems and first results.

The problem of the first return attached to a pseudodifferential operator in dimension 3

Directory of Open Access Journals (Sweden)

Oscar F. Casas-Sánchez

2015-12-01

Full Text Available In this article we study the problem of first return associated to an elliptic pseudodifferential operator with non-radial symbol of dimension 3 over the p-adics. Resumen.El problema del primer retorno asociado a un operador seudodiferencial en dimensión 3 En este artículo estudiamos el problema del primer retorno asociado a un operador seudodiferencial elíptico con símbolo no radial de dimensión 3 sobre el cuerpo de los números pádicos.

The Mars Sample Return Lab(s) - Lessons from the Past and Implications for the Future

Science.gov (United States)

Allen, Carlton

2012-01-01

It has been widely understood for many years that an essential component of a Mars Sample Return mission is a Sample Receiving Facility (SRF). The purpose of such a facility would be to take delivery of the flight hardware that lands on Earth, open the spacecraft and extract the sample container and samples, and conduct an agreed upon test protocol, while ensuring strict containment and contamination control of the samples while in the SRF. Any samples that are found to be non-hazardous (or are rendered non-hazardous by sterilization) would then be transferred to long-term curation. Although the general concept of an SRF is relatively straightforward, there has been considerable discussion about implementation planning.

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Hayabusa2 Sample Catcher and Container: Metal-Seal System for Vacuum Encapsulation of Returned Samples with Volatiles and Organic Compounds Recovered from C-Type Asteroid Ryugu

Science.gov (United States)

Okazaki, Ryuji; Sawada, Hirotaka; Yamanouchi, Shinji; Tachibana, Shogo; Miura, Yayoi N.; Sakamoto, Kanako; Takano, Yoshinori; Abe, Masanao; Itoh, Shoichi; Yamada, Keita; Yabuta, Hikaru; Okamoto, Chisato; Yano, Hajime; Noguchi, Takaaki; Nakamura, Tomoki; Nagao, Keisuke

2017-07-01

The spacecraft Hayabusa2 was launched on December 3, 2014, to collect and return samples from a C-type asteroid, 162173 Ryugu (provisional designation, 1999 JU3). It is expected that the samples collected contain organic matter and water-bearing minerals and have key information to elucidate the origin and history of the Solar System and the evolution of bio-related organics prior to delivery to the early Earth. In order to obtain samples with volatile species without terrestrial contamination, based on lessons learned from the Hayabusa mission, the sample catcher and container of Hayabusa2 were refined from those used in Hayabusa. The improvements include (1) a mirror finish of the inner wall surface of the sample catcher and the container, (2) adoption of an aluminum metal sealing system, and (3) addition of a gas-sampling interface for gas collection and evacuation. The former two improvements were made to limit contamination of the samples by terrestrial atmosphere below 1 Pa after the container is sealed. The gas-sampling interface will be used to promptly collect volatile species released from the samples in the sample container after sealing of the container. These improvements maintain the value of the returned samples.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Robotic traverse and sample return strategies for a lunar farside mission to the Schrodinger basin

NARCIS (Netherlands)

Potts, N.J.; Gullikson, A.L.; Curran, N.M.; Dhaliwal, J.K.; Leader, M.K.; Rege, R.N.; Klaus, K.K.; Kring, D.A.

2015-01-01

Most of the highest priority objectives for lunar science and exploration (e.g.; NRC, 2007) require sample return. Studies of the best places to conduct that work have identified Schrödinger basin as a geologically rich area, able to address a significant number of these scientific concepts. In this

Touch And Go Camera System (TAGCAMS) for the OSIRIS-REx Asteroid Sample Return Mission

Science.gov (United States)

Bos, B. J.; Ravine, M. A.; Caplinger, M.; Schaffner, J. A.; Ladewig, J. V.; Olds, R. D.; Norman, C. D.; Huish, D.; Hughes, M.; Anderson, S. K.; Lorenz, D. A.; May, A.; Jackman, C. D.; Nelson, D.; Moreau, M.; Kubitschek, D.; Getzandanner, K.; Gordon, K. E.; Eberhardt, A.; Lauretta, D. S.

2018-02-01

NASA's OSIRIS-REx asteroid sample return mission spacecraft includes the Touch And Go Camera System (TAGCAMS) three camera-head instrument. The purpose of TAGCAMS is to provide imagery during the mission to facilitate navigation to the target asteroid, confirm acquisition of the asteroid sample, and document asteroid sample stowage. The cameras were designed and constructed by Malin Space Science Systems (MSSS) based on requirements developed by Lockheed Martin and NASA. All three of the cameras are mounted to the spacecraft nadir deck and provide images in the visible part of the spectrum, 400-700 nm. Two of the TAGCAMS cameras, NavCam 1 and NavCam 2, serve as fully redundant navigation cameras to support optical navigation and natural feature tracking. Their boresights are aligned in the nadir direction with small angular offsets for operational convenience. The third TAGCAMS camera, StowCam, provides imagery to assist with and confirm proper stowage of the asteroid sample. Its boresight is pointed at the OSIRIS-REx sample return capsule located on the spacecraft deck. All three cameras have at their heart a 2592 × 1944 pixel complementary metal oxide semiconductor (CMOS) detector array that provides up to 12-bit pixel depth. All cameras also share the same lens design and a camera field of view of roughly 44° × 32° with a pixel scale of 0.28 mrad/pixel. The StowCam lens is focused to image features on the spacecraft deck, while both NavCam lens focus positions are optimized for imaging at infinity. A brief description of the TAGCAMS instrument and how it is used to support critical OSIRIS-REx operations is provided.

Predictable return distributions

DEFF Research Database (Denmark)

Pedersen, Thomas Quistgaard

trace out the entire distribution. A univariate quantile regression model is used to examine stock and bond return distributions individually, while a multivariate model is used to capture their joint distribution. An empirical analysis on US data shows that certain parts of the return distributions......-of-sample analyses show that the relative accuracy of the state variables in predicting future returns varies across the distribution. A portfolio study shows that an investor with power utility can obtain economic gains by applying the empirical return distribution in portfolio decisions instead of imposing...

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Reduction of Martian Sample Return Mission Launch Mass with Solar Sail Propulsion

Science.gov (United States)

Russell, Tiffany E.; Heaton, Andrew; Thomas, Scott; Thomas, Dan; Young, Roy; Baysinger, Mike; Capizzo, Pete; Fabisinski, Leo; Hornsby, Linda; Maples, Dauphne;

Sample Return Robot

Data.gov (United States)

National Aeronautics and Space Administration — This Challenge requires demonstration of an autonomous robotic system to locate and collect a set of specific sample types from a large planetary analog area and...

Mars Earth Return Vehicle (MERV) Propulsion Options

Science.gov (United States)

Oleson, Steven R.; McGuire, Melissa L.; Burke, Laura; Fincannon, James; Warner, Joe; Williams, Glenn; Parkey, Thomas; Colozza, Tony; Fittje, Jim; Martini, Mike;

Mars Sample Return: The Next Step Required to Revolutionize Knowledge of Martian Geological and Climatological History

Science.gov (United States)

Mittlefehldt, D. W.

2012-01-01

The capability of scientific instrumentation flown on planetary orbiters and landers has made great advances since the signature Viking mission of the seventies. At some point, however, the science return from orbital remote sensing, and even in situ measurements, becomes incremental, rather than revolutionary. This is primarily caused by the low spatial resolution of such measurements, even for landed instrumentation, the incomplete mineralogical record derived from such measurements, the inability to do the detailed textural, mineralogical and compositional characterization needed to demonstrate equilibrium or reaction paths, and the lack of chronological characterization. For the foreseeable future, flight instruments will suffer from this limitation. In order to make the next revolutionary breakthrough in understanding the early geological and climatological history of Mars, samples must be available for interrogation using the full panoply of laboratory-housed analytical instrumentation. Laboratory studies of samples allow for determination of parageneses of rocks through microscopic identification of mineral assemblages, evaluation of equilibrium through electron microbeam analyses of mineral compositions and structures, determination of formation temperatures through secondary ion or thermal ionization mass spectrometry (SIMS or TIMS) analyses of stable isotope compositions. Such details are poorly constrained by orbital data (e.g. phyllosilicate formation at Mawrth Vallis), and incompletely described by in situ measurements (e.g. genesis of Burns formation sediments at Meridiani Planum). Laboratory studies can determine formation, metamorphism and/or alteration ages of samples through SIMS or TIMS of radiogenic isotope systems; a capability well-beyond flight instrumentation. Ideally, sample return should be from a location first scouted by landers such that fairly mature hypotheses have been formulated that can be tested. However, samples from clastic

Money growth and aggregate stock returns

OpenAIRE

Böing, Tobias; Stadtmann, Georg

2016-01-01

We empirically evaluate the predictive power of money growth measured by M2 for stock returns of the S&P 500 index. We use monthly US data and predict multiperiod returns over 1, 3, and 5 years with long-horizon regressions. In-sample regressions show that money growth is useful for predicting returns. Higher recent money growth has a significantly negative effect on subsequent returns of the S&P 500. An out-of-sample analysis shows that a simple model with money growth as a single predictor ...

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Mars Sample Return as a Feed-Forward into Planetary Protection for Crewed Missions to the Martian Surface

Science.gov (United States)

Spry, J. A.; Siegel, B.

2018-04-01

PP implementation is a required part of crewed exploration of Mars. Determining how PP is achieved is contingent on improved knowledge of Mars, best obtained in part by analysis of martian material of known provenance, as part of a Mars Sample Return mission.

Mars Rover Sample Return aerocapture configuration design and packaging constraints

Science.gov (United States)

Lawson, Shelby J.

1989-01-01

This paper discusses the aerodynamics requirements, volume and mass constraints that lead to a biconic aeroshell vehicle design that protects the Mars Rover Sample Return (MRSR) mission elements from launch to Mars landing. The aerodynamic requirements for Mars aerocapture and entry and packaging constraints for the MRSR elements result in a symmetric biconic aeroshell that develops a L/D of 1.0 at 27.0 deg angle of attack. A significant problem in the study is obtaining a cg that provides adequate aerodynamic stability and performance within the mission imposed constraints. Packaging methods that relieve the cg problems include forward placement of aeroshell propellant tanks and incorporating aeroshell structure as lander structure. The MRSR missions developed during the pre-phase A study are discussed with dimensional and mass data included. Further study is needed for some missions to minimize MRSR element volume so that launch mass constraints can be met.

Sealed Planetary Return Canister (SPRC), Phase II

Data.gov (United States)

National Aeronautics and Space Administration — Sample return missions have primary importance in future planetary missions. A basic requirement is that samples be returned in pristine, uncontaminated condition,...

Elemental Composition of Mars Return Samples Using X-Ray Fluorescence Imaging at the National Synchrotron Light Source II

Science.gov (United States)

Thieme, J.; Hurowitz, J. A.; Schoonen, M. A.; Fogelqvist, E.; Gregerson, J.; Farley, K. A.; Sherman, S.; Hill, J.

2018-04-01

NSLS-II at BNL provides a unique and critical capability to perform assessments of the elemental composition and the chemical state of Mars returned samples using synchrotron radiation X-ray fluorescence imaging and X-ray absorption spectroscopy.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

Directory of Open Access Journals (Sweden)

Laura Audrey Hug

2013-11-01

Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

KINERJA KEUANGAN KONVENSIONAL, ECONOMIC VALUE ADDED, DAN RETURN SAHAM

Directory of Open Access Journals (Sweden)

Bambang Sudiyatno

2011-09-01

Full Text Available Penelitian ini bertujuan untuk menguji pengaruh kinerja keuangan konvensional; Return on Asset (ROA, Return on Equity (ROE, Residual Income (RI, dan kinerja keuangan yang lebih modern; Economic Value Added (EVA terhadap return saham pada perusahaan-perusahaan dalam industry makanan dan minuman yang terdaftar di Bursa Efek Indonesia. Pengambilan sampel dalam penelitian ini menggunakan metode sensus, karena semua perusahaan dalam industry makanan dan minuman digunakan sebagai sampel. Namun dalam proses samplingnya mengunakan metode purposive sampling, yaitu menggunakan sampel dengan criteria-kriteria tertentu. Hasil penelitian menunjukkan bahwa Return on Asset (ROA dan Residual Income (RI berpengaruh positif dan secara statistik signifikan terhadap return saham pada level signifikansi 1%. Sedangkan Return on Equity (ROE berpengaruh negative dan secara statistik signifikan terhadap return saham pada level signifikansi 10%, dan Economic Value Added (ERA berpengaruh positif tetapi tidak signifikan terhadap return saham.This study aims to test the effect of conventional financial performance i.e. Return on Asset (ROA, Return on Equity (ROE, Residual Income (RI, and the more modern financial performance which is Economic Value Added (EVA toward stock returns on companies in the food and beverage industry listed in Indonesia Stock Exchange. Sampling technique in this study uses the census method, all companies in the food and beverage industry are used as a sample. The process of sampling using purposive sampling method. The result shows that Return On Asset (ROA and Residual Income (RI are positive and statistic significant impact on the stock returns at significance level 1%. While the Return on Equity (ROE is negative and statistic significant impact on the stock returns at significance level 10%, Economic Value Added (EVA is positive and statistic not significant impact on the stock returns.

Computing return times or return periods with rare event algorithms

Science.gov (United States)

Lestang, Thibault; Ragone, Francesco; Bréhier, Charles-Edouard; Herbert, Corentin; Bouchet, Freddy

2018-04-01

The average time between two occurrences of the same event, referred to as its return time (or return period), is a useful statistical concept for practical applications. For instance insurances or public agencies may be interested by the return time of a 10 m flood of the Seine river in Paris. However, due to their scarcity, reliably estimating return times for rare events is very difficult using either observational data or direct numerical simulations. For rare events, an estimator for return times can be built from the extrema of the observable on trajectory blocks. Here, we show that this estimator can be improved to remain accurate for return times of the order of the block size. More importantly, we show that this approach can be generalised to estimate return times from numerical algorithms specifically designed to sample rare events. So far those algorithms often compute probabilities, rather than return times. The approach we propose provides a computationally extremely efficient way to estimate numerically the return times of rare events for a dynamical system, gaining several orders of magnitude of computational costs. We illustrate the method on two kinds of observables, instantaneous and time-averaged, using two different rare event algorithms, for a simple stochastic process, the Ornstein–Uhlenbeck process. As an example of realistic applications to complex systems, we finally discuss extreme values of the drag on an object in a turbulent flow.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

Science.gov (United States)

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.

Science.gov (United States)

Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen

2015-06-26

Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples. Copyright © 2015 Elsevier Inc. All rights reserved.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Plans for Selection and In-Situ Investigation of Return Samples by the Supercam Instrument Onboard the Mars 2020 Rover

Science.gov (United States)

Wiens, R. C.; Maurice, S.; Mangold, N.; Anderson, R.; Beyssac, O.; Bonal, L.; Clegg, S.; Cousin, A.; DeFlores, L.; Dromart, G.; Fisher, W.; Forni, O.; Fouchet, T.; Gasnault, O.; Grotzinger, J.; Johnson, J.; Martinez-Frias, J.; McLennan, S.; Meslin, P.-Y.; Montmessin, F.; Poulet, F.; Rull, F.; Sharma, S.

2018-04-01

The SuperCam instrument onboard Rover 2020 still provides a complementary set of analyses with IR reflectance and Raman spectroscopy for mineralogy, LIBS for chemistry, and a color imager in order to investigate in-situ samples to return.

Processes to Open the Container and the Sample Catcher of the Hayabusa Returned Capsule in the Planetary Material Sample Curation Facility of JAXA

Science.gov (United States)

Fujimura, A.; Abe, M.; Yada, T.; Nakamura, T.; Noguchi, T.; Okazaki, R.; Ishibashi, Y.; Shirai, K.; Okada, T.; Yano, H.;

KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

Directory of Open Access Journals (Sweden)

Yuli Kurniawati

2015-05-01

Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

Science.gov (United States)

Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

2007-04-01

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Evaluating the biological potential in samples returned from planetary satellites and small solar system bodies: framework for decision making

National Research Council Canada - National Science Library

National Research Council Staff; Space Studies Board; Division on Engineering and Physical Sciences; National Research Council; National Academy of Sciences

... from Planetary Satellites and Small Solar System Bodies Framework for Decision Making Task Group on Sample Return from Small Solar System Bodies Space Studies Board Commission on Physical Sciences, Mathematics, and Applications National Research Council NATIONAL ACADEMY PRESS Washington, D.C. 1998 i Copyrightthe true use are Please breaks...

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

DEFF Research Database (Denmark)

Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

2002-01-01

sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

Product return management

DEFF Research Database (Denmark)

Shaharudin, Mohd Rizaimy; Govindan, Kannan; Zailani, Suhaiza

2017-01-01

The aim of this study is to examine the extent to which product returns motivate manufacturing firms to adopt closed-loop supply chain activities that influence the effectiveness of reverse supply chains. The hypotheses have been tested using data from a sample of 150 environmental management...... system ISO 14001 certified manufacturing firms in Malaysia through the census sampling approach. The results of the empirical test using LISREL Version 8.70 for the structural equation modeling support the fundamental explanation of the influence of the institutional forces towards the adoption of closed...... eventually impacts the firm's effectiveness in the reverse supply chain. The findings also help managers to understand the factors that can improve the outcome of the adoption of closed-loop supply chain activities by intensifying the extent of involvement in product returns, which provides a valuable...

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

DEFF Research Database (Denmark)

Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

2015-01-01

the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

Priority Science Targets for Future Sample Return Missions within the Solar System Out to the Year 2050

Science.gov (United States)

McCubbin, F. M.; Allton, J. H.; Barnes, J. J.; Boyce, J. W.; Burton, A. S.; Draper, D. S.; Evans, C. A.; Fries, M. D.; Jones, J. H.; Keller, L. P.;

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

2018-01-01

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.

2018-05-23

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

Optimisation of the PCR-invA primers for the detection of Salmonella ...

African Journals Online (AJOL)

A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

A spreadsheet template compatible with Microsoft Excel and iWork Numbers that returns the simultaneous confidence intervals for all pairwise differences between multiple sample means.

Science.gov (United States)

Brown, Angus M

2010-04-01

The objective of the method described in this paper is to develop a spreadsheet template for the purpose of comparing multiple sample means. An initial analysis of variance (ANOVA) test on the data returns F--the test statistic. If F is larger than the critical F value drawn from the F distribution at the appropriate degrees of freedom, convention dictates rejection of the null hypothesis and allows subsequent multiple comparison testing to determine where the inequalities between the sample means lie. A variety of multiple comparison methods are described that return the 95% confidence intervals for differences between means using an inclusive pairwise comparison of the sample means. 2009 Elsevier Ireland Ltd. All rights reserved.

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Lidar 2009 - All Returns

Data.gov (United States)

Kansas Data Access and Support Center — LIDAR-derived binary (.las) files containing classified points of all returns. We have 3 classifications Unclassified, Ground, Low points. The average Ground Sample...

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

MANAJEMEN LABA, RETURN SAHAM, DAN KINERJA OPERASI SEBAGAI PEMODERASI

Directory of Open Access Journals (Sweden)

Farid Addy Sumantri

2017-09-01

Full Text Available The purpose of this study was to determine the indications of the practice of earnings management at the time of the IPO, one year after the IPO, and two years after the IPO. This study also examined the effect of earnings management on stock returns and operating performance in moderating the relationship between earnings management and stock returns. The study sample comprised 33 firms that go public in the year 2007 to 2011 using a purposive sampling method. Earnings management is proxied by discretionary accruals using the Modified Jones Model, which used proxy for the stock return is cummulative abnormal returns (CAR, while for the company's operating performance used proxy for the return on assets (ROA. The results showed that there were indications of earnings management at the time of the IPO, one year after the IPO, and two years after the IPO with a lower profit rate. No effect on earnings management is proxied by stock return cummulative abnormal returns (CAR. Operating performance of the company also can not moderate the relationship between earnings management with stock return.   Keywords: Earning Management, Initial Public Offering, Cummulative Abnormal Return, Return On Asset

The Benefits of Sample Return: Connecting Apollo Soils and Diviner Lunar Radiometer Remote Sensing Data

Science.gov (United States)

Greenhagen, B. T.; Donaldson-Hanna, K. L.; Thomas, I. R.; Bowles, N. E.; Allen, C. C.; Pieters, C. M.; Paige, D. A.

2014-01-01

The Diviner Lunar Radiometer, onboard NASA's Lunar Reconnaissance Orbiter, has produced the first global, high resolution, thermal infrared observations of an airless body. The Moon, which is the most accessible member of this most abundant class of solar system objects, is also the only body for which we have extraterrestrial samples with known spatial context. Here we present the results of a comprehensive study to reproduce an accurate simulated lunar environment, evaluate the most appropriate sample and measurement conditions, collect thermal infrared spectra of a representative suite of Apollo soils, and correlate them with Diviner observations of the lunar surface. We find that analyses of Diviner observations of individual sampling stations and SLE measurements of returned Apollo soils show good agreement, while comparisons to thermal infrared reflectance under terrestrial conditions do not agree well, which underscores the need for SLE measurements and validates the Diviner compositional dataset. Future work includes measurement of additional soils in SLE and cross comparisons with measurements in JPL Simulated Airless Body Emission Laboratory (SABEL).

A LIBS Boroscope for Evaluation of Mars Sample Return Core Candidates

Data.gov (United States)

National Aeronautics and Space Administration — The leading recommendation of the Decadal Survey [National Research Council, 2011] is &taking the first critical steps toward returning carefully selected...

Heating and thermal control of brazing technique to break contamination path for potential Mars sample return

Science.gov (United States)

Bao, Xiaoqi; Badescu, Mircea; Sherrit, Stewart; Bar-Cohen, Yoseph; Campos, Sergio

2017-04-01

The potential return of Mars sample material is of great interest to the planetary science community, as it would enable extensive analysis of samples with highly sensitive laboratory instruments. It is important to make sure such a mission concept would not bring any living microbes, which may possibly exist on Mars, back to Earth's environment. In order to ensure the isolation of Mars microbes from Earth's Atmosphere, a brazing sealing and sterilizing technique was proposed to break the Mars-to-Earth contamination path. Effectively, heating the brazing zone in high vacuum space and controlling the sample temperature for integrity are key challenges to the implementation of this technique. The break-thechain procedures for container configurations, which are being considered, were simulated by multi-physics finite element models. Different heating methods including induction and resistive/radiation were evaluated. The temperature profiles of Martian samples in a proposed container structure were predicted. The results show that the sealing and sterilizing process can be controlled such that the samples temperature is maintained below the level that may cause damage, and that the brazing technique is a feasible approach to breaking the contamination path.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Fourth-quarter Economic Growth and Time-varying Expected Returns

DEFF Research Database (Denmark)

Møller, Stig V.; Rangvid, Jesper

not predict returns. Fourth-quarter economic growth rates contain considerably more information about expected returns than standard variables used in the literature, are robust to the choice of macro variable, and work in-sample, out-of-sample, and in subsamples. To help explain these results, we show...... that economic growth and growth in consumer confidence are correlated during the fourth quarter, but not during the other quarters: When economic growth is low during the fourth quarter, confidence in the economy is also low such that investors require higher future returns. We discuss rational and behavioral...... reasons why fourth-quarter economic growth, growth in consumer confidence, and expected returns are related....

An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

Science.gov (United States)

Mendrek, M. J.

1992-01-01

A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

Thermal Protection for Mars Sample Return Earth Entry Vehicle: A Grand Challenge for Design Methodology and Reliability Verification

Science.gov (United States)

Venkatapathy, Ethiraj; Gage, Peter; Wright, Michael J.

2017-01-01

Mars Sample Return is our Grand Challenge for the coming decade. TPS (Thermal Protection System) nominal performance is not the key challenge. The main difficulty for designers is the need to verify unprecedented reliability for the entry system: current guidelines for prevention of backward contamination require that the probability of spores larger than 1 micron diameter escaping into the Earth environment be lower than 1 million for the entire system, and the allocation to TPS would be more stringent than that. For reference, the reliability allocation for Orion TPS is closer to 11000, and the demonstrated reliability for previous human Earth return systems was closer to 1100. Improving reliability by more than 3 orders of magnitude is a grand challenge indeed. The TPS community must embrace the possibility of new architectures that are focused on reliability above thermal performance and mass efficiency. MSR (Mars Sample Return) EEV (Earth Entry Vehicle) will be hit with MMOD (Micrometeoroid and Orbital Debris) prior to reentry. A chute-less aero-shell design which allows for self-righting shape was baselined in prior MSR studies, with the assumption that a passive system will maximize EEV robustness. Hence the aero-shell along with the TPS has to take ground impact and not break apart. System verification will require testing to establish ablative performance and thermal failure but also testing of damage from MMOD, and structural performance at ground impact. Mission requirements will demand analysis, testing and verification that are focused on establishing reliability of the design. In this proposed talk, we will focus on the grand challenge of MSR EEV TPS and the need for innovative approaches to address challenges in modeling, testing, manufacturing and verification.

What Is the Expected Return on a Stock?

DEFF Research Database (Denmark)

Martin, Ian; Wagner, Christian

We derive a formula that expresses the expected return on a stock in terms of the risk-neutral variance of the market and the stock's excess risk-neutral variance relative to the average stock. These components can be computed from index and stock option prices; the formula has no free parameters....... We test the theory in-sample by running panel regressions of stock returns onto risk-neutral variances. The formula performs well at 6-month and 1-year forecasting horizons, and our predictors drive out beta, size, book-to-market, and momentum. Out-of-sample, we find that the formula outperforms...... a range of competitors in forecasting individual stock returns. Our results suggest that there is considerably more variation in expected returns, both over time and across stocks, than has previously been acknowledged....

What is the Expected Return on a Stock?

DEFF Research Database (Denmark)

Martin, Ian; Wagner, Christian

We derive a formula that expresses the expected return on a stock in terms of the risk-neutral variance of the market and the stock’s excess risk-neutral variance relative to the average stock. These components can be computed from index and stock option prices; the formula has no free parameters....... We test the theory in-sample by running panel regressions of stock returns onto risk-neutral variances. The formula performs well at 6-month and 1-year forecasting horizons, and our predictors drive out beta, size, book-to-market, and momentum. Out-of-sample, we find that the formula outperforms...... a range of competitors in forecasting individual stock returns. Our results suggest that there is considerably more variation in expected returns, both over time and across stocks, than has previously been acknowledged....

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Trajectory Options for a Potential Mars Mission Combining Orbiting Science, Relay and a Sample Return Rendezvous Demonstration

Science.gov (United States)

Guinn, Joseph R.; Kerridge, Stuart J.; Wilson, Roby S.

2012-01-01

Mars sample return is a major scientific goal of the 2011 US National Research Council Decadal Survey for Planetary Science. Toward achievement of this goal, recent architecture studies have focused on several mission concept options for the 2018/2020 Mars launch opportunities. Mars orbiters play multiple roles in these architectures such as: relay, landing site identification/selection/certification, collection of on-going or new measurements to fill knowledge gaps, and in-orbit collection and transportation of samples from Mars to Earth. This paper reviews orbiter concepts that combine these roles and describes a novel family of relay orbits optimized for surface operations support. Additionally, these roles provide an intersection of objectives for long term NASA science, human exploration, technology development and international collaboration.

A Multi-Decadal Sample Return Campaign Will Advance Lunar and Solar System Science and Exploration by 2050

Science.gov (United States)

Neal, C. R.; Lawrence, S. J.

2017-01-01

There have been 11 missions to the Moon this century, 10 of which have been orbital, from 5 different space agencies. China became the third country to successfully soft-land on the Moon in 2013, and the second to successfully remotely operate a rover on the lunar surface. We now have significant global datasets that, coupled with the 1990s Clementine and Lunar Prospector missions, show that the sample collection is not representative of the lithologies present on the Moon. The M3 data from the Indian Chandrayaan-1 mission have identified lithologies that are not present/under-represented in the sample collection. LRO datasets show that volcanism could be as young as 100 Ma and that significant felsic complexes exist within the lunar crust. A multi-decadal sample return campaign is the next logical step in advancing our understanding of lunar origin and evolution and Solar System processes.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Bond return predictability in expansions and recessions

DEFF Research Database (Denmark)

Engsted, Tom; Møller, Stig Vinther; Jensen, Magnus David Sander

We document that over the period 1953-2011 US bond returns are predictable in expansionary periods but unpredictable during recessions. This result holds in both in-sample and out-of-sample analyses and using both univariate regressions and combination forecasting techniques. A simulation study...... but negative in recessions. The results are also consistent with tests showing that the expectations hypothesis of the term structure holds in recessions but not in expansions. However, the results for bonds are in sharp contrast to results for stocks showing that stock returns are predictable in recessions...... but not in expansions. Thus, our results indicate that there is not a common predictive pattern of stock and bond returns associated with the state of the economy....

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

Directory of Open Access Journals (Sweden)

E. Mahmoudi

2007-08-01

Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

The Importance of Sample Return in Establishing Chemical Evidence for Life on Mars or Other Solar System Bodies

Science.gov (United States)

Glavin, D. P.; Conrad, P.; Dworkin, J. P.; Eigenbrode, J.; Mahaffy, P. R.

2011-01-01

The search for evidence of life on Mars and elsewhere will continue to be one of the primary goals of NASA s robotic exploration program over the next decade. NASA and ESA are currently planning a series of robotic missions to Mars with the goal of understanding its climate, resources, and potential for harboring past or present life. One key goal will be the search for chemical biomarkers including complex organic compounds important in life on Earth. These include amino acids, the monomer building blocks of proteins and enzymes, nucleobases and sugars which form the backbone of DNA and RNA, and lipids, the structural components of cell membranes. Many of these organic compounds can also be formed abiotically as demonstrated by their prevalence in carbonaceous meteorites [1], though, their molecular characteristics may distinguish a biological source [2]. It is possible that in situ instruments may reveal such characteristics, however, return of the right sample (i.e. one with biosignatures or having a high probability of biosignatures) to Earth would allow for more intensive laboratory studies using a broad array of powerful instrumentation for bulk characterization, molecular detection, isotopic and enantiomeric compositions, and spatially resolved chemistry that may be required for confirmation of extant or extinct Martian life. Here we will discuss the current analytical capabilities and strategies for the detection of organics on the Mars Science Laboratory (MSL) using the Sample Analysis at Mars (SAM) instrument suite and how sample return missions from Mars and other targets of astrobiological interest will help advance our understanding of chemical biosignatures in the solar system.

Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

Science.gov (United States)

Smielewska-Loś, E

2003-01-01

Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

Science.gov (United States)

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

Sample Curation at a Lunar Outpost

Science.gov (United States)

Allen, Carlton C.; Lofgren, Gary E.; Treiman, A. H.; Lindstrom, Marilyn L.

2007-01-01

The six Apollo surface missions returned 2,196 individual rock and soil samples, with a total mass of 381.6 kg. Samples were collected based on visual examination by the astronauts and consultation with geologists in the science back room in Houston. The samples were photographed during collection, packaged in uniquely-identified containers, and transported to the Lunar Module. All samples collected on the Moon were returned to Earth. NASA's upcoming return to the Moon will be different. Astronauts will have extended stays at an out-post and will collect more samples than they will return. They will need curation and analysis facilities on the Moon in order to carefully select samples for return to Earth.

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Stock return distribution in the BRICS

Directory of Open Access Journals (Sweden)

George Adu

2015-12-01

Full Text Available Stock returns in emerging market economies exhibit patterns that are distinctively different from developed countries: returns are noted to be highly volatile and autocorrelated, and long horizon returns are predictable. While these stylized facts are well established, the assumption underlying the distribution of returns is less understood. In particular, the empirical literature continues to rely on the normality assumption as a starting point, and most asset pricing models tend to overstretch this point. This paper questions the rationale behind this supposition and proceeds to test more formally for normality using multivariate joint test for skewness and kurtosis. Additionally, the paper extends the literature by examining a number of empirical regularities for Brazil, Russia, India, China and South Africa (the BRICS for short. Our main findings are that the distribution of stock returns for the BRICS exhibits peakedness with fatter and longer tails, and this is invariant to both the unit of measurement and the time horizon of returns. Volatility clustering is prevalent in all markets, and this decays exponentially for all but Brazil. The relationship between risk and return is found to be significant and risk premiums are prevalent in our sample.

What We Might Know About Gusev Crater if the Mars Exploration Rover Spirit Mission were Coupled with a Mars Sample Return Mission

Science.gov (United States)

Morris, Richard V.

2008-01-01

The science instruments on the Mars Exploration Rover (MER) Spirit have provided an enormous amount of chemical and mineralogical data during more than 1450 sols of exploration at Gusev crater. The Moessbauer (MB) instrument identified 10 Fe-bearing phases at Gusev Crater: olivine, pyroxene, ilmenite, chromite, and magnetite as primary igneous phases and nanophase ferric oxide (npOx), goethite, hematite, a ferric sulfate, and pyrite/marcusite as secondary phases. The Miniature Thermal Emission Spectrometer (Mini-TES) identified some of these Fe-bearing phases (olivine and pyroxene), non- Fe-bearing phases (e.g., feldspar), and an amorphous high-SiO2 phase near Home Plate. Chemical data from the Alpha Particle X-Ray Spectrometer (APXS) provided the framework for rock classification, chemical weathering/alteration, and mineralogical constraints. APXS-based mineralogical constraints include normative calculations (with Fe(3+)/FeT from MB), elemental associations, and stoichiometry (e.g., 90% SiO2 implicates opalline silica). If Spirit had cached a set of representative samples and if those samples were returned to the Earth for laboratory analysis, what value is added by Mars Sample return (MSR) over and above the mineralogical and chemical data provided by MER?

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

Mars Sample Handling Functionality

Science.gov (United States)

Meyer, M. A.; Mattingly, R. L.

2018-04-01

The final leg of a Mars Sample Return campaign would be an entity that we have referred to as Mars Returned Sample Handling (MRSH.) This talk will address our current view of the functional requirements on MRSH, focused on the Sample Receiving Facility (SRF).

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

Science.gov (United States)

Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

2015-07-01

The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

Mars ascent propulsion options for small sample return vehicles

International Nuclear Information System (INIS)

Whitehead, J. C.

1997-01-01

An unprecedented combination of high propellant fraction and small size is required for affordable-scale Mars return, regardless of the number of stages, or whether Mars orbit rendezvous or in-situ propellant options are used. Conventional space propulsion technology is too heavy, even without structure or other stage subsystems. The application of launch vehicle design principles to the development of new hardware on a tiny scale is therefore suggested. Miniature pump-fed rocket engines fed by low pressure tanks can help to meet this challenge. New concepts for engine cycles using piston pumps are described, and development issues are outlined

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

Science.gov (United States)

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

Directory of Open Access Journals (Sweden)

Vasco Elbrecht

Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

Science.gov (United States)

Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

2018-06-01

Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

End-of-the-Year Economic Growth and Time-varying Expected Returns

DEFF Research Database (Denmark)

Møller, Stig Vinther; Rangvid, Jesper

. To explain these results, we show as the second main fi?nding of our paper that economic growth and growth in economic confidence (consumer con?dence and business con?dence) are strongly correlated during the fourth quarter, but not during the other quarters. In summary, we therefore show that when economic......We show that macroeconomic growth at the end of the year (fourth-quarter or December) strongly predicts the returns of the aggregate market, small- and large-cap stocks, portfolios sorted on book-to-market and dividend yields, bond returns, and international stock returns, whereas economic growth...... during the rest of the year does not predict returns. End-of-the-year economic growth rates contain considerably more information about expected returns than standard variables used to predict returns, are robust to the choice of macro variables, and work in-sample, out-of-sample, and in subsamples...

End-of-the-year economic growth and time-varying expected returns

DEFF Research Database (Denmark)

Møller, Stig Vinther; Rangvid, Jesper

. To explain these results, we show as the second main fi…nding of our paper that economic growth and growth in economic confidence (consumer con…dence and business con…dence) are strongly correlated during the fourth quarter, but not during the other quarters. In summary, we therefore show that when economic......We show that macroeconomic growth at the end of the year (fourth-quarter or December) strongly predicts the returns of the aggregate market, small- and large-cap stocks, portfolios sorted on book-to-market and dividend yields, bond returns, and international stock returns, whereas economic growth...... during the rest of the year does not predict returns. End-of-the-year economic growth rates contain considerably more information about expected returns than standard variables used to predict returns, are robust to the choice of macro variables, and work in-sample, out-of-sample, and in subsamples...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

Science.gov (United States)

Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

2010-08-01

We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

EMPIRICAL DISTRIBUTION OF STOCK RETURNS OF SOUTHEAST EUROPEAN EMERGING MARKETS

Directory of Open Access Journals (Sweden)

Aleksandar Naumoski

2017-06-01

Full Text Available The assumption that equity returns follow the normal distribution, most commonly made in financial economics theory and applications, is strongly rejected by empirical evidence presented in this paper. As it was found in many other studies, we confirm that stock returns follow a leptokurtic distribution and skewness, which in most of the Southeast European (SEE markets is negative. This paper investigates further whether there is any distribution that may be considered an optimal fit for stock returns in the SEE region. Using daily, weekly and monthly data samples for a period of five years from ten Southeast European emerging countries, we applied the Anderson-Darling test of Goodness-of-fit. We strongly rejected the aforementioned assumption of normality for all considered data samples and found that the daily stock returns are best fitted by the Johnson SU distribution whereas for the weekly and monthly stock returns there was not one predominant, but many distributions that can be considered a best fit.

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

Respiratory health as a predictor of questionnaire return in a sample of United States underground coal miners

Energy Technology Data Exchange (ETDEWEB)

Trent, R B; Ames, R G

1987-06-01

A logistic model was used to analyse questionnaire return in a postal survey of 311 coalminers, who had left their place of employment between 1977 and 1982. Three measures of respiratory health, obstruction, restriction, and presence of chronic bronchitis symptoms, were included in the model as predictors together with the possibly confounding factors of age, education and marital and smoking status. Age was positively associated with questionnaire return (p<0.001). Speed of return, and whether the return was in response to a prompt, were not predicted by either the respiratory health measures or any of the other possibly confounding variables. 47 refs., 2 tabs.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Earth-return trajectory options for the 1985-86 Halley opportunity

Science.gov (United States)

Farquhar, R. W.; Dunham, D. W.

1982-01-01

A unique and useful family of ballistic trajectories to Halley's comet is described. The distinguishing feature of this family is that all of the trajectories return to the Earth's vicinity after the Halley intercept. It is shown that, in some cases, the original Earth-return path can be reshaped by Earth-swingby maneuvers to achieve additional small-body encounters. One mission profile includes flybys of the asteroid Geographos and comet Tempel-2 following the Halley intercept. Dual-flyby missions involving comets Encke and Borrelly and the asteroid Anteros are also discussed. Dust and gas samples are collected during the high-velocity (about 70 km/sec) flythrough of Halley, and then returned to a high-apogee Earth orbit. Aerobraking maneuvers are used to bring the sample-return spacecraft to a low-altitude circular orbit where it can be recovered by the Space Shuttle.

Habit formation, surplus consumption and return predictability

DEFF Research Database (Denmark)

Engsted, Tom; Hyde, Stuart; Vinther Møller, Stig

2010-01-01

On an international post World War II dataset, we use an iterated GMM procedure to estimate and test the Campbell and Cochrane (1999, By force of habit: a consumption-based explanation of aggregate stock market behavior. Journal of Political Economy 107, 205–251.) habit formation model with a time......-varying risk-free rate. In addition, we analyze the predictive power of the surplus consumption ratio for future stock and bond returns. We find that, although there are important cross-country differences and economically significant pricing errors, for the majority of countries in our sample the model gets...... significant information about future stock returns, also during the 1990s. In addition, in most countries the surplus consumption ratio is also a powerful predictor of future bond returns. Thus, the surplus consumption ratio captures time-varying expected returns in both stock and bond markets....

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

DEFF Research Database (Denmark)

Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

Inactive nurses in Taiwan: human capital, intention to return to hospital nursing, and incentives for returning.

Science.gov (United States)

Yu, Hsing-Yi; Tang, Fu-In; Chen, I-Ju; Yin, Teresa J C; Chen, Chu-Chieh; Yu, Shu

2016-04-01

To investigate inactive nurses' human capital, intention to return to hospital nursing and incentives for returning. Few studies have discussed the loss of human capital with regard to inactive nurses and how to attract them to return to clinical work. Systematic random sampling was used, with 328 subjects completing the mailed questionnaires, resulting in a response rate of 25.4%. Inactive nurses not only had moderate to high human capital (average years of nursing experience was 10.29, with moderate to high levels of nursing professional commitment and nursing competence) and were young. Forty-three percent of subjects reported intending to return to hospital nursing. Sufficient nurse staffing, greater safety in the working environment, and re-entry preparation programmes were incentives for returning. Recruiting inactive nurses back to hospital work is vital and feasible as inactive nurses had a moderate to high degree of human capital. The most feasible way is offering reasonable working conditions, in particular, providing sufficient staffing, a safe working environment and re-entry preparation programmes. The findings confirm the human capital of inactive nurses and provide concrete directions for nursing managers to follow when recruiting inactive nurses to hospital nursing. © 2015 John Wiley & Sons Ltd.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Abnormal Returns and Contrarian Strategies

Directory of Open Access Journals (Sweden)

Ivana Dall'Agnol

2003-12-01

Full Text Available We test the hypothesis that strategies which are long on portfolios of looser stocks and short on portfolios of winner stocks generate abnormal returns in Brazil. This type of evidence for the US stock market was interpreted by The Bondt and Thaler (1985 as reflecting systematic evaluation mistakes caused by investors overreaction to news related to the firm performance. We found evidence of contrarian strategies profitability for horizons from 3 months to 3 years in a sample of stock returns from BOVESPA and SOMA from 1986 to 2000. The strategies are more profitable for shorter horizons. Therefore, there was no trace of the momentum effect found by Jagadeesh and Titman (1993 for the same horizons with US data. There are remaing unexplained positive returns for contrarian strategies after accounting for risk, size, and liquidity. We also found that the strategy profitability is reduced after the Real Plan, which suggests that the Brazilian stock market became more efficient after inflation stabilization.

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Are fund of hedge fund returns asymmetric?

OpenAIRE

Lynch, Margaret; Hutson, Elaine; Stevenson, Max

2004-01-01

We examine the return distributions of 332 funds of hedge funds and associated indices. Over half of the sample is significantly skewed according to the skewness statistic, and these are split 50/50 positive and negative. However, we argue that the skewness statistic can lead to erroneous inferences regarding the nature of the return distribution, because the test statistic is based on the normal distribution. Using a series of tests that make minimal assumptions about the shape of the ...

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

DNA barcoding of selected UAE medicinal plant species: a comparative assessment of herbarium and fresh samples.

Science.gov (United States)

Enan, Mohamed Rizk; Palakkott, Abdul Rasheed; Ksiksi, Taoufik Saleh

2017-01-01

It is commonly difficult to extract and amplify DNA from herbarium samples as they are old and preserved using different compounds. In addition, such samples are subjected to the accumulation of intrinsically produced plant substances over long periods (up to hundreds of years). DNA extraction from desert flora may pause added difficulties as many contain high levels of secondary metabolites. Herbarium samples from the Biology Department (UAE University) plant collection and fresh plant samples, collected from around Al-Ain (UAE), were used in this study. The three barcode loci for the coding genes matK, rbcL and rpoC1-were amplified. Our results showed that T. terresteris , H. robustum , T. pentandrus and Z. qatarense were amplified using all three primers for both fresh and herbaium samples. Both fresh and herbarium samples of C. comosum , however, were not amplified at all, using the three primers. Herbarium samples from A. javanica , C. imbricatum , T. aucherana and Z. simplex were not amplified with any of the three primers. For fresh samples 90, 90 and 80% of the samples were amplified using matK, rbcL and rpoC1, respectively. In short, fresh samples were significantly better amplified than those from herbarium sources, using the three primers. Both fresh and herbarium samples from one species ( C. comosum ), however, were not successfully amplified. It is also concluded that the rbcL regions showed real potentials to distinguish the UAE species under investigation into the appropriate family and genus.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

Science.gov (United States)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

Directory of Open Access Journals (Sweden)

Mostafa Bakhshi

2017-07-01

Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Cost Efficiency and Returns to Scope in Italian Investment Firms

OpenAIRE

Marcello Basili; Fulvio Fontini

2005-01-01

This paper estimates cost efficiency and returns to scope of Italian investment firms during the period 1998-2002, following the stochastic frontier function approach. Results indicate a large inefficiency for Italian investment firms (with a high standard deviation across sample) and the absence of significant returns to scope

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

Sample Transport for a European Sample Curation Facility

Science.gov (United States)

Berthoud, L.; Vrublevskis, J. B.; Bennett, A.; Pottage, T.; Bridges, J. C.; Holt, J. M. C.; Dirri, F.; Longobardo, A.; Palomba, E.; Russell, S.; Smith, C.

2018-04-01

This work has looked at the recovery of Mars Sample Return capsule once it arrives on Earth. It covers possible landing sites, planetary protection requirements, and transportation from the landing site to a European Sample Curation Facility.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

DAMPAK PENYAJIAN KEMBALI EPS DAN CFPS TERHADAP RETURN SAHAM

Directory of Open Access Journals (Sweden)

Imelda Sinaga

2014-04-01

Full Text Available The problem in this study is whether there is a positive influence of CFPS and EPS before and after restatement in giving positive impact on stock returns. The sample used in EPS before and after the restatement, while as many as 102 samples meanwhile CFPS before and after restatement using 82 sample companies listed on the Stock Exchange. Independent variables used in this study are the earnings per share and cash flow per share and the dependent variables used in this study is the stock return. Test equipment used in this study using multiple regression statistical model           The results of this study demonstrate that EPS before restatement did not impact significantly on the stock returns which indicates that investors have been aware that there is signal to improve the EPS before the restatement. EPS after restatement had no significant effect on return, this indicates that the new information is in accordance with the Market Efficiency hypothesis is that will make the market participants to react and take action to respond that new information. CFPS before and after restatement also had no significant effect on stock returns because investors do not use operating cash flow information as a basic for investment decisions. This can have implications on investors who use financial statements to make right decisions on the location of their assets in the companies that perform restatement as well for the company itself that financial report restatement can be made if it is seen as a form of commitment and sense of responsibility to the market to provide trustable information

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

A practical primer on geostatistics

Science.gov (United States)

Olea, Ricardo A.

2009-01-01

has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

Science.gov (United States)

Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

2018-01-01

We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

Pengaruh Dividen Inisiasi dan Dividen Omisi terhadap Return Saham di Bursa Efek Indonesia

Directory of Open Access Journals (Sweden)

Azizah Ayu Sielvia

2011-03-01

Full Text Available The objective of this study is to determine the effect of dividend initiations and dividend omission of stock returns in Indonesia Stock Exchange (BEI. Variables in this study consist of dividends, dividend announcements, and a significant stock return on dividend announcement reflected the presence of abnormal return during the event period. This study employs the company's shares listed on Indonesia Stock Exchange and are actively traded. Samples used as many as 50 companies, where 37 companies as a dividend initiation and 13 companies as a dividend omission. The sample selection was done by purposive sampling method that is research based on certain criteria. Results of analysis testing the effect of the abnormal return of dividend announcements indicate a significant influence. Announcements of dividend initiations have significant positive influence, while the announcements of dividend omissions have significant negative market reaction. That means the announcement of dividend initiations have a signal or a specific information content that causes the market to react more than normal state of the information, while the announcement of dividend omissions affect investors to remove their stock price moves down or there is a significant abnormal return.Keywords: dividend initiation, dividend omission, dividend announcement, stock return

The Economic Value of Predicting Stock Index Returns and Volatility

NARCIS (Netherlands)

Marquering, W.; Verbeek, M.J.C.M.

2000-01-01

In this paper, we analyze the economic value of predicting index returns as well as volatility. On the basis of fairly simple linear models, estimated recursively, we produce genuine out-of-sample forecasts for the return on the S&P 500 index and its volatility. Using monthly data from 1954-1998, we

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Stock Price Informativeness and Idiosyncratic Return Volatility in Emerging Markets: Evidence from China

OpenAIRE

Karen Jingrong Lin; Khondkar Karim; Clairmont Carter

2014-01-01

This study attempts to address two research questions on the idiosyncratic return volatility and stock price informativeness. First, whether idiosyncratic return volatility is a valid proxy for stock price informativeness in emerging markets, and if it is, whether there exists a monotonic relationship between the idiosyncratic return volatility and stock price informativeness throughout the whole sample. We find that the idiosyncratic return volatility reflects the stock price informativeness...

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

Science.gov (United States)

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

Science.gov (United States)

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

INDIKATOR MAKROEKONOMI DAN RETURN SAHAM SYARIAH DI INDONESIA

Directory of Open Access Journals (Sweden)

Utami Baroroh

2016-02-01

Full Text Available The objectives of this study are to examine empirical test the long term equilibrium and simulteneous relationship between macroeconomics variables to stock return in Indonesia and to observe stock return response because shock/innovation of inflation, SBI discount rate and exchange rate Rupiah to US dollar. The data sample used in this study are monthly time series data from 2003.1 – 2010.6. Those data are SBI discount rate, inflation (CPI, exchange rate Rupiah to US dollar, money supply and stock return (IHSG. A method of analysis in this study are Granger Causality Test and Cointegration test. The empirical results shows that SBI discount rate, inflation (CPI, and exchange rate Rupiah to US dollar have causality relationship to stock return.. The cointegration test indicates that among research variables there is long term equilibrium and simultaneous relationshipDOI: 10.15408/sjie.v2i2.2421

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

Directory of Open Access Journals (Sweden)

Mayra Eduardoff

2017-09-01

Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS

Planetary Sample Caching System Design Options

Science.gov (United States)

Collins, Curtis; Younse, Paulo; Backes, Paul

2009-01-01

Potential Mars Sample Return missions would aspire to collect small core and regolith samples using a rover with a sample acquisition tool and sample caching system. Samples would need to be stored in individual sealed tubes in a canister that could be transfered to a Mars ascent vehicle and returned to Earth. A sample handling, encapsulation and containerization system (SHEC) has been developed as part of an integrated system for acquiring and storing core samples for application to future potential MSR and other potential sample return missions. Requirements and design options for the SHEC system were studied and a recommended design concept developed. Two families of solutions were explored: 1)transfer of a raw sample from the tool to the SHEC subsystem and 2)transfer of a tube containing the sample to the SHEC subsystem. The recommended design utilizes sample tool bit change out as the mechanism for transferring tubes to and samples in tubes from the tool. The SHEC subsystem design, called the Bit Changeout Caching(BiCC) design, is intended for operations on a MER class rover.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

DAMPAK PEMODERASIAN KOMPONEN ARUS KAS TERHADAP HUBUNGAN LABA AKUNTANSI DENGAN RETURN SAHAM

Directory of Open Access Journals (Sweden)

Hendy Hermawan

2012-02-01

Full Text Available Accurate information regarding listed companies is crucial to minimize investment risk. This research aims to examine the effect of accounting income on stock return, and the effect of cash flow from operation, cash flow from investment, and cash flow from financing activities respectively as moderating variables on the relationship between accounting income and stock return of manufacturer listed on the Jakarta Stock Exchange. There were 161 manufacturing companies listed during 2001 to 2005, and 39 of them are selected as sample research using purposive sampling method. With 5 year research period, there are 195 observations done. Data then are analyzed using multiple linear regressions. Results show that accounting income affect stock return significantly, which is shown by greater value of t count compare to t table. While cash flow from operation, investment, and financing activities are not able to moderate relationship between accounting income and stock return

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

Science.gov (United States)

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Spacecraft Actuator Diagnosis with Principal Component Analysis: Application to the Rendez-Vous Phase of the Mars Sample Return Mission

Directory of Open Access Journals (Sweden)

Othman Nasri

2015-01-01

Full Text Available This paper presents a fault detection and isolation (FDI approach in order to detect and isolate actuators (thrusters and reaction wheels faults of an autonomous spacecraft involved in the rendez-vous phase of the Mars Sample Return (MSR mission. The principal component analysis (PCA has been adopted to estimate the relationships between the various variables of the process. To ensure the feasibility of the proposed FDI approach, a set of data provided by the industrial “high-fidelity” simulator of the MSR and representing the opening (resp., the rotation rates of the spacecraft thrusters (resp., reaction wheels has been considered. The test results demonstrate that the fault detection and isolation are successfully accomplished.

Bank Activity and Funding Strategies: The Impact on Risk and Return

OpenAIRE

Demirgüc-Kunt, A.; Huizinga, H.P.

2009-01-01

This paper examines the implications of bank activity and short-term funding strategies for bank risk and return using an international sample of 1334 banks in 101 countries leading up to the 2007 financial crisis. Expansion into non-interest income generating activities such as trading increases the rate of return on assets, and it may offer some risk diversification benefits at very low levels. Non-deposit, wholesale funding in contrast lowers the rate of return on assets, while it can offe...

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Modeling returns volatility: Realized GARCH incorporating realized risk measure

Science.gov (United States)

Jiang, Wei; Ruan, Qingsong; Li, Jianfeng; Li, Ye

2018-06-01

This study applies realized GARCH models by introducing several risk measures of intraday returns into the measurement equation, to model the daily volatility of E-mini S&P 500 index futures returns. Besides using the conventional realized measures, realized volatility and realized kernel as our benchmarks, we also use generalized realized risk measures, realized absolute deviation, and two realized tail risk measures, realized value-at-risk and realized expected shortfall. The empirical results show that realized GARCH models using the generalized realized risk measures provide better volatility estimation for the in-sample and substantial improvement in volatility forecasting for the out-of-sample. In particular, the realized expected shortfall performs best for all of the alternative realized measures. Our empirical results reveal that future volatility may be more attributable to present losses (risk measures). The results are robust to different sample estimation windows.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

Science.gov (United States)

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

Earnings Quality Measures and Excess Returns.

Science.gov (United States)

Perotti, Pietro; Wagenhofer, Alfred

2014-06-01

This paper examines how commonly used earnings quality measures fulfill a key objective of financial reporting, i.e., improving decision usefulness for investors. We propose a stock-price-based measure for assessing the quality of earnings quality measures. We predict that firms with higher earnings quality will be less mispriced than other firms. Mispricing is measured by the difference of the mean absolute excess returns of portfolios formed on high and low values of a measure. We examine persistence, predictability, two measures of smoothness, abnormal accruals, accruals quality, earnings response coefficient and value relevance. For a large sample of US non-financial firms over the period 1988-2007, we show that all measures except for smoothness are negatively associated with absolute excess returns, suggesting that smoothness is generally a favorable attribute of earnings. Accruals measures generate the largest spread in absolute excess returns, followed by smoothness and market-based measures. These results lend support to the widespread use of accruals measures as overall measures of earnings quality in the literature.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

PRODUCT RETURNS MANAGEMENT IN THE CLOTHING INDUSTRY IN POLAND

Directory of Open Access Journals (Sweden)

Anna Maria Jeszka

2014-12-01

Full Text Available Background: The aim of this study is to identify and define on the basis of the literature the principal external and organizational factors and check to what extent they affect the efficiency of returns management as well as any resultant savings. The author proposes a conceptual model which correlates the results of returns management as well as savings with the main determinants identified on the basis of the literature. Then, in the operationalisation phase of the model, the dependent and independent variables were defined in the form of constructs. In accordance with the adopted model, individual constructs were measured based on standardised interviews. Materials and methods:  The results of returns management and any savings generated by this process are affected by certain determinants which are described in the literature. The adopted model included external factors, such as the cooperation of retailers with logistics operators and suppliers, the exchange of information in the supply chain, and organizational behaviour (experience of employees; as well as organizational factors related to the flow of information and IT systems. Due to financial and organisational restrictions, the originally planned representative sample of retail chains was limited to the regions of Wielkopolska and Lubuskie. In the end, 105 interviews were analysed. Results:  The results obtained in the research sample confirm assumptions about the possible potential savings that can be achieved as a result of appropriately conducted corporate policies in the area of reverse logistics. A correlation was also revealed between the experience and competencies of staff and the efficiency of returns management. Conclusions: Research into the factors affecting the efficiency of returns management and any savings resulting from returns management policies have not been conducted in Poland to date. The present study contributes to the growing trend of research into the

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

26 CFR 301.6103(h)(2)-1 - Disclosure of returns and return information (including taxpayer return information) to and by...

Science.gov (United States)

2010-04-01

... administration. 301.6103(h)(2)-1 Section 301.6103(h)(2)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Returns Returns and Records § 301.6103(h)(2)-1 Disclosure of returns and return information (including..., shall, to the extent provided by section 6103(h)(2) (A), (B), and (C) and subject to the requirements of...

Are Samples Obtained after Return to Earth Reflective of Spaceflight or Increased Gravity?

Science.gov (United States)

Wade, C. R.; Holton, E.; Baer, L.; Moran, M.

2001-01-01

Upon return to Earth, following space flight, living systems are immediately exposed to an increase in gravity of 1G. It has been difficult to differentiate between changes that are residuals of the acclimation to space flight from those resulting from acute exposure to an increase in =gravity upon re-entry. We compared previously reported changes observed in male Sprague-Dawley rats upon return to Earth to those induced by centrifugation, because both paradigms result in an increase of 1G. With both treatments there was a reduction in body mass, due to reduced food intake and increased urine output. The decrease in food intake was initially greater with centrifugation. The magnitudes of the changes in food intake and urine output were similar in both treatments. However, the slightly greater initial loss in body mass with centrifugation was due to a decrease in water intake not seen after space flight. The absence of pronounced differences between these treatments suggest the responses observed after landing are not residuals of adaptation to the space flight environment, but the result of adaptation to an increase in the level of gravity.

Religion's Return to Higher Education: A Primer

Science.gov (United States)

Jacobsen, Douglas; Jacobsen, Rhonda Hustedt

2013-01-01

Board meetings usually focus on nuts-and-bolts issues--action items and financial matters that require immediate discussion and prompt decisions. But larger philosophical issues also sometimes float to the surface--matters having to do with institutional mission, campus ethos, or educational styles--and when these kinds of issues arise, it is…

EFEKTIVITAS PEMBERIAN TERAPI MUSIK (MOZART DAN BACK EXERCISE TERHADAP PENURUNAN NYERI DYSMENORRHEA PRIMER

Directory of Open Access Journals (Sweden)

reni heryani

2017-12-01

Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

PENGARUH PENGUMUMAN STRATEGI PENGUNGKAPAN INFORMASI EMITEN PADA RETURN SAHAM DI BURSA EFEK INDONESIA

Directory of Open Access Journals (Sweden)

I GEDE SUPARTA WISADHA

2010-07-01

Full Text Available The objective of this research is to the empirical test hyphotesis (1 theeffect of the information disclosures strategy to the stocks return.,(2 thelower average abnormal return after the announcement of informationdisclosures strategy then average abnormal return before of theannouncement it, (3 the lower average abnormal return after theannouncement of information disclosurse strategy then average abnormalreturn on the date of announcement it.The methodology of this research is expalanatory survey by usingsecondary data and 154 of listing companys at Indonesia StockExchanges as sample size, the sampling method used is a purposiverandom which category only the company sending the disclosures strategyto the Bapepam. The analysist data method is used the marketmodel(Markowitz with the events study -3 days before and +3 days afterat the date announcement of disclosures strategy.The results of these research are (1 the effect of the informationdisclosures strategy to the stocks return is significantly.,(2 the loweraverage abnormal return after the announcement of informationdisclosures strategy then average abnormal return before of theannouncement has an empirical prove, (3 the lower average abnormalreturn after the announcement of information disclosures strategy thenaverage abnormal return on the date of announcement has an empiricalprove .The conclusion of this research are the results of these research isconsistently with the study before, however the assumption is used didnot the efficient market in the semi-strong form, but in the weak-formespecially for the Indonesia Capital Market.

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

ITS primers for the identification of marketable Boletus.

Science.gov (United States)

Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

2006-02-10

Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

SWEET CORN FARMING: THE EFFECT OF PRODUCTION FACTOR, EFFICIENCY AND RETURN TO SCALE

Directory of Open Access Journals (Sweden)

Dwijatenaya I.B.M.A.

2017-10-01

Full Text Available This research aims to determine the effect of production factors on the sweet corn production, the efficiency of sweet corn farming, and the return to scale of sweet corn production. The sampling technique was taken by proportionate stratified random sampling method with the sample number of 57 people while the analyzer used was the program of Frointer 4.1c. The results show that the production factors of the land farm, seed, and fertilizer have a positive and significant effect on sweet corn production. On the other hand, labor production factors have a positive but not significant effect on sweet corn production. It also found that technical efficiency, price efficiency, and economic efficiency of sweet corn farming in Muara Wis Sub-district of Kutai Kartanegara Regency are not efficient yet. The return to scale of sweet corn yield has an increasing return to scale condition.

Return-to-Work Program for Injured Workers: Factors of Successful Return to Employment.

Science.gov (United States)

Awang, Halimah; Shahabudin, Sharifah Muhairah; Mansor, Norma

2016-11-01

This study examined the factors of successful return to employment among participants in the return to work program (RTW) following work-related injury. Data were obtained from the Social Security Organization database containing 9850 injured workers who underwent RTW in 2010 to 2013. About 65% had successfully returned to employment. Significant factors of successful return include gender, employer interest, motivation, age, intervention duration, and type of injury. Male and motivated employees were more likely to return to employment compared with female and unmotivated employees, respectively. Participants from interested employers were 23.22 times more likely to return to work than those from uninterested employers, whereas participants whose intervention period exceeded 5 months were 41% less likely to return to work compared with those whose intervention period was within 3 months. Appropriate strategy and enhanced collaboration between the stakeholders would improve the proportion of successful return to employment. © 2016 APJPH.

The Equity Share in New Issues and Aggregate Stock Returns

OpenAIRE

Malcolm Baker; Jeffrey Wurgler

1999-01-01

The share of equity issues in total new equity and debt issues is a strong predictor of U.S. stock market returns between 1928 and 1997. In particular, firms issue relatively more equity than debt just before periods of low market returns. The equity share in new issues has stable predictive power in both halves of the sample period, and after controlling for other known predictors. We do not find support for efficient market ex

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Regolith X-Ray Imaging Spectrometer (REXIS) Aboard the OSIRIS-REx Asteroid Sample Return Mission

Science.gov (United States)

Masterson, R. A.; Chodas, M.; Bayley, L.; Allen, B.; Hong, J.; Biswas, P.; McMenamin, C.; Stout, K.; Bokhour, E.; Bralower, H.; Carte, D.; Chen, S.; Jones, M.; Kissel, S.; Schmidt, F.; Smith, M.; Sondecker, G.; Lim, L. F.; Lauretta, D. S.; Grindlay, J. E.; Binzel, R. P.

2018-02-01

The Regolith X-ray Imaging Spectrometer (REXIS) is the student collaboration experiment proposed and built by an MIT-Harvard team, launched aboard NASA's OSIRIS-REx asteroid sample return mission. REXIS complements the scientific investigations of other OSIRIS-REx instruments by determining the relative abundances of key elements present on the asteroid's surface by measuring the X-ray fluorescence spectrum (stimulated by the natural solar X-ray flux) over the range of energies 0.5 to 7 keV. REXIS consists of two components: a main imaging spectrometer with a coded aperture mask and a separate solar X-ray monitor to account for the Sun's variability. In addition to element abundance ratios (relative to Si) pinpointing the asteroid's most likely meteorite association, REXIS also maps elemental abundance variability across the asteroid's surface using the asteroid's rotation as well as the spacecraft's orbital motion. Image reconstruction at the highest resolution is facilitated by the coded aperture mask. Through this operation, REXIS will be the first application of X-ray coded aperture imaging to planetary surface mapping, making this student-built instrument a pathfinder toward future planetary exploration. To date, 60 students at the undergraduate and graduate levels have been involved with the REXIS project, with the hands-on experience translating to a dozen Master's and Ph.D. theses and other student publications.

PERAN PROFITABILITAS DAN LIKUIDITAS SERTA DIVIDEN PAYOUT RATIO TERHADAP RETURN SAHAM

Directory of Open Access Journals (Sweden)

Riawan

2016-10-01

Full Text Available This study was conducted to examine the influence of fundamental factors of profitability and liquidity on dividend policy (DPR. And furthermore the influence of profitability, liquidity and dividend policy (DPR to return stock in companies incorporated in the Jakarta Islamic Index listed on the Indonesia Stock Exchange for the period 2010-2013. The sampling technique used in this research is purposive sampling with criteria : (1 It is listed in Indonesia Stock Exchange 2010-2013. (2 It is always seem annual financial statements for the period 2010- 2013. (3 It is always pay dividends. The data required in this study were drawn from the Indonesian Capital Market Directory (ICMD from 2010 to 2013 consisting of 20 companies. Multiple regression analysis of the data. Hypothesis test used the t-statistic at the 5% significance level. The results showed profitability and dividend policy (DPR have a significant effect on stock returns. These results indicate that the performance of the fundamental factors of profitability and dividend payout on stock returns are used by investors to predict stock returns manufacturing companies listed in Indonesia Stock Exchange in2010-2013.

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Classifying Returns as Extreme: European Stock and Bond Markets

DEFF Research Database (Denmark)

Christiansen, Charlotte

whereby a shorter sample period is needed. For the bond markets the simultaneous extreme return variable (used for analyzing integration and contagion of financial markets) is not statistically different for the two schemes. For the stock markets there are differences, but they are disappearing......I consider the stock and bond markets of 14 EU countries. I use two classification schemes for defining extreme returns: One, the existing univariate classification scheme which considers each market separately. Two, the new multivariate classification scheme that considers all the markets jointly...

Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

Directory of Open Access Journals (Sweden)

Warenholt Janina

2011-01-01

Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Bank activity and funding strategies : the impact on risk and returns

OpenAIRE

Demirguc-Kunt, Asli; Huizinga, Harry

2009-01-01

This paper examines the implications of bank activity and short-term funding strategies for bank risk and returns using an international sample of 1,334 banks in 101 countries leading up to the 2007 financial crisis. Expansion into non-interest income generating activities such as trading increases the rate of return on assets, and it may offer some risk diversification benefits at very lo...

26 CFR 1.6013-2 - Joint return after filing separate return.

Science.gov (United States)

2010-04-01

... the case of a joint return made under section 6013(b), the period of limitations provided in sections... (c)(1) of this section, relating to the application of sections 6501 and 6651 with respect to a joint... 26 Internal Revenue 13 2010-04-01 2010-04-01 false Joint return after filing separate return. 1...

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

Mobile/Modular BSL-4 Facilities for Meeting Restricted Earth Return Containment Requirements

Science.gov (United States)

Calaway, M. J.; McCubbin, F. M.; Allton, J. H.; Zeigler, R. A.; Pace, L. F.

2017-01-01

NASA robotic sample return missions designated Category V Restricted Earth Return by the NASA Planetary Protection Office require sample containment and biohazard testing in a receiving laboratory as directed by NASA Procedural Requirement (NPR) 8020.12D - ensuring the preservation and protection of Earth and the sample. Currently, NPR 8020.12D classifies Restricted Earth Return for robotic sample return missions from Mars, Europa, and Enceladus with the caveat that future proposed mission locations could be added or restrictions lifted on a case by case basis as scientific knowledge and understanding of biohazards progresses. Since the 1960s, sample containment from an unknown extraterrestrial biohazard have been related to the highest containment standards and protocols known to modern science. Today, Biosafety Level (BSL) 4 standards and protocols are used to study the most dangerous high-risk diseases and unknown biological agents on Earth. Over 30 BSL-4 facilities have been constructed worldwide with 12 residing in the United States; of theses, 8 are operational. In the last two decades, these brick and mortar facilities have cost in the hundreds of millions of dollars dependent on the facility requirements and size. Previous mission concept studies for constructing a NASA sample receiving facility with an integrated BSL-4 quarantine and biohazard testing facility have also been estimated in the hundreds of millions of dollars. As an alternative option, we have recently conducted an initial trade study for constructing a mobile and/or modular sample containment laboratory that would meet all BSL-4 and planetary protection standards and protocols at a faction of the cost. Mobile and modular BSL-2 and 3 facilities have been successfully constructed and deployed world-wide for government testing of pathogens and pharmaceutical production. Our study showed that a modular BSL-4 construction could result in approximately 90% cost reduction when compared to

The Risk Return Relationship: Evidence from Index Return and Realised Variance Series

OpenAIRE

Minxian Yang

2014-01-01

The risk return relationship is analysed in bivariate models for return and realised variance(RV) series. Based on daily time series from 21 international market indices for more than 13 years (January 2000 to February 2013), the empirical findings support the arguments of risk return tradeoff, volatility feedback and statistical balance. It is reasoned that the empirical risk return relationship is primarily shaped by two important data features: the negative contemporaneous correlation betw...

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

DAMPAK PEMODERASIAN KOMPONEN ARUS KAS TERHADAP HUBUNGAN LABA AKUNTANSI DENGAN RETURN SAHAM

Directory of Open Access Journals (Sweden)

PUTU ARI DHARMA LAKSMI

2009-07-01

Full Text Available Accurate information regarding listed companies is crucial tominimize investment risk. This research aims to examine the effect ofaccounting income on stock return, and the effect of cash flow fromoperation, cash flow from investment, and cash flow from financingactivities respectively as moderating variables on the relationshipbetween accounting income and stock return of manufacturer listedon the Jakarta Stock Exchange.There were 161 manufacturing companies listed during 2001to 2005, and 39 of them are selected as sample research usingpurposive sampling method. With 5 year research period, there are195 observations done. Data then are analyzed using multiple linearregressions.Results show that accounting income affect stock returnsignificantly, which is shown by greater value of t count compare to ttable. While cash flow from operation, investment, and financingactivities are not able to moderate relationship between accountingincome and stock return.

Laboratory simulations of prebiotic molecule stability in the jarosite mineral group; end member evaluation of detection and decomposition behavior related to Mars sample return

Energy Technology Data Exchange (ETDEWEB)

J. Michelle Kotler; Nancy W. Hinman; C. Doc Richardson; Andrew G. Conly; Jill R. Scott

2009-10-01

Recently, the prebiotic amino acid glycine has been found associated with natural jarosite samples from various locations around the world. Since the discovery of jarosite on Mars, extensive research focuses on linking this mineral group with possible detection of biosignatures in the geologic record on Earth and Mars. Multiple analytical methods, including extraction and mass spectrometry techniques have identified glycine and other biomolecules in jarosite samples. The jarosite end members jarosite (sensu stricto-potassium jarosite), natrojarosite (sodium jarosite), and ammoniojarosite (ammonium jarosite) have different thermodynamic stabilities, decompose at different rates, and have potentially different susceptibilities to substitution. Planetary protection issues have led to the suggestion that samples returned from Mars would need to be heat-treated before they could be analyzed on Earth. Although heat treatment of the samples would in theory destroy any potential biosignatures, valuable information can be obtained during thermal treatment by employing gravimetric techniques. The relationship between the thermodynamic stability of the jarosite end members and the effect that glycine has on the thermal decomposition behavior of each end member was investigated using thermal gravimetric analysis. Thermal gravimetric analysis has been suggested as a method capable of providing the heat treatment necessary to provide planetary protection while still providing useful information about the original state and composition of the potentially returned materials. Introducing glycine into the synthesis procedure of the potassium, sodium and ammonium jarosite end-member has elucidated the effects that glycine has on the thermal stability of the mineral group. Potassium jarosite appears to be the least susceptible to the effects of glycine, with the sodium and ammonium end members showing marked changes in thermal decomposition behavior and decomposition rates. In

Microbial community analysis of shallow subsurface samples with PCR-DGGE

Energy Technology Data Exchange (ETDEWEB)

Itaevaara, M.; Suihko, M. -L.; Kapanen, A.; Piskonen, R.; Juvonen, R. [VTT Biotechnology, Espoo (Finland)

2005-11-15

This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing

Microbial community analysis of shallow subsurface samples with PCR-DGGE

International Nuclear Information System (INIS)

Itaevaara, M.; Suihko, M.-L.; Kapanen, A.; Piskonen, R.; Juvonen, R.

2005-11-01

This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing

US Implied Volatility as A predictor of International Returns

Directory of Open Access Journals (Sweden)

Mehmet F. Dicle

2017-12-01

Full Text Available This study provides evidence of the US implied volatility’s e ect on international equitymarkets’ returns. This evidence has two main implications: i investors may find that foreign equityreturns adjusting to US implied volatility may not provide true diversification benefits, and ii foreignequity returns may be predicted using US implied volatility. Our sample includes US volatility index(VIX and major equity indexes in twenty countries for the period between January, 2000 throughJuly, 2017. VIX leads eighteen of the international markets and Granger causes seventeen of themarkets after controlling for the S&P-500 index returns and the 2007/2008 US financial crisis. USinvestors looking to diversify US risk may find that international equities may not provide intendeddiversification benefits. Our evidence provides support for predictability of international equity returnsbased on US volatility.

Costs and return analysis in rubber latex production in Edo State ...

African Journals Online (AJOL)

The study examined the costs and return analysis in rubber latex production in Edo Sate, Nigeria. Multi-stage sampling method was adopted to select 96 smallholder rubber framers for the study. The first stage was a purposive sampling of two LGAs and then simple random sampling of 6 villages each from the two LGA.

Out-of-sample Forecasting Performance of Won/Dollar Exchange Rate Return Volatility Model

Directory of Open Access Journals (Sweden)

Hojin Lee

2009-06-01

Full Text Available We compare the out-of-sample forecasting performance of volatility models using daily exchange rate for the KRW/USD during the period from 1992 to 2008. For various forecasting horizons, historical volatility models with a long memory tend to make more accurate forecasts. Especially, we carefully observe the difference between the EWMA and the GARCH(1,1 model. Our empirical finding that the GARCH model puts too much weight on recent observations relative to those in the past is consistent with prior evidence showing that asset market volatility has a long memory, such as Ding and Granger (1996. The forecasting model with the lowest MSFE and VaR forecast error among the models we consider is the EWMA model in which the forecast volatility for the coming period is a weighted average of recent squared return with exponentially declining weights. In terms of forecast accuracy, it clearly dominates the widely accepted GARCH and rolling window GARCH models. We also present a multiple comparison of the out-of-sample forecasting performance of volatility using the stationary bootstrap of Politis and Romano (1994. We find that the White's reality check for the GARCH(1,1 expanding window model and the FIGARCH(1,1 expanding window model clearly reject the null hypothesis and there exists a better model than the two benchmark models. On the other hand, when the EWMA model is the benchmark, the White's for all forecasting horizons are very high, which indicates the null hypothesis may not be rejected. The Hansen's report the same results. The GARCH(1,1 expanding window model and the FIGARCH(1,1 expanding window model are dominated by the best competing model in most of the forecasting horizons. In contrast, the RiskMetrics model seems to be the most preferred. We also consider combining the forecasts generated by averaging the six raw forecasts and a trimmed set of forecasts which calculate the mean of the four forecasts after disregarding the highest and

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

The Prevalence of Norovirus in returning international travelers with diarrhea

Directory of Open Access Journals (Sweden)

Löscher Thomas

2010-05-01

Full Text Available Abstract Background There is a high incidence of diarrhea in traveling populations. Norovirus (NV infection is a common cause of diarrhea and is associated with 7% of all diarrhea related deaths in the US. However, data on the overall prevalence of NV infection in traveling populations is limited. Furthermore, the prevalence of NV amongst travelers returning to Europe has not been reported. This study determined the prevalence of NV among international travelers returning to Germany from over 50 destinations in and outside Europe. Methods Stool samples of a total of 104 patients with a recent ( Results In our cohort, NV infection was detected in 15.7% of returning travelers with diarrhea. The closer to the date of return symptoms appeared, the higher the incidence of NV, ranging as high as 21.2% within the first four days after return. Conclusions In our cohort, NV infection was shown to be frequent among returning travelers especially in those with diarrhea, with over 1/5 of diarrhea patients tested positive for NV within the first four days after their return to Germany. Due to this prevalence, routine testing for NV infection and hygienic precautions may be warranted in this group. This is especially applicable to patients at an increased risk of spreading the disease, such as healthcare workers, teachers or food-handlers.

The Impact of Fund Attrition on Superannuation Returns

OpenAIRE

Drew, Michael E.; Stanford, Jon D.

2001-01-01

This paper investigates the impact of fund attrition on returns from a sample of superannuation fund managers (specialising in the management of domestic stock portfolios) for the period 1991 through 1999, using a four-factor asset pricing model. Survivorship bias is estimated at 23 basis points per annum. The evidence presented in this study is consistent with recent international evidence that suggests that a sampling technique that excludes terminated funds would result in an overestimatio...

Control Basado en Eventos de Sistemas de Primer Orden Con Retardo

Directory of Open Access Journals (Sweden)

Ángel Ruiz

2013-07-01

Full Text Available Resumen: La teoría de control PID en su vertiente discreta, apoyándose en una gestión periódica de los muestreos (eventos planificados en tiempo se considera un área madura dentro del paradigma del control automático. Por el contrario, la planificación por eventos deriva, casi inevitablemente, en muestreos asíncronos planteando, problemas adicionales que necesitan ser caracterizados y estudiados. Bajo este escenario, aspectos como la sintonía de los controladores y las condiciones para la estabilidad global o la ausencia de ciclos límite siguen siendo temas que todavía están lejos de ser completamente resueltos. Con el trabajo actual se presenta un nuevo esquema de muestreo y control basado en eventos para sistemas de primer orden con retardo para el que se han analizado los aspectos anteriores. El esquema se basa en el Predictor de Smith para la compensación de los retardos, y en el algoritmo de muestreo SSOD (Symmetric Send- On-Delta para la generación de los eventos. En base a este esquema, se desarrolla el análisis de estabilidad y se propone una metodología de sintonía con una interpretación intuitiva y eficaz. Abstract: PID control theory based on periodic managing of samples has become a well-known area in automatic control. Asynchronous sampling inherent to event-based scheduling causes non-linear dynamics. Under this situation, complex problems arise that must be studied. Issues such as controller tuning, conditions for global stability and the absence of limit cycles are topics that are far from being fully solved yet. In this work, a new event-based scheme of sampling and control for FOPTD processes is presented. The scheme is based on the Smith Predictor structure for delay compensation and the SSOD (Symmetric-Send-On- Delta scheme for events generation. By means of the proposed scheme, a stability analysis is addressed and a simple tuning methodology with effective interpretation is proposed. Palabras clave

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Spearman's "law of diminishing returns" and the role of test reliability investigated in a large sample of Danish military draftees

DEFF Research Database (Denmark)

Teasdale, Thomas William; Hartmann, P.

2005-01-01

The present article investigates Spearman's "Law of Diminishing Returns" (SLODR), which hypothesizes that the g saturation for cognitive tests is lower for high ability subjects than for low ability subjects. This hypothesis was tested in a large sample of Danish military draftees (N = 6757) who...... were representative of the young adult male population, aged 18-19, and tested with a group-administered intelligence test comprised of four subtests. The aim of the study was twofold. The first was to reproduce previous SLODR findings by the present authors. This was done by replicating...... in reliability could account for the difference in g saturation across ability groups. The results showed that the reliability was larger for the High ability group, thereby not explaining the present findings....

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Cross sectional moments and portfolio returns: Evidence for select emerging markets

Directory of Open Access Journals (Sweden)

Sanjay Sehgal

2016-09-01

Full Text Available Research does not indicate a consensus on the relationship between idiosyncratic volatility and asset returns. Moreover, the role of cross sectional higher order moments in predicting market returns is relatively unexplored. We show that the cross sectional volatility measure suggested by Garcia et al. is highly correlated with alternative measures of idiosyncratic volatility constructed as variance of errors from the capital asset pricing model and the Fama French model. We find that cross sectional moments help in predicting aggregate market returns in some sample countries and also provide information for portfolio formation, which is more consistent for portfolios sorted on sensitivity to cross sectional skewness.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

Directory of Open Access Journals (Sweden)

Zhiyuan Wu

2014-01-01

Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

Science.gov (United States)

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

The Effect of Stock Return Sequences on Trading Volumes

Directory of Open Access Journals (Sweden)

Andrey Kudryavtsev

2017-10-01

Full Text Available The present study explores the effect of the gambler’s fallacy on stock trading volumes. I hypothesize that if a stock’s price rises (falls during a number of consecutive trading days, then the gambler’s fallacy may cause at least some of the investors to expect that the stock’s price “has” to subsequently fall (rise, and thus, to increase their willingness to sell (buy the stock, resulting in a stronger degree of disagreement between the investors and a higher-than-usual stock trading volume on the first day when the stock’s price indeed falls (rises. Employing a large sample of daily price and trading volume data, I document that following relatively long sequences of the same-sign stock returns, on the days when the sign is reversed, the trading activity in the respective stocks is abnormally high. Moreover, average abnormal trading volumes gradually and significantly increase with the length of the preceding return sequence. The effect is slightly more pronounced following the sequences of negative stock returns, and remains significant after controlling for other potentially influential factors, including contemporaneous and lagged actual and absolute stock returns, historical stock returns and volatilities, and company-specific events, such as earnings announcements and dividend payments.

Analisis Karakteristik Perusahaan Dan Ekonomi Makro Pada Return Saham Syariah Dan Non Syariah

Directory of Open Access Journals (Sweden)

Ardi Hamzah

2011-10-01

Full Text Available The objectives of this paper are to determine, to examine, and to test whether firm characteristic and macro economics are the important discriminators for return of syariah and non syariah stock; to determine whether there are any differences in return of some syariah and non syariah stock; to determine and to test whether there is a relationship between return and firm characteristic and macro economis in some syariah and non syariah stock. The total sample is 300 stock that were taken each from 150 for syariah stock and 150 for non syariah stock for period 2005 – 2009. The study also showed that there is a difference in return between syariah and non syariah stock. Finally,with regression analysis indicated that partially price book value, price earnings ratio, and kurs rupiah on dollar significantly effect on return of syariah stock, while for return of non syariah stock only kurs rupiah on dollar that significantly effect on return of non syariah stock. For testing with simultant regression indicate firm characteristic and macro economics significantly effect on return of syariah stock, while at return of non syariah stock not significantly effect.

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Comparison of shear bond strength of orthodontic brackets bonded using two different hydrophilic primers: An in vitro study

Directory of Open Access Journals (Sweden)

M Kumaraswamy Anand

2014-01-01

Full Text Available Context: Salivary control and maintenance of a dry operating field is a prime requisite of orthodontic bonding. Moisture insensitive primer (MIP with a clinical significant bond strength values have a better edge over the conventional hydrophobic bonding systems. Aim: The aim of this study is to investigate the effectiveness of two hydrophilic primers with respect to conventional hydrophobic primer by comparing their shear bond strength (SBS and adhesive-failure locations after contamination with saliva and saliva substitute. Materials and Methods: A total of 150 extracted human premolars were randomly divided into five group s ; Group A (Transbond MIP/saliva substitute, Group B (Opal Primo/saliva substitute, Group C (Transbond MIP/natural saliva, Group D (Opal Primo/natural saliva, control group - Group E (Transbond XT/dry, adhesive-Transbond XT used for all five groups and bonded using stainless steel brackets. Shear forces were applied to the samples with a universal testing machine. SBSs was measured in megapascals. The mode of bond failure was determined using the adhesive remnant index (ARI. Results: The mean SBS produced by Transbond MIP was higher than Opal Primo, which was statistically significant according to one-way analysis of variance. Both the tested groups showed lesser bond strength values than Transbond XT (the control. ARI scores revealed that there was no statistically significant difference in the site of bond failure between study groups. ARI scores were found to be lower for study groups suggesting adhesive failure, compared to higher ARI scores for the control group suggesting cohesive failure. Conclusion: Transbond XT adhesive with Transbond MIP or Opal Primo have clinically acceptable bond strength in wet fields. Opal Primo is a viable option to use as a hydrophilic primer clinically.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

Analyzing traffic source impact on returning visitors ratio in information provider website

Science.gov (United States)

Prasetio, A.; Sari, P. K.; Sharif, O. O.; Sofyan, E.

2016-04-01

Web site performance, especially returning visitor is an important metric for an information provider web site. Since high returning visitor is a good indication of a web site’s visitor loyalty, it is important to find a way to improve this metric. This research investigated if there is any difference on returning visitor metric among three web traffic sources namely direct, referral and search. Monthly returning visitor and total visitor from each source is retrieved from Google Analytics tools and then calculated to measure returning visitor ratio. The period of data observation is from July 2012 to June 2015 resulting in a total of 108 samples. These data then analysed using One-Way Analysis of Variance (ANOVA) to address our research question. The results showed that different traffic source has significantly different returning visitor ratio especially between referral traffic source and the other two traffic sources. On the other hand, this research did not find any significant difference between returning visitor ratio from direct and search traffic sources. The owner of the web site can focus to multiply referral links from other relevant sites.

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

Perbandingan Kinerja Reksadana Syariah Dan Reksadana Konvensional Ditinjau Berdasarkan Tingkat Risk And Return

Directory of Open Access Journals (Sweden)

Chaidir Iswanaji

2016-08-01

Abstract                This study aims to determine the risk level of the comparison between Islamic and conventional mutual funds and to compare the rate of return between Islamic and conventional mutual funds.                This study uses comparative test two samples by using two-sample t-test to determine whether there are differences in the level of risk and return between Islamic mutual funds and conventional funds and then further testing data using SPSS.16 The first hypothesis testing results show that the average risk Islamic and conventional mutual funds do not have significant difference Likewise with hypothesis testing further showed that the average return fixed income funds Islamic and conventional is not a significant difference                Although there are no differences were significant between risk and return of test results of the study, the percentage Islamic mutual funds were able to outperform on the rate of return greater than the return of funds of conventional and also in terms of risk with a rate that is smaller when compared with the risk in the fund conventional , it is hoped this may be a consideration for investors in selecting mutual funds to invest. Key words : Islamic mutual funds, conventional mutual funds, risk and retur

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Returns to nursing education: rural and nonrural practice.

Science.gov (United States)

Pan, S; Straub, L

1997-01-01

This study uses data from a national sample of registered nurses to compare earnings of nurses in rural and nonrural practice. The comparisons, conditioned by the nurses' education level, are analogous to the concept of "returns to human capital investment" used in labor economics. A general linear model is applied within a framework of labor economics analysis. Results show that nurses with more education receive less for their investment if they practice in rural areas. Work experience and employment setting are also related to lower annualized earnings for rural practice. One exception to the otherwise consistent findings is that returns to advanced practice nursing are higher in rural areas. Results and policy implications are discussed.

Curating NASA's future extraterrestrial sample collections: How do we achieve maximum proficiency?

Science.gov (United States)

McCubbin, Francis; Evans, Cynthia; Allton, Judith; Fries, Marc; Righter, Kevin; Zolensky, Michael; Zeigler, Ryan

2016-07-01

Introduction: The Astromaterials Acquisition and Curation Office (henceforth referred to herein as NASA Curation Office) at NASA Johnson Space Center (JSC) is responsible for curating all of NASA's extraterrestrial samples. Under the governing document, NASA Policy Directive (NPD) 7100.10E "Curation of Extraterrestrial Materials", JSC is charged with "The curation of all extraterrestrial material under NASA control, including future NASA missions." The Directive goes on to define Curation as including "…documentation, preservation, preparation, and distribution of samples for research, education, and public outreach." Here we describe some of the ongoing efforts to ensure that the future activities of the NASA Curation Office are working to-wards a state of maximum proficiency. Founding Principle: Curatorial activities began at JSC (Manned Spacecraft Center before 1973) as soon as design and construction planning for the Lunar Receiving Laboratory (LRL) began in 1964 [1], not with the return of the Apollo samples in 1969, nor with the completion of the LRL in 1967. This practice has since proven that curation begins as soon as a sample return mission is conceived, and this founding principle continues to return dividends today [e.g., 2]. The Next Decade: Part of the curation process is planning for the future, and we refer to these planning efforts as "advanced curation" [3]. Advanced Curation is tasked with developing procedures, technology, and data sets necessary for curating new types of collections as envisioned by NASA exploration goals. We are (and have been) planning for future curation, including cold curation, extended curation of ices and volatiles, curation of samples with special chemical considerations such as perchlorate-rich samples, curation of organically- and biologically-sensitive samples, and the use of minimally invasive analytical techniques (e.g., micro-CT, [4]) to characterize samples. These efforts will be useful for Mars Sample Return

Kinerja Lingkungan Terhadap Return on Asset Melalui Corporate Social Responsibility Discloure

OpenAIRE

Restuningdiah, Nurika

2010-01-01

The purpose of this research was to examine the impact of environmental perfor-mance to Corporate Social Responsibility (CSR) disclosure, the impact of CSR disclosure toReturn on Asset, and the undirect impact of of environmental performance to Return onAsset through CSR disclosure. Path Analysis of 18 public companies listed in Indonesia StockExchange and participated in the Proper Program from 2007 -2008 through a judgment sam-pling technique indicated that environmental performance had a p...

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

KINERJA LINGKUNGAN TERHADAP RETURN ON ASSET MELALUI CORPORATE SOCIAL RESPONSIBILITY DISCLOURE

Directory of Open Access Journals (Sweden)

Nurika Restuningdiah

2017-03-01

Full Text Available The purpose of this research was to examine the impact of environmental perfor-mance to Corporate Social Responsibility (CSR disclosure, the impact of CSR disclosure toReturn on Asset, and the undirect impact of of environmental performance to Return onAsset through CSR disclosure. Path Analysis of 18 public companies listed in Indonesia StockExchange and participated in the Proper Program from 2007 -2008 through a judgment sam-pling technique indicated that environmental performance had a positive effect to Corpo-rate Social Responsibility (CSR disclosure. The CSR disclosure had the positive impact toReturn on Asset, but the environmental performance had a negative effect to Return onAsset. This study also showed that there was positive undirect impact of environmentalperformance to Return on Asset through CSR disclosure. The implication of this study wasrelevant for public companies to publish their environmental performance on their annualreport (CSR Disclosure in order to give the “good news” to the public, and get the “goodimage” to increase sales.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Socioeconomic Status and Self-Rated Oral Health; Diminished Return among Hispanic Whites.

Science.gov (United States)

Assari, Shervin

2018-04-24

Background. An extensive body of knowledge has documented weaker health effects of socio-economic status (SES) for Blacks compared to Whites, a phenomenon also known as Blacks’ diminished return. It is, however, unknown whether the same diminished return also holds for other ethnic minorities such as Hispanics or not. Aim. Using a nationally representative sample, the current study aimed to compare Non-Hispanic and Hispanic Whites for the effects of SES on self-rated oral health. Methods. For the current cross-sectional study, we used data from the Collaborative Psychiatric Epidemiology Surveys (CPES), 2001⁻2003. With a nationally representative sampling, CPES included 11,207 adults who were either non-Hispanic Whites ( n = 7587) or Hispanic Whites ( n = 3620. The dependent variable was self-rated oral health, treated as dichotomous measure. Independent variables were education, income, employment, and marital status. Ethnicity was the focal moderator. Age and gender were covariates. Logistic regressions were used for data analysis. Results. Education, income, employment, and marital status were associated with oral health in the pooled sample. Although education, income, employment, and marital status were associated with oral health in non-Hispanic Whites, none of these associations were found for Hispanic Whites. Conclusion. In a similar pattern to Blacks’ diminished return, differential gain of SES indicators exists between Hispanic and non-Hispanic Whites, with a disadvantage for Hispanic Whites. Diminished return of SES should be regarded as a systemically neglected contributing mechanism behind ethnic oral health disparities in the United States. Replication of Blacks’ diminished return for Hispanics suggests that these processes are not specific to ethnic minority groups, and non-White groups gain less because they are not enjoying the privilege and advantage of Whites.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

Science.gov (United States)

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Planning Considerations Related to Collecting and Analyzing Samples of the Martian Soils

Science.gov (United States)

Liu, Yang; Mellon, Mike T.; Ming, Douglas W.; Morris, Richard V.; Noble, Sarah K.; Sullivan, Robert J.; Taylor, Lawrence A.; Beaty, David W.

2014-01-01

The Mars Sample Return (MSR) End-to-End International Science Analysis Group (E2E-iSAG [1]) established scientific objectives associ-ated with Mars returned-sample science that require the return and investigation of one or more soil samples. Soil is defined here as loose, unconsolidated materials with no implication for the presence or absence of or-ganic components. The proposed Mars 2020 (M-2020) rover is likely to collect and cache soil in addition to rock samples [2], which could be followed by future sample retrieval and return missions. Here we discuss key scientific consid-erations for sampling and caching soil samples on the proposed M-2020 rover, as well as the state in which samples would need to be preserved when received by analysts on Earth. We are seeking feedback on these draft plans as input to mission requirement formulation. A related planning exercise on rocks is reported in an accompanying abstract [3].

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

Science.gov (United States)

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Habit Formation, Surplus Consumption and Return Predictability: International Evidence

DEFF Research Database (Denmark)

Engsted, Tom; Hyde, Stuart; Møller, Stig V.

On an international post World War II dataset, we use an iterated GMM pro- cedure to estimate and test the Campbell-Cochrane (1999) habit formation model. In addition, we analyze the predictive power of the surplus consumption ratio for future asset returns. We find that, although...... there are important cross-country differences, for the majority of countries in our sample the model gets empirical support in a variety of diffrent dimensions, including reasonable estimates of risk- free rates, and the model dominates the time-separable power utility model in terms of pricing errors. Further...... ratio is also a powerful predictor of future bond returns....

Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

Science.gov (United States)

Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

2001-01-01

We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

IMPLIKASI KOMPONEN LAPORAN ARUS KAS, LABA KOTOR, DAN SIZE PERUSAHAAN TERHADAP EXPECTED RETURN SAHAM

Directory of Open Access Journals (Sweden)

Totok Sasongko

2017-03-01

Full Text Available Expected return of an investment was the probabilit y rate dist ribut ion on invest -ment returns. Although investors (stockholders did not know exact ly what rate of returnthey would get , they had base on their decisions to invest . Work performance measurementused by stockholders in investment decisions were prof it and cash f low. Besides, investorsalso considered company f inancial characterist ic like company size. The main purpose of thisresearch was to analyze the implicat ion of informat ion cash f low statement , gross prof it ,company size toward expected stock return. Populat ion of this research was manufacturecompanies listed at Jakarta Stock Exchange. The sample was selected by purposive sampling.The analysis data used was a mult i linear regression. The result showed that simultaneously,cash f low component , gross prof it and company size had signif icant ef fect to stock expectedreturns. But part ially, the cash f low f rom operat ion and f inancing didn’t have signif icantef fect to stock expected returns.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Predictability of Stock Returns

Directory of Open Access Journals (Sweden)

Ahmet Sekreter

2017-06-01

Full Text Available Predictability of stock returns has been shown by empirical studies over time. This article collects the most important theories on forecasting stock returns and investigates the factors that affecting behavior of the stocks’ prices and the market as a whole. Estimation of the factors and the way of estimation are the key issues of predictability of stock returns.

International Sign Predictability of Stock Returns: The Role of the United States

DEFF Research Database (Denmark)

Nyberg, Henri; Pönkä, Harri

from the U.S. to foreign markets. We introduce a new bivariate probit model that allows for such a contemporaneous predictive linkage from one market to the other. Our in-sample and out-of-sample forecasting results indicate superior predictive performance of the new model over the competing models...... by statistical measures and market timing performance, suggesting gradual diffusion of predictive information from the U.S. to the other markets.......We study the directional predictability of monthly excess stock market returns in the U.S. and ten other markets using univariate and bivariate binary response models. Our main interest is on the potential benefits of predicting the signs of the returns jointly, focusing on the predictive power...

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381