
Sample records for samarium 164

  1. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele


    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  2. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.


    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  3. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)


    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  4. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry


    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  5. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J


    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  6. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  7. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  8. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)


    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  9. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  10. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  11. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment. (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna


    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail:


    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  13. Samarium Monosulfide (SmS): Reviewing Properties and Applications


    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  14. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  15. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail:; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)


    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  16. Ionization of Samarium by Chemical Releases in the Upper Atmosphere (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.


    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  17. Reactive Materials for Evaporating Samarium (Pre-Print) (United States)


    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  18. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  19. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)


    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  20. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.


    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  1. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes


    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  2. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)


    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  3. 46 CFR 164.003-2 - Grades. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Grades. 164.003-2 Section 164.003-2 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Kapok, Processed § 164.003-2 Grades. (a) Processed kapok shall be of but one grade as in...

  4. 40 CFR 164.31 - Intervention. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Intervention. 164.31 Section 164.31... REGISTER, CANCELLATIONS OF REGISTRATIONS, CHANGES OF CLASSIFICATIONS, SUSPENSIONS OF REGISTRATIONS AND... (Other Than Expedited Hearings) Appearances, Intervention, and Consolidation § 164.31 Intervention. (a...

  5. 40 CFR 164.123 - Emergency order. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Emergency order. 164.123 Section 164... Hearings § 164.123 Emergency order. (a) Whenever the Environmental Appeals Board determines that an emergency exists that does not permit him to hold a hearing before suspension, the Environmental Appeals...

  6. 32 CFR 935.164 - Boat operations. (United States)


    ... 32 National Defense 6 2010-07-01 2010-07-01 false Boat operations. 935.164 Section 935.164 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE TERRITORIAL AND INSULAR REGULATIONS WAKE ISLAND CODE Public Safety § 935.164 Boat operations. The operator of each boat used at Wake...

  7. 40 CFR 164.6 - Time. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Time. 164.6 Section 164.6 Protection... OTHER HEARINGS CALLED PURSUANT TO SECTION 6 OF THE ACT General § 164.6 Time. (a) Computation. In computing any period of time prescribed or allowed by these rules, except as otherwise provided, the day of...

  8. 45 CFR 164.314 - Organizational requirements. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Organizational requirements. 164.314 Section 164.314 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED... Information § 164.314 Organizational requirements. (a)(1) Standard: Business associate contracts or other...

  9. 45 CFR 164.105 - Organizational requirements. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Organizational requirements. 164.105 Section 164.105 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY General Provisions § 164.105 Organizational requirements. (a)(1) Standard...

  10. 46 CFR 164.015-2 - Types. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Types. 164.015-2 Section 164.015-2 Shipping COAST GUARD... APPROVAL MATERIALS Plastic Foam, Unicellular, Buoyant, Sheet and Molded Shape § 164.015-2 Types. (a..., polymer or copolymer plastic foam shall be of three types as follows: Type A—for life preservers, buoyant...

  11. 46 CFR 164.012-10 - Requirements. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Requirements. 164.012-10 Section 164.012-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Interior Finishes for Merchant Vessels § 164.012-10 Requirements. (a) For...

  12. 21 CFR 164.150 - Peanut butter. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Peanut butter. 164.150 Section 164.150 Food and... § 164.150 Peanut butter. (a) Peanut butter is the food prepared by grinding one of the shelled and... preservatives, and color additives are not suitable ingredients in peanut butter. Oil products used as optional...

  13. Optical analysis of samarium doped sodium bismuth silicate glass. (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V


    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Samarium Monosulfide (SmS): Reviewing Properties and Applications. (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  15. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)


    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  16. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)


    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  17. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations. (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich


    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. 46 CFR 164.006-2 - Grades. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Grades. 164.006-2 Section 164.006-2 Shipping COAST GUARD... APPROVAL MATERIALS Deck Coverings for Merchant Vessels § 164.006-2 Grades. (a) Deck coverings shall be of but one grade as specified in this subpart, and shall be known as “an approved deck covering.” (b) ...

  19. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  20. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.


    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  1. 40 CFR 152.164 - Classification procedures. (United States)


    ... physical properties, in common. (b) Classification reviews. The Agency may conduct classification reviews... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Classification procedures. 152.164... PESTICIDE REGISTRATION AND CLASSIFICATION PROCEDURES Classification of Pesticides § 152.164 Classification...

  2. 46 CFR 164.018-3 - Classification. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Classification. 164.018-3 Section 164.018-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS... Classification. The following types of retroreflective material are approved under this specification: (a) Type I...

  3. 27 CFR 17.164 - Production record. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Production record. 17.164... PRODUCTS Records § 17.164 Production record. (a) General. Each manufacturer shall keep a production record for each batch of intermediate product and for each batch of nonbeverage product. The production...

  4. 45 CFR 164.312 - Technical safeguards. (United States)


    ... specifications: (i) Unique user identification (Required). Assign a unique name and/or number for identifying and...) Implementation specification: Mechanism to authenticate electronic protected health information (Addressable... Information § 164.312 Technical safeguards. A covered entity must, in accordance with § 164.306: (a)(1...

  5. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot


    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  6. Solar nebula heterogeneity in p-process samarium and neodymium isotopes. (United States)

    Andreasen, Rasmus; Sharma, Mukul


    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  7. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)


    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  8. A temporal three-dimensional simulation of samarium release in the ionosphere (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li


    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  9. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare


    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  10. 45 CFR 164.406 - Notification to the media. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Notification to the media. 164.406 Section 164.406... § 164.406 Notification to the media. (a) Standard. For a breach of unsecured protected health... the discovery of the breach as provided in § 164.404(a)(2), notify prominent media outlets serving the...

  11. Non-Rotational States of 164Dy (United States)

    Běrziņš, J.; Bondarenko, V.; Krasta, T.; Hoyler, F.; Föhl, K.; Börner, H. G.; Krusche, B.; Robinson, S. J.; Schillenbeck, P.


    The level scheme of 164Dy up to about 2.6 MeV energy is analyzed, using experimental data obtained in (n, γ), (n, e-) and (n, nγγ) reaction measurements at the high-flux reactor ILL Grenoble, as well as the (n, n'γ) reaction data, measured at the IRT reactor in Salaspils. The structure of low-lying levels of 164Dy is interpreted in terms of two-quasiparticle states, interacting with collective excitations of axially-deformed core.

  12. Dicty_cDB: SLJ164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ164 (Link to dictyBase) - - - Contig-U10711-1 SLJ164Z (Link... to Original site) - - SLJ164Z 229 - - - - Show SLJ164 Library SL (Link to library) Clone ID SLJ164 (Link Representative seq. ID SLJ16...4Z (Link to Original site) Representative DNA sequence >SLJ164 (SLJ164Q) /CSM/SL/SLJ1-C/SLJ164Q.Seq.d/ XXXXX...M-cDNA Score E Sequences producing significant alignments: (bits) Value VSE426 (VSE426Q) /CSM/VS/VSE4-B/VSE426Q.Seq.d/ 454 e-127 SLJ

  13. 45 CFR 164.530 - Administrative requirements. (United States)


    ... by the notice required by § 164.520. (2) Implementation specification: Personnel designations. A... workforce on the policies and procedures with respect to protected health information required by this...) Implementation specification: Safeguards. A covered entity must reasonably safeguard protected health information...

  14. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones. (United States)

    Molander, Gary A; St Jean, David J


    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  15. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani


    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  16. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra


    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  17. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha


    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  18. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223. (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric


    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  19. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  20. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail:; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  1. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail:


    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  2. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  3. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin


    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  4. Brucellosis: a retrospective evaluation of 164 cases. (United States)

    Kazak, Esra; Akalın, Halis; Yılmaz, Emel; Heper, Yasemin; Mıstık, Reşit; Sınırtaş, Melda; Özakın, Cüneyt; Göral, Güher; Helvacı, Safiye


    Brucellosis is a public health problem that is prevalent in several developing countries. The clinical and laboratory characteristics of 164 cases of brucellosis in Bursa, Turkey, were retrospectively evaluated. The ages of the 164 patients ranged from 15-85 years. All of the patients underwent the Rose Bengal test and 163 (99.4%) patients tested positive. 122 (74.4%) patients were diagnosed with acute brucellosis, 31 (18.9%) with subacute brucellosis and 11 (6.7%) with chronic brucellosis. Focal involvement was found in 101 (61.6%) patients. Although patients with focal involvement had a higher white blood cell count (p = 0.002), those without focal involvement had higher aspartate transaminase and alanine transaminase values, and lower platelet values (p = 0.005, 0.007 and 0.039, respectively). Spondylodiscitis was observed on imaging in 58 (66.7%) of the 87 patients who presented with back pain. Among the 118 patients who were examined within the first month of treatment, 79 (66.9%) responded to treatment. The relapse rate was 11.6% among all 164 patients. Brucellosis should be considered as a differential diagnosis among patients who present with fever, and joint or back pain. Focal involvement should be investigated in the presence of leucocytosis, and subacute or chronic forms of brucellosis. To identify cases of spondylodiscitis, radiography should be performed in patients who present with back pain.

  5. 45 CFR 164.404 - Notification to individuals. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Notification to individuals. 164.404 Section 164... § 164.404 Notification to individuals. (a) Standard—(1) General rule. A covered entity shall, following the discovery of a breach of unsecured protected health information, notify each individual whose...

  6. 45 CFR 164.106 - Relationship to other parts. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Relationship to other parts. 164.106 Section 164.106 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY General Provisions § 164.106 Relationship to other parts. In complying with...

  7. 33 CFR 164.41 - Electronic position fixing devices. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Electronic position fixing devices. 164.41 Section 164.41 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) PORTS AND WATERWAYS SAFETY NAVIGATION SAFETY REGULATIONS § 164.41 Electronic position...

  8. 19 CFR 191.164 - Return to Customs custody. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Return to Customs custody. 191.164 Section 191.164... to Sample or Specifications § 191.164 Return to Customs custody. There is no time limit for the return to Customs custody of distilled spirits, wine, or beer subject to refund of taxes under the...

  9. 46 CFR 164.008-4 - Test requirements. (United States)


    ...: SPECIFICATIONS AND APPROVAL MATERIALS Bulkhead Panels § 164.008-4 Test requirements. (a) Thermal insulation: The insulation value of the specimens for the full scale test shall be such that the average temperature of... 46 Shipping 6 2010-10-01 2010-10-01 false Test requirements. 164.008-4 Section 164.008-4 Shipping...

  10. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)


    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  11. Dicty_cDB: SHK164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available (Link to library) SHK164 (Link to dictyBase) - G23215 DDB0235267 Contig-U15795-1 - (Link to Original site)...Show SHK164 Library SH (Link to library) Clone ID SHK164 (Link to dictyBase) Atlas ID - NBRP ID G23215 dictyBase...dictyBase ID DDB0235267 Link to Contig Contig-U15795-1 Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >SHK164...XXXXXXXXXXGATCAGTAGCTCAGAATAAAACAATTGGATCAGGTAAAATGTTATCAATT AATATTGGTGCTAAAGAATACTTGGATTCTTATTCAACTAAATATCCATCGGTAGAAATC

  12. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail:


    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  13. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline


    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  14. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li


    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  15. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.


    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  16. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium. (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan


    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  17. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas


    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI:

  18. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1. (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru


    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  19. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail:; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)


    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  20. 40 CFR 164.1 - Number of words. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Number of words. 164.1 Section 164.1... OTHER HEARINGS CALLED PURSUANT TO SECTION 6 OF THE ACT General § 164.1 Number of words. As used in this part, a word in the singular form shall be deemed to import the plural, and vice versa, as the case may...

  1. Structural and luminescence properties of samarium doped lead alumino borate glasses (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet


    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  2. 33 CFR 164.80 - Tests, inspections, and voyage planning. (United States)


    ... planning. 164.80 Section 164.80 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND..., and voyage planning. (a) The owner, master, or operator of each towing vessel of less than 1,600 GT... applicable; of chafing gear; and of the winch brake, if installed. (c)(1) The voyage-planning requirements...

  3. 46 CFR 164.009-17 - Density measurement. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Density measurement. 164.009-17 Section 164.009-17... measurement. (a) The measurements described in this section are made to determine the density of a sample. (b... the specimen. The average of at least four measurements of each dimension is determined. (c) If the...

  4. 33 CFR 164.03 - Incorporation by reference. (United States)


    ... Identification System (AIS), dated January 6, 2003 164.46 SOLAS, International Convention for Safety of Life at..., (SOLAS 2000 Amendments) 164.46 Conference resolution 1, Adoption of amendments to the Annex to the International Convention for the Safety of Life at Sea, 1974, and amendments to Chapter V of SOLAS 1974, adopted...

  5. 49 CFR 176.164 - Fire precautions and firefighting. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Fire precautions and firefighting. 176.164 Section... Detailed Requirements for Class 1 (Explosive) Materials Precautions During Loading and Unloading § 176.164 Fire precautions and firefighting. (a) Matches, lighters, fire, and other ignition sources are...

  6. 46 CFR 164.003-3 - Material and workmanship. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Material and workmanship. 164.003-3 Section 164.003-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS... not permitted. Provision shall be made for trapping seeds and heavy objects in gravity traps and the...

  7. 7 CFR 457.164 - Nursery rehabilitation endorsement. (United States)


    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Nursery rehabilitation endorsement. 457.164 Section... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.164 Nursery rehabilitation endorsement. Nursery Crop Insurance Rehabilitation Endorsement If you elect this endorsement and pay the...

  8. 49 CFR 572.164 - Thorax assembly and test procedure. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.164... Hybrid III Six-Year-Old Weighted Child Test Dummy § 572.164 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly. The thorax consists of the part of the torso assembly shown in drawing 167...

  9. 27 CFR 22.164 - Filing and retention of records. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Filing and retention of records. 22.164 Section 22.164 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF TAX-FREE ALCOHOL Records of...

  10. 33 CFR 164.19 - Requirements for vessels at anchor. (United States)


    ... anchor. 164.19 Section 164.19 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... vessels at anchor. The master or person in charge of each vessel that is anchored shall ensure that: (a) A proper anchor watch is maintained; (b) Procedures are followed to detect a dragging anchor; and (c...

  11. 46 CFR 164.006-3 - Construction, materials, and workmanship. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Construction, materials, and workmanship. 164.006-3..., CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL MATERIALS Deck Coverings for Merchant Vessels § 164.006-3 Construction, materials, and workmanship. (a) It is the intent of this specification to obtain a...

  12. 33 CFR 164.42 - Rate of turn indicator. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Rate of turn indicator. 164.42...) PORTS AND WATERWAYS SAFETY NAVIGATION SAFETY REGULATIONS § 164.42 Rate of turn indicator. Each vessel of... turn indicator. ...

  13. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.


    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  14. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications. (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh


    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  15. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang


    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  16. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)


    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  17. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  18. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana


    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  19. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine. (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli


    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail:; Kalombo, Lonji, E-mail: [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail:; Zeevaart, Jan Rijn, E-mail: [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  1. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  2. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)


    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  3. Shell closure at {ital N}=164: Spherical or deformed?

    Energy Technology Data Exchange (ETDEWEB)

    Rigol, J. [Joint Institute for Nuclear Research, 141980 Dubna (Russia)


    Brenner {ital et al}. [1] recently reported the apparent evidence for a spherical shell at {ital N}=164. Some arguments are given which may make it necessary to reconsider this conclusion. {copyright} {ital 1997} {ital The American Physical Society}

  4. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P


    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  5. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail:


    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  6. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  7. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)


    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  8. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar


    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  9. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness. (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo


    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  10. Phenotype abnormality: 164 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 164 decreased efficiency... in organ named whole plant during process named 0 seed germination stage ... whole plant ... decreased efficiency ... 0 seed germination stage ...

  11. Image collection: 164 [Togo Picture Gallery[Archive

    Lifescience Database Archive (English)

    Full Text Available 164 Cynocephalus_volans_NL.png フィリピンヒヨケザル Philippine flying lemur Cynocephalus volans 110931 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱

  12. Tilted axis rotation in odd-odd {sup 164}Tm

    Energy Technology Data Exchange (ETDEWEB)

    Reviol, W.; Riedinger, L.L.; Wang, X.Z.; Zhang, J.Y. [Univ. of Tennessee, Knoxville, TN (United States)] [and others


    Ten band structures are observed in {sup 164}Tm, among them sets of parallel and anti-parallel couplings of the proton and neutron spins. The Tilted Axis Cranking scheme is applied for the first time to an odd-odd nucleus in a prominent region of nuclear deformation.

  13. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)


    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  14. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.


    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  15. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C


    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  16. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail:; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)


    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  17. 40 CFR 164.24 - Response to the Administrator's notice of intention to hold a hearing. (United States)


    ... of intention to hold a hearing. 164.24 Section 164.24 Protection of Environment ENVIRONMENTAL...) Commencement of Proceeding § 164.24 Response to the Administrator's notice of intention to hold a hearing. Any... intention to hold a hearing, shall file with the hearing clerk, within the time set by the Administrator in...

  18. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear


    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  19. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján


    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  20. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher


    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  1. Electroexcitation of rotational vibrations in sup 164 Dy

    Energy Technology Data Exchange (ETDEWEB)

    Scholtz, F.G.; Nojarov, R.; Faessler, A. (Institut fur Theoretische Physik, Universitat Tubingen, Auf der Morgenstelle 14, D-7400 Tubingen 1, Federal Republic of Germany (DE))


    We calculate the {ital M}1 spectrum and the distorted-wave Born-approximation ({ital e},{ital e}{prime}) form factors of the strong {ital K}{sup {pi}}=1{sup +} states in {sup 164}Dy, using a deformed Woods-Saxon potential and the quasiparticle random-phase approximation with quadrupole, spin, and spin-quadrupole interactions. A residual rotation-vibrational coupling ensures the exclusion of the spurious state. We find strongly orbital {ital M}1 states at 3.1 MeV which fit the experimental spectrum very well and exhaust 40% of the collectivity of the 1{sup +} mode. The form factor of the lowest one of these states is also in a good agreement with the experimental form factor.

  2. Recombinant Goat VEGF164 Increases Hair Growth by Painting Process on the Skin of Shaved Mouse

    Directory of Open Access Journals (Sweden)

    Wenlei Bao


    Full Text Available To detect goat vascular endothelial growth factor (VEGF-mediated regrowth of hair, full-length VEGF164 cDNA was cloned from Inner Mongolia cashmere goat (Capra hircus into the pET-his prokaryotic expression vector, and the recombinant plasmid was transferred into E. coli BL21 cells. The expression of recombinant 6×his-gVEGF164 protein was induced by 0.5 mM isopropyl thio-β-D-galactoside at 32°C. Recombinant goat VEGF164 (rgVEGF164 was purified and identi ed by western blot using monoclonal anti-his and anti-VEGF antibodies. The rgVEGF164 was smeared onto the dorsal area of a shaved mouse, and we noted that hair regrowth in this area was faster than in the control group. Thus, rgVEGF164 increases hair growth in mice.

  3. The high power engine of the Bugatti Veyron 16.4; Der Hochleistungsmotor des Bugatti Veyron 16.4

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, K.H.; Kurowski, A. [Bugatti Engineering GmbH, Wolfsburg (Germany)


    With the Bugatti brand, a significant traditional name among the automobile manufacturers awakens to new life. The traditional maxims of the company philosophy such as workmanship and technological perfection into the smallest detail as well as aesthetic design are carried on in the new high power Bugatti Veyron 16.4 sports car concept, even if in a new, modern interpretation. From the technical point of view, the highlight of the vehicle is undoubtedly once again set by the drive system. An adequate, innovative drive concept is used as a completely newly developed 8.0 liter, 16-cylinder mid-mounted engine with a performance of 736 kW/1001 PS, following the style of the 16-cylinder idea realized for the first time over 70 years ago. The article at hand first describes the selected engine concept in detail, contemplated under the presented general conceptual framework. Through the selection of the W-design as an extraordinarily compact manufacturing basis-construction, a supercharged aggregate with four turbochargers and an effective charge-air cooling could be realized in spite of the strict installation specifications pre-determined by the vehicle. In the following descriptions, the finer points of the W16 motor's detailed solutions will be more closely dealt with using selected examples. Along with the short-block assembly and the complex, highly loaded crank mechanism, characteristics on the oil circulation system with its innovative modular shaft oil pump will be more closely inspected. In order to fulfill the lofty goals regarding sovereign, instantaneous power development, the turbocharger concept was given special attention. Its specific layout systematic and thermodynamic design will be comprehensively portrayed. The engine parameters, reached in sum through the explained measures, help the new Bugatti Veyron 16.4 to outstanding road performance that is superior to the competition. (orig.) [German] Mit der Marke Bugatti erwacht ein bedeutender

  4. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)


    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  5. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  6. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  7. 40 CFR 98.164 - Monitoring and QA/QC requirements. (United States)


    ... feedstock flow meters, and other measurement devices. The estimated accuracy of measurements made with these....164 Section 98.164 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS.... The GHG emissions data for hydrogen production process units must be quality-assured as specified in...

  8. 46 CFR 164.023-3 - Specifications and standards incorporated by reference. (United States)


    ... Thread and Yarn; Single Strand—164.023-7. (3) Method 5804, Weathering Resistance of Cloth; Accelerated..., Polyester Core: Cotton-, Rayon-, or Polyester-Covered, September 30, 1986—164.023-5. (7) MIL-T-43624A—Thread...

  9. 9 CFR 381.164 - “(Kind) barbecued.” (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false â(Kind) barbecued.â 381.164 Section 381.164 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  10. 46 CFR 164.009-19 - Measurement of moisture and volatile matter content. (United States)


    ... stopper is inserted in the bottle and the bottle and sample are cooled and weighed. (c) The content of... 46 Shipping 6 2010-10-01 2010-10-01 false Measurement of moisture and volatile matter content. 164... Vessels § 164.009-19 Measurement of moisture and volatile matter content. (a) The measurements described...

  11. 33 CFR 164.43 - Automatic Identification System Shipborne Equipment-Prince William Sound. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Automatic Identification System Shipborne Equipment-Prince William Sound. 164.43 Section 164.43 Navigation and Navigable Waters COAST GUARD... Automatic Identification System Shipborne Equipment—Prince William Sound. (a) Until December 31, 2004, each...

  12. [Treatment of patella fractures of 164 patients with 5 methods]. (United States)

    Xie, Feng; Fang, Guo-Hua; Zhou, Yi


    To investigate the effects of different treatments for different patella fractures, and analyze the clinical outcome. One hundred and sixty-four patients with patella fracture were treated between July 2005 and December 2009, 113 males and 51 females with an average age of 38.5 years old, ranging from 21 to 72 years. There were 21 cases of linear fracture or separation of the patella patella separation > 0.5 cm and for the pure horizontal type or vertical-type fractures, 34 cases were separated into three block, 46 cases were separated into four and above. Of 164 cases, 21 patients accepted traditional treatment, 39 patients were fixed with cerclage wire and tension band wire, 43 with cannulated screws and tension band wire fixation, 29 with cannulated screws for the minimally invasive treatment, 32 patients with fixation of NT-PC RESULTS: One hundred and sixty-four cases were followed up with a mean period of 14 months (3 to 36 months). By Lysholm knee score criteria: 19 cases in traditional treatment were excellent and good, 36 cases in cerclage wire and tension band wire technique cases were excellent and good, 40 cases in cannulated screws and tension band wire fixation, 27 cases in cannulated screws for the minimally invasive treatment were excellent and good, 30 cases in NT-PC were excellent and good. The surgery should be avoided if the patients can be treated with manipulation and fixation. Those who need surgical treatment should be based on the type of fracture to select a different surgical operation. Percutaneous reduction can be fixed, and try to minimally invasive surgery. Whether traditional treatment or internal fixation, the appropriate functional exercise need to make as early as possible.

  13. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2 (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.


    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  14. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto


    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  15. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia. (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A


    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  16. 33 CFR 165.164 - Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New York, NY. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New York, NY. 165.164 Section 165.164 Navigation and Navigable Waters... Guard District § 165.164 Security Zones: Dignitary Arrival/Departure and United Nations Meetings, New...

  17. 33 CFR 164.72 - Navigational-safety equipment, charts or maps, and publications required on towing vessels. (United States)


    ..., charts or maps, and publications required on towing vessels. 164.72 Section 164.72 Navigation and... NAVIGATION SAFETY REGULATIONS § 164.72 Navigational-safety equipment, charts or maps, and publications... navigation of the areas possible. (ii) The charts or maps must be either— (A) Current editions or currently...

  18. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.


    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  19. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  20. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal


    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  1. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi


    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  2. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)


    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  3. β2-adrenergic receptor Thr164Ile polymorphism, obesity, and diabetes

    DEFF Research Database (Denmark)

    Thomsen, Mette; Dahl, Morten; Tybjærg-Hansen, Anne


    The β(2)-adrenergic receptor (ADRB2) influences regulation of energy balance by stimulating catecholamine-induced lipolysis in adipose tissue. The rare functional ADRB2rs1800888(Thr164Ile) polymorphism could therefore influence risk of obesity and subsequently diabetes....

  4. 26 CFR 1.164-5 - Certain retail sales taxes and gasoline taxes. (United States)


    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Certain retail sales taxes and gasoline taxes. 1....164-5 Certain retail sales taxes and gasoline taxes. For taxable years beginning before January 1...) and tax on the sale of gasoline, diesel fuel or other motor fuel paid by the consumer (other than in...

  5. 49 CFR 173.164 - Mercury (metallic and articles containing mercury). (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For transportation by aircraft, mercury must be packaged in packagings which meet the requirements of part 178 of...

  6. 33 CFR 164.37 - Equipment: Vessels of 10,000 gross tons or more. (United States)


    ... will not render the other system inoperative. (b) On each tanker of 10,000 gross tons or more that is... to the radar system under § 164.35(a), a second marine radar system that operates independently of the first. Note: Independent operation means two completely separate systems, from separate branch...

  7. 45 CFR 164.522 - Rights to request privacy protection for protected health information. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Rights to request privacy protection for protected... ADMINISTRATIVE DATA STANDARDS AND RELATED REQUIREMENTS SECURITY AND PRIVACY Privacy of Individually Identifiable Health Information § 164.522 Rights to request privacy protection for protected health information. (a)(1...

  8. Beta2-adrenoceptor Thr164Ile polymorphism is associated with markedly decreased vasodilator and increased vasoconstrictor sensitivity in vivo. (United States)

    Dishy, Victor; Landau, Ruth; Sofowora, Gbenga G; Xie, Hong-Guang; Smiley, Richard M; Kim, Richard B; Byrne, Daniel W; Wood, Alastair J J; Stein, C Michael


    The uncommon Thr164Ile polymorphism of the beta2-adrenoceptor is associated with profoundly altered responses to agonist in vitro; however its effects on vascular responses in vivo are not known. Altered adrenergic vascular sensitivity may contribute to the decreased survival observed in patients with congestive heart failure carrying the Ile164 allele. We used the linear variable differential transformer dorsal hand vein technique to compare vasodilation in response to the beta-adrenergic receptor agonist, isoproterenol, and vasoconstriction in response to the alpha-adrenergic receptor agonist, phenylephrine, in healthy homozygous (Thr164/Thr164) (n = 21) and heterozygous Thr164/Ile164 (n = 5) women. The dose of isoproterenol required to achieve 50% venodilation (geometric mean; 95% CI) was significantly higher in women with the Ile164 allele (82.5 ng/min; 17.3-394 ng/min) than those without (15.8 ng/min; 11-25 ng/min; P = 0.004). The maximum response to isoproterenol was not different (102 +/- 1% and 102 +/- 3%, respectively, P = 0.9). The dose of phenylephrine needed to induce 50% venoconstriction was significantly lower in women with the Ile164 allele (151 ng/min; 42-543 ng/min) than those without (540 ng/min; 350-835 ng/min; P = 0.02). The Thr164Ile polymorphism of the beta2-adrenergic receptor is associated with a five-fold reduction in sensitivity to beta2 receptor agonist-mediated vasodilation; vasoconstrictor sensitivity is increased. The overall effect of the Thr164Ile polymorphism is to shift the balance of adrenergic vascular tone toward vasoconstriction. This suggests a mechanistic explanation for the clinical observation of decreased survival in patients with congestive heart failure heterozygous for the Thr164Ile polymorphism.

  9. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N


    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  10. Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness. (United States)

    Sieber, Patrick; Wellmer, Frank; Gheyselinck, Jacqueline; Riechmann, José Luis; Meyerowitz, Elliot M


    In plants, members of microRNA (miRNA) families are often predicted to target the same or overlapping sets of genes. It has thus been hypothesized that these miRNAs may act in a functionally redundant manner. This hypothesis is tested here by studying the effects of elimination of all three members of the MIR164 family from Arabidopsis. It was found that a loss of miR164 activity leads to a severe disruption of shoot development, in contrast to the effect of mutation in any single MIR164 gene. This indicates that these miRNAs are indeed functionally redundant. Differences in the expression patterns of the individual MIR164 genes imply, however, that redundancy among them is not complete, and that these miRNAs show functional specialization. Furthermore, the results of molecular and genetic analyses of miR164-mediated target regulation indicate that miR164 miRNAs function to control the transcript levels, as well as the expression patterns, of their targets, suggesting that they might contribute to developmental robustness. For two of the miR164 targets, namely CUP-SHAPED COTYLEDON1 (CUC1) and CUC2, we provide evidence for their involvement in the regulation of growth and show that their derepression in miR164 loss-of-function mutants is likely to account for most of the mutant phenotype.

  11. 45 CFR 164.510 - Uses and disclosures requiring an opportunity for the individual to agree or to object. (United States)


    ... persons who ask for the individual by name. (2) Opportunity to object. A covered health care provider must... the individual to agree or to object. 164.510 Section 164.510 Public Welfare DEPARTMENT OF HEALTH AND... individual to agree or to object. A covered entity may use or disclose protected health information, provided...

  12. 27 CFR 70.164 - Surrender of property subject to levy in the case of life insurance and endowment contracts. (United States)


    ... subject to levy in the case of life insurance and endowment contracts. 70.164 Section 70.164 Alcohol... the case of life insurance and endowment contracts. (a) In general. This section provides special rules relating to the surrender of property subject to levy in the case of life insurance and endowment...

  13. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)


    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  14. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.


    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  15. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)


    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  16. Acidente vascular cerebral em pacientes jovens: análise de 164 casos Stroke in young adults: analysis of 164 patients

    Directory of Open Access Journals (Sweden)

    Viviane H. Flumignan Zétola


    Full Text Available Realizamos análise epidemiológica de 164 pacientes com AVC, cujo primeiro episódio ocorreu entre 15 e 49 anos de idade através de um estudo retrospectivo de pacientes ambulatoriais. O principal tipo de apresentação foi AVC isquêmico (AVCI em 141 pacientes, ocorrendo AVC hemorrágico (AVCH em16 casos e 7 pacientes com trombose venosa. A presença de fatores de risco aterotrombóticos foi prevalente, em 48,22% dos pacientes com AVCI sendo que a hipertensão arterial sistêmica (HAS, nos casos de AVCH, foi a etiologia mais frequente. Em 32% dos casos não se pode determinar a sua causa. Embora a população jovem possua determinantes diferentes e geralmente deva ter uma investigação etiológica mais abrangente, no grupo estudado foram prevalentes os fatores de risco conhecidos e potencialmente controláveis, sugerindo que campanhas de prevenção e detecção precoce devam ser incentivados.We retrospectively analyzed the epidemiological features of 164 out-clinic patients with a first-onset stroke between 15 and 49 years old. Ischemic stroke occurred in 141 patients, hemorrhagic stroke in 16 patients, and venous thrombosis in 7 patients. Forty-eight percent of ischemic strokes were atherothrombotic, but no etiology was found in 32% of patients with ischemic stroke. Systemic arterial hypertension was the most frequent etiology in the hemorrhagic stroke group. The most frequent risk factors were systemic arterial hypertension, smoking, hypercholesterolemia, alcoholism and diabetes mellitus. Although stroke in young adults deserves some specific etiological investigation, we found that ordinary risk factors such as hypertension, tabacco use, hypercolesteremia and diabetes were prevalent in our population. It seems that prevention campaigns should be the target of our work.

  17. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  18. 77 FR 59420 - 164th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Meeting Pursuant to the authority... 164th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans (also known as...

  19. Exome capture reveals ZNF423 and CEP164 mutations, linking renal ciliopathies to DNA damage response signaling

    DEFF Research Database (Denmark)

    Chaki, Moumita; Airik, Rannar; Ghosh, Amiya K


    identify by whole-exome resequencing, mutations of MRE11, ZNF423, and CEP164 as causing NPHP-RC. All three genes function within the DNA damage response (DDR) pathway. We demonstrate that, upon induced DNA damage, the NPHP-RC proteins ZNF423, CEP164, and NPHP10 colocalize to nuclear foci positive for TIP60......, known to activate ATM at sites of DNA damage. We show that knockdown of CEP164 or ZNF423 causes sensitivity to DNA damaging agents and that cep164 knockdown in zebrafish results in dysregulated DDR and an NPHP-RC phenotype. Our findings link degenerative diseases of the kidney and retina, disorders......Nephronophthisis-related ciliopathies (NPHP-RC) are degenerative recessive diseases that affect kidney, retina, and brain. Genetic defects in NPHP gene products that localize to cilia and centrosomes defined them as "ciliopathies." However, disease mechanisms remain poorly understood. Here, we...

  20. ß2 -adrenergic receptor Thr164IIe polymorphism, blood pressure and ischaemic heart disease in 66¿750 individuals

    DEFF Research Database (Denmark)

    Thomsen, M; Dahl, Morten; Tybjaerg-Hansen, A


    The ß(2) -adrenergic receptor (ADRB2) is located on smooth muscle cells and is an important regulator of smooth muscle tone. The Thr164Ile polymorphism (rs1800888) in the ADRB2 gene is rare but has profound functional consequences on receptor function and could cause lifelong elevated smooth musc...... tone. We tested the hypothesis that Thr164Ile is associated with increased blood pressure, increased frequency of hypertension and increased risk of cardiovascular disease (CVD)....

  1. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others


    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  2. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid. (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua


    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  3. Exome capture reveals ZNF423 and CEP164 mutations, linking renal ciliopathies to DNA damage response signaling (United States)

    Chaki, Moumita; Airik, Rannar; Ghosh, Amiya K.; Giles, Rachel H.; Chen, Rui; Slaats, Gisela G.; Wang, Hui; Hurd, Toby W.; Zhou, Weibin; Cluckey, Andrew; Gee, Heon-Yung; Ramaswami, Gokul; Hong, Chen-Jei; Hamilton, Bruce A.; Červenka, Igor; Ganji, Ranjani Sri; Bryja, Vitezslav; Arts, Heleen H.; van Reeuwijk, Jeroen; Oud, Machteld M.; Letteboer, Stef J.F.; Roepman, Ronald; Husson, Hervé; Ibraghimov-Beskrovnaya, Oxana; Ysunaga, Takayuki; Walz, Gerd; Eley, Lorraine; Sayer, John A.; Schermer, Bernhard; Liebau, Max C.; Benzing, Thomas; Le Corre, Stephanie; Drummond, Iain; Joles, Jaap A.; Janssen, Sabine; Allen, Susan J.; Natarajan, Sivakumar; O Toole, John F.; Attanasio, Massimo; Saunier, Sophie; Antignac, Corinne; Koenekoop, Robert K.; Ren, Huanan; Lopez, Irma; Nayir, Ahmet; Stoetzel, Corinne; Dollfus, Helene; Massoudi, Rustin; Gleeson, Joseph G.; Andreoli, Sharon P.; Doherty, Dan G.; Lindstrad, Anna; Golzio, Christelle; Katsanis, Nicholas; Pape, Lars; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard A.; Lupski, James R.; Omran, Heymut; Lee, Eva; Wang, Shaohui; Sekiguchi, JoAnn M.; Saunders, Rudel; Johnson, Colin A.; Garner, Elizabeth; Vanselow, Katja; Andersen, Jens S.; Shlomai, Joseph; Nurnberg, Gudrun; Nurnberg, Peter; Levy, Shawn; Smogorzewska, Agata; Otto, Edgar A.; Hildebrandt, Friedhelm


    SUMMARY Nephronophthisis-related ciliopathies (NPHP-RC) are degenerative recessive diseases that affect kidney, retina and brain. Genetic defects in NPHP gene products that localize to cilia and centrosomes defined them as ‘ciliopathies’. However, disease mechanisms remain poorly understood. Here we identify by whole exome resequencing, mutations of MRE11, ZNF423, and CEP164 as causing NPHP-RC. All three genes function within the DNA damage response (DDR) pathway, hitherto not implicated in ciliopathies. We demonstrate that, upon induced DNA damage, the NPHP-RC proteins ZNF423, CEP164 and NPHP10 colocalize to nuclear foci positive for TIP60, known to activate ATM at sites of DNA damage. We show that knockdown of CEP164 or ZNF423 causes sensitivity to DNA damaging agents, and that cep164 knockdown in zebrafish results in dysregulated DDR and an NPHP-RC phenotype. We identify TTBK2, CCDC92, NPHP3 and DVL3 as novel CEP164 interaction partners. Our findings link degenerative diseases of kidney and retina, disorders of increasing prevalence, to mechanisms of DDR. PMID:22863007

  4. G333.466-0.164, An EGO That Is Not Aligned With Its Disk Axis (United States)

    Simpson, Janet P.; Burton, Michael; Cotera, Angela; Cunningham, Maria; Lo, Nadia


    The infrared source G333.466-0.164 (IRAS 16175-5002) was discovered to contain a 4.5 micron emission feature (extended green object, EGO) in images taken with Spitzer's Infrared Array Camera in 2004. EGOs appear to define the location of outflows from massive young stellar objects (MYSOs) and have been attributed to both emission from molecular hydrogen or CO in the shocked outflow and to scattered light from the outflow cavity. We confirmed that there is a MYSO at the south end of the 15'' long, thin EGO from spectra taken with Spitzer's Infrared Spectrograph in 2009 (Simpson et al. 2012, MNRAS, 419, 211). To further characterize G333.466-0.164 we obtained 12.3 and 24.5 micron images with T-ReCS on Gemini South. Although the MYSO itself is not detected at 12.3 micron, we clearly resolve an elongated source at the location of the MYSO at 24.5 micron with the 0.76" FWHM resolution of Gemini. The elongated region has major and minor axes 2.5'' and 1.5'', respectively, where the position angle of the major axis is 147 pm 5 degrees east of north. For a distance of 3.6 kpc, this corresponds to a size of 9000 AU by 5400 AU. We contrast the position angle of the source to that of the EGO, which is approximately -10 degrees east of north measured from the MYSO. Methanol masers have been measured in G333.466-0.164 by Caswell et al. (2011, MNRAS, 417, 1964) and Voronkov et al. (2014, MNRAS, 439, 258). The 6.7 GHz Class II maser is found at the position of the MYSO and the 36 and 44 GHz Class I masers, which are excited by shocks, are found in positions coinciding with the EGO and also in a line perpendicular to the EGO, in an area obscured by an optically thick dust lane. Voronkov et al. suggest that the actual outflow lies between the two lines of Class I masers in the northeast direction; this is in excellent agreement with the northeast-oriented minor axis of the elongated feature that we observe at 24.5 micron. Thus we identify the 24.5 micron source as the disk of the

  5. miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.). (United States)

    Li, Jing; Guo, Guanghui; Guo, Weiwei; Guo, Ganggang; Tong, Dan; Ni, Zhongfu; Sun, Qixin; Yao, Yingyin


    MicroRNAs are a class of small, non-coding RNAs that regulate gene expression by binding target mRNA, which leads to cleavage or translational inhibition. The NAC proteins, which include NAM, ATAF, and CUC, are a plant-specific transcription factor family with diverse roles in development and stress regulation. It has been reported that miR164 negatively regulates NAC1 expression, which in turn affects lateral root development in Arabidopsis; however, little is known about the involvement of the maize NAC family and miR164 in lateral root development. We collected 175 maize transcripts with NAC domains. Of these, 7 ZmNACs were putative targets for regulation by miR164. We isolated one gene, called TC258020 (designated ZmNAC1) from 2 maize inbred lines, 87-1 and Zong3. ZmNAC1 had a high expression level in roots and showed higher abundance (1.8 fold) in Zong3 relative to 87-1, which had less lateral roots than Zong3. There was a significant correlation between the expression level of ZmNAC1 and the lateral root density in the recombinant inbred line (RIL) population. Transgenic Arabidopsis that overexpressed ZmNAC1 had increased lateral roots in comparison to the wild type. These findings suggest that ZmNAC1 played a significant role in lateral root development. An allelic expression assay showed that trans-regulatory elements were the dominant mediators of ZmNAC1 differential expression in 87-1 and Zong3, and further analysis revealed that miR164 was a trans-element that guided the cleavage of endogenous ZmNAC1 mRNA. Both mature miR164 and miR164 precursors had higher expression in 87-1 than Zong3, which was the opposite of the expression pattern of ZmNAC1. Additionally, the allelic assay showed that the cis-regulatory element most likely affected Zm-miR164b's expression pattern. A β-glucuronidase (GUS) assay showed that the Zm-miR164b promoter had higher GUS activity in 87-1 than in Zong3. In addition, we detected miR164b expression in the RIL population, and the

  6. miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Li Jing


    Full Text Available Abstract Background MicroRNAs are a class of small, non-coding RNAs that regulate gene expression by binding target mRNA, which leads to cleavage or translational inhibition. The NAC proteins, which include NAM, ATAF, and CUC, are a plant-specific transcription factor family with diverse roles in development and stress regulation. It has been reported that miR164 negatively regulates NAC1 expression, which in turn affects lateral root development in Arabidopsis; however, little is known about the involvement of the maize NAC family and miR164 in lateral root development. Results We collected 175 maize transcripts with NAC domains. Of these, 7 ZmNACs were putative targets for regulation by miR164. We isolated one gene, called TC258020 (designated ZmNAC1 from 2 maize inbred lines, 87-1 and Zong3. ZmNAC1 had a high expression level in roots and showed higher abundance (1.8 fold in Zong3 relative to 87-1, which had less lateral roots than Zong3. There was a significant correlation between the expression level of ZmNAC1 and the lateral root density in the recombinant inbred line (RIL population. Transgenic Arabidopsis that overexpressed ZmNAC1 had increased lateral roots in comparison to the wild type. These findings suggest that ZmNAC1 played a significant role in lateral root development. An allelic expression assay showed that trans-regulatory elements were the dominant mediators of ZmNAC1 differential expression in 87-1 and Zong3, and further analysis revealed that miR164 was a trans-element that guided the cleavage of endogenous ZmNAC1 mRNA. Both mature miR164 and miR164 precursors had higher expression in 87-1 than Zong3, which was the opposite of the expression pattern of ZmNAC1. Additionally, the allelic assay showed that the cis-regulatory element most likely affected Zm-miR164b's expression pattern. A β-glucuronidase (GUS assay showed that the Zm-miR164b promoter had higher GUS activity in 87-1 than in Zong3. In addition, we detected mi

  7. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais


    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  8. Transfer and breakup reactions in 16O + CsI at 16.4 MeV/n

    Directory of Open Access Journals (Sweden)

    M.J. Murphy


    Full Text Available A streamer-chamber particle-telescope system has been used to observe ejectile charge, energy, and associated charged particle multiplicity in the reaction of 16O + CsI at 16.4 MeV/n. The measurement provides relative probabilities for transfer and projectile breakup as a function of ejectile charge, and spectra for the heavy ejectiles from transfer and breakup events. The results show that the interaction energy of 16.4 MeV/n is near the threshold for breakup reactions in heavy-ion collisions.

  9. 17 CFR 1.64 - Composition of various self-regulatory organization governing boards and major disciplinary... (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Composition of various self... ACT Miscellaneous § 1.64 Composition of various self-regulatory organization governing boards and... organization and is otherwise consistent with this regulation's composition requirements; (c) Each self...

  10. 77 FR 66186 - 164th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 164th Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  11. Lysine residue 185 of Rad1 is a topological but not a functional counterpart of lysine residue 164 of PCNA.

    Directory of Open Access Journals (Sweden)

    Niek Wit

    Full Text Available Monoubiquitylation of the homotrimeric DNA sliding clamp PCNA at lysine residue 164 (PCNA(K164 is a highly conserved, DNA damage-inducible process that is mediated by the E2/E3 complex Rad6/Rad18. This ubiquitylation event recruits translesion synthesis (TLS polymerases capable of replicating across damaged DNA templates. Besides PCNA, the Rad6/Rad18 complex was recently shown in yeast to ubiquitylate also 9-1-1, a heterotrimeric DNA sliding clamp composed of Rad9, Rad1, and Hus1 in a DNA damage-inducible manner. Based on the highly similar crystal structures of PCNA and 9-1-1, K185 of Rad1 (Rad1(K185 was identified as the only topological equivalent of PCNA(K164. To investigate a potential role of posttranslational modifications of Rad1(K185 in DNA damage management, we here generated a mouse model with a conditional deletable Rad1(K185R allele. The Rad1(K185 residue was found to be dispensable for Chk1 activation, DNA damage survival, and class switch recombination of immunoglobulin genes as well as recruitment of TLS polymerases during somatic hypermutation of immunoglobulin genes. Our data indicate that Rad1(K185 is not a functional counterpart of PCNA(K164.

  12. Production of a nisin-like bacteriocin by Lactococcus lactis subsp. lactis A164 isolated from Kimchi. (United States)

    Choi, H J; Cheigh, C I; Kim, S B; Pyun, Y R


    Lactococcus lactis subsp. lactis A164 was isolated from Kimchi (Korean traditional fermented vegetables). The bacteriocin produced by strain A164 was active against closely related lactic acid bacteria and some food-borne pathogens including Staphylococcus aureus, Listeria monocytogenes and Salmonella typhimurium. The antimicrobial spectrum was nearly identical to that of nisin. Bacteriocin activity was not destroyed by exposure to elevated temperatures at low pH values, but the activity was lost at high pH values. This bacteriocin was inactivated by pronase E and alpha, beta-chymotrypsin, but not by trypsin, pepsin, and alpha-amylase. Cultures of L. lactis subsp. lactis A164 maintained at a constant pH of 6.0 exhibited maximum production of the bacteriocin. It was purified to homogeneity by ammonium sulphate precipitation, sequential ion exchange chromatography, and ultrafiltration. Tricine-SDS-PAGE of purified bacteriocin gave the same molecular weight of 3.5 kDa as that of nisin. The gene encoding this bacteriocin was amplified by PCR with nisin gene-specific primers and sequenced. It showed identical sequences to the nisin gene. These results indicate that bacteriocin produced by Lactococcus lactis A164 is a nisin-like bacteriocin.

  13. The Effects of Isosorbide Dinitrate on in Vitro Proliferation of WEHI-164 Cells and Peripheral Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Resvan Madani FZ


    Full Text Available Background: Isosorbide dinitrate has been broadly used in the treatment of various ischemic heart diseases. Isosorbide is a nitric oxide donor which increases blood flow to tumors through vasodilatation and consequently accelerates the access of chemo-drugs to them. Furthermore, this drug has inhibitory effects on angiogenesis, tumor growth and metastasis in vivo. Moreover, its ant-inflammatory effects have also been reported. In the present study we evaluated the effects of isosorbide on the proliferative activity of fibrosarcoma WEHI-164 cell line and peripheral blood mononuclear cells (PBMCs. Methods: WEHI-164 fibrosarcoma cells and human PBMCs were cultured in complete Roswell Park Memorial Institute (RPMI 1640 medium with 10% fetal bovine serum and 2×104 cells/mL for WEHI-164 and 2×105 cells/mL for PBMCs. The cells were then incubated at the exponential growth phase with different concentrations of isosorbide (4×10-6-1.6×10-3 M for 24, 48 and 72 hours. Subsequently, isosorbide effects on proliferation of the cells were evaluated by trypan blue dye exclusion (TB test and MTT assay. Statistical comparisons between groups were made by analysis of variance. Results: The proliferative activity of WEHI-164 fibrosarcoma cells and human PBMCs treated with different concentrations of isosorbide, did not show any significant difference with untreated control cells. Conclusion: The results of this study showed that isosorbide neither had any significant effects on the proliferative activity of fibrosarcoma WEHI-164 cells nor on human PBMCs. Our findings suggest that anti-tumoral effects of isosorbide reported by other investigators may be mediated through non-cytotoxic mechanisms.

  14. The early extra petals1 mutant uncovers a role for microRNA miR164c in regulating petal number in Arabidopsis. (United States)

    Baker, Catherine C; Sieber, Patrick; Wellmer, Frank; Meyerowitz, Elliot M


    MicroRNAs (miRNAs) are small 20-25 nucleotide non-protein-coding RNAs that negatively regulate expression of genes in many organisms, ranging from plants to humans. The MIR164 family of miRNAs in Arabidopsis consists of three members that share sequence complementarity to transcripts of NAC family transcription factors, including CUP-SHAPED COTYLEDON1 (CUC1) and CUC2. CUC1 and CUC2 are redundantly required for the formation of boundaries between organ primordia. The analysis of transgenic plants that either overexpress miR164a or miR164b or express a miRNA-resistant version of CUC1 or CUC2 has shown that miRNA regulation of CUC1 and CUC2 is necessary for normal flower development. A loss-of-function allele of MIR164b did not result in a mutant phenotype, possibly because of functional redundancy among the three members of the MIR164 family. In this study, we describe the characterization of the early extra petals1 (eep1) Arabidopsis mutant, whose predominant phenotype is the formation of extra petals in early-arising flowers. We demonstrate that eep1 is a loss-of-function allele of MIR164c, one of three known members of the MIR164 family. Our analyses of miR164c function and eep1 mir164b double mutants reveal that miR164c controls petal number in a nonredundant manner by regulating the transcript accumulation of the transcription factors CUC1 and CUC2. The data presented in this study indicate that closely related miRNA family members that are predicted to target the same set of genes can have different functions during development, possibly because of nonoverlapping expression patterns.

  15. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza


    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  16. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino


    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  17. The extreme blazar AO 0235+164 as seen by extensive ground and space radio observations (United States)

    Kutkin, A. M.; Pashchenko, I. N.; Lisakov, M. M.; Voytsik, P. A.; Sokolovsky, K. V.; Kovalev, Y. Y.; Lobanov, A. P.; Ipatov, A. V.; Aller, M. F.; Aller, H. D.; Lahteenmaki, A.; Tornikoski, M.; Gurvits, L. I.


    Clues to the physical conditions in radio cores of blazars come from measurements of brightness temperatures as well as effects produced by intrinsic opacity. We study the properties of the ultra compact blazar AO 0235+164 with RadioAstron ground-space radio interferometer, multi-frequency VLBA, EVN and single-dish radio observations. We employ visibility modeling and image stacking for deriving structure and kinematics of the source, and use Gaussian process regression to find the relative multi-band time delays of the flares. The multi-frequency core size and time lags support prevailing synchrotron self absorption. The intrinsic brightness temperature of the core derived from ground-based VLBI is close to the equipartition regime value. In the same time, there is evidence for ultra-compact features of the size of less than 10 μas in the source, which might be responsible for the extreme apparent brightness temperatures of up to 1014 K as measured by RadioAstron. In 2007-2016 the VLBI components in the source at 43 GHz are found predominantly in two directions, suggesting a bend of the outflow from southern to northern direction. The apparent opening angle of the jet seen in the stacked image at 43 GHz is two times wider than that at 15 GHz, indicating a collimation of the flow within the central 1.5 mas. We estimate the Lorentz factor Γ = 14, the Doppler factor δ = 21, and the viewing angle θ = 1.7° of the apparent jet base, derive the gradients of magnetic field strength and electron density in the outflow, and the distance between jet apex and the core at each frequency.

  18. A Novel Locus Harbouring a Functional CD164 Nonsense Mutation Identified in a Large Danish Family with Nonsyndromic Hearing Impairment

    DEFF Research Database (Denmark)

    Nyegaard, Mette; Rendtorff, Nanna D; Nielsen, Morten S


    -based linkage analysis and follow up microsatellite markers to identify a novel locus (DFNA66) on chromosome 6q15-21 (LOD 5.1) in a large Danish family with dominantly inherited NSHI. By locus specific capture and next-generation sequencing, we identified a c.574C>T heterozygous nonsense mutation (p.R192......*) in CD164. This gene encodes a 197 amino acid transmembrane sialomucin (known as endolyn, MUC-24 or CD164), which is widely expressed and involved in cell adhesion and migration. The mutation segregated with the phenotype and was absent in 1200 Danish control individuals and in databases with whole......-genome and exome sequence data. The predicted effect of the mutation was a truncation of the last six C-terminal residues of the cytoplasmic tail of CD164, including a highly conserved canonical sorting motif (YXX phi). In whole blood from an affected individual, we found by RT-PCR both the wild...


    DEFF Research Database (Denmark)

    Rasmussen, Søren; Vægter, Christian Bjerggaard; Cha, J

    In this study we have established methods for visualization and tracking of the dopamine transporter (DAT) in cultured dopaminergic neurons in real time using a fluorescent cocaine analogue JHC 1-64 and confocal fluorescence microscopy. The initial binding experiments in HEK 293 cells stably...... 1-64 was prevented by excess concentrations of dopamine, cocaine, mazindol, or RTI-55, whereas the norepinephrine and/or serotonin transporter specific inhibitors desmethylimipramine and citalopram did not affect fluorescent labeling of the neurons. This strongly supports that JHC 1-64 specifically...

  20. Internal corrosion of EK164 and CHS68 fuel pin cladding steels of uranium dioxide fast power reactor

    Directory of Open Access Journals (Sweden)

    E.A. Kinev


    Full Text Available Austenitic chromium-nickel steel EK-164 is the promising material for manufacturing claddings of fuel pins of fast nuclear reactors. Physical and chemical compatibility with typical nuclear fuel compositions on the basis of uranium dioxide pellets is an important aspect of ensuring fuel cladding operability. Post-irradiation examination of irradiated combined fuel assembly with maximum burnup 9.1% FIMA and damaging dose of 77.3dpa equipped with fuel pins with claddings made of CHS-68 and EK-164 steels in cold-worked state was performed. Gamma-scanning, electric potential resistometry and optical metallography methods were applied in the examination. According to the gamma-scanning and resistometry data high-temperature sections of fuel pins are the potential centers of development of fuel pin cladding corrosion. Comparative analysis of internal corrosion of fuel pin claddings made of EK-164 and CHS-68 steels along the reactor core height was performed. In the section with maximum power density at operational temperatures below 540°С depth of corrosion of CHS-68 steel from the side of fuel did not exceed 15µm. On similar sections of fuel pin cladding made of EK-164 steel depth of internal corrosion amounted to 10µm. Maximum of corrosion damage for both steel types was registered at temperatures in the range from 600°С to 650°С. In this case depth of corrosion damages in the form of intercrystalline and general corrosion did not exceed 20µm. No significant differences in the corrosion mechanism between the steels were found. Local exacerbation of corrosion at the junctions between fuel pellets and in places of concentration of cesium fission fragments was detected. And contrariwise in place of narrowing residual gap between fuel and cladding, where cesium is not present, corrosion of EK-164 steel is minimal. Maximum thinning of cladding of the investigated fuel pins with maximum burnup of 9% FIMA amounted to not more than 5% of the

  1. Long-lasting fibrin matrices ensure stable and functional angiogenesis by highly tunable, sustained delivery of recombinant VEGF164. (United States)

    Sacchi, Veronica; Mittermayr, Rainer; Hartinger, Joachim; Martino, Mikaël M; Lorentz, Kristen M; Wolbank, Susanne; Hofmann, Anna; Largo, Remo A; Marschall, Jeffrey S; Groppa, Elena; Gianni-Barrera, Roberto; Ehrbar, Martin; Hubbell, Jeffrey A; Redl, Heinz; Banfi, Andrea


    Clinical trials of therapeutic angiogenesis by vascular endothelial growth factor (VEGF) gene delivery failed to show efficacy. Major challenges include the need to precisely control in vivo distribution of growth factor dose and duration of expression. Recombinant VEGF protein delivery could overcome these issues, but rapid in vivo clearance prevents the stabilization of induced angiogenesis. Here, we developed an optimized fibrin platform for controlled delivery of recombinant VEGF, to robustly induce normal, stable, and functional angiogenesis. Murine VEGF164 was fused to a sequence derived from α2-plasmin inhibitor (α2-PI1-8) that is a substrate for the coagulation factor fXIIIa, to allow its covalent cross-linking into fibrin hydrogels and release only by enzymatic cleavage. An α2-PI1-8-fused variant of the fibrinolysis inhibitor aprotinin was used to control the hydrogel degradation rate, which determines both the duration and effective dose of factor release. An optimized aprotinin-α2-PI1-8 concentration ensured ideal degradation over 4 wk. Under these conditions, fibrin-α2-PI1-8-VEGF164 allowed exquisitely dose-dependent angiogenesis: concentrations ≥25 μg/mL caused widespread aberrant vascular structures, but a 500-fold concentration range (0.01-5.0 μg/mL) induced exclusively normal, mature, nonleaky, and perfused capillaries, which were stable after 3 mo. Optimized delivery of fibrin-α2-PI1-8-VEGF164 was therapeutically effective both in ischemic hind limb and wound-healing models, significantly improving angiogenesis, tissue perfusion, and healing rate. In conclusion, this optimized platform ensured (i) controlled and highly tunable delivery of VEGF protein in ischemic tissue and (ii) stable and functional angiogenesis without introducing genetic material and with a limited and controllable duration of treatment. These findings suggest a strategy to improve safety and efficacy of therapeutic angiogenesis.

  2. Multi-center experience of 164 consecutive Hemodialysis Reliable Outflow [HeRO] graft implants for hemodialysis treatment. (United States)

    Gage, S M; Katzman, H E; Ross, J R; Hohmann, S E; Sharpe, C A; Butterly, D W; Lawson, J H


    To report a multi-center experience with the novel Hemodialysis Reliable Outflow (HeRO) vascular access graft. Four centers conducted a retrospective review of end stage renal disease patients who received the HeRO device from implant to last available follow-up. Data is available on 164 patients with an accumulated 2092.1 HeRO implant months. At 6 months, HeRO primary and secondary patency is 60% and 90.8%, respectively and at 12 months, 48.8% and 90.8%, respectively. At 24 months, HeRO had a primary patency of 42.9% and secondary patency was 86.7%. Interventions to maintain or re-establish patency have been required in 71.3% of patients (117/164) resulting in an intervention rate of 1.5/year. Access related infections have been reported in 4.3% patients resulting in a rate of 0.14/1000 implant days. In our experience the HeRO device has performed comparably to standard AVGs and has proven superior to TDCs in terms of patency, intervention, and infection rates when compared to the peer-reviewed literature. As an alternative to catheter dependence as a means for hemodialysis access, this graft could reduce the morbidity and mortality associated with TDCs and have a profound impact on the costs associated with catheter related infections and interventions. Copyright © 2012 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  3. The 164-d period in SS433 as precessional motion - The massive black hole and pulsar models

    Energy Technology Data Exchange (ETDEWEB)

    Shaham, J.


    The geometries predicted by black hole ring and neutron star precession models for SS 433 are examined in relation to the recently observed 164-d periodicity in wavelength shifts from this object. In the first model, a Keplerian ring of matter exists surrounding a black hole of approximately 1,000,000 solar masses and radiates predominantly from its nodes, which are the ring sections closest to the black hole accretion disk and precess around the rotation axis of the hole with a period of approximately 160 days due to the Lense-Thirring effect. The free precession of a rapidly rotating neutron star emitting a double jet of matter can also bring about the observed wavelength variation. It should be possible to decide between the models by determining the change with time of the precession period, as the massive black hole model predicts its decrease and the rapidly rotating pulsar model predicts its increase.

  4. 40 CFR 164.21 - Contents of a denial of registration, notice of intent to cancel a registration, or notice of... (United States)


    ... classification. (a) Contents. The denial of registration or a notice of intent to cancel a registration or to... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Contents of a denial of registration, notice of intent to cancel a registration, or notice of intent to change a classification. 164.21 Section...

  5. 164Ile allele in the beta2-Adrenergic receptor gene is associated with risk of elevated blood pressure in women. The Copenhagen City Heart Study

    DEFF Research Database (Denmark)

    Sethi, Amar A; Tybjaerg-Hansen, Anne; Jensen, Gorm B


    Since beta2-adrenergic receptors are important regulators of blood pressure, genetic variation in this receptor could explain risk of elevated blood pressure in selected individuals. We tested the hypothesis that Gly16Arg, Gln27Glu, and Thr164Ile in the beta2-adrenergic receptor gene associated...... with elevated blood pressure....

  6. A whole-genome scan in 164 Dutch sib pairs with attention-deficit/hyperactivity disorder : Suggestive evidence for linkage on chromosomes 7p and 15q

    NARCIS (Netherlands)

    Bakker, SC; van der Meulen, EM; Buitelaar, JK; Sandkuijl, LA; Pauls, DL; Monsuur, AJ; van't Slot, R; Minderaa, RB; Gunning, WB; Pearson, PL; Sinke, RJ

    A genome scan was performed on 164 Dutch affected sib pairs (ASPs) with attention-deficit/hyperactivity disorder (ADHD). All subjects were white and of Dutch descent and were phenotyped according to criteria set out in the Diagnostic and Statistical Manual Of Mental Disorders, 4th edition.

  7. A whole-genome scan in 164 Dutch sib pairs with attention-deficit/hyperactivity disorder: suggestive evidence for linkage on chromosomes 7p and 15q.

    NARCIS (Netherlands)

    Bakker, S.C.; Meulen, E.M. van der; Sandkuijl, L.A.; Pauls, D.L.; Monsuur, A.J.; Slot, R. van 't; Minderaa, R.B.; Gunning, W.B.; Pearson, P.L.; Sinke, R.J.


    A genome scan was performed on 164 Dutch affected sib pairs (ASPs) with attention-deficit/hyperactivity disorder (ADHD). All subjects were white and of Dutch descent and were phenotyped according to criteria set out in the Diagnostic and Statistical Manual Of Mental Disorders, 4th edition.

  8. Blood loss in orthotopic liver transplantation : a retrospective analysis of transfusion requirements and the effects of autotransfusion of cell saver blood in 164 consecutive patients

    NARCIS (Netherlands)

    Hendriks, HGD; van der Meer, J; Klompmaker, IJ; Choudhury, N; Hagenaars, JAM; Porte, RJ; de Kam, PJ; Sloof, MJH; de Wolf, JTM

    Liver transplantation is associated with excessive blood loss. In order to identify factors influencing blood loss and to provide a basis for a pilot study to evaluate recombinant activated factor VII as a haemostatic agent, a retrospective study was performed in 164 consecutive patients with

  9. In vivo high angular resolution diffusion-weighted imaging of mouse brain at 16.4 Tesla.

    Directory of Open Access Journals (Sweden)

    Othman I Alomair

    Full Text Available Magnetic Resonance Imaging (MRI of the rodent brain at ultra-high magnetic fields (> 9.4 Tesla offers a higher signal-to-noise ratio that can be exploited to reduce image acquisition time or provide higher spatial resolution. However, significant challenges are presented due to a combination of longer T1 and shorter T2/T2* relaxation times and increased sensitivity to magnetic susceptibility resulting in severe local-field inhomogeneity artefacts from air pockets and bone/brain interfaces. The Stejskal-Tanner spin echo diffusion-weighted imaging (DWI sequence is often used in high-field rodent brain MRI due to its immunity to these artefacts. To accurately determine diffusion-tensor or fibre-orientation distribution, high angular resolution diffusion imaging (HARDI with strong diffusion weighting (b >3000 s/mm2 and at least 30 diffusion-encoding directions are required. However, this results in long image acquisition times unsuitable for live animal imaging. In this study, we describe the optimization of HARDI acquisition parameters at 16.4T using a Stejskal-Tanner sequence with echo-planar imaging (EPI readout. EPI segmentation and partial Fourier encoding acceleration were applied to reduce the echo time (TE, thereby minimizing signal decay and distortion artefacts while maintaining a reasonably short acquisition time. The final HARDI acquisition protocol was achieved with the following parameters: 4 shot EPI, b = 3000 s/mm2, 64 diffusion-encoding directions, 125×150 μm2 in-plane resolution, 0.6 mm slice thickness, and 2h acquisition time. This protocol was used to image a cohort of adult C57BL/6 male mice, whereby the quality of the acquired data was assessed and diffusion tensor imaging (DTI derived parameters were measured. High-quality images with high spatial and angular resolution, low distortion and low variability in DTI-derived parameters were obtained, indicating that EPI-DWI is feasible at 16.4T to study animal models of white

  10. In vivo high angular resolution diffusion-weighted imaging of mouse brain at 16.4 Tesla. (United States)

    Alomair, Othman I; Brereton, Ian M; Smith, Maree T; Galloway, Graham J; Kurniawan, Nyoman D


    Magnetic Resonance Imaging (MRI) of the rodent brain at ultra-high magnetic fields (> 9.4 Tesla) offers a higher signal-to-noise ratio that can be exploited to reduce image acquisition time or provide higher spatial resolution. However, significant challenges are presented due to a combination of longer T1 and shorter T2/T2* relaxation times and increased sensitivity to magnetic susceptibility resulting in severe local-field inhomogeneity artefacts from air pockets and bone/brain interfaces. The Stejskal-Tanner spin echo diffusion-weighted imaging (DWI) sequence is often used in high-field rodent brain MRI due to its immunity to these artefacts. To accurately determine diffusion-tensor or fibre-orientation distribution, high angular resolution diffusion imaging (HARDI) with strong diffusion weighting (b >3000 s/mm2) and at least 30 diffusion-encoding directions are required. However, this results in long image acquisition times unsuitable for live animal imaging. In this study, we describe the optimization of HARDI acquisition parameters at 16.4T using a Stejskal-Tanner sequence with echo-planar imaging (EPI) readout. EPI segmentation and partial Fourier encoding acceleration were applied to reduce the echo time (TE), thereby minimizing signal decay and distortion artefacts while maintaining a reasonably short acquisition time. The final HARDI acquisition protocol was achieved with the following parameters: 4 shot EPI, b = 3000 s/mm2, 64 diffusion-encoding directions, 125×150 μm2 in-plane resolution, 0.6 mm slice thickness, and 2h acquisition time. This protocol was used to image a cohort of adult C57BL/6 male mice, whereby the quality of the acquired data was assessed and diffusion tensor imaging (DTI) derived parameters were measured. High-quality images with high spatial and angular resolution, low distortion and low variability in DTI-derived parameters were obtained, indicating that EPI-DWI is feasible at 16.4T to study animal models of white matter (WM


    Energy Technology Data Exchange (ETDEWEB)

    Ackermann, M. [Deutsches Elektronen Synchrotron DESY, D-15738 Zeuthen (Germany); Ajello, M.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Bottacini, E.; Buehler, R.; Cameron, R. A. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Ballet, J.; Casandjian, J. M. [Laboratoire AIM, CEA-IRFU/CNRS/Universite Paris Diderot, Service d' Astrophysique, CEA Saclay, 91191 Gif sur Yvette (France); Barbiellini, G. [Istituto Nazionale di Fisica Nucleare, Sezione di Trieste, I-34127 Trieste (Italy); Bastieri, D.; Buson, S. [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131 Padova (Italy); Bellazzini, R.; Bregeon, J. [Istituto Nazionale di Fisica Nucleare, Sezione di Pisa, I-56127 Pisa (Italy); Bonamente, E. [Istituto Nazionale di Fisica Nucleare, Sezione di Perugia, I-06123 Perugia (Italy); Brigida, M. [Dipartimento di Fisica ' M. Merlin' dell' Universita e del Politecnico di Bari, I-70126 Bari (Italy); Bruel, P. [Laboratoire Leprince-Ringuet, Ecole polytechnique, CNRS/IN2P3, Palaiseau (France); Caliandro, G. A. [Institut de Ciencies de l' Espai (IEEE-CSIC), Campus UAB, 08193 Barcelona (Spain); Caraveo, P. A., E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [INAF-Istituto di Astrofisica Spaziale e Fisica Cosmica, I-20133 Milano (Italy); Collaboration: Fermi-LAT Collaboration; GASP-WEBT consortium; F-GAMMA; Iram-PdBI; Kanata; RXTE; SMARTS; Swift-XRT; and others


    The blazar AO 0235+164 (z = 0.94) has been one of the most active objects observed by Fermi Large Area Telescope (LAT) since its launch in Summer 2008. In addition to the continuous coverage by Fermi, contemporaneous observations were carried out from the radio to {gamma}-ray bands between 2008 September and 2009 February. In this paper, we summarize the rich multi-wavelength data collected during the campaign (including F-GAMMA, GASP-WEBT, Kanata, OVRO, RXTE, SMARTS, Swift, and other instruments), examine the cross-correlation between the light curves measured in the different energy bands, and interpret the resulting spectral energy distributions in the context of well-known blazar emission models. We find that the {gamma}-ray activity is well correlated with a series of near-IR/optical flares, accompanied by an increase in the optical polarization degree. On the other hand, the X-ray light curve shows a distinct 20 day high state of unusually soft spectrum, which does not match the extrapolation of the optical/UV synchrotron spectrum. We tentatively interpret this feature as the bulk Compton emission by cold electrons contained in the jet, which requires an accretion disk corona with an effective covering factor of 19% at a distance of 100 R{sub g}. We model the broadband spectra with a leptonic model with external radiation dominated by the infrared emission from the dusty torus.

  12. Jets and Outflows from Young Stellar Objects in the Carina Nebula Observed in [Fe II] 1.64 um (United States)

    Shinn, Jong-Ho; Pyo, Tae-Soo; Lee, Jae-Joon; Lee, Ho-Gyu; Kim, Hyun-Jeong; Koo, Bon-Chul; Sung, Hwankyung; Chun, Moo Young; Lyo, A.-Ran; Moon, Dae-Sik; Kyeong, Jaemann; Park, Byeong-Gon; Hur, Hyeonoh; Lee, Yong-Hyun


    We present [Fe II] 1.64 um imaging observations for jets and outflows from young stellar objects (YSOs) over the northern part (~24'x45') of the Carina Nebula, a massive star forming region. The observations were performed with IRIS2 of Anglo-Autralian Telescope and the seeing was ~1.5". Several jets and outflows features are detected at eight different regions, and named as forbidden emission line regions (FELRs). One new candidate for Herbig-Haro Object is identified comparing our [Fe II] images to H_alpha images of Hubble Space Telescope. FELRs have knotty or longish shapes, and distribute around the triangular area formed by three star clusters Tr 14, Tr 15, and Tr 16, which contain many massive stars. The detection rate of FELRs against previously identified YSOs is 1.4 %. We estimate the outflow rate from the [Fe II] flux based on some assumptions. The jet-driving objects are identified for three FELRs (FELR-2, -4, and -7), for which we study the relations between the outflow rate and the YSO physical parameters from the radiative transfer model fitting. The ratios of the outflow rate over the disk accretion rate are consistent for FELR-4 and -7 with the previously reported values, while it is higher for FELR-2. The masses of jet-driving objects are low or intermediate, and they are not likely to become massive stars (> 8 Ms). Other YSO physical parameters, such as luminosity and age, show reasonable relations or trends.

  13. Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. (United States)

    Maes, Christa; Carmeliet, Peter; Moermans, Karen; Stockmans, Ingrid; Smets, Nico; Collen, Désiré; Bouillon, Roger; Carmeliet, Geert


    Vascular endothelial growth factor (VEGF)-mediated angiogenesis is an important part of bone formation. To clarify the role of VEGF isoforms in endochondral bone formation, we examined long bone development in mice expressing exclusively the VEGF120 isoform (VEGF120/120 mice). Neonatal VEGF120/120 long bones showed a completely disturbed vascular pattern, concomitant with a 35% decrease in trabecular bone volume, reduced bone growth and a 34% enlargement of the hypertrophic chondrocyte zone of the growth plate. Surprisingly, embryonic hindlimbs at a stage preceding capillary invasion exhibited a delay in bone collar formation and hypertrophic cartilage calcification. Expression levels of marker genes of osteoblast and hypertrophic chondrocyte differentiation were significantly decreased in VEGF120/120 bones. Furthermore, inhibition of all VEGF isoforms in cultures of embryonic cartilaginous metatarsals, through the administration of a soluble receptor chimeric protein (mFlt-1/Fc), retarded the onset and progression of ossification, suggesting that osteoblast and/or hypertrophic chondrocyte development were impaired. The initial invasion by osteoclasts and endothelial cells into VEGF120/120 bones was retarded, associated with decreased expression of matrix metalloproteinase-9. Our findings indicate that expression of VEGF164 and/or VEGF188 is important for normal endochondral bone development, not only to mediate bone vascularization but also to allow normal differentiation of hypertrophic chondrocytes, osteoblasts, endothelial cells and osteoclasts.

  14. Multi-wavelength Observations of Blazar AO 0235+164 in the 2008-2009 Flaring State (United States)

    Ackermann, M.; Ajello, M.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Bellazzini, R.; Blandford, R. D.; Bloom, E. D.; Bonamente, E.; Borgland, A. W.; Bottacini, E.; Bregeon, J.; Brigida, M.; Bruel, P.; Buehler, R.; Buson, S.; Caliandro, G. A.; Cameron, R. A.; Caraveo, P. A.; Casandjian, J. M.; Cavazzuti, E.; Cecchi, C.; Charles, E.; Chekhtman, A.; Chiang, J.; Ciprini, S.; Claus, R.; Cohen-Tanugi, J.; Cutini, S.; D'Ammando, F.; de Palma, F.; Dermer, C. D.; Silva, E. do Couto e.; Drell, P. S.; Drlica-Wagner, A.; Dubois, R.; Favuzzi, C.; Fegan, S. J.; Ferrara, E. C.; Focke, W. B.; Fortin, P.; Fuhrmann, L.; Fukazawa, Y.; Fusco, P.; Gargano, F.; Gasparrini, D.; Gehrels, N.; Germani, S.; Giglietto, N.; Giommi, P.; Giordano, F.; Giroletti, M.; Glanzman, T.; Godfrey, G.; Grenier, I. A.; Guiriec, S.; Hadasch, D.; Hayashida, M.; Hughes, R. E.; Itoh, R.; Jóhannesson, G.; Johnson, A. S.; Katagiri, H.; Kataoka, J.; Knödlseder, J.; Kuss, M.; Lande, J.; Larsson, S.; Lee, S.-H.; Longo, F.; Loparco, F.; Lott, B.; Lovellette, M. N.; Lubrano, P.; Madejski, G. M.; Mazziotta, M. N.; McEnery, J. E.; Mehault, J.; Michelson, P. F.; Mitthumsiri, W.; Mizuno, T.; Monte, C.; Monzani, M. E.; Morselli, A.; Moskalenko, I. V.; Murgia, S.; Naumann-Godo, M.; Nishino, S.; Norris, J. P.; Nuss, E.; Ohsugi, T.; Okumura, A.; Omodei, N.; Orlando, E.; Ozaki, M.; Paneque, D.; Panetta, J. H.; Pelassa, V.; Pesce-Rollins, M.; Pierbattista, M.; Piron, F.; Pivato, G.; Porter, T. A.; Rainò, S.; Rando, R.; Rastawicki, D.; Razzano, M.; Readhead, A.; Reimer, A.; Reimer, O.; Reyes, L. C.; Richards, J. L.; Sbarra, C.; Sgrò, C.; Siskind, E. J.; Spandre, G.; Spinelli, P.; Szostek, A.; Takahashi, H.; Tanaka, T.; Thayer, J. G.; Thayer, J. B.; Thompson, D. J.; Tinivella, M.; Torres, D. F.; Tosti, G.; Troja, E.; Usher, T. L.; Vandenbroucke, J.; Vasileiou, V.; Vianello, G.; Vitale, V.; Waite, A. P.; Winer, B. L.; Wood, K. S.; Yang, Z.; Zimmer, S.; Fermi-LAT Collaboration; Moderski, R.; Nalewajko, K.; Sikora, M.; Villata, M.; Raiteri, C. M.; Aller, H. D.; Aller, M. F.; Arkharov, A. A.; Benítez, E.; Berdyugin, A.; Blinov, D. A.; Boettcher, M.; Bravo Calle, O. J. A.; Buemi, C. S.; Carosati, D.; Chen, W. P.; Diltz, C.; Di Paola, A.; Dolci, M.; Efimova, N. V.; Forné, E.; Gurwell, M. A.; Heidt, J.; Hiriart, D.; Jordan, B.; Kimeridze, G.; Konstantinova, T. S.; Kopatskaya, E. N.; Koptelova, E.; Kurtanidze, O. M.; Lähteenmäki, A.; Larionova, E. G.; Larionova, L. V.; Larionov, V. M.; Leto, P.; Lindfors, E.; Lin, H. C.; Morozova, D. A.; Nikolashvili, M. G.; Nilsson, K.; Oksman, M.; Roustazadeh, P.; Sievers, A.; Sigua, L. A.; Sillanpää, A.; Takahashi, T.; Takalo, L. O.; Tornikoski, M.; Trigilio, C.; Troitsky, I. S.; Umana, G.; GASP-WEBT Consortium; Angelakis, E.; Krichbaum, T. P.; Nestoras, I.; Riquelme, D.; F-GAMMA; Krips, M.; Trippe, S.; Iram-PdBI; Arai, A.; Kawabata, K. S.; Sakimoto, K.; Sasada, M.; Sato, S.; Uemura, M.; Yamanaka, M.; Yoshida, M.; Kanata; Belloni, T.; Tagliaferri, G.; RXTE; Bonning, E. W.; Isler, J.; Urry, C. M.; SMARTS; Hoversten, E.; Falcone, A.; Pagani, C.; Stroh, M.; (Swift-XRT


    The blazar AO 0235+164 (z = 0.94) has been one of the most active objects observed by Fermi Large Area Telescope (LAT) since its launch in Summer 2008. In addition to the continuous coverage by Fermi, contemporaneous observations were carried out from the radio to γ-ray bands between 2008 September and 2009 February. In this paper, we summarize the rich multi-wavelength data collected during the campaign (including F-GAMMA, GASP-WEBT, Kanata, OVRO, RXTE, SMARTS, Swift, and other instruments), examine the cross-correlation between the light curves measured in the different energy bands, and interpret the resulting spectral energy distributions in the context of well-known blazar emission models. We find that the γ-ray activity is well correlated with a series of near-IR/optical flares, accompanied by an increase in the optical polarization degree. On the other hand, the X-ray light curve shows a distinct 20 day high state of unusually soft spectrum, which does not match the extrapolation of the optical/UV synchrotron spectrum. We tentatively interpret this feature as the bulk Compton emission by cold electrons contained in the jet, which requires an accretion disk corona with an effective covering factor of 19% at a distance of 100 R g. We model the broadband spectra with a leptonic model with external radiation dominated by the infrared emission from the dusty torus.


    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  16. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...


    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  18. 164 -168_Zhigila

    African Journals Online (AJOL)



    Dec 2, 2014 ... PALYNOMORPHS AND FLORAL BLOOM AS TAXONOMIC CHARACTERS IN. SOME SPECIES OF THE GENUS ... microscope to examine their morphology and pollen characteristics in relation to taxonomy. These species include ... as part of the taxonomic revision at species level on a worldwide basis ...


    African Journals Online (AJOL)


    The cost of all non-collected or delivered reports was N1, 442,560 or 29.3% of the cost of the total requests ... Donc il est nécessaire d'instituer et de mettre en œuvre un system de gestion de laboratoire de bonne qualité et .... than the 13 % recorded in a similar study in Pakistan.8 This constitutes a huge economic loss to the ...

  20. New K isomers in the neutron-rich N =100 isotones 162Sm, 163Eu, and 164Gd (United States)

    Yokoyama, R.; Go, S.; Kameda, D.; Kubo, T.; Inabe, N.; Fukuda, N.; Takeda, H.; Suzuki, H.; Yoshida, K.; Kusaka, K.; Tanaka, K.; Yanagisawa, Y.; Ohtake, M.; Sato, H.; Shimizu, Y.; Baba, H.; Kurokawa, M.; Nishimura, D.; Ohnishi, T.; Iwasa, N.; Chiba, A.; Yamada, T.; Ideguchi, E.; Fujii, T.; Nishibata, H.; Ieki, K.; Murai, D.; Momota, S.; Sato, Y.; Hwang, J. W.; Kim, S.; Tarasov, O. B.; Morrissey, D. J.; Sherrill, B. M.; Simpson, G.; Praharaj, C. R.


    Very neutron-rich Z ˜60 isotopes produced by in-flight fission of a 345 MeV/nucleon 238U beam at the RI Beam Factory, RIKEN Nishina Center, have been studied by delayed γ -ray spectroscopy. New isomers were discovered in the neutron-rich N =100 isotones 162Sm, 163Eu, and 164Gd. Half-lives, γ -ray energies, and relative intensities of these isomers were obtained. Level schemes were proposed for these nuclei and the first 2+ and 4+ states were assigned for the even-even nuclei. The first 2+ and 4+ state energies decrease as the proton numbers get smaller. The energies and the half-lives of the new isomers are very similar to those of 4- isomers known in less neutron-rich N =100 isotones 168Er and 170Yb. A deformed Hartree-Fock with angular momentum projection model suggests Kπ=4- two-quasiparticle states with ν 7 /2 [633 ]⊗ν 1 /2 [521 ] configurations with similar excitation energy. The results suggest that neutron-rich N =100 nuclei are well deformed and the deformation gets larger as Z decreases to 62. The onset of K isomers with the same configuration at almost the same energy in N =100 isotones indicates that the neutron single-particle structures of neutron-rich isotones down to Z =62 do not change significantly from those of the Z =70 stable nuclei. Systematics of the excitation energies of new isomers can be explained without the predicted N =100 shell gap.

  1. Fatty acid 16:4(n-3) stimulates a GPR120-induced signaling cascade in splenic macrophages to promote chemotherapy resistance

    DEFF Research Database (Denmark)

    Houthuijzen, Julia M; Oosterom, Ilse; Hudson, Brian D


    Although chemotherapy is designed to eradicate tumor cells, it also has significant effects on normal tissues. The platinum-induced fatty acid 16:4(n-3) (hexadeca-4,7,10,13-tetraenoic acid) induces systemic resistance to a broad range of DNA-damaging chemotherapeutics. We show that 16:4(n-3) exerts...... its effect by activating splenic F4/80(+)/CD11b(low) macrophages, which results in production of chemoprotective lysophosphatidylcholines (LPCs). Pharmacologic studies, together with analysis of expression patterns, identified GPR120 on F4/80(+)/CD11b(low) macrophages as the relevant receptor for 16...... identify a novel and unexpected function for GPR120 and suggest that antagonists of this receptor might be effective agents to limit development of chemotherapy resistance.-Houthuijzen, J. M., Oosterom, I., Hudson, B. D., Hirasawa, A., Daenen, L. G. M., McLean, C. M., Hansen, S. V. F., van Jaarsveld, M. T...

  2. Study of the blazar AO 0235+164 during the multi-wavelength observation period from October 2008 to February 2009

    Energy Technology Data Exchange (ETDEWEB)

    Rainò, S. [INFN – Sezione di Bari (Italy); Madejski, G.; Couto e Silva, E. do [W.W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Gargano, F. [INFN – Sezione di Bari (Italy); Reyes, L. [Department of Physics, California Polytechnic State University, San Luis Obispo, CA 93401 (United States); Nalewajko, K. [Nicolaus Copernicus Astronomical Center, 00-716 Warsaw (Poland); University of Colorado, 440 UCB, Boulder, CO 80309 (United States); Sikora, M. [Nicolaus Copernicus Astronomical Center, 00-716 Warsaw (Poland)


    AO 0235+164 is one of the most studied and monitored BL Lac objects in the sky. Since the launch of Fermi, the source has been monitored in the gamma-ray band by Fermi Large Area Telescope. Starting in October 2008, AO 0235+164 showed an increasing activity in gamma-rays that led to a multi-wavelength campaign with instruments in the radio, near-infrared, optical, UV and X-ray bands. We present here the results of the analysis of the multi-wavelength data collected during the flaring period: the high variability properties of this source and the SED built from radio frequencies to gamma-rays are shown, and are interpreted in the context of well-known blazar emission models [Ackermann, M. et al. 2012, ApJ 751, 159].

  3. Overexpression of OsmiR164b-resistant OsNAC2 improves plant architecture and grain yield in rice. (United States)

    Jiang, Dagang; Chen, Weiting; Dong, Jingfang; Li, Jing; Yang, Fen; Wu, Zhichao; Zhou, Hai; Wang, Wensheng; Zhuang, Chuxiong


    Plant architecture is a major target of rice (Oryza sativa) breeding and selection, but the underlying regulatory networks remain unclear. Here, we overexpressed a OsNAC2 mutant (OErN) that cannot be cleaved by the microRNA miR164b. OErN plants had better plant architecture, longer panicles, and produced more grains. The parental line averaged 12.2 primary and 31.5 secondary branches in the main panicles; two OErN lines averaged 15.0 and 15.2 primary, and 41.5 and 44.3 secondary branches. In large-scale field trials, OErN plants produced at least 58.62% more total grain (by weight) compared with the parental line. They also had more large and small vascular bundles in the stem internodes and leaves. Overexpression of miR164b or down-regulation of OsNAC2 led to decreased panicle length and grain yield in the main panicle. The OErN plants showed significant up-regulation of the grain number and plant architecture related genes IPA1 and DEP1. A survey of more than 3,000 rice varieties found no natural mutations in the miR164b binding site of OsNAC2. OErN increased yield in Nipponbare and the commonly grown Yangyujing 3 cultivars. In summary, we identified an efficient new strategy to substantially increase rice yield and improve plant architecture through over-expression of OsmiR164b-resistant OsNAC2. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  4. Smac mimetic SM-164 potentiates APO2L/TRAIL- and doxorubicin-mediated anticancer activity in human hepatocellular carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Shuijun Zhang

    Full Text Available BACKGROUND: The members of inhibitor of apoptosis proteins (IAPs family are key negative regulators of apoptosis. Overexpression of IAPs are found in hepatocellular carcinoma (HCC, and can contribute to chemotherapy resistance and recurrence of HCC. Small-molecule Second mitochondria-derived activator of caspases (Smac mimetics have recently emerged as novel anticancer drugs through targeting IAPs. The specific aims of this study were to 1 examine the anticancer activity of Smac mimetics as a single agent and in combination with chemotherapy in HCC cells, and 2 investigate the mechanism of anticancer action of Smac mimetics. METHODS: Four HCC cell lines, including SMMC-7721, BEL-7402, HepG2 and Hep3B, and 12 primary HCC cells were used in this study. Smac mimetic SM-164 was used to treat HCC cells. Cell viability, cell death induction and clonal formation assays were used to evaluate the anticancer activity. Western blotting analysis and a pancaspase inhibitor were used to investigate the mechanisms. RESULTS: Although SM-164 induced complete cIAP-1 degradation, it displayed weak inhibitory effects on the viability of HCC cells. Nevertheless, SM-164 considerably potentiated Apo2 ligand or TNF-related apoptosis-inducing ligand (APO2L/TRAIL- and Doxorubicin-mediated anticancer activity in HCC cells. Mechanistic studies demonstrated that SM-164 in combination with chemotherapeutic agents resulted in enhanced activation of caspases-9, -3 and cleavage of poly ADP-ribose polymerase (PARP, and also led to decreased AKT activation. CONCLUSIONS: Smac mimetics can enhance chemotherapeutic-mediated anticancer activity by enhancing apoptosis signaling and suppressing survival signaling in HCC cells. This study suggests Smac mimetics are potential therapeutic agents for HCC.


    Directory of Open Access Journals (Sweden)

    Sergiu BRÎNZA


    Full Text Available Analiza efectuată în cadrul acestui articol are ca obiect caracteristicile juridico-penale ale infracţiunilor specificate la art.164 şi 166 CP RM. Se argumentează că, în cazul infracţiunii specificate la art.164 CP RM, constrângerea fizică se poate concretiza în: 1 vătămarea intenţionată gravă, medie sau uşoară a integrităţii corporale ori a sănătăţii; 2 violenţa care nu implică un prejudiciu cauzat sănătăţii. În continuare, se arată că oricare din tipurile de arme menţionate în Legea privind regimul armelor şi al muniţiilor cu destinaţie civilă pot fi aplicate ca mijloace de săvârşire a infracţiunii prevă-zute la lit.g alin.(2 art.164 CP RM. Or, legiuitorul nu a stabilit nicio limitare a tipurilor de arme ce pot fi aplicate la răpirea unei persoane. Contează doar ca armele să fie utilizabile în vederea anihilării unei persoane. Nu în ultimul rând, în legătură cu infracţiunile prevăzute la art.166 CP RM, se relevă că, în condiţiile Republicii Moldova, care se confruntă cu fenomenul separatismului, restrângerea libertăţii persoanei are un caracter ilegal şi atunci când este exercitată de autorităţile neconstituţionale care controlează partea de est a ţării.THE OFFENCES REFERRED TO AT ART.164. AND 166 PC RM: THEORETICAL AND PRACTICAL ASPECTS The analysis performed in this article covers the legal-penal characteristics of the offences specified in art.164 and 166 PC RM. It is argued that, with regard to the offence specified in art.164 PC RM, the physical constraint may result in: 1 intentional grave, ordinary or easy battery or health harm; 2 violence without any health harm. Further, it is shown that any of the types of weapons mentioned in Law on weapons and ammunition destined for civil usage can be applied as means of committing the offence referred to at lett.g par.(2 art.164 PC RM. Or, the legislature did not set any limitation on the types of weapons that can be

  6. An Integrated Organic-Inorganic Geochemical Study of the 1.64 Ga Barney Creek Formation in Australia (Invited) (United States)

    Kelly, A. E.; Love, G. D.; Lyons, T. W.; Anbar, A. D.


    The chemistry and redox structure of the ancient ocean played a key role in influencing the evolution of life throughout Earth’s history. Surface waters in the mid-Proterozoic ocean (~1.0-1.7 billion years old [Ga]) were likely oxygenated, while deeper anoxic waters contained metastable sulfidic (euxinic) zones at intermediate depths, which constitute a hostile aquatic environment for eukaryotes. Hydrocarbon biomarkers provide a means of analyzing both microbial communities and paleoenvironmental redox conditions. Iron (Fe) proxies are the most effective inorganic proxy for delineating ancient euxinia on the local scale and do not require photic-zone depths for the sulfidic waters. Additionally, Fe proxies allow us to distinguish between anoxic and oxic waters and Fe-rich (ferruginous) from euxinic conditions, the latter characterized by free sulfide in the water column. Viewing these parameters in an integrated fashion for the first time, we can explore the backdrop of ocean redox during the evolution of eukaryotes, fully revealing the complex redox structure and paleoecology. A suite of thermally well-preserved mid-Proterozoic sedimentary rocks collected from drill core of the 1.64 Ga Barney Creek Formation, spanning a range of depositional facies, has been studied using detailed biomarker and inorganic geochemical redox proxies. Iron speciation data indicate burial of the sediments under periodically euxinic conditions. Our biomarker data clearly show the presence of two organic facies and include bacterially-derived hopanes and much lower concentrations of dinosteranes with an absence of detectable regular steranes. In addition, in both the free bitumens and corresponding kerogen hydropyrolysates, the pattern of dinosterane isomers to 4α-methyl-24-ethylcholestane abundance is markedly different in the Barney Creek samples compared to typical Phanerozoic methylsterane patterns. Though both dinosteranes and 4α-methyl-24-ethylcholestane are diagnostic of

  7. Microsomal triglyceride transfer protein -164 T > C gene polymorphism and risk of cardiovascular disease: results from the EPIC-Potsdam case-cohort study (United States)


    Background The microsomal triglyceride transfer protein (MTTP) is encoded by the MTTP gene that is regulated by cholesterol in humans. Previous studies investigating the effect of MTTP on ischemic heart disease have produced inconsistent results. Therefore, we have tested the hypothesis that the rare allele of the -164T > C polymorphism in MTTP alters the risk of cardiovascular disease (CVD), depending on the cholesterol levels. Methods The -164T > C polymorphism was genotyped in a case-cohort study (193 incident myocardial infarction (MI) and 131 incident ischemic stroke (IS) cases and 1 978 non-cases) nested within the European Prospective Investigation into Cancer and Nutrition (EPIC)–Potsdam study, comprising 27 548 middle-aged subjects. The Heinz Nixdorf Recall study (30 CVD cases and 1 188 controls) was used to replicate our findings. Results Genotype frequencies were not different between CVD and CVD free subjects (P = 0.79). We observed an interaction between the -164T > C polymorphism and total cholesterol levels in relation to future CVD. Corresponding stratified analyses showed a significant increased risk of CVD (HRadditve = 1.38, 95% CI: 1.07 to 1.78) for individuals with cholesterol levels Potsdam study. HRadditive was 1.06, 95% CI: 0.33 to 3.40 for individuals in the Heinz Nixdorf Recall study. A borderline significant decrease in CVD risk was observed in subjects with cholesterol levels ≥200 mg/dL (HRadditve = 0.77, 95% CI: 0.58 to 1.03) in the EPIC-Potsdam study. A similar trend was observed in the independent cohort (HRadditve = 0.60, 95% CI: 0.29 to 1.25). Conclusions Our study suggests an interaction between MTTP -164T > C functional polymorphism with total cholesterol levels. Thereby risk allele carriers with low cholesterol levels may be predisposed to an increased risk of developing CVD, which seems to be abolished among risk allele carriers with high cholesterol levels. PMID:23356586

  8. Microsomal triglyceride transfer protein -164 T > C gene polymorphism and risk of cardiovascular disease: results from the EPIC-Potsdam case-cohort study. (United States)

    di Giuseppe, Romina; Pechlivanis, Sonali; Fisher, Eva; Arregui, Maria; Weikert, Beate; Knüppel, Sven; Buijsse, Brian; Fritsche, Andreas; Willich, Stefan N; Joost, Hans-Georg; Boeing, Heiner; Moebus, Susanne; Weikert, Cornelia


    The microsomal triglyceride transfer protein (MTTP) is encoded by the MTTP gene that is regulated by cholesterol in humans. Previous studies investigating the effect of MTTP on ischemic heart disease have produced inconsistent results. Therefore, we have tested the hypothesis that the rare allele of the -164T > C polymorphism in MTTP alters the risk of cardiovascular disease (CVD), depending on the cholesterol levels. The -164T > C polymorphism was genotyped in a case-cohort study (193 incident myocardial infarction (MI) and 131 incident ischemic stroke (IS) cases and 1 978 non-cases) nested within the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam study, comprising 27 548 middle-aged subjects. The Heinz Nixdorf Recall study (30 CVD cases and 1 188 controls) was used to replicate our findings. Genotype frequencies were not different between CVD and CVD free subjects (P = 0.79). We observed an interaction between the -164T > C polymorphism and total cholesterol levels in relation to future CVD. Corresponding stratified analyses showed a significant increased risk of CVD (HR(additve) = 1.38, 95% CI: 1.07 to 1.78) for individuals with cholesterol levels Potsdam study. HR(additive) was 1.06, 95% CI: 0.33 to 3.40 for individuals in the Heinz Nixdorf Recall study. A borderline significant decrease in CVD risk was observed in subjects with cholesterol levels ≥ 200 mg/dL (HR(additve) = 0.77, 95% CI: 0.58 to 1.03) in the EPIC-Potsdam study. A similar trend was observed in the independent cohort (HR(additve) = 0.60, 95% CI: 0.29 to 1.25). Our study suggests an interaction between MTTP -164T > C functional polymorphism with total cholesterol levels. Thereby risk allele carriers with low cholesterol levels may be predisposed to an increased risk of developing CVD, which seems to be abolished among risk allele carriers with high cholesterol levels.

  9. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)


    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  10. Gene Therapy Using Plasmid DNA Encoding Vascular Endothelial Growth Factor 164 and Fibroblast Growth Factor 2 Genes for the Treatment of Horse Tendinitis and Desmitis: Case Reports

    Directory of Open Access Journals (Sweden)

    Milomir Kovac


    Full Text Available In this clinical study, for the first time we used the direct gene therapy to restore severe injuries of the suspensory ligament branch and superficial digital flexor tendon in horses (Equus caballus. We injected the plasmid DNA encoding two therapeutic species-specific growth factors: vascular endothelial growth factor 164 and fibroblast growth factor 2 at the site of injury in the suspensory ligament branch and tendon. Treatment effects were evaluated with the use of clinical observation and ultrasound imaging during a period of a few months. We showed that gene therapy used within a period of 2–3 months after the injury resulted in the complete recovery of functions and full restoration of the severely damaged suspensory ligament and superficial digital flexor tendon.

  11. Comment on ‘To stack or not to stack: Performance of a new density functional for the uracil and thymine dimers’ [Chem. Phys. Lett. 459 (2008) 164 (United States)

    van Mourik, Tanja


    A Letter by Gu et al. [J. Gu, J. Wang, J. Leszczynski, Y. Xie, H.F. Schaefer III, Chem. Phys. Lett. 459 (2008) 164] presented MP2/6-31+G(d) and MP2/TZVPP stacking energies for the uracil and thymine dimers, with the aim to assess the performance of the new M06-2X density functional. However, the stacking energies were not corrected for the basis set superposition error (BSSE). Here we show that correction for this error dramatically changes the results. BSSE correction severely reduces the stacking energy of the thymine dimer, whereas the stacked uracil dimer structure considered by Gu et al. is not even a minimum on the MP2/6-31+G(d) potential energy surface.

  12. Molecular surveillance of the antifolate-resistant mutation I164L in imported African isolates of Plasmodium falciparum in Europe: sentinel data from TropNetEurop

    DEFF Research Database (Denmark)

    Wichmann, Ole; Jelinek, Tomas; Peyerl-Hoffmann, Gabriele


    BACKGROUND: Malaria parasites that carry the DHFR-mutation I164L are not only highly resistant to sulfadoxine-pyrimethamine but also to the new antimalarial drug chlorproguanil-dapsone. The spread of this mutation in Africa would result in a public health disaster since there is a lack of effective...

  13. Incidence and predictors of dural venous sinus pressure gradient in idiopathic intracranial hypertension and non-idiopathic intracranial hypertension headache patients: results from 164 cerebral venograms. (United States)

    Levitt, Michael R; Hlubek, Randall J; Moon, Karam; Kalani, M Yashar S; Nakaji, Peter; Smith, Kris A; Little, Andrew S; Knievel, Kerry; Chan, Jane W; McDougall, Cameron G; Albuquerque, Felipe C


    OBJECTIVE Cerebral venous pressure gradient (CVPG) from dural venous sinus stenosis is implicated in headache syndromes such as idiopathic intracranial hypertension (IIH). The incidence of CVPG in headache patients has not been reported. METHODS The authors reviewed all cerebral venograms with manometry performed for headache between January 2008 and May 2015. Patient demographics, headache etiology, intracranial pressure (ICP) measurements, and radiographic and manometric results were recorded. CVPG was defined as a difference ≥ 8 mm Hg by venographic manometry. RESULTS One hundred sixty-four venograms were performed in 155 patients. There were no procedural complications. Ninety-six procedures (58.5%) were for patients with IIH. The overall incidence of CVPG was 25.6% (42 of 164 procedures): 35.4% (34 of 96 procedures) in IIH patients and 11.8% (8 of 68 procedures) in non-IIH patients. Sixty procedures (36.6%) were performed in patients with preexisting shunts. Seventy-seven patients (49.7%) had procedures preceded by an ICP measurement within 4 weeks of venography, and in 66 (85.7%) of these patients, the ICP had been found to be elevated. CVPG was seen in 8.3% (n = 5) of the procedures in the 60 patients with a preexisting shunt and in 0% (n = 0) of the 11 procedures in the 77 patients with normal ICP (p < 0.001 for both). Noninvasive imaging (MR venography, CT venography) was assessed prior to venography in 112 (68.3%) of 164 cases, and dural venous sinus abnormalities were demonstrated in 73 (65.2%) of these cases; there was a trend toward CVPG (p = 0.07). Multivariate analysis demonstrated an increased likelihood of CVPG in patients with IIH (OR 4.97, 95% CI 1.71-14.47) and a decreased likelihood in patients with a preexisting shunt (OR 0.09, 95% CI 0.02-0.44). CONCLUSIONS CVPG is uncommon in IIH patients, rare in those with preexisting shunts, and absent in those with normal ICP.

  14. Radio and γ-Ray Variability in the BL Lac PKS 0219-164: Detection of Quasi-periodic Oscillations in the Radio Light Curve (United States)

    Bhatta, Gopal


    In this work, we explore the long-term variability properties of the blazar PKS 0219-164 in the radio and the γ-ray regime, utilizing the OVRO 15 GHz and the Fermi/LAT observations from the period 2008-2017. We found that γ-ray emission is more variable than the radio emission implying that γ-ray emission possibly originated in more compact regions while the radio emission represented continuum emission from the large-scale jets. Also, in the γ-ray, the source exhibited spectral variability, characterized by the softer-when-brighter trend, a less frequently observed feature in the high-energy emission by BL Lacs. In radio, using Lomb-Scargle periodogram and weighted wavelet z-transform, we detected a strong signal of quasi-periodic oscillation (QPO) with a periodicity of 270 ± 26 days with possible harmonics of 550 ± 42 and 1150 ± 157 day periods. At a time when detections of QPOs in blazars are still under debate, the observed QPO with high statistical significance (˜97%-99% global significance over underlying red-noise processes) and persistent over nearly 10 oscillations could make one of the strongest cases for the detection of QPOs in blazar light curves. We discuss various blazar models that might lead to the γ-ray and radio variability, QPO, and the achromatic behavior seen in the high-energy emission from the source.

  15. Urgent segmental resection as the primary strategy in management of benign tracheal stenosis. A single center experience in 164 consecutive cases. (United States)

    Krajc, Tibor; Janik, Miroslav; Benej, Roman; Lucenic, Martin; Majer, Ivan; Demian, Juraj; Harustiak, Svetozar


    The report is a retrospective review of 238 benign tracheal stenoses of various etiologies treated between 1995 and 2008. To show that urgent segmental resection has complication rates similar to elective resection and, therefore, preoperative dilation is not necessary, we analysed records of patients who underwent either standard segmental resections with anterolateral mediastinal tracheal mobilization, single-suture anastomosis and neck flexion; or insertion of T-tube with oval-shaped horizontal arm. Primary segmental resection was performed in 164 patients (68.9%), including 14 cases with concomitant tracheo-esophageal fistula (TEF). T-tube as an initial treatment suited 74 (31.1%) patients. We encountered two partial and one complete anastomotic disruptions following subglottic resections treated by T-tube insertion and costal cartilage tracheoplasty or permanent tracheostomy. Restenosis rate in segmental resection was 3.1%. No difference in complication rate between urgent and elective segmental resections was experienced. We treated a small number of patients by endotracheal stent insertion but the results were discouraging. Urgent segmental resection without prior rigid bronchoscopy dilation is our strategy of choice whenever possible. As an alternative to dilation we prefer temporary insertion of modified T-tube. Stand-alone endoluminal dilation and stenting has yet to prove its safety and long-term efficacy.

  16. High-Quality (CH3NH3)3Bi2I9 Film-Based Solar Cells: Pushing Efficiency up to 1.64. (United States)

    Zhang, Zheng; Li, Xiaowei; Xia, Xiaohong; Wang, Zhuo; Huang, Zhongbing; Lei, Binglong; Gao, Yun


    Bismuth-based solar cells have exhibited some advantages over lead perovskite solar cells for nontoxicity and superior stability, which are currently two main concerns in the photovoltaic community. As for the perovskite-related compound (CH3NH3)3Bi2I9 applied for solar cells, the conversion efficiency is severely restricted by the unsatisfactory photoactive film quality. Herein we report a novel two-step approach- high-vacuum BiI3 deposition and low-vacuum homogeneous transformation of BiI3 to (CH3NH3)3Bi2I9-for highly compact, pinhole-free, large-grained films, which are characterized with absorption coefficient, trap density of states, and charge diffusion length comparable to those of some lead perovskite analogues. Accordingly, the solar cells have realized a record power conversion of efficiency of 1.64% and also a high external quantum efficiency approaching 60%. Our work demonstrates the potential of (CH3NH3)3Bi2I9 for highly efficient and long-term stable solar cells.

  17. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma


    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  18. Ringo 155-164.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    5.5. In fact, in some parts, Al saturation is high (4-55%) and dramatically affects the availability of phosphorus (Kanyanjua et al., 2002). Acid soils cover more than 15% of the agricultural land in. Tanzania (MARI, 2006), and over 7.5% in Kenya.

  19. On the Location of the gamma-Ray Outburst Emission in the BL Lacertae Object AO 0235 + 164 Through Observations Across the Electromagnetic Spectrum (United States)

    Agudo, Ivan; Marscher, Alan P.; Jorstad, Svetlana G.; Larionov, Valeri M.; Gomez, Jose L.; Laehteenmaeki, Anne; Smith, Paul S.; Nilsson, Kari; Readhead, Anthony C. S.; Aller, Margo F.; hide


    We present observations of a major outburst at centimeter, millimeter, optical, X-ray, and gamma-ray wavelengths of the BL Lacertae object AO 0235+164. We analyze the timing of multi-waveband variations in the flux and linear polarization, as well as changes in Very Long Baseline Array images at A = 7 mm with approx.0.15 milliarcsec resolution. The association of the events at different wavebands is confirmed at high statistical significance by probability arguments and Monte Carlo simulations. A series of sharp peaks in optical linear polarization, as well as a pronounced maximum in the 7 mm polarization of a superluminal jet knot, indicate rapid fluctuations in the degree of ordering of the magnetic field. These results lead us to conclude that the outburst occurred in the jet both in the quasi-stationary "core" and in the superluminal knot, both parsecs downstream of the supermassive black hole. We interpret the outburst as a consequence of the propagation of a disturbance, elongated along the line of sight by light-travel time delays, that passes through a standing recollimation shock in the core and propagates down the jet to create the superluminal knot. The multi-wavelength light curves vary together on long timescales (months/ years), but the correspondence is poorer on shorter timescales. This, as well as the variability of the polarization and the dual location of the outburst, agrees with the expectations of a multi-zone emission model in which turbulence plays a major role in modulating the synchrotron and inverse Compton fluxes.

  20. KIC 8462852 Faded at an Average Rate of 0.164 ± 0.013 Magnitudes per Century from 1890 to 1989 (United States)

    Schaefer, Bradley E.


    KIC 8462852 is a completely ordinary F3 main-sequence star, except that the light curve from Kepler shows episodes of unique and inexplicable day-long dips with up to 20% dimming. Here, I provide a light curve of 1338 Johnson B-band magnitudes from 1890 to 1989 taken from archival photographic plates at Harvard. KIC 8462852 displays a secular dimming at an average rate of 0.164 ± 0.013 mag per century. From the early-1890s to the late-1980s, KIC 8462852 faded by 0.193 ± 0.030 mag. The decline is not an artifact because nearby check stars have closely flat light curves. This century-long dimming is unprecedented for any F-type main-sequence star. Thus, the Harvard light curve provides the first confirmation (past the several dips seen in the Kepler light curve alone) that KIC 8462852 has anything unusual. The century-long dimming and the day-long dips are both just extreme ends of a spectrum of timescales for unique dimming events. By Ockham’s Razor, two such unique and similar effects are very likely produced by one physical mechanism. This one mechanism does not appear as any isolated catastrophic event in the last century, but rather must be some ongoing process with continuous effects. Within the context of dust-occultation models, the century-long dimming trend requires 104-107 times as much dust as for the deepest Kepler dip. Within the context of the comet-family idea, the century-long dimming trend requires an estimated 648,000 giant comets (each with 200 km diameter) all orchestrated to pass in front of the star within the last century.

  1. Shortening of the Lactobacillus paracasei subsp. paracasei BGNJ1-64 AggLb protein switches its activity from auto-aggregation to biofilm formation

    Directory of Open Access Journals (Sweden)

    Marija Miljković


    Full Text Available AggLb is the largest (318.6 kDa aggregation-promoting protein of Lactobacillus paracasei subsp. paracasei BGNJ1-64 responsible for forming large cell aggregates, which causes auto-aggregation, collagen binding and pathogen exclusion in vitro. It contains an N-terminus leader peptide, followed by six successive collagen binding domains, 20 successive repeats (CnaB-like domains and an LPXTG sorting signal at the C-terminus for cell wall anchoring. Experimental information about the roles of the domains of AggLb is currently unknown. To define the domain that confers cell aggregation and the key domains for interactions of specific affinity between AggLb and components of the extracellular matrix (ECM, we constructed a series of variants of the aggLb gene and expressed them in Lactococcus lactis subsp. lactis BGKP1-20 using a lactococcal promoter. All of the variants contained a leader peptide, an inter collagen binding-CnaB domain region (used to raise an anti-AggLb antibody, an anchor domain and a different number of collagen binding and CnaB-like domains. The role of the collagen binding repeats of the N-terminus in auto-aggregation and binding to collagen and fibronectin was confirmed. Deletion of the collagen binding repeats II, III and IV resulted in a loss of the strong auto-aggregation, collagen and fibronectin binding abilities whereas the biofilm formation capability was increased. The strong auto-aggregation, collagen and fibronectin binding abilities of AggLb were negatively correlated to biofilm formation.

  2. [Fe II] 1.64 μm Features of Jets and Outflows from Young Stellar Objects in the Carina Nebula (United States)

    Shinn, Jong-Ho; Pyo, Tae-Soo; Lee, Jae-Joon; Lee, Ho-Gyu; Kim, Hyun-Jeong; Koo, Bon-Chul; Sung, Hwankyung; Chun, Moo-Young; Lyo, A.-Ran; Moon, Dae-Sik; Kyeong, Jaemann; Park, Byeong-Gon; Hur, Hyeonoh; Lee, Yong-Hyun


    We present [Fe II] 1.64 μm imaging observations for jets and outflows from young stellar objects (YSOs) over the northern part (~24' × 45') of the Carina Nebula, a massive star-forming region. The observations were performed with IRIS2 of the Anglo-Australian Telescope and the seeing was ~1.''5 ± 0.''5. Eleven jet and outflow features are detected at eight different regions and are termed ionized Fe objects (IFOs). One Herbig-Haro candidate that was missed in Hubble Space Telescope Hα observations is newly identified as HHc-16, referring to our [Fe II] images. IFOs have knotty or longish shapes, and the detection rate of IFOs against previously identified YSOs is 1.4%, which should be treated as a lower limit. Four IFOs show anti-correlated peak intensities in [Fe II] and Hα, where the ratio I([Fe II])/I(Hα) is higher for longish IFOs than for knotty IFOs. We estimate the outflow mass loss rate from the [Fe II] flux using two different methods. The jet-driving objects are identified for three IFOs (IFO-2, -4, and -7) for which we study the relations between the outflow mass loss rate and the YSO physical parameters from the radiative transfer model fitting. The ratios of the outflow mass loss rate over the disk accretion rate for IFO-4 and -7 are consistent with the previously reported values (10-2-10+1), while the ratio is higher for IFO-2. This excess may result from underestimating the disk accretion rate. The jet-driving objects are likely to be low- or intermediate-mass stars. Other YSO physical parameters, such as luminosity and age, show reasonable relations or trends.

  3. Anvendelsen af sammenligningslejemål i sager om fastsættelse af det lejedesværdi- med udgangspunkt i en analyse af T:BB 2009.164 V

    DEFF Research Database (Denmark)

    Juul-Sandberg, Jakob


    I T:BB 2009.164 V tog Vestre Landsret i en tvist om størrelsen af det lejedes værdi stilling til den bevismæssige betydning af, om størrelsen af lejen i et sammenligningslejemål havde været prøvet i huslejenævnet, ligesom boligretten afgrænsede de relevante sammenligningslejemål med forskellige...

  4. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)


    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  5. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  6. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)


    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  7. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)


    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  8. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  9. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  10. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  11. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  12. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry


    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  13. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)


    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  14. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System (United States)


    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  15. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  16. 1.92 Tb/s coherent DWDM-OFDMA-PON with no high-speed ONU-side electronics over 100 km SSMF and 1:64 passive split. (United States)

    Cvijetic, Neda; Huang, Ming-Fang; Ip, Ezra; Shao, Yin; Huang, Yue-Kai; Cvijetic, Milorad; Wang, Ting


    Record 1.92-Tb/s (40λ × 48 Gb/s/λ) coherent DWDM-OFDMA-PON without high-speed ONU-side ADCs/DACs/DSP/RF clock sources is demonstrated over 100 km straight SSMF with a 1:64 passive split. Novel optical-domain OFDMA sub-band selection, coherent detection, and simple RF components are exploited. As the first experimental verification of a next-generation optical platform capable of delivering 1 Gb/s to 1000(+) users over 100 km, the new architecture is promising for future optical access/metro systems. © 2011 Optical Society of America

  17. Cervical carcinoma and sexual behavior: collaborative reanalysis of individual data on 15,461 women with cervical carcinoma and 29,164 women without cervical carcinoma from 21 epidemiological studies

    DEFF Research Database (Denmark)

    Kjær, Susanne Krüger


    High-risk human papillomavirus (HPV) types cause most cervical carcinomas and are sexually transmitted. Sexual behavior therefore affects HPV exposure and its cancer sequelae. The International Collaboration of Epidemiological Studies of Cervical Cancer has combined data on lifetime number...... for invasive cancer and CIN3 were estimated by conditional logistic regression. Risk of invasive cervical carcinoma increased with lifetime number of sexual partners (P for linear trend or =6 versus 1 partner, conditioned on age, study, and age at first intercourse, was 2...... of sexual partners and age at first sexual intercourse from 21 studies, or groups of studies, including 10,773 women with invasive cervical carcinoma, 4,688 women with cervical intraepithelial neoplasia grade 3 (CIN3)/carcinoma in situ, and 29,164 women without cervical carcinoma. Relative risks...

  18. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORING_M2_164W_57N in the Bering Sea from 2013-05-06 to 2014-10-19 (NCEI Accession 0157599) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0157599 includes chemical, meteorological, physical and time series data collected from MOORING_M2_164W_57N in the Bering Sea from 2013-05-06 to...

  19. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Directory of Open Access Journals (Sweden)

    R. N. Bhowmik


    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  20. Crystal structure of a silver-, cobalt- and iron-based phosphate with an alluaudite-like structure: Ag1.655Co1.64Fe1.36(PO43

    Directory of Open Access Journals (Sweden)

    Adam Bouraima


    Full Text Available The new silver-, cobalt- and iron-based phosphate, silver cobalt iron tris(orthophosphate, Ag1.655Co1.64Fe1.36(PO43, was synthesized by solid-state reactions. Its structure is isotypic to that of Na2Co2Fe(PO43, and belongs to the alluaudite family, with a partial cationic disorder, the AgI atoms being located on an inversion centre and twofold rotation axis sites (Wyckoff positions 4a and 4e, with partial occupancies of 0.885 (2 and 0.7688 (19, respectively. One of the two P atoms in the asymmetric unit completely fills one 4e site while the Co and Fe atoms fill another 4e site, with partial occupancies of 0.86 (5 and 0.14 (5, respectively. The remaining Co2+ and Fe3+ cations are distributed on a general position, 8f, in a 0.39 (4:0.61 (4 ratio. All O atoms and the other P atoms are in general positions. The structure is built up from zigzag chains of edge-sharing [MO6] (M = Fe/Co octahedra stacked parallel to [101]. These chains are linked together through PO4 tetrahedra, forming polyhedral sheets perpendicular to [010]. The resulting framework displays two types of channels running along [001], in which the AgI atoms (coordination number eight are located.

  1. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Protecting rights and reducing stigma against Vietnamese women married overseas (open access). Since the mid-1990s, marriage has gained significance among the reasons for migration from Vietnam, with large numbers of women leaving the country and becoming foreign brides for East Asian men, particularly in ...

  2. 46 CFR 164.012-5 - Scope. (United States)


    ... “Interior Finish” means any coating, overlay, or veneer except standard paint which is applied for decorative or other purpose. It includes not only the visible finish, but all material used in its...) With the exception of nitrocellulose or other highly inflammable or noxious fume-producing paints or...

  3. 33 CFR 164.70 - Definitions. (United States)


    ... alongside, or any combination of pulling, pushing, or hauling alongside. Western Rivers means the... Allen-Morgan City Alternative Route, and that part of the Atchafalaya River above its junction with the Port Allen-Morgan City Alternative Route including the Old River and the Red River and those waters...

  4. 42 CFR 460.164 - Involuntary disenrollment. (United States)


    ...) Documentation of disruptive or threatening behavior. If a PACE organization proposes to disenroll a participant... remedy the situation. (d) Noncompliant behavior. (1) A PACE organization may not disenroll a PACE... the PACE organization after a 30-day grace period. (2) The participant engages in disruptive or...

  5. 45 CFR 164.103 - Definitions. (United States)


    ...) Whose business activities include both covered and non-covered functions; and (3) That designates health... criminal, civil, or administrative proceeding arising from an alleged violation of law. Plan sponsor is defined as defined at section 3(16)(B) of ERISA, 29 U.S.C. 1002(16)(B). Required by law means a mandate...

  6. 45 CFR 164.308 - Administrative safeguards. (United States)


    ... business processes for protection of the security of electronic protected health information while... REQUIREMENTS SECURITY AND PRIVACY Security Standards for the Protection of Electronic Protected Health... confidentiality, integrity, and availability of electronic protected health information held by the covered entity...

  7. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... d'Ivoire (open access). When a system loses resilience it becomes vulnerable. Assessing the vulnerability of an ecosystem facing multiple hazards is problematic for researchers. The White Bandama Basin (WBB) in Northern Côte d''Ivoire is one of the most vulnerable areas to climate change with drought as the most.

  8. Reference: 164 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available stel C et al. 2005 Mar. Development 132(5):897-911. The higher-plant shoot apical meristem is a dynamic structure...wo antagonistic processes: self-renewal of the stem cell population and initiation of the lateral organs. coordination is stringently controlled by gene networks that contain both positive and negative components. We have pre...viously defined the ULTRAPETALA1 (ULT1) gene as a key negative regu...lator of cell accumulation in Arabidopsis shoot and floral meristems, because mutations in ULT1 cause the enlargement of inflore

  9. 21 CFR 164.110 - Mixed nuts. (United States)


    ... CONSUMPTION TREE NUT AND PEANUT PRODUCTS Requirements for Specific Standardized Tree Nut and Peanut Products... and not more than 80 percent by weight of the finished food. For purposes of this section, each kind... to in paragraph (a) of this section are: (1) Almonds, black walnuts, Brazil nuts, cashews, English...

  10. Publications | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Once achieved, UHC became an entitlement for the population and now enjoys broad public support. This paper explores... Physiological and biochemical response of local landrace and chickpea varieties to rhizobium inoculation and planting dates under different agro-ecological zones of Ethiopia (restricted access).

  11. 45 CFR 164.501 - Definitions. (United States)


    ... items: Diagnosis, functional status, the treatment plan, symptoms, prognosis, and progress to date... and is maintained, collected, used, or disseminated by or for a covered entity. Direct treatment relationship means a treatment relationship between an individual and a health care provider that is not an...

  12. 12 CFR 250.164 - Bankers' acceptances. (United States)


    .... The legislative history of the BESA indicates no intent to change this domestic acceptance limitation... financial statements prepared in accordance with local accounting practices and an explanation of the accounting terminology and the major features of the accounting standards used in the preparation of the...

  13. Environmental Radiation Data (ERD) Journal Report 164 (United States)

    RadNet environmental radiation monitoring data report for the period of October - December 2015. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  14. 32 CFR 552.164 - General. (United States)


    ...), and Director of Engineering and Housing (DEH). If the event can be supported, DPTM will advise the organization to contact the Director of Engineering and Housing Real Property Branch. Requests for such... the appropriate Installation Range Regulations. (f) Non-DoD personnel in transit. Individuals in...

  15. 21 CFR 133.164 - Nuworld cheese. (United States)


    ...-white mold, a white mutant of Penicillium roquefortii, throughout the cheese. The minimum milkfat... forms, spores of a white mutant of the mold Penicillium roquefortii are added. The forms are turned..., used alone or in combination. (2) Clotting enzymes. Rennet and/or other clotting enzymes of animal...

  16. 45 CFR 164.304 - Definitions. (United States)


    .... Malicious software means software, for example, a virus, designed to damage or disrupt a system. Password... laptop or desktop computer, or any other device that performs similar functions, and electronic media...

  17. Atypical juvenile presentation of GM2 gangliosidosis AB in a patient compound-heterozygote for c.259G>T and c.164C>T mutations in the GM2A gene

    Directory of Open Access Journals (Sweden)

    Carla Martins


    Full Text Available GM2-gangliosidosis, AB variant is an extremely rare autosomal recessive inherited disorder caused by mutations in the GM2A gene that encodes GM2 ganglioside activator protein (GM2AP. GM2AP is necessary for solubilisation of GM2 ganglioside in endolysosomes and its presentation to β-hexosaminidase A. Conversely GM2AP deficiency impairs lysosomal catabolism of GM2 ganglioside, leading to its storage in cells and tissues. We describe a 9-year-old child with an unusual juvenile clinical onset of GM2-gangliosidosis AB. At the age of 3 years he presented with global developmental delay, progressive epilepsy, intellectual disability, axial hypertonia, spasticity, seizures and ataxia, but without the macular cherry-red spots typical for GM2 gangliosidosis. Brain MRI detected a rapid onset of diffuse atrophy, whereas whole exome sequencing showed that the patient is a compound heterozygote for two mutations in GM2A: a novel nonsense mutation, c.259G>T (p.E87X and a missense mutation c.164C>T (p.P55L that was recently identified in homozygosity in patients of a Saudi family with a progressive chorea-dementia syndrome. Western blot analysis showed an absence of GM2AP in cultured fibroblasts from the patient, suggesting that both mutations interfere with the synthesis and/or folding of the protein. Finally, impaired catabolism of GM2 ganglioside in the patient's fibroblasts was demonstrated by metabolic labeling with fluorescently labeled GM1 ganglioside and by immunohistochemistry with anti-GM2 and anti-GM3 antibodies. Our observation expands the molecular and clinical spectrum of molecular defects linked to GM2-gangliosidosis and suggests novel diagnostic approach by whole exome sequencing and perhaps ganglioside analysis in cultured patient's cells.

  18. Contribution to the study of samarium-151 excited levels; Contribution a l'etude des niveaux excites du samarium-151

    Energy Technology Data Exchange (ETDEWEB)

    Locard, P. [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Grenoble, 38 (France)


    The nucleus of {sup 151}Sm, which has 89 neutrons, happens to be on the lower edge of the deformed nuclei of region II. Therefore, the study of its levels is very interesting for the verification of the goodness of the collective models for deformed nuclei when the deformation is small (we introduce these models in the first chapter). {sup 151}Sm has often been studied, but the direct gamma spectrum measured with a lithium drift-germanium detector (chapter 3) shows many high energy transitions which did not appear in the previous level schemes. In order to settle these transitions, we have undertaken gamma-gamma coincidence spectra (as well as sum-coincidence spectra) experiments with a scintillation spectrometer designed in our laboratory (chapter 2). The investigation of the intensities of these coincidences leads us to modify the last proposed level schemes: we suppress the levels at 405,5 and 650 keV, we add levels at 245,6 - 306,6 - 522 - 952 and 962 keV. We have also verified the multipolarities of the main transitions and measured the half-lives of a few levels (chapter 3) (we find a half-life of 1.1 {+-} 0.5 nanosecond for the level at 167,7 keV). In chapter 4, we compare our results to the predictions of the models described in chapter 1. (author) [French] Le noyau de {sup 151}Sm, qui possede 89 neutrons, se trouve a la limite inferieure des noyaux deformes de la region II. L'etude de ses niveaux excites est donc d'un interet tout particulier pour la verification de la validite des differents modeles collectifs pour les noyaux deformes, lorsque la deformation est petite (nous introduisons ces modeles dans un premier chapitre). Le {sup 151}Sm a deja fait l'objet de nombreuses etudes, mais le spectre gamma direct fait avec une jonction de germanium compense au lithium (chapitre 3), nous a montre l'existence d'un grand nombre de transitions de hautes energies qui ne sont pas placees dans les schemas proposes jusqu'a ce jour. Pour preciser la place de ces transitions, nous avons donc entrepris des experiences de coincidences gamma-gamma (et de ''spectre de somme'') a l'aide d'un ensemble de spectrometrie a scintillation realise au laboratoire (chapitre 2). L'etude des intensites de ces coincidences (chapitre 3) nous amene a modifier le dernier schema propose: nous supprimons les niveaux a 405,5 et 650 keV, nous ajoutons des niveaux a 245,6 - 306,6 - 522 - 952 et 962 keV. Nous avons egalement verifie la multipolarite des principales transitions et mesure la duree de vie de certains des niveaux (chapitre 3) (nous trouvons une periode de 1,1 {+-} 0,5) nanoseconde pour le niveau a 167,7 keV). Le chapitre 4 est enfin consacre a la comparaison de nos resultats avec les predictions des differents modeles decrits au chapitre 1. (auteur)

  19. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)


    Key Laboratory for Special Functional Aggregate Materials of Education Ministry,. School of Chemistry and Chemical ... been flourishing since its excellent electric properties were discovered in the 1980s.1 At present SDC is ... absolute ethanol three times and dried in an electric oven at 60°C overnight, and then calcined at ...

  20. Trichloridotris{N-[phenyl(pyridin-2-ylmethylidene]hydroxylamine-κ2N,N′}samarium(III

    Directory of Open Access Journals (Sweden)

    Yahong Li


    Full Text Available The SmIII ion in the title compound, [SmCl3(C12H10N2O3], shows a coordination number of nine with a slightly distorted tricapped trigonal prismatic geometry based on a Cl3N6 donor set. The molecular structure is stabilized by three intramolecular O—H...Cl hydrogen bonds.

  1. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)


    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  2. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    CSIR Research Space (South Africa)

    Mandiwana, V


    Full Text Available .63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems...

  3. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    National Research Council Canada - National Science Library

    Gangu, Kranthi Kumar; Maddila, Suresh; Maddila, Surya Narayana; Jonnalagadda, Sreekantha B


    ...) and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp) were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine...

  4. Samarium(III) picrate tetraethylene glycol complex: Photoluminescence study and active material in monolayer electroluminescent

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I. [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Za' aba, Noor K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)


    A mononuclear Sm(III) complex involving Pic and EO4 (where Pic=picrate anion and EO4=tetraethylene glycol) has been studied. It shows a bright-orange emission when used as active material in a monolayer electroluminescent device of ITO/EO4-Sm-Pic/Al. The crystal structure of the complex consists of [Sm(Pic){sub 2}(H{sub 2}O)(EO4)]{sup +} cation and [Pic]{sup -} anion. The Sm(III) ion is coordinated with nine oxygen atoms from one EO4 ligand in a pentadentate mode, two Pic anions each in bidentate and monodentate modes, and one water molecule. Both the terminal alcohol groups of the acyclic EO4 ligand were involved in the O-H...O hydrogen bonding by infinite one-dimensional (1D) chain within a symmetry direction [0 1 0]. The photoluminescence (PL) spectrum of the thin film shows the typical spectral features of the Sm(III) ion ({sup 4}G{sub 5/2}{yields}{sup 6}H{sub 7/2} transitions). The root-mean-square (rms) of the roughness of thin film is 30.605 nm and indicates that the formation of the monolayer electroluminescent device is not uniform and retains a high crystallinity. Typical semiconductor current-voltage (I-V) property was also observed in this device with threshold and turn voltages of 2.8 and 6.2 V, respectively. The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex can be applied as a luminescent center in OLED for bright-orange emission. - Highlights: > The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in monolayer device structure of ITO/EO4-Sm-Pic/Al. > The photoluminescence spectrum of the crystalline and thin film shows a bright-orange emission. > The current-voltage property showed the turn on voltage of 6.2 V.

  5. Pulsed laser deposition and optical characterizations of the magnetic samarium orthoferrite

    Energy Technology Data Exchange (ETDEWEB)

    Berini, Bruno, E-mail: [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France); Mistrik, Jan [Institute of Applied Physics and Mathematics, Faculty of Chemical Technology, University of Pardubice, Studentska 84, 532 10 Pardubice (Czech Republic); Dumont, Yves; Popova, Elena; Fouchet, Arnaud; Scola, Joseph; Keller, Niels [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France)


    Pulsed Laser Deposition of magnetically ordered polycrystalline SmFeO{sub 3} films has been optimized onto SiO{sub 2} glass substrates as function of substrate temperature, oxygen pressure and pulsed laser fluency. Using a KrF excimer laser, crystallization temperature is found to be about 1048 K for a weak fluency of only 1.7 J cm{sup -2}. We show that this growth temperature can be reduced using higher fluency and that it is possible to obtain a film texturation along the c axis by reducing the oxygen pressure at given temperature and fluency. In a second part, we focus on the SmFeO{sub 3} optical constants determined by in situ ellipsometry using a stacking model and the Cauchy dispersion relation for SmFeO{sub 3} layer. We show a good correlation between the transmission and reflection calculated from these data and measured by ex situ spectrophotometry in the visible range.

  6. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu


    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  7. Body composition analysis by DEXA by using dynamically changing samarium filtration

    DEFF Research Database (Denmark)

    Gotfredsen, Arne; Baeksgaard, L; Hilsted, J


    , which depends on the current-absorber thickness. With this system we found a good agreement (r = 0.99) between reference and measured amounts of tissue or fat percentages in a plastic phantom and in smaller (approximately 0.5-4 kg) and larger (approximately 5-20 kg) piles of tissue (ox muscle and lard......). Scans of six healthy volunteers covered with combinations of beef and lard (approximately 5-15 kg) showed a good agreement (r = 0.99) between reference and DEXA values of added soft tissue mass and fat percentage. We conclude that the DEXA method (and, in particular, the Norland XR-36 using dynamic...

  8. Synthesis, thermal and photoluminescent properties of ZnSe- based oxyfluoride glasses doped with samarium (United States)

    Kostova, I.; Okada, G.; Pashova, T.; Tonchev, D.; Kasap, S.


    Rare earth (RE) doped glasses and glass ceramic materials have recently received considerable attention because of their potential or realized applications as X-ray intensifying screens, phosphors, detectors, waveguides, lasers etc. [1]. In this work, we present a new RE doped ZnO-ZnSe-SrF2-P2O5-B2O3-Sm2O3-SmF3 (ZSPB) glass system synthesized by melt quenching technique. The resulting glasses were visually fully transparent and stable with glass the transition temperatures around 530°C. The thermal properties of this glass system were characterized by Modulated Differential Scanning Calorimetry (MDSC) measurements before and after annealing at 650°C. We have characterized these glasses by Raman spectroscopy and photoluminescence (PL) measurements over the UV-VIS range using light emitting diodes (LED) and laser diodes (LD) excitation sources. We have also irradiated thermally treated and non-treated glass samples by X-rays and have studied the resulting PL. We discuss the results in terms of previously reported models for Sm-doped Zn-borophosphate oxide, oxyfluoride and oxyselenide glasses.

  9. Laser-Induced Luminescence Study of Samarium(III) Thiodiglycolate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Dong Yong; Lee, Eil Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kimura, Takaumi [Japan Atomic Energy Research Institute, Ibaraki-ken (Japan)


    The hydration number of Sm(III) has been obtained by using the difference in the decay rate constants in H{sub 2}O and D{sub 2}O solutions. In general, k{sub obs}(H{sub 2}O) >> k{sub obs}(D{sub 2}O), k{sub obs}(D{sub 2}O) ≅ constant, and ligands are not as effective in causing non-radiative de-excitation of the excited state. For Sm(III), a relationship has been proposed in which the hydration number is related directly to the decay rate constant in H{sub 2}O. If there is no contribution from the ligand to the de-excitation of the luminescence excited state, the hydration of Sm(III) in the different complexes can be obtained directly from the values of k{sub obs} measured in H{sub 2}O. The number and the geometric distribution of solvent molecules around a metal ion in solution are an important factor in the structural and chemical behavior of cation. Indeed, such information has been utilized to design novel ionophores and receptors. However, there have been few studies of hydration structure for lanthanides. The fact that many f-element salts which have relatively large lattice energies are fairly soluble in water is a reflection of the strength of the interactions between the metal cations and water molecules.

  10. Oxygen Fugacity of the Martian Mantle from Pigeonite/Melt Partitioning of Samarium, Europium and Gadolinium (United States)

    Musselwhite, S.; Jones, J. H.; Shearer, C.


    This study is part of an ongoing effort to calibrate the pyroxene/melt Eu oxybarometer for conditions relevant to the martian meteorites. There is fairly good agreement between a determinations using equilibria between Fe-Ti oxides and the estimates from Eu anomalies in shergottite augites in tenns of which meteorites are more or less oxidized. The Eu calibration was for angrite composition pyroxenes which are rather extreme. However, application of a calibration for martian composition augites 113 does not significantly reduce the discrepancy between the two methods. One possible reason for this discrepancy is that augites are non-liquidus. The use of pigeonite rather than augite as the oxy-barometer phase is considered. We have conducted experiments on martian composition pigeonite/melt REE partitioning as a function of fO2.

  11. Doping controlled spin reorientation in dysprosium-samarium orthoferrite single crystals (United States)

    Cao, Shixun; Zhao, Weiyao; Kang, Baojuan; Zhang, Jincang; Ren, Wei


    As one of the most important phase transitions, spin reorientation (SR) in rare earth transition metal oxides draws much attention of emerging materials technologies. The origin of SR is the competition between different spin configurations which possess different free energy. We report the control of spin reorientation (SR) transition in perovskite rare earth orthoferrite Dy1-xSmxFeO3, a whole family of single crystals grown by optical floating zone method from x =0 to 1. Temperature dependence of the magnetizations under zero-field-cooling (ZFC) and field-cooling (FC) processes are studied. We have found a remarkable linear change of SR transition temperature in Sm-rich samples for x>0.2, which covers an extremely wide temperature range including room temperature. The a-axis magnetization curves under FCC process bifurcate from and then jump down to that of warming process (ZFC and FCW curves) in single crystals when x =0.5-0.9, suggesting complicated 4f-3d electron interactions among Dy3+-Sm3+, Dy3+-Fe3+, and Sm3+-Fe3+ sublattices of diverse magnetic configurations for materials physics and design. The magnetic properties and the doping effect on SR transition temperature in these single crystals might be useful in the spintronics device application. This work is supported by the National Key Basic Research Program of China (Grant No. 2015CB921600), and the National Natural Science Foundation of China (NSFC, Nos. 51372149, 50932003, 11274222).

  12. Synthesis, crystal structure and luminescent properties of a new samarium-fluorescein metal-organic framework (United States)

    Thomas, Jesty; Ambili, K. S.


    A new metal-organic framework with empirical formula C43H30NO12Sm was solvothermally synthesized using SmCl3, fluorescein and N, N-Dimethyl formamide (DMF) and characterized by single crystal X-ray diffraction, powder X-ray diffraction, infrared spectroscopy, UV-Visible spectroscopy, scanning electron microscopy, optical microscopy, photoluminescence spectroscopy, CHN elemental analysis and thermogravimetric analysis. Single crystal X-ray diffraction revealed that the crystal structure belongs to the triclinic system, P-1 space group with a = 12.113 (6) Å, b = 12.1734 (7) Å, c = 13.2760(8) Å, α = 67.930(3)⁰, β = 87.779(3)⁰, γ = 77.603(3)⁰ and V = 1769.71 (17) Å3. The photoluminescence spectrum showed emission peaks at 550 nm, 600 nm and 647 nm due to the characteristic transitions 4G5/2 to 6H5/2, 4G5/2 to 6H7/2 and 4G5/2 to 6H9/2 respectively, when excited at 398 nm.

  13. High-temperature heat capacity of samarium and erbium titanates with pyrochlore structure (United States)

    Denisova, L. T.; Chumilina, L. G.; Denisov, V. M.; Ryabov, V. V.


    Titanates Sm2Ti2O7 and Er2Ti2O7 with pyrochlore structure have been prepared by solid-phase synthesis in air from stoichiometric Sm2O3 (Er2O3)-TiO2 mixtures sequentially at 1673 and 1773 K. Hightemperature heat capacity of the oxide compounds has been determined by differential scanning calorimetry. Their thermodynamic properties have been calculated from experimental temperature dependence C p = f( T).

  14. 164 Meaning and Thematic Roles in the Igbo Language Chukwuma ...

    African Journals Online (AJOL)

    Ike Odimegwu

    Chika, chair, goat, dog, pen, etc. The theory excludes sentences. It also excludes adjectives because they have no ..... Ejima borrow-PAST money that he take save life nna ya father him. 'Ejima borrowed money in order to save his father's life'. In example (26) above, the reason why 'Ibe' married is that he loves 'Amaka.

  15. 45 CFR 164.504 - Uses and disclosures: Organizational requirements. (United States)


    ... other law (including regulations adopted by the covered entity or its business associate) contains... section. (ii) If a business associate is required by law to perform a function or activity on behalf of a...) The disclosure is required by law; or (B)(1) The business associate obtains reasonable assurances from...

  16. Dicty_cDB: CFJ164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AGGCTTA sequence update 2001.11.22 Translated Amino Acid sequence yfiflsfinthlynnyiln*tih*il*KKKKXXSXXFLKXKN...ftxxfnc*cwyfincrcskyfysnfkvsitxxsf nfi*xfkfttaiynckysfskstttttiik*inkflaitksxrxqxirl Frame B: yfiflsfinthlynn

  17. 2012 December_ Edition_Vol 16_4_article_17

    African Journals Online (AJOL)

    AJRH Managing Editor

    Nous avons donc mis au point une technique d'insémination intra-utérine assez simple qui peut être effectuée dans les pays en développement, sans avoir recours aux équipements sophistiqués, aux matériaux coûteux, aux médias, ou aux cathéters d'insémination jetables. Il est assez bon marché et peut être réalisé par le ...

  18. 164 original article profile of institutional infrastructure for ...

    African Journals Online (AJOL)

    Dr Oboro VO

    Methods: The objectives of this study were to assess the universal precaution profile of primary health care facilities and determine those factors that inform their prevailing safety status. Using a structured checklist, 23 representative primary health care facilities from the 23 local government areas in Sokoto State were ...

  19. Dicty_cDB: CFD164 [Dicty_cDB

    Lifescience Database Archive (English)


  20. Publications | Page 164 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    De septembre à novembre 1997, les incendies qui ont fait rage en Indonésie ont rejeté suffisamment de fumée dans l'atmosphère pour recouvrir toutes les régions d'un brouillard qui a atteint le sud de la Thaïlande et les Philippines au nord, la Malaisie et Singapour étant particulièrement touchés... En quoi est-ce que cela ...

  1. 33 CFR 164.39 - Steering gear: Foreign tankers. (United States)


    ... foreign vessel mean the same as in 46 U.S.C. 2101. SOLAS 74 means the International Convention for the... the same as in Chapter II-1, Regulations 1.1.2 and, of SOLAS 74. Existing tanker means a... September 1, 1984, must meet the applicable requirements of Chapter II-1, Regulations 29 and 30, of SOLAS 74...

  2. 33 CFR 164.11 - Navigation under way: General. (United States)


    ... passenger vessel meeting the requirements of the International Convention for the Safety of Life at Sea, 1960 (SOLAS 60) and on each cargo vessel meeting the requirements of SOLAS 74 as amended in 1981, the...

  3. 164 Causes and Architectural Solution to Heat and Non- conducive ...

    African Journals Online (AJOL)

    Nekky Umera

    design is one fraction of green building design and does not consist of active systems such as mechanical ... infiltration from poor weatherization can contribute up to 60% of heat gain during summer and 40% of heat ..... This will completely eliminate thermal transmission of any sort from the heat conducting roofing sheets.

  4. 26 CFR 1.164-3 - Definitions and special rules. (United States)


    ..., tobacco, admissions, luxury items, and a few other items is not general. Similarly, a tax imposed solely.... For purposes of this section, the term “food” means food for human consumption off the premises where... “compensating use tax” means, in respect of any item, a tax which is imposed on the use, storage, or consumption...

  5. 29 CFR 1952.164 - Final approval determination. (United States)


    ... and contractor-operated facilities engaged in USPS mail operations; bridge construction projects... engaged in egg, poultry, or red meat production, or the post-harvest processing of agricultural or...

  6. 27 CFR 25.164 - Quarterly and semimonthly returns. (United States)


    ... file a return on Form 5000.24 for each return period even though no beer was removed for consumption or... required to be determined (and which has not been prepaid) on all beer removed for consumption or sale... BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Preparation and Remittance of Tax Returns...

  7. Dicty_cDB: CHS164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available utrients Pinus taeda cDNA clone RTMNUT1_37_B06_A029 5', mRNA sequence. 54 2e-11 4 C...icon esculentum cDNA clone cLEG49G24 5' end, mRNA sequence. 58 7e-12 2 DR181209 |DR181209.1 RTMNUT1_37_B06.g2_A029 Roots minus micron

  8. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Equity Gauge Zambia : Enhancing Governance, Equity and Health. Like most African countries, Zambia has undertaken a series of reforms to improve the quality and equity of its health services through greater involvement of community organizations, health workers and other actors in the health system. Zambia, North Of ...

  9. Dicty_cDB: SSL164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available LV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA clone NXLV105_F05 5', mRNA sequence. 62 9e-06 1 BU777208 ...24 |AL865124.1 Xenopus tropicalis EST, clone TEgg076m08 5'. 52 2e-08 2 BQ196812 |BQ196812.1 NXLV105_F05_F NX

  10. Dicty_cDB: VFO164 [Dicty_cDB

    Lifescience Database Archive (English)


  11. Dicty_cDB: CHP164 [Dicty_cDB

    Lifescience Database Archive (English)


  12. Dicty_cDB: SHH164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sequence. 62 3e-05 1 CK808839 |CK808839.1 Rasgsc1686 Salivary Gland 4th instar 3rd period (spinning cocoon)...sequence. 34 4e-05 3 CK808739 |CK808739.1 Rasgsc1529 Salivary Gland 4th instar 3rd period (spinning cocoon)...sequence. 58 5e-04 1 CK808037 |CK808037.1 Rasgsc0316 Salivary Gland 4th instar 3rd period (spinning cocoon)

  13. 164 original article profile of institutional infrastructure for ...

    African Journals Online (AJOL)

    Dr Oboro VO

    planning, general medical and emergency, laboratory, school health, housekeeping, community-based, waste and instrument management are associated with infection transmission requiring adequate provision of enabling environment for effective control of infectious agents capable of been transmitted through them.

  14. 33 CFR 164.46 - Automatic Identification System (AIS). (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Automatic Identification System... Identification System (AIS). (a) The following vessels must have a properly installed, operational, type approved...) Passenger vessels, of 150 gross tonnage or more, not later than July 1, 2003; (ii) Tankers, regardless of...

  15. Dicty_cDB: SLD164 [Dicty_cDB

    Lifescience Database Archive (English)


  16. 33 CFR 164.35 - Equipment: All vessels. (United States)


    ... must have the following: (a) A marine radar system for surface navigation. (b) An illuminated magnetic... a fixed propeller, a table of shaft revolutions per minute for a representative range of speeds. (4) For each vessel with a controllable pitch propeller, a table of control settings for a representative...

  17. 46 CFR 164.006-4 - Inspection and testing. (United States)


    ... rejection. (d) Organic carbon content test. (1) The organic carbon content shall be determined and shall not... the certificate of approval, but the Coast Guard also reserves the right to make spot-check tests of...

  18. Dicty_cDB: VHB164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |DY889811.1 CeleSEQ6761 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY889772.1 CeleSEQ11980 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY890935.1 CeleSEQ7425 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY887441.1 CeleSEQ3766 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone...|DY888936.1 CeleSEQ6366 Cunninghamella elegans pBluescript (EcoRI-XhoI) Cunninghamella elegans cDNA clone

  19. Dicty_cDB: AFI164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sing malaria and immune antigen for suppressing growth of plasmodium. 62 1e-29 6 BD183625 |BD183625.1 for diagnosing malaria and immune antigen for suppressing growth of plasmodium

  20. 46 CFR 164.015-4 - Inspections and tests. (United States)


    ... foam. A marine inspector shall be admitted to any place in the factory where production or partial... dimension forms a 45° angle with the horizontal and with the widths in a vertical position. A bunsen burner...

  1. 46 CFR 164.007-4 - Testing procedure. (United States)


    ...) Preparation of fire test specimens. (1) The fire test specimens shall be conditioned to approximately constant... appreciable volumes of smoke or noxious vapors from the unexposed side of the test specimen. The specimen..., including the retests, shall be conducted at the National Bureau of Standards or other laboratories...

  2. 164th Symposium of the International Astronomical Union

    CERN Document Server

    Gilmore, G


    The concept of Stellar Populations has played a fundamental role in astronomy in the last few decades. It was introduced by Walter Baade after he was able to resolve the Andromeda Nebula and its companions into stars when he used red-sensitive plates and realised that there were two fundamentally different Herzsprung-Russell diagrams in our and these nearby galaxies (common stars in the solar neighborhood versus globular clusters). This result was published in two papers in 1944 in volume 100 of the Astrophysical Journal. Subsequent research gave the concept a much firmer basis and at the famous Vatican Symposium of 1957 resulted in a general scheme of the concept and a working hypothesis for idea's on the formation and evolution of the Galaxy. This has been a guiding principle of studies of our and other galaxies for decades. Some years ago it seemed to us appropriate to commemorate Baade's seminal work in 1994, when it would have its 50-th anniversary, and to review its present status and also its role in c...

  3. 2012 December_ Edition_Vol 16_4._article_2

    African Journals Online (AJOL)

    AJRH Managing Editor

    insemination with husband sperm, embryo donation from couples who have been verified to be HIV negative, insemination with donor sperm, timed unprotected intercourse (TUI) and sperm washing combined with intrauterine insemination (IUI) and assisted reproductive ..... c) Cryopreservation in separate cryostorage tanks.

  4. 46 CFR 164.009-9 - Procedure for approval. (United States)


    ... approval. (a) An application for approval of a material under this subpart must be sent to the Commandant (CG-521), U.S. Coast Guard, Washington, DC 20593-0001. (b) The application is examined by the Coast Guard to determine the probability that the material meets the requirements for approval. The Coast...

  5. 2012 December_ Edition_Vol 16_4_article_16

    African Journals Online (AJOL)

    AJRH Managing Editor

    of marriage. Economic and social deprivation appears to expose Ethiopian adolescents to early and unsafe sexual relations resulting in teen motherhood. As indicated above, adolescents' decision to have children is partly dependent upon their family status, the environment in which they were raised, the economic and ...


    African Journals Online (AJOL)

    run off and infiltration activities, use of galvanized materials in handpump construction and agricultural landuse activities. Although iron concentrations at objectionable level were noted in some of the boreholes villagers were found using them ...

  7. 45 CFR 164.306 - Security standards: General rules. (United States)


    ... all electronic protected health information. (d) Implementation specifications. In this subpart: (1) Implementation specifications are required or addressable. If an implementation specification is required, the word “Required” appears in parentheses after the title of the implementation specification. If an...

  8. Dicty_cDB: AFK164 [Dicty_cDB

    Lifescience Database Archive (English)


  9. Dicty_cDB: CHR164 [Dicty_cDB

    Lifescience Database Archive (English)


  10. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    providing developing-country researchers with financial resources, advice, and training to find solutions to local problems;; sharing our knowledge with policymakers, researchers, and ... Managing Agricultural Biodiversity for Nutrition, Health, Livelihoods and Sustainable Production Systems (Sub-Saharan Africa).

  11. All projects related to | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    Total Funding: CA$ 497,200.00. Phenomenology of criminal violence and challenges for local urban governance in Côte d'Ivoire. Project. This research focuses on the changes in criminal urban violence that have accompanied the sociopolitical developments in Côte d'Ivoire since the 1990s. Start Date: December 21, 2012.

  12. 33 CFR 164.38 - Automatic radar plotting aids (ARPA). (United States)


    ... present in a period of not more than one minute an indication of the target's motion trend and display... state tracking the relative motion trend of a target with the following accuracy values (95 percent... present in a period of not more than one minute an indication of the target's motion trend, and display...

  13. Dicty_cDB: SFH164 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available fniix*fkkkkn*kknnkq Frame C: ---xsxnltxfhflq*qgixr*lcxssr**fnrsr*x*x*ncpxkltssxtx...rhxfgfrc xhsfsr*xxtklyngtxsfhxccqsxnwxkxlslrslsxrwxkxcpxcw*sls*sikskq lvxxccw*rxarrssrftpnxwxxinlillxnlkkkki

  14. What we do | Page 164 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Public Accountability Institutions in Pakistan and their Macroeconomic Impacts. Corruption is the single most important impediment to governance and the functioning of the economy in Pakistan. Central Asia, Far East Asia, South Asia, Pakistan. PROJECT ...

  15. Structures of Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) and a C164Q mutant provide templates for antibacterial drug discovery and identify a buried potassium ion and a ligand-binding site that is an artefact of the crystal form

    Energy Technology Data Exchange (ETDEWEB)

    Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)


    Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.

  16. Fluorescence enhancement of samarium (III) perchlorate by 1,10-phenanthroline on Phenylnaphthoylmethyl sulfoxide complex and luminescence mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail:; Feng, Shu-Yan; Liu, Yu; Zhang, Jing; Xin, Xiao-Dong; Ao, Bo-Yang; Li, Ying-Jie


    A novel ligand, Phenylnaphthoylmethyl sulfoxide, was synthesized by a new method. Its novel binary complex, SmL{sub 5}·(ClO{sub 4}){sub 3}·2H{sub 2}O, and the ternary complex, SmL{sub 4}·L′(ClO{sub 4}){sub 3}·2H{sub 2}O, had been synthesized (using Phenylnaphthoylmethyl sulfoxide as the first ligand L, 1,10-phenanthroline as the second ligand L′). The complexes were characterized by element analysis, coordination titration, molar conductivity, IR, TG-DSC, {sup 1}HNMR and UV spectra. Their fluorescence emission mechanism, fluorescence intensities and phosphorescence spectra of the two ligands were also investigated by comparison. Fluorescent spectra illustrated that the ternary rare-earth complex presented stronger fluorescence intensity than the binary rare-earth complex in such material. The strongest characteristic fluorescence emission intensity of the ternary system was 1.81 times as strong as that of the binary system. By the analysis of fluorescence and phosphorescence spectra, it was found that the Phenylnaphthoylmethyl sulfoxide and phen had the advantage to absorb and transfer energy to Sm (III) ions effectively, and then the complexes emitted the characteristic fluorescence of Sm (III) ions. The phosphorescence spectra and fluorescence lifetime of the complexes were also measured. -- Highlights: • A novel ligand, Phenylnaphthoylmethyl sulfoxide, has been synthesized. • Its novel ternary complex and the binary complex have been synthesized. • The fluorescence emission intensity of ternary rare earth complex exhibit obvious enhancement. • The fluorescence emission mechanism and phosphorescence spectra are also investigated.

  17. Polypropylene oil as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    The research focusses on converting polypropylene oil as pyrolysis product of polypropylene plastic into an electricity. The converter was a direct liquid fuel-solid oxide fuel cell (SOFC) with cerium oxide based material as electrolyte. The polypropylene vapor flowed into fuel cell, in the anode side and undergo oxidation reaction, meanwhile, the Oxygen in atmosphere reduced into oxygen ion at cathode. The fuel cell test was conducted at 400 - 600 °C. According to GC-MS analysis, the polypropylene oil consist of C8 to C27 hydrocarbon chain. The XRD analysis result shows that Na2CO3 did not change the crystal structure of SDC even increases the electrical conductivity. The maximum power density is 0.079 at 773 K. The open circuite voltage is 0.77 volt. Chemical stability test by analysing the single cell at before and after fuel cell test found that ionic migration occured during fuel cell operation. It is supported by the change of elemental composition in the point position of electrolyte and at the electrolyte-electrode interface

  18. A distribution pattern of cadmium, gadolinium and samarium in Phaseolus vulgaris (L) plants as assessed by dynamic neutron radiography (United States)

    Kőrösi, Ferenc; Balaskó, Márton; Sváb, Erzsébet


    The qualitative and semi-quantitative distributions, presumably apoplast transport patterns for the Gd, Sm and Cd were investigated in the primordial leaf tissues of the bean using dynamic neutron radiography. According to the applied 3D, 2D images and the pixel count distribution histograms of the considered gray levels, peculiar distribution patterns were postulated for the elements. Main and lateral vascular systems for Gd, the cell walls as well as intercellular spaces for Sm and the main leaf vein for Cd assumed to be the apoplast transport spaces and volumes.

  19. Ab initio calculation of the migration free energy of oxygen diffusion in pure and samarium-doped ceria (United States)

    Koettgen, Julius; Schmidt, Peter C.; Bučko, Tomáš; Martin, Manfred


    We have studied the free energy migration barriers Δ F‡ for oxygen diffusion in pure ceria and Sm-doped ceria for the temperatures 300, 700, and 1000 K. We used the density functional theory in the generalized gradient approximation and an additional Hubbard U parameter for the Ce 4 f electronic states. We compare the results for the free energy deduced from three different methods. First, a static harmonic approach is applied in which the temperature dependent vibrational contributions to energy and entropy are deduced from the phonon frequencies of supercells with a fixed volume. Second, a static quasiharmonic approach is used in which a part of the anharmonicity effect is introduced via an implicit dependence of the harmonic frequencies on the thermally expanding cell volume. Third, the free energy barriers are calculated using metadynamics and molecular dynamics in which anharmonicity effects are naturally taken into account. The three methods examined in this study lead to distinctly different results. According to the harmonic approximation, the migration free energy difference Δ F‡ increases with increasing temperature due to an increasing entropic contribution. According to the quasiharmonic approximation, the migration free energy is independent of temperature. Finally, molecular dynamics predicts a thermally induced increase in the migration free energy. We conclude that temperature dependent experimental lattice constants cancel out the increasing entropic contribution with increasing temperature in the static quasiharmonic approach. The full consideration of anharmonicity effects in the metadynamics method again leads to a temperature dependent migration free energy.

  20. Studies on the preparation and stability of samarium-153 propylene diamine tetramethylene phosphonate (PDTMP) complex as a bone seeker

    Energy Technology Data Exchange (ETDEWEB)

    Majali, M.A. E-mail:; Mathakar, A.R.; Shimpi, H.H.; Banerjee, Sharmila; Samuel, Grace


    Propylene diamine tetra methylene phosphonate (PDTMP) was synthesised by modifying a method reported for the synthesis of EDTMP. Complexation of the synthesised phosphonate ligand with {sup 153}Sm was carried out by varying the experimental parameters and the complex was radiochemically characterized. Biodistribution studies showed that the uptake by bone in rats was 2% per g of bone, which was retained up to 48 h. The uptake by other organs was insignificant, except by the liver which showed a slightly higher absorption.

  1. Crystal structure of a samarium(III nitrate chain cross-linked by a bis-carbamoylmethylphosphine oxide ligand

    Directory of Open Access Journals (Sweden)

    Julie A. Stoscup


    Full Text Available In the title compound poly[aquabis(μ-nitrato-κ4O,O′:O,O′′tetrakis(nitrato-κ2O,O′{μ4-tetraethyl [(ethane-1,2-diylbis(azanediylbis(2-oxoethane-2,1-diyl]diphosphonate-κ2O,O′}disamarium(III], [Sm2(NO36(C14H30N2O8P2(H2O]n, a 12-coordinate SmIII and a nine-coordinate SmIII cation are alternately linked via shared bis-bidentate nitrate anions into a corrugated chain extending parallel to the a axis. The nine-coordinate SmIII atom of this chain is also chelated by a bidentate, yet flexible, carbamoylmethylphoshine oxide (CMPO ligand and bears one water molecule. This water molecule is hydrogen bonded to nitrate groups bonded to the 12-coordinate SmIII cation. The CMPO ligand, which lies about an inversion center, links neighboring chains along the c axis, forming sheets parallel to the ac plane. Hydrogen bonds between the amide NH group and metal-bound nitrate anions are also present in these sheets. The sheets are packed along the b axis through only van der Waals interactions.

  2. Structure, reactivity, electronic configuration and magnetism of samarium atomic layers deposited on Si(0 0 1) by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Gheorghe, Nicoleta G.; Lungu, George A.; Husanu, Marius A.; Costescu, Ruxandra M.; Macovei, Dan [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania); Teodorescu, Cristian M., E-mail: [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania)


    The surface structure, interface reactivity, electron configuration and magnetic properties of Sm layers deposited on Si(0 0 1) at various temperatures are investigated by low-energy electron diffraction (LEED), X-ray photoelectron spectroscopy (XPS), X-ray absorption spectroscopy (XAS) and magneto-optical Kerr effect (MOKE). It is found that metal Sm is present on samples prepared at low temperature, with an interface layer containing SmSi{sub 2} and Sm{sub 4}Si{sub 3}. When samples are prepared at high temperature, much less metal Sm is found, with an increasing amount of SmSi{sub 2}. Room temperature ferromagnetism is observed for all prepared layers, with a decrease of the saturation magnetization when samples are prepared at high temperature. It is found that ferromagnetism implies mostly a compound with approximate stoichiometry Sm{sub 4}Si{sub 3}. Also, the decrease in the intensity of the XAS 2p{sub 3/2} → 3d white lines with the corresponding increasing amount of SmSi{sub 2} may be explained by assuming a higher occupancy of Sm 5d orbitals (5d{sup 2} configuration), most probably due to hybridation effects.

  3. Calculation and comparison of xenon and samarium reactivities of the HEU, LEU core in the low power research reactor. (United States)

    Dawahra, S; Khattab, K; Saba, G


    Comparative studies for the conversion of the fuel from HEU to LEU in the Miniature Neutron Source Reactor (MNSR) have been performed using the MCNP4C and GETERA codes. The precise calculations of (135)Xe and (149)Sm concentrations and reactivities were carried out and compared during the MNSR operation time and after shutdown for the existing HEU fuel (UAl4-Al, 90% enriched) and the potential LEU fuels (U3Si2-Al, U3Si-Al, U9Mo-Al, 19.75% enriched and UO2, 12.6% enriched) in this paper using the MCNP4C and GETERA codes. It was found that the (135)Xe and (149)Sm reactivities did not reach their equilibrium reactivities during the daily operating time of the reactor. The (149)Sm reactivities could be neglected compared to (135)Xe reactivities during the reactor operating time and after shutdown. The calculations for the UAl4-Al produced the highest (135)Xe reactivity in all the studied fuel group during the reactor operation (0.39 mk) and after the reactor shutdown (0.735 mk), It followed by U3Si-Al (0.34 mk, 0.653 mk), U3Si2-Al (0.33 mk, 0.634 mk), U9Mo-Al (0.3 mk, 0.568 mk) and UO2 (0.24 mk, 0.448 mk) fuels, respectively. Finally, the results showed that the UO2 was the best candidate for fuel conversion to LEU in the MNSR since it gave the lowest (135)Xe reactivity during the reactor operation and after shutdown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Development of samarium [{sup 32}P] phosphate colloid for radiosynoviorthesis applications: Preparation, biological and preliminary clinical studies experience

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, G. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India)], E-mail:; Sachdev, Satbir S.; Umamaheswari, S.; Sivaprasad, N.; Bhatia, Manohar H. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India); Chaudhari, Pradip R. [Laboratory Nuclear Medicine Services, BARC, Mumbai 400 012 (India); Solav, Srikant V. [Spect Lab, Nuclear Medicine Services, Opposite Dinanath Mangeshkar Hospital, Pune 411004 (India)


    A new therapeutic radio colloid for radiosynoviorthesis (RS) applications is reported. The method of preparation involves the reaction of SmCl{sub 3} carrier with carrier added [{sup 32}P]H{sub 3}PO{sub 4} in the presence of gelatin. The pure colloid was recovered by dialysis purification leading to radiochemical yield of around 90%. The radiochemical purity of the pure colloid formulated in isotonic saline was over 98%, for the usage period of 14 days, as assessed by paper chromatography. Ninety percent of colloid particles were in the size of 1-10 {mu}m as evident from the laser diffraction particle size analysis, ideally suitable for the intended end use. Animal studies revealed complete retention of the radio colloid in the rabbit knee joint. The results of clinical trials in humans are satisfactory and encouraging, satisfactory retention of the colloid in the knee joint and negligible leakage into the systemic circulation.

  5. KN164L01: WHOI cruise 164 leg 01 aboard the R/V Knorr from 2001-10-05 - 2001-10-08 (NODC Accession 0067236) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  6. KN164L02: WHOI cruise 164 leg 02 aboard the R/V Knorr from 2001-10-08 - 2001-10-23 (NODC Accession 0070535) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  7. Tetrakis(μ-propanoato-κ2O:O′bis[(1,10-phenanthroline-κ2N,N′(propanoato-κ2O,O′samarium(III

    Directory of Open Access Journals (Sweden)

    Chun-Xiang Wang


    Full Text Available The title complex, [Sm2(C3H5O26(C12H8N22], is a dinuclear centrosymmetric molecule, in which two crystallographically equivalent Sm atoms, separated by 3.9502 (2 Å, are bridged by four propanoate anions. Each Sm atom is coordinated by two N atoms from one chelating phenanthroline ligand and seven carboxylate O atoms from five propanoate anions, to form a distorted tricapped trigonal prism.

  8. Processing of composites based on NiO, samarium-doped ceria and carbonates (NiO-SDCC as anode support for solid oxide fuel cells

    Directory of Open Access Journals (Sweden)

    Lily Siong Mahmud


    Full Text Available NiO-SDCC composites consisting of NiO mixed with Sm-doped ceria (SDC and carbonates (Li2CO3 and Na2CO3 were sintered at different temperatures and reduced at 550 °C. The influence of reduction on structure of the NiO-SDCC anode support for solid oxide fuel cells (SOFCs was investigated. Raman spectra of the NiO-SDCC samples sintered at 500, 600 and 700 °C showed that after reducing at 550 °C NiO was reduced to Ni. In addition, SDC and carbonates (Li2CO3 and Na2CO3 did not undergo chemical transformation after reduction and were still detected in the samples. However, no Raman modes of carbonates were identified in the NiO-SDCC pellet sintered at 1000 °C and reduced at 550 °C. It is suspected that carbonates were decomposed at high sintering temperature and eliminated due to the reaction between the CO32– and hydrogen ions during reduction in humidified gases at 550 °C. The carbonate decomposition increased porosity in the Ni-SDCC pellets and consequently caused formation of brittle and fragile structure unappropriated for SOFC application. Because of that composite NiO-SDC samples without carbonates were also analysed to determine the factors affecting the crack formation. In addition, it was shown that the different reduction temperatures also influenced the microstructure and porosity of the pellets. Thus, it was observed that Ni-SDC pellet reduced at 800 °C has higher electrical conductivity of well-connected microstructures and sufficient porosity than the pellet reduced at 550 °C.

  9. The single cell of low temperature solid oxide fuel cell with sodium carbonate-SDC (samarium-doped ceria) as electrolyte and biodiesel as fuel (United States)

    Rahmawati, F.; Nuryanto, A.; Nugrahaningtyas, K. D.


    In this research NSDC (composite of Na2CO3-SDC) was prepared by the sol-gel method to produce NSDC1 and also by the ceramic method to produce NSDC2. The prepared NSDC then were analyzed by XRD embedded with Le Bail refinement to study the change of characteristic peaks, their crystal structure, and their cell parameters. Meanwhile, the measurement of impedance was conducted to study the electrical conductivity of the prepared materials. A single cell was prepared by coating NSDC-L (a composite of NSDC with Li0.2Ni0.7Cu0.1O2) on both surfaces of NSDC. The NSDC-L was used as anode and cathode. The ionic conductivity of NSDC1 and NSDC2 at 400 oC are 4.1109 x 10-2 and 1.6231 x 10-2, respectively. Both electrolytes have ionic conductivity higher than 1 x 10-4, therefore, can be categorized as good electrolyte [1]. However, the NSDC1 shows electrodeelectrolyte conduction. It indicates the existence of electronic migration from electrolyte- electrode or vice versa. Those may cause a short circuit during fuel cell operation and will reduce the fuel cell performance fastly. The single cell tests were conducted at 300, 400, 500 and 600 °C. The single fuel cell with NSDC1 and NSDC2 as electrolyte show maximum power density at 400 °C with the power density of 3.736 x 10-2 and 2.245 x 10-2, respectively.

  10. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.


    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs appears to be disturbed, the initial 87Sr/86Sr value determined from the isochron is 0.698942 ± 0.000008, and closely approximates estimates of the initial Solar System value. Although this isochron may be a mixing line, it might also record alteration on the Allende parent body in which Rb was added to the Al3S4 CAI that was initially largely devoid of Rb.

  11. Anthropogenic dissolved and colloid/nanoparticle-bound samarium, lanthanum and gadolinium in the Rhine River and the impending destruction of the natural rare earth element distribution in rivers (United States)

    Kulaksız, Serkan; Bau, Michael


    The strong increase in the consumption of rare earth elements (REE) in high-tech products and processes is accompanied by increasing amounts of REE released into the environment. Following the first report of Gd contamination of the hydrosphere in 1996, anthropogenic Gd originating from contrast agents has now been reported worldwide from river and estuarine waters, coastal seawater, groundwater and tap water. Recently, microcontamination with La, that is derived from a point source where catalysts for petroleum refining are produced, has been detected in the Rhine River in Germany and the Netherlands. Here we report the occurrence of yet another REE microcontamination of river water: in addition to anthropogenic Gd and La, the Rhine River now also shows significant amounts of anthropogenic Sm. The anthropogenic Sm, which enters the Rhine River north of Worms, Germany, with the same industrial wastewater that carries the anthropogenic La, can be traced through the Middle and Lower Rhine to the Netherlands. At Leverkusen, Germany, some 250 km downstream from the point source at Worms, anthropogenic Sm still contributes up to 87% of the total dissolved Sm concentration of the Rhine River. Results from ultrafiltration suggest that while the anthropogenic Gd is not particle-reactive and hence exclusively present in the truly dissolved REE pool (Worms get close to and well-above, respectively, the levels at which ecotoxicological effects have been documented. Because of the increasing use of REE and other formerly "exotic" trace elements in high-tech applications, these critical metals have now become emerging contaminants that should be monitored, and it appears that studies of their biogeochemical behavior in natural freshwaters might soon no longer be possible.

  12. Ultra-Sensitive Nano Optical Sensor Samarium-Doxycycline Doped in Sol Gel Matrix for Assessment of Glucose Oxidase Activity in Diabetics Disease. (United States)

    Tharwat, Marwa M; Attia, M S; Alghamdi, M S; Mahros, Amr M


    A low cost and very sensitive method for the determination of the activity of glucose oxidase enzyme in different diabetics serum samples was developed. The method based on the assessment of the H2O2 concentration produced from the reaction of the glucose oxidase (GOx) enzyme with glucose as substrate in the serum of diabetics patients by nano optical sensor Sm-doxycycline doped in sol gel matrix. H2O2 enhances the luminescence intensity of all bands of the nano Sm-doxycycline complex [Sm-(DC)2](+) doped in sol-gel matrix, especially the 645 nm band at λex = 400 nm and pH 7.0 in water. The influence of the different analytical parameters that affect the luminescence intensity of the nano optical sensor, e.g. pH, H2O2 concentration and foreign ions concentrations were studied. The remarkable enhancement of the luminescence intensity of nano optical sensor [Sm-(DC)2](+) complex in water at 645 nm by the addition of various concentrations of H2O2 was successfully used as an optical sensor for the assessment of the activity of the glucose oxidase enzyme in different diabetics serum samples. The calibration plot was achieved over the activity range 0.1-240 U/L with a correlation coefficient of 0.999 and a detection limit of 0.05 U/L.

  13. Effect of Mg doping and sintering temperature on structural and morphological properties of samarium-doped ceria for IT-SOFC electrolyte (United States)

    Ahmad, Syed Ismail; Mohammed, Tasneem; Bahafi, Amal; Suresh, Madireddy Buchi


    Samples of Sm and Mg co-doped ceria electrolyte of Ce1- x Sm x- y Mg y O2- δ ( x = 0.2; y = 0.00, 0.05, 0.1, 0.15, and 0.175) were synthesized by sol-gel process. The prepared samples were sintered at 1100 and 1400 °C for 4 h. The bulk densities were measured by Archimedes method. XRD measurements indicate that the synthesized samples were in single-phase cubic fluorite structure (space group Fm3m). The cell parameters decrease with the concentration of Mg, and 2 θ values slightly shift towards right. The particle sizes obtained were between 7.14 and 17.44 nm. The sintered sample achieved 95% of theoretical density. FTIR spectra of samples sintered at 1400 °C indicates weak interactions between 3550-3400 cm-1 and 1600-1300 cm-1 are attributed to O-H stretching modes and strong bonds 850-450 cm-1 are assigned to characteristic Ce-O vibrations. The surface morphology and chemical composition were analyzed by SEM and EDS, SEM micrographs show spherical faceted grains, and the samples were crack free, dense material with some pores on surface which are inconsistent with density results. The average grain size obtained was 0.5 μm. Particle size obtained by TEM was in agreement with that obtained by XRD. The high-density ceria co-doped ceramic can be used as electrolyte in SOFC.

  14. Synthesis, spectroscopic, thermal and antimicrobial studies of neodymium(III) and samarium(III) complexes derived from tetradentate ligands containing N and S donor atoms (United States)

    Ain, Qurratul; Pandey, S. K.; Pandey, O. P.; Sengupta, S. K.


    Trivalent lanthanide complexes of the type [Ln(L)Cl(H2O)2] (where Ln = Nd(III) or Sm(III) and LH2 = Schiff bases derived by the condensation of 3-(phenyl/substitutedphenyl)-4-amino-5-mercapto-1,2,4-triazole with diacetyl/benzil) have been synthesized by the reactions of anhydrous lanthanide(III) chloride with Schiff bases in methanol. The structures of the complexes have been proposed on the basis of elemental analysis, electrical conductance, magnetic moment, spectroscopic measurements (IR, 1H, 13C NMR and UV-vis spectra) and X-ray diffraction studies. The spectral data reveal that the Schiff base ligands behave as dibasic tetradentate chelating agents having coordination sites at two thiol sulfur atoms and two azomethine nitrogen atoms. The presence of coordinated water in metal complexes was confirmed by thermal and IR data of the complexes. All the Schiff bases and their metal complexes have also been screened for their antibacterial activity against Bacillus subtilis, Staphylococcus aureus and antifungal activities against Aspergillus niger, Curvularia pallescens and Colletotrichum capsici.

  15. Logarithmic temperature dependence of samarium ion valence in the heavy-fermion S mxL a1 -xO s4S b12 (United States)

    Fushiya, Kengo; Miyazaki, Ryoichi; Higashinaka, Ryuji; Yamada, Akira; Mizumaki, Masaichiro; Tsutsui, Satoshi; Nitta, Kiyofumi; Uruga, Tomoya; Suemitsu, Bunya; Sato, Hideyuki; Aoki, Yuji


    We have measured x-ray absorption spectra at the Sm L3 edge to investigate the Sm-ion valence of (S mxL a1 -x) O s4S b12 , in which field-insensitive heavy-fermion behavior appears at low temperatures for x =1 . It has been found that the Sm-ion valance shifts to 2 + with La ion substitution; from v =+2.78 (x =1 ) to v =+2.73 (x =0.2 ) at 10 K. For all x investigated, its temperature dependence shows a logT behavior, indicating that the valence change is caused by "an unconventional Kondo effect" associated with Sm 4 f -electron charge degrees of freedom. Almost x independence of "the associated Kondo temperature" (T˜K=56 ±10 K ) indicates that the Kondo effect has a local nature, attributable to the cage structure of the filled skutterudite.

  16. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water

    Energy Technology Data Exchange (ETDEWEB)

    Merschel, Gila, E-mail:; Bau, Michael


    High-technology metals — such as the rare earth elements (REE) — have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. - Highlights: • Corbicula fluminea shells are bioarchives of dissolved geogenic REE in rivers. • Anthropogenic La and Sm in the Rhine River are bioavailable, hence incorporated. • Anthropogenic Gd from contrast agents is not incorporated, i.e. not bioavailable. • REE concentrations in Corbicula shells decrease with increasing size, i.e. age.

  17. Mechanically induced strong red emission in samarium ions doped piezoelectric semiconductor CaZnOS for dynamic pressure sensing and imaging (United States)

    Wang, Wei; Peng, Dengfeng; Zhang, Hanlu; Yang, Xiaohong; Pan, Caofeng


    Piezoelectric semiconductor with optical, electrical and mechanical multifunctions has great potential applications in future optoelectronic devices. The rich properties and applications mainly encompass the intrinsic structures and their coupling effects. Here, we report that lanthanide ions doped piezoelectric semiconductor CaZnOS:Sm3+ showing strong red emission induced by dynamic mechanical stress. Under moderate mechanical load, the doped piezoelectric semiconductor exhibits strong visible red emission to the naked eyes even under the day light. A flexible dynamic pressure sensor device is fabricated based on the prepared CaZnOS:Sm3+ powders. The mechanical-induced emission properties of the device are investigated by the optical fiber spectrometer. The linear characteristic emissions are attributed to the 4G5/2→6H5/2 (566 nm), 4G5/2→6H7/2 (580-632 nm), 4G5/2→6H9/2 (653-673 nm) and 4G5/2→6H11/2 (712-735 nm) f-f transitions of Sm3+ ions. The integral emission intensity is proportional to the value of applied pressure. By using the linear relationship between integrated emission intensity and the dynamic pressure, the real-time pressure distribution is visualized and recorded. Our results highlight that the incorporation of lanthanide luminescent ions into piezoelectric semiconductors as smart materials could be applied into the flexible mechanical-optical sensor device without additional auxiliary power, which has great potential for promising applications such as mapping of personalized handwriting, smart display, and human machine interface.

  18. Investigation of oxidative coupling of methane over bismuth oxychloride, samarium chloride, or manganese chloride supported on lithium carbonate-magnesia systems

    Energy Technology Data Exchange (ETDEWEB)

    Khan, A.Z.; Ruckenstein, E. (State Univ. of New York, Buffalo, NY (United States))


    The magnesia-supported bismuth oxychloride with lithium carbonate present is significantly more effective and stable with time-on-stream than the unsupported or supported systems free of Li[sub 2]CO[sub 3] in the oxidative coupling of methane at 750[degrees]C, P[sub CH[sub 4

  19. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water. (United States)

    Merschel, Gila; Bau, Michael


    High-technology metals - such as the rare earth elements (REE) - have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Samario-153-Lexidronam (EDTMP) en el tratamiento de las metástasis óseas Samarium-153-Lexidronam (EDTMP) for the management of bone metastases


    F. Torre; C. Gómez-Vega; A. Callejo; J. Genolla


    Las metástasis óseas son una complicación frecuente en pacientes neoplásicos, en este sentido, el tejido óseo ocupa el tercer lugar de todos los órganos y sistemas con metástasis después del pulmón e hígado. Aproximadamente un 75% de los enfermos con metástasis óseas sufrirán dolor, siendo estas la causa más frecuente de dolor en pacientes con cáncer. El dolor óseo aumenta con los movimientos y a la presión, limitando la autonomía del enfermo y su calidad de vida. El tratamiento incluye vario...

  1. Morphology and orientation of β-BaB{sub 2}O{sub 4} crystals patterned by laser in the inside of samarium barium borate glass

    Energy Technology Data Exchange (ETDEWEB)

    Nishii, Akihito; Shinozaki, Kenji; Honma, Tsuyoshi; Komatsu, Takayuki, E-mail:


    Nonlinear optical β-BaB{sub 2}O{sub 4} crystal lines (β-BBO) were patterned in the inside of 8Sm{sub 2}O{sub 3}–42BaO–50B{sub 2}O{sub 3} glass by irradiations of continuous-wave Yb:YVO{sub 4} lasers with a wavelength of 1080 nm (power: P=0.8–1.0 W, scanning speed: S=0.2–2.5 μm/s), in which the laser focal position was moved gradually from the surface to the inside. The morphology, size, and orientation of β-BBO crystals were examined from polarization optical microscope and birefringence imaging observations. It was demonstrated that c-axis oriented β-BBO crystals with long lengths (e.g., 20 mm) were patterned in the inside of the glass. The morphology of β-BBO in the cross-section of lines was a rectangular shape with rounded corners, and the volume of β-BBO formed increased with increasing laser power and with decreasing laser scanning speed. The maximum depth in the inside from the surface for β-BBO patterning increased with increasing laser power, e.g., D{sub max}∼100 μm at P=0.8 W, D{sub max}∼170 μm at P=0.9 W, and D{sub max}∼200 μm at P=1 W. The present study proposes that the laser-induced crystallization opens a new door for applied engineering in glassy solids. - Graphical abstract: This figure shows the POM photographs for β-BaB{sub 2}O{sub 4} crystal lines patterned by cw Yb:YVO{sub 4} fiber laser irradiations with a laser power of P=0.8 W and a laser scanning speed S=2 μm/s in the glass. The laser focal point was moved gradually from the surface into the inside. The results shown in Fig. 1 demonstrate that it is possible to pattern highly oriented β-BaB{sub 2}O{sub 4} crystals even in the inside of glasses. - Highlights: • β-BaB{sub 2}O{sub 4} crystal lines were patterned in the inside of a glass by lasers. • Laser focal position was moved gradually from the surface to the inside. • Birefringence imaging was observed. • Morphology, size, and orientation of crystals were clarified. • Crystal lines with long lengths (e.g., 20 mm) were patterned at the depth of 200 μm.

  2. Selected Economic Translations on Eastern Europe (164th in the Series) (United States)


    however, only if we cooperate more closely with our workers by drawing them into our collective. The Textile Research Institutes in the GBR ...supplying industries» for example the magnet and membrane plants* In socialist joint work above the plant level, pro- ducer and processing plants must

  3. Ce que nous faisons | Page 164 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Amélioration des moyens de subsistance agropastoraux dans le nord-ouest du Yunnan (Chine) - phase II. Sujet(s): Herbages, Terres Communales, Utilisation Du Sol, Gestion Des Terres, Résolution De Conflits, Participation Communautaire, Création D'institutions, Gouvernance. Région(s): Asie, Chine, Extrême-Orient.

  4. Clinics in diagnostic imaging (164). Morel-Lavallée lesion. (United States)

    Cheong, Sook Chuei Wendy; Wong, Bak Siew Steven


    A 31-year-old male motorcyclist presented with prepatellar swelling of the left knee after a collision with a car. Magnetic resonance imaging of the knee showed no bony or ligamentous injury to the knee. Instead, a well-defined, thin-walled, T2-weighted hyperintense fluid collection with internal septations was identified in a prefascial location overlying the left patella and patellar tendon. The findings were in keeping with those of a Morel-Lavallée lesion, a closed internal degloving injury. Morel-Lavallée lesions are occasionally encountered after a blunt soft-tissue trauma. The presentation and imaging features are discussed. Copyright © Singapore Medical Association.

  5. 40 CFR 164.22 - Contents of document setting forth objections. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Contents of document setting forth... Contents of document setting forth objections. (a) Concise statement required. Any document containing... registration, or change the classification of a pesticide, shall clearly and concisely set forth such...

  6. FCJ-164 ‘Don’t be Rude on the Road’: Cycle Blogging, Trolling and Lifestyle

    Directory of Open Access Journals (Sweden)

    Steve Jones


    Full Text Available This article examines hostile noise on the UK Guardian’s Bike Blog. Like the Internet, the bicycle has been framed as a redemptive technology at the heart of new forms of urbanity and citizenship. The article examines these struggles, concentrating on how accusations of trolling police the boundaries between cycling as a sphere of autonomous play and a more ‘ethical’ disposition that links cycling to environmental and social responsibility. It argues that a sense of community is established through the embattled relationship with a ‘petrolhead’ mode of online writing which asserts the pleasures of unrestrained lifestyle-as-fun and contests the claims to good citizenship made by pro-cycle bloggers. The article asks whether cycle blogging is constituted by its games of taste and its defensive response to trolling, or if conjoined strategies of netiquette and on-road etiquette framed in terms of ‘responsibility’, offer a route to legitimacy.

  7. 164 antitrypanosomal activity of senna villosa in infected balb/c mice ...

    African Journals Online (AJOL)


    Inhibition of Trypanosoma cruzi growth in mammalian cells by purine and pyrimidine analogs. Antimicrob Agents Chemother. 40:2455-2458. 23. Organización Mundial de la Salud. (2007). Reporte sobre la enfermedad de Chagas. Programa Especial de. Investigaciones y Enseñanzas sobre Enfermedades Tropicales (TDR) ...

  8. Analysis of Optical Variations of BL Lac Object AO 0235+164 Wang ...

    Indian Academy of Sciences (India)

    The author would like to thank Dr. Liu Wenpo from Civil Aviation University of. China for a constructive discussion. He acknowledges the archive data from the. Whole Earth Blazar Telescope (WEBT) consortium. This work is supported by the LangFang Municipal Science and Technology Research and Development Pro-.

  9. : tous les projets | Page 164 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ce projet concerté examinera le rôle que pourrait jouer le modèle intégré de coopératives pour réduire la pauvreté et favoriser le développement dans les collectivités rurales de l'Afrique. End Date: 16 janvier 2017. Sujet: COOPERATIVES. Région: Canada, South of Sahara, Rwanda, Uganda, Tanzania. Programme: ...


    Directory of Open Access Journals (Sweden)



    Full Text Available Así pues, juega papel importante el maestro de Ciencias Naturales en el proceso de formación de los estudiantes, en tanto mediador simbólico e interpretador de las diferentes variables que convergen e interactúan en los procesos de enseñanza y aprendizaje, como lo son: características socioculturales; en las cuales se lleva a cabo dichos procesos, los intereses y motivaciones de los estudiantes y la organización de la práctica educativa como tal, en donde se encuentran combinadas las intenciones del maestro, el currículo de la institución y los objetivos planteados por los estándares curriculares, fundándose de esta manera, la meta por la calidad educativa. La formación en Biología, es pues, un proceso sutil, ya que se encuentra enmarcada dentro de las ciencias experimentales, pero sobre todo, dentro de las ciencias humanas, aquellas que dan cuenta del valor agregado que adquiere el estudiante como principal actor social, como ser humano en constante interacción con su entorno natural. El maestro debe convertirse en mediador, artista o creativo, al intentar buscar esa interrelación sistémica y armónica entre la acción educativa y el contexto cultural-ambiental, es decir lograr contextualizar los diferentes conocimientos teóricos con la realidad de cada uno de los estudiantes. La formación debe orientarse no sólo al conocimiento

  11. Selected translated abstracts of Russian-language climate-change publications, III aerosols: Issue 164

    Energy Technology Data Exchange (ETDEWEB)

    Razuvaev, V.N.; Ssivachok, S.G. [All-Russian Research Inst. of Hydrometeorological Information-World Data Center, Obninsk (Russian Federation)


    This report presents abstracts in Russian and translated into English of important Russian-language literature concerning aerosols as they relate to climate change. In addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

  12. 45 CFR 164.508 - Uses and disclosures for which an authorization is required. (United States)


    ... which students, trainees, or practitioners in mental health learn under supervision to practice or... of the research study,” “none,” or similar language is sufficient if the authorization is for a use... maintenance of a research database or research repository. (vi) Signature of the individual and date. If the...

  13. 40 CFR 65.164 - Performance test and flare compliance determination notifications and reports. (United States)


    ..., record of operating conditions during the test, record of preparation of standards, record of calibrations, raw data sheets for field sampling, raw data sheets for field and laboratory analyses... as the technical or economic infeasibility, or the impracticality, of the source performing the test. ...

  14. 45 CFR 164.524 - Access of individuals to protected health information. (United States)


    ... inmates, or the safety of any officer, employee, or other person at the correctional institution or... paragraph (a)(1) of this section. (ii) A covered entity that is a correctional institution or a covered health care provider acting under the direction of the correctional institution may deny, in whole or in...

  15. Ce que nous faisons | Page 164 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Amélioration des moyens de subsistance agropastoraux dans le nord-ouest du Yunnan (Chine) - phase II. On trouve, dans le nord-ouest de la province du Yunnan, une importante ethnie tibétaine minoritaire qui vit principalement dans les régions rurales montagneuses et gère des systèmes de production complexes et ...

  16. 15 CFR 922.164 - Additional activity regulations by Sanctuary area. (United States)


    ... defense, law enforcement, or responses to emergencies that threaten life, property, or the environment... through without interruption or for law enforcement purposes: pole spears, air rifles, bows and arrows, slings, Hawaiian slings, rubber powered arbaletes, pneumatic and spring-loaded guns or similar devices...

  17. 46 CFR 164.018-5 - Specifications and standards incorporated by reference. (United States)


    ... (August 12, 1970), entitled “Cloth, Drill, Cotton.” (4) Federal Specification CCC-C-443 E (December 2, 1974), entitled “Cloth, Duck, Cotton (Single and Plied Filling Yarns, Flat).” (5) Federal Test Method... Inspection, Sampling and Testing.” (Method 6141 “Washability of Paints”, and Method 6142 “Scrub Resistance...

  18. Yeast Interacting Proteins Database: YEL043W, YOR164C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available on quantitative analysis of protein-protein interaction maps; may interact with ribosomes, based on co-purification based on quantitative analysis of protein-protein interaction maps; may interact with ribosomes, based on co-purification studies

  19. 45 CFR 164.520 - Notice of privacy practices for protected health information. (United States)


    ... purposes: treatment, payment, and health care operations. (B) A description of each of the other purposes....526; (E) The right to receive an accounting of disclosures of protected health information as provided... covered health care providers. A covered health care provider that has a direct treatment relationship...

  20. 46 CFR 164.009-3 - Noncombustible materials not requiring specific approval. (United States)


    ... subpart: (a) Sheet glass, block glass, clay, ceramics, and uncoated fibers. (b) All metals, except magnesium and magnesium alloys. (c) Portland cement, gypsum, and magnesite concretes having aggregates of... pumice. (d) Woven, knitted or needle punched glass fabric containing no additives other than lubricants...

  1. General Systems Theory, Systems Analysis, and Regional Planning: An Introductory Bibliography. Exchange Bibliography No. 164. (United States)

    Williams, Hugh E.

    This bibliography suggests a number of introductory readings that will enable regional and urban planners to understand the systems approach. The main focus of the research study that gave rise to this review of the literature was on establishing ways in which decisionmakers in regional planning could be helped in making their choices. The…

  2. 45 CFR 164.514 - Other requirements relating to uses and disclosures of protected health information. (United States)


    ... Locators (URLs); (O) Internet Protocol (IP) address numbers; (P) Biometric identifiers, including finger... covered entity must identify: (A) Those persons or classes of persons, as appropriate, in its workforce... to limit the access of such persons or classes identified in paragraph (d)(2)(i)(A) of this section...

  3. SU-E-J-164: Verification of Commercial Respiratory Tracking System Using Scintillation Screen. (United States)

    Lim, S


    The accuracy of the tracking system is critical for the result of four-dimensional radiation therapy. The objective of this study is to propose the method of verifying the accuracy of respiratory tracking system. The scintillation screen and the light marker between the transparent acrylic plates were designed to move according to the prerecorded respiratory organ motion of volunteers. A vertical circle photon beam with 3 cm diameters from the cyberknife unit was planned to track the motion of the scintillation screen with the plates. In dark room, the CCD camera outside of the phantom captured the scintillation from the screen and the light marker in 30 frames per second when the photon beam was incident. The pictures were captured by the CCD camera were analyzed frame by frame, and the discrepancy between the scintillating circle on the scintillation screen and the light marker depending on the time was measured. The discrepancy of the motions of the delivered photon beam and the light marker was analyzed. In the preliminary study, the maximum discrepancy was measured less than 1.5 mm in normal breathing pattern as the manufacturer specified it. As the speed of the motion was increased, the discrepancy between the position of the beam and internal marker increased. However, the error was clinically acceptable. The further study will be performed for the irregular respiratory motion patterns. This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (20110004848). © 2012 American Association of Physicists in Medicine.

  4. Yeast Interacting Proteins Database: YJL164C, YIL033C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available tein kinase (PKA), a component of a signaling pathway that controls a variety of cellular processes, includi...dependent protein kinase (PKA), a component of a signaling pathway that controls a variety of cellular processes

  5. 33 CFR 164.74 - Towline and terminal gear for towing astern. (United States)


    ...) Appropriate for exposure to the marine environment and to any chemicals used or carried on board the vessel... bollard pull of the vessel; (ii) Appropriate for the static loads and dynamic loads expected during the... the strength and anticipated loading of the towline and for the environment; (2) Each connection is...

  6. Evaluation of serum cobalamin concentrations in dogs of 164 dog breeds (2006-2010). (United States)

    Grützner, Niels; Cranford, Shannon M; Norby, Bo; Suchodolski, Jan S; Steiner, Jörg M


    Altered serum cobalamin concentrations have been observed in dogs with gastrointestinal disorders such as exocrine pancreatic insufficiency (EPI) or gastrointestinal inflammation. The aims of the current study were 1) to identify breeds with a higher proportion of dogs with a decreased serum cobalamin concentration, 2) to determine whether dogs with such decreased concentrations tend to have serum canine trypsin-like immunoreactivity (cTLI) concentrations diagnostic for EPI, and 3) to compare the number of submissions for serum cobalamin analysis by breed to the American Kennel Club (AKC) breed ranking list of 2009. In this retrospective study, results of 28,675 cobalamin tests were reviewed. Akitas, Chinese Shar-Peis, German Shepherd Dogs, Greyhounds, and Labrador Retrievers had increased proportions of serum cobalamin concentrations below the lower limit of the reference interval (Dogs, and Border Collies had increased proportions of serum cobalamin concentrations below the detection limit of the assay (Dogs with serum cobalamin concentrations <150 ng/l were more likely to have a serum cTLI concentration considered diagnostic for EPI (≤2.5 µg/l; all P ≤ 0.001). The breed with the highest proportion of samples submitted for serum cobalamin analysis in comparison with the AKC ranking list was the Greyhound (odds ratio: 84.6; P < 0.0001). In Akitas and Border Collies, further investigations are warranted to clarify if a potentially breed-specific gastrointestinal disorder is responsible for the increased frequency of decreased serum cobalamin and cTLI concentrations.

  7. SU-E-T-164: Characterization of Breast Deformation During Accuboost TM Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Cobian, J; Liu, F [Rhode Island Hospital / Warren Alpert Medical, Providence, RI (United States)


    Purpose: During treatment using AccuboostTM (Advanced Radiation Therapy, Tyngsboro, MA) applicators the breast is compressed between two paddles in order to immobilize it. This causes the breast tissue to expand. The purpose of this study was to analyze the nature of this deformation. Methods: CT scans of a breast phantom (Computerized Imaging Reference Systems, Norfolk, VA) were acquired at different compressions in the cranial-caudal (CC) direction. These were performed by placing the phantom between two plates whose position is controlled by a manual crank. The phantom masses were contoured in order to simulate the clips placed after surgery. For all scans the mean distance between the masses was computed. Additionally, deformable registration was performed between two scans using the Velocity software (Varian Medical Systems, Palo Alto, CA) to assess the shifts of each of these masses. Results: As the compression increases so does the average distance between the masses. The relationship between deformation and compression is not linear. Additionally, the largest displacements are in the direction of compression. The mean shift is 1.8mm. The shifts in the RT-LT direction and ANT-POST direction are 1.1 mm and 0.7 mm respectively Conclusion: When treating patients the clips shift their position as a Result of the plate compression. For CC compressions this is not a problem if they shift their position primarily in the superior-inferior direction. The problem of not being able to cover all clips (target area) can arise when they shift position on a plane perpendicular to the patient. For clips which are already near the chest wall, care should be exercised not to compress the breast in such a way as to move those clips out of the treatable area.These preliminary results show a larger shift in the RT-LT direction than the ANT-POST one. Further research will seek to either confirm or infirm this.

  8. Dugway Proving Ground: Closure Plan Module 2, for SWMUs 20, 164, 166 and 170 (United States)


    PAGE wApme Pubiner soll Moo"" NtIso doem~ me soW N mq Va S amoay uaggm 8=0 "porn soV b~ Someo a a" motra~ioofso -.,,d I, bi~mn bainowi amemminea fr...cross the placenta and accumulate in the amniotic fluid (Danielsson and others, 1986). Associated developmental effects of high doses of chloroform in...inhalation exposure to chromium (VI) compounds. Other effects observed following chromium (VI) exposure include effects on the immune system, nervous

  9. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  10. An experiment using neutron activation analysis and a rare earth element to mark cotton plants and two insects that feed on them

    Energy Technology Data Exchange (ETDEWEB)

    Showler, Allan T. [USDA-ARS IFNRRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States)]. E-mail:; James, William D. [Elemental Analysis Laboratory, 3144 Texas A and M University, College Station, TX 77843-3144 (United States); Armstrong, John S. [USDA-ARS BIRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States); Westbrook, John K. [USDA-ARS APMRU, 2771 F and B Road, College Station, TX 77845-4966 (United States)


    Studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. Rare earth elements, such as samarium (Sm), have been used as ingested markers of some insects and detected using neutron activation analysis (NAA). In this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), at different dosages and in water used to irrigate cotton, Gossypium hirsutum L. Samarium was detected in adult boll weevils fed on the samarium-labeled diet, but not after 5 or 10 days of being switched to non-labeled diet, even if the insects were given labeled diet for as long as 7 consecutive days. Introduced in irrigation water, 1% samarium (m/m) was detectable in cotton squares and leaf tissue. However, boll weevil adults fed samarium-labeled squares did not retain detectable levels of samarium, nor did boll weevil adults reared to adulthood from samarium-labeled squares. Fourth instar beet armyworms, Spodoptera exigua (Huebner) (Noctuidae: Lepidoptera), fed on samarium-labeled cotton leaves obtained enough samarium for NAA detection, but adult moths reared from them did not have detectable amounts of samarium. Although samarium can be useful as a marker when insects are presented with a continuous pulse of the label, elements that are assimilated by the insect would be more useful if a continuous infusion of the marker cannot be provided.

  11. Risk behaviors for the health of adolescents from High School - doi:10.5020/18061230.2009.p164

    Directory of Open Access Journals (Sweden)

    Eliane Denise da Silveira Araújo


    Full Text Available Objective: To investigate the risk behaviors (smoking addiction, alcoholism, drug use and sexual risk behavior of adolescents from High School. Methods: It was an analytical and cross-sectional study. The sample consisted of 720 scholars (252 boys and 468 girls from the age group of 16 to 17 years-old, from three public schools in Florianopolis/SC. The data was collected through two types of self administrated questionnaires; one for the parents and another one for the students, from March to December, 2005. The studied variables were legal and illegal drug use and sexual risk behavior. The descriptive statistics and the chi- squared test were used to carry out the data analysis Results: The beginning of risk behaviors occurred between 14 and 15 years old, for both genders. It was observed that 26 (3.6% scholars drank alcohol regularly; 38 (5.3% smoked daily; 66 (9.2 % were drug users or had used drugs several times and 14 (2% were drug dependents. Concerning to sexual risk behavior, 318 (44.5% scholars had sexual risk behavior and from those, 97 (13.6% did not always use condom. From the studied sample, 545 (76.5% scholars did not present any risk behavior. Among risk behaviors, sexual risk prevailed (42.5%. Conclusion: The number of adolescents with risk behavior was not high. Nevertheless, there is a small proportion of adolescents that smoke, drink and do drugs and have sexual risk behavior. Thispoints out to the need of a bigger supervision and guidance for these students.

  12. Precise methane absorption measurements in the 1.64 μm spectral region for the MERLIN mission (United States)

    Delahaye, T.; Maxwell, S. E.; Reed, Z. D.; Lin, H.; Hodges, J. T.; Sung, K.; Devi, V. M.; Warneke, T.; Spietz, P.; Tran, H.


    In this article we describe a high-precision laboratory measurement targeting the R(6) manifold of the 2ν3 band of 12CH4. High-fidelity modeling of this absorption spectrum for atmospheric temperature and pressure conditions will be required by the Franco-German, Methane Remote Sensing LIDAR (MERLIN) space mission for retrievals of atmospheric methane. The analysis uses the Hartmann-Tran profile for modeling line shape and also includes line-mixing effects. To this end, six high-resolution and high signal-to-noise ratio absorption spectra of air-broadened methane were recorded using a frequency-stabilized cavity ring-down spectroscopy apparatus. Sample conditions corresponded to room temperature and spanned total sample pressures of 40 hPa-1013 hPa with methane molar fractions between 1 µmol mol-1 and 12 µmol mol-1. All spectroscopic model parameters were simultaneously adjusted in a multispectrum nonlinear least squares fit to the six measured spectra. Comparison of the fitted model to the measured spectra reveals the ability to calculate the room temperature, methane absorption coefficient to better than 0.1% at the online position of the MERLIN mission. This is the first time that such fidelity has been reached in modeling methane absorption in the investigated spectral region, fulfilling the accuracy requirements of the MERLIN mission. We also found excellent agreement when comparing the present results with measurements obtained over different pressure conditions and using other laboratory techniques. Finally, we also evaluated the impact of these new spectral parameters on atmospheric transmissions spectra calculations.

  13. School Feeding Analysis in the context of a Food and Nutrition Program - doi:10.5020/18061230.2006.p164

    Directory of Open Access Journals (Sweden)

    Dixis Figueroa Pedraza


    Full Text Available The diversity of standards related to school feeding makes it a complex topic and difficult to lead with. This research aimed at reflecting on the essential aspects of the subject, in a bibliographical revision of global proposal that was based on what the term “program” represents. The School Feeding Program means a combination of projects addressed to bring meals to keep students nourished, independent of their condition. This concept implies that all School Feeding Program should consist of three stages: design, carrying out and evaluation. The design includes important controversial aspects, related to school feeding, such as: the program objectives, their relationship with starvation, malnutrition and school failure; and the distinction of treating this matter from the perspective of breeding right. There are significant differences among experiences in running School Feeding Programs in developed and in developing countries, as well as within the last ones. The evaluation stage usually is not well designed or it is not considered. This stage is really important and it is addressed to determine if the outcomes are corresponding to planned objectives. In order to complete a useful evaluation stage, the use of proper indicators is a main point. Finally, a whole analysis of the Program is carried out in order to obtain unquestionable results. The School Feeding Program is discussed as a Public Policy, into the context of Food Security and the other complementary activities included in it. The proposed view considers school feeding as a right that must be satisfied in the implementation of organized projects.

  14. rm. J. Biol. Chem. Sci. 1(2); 158-164, 2007 “1mm;“m“f

    African Journals Online (AJOL)

    were prepared at various dilutions and plated on selective media for Coryneforrns, Escherichia coli,. Enterococcus faeoalis and ... Keywords: Escherichia coli, Pseudomonas, Coryneforms, Enterococcus faecalis, chicken, ostrich, faeces. INTRODUCTION .... Colony Description Species AFRC ACC A0. Dark yellow centered ...

  15. The Transfer of HRM Policies and Practices in American Multinational Hotels in Saudi Arabia (P.155-164

    Directory of Open Access Journals (Sweden)

    Amal Hatem Alkhaldi


    Full Text Available Global   competition   in   the   international   business   environment has   pushed companies to achieve competitive advantage through mergers, acquisitions and through locating their subsidiaries in less developed counties for cost effectiveness. Consequently, the competitive pressure has increased the significance of human resource management (HRM in multinational companies (MNCs, and MNCs have recognised the significance of the transfer HRM process across borders. This study examines the transfer of HRM policies and practices of US MNCs to their subsidiaries in Saudi Arabia. The aim of the study is to determine the extent to which US MNCs transfer HRM policies and practices from their Headquarters to their subsidiaries in Saudi Arabia; and identify the factors that facilitate and inhibit HRM transfer. The paper is based on an investigation of the interaction between home-country and host-country effects in determining HRM policies and practices in MNCs in the context of the Middle East. The study adopts a mixed methods approach of documentary analysis, focus group interviews of employees and in depth interviews of key informants in four subsidiaries of US owned international hotel chains located in Riyadh, Saudi Arabia.Keywords: Home  country, host  country, human  resource  managem transfer,Institutional theory, culture conditions.

  16. Long-lasting fibrin matrices ensure stable and functional angiogenesis by highly tunable, sustained delivery of recombinant VEGF164


    Sacchi, Veronica; Mittermayr, Rainer; Hartinger, Joachim; Martino, Mikaël M.; Lorentz, Kristen M.; Wolbank, Susanne; Hofmann, Anna; Largo, Remo A.; Marschall, Jeffrey S.; Groppa, Elena; Gianni-Barrera, Roberto; Ehrbar, Martin; Hubbell, Jeffrey A.; Redl, Heinz; Banfi, Andrea


    Inducing the growth of new blood vessels by specific factors is an attractive strategy to restore blood flow in ischemic tissues. Vascular endothelial growth factor (VEGF) is the master regulator of angiogenesis, yet clinical trials of VEGF gene delivery failed. Major challenges include the need to control the tissue distribution of factor dose and the duration of expression. Here, we developed a highly tunable fibrin-based platform to precisely control the dose and duration of VEGF protein d...

  17. 15 CFR 16.4 - Finding of need to establish a specification for labeling a consumer product. (United States)


    ... writing and will, to the extent practicable, include the following information: (1) Identification of the... difficulty experienced by consumers in making informed purchase decisions because of a lack of knowledge... requests and shall notify the requester of her decision in writing. If the Secretary determines that there...

  18. SU-E-T-164: Clinical Implementation of ASi EPID Panels for QA of IMRT/VMAT Plans. (United States)

    Hosier, K; Wu, C; Beck, K; Radevic, M; Asche, D; Bareng, J; Kroner, A; Lehmann, J; Logsdon, M; Dutton, S; Rosenthal, S


    To investigate various issues for clinical implementation of aSi EPID panels for IMRT/VMAT QA. Six linacs are used in our clinic for EPID-based plan QA; two Varian Truebeams, two Varian 2100 series, two Elekta Infiniti series. Multiple corrections must be accounted for in the calibration of each panel for dosimetric use. Varian aSi panels are calibrated with standard dark field, flood field, and 40×40 diagonal profile for beam profile correction. Additional corrections to account for off-axis and support arm backscatter are needed for larger field sizes. Since Elekta iViewGT system does not export gantry angle with images, a third-party inclinometer must be physically mounted to back of linac gantry and synchronized with data acquisition via iViewGT PC clock. A T/2 offset correctly correlates image and gantry angle for arc plans due to iView image time stamp at the end of data acquisition for each image. For both Varian and Elekta panels, a 5 MU 10×10 calibration field is used to account for the nonlinear MU to dose response at higher energies. Acquired EPID images are deconvolved via a high pass filter in Fourier space and resultant fluence maps are used to reconstruct a 3D dose 'delivered' to patient using DosimetryCheck. Results are compared to patient 3D dose computed by TPS using a 3D-gamma analysis. 120 IMRT and 100 VMAT cases are reported. Two 3D gamma quantities (Gamma(V10) and Gamma(PTV)) are proposed for evaluating QA results. The Gamma(PTV) is sensitive to MLC offsets while Gamma(V10) is sensitive to gantry rotations. When a 3mm/3% criteria and 90% or higher 3D gamma pass rate is used, all IMRT and 90% of VMAT QA pass QA. After appropriate calibration of aSi panels and setup of image acquisition systems, EPID based 3D dose reconstruction method is found clinically feasible. © 2012 American Association of Physicists in Medicine.

  19. Obtention of Samarium and Gadolinium concentrates by solvent extraction using mono-2-ethylhexyl ester of 2-ethylhexyl phosphonic acid; Obtencao de concentrados de samario e gadolinio via extracao por solventes com o ester mono-2-etilhexil do acido 2-etilhexilfosfonico

    Energy Technology Data Exchange (ETDEWEB)

    Miranda Junior, Pedro


    The rare earth chlorides solution employed in this study, which is constituted by medium and heavy fractions, is derived from monazite processing accomplished by NUCLEMON-Mineroquimica (SP). This solution shows an acidity about 1.18 M and 189 g/L of rare earth oxides, containing as main constituents: Sm(34.55%), Gd(23.85%), Dy (6.82%), and Y (24.45%). It was used, as organic phase, 2-ethylhexyl phosphonic acid, mono-2-ethylhexylester diluted to 1 M in isododecane. (author)

  20. Poly(dl)lactic acid/polyglycolic acid/iron and poly(dl)lactic acid/polyglycolic acid/samarium cobalt composites for use as a delivery mechanism for magnetically directed chondrogenesis (United States)

    Oppermann, Dean Alan

    Magnetically directed chondrogenesis (MDC) is a fundamental approach to articular cartilage repair. In MDC a magnet is implanted into the subchondral trabecular bone underlying a cartilage defect and used to attract chondrocytes, magnetically tagged with Fe nanoparticles, to the defect site. Pilot studies by Halpern, Crimp and Grande, using solid neodymium (Nd) magnets, indicated optimistic results by producing a hyaline-like articular cartilage after 8 weeks implantation. Since solid Nd magnets introduce long-term biocompatibility issues, the focus of this dissertation was to develop P(dl)A/PGA/Fe and P(dl)A/PGA/SmCo 5 implants for use in MDC. The effect of implant porosity, implant composition and magnetic material (Fe or SmCo5) on the initial and degraded magnetic properties were evaluated. The biocompatibility of P(dl)A/PGA/Fe implants were investigated by implantation into New Zealand white rabbits for 8 weeks. The effect of hydrogen peroxide (H2O2) and ethylene oxide (EO) sterilization techniques on the molecular weight and chemical structure of P(dl)A/PGA polymers were evaluated using gel permeation chromatography and Fourier transform infrared spectroscopy. The effect of implant morphology, size and number on the von Mises stress in the trabecular bone surrounding the implant was evaluated using a finite element model. In general, SmCo5 implants resulted in higher magnetic fields initially and after 8 weeks of degradation than comparable Fe implants. Increases in magnetic field strength were achieved by increasing the volume fraction of magnetic material and by increasing the PGA concentration. The magnetic field strength degradation rate decreased with increases in volume fraction of magnetic material and increases in PLA concentration. Implantation studies indicated that 50/50 P(dl)A/PGA were more bioactive than 75/25 P(dl)A/PGA with an increased cellular response that is specific to bone growth. The compressive strength and elastic modulus of porous implants were comparable to trabecular bone, and the compressive strength and elastic modulus of solid implants was higher than trabecular bone but less than cortical bone. Finite element modeling showed that the implantation of solid and porous P(dl)A/PGA/Fe implants did not significantly increase the von Mises stress concentration adjacent to the implant. The von Mises stress surrounding porous implants was higher than the solid implants which predicts faster bone remodeling. Comparing single implants to multiple implants indicated a significant decrease in von Mises stress between the implants. This would predict bone resorption in that area. H2O2 sterilization resulted in a gradual decrease in the molecular weight of P(dl)A/PGA polymers that was a result of hydrolytic scission of the ester bonds present between the individual monomers. The polymers were less affected by EO sterilization with only the 75/25 P(dl)A/PGA, indicating a decrease in molecular weight. From these results, it was concluded that solid 50/50 P(dl)A/PGA/SmCo 5 implants that span the entire width of the cartilage defect should be used to optimize the attraction potential and bioactivity of the implant. Also ethylene oxide, which caused less premature implant degradation, should be used for sterilization.

  1. Fabrication of a new samarium(III) ion-selective electrode based on 3-{l_brace}[2-oxo-1(2h)-acenaphthylenyliden]amino{r_brace}-2-thioxo -1,3-thiazolidin-4-one

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali [Islamic Azad University, Quchan (Iran, islamic Republic of). Quchan Branch. Dept. of Chemistry]. E-mail:; Ganjali, Mohammad Reza [Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of). Endocrine and Metabolism Research Center; Adib, Mehdi [University of Tehran, Tehran (Iran, Islamic Republic of). Faculty of Chemistry. Center of Excellence in Electrochemistry


    This paper introduces the development of an original PVC membrane electrode, based on 3-{l_brace}[2-oxo-1(2H)-acenaphthylenyliden]amino{r_brace}-2-thioxo-1,3-thiazolidin-4-one (ATTO) which has revealed to be a suitable carrier for Sm{sup 3+} ions. The resulting data illustrated that the electrode shows a Nernstian slope of 19.3 {+-} 0.6 mV per decade for Sm{sup 3+} ions over a broad working concentration range of 1.0 X 10{sup -6} to 1.0 X 10{sup -1} mol L{sup -1}. The lower detection limit was found to be equal to (5.5{+-} 0.3) X 10{sup -7} mol L{sup -}'1 in the pH range of 3.5-7.5, and the response time was very short ({approx}10 s). The potentiometric sensor displayed good selectivities for a number of cations such as alkali, alkaline earth, transition and heavy metal ions. (author)



  3. Assessment of Non-Traditional Isotopic Ratios by Mass Spectrometry for Analysis of Nuclear Activities (United States)


    distinguish between commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and products from nuclear weapons explosions. Methods will...Isotopic ratios will be calculated for radionuclides produced in commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and... chemistry for analysis of samarium. The chemical form of samarium required for analysis varies for different mass spectrometry techniques

  4. Long-term safety and stability of angiogenesis induced by balanced single-vector co-expression of PDGF-BB and VEGF164 in skeletal muscle (United States)

    Gianni-Barrera, Roberto; Burger, Maximilian; Wolff, Thomas; Heberer, Michael; Schaefer, Dirk J.; Gürke, Lorenz; Mujagic, Edin; Banfi, Andrea


    Therapeutic angiogenesis by growth factor delivery is an attractive treatment strategy for ischemic diseases, yet clinical efficacy has been elusive. The angiogenic master regulator VEGF-A can induce aberrant angiogenesis if expressed above a threshold level. Since VEGF remains localized in the matrix around expressing cells, homogeneous dose distribution in target tissues is required, which is challenging. We found that co-expression of the pericyte-recruiting factor PDGF-BB at a fixed ratio with VEGF from a single bicistronic vector ensured normal angiogenesis despite heterogeneous high VEGF levels. Taking advantage of a highly controlled gene delivery platform, based on monoclonal populations of transduced myoblasts, in which every cell stably produces the same amount of each factor, here we rigorously investigated a) the dose-dependent effects, and b) the long-term safety and stability of VEGF and PDGF-BB co-expression in skeletal muscle. PDGF-BB co-expression did not affect the normal angiogenesis by low and medium VEGF doses, but specifically prevented vascular tumors by high VEGF, yielding instead normal and mature capillary networks, accompanied by robust arteriole formation. Induced angiogenesis persisted unchanged up to 4 months, while no tumors appeared. Therefore, PDGF-BB co-expression is an attractive strategy to improve safety and efficacy of therapeutic angiogenesis by VEGF gene delivery. PMID:26882992

  5. Effect of SCH55700, a humanized anti-human interleukin-5 antibody, in severe persistent asthma - A pilot study 164/rccm.200206-5250C

    NARCIS (Netherlands)

    Kips, JC; O'Connor, BJ; Langley, SJ; Woodcock, A; Kerstjens, HAM; Postma, DS; Danzig, M; Cuss, F; Pauwels, RA


    Antagonizing the effect of interleukin (IL)-5 is a potential new treatment strategy in allergic disorders. We evaluated the safety, biological activity, and pharmacokinetics of SCH55700, a humanized anti-human IL-5 antibody, in subjects with severe persistent asthma treated with oral or high doses

  6. 164. Abordaje híbrido de patología compleja de arco aórtico y aorta torácica

    Directory of Open Access Journals (Sweden)

    V.X. Mosquera Rodríguez


    Conclusiones: Nuestro estudio destaca cómo las estrategias híbridas incorporando un abordaje quirúrgico abierto y endovascular pueden ser empleadas con éxito en el tratamiento de patología compleja de arco y aorta torácica. Este abordaje combinado expande potencialmente el uso de las técnicas endovasculares aórticas y es una solución atractiva para pacientes quirúrgicos de alto riesgo.

  7. [Fe II] 1.64 μm Imaging Observations of the Outflow Features around Ultracompact H II Regions in the First Galactic Quadrant (United States)

    Shinn, Jong-Ho; Kim, Kee-Tae; Lee, Jae-Joon; Lee, Yong-Hyun; Kim, Hyun-Jeong; Pyo, Tae-Soo; Koo, Bon-Chul; Kyeong, Jaemann; Hwang, Narae; Park, Byeong-Gon


    We present [Fe II] 1.644 μm features around ultracompact H II regions (UCHIIs) found on a quest for the "footprint" outflow features of UCHIIs—the features produced by outflowing materials ejected during an earlier, active accretion phase of massive young stellar objects (MYSOs). We surveyed 237 UCHIIs in the first Galactic quadrant, employing the CORNISH UCHII catalog and UWIFE data, which is an imaging survey in [Fe II] 1.644 μm performed with UKIRT-WFCAM under ~0.''8 seeing conditions. The [Fe II] features were found around five UCHIIs, one of which was less plausible. We interpret the [Fe II] features to be shock-excited by outflows from YSOs and estimate the outflow mass-loss rates from the [Fe II] flux which are ~1 × 10-6-4 × 10-5 M ⊙ yr-1. We propose that the [Fe II] features might be the "footprint" outflow features, but more studies are required to clarify whether or not this is the case. This is based on the morphological relation between the [Fe II] and 5 GHz radio features, the outflow mass-loss rate, the travel time of the [Fe II] features, and the existence of several YSO candidates near the UCHIIs. The UCHIIs accompanying the [Fe II] features have relatively higher peak flux densities. The fraction of UCHIIs accompanying the [Fe II] features, 5/237, is small when compared to the ~90% detection rate of high-velocity CO gas around UCHIIs. We discuss some possible explanations for the low detection rate.

  8. Microstructure of Welded Joints of X5CrNiCuNb16-4 (17-4 PH Martensitic Stainlees Steel After Heat Treatment

    Directory of Open Access Journals (Sweden)

    Ziewiec A.


    Full Text Available The paper presents rezults of microstructure (LM, TEM investigation and hardness measurments of welded joints in martensitic precipitation hardened stainless steel containing copper, subjected to heat treatment. For the aging temperature up to 540 °C even for the very long times, the microstructure of the welded joints is similar to this one at lower temerature aging. After aging at 620 °C a distinct change of the microstructure was observed. Non-equilibrium solidification conditions of the weld metal, segregation and the diffusion of copper and the elements stablilizing the austenite cause the occurrence of the reverse transformation of the martensite into austenite as fast as just 1 hour at 620 °C. TEM investigations revealed the differences in dispersion of hardening copper precipitates after aging at temperature 620 °C for 1 and 4 hours.

  9. Dynamics of ionospheric irregularities in increasing phase of 24th solar cycle at Kolhapur [16.4°N, 74.2°E (United States)

    Sharma, A. K.; Chavan, G. A.; Gurav, O. B.; Gaikwad, H. P.; Ghodpage, R. N.; Nade, D. P.


    In this paper we have focused on drift of irregularities using amplitude scintillations for period January 2011 to December 2015. The data of VHF amplitude scintillations and all sky imager at Kolhapur has been used to obtain the drift of ionospheric irregularities. The drift is compared with velocities of thermospheric wind obtained by HWM-07 (Horizontal Wind Model-07) and of EPBs (Equatorial Plasma Bubbles). The results are in good agreement with model data. Also, the pattern of drift in scintillation data matches well with velocity of EPBs, mainly during equinoctial months. To examine the possible effect of magnetospheric disturbance on the dynamics of the irregularities we have compared the drift on magnetically disturbed nights with the monthly averaged quiet nights drift. Zonal velocity pattern on magnetically disturbed nights shows reversal in the direction of eastward zonal drift around midnight. The deviation of plasma drift on disturbed nights from monthly averaged quiet night drift shows maximum effect of magnetic activity around midnight. The monthly averaged peaks of the zonal drift increases with increasing 10.7 cm solar flux.

  10. MODIS-Derived 1.64 micron white-sky albedo on a global, 1-minute equal angle grid (Collection 004 and 005) (United States)

    National Aeronautics and Space Administration — The Filled Land Surface Albedo Product is a global data set of spatially complete albedo maps. It was derived from the MODIS MOD43B3 Land product and includes both...

  11. 45 CFR 164.512 - Uses and disclosures for which an authorization or opportunity to agree or object is not required. (United States)


    ... types of wounds or other physical injuries, except for laws subject to paragraph (b)(1)(ii) or (c)(1)(i... or receive such information for the purpose of preventing or controlling disease, injury, or disability, including, but not limited to, the reporting of disease, injury, vital events such as birth or...

  12. Clinicopathological evaluation of 164 dental follicles and dentigerous cysts with emphasis on the presence of odontogenic epithelium in the connective tissue. The hypothesis of "focal ameloblastoma"

    NARCIS (Netherlands)

    Meleti, M.; van der Waal, I.


    Objectives: Some ameloblastomas presumably originate from odontogenic epithelium within the connective tissue of dental follicles and dentigerous cysts. Therefore, it would seem reasonable to discuss as whether odontogenic epithelium proliferations, frankly displaying ameloblastomatous features

  13. Fat phenotype, associated factors and rs9939609 polymorphism of the FTO gene DOI:10.5007/1980-0037.2010v12n2p164

    Directory of Open Access Journals (Sweden)

    William Alves Lima


    Full Text Available The purpose of this work was to review the main results of studies that have analysed the relationship between the rs9939609 single nucleotide polymorphism (SNP of the FTO gene and the manifestation of overweight/obesity with its associated co-morbidity, and to discuss the interaction of this polymorphism with the other factors which cause obesity. The search was performed using the MEDLINE, Highwire, Science Direct and SciELO databases, applying the following key words: FTO rs9939609, obesity genetic, gene associated obesity, FTO contributes obesity. Inclusion criteria were: original articles where the search was performed in humans and including the rs9939609. Articles that analysed the FTO gene associated with preinstalled hormonal diseases were excluded. Of the several SNP associated with the FTO gene, rs9939609 has been the most researched (studied. This SNP comprises the A and T alleles, with the A homozygote being most susceptible to the development of overweight/obesity in all age ranges, especially in the caucasian population. In this situation, the control of environmental factors (alimentation and physical activity can prevent the excessive build up of fats. Obesity is related to the development of non-transmissible chronic illnesses. Association of rs9939609 polymorphism with the lipidic profile and glycemia were observed. The practicing of physical exercise and feeding habits seem to be the main contributors in the development of overweight/obesity and its resulting co-morbidity.

  14. Local Control in Action: Learning from the CORE Districts' Focus on Measurement, Capacity Building, and Shared Accountability. Policy Brief 16-4 (United States)

    Marsh, Julie; Bush-Mecenas, Susan; Hough, Heather


    California and the nation are at the crossroads of a major shift in school accountability policy. At the state level, California's Local Control and Accountability Plan (LCAP) encourages the use of multiple measures of school performance used locally to support continuous improvement and strategic resource allocation. Similarly, the federal Every…

  15. CRED Subsurface Temperature Recorder (STR); NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 17.07m; Data Range: 20050414-20060904. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  16. The Critical Technologies Project Executive Summary (United States)


    Materials with the Not covered Chalcopyrite Structure 7.8.23 Rare Earth- Transition Metal Permanent Not covered I Magnets (exanple: samarium cobalt and... Transition Metal Permanent - Magnets (example: samarium cobalt I and substituted samarium cobalt) New 7.8.24 Gadolinium Gallium Garnet (GGG) - - and...III T i mm~ 1.W 8 Poesse Maclw Tools 1110 1129. 1131 133 1142 0 F -~, oO 16.qm P c Metals 1145, 1203, 1236 4203 1365 00, awm.wq *4 1303 1311

  17. sup 8 sup 9 Sr and sup 1 sup 5 sup 3 Sm-EDTMP therapy of disseminated skeletal metastasis

    CERN Document Server

    Zhang Jun Ning; Zhu Shou Peng


    A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis

  18. Gastrointestinal behavior of orally administered radiolabeled erythromycin pellets in man as determined by gamma scintigraphy. (United States)

    Digenis, G A; Sandefer, E P; Parr, A F; Beihn, R; McClain, C; Scheinthal, B M; Ghebre-Sellassie, I; Iyer, U; Nesbitt, R U; Randinitis, E


    The behavior of single 250-mg doses of a multiparticulate form of erythromycin base (ERYC(R)), each including five pellets radiolabeled with neutron-activated samarium-153, was observed by gamma scintigraphy in seven male subjects under fasting and nonfasting conditions. The residence time and locus of radiolabeled pellets within regions of the gastrointestinal tract were determined and were correlated with plasma concentrations of erythromycin at coincident time points. Administration of food 30 minutes postdosing reduced fasting plasma erythromycin Cmax and area under the plasma erythromycin versus time curve (AUC) values by 43% and 54%, respectively. Mean peak plasma concentration of erythromycin (Cmax) in the fasting state was 1.64 micrograms/mL versus 0.94 micrograms/mL in the nonfasting state. Total oral bioavailability, as determined by mean AUC (0-infinity) of the plasma erythromycin concentration versus time curve, was 7.6 hr/micrograms/mL in the fasted state, versus 3.5 hr/micrograms/mL in the nonfasting state. Mean time to peak plasma erythromycin concentration (tmax) in the fasting state was 3.3 hours, versus 2.3 hours in the nonfasting state. Plasma concentrations of erythromycin in both fasting and nonfasting states were within acceptable therapeutic ranges. Evidence provided by this study: 1) indicates that pellet erosion and absorption of active erythromycin base begins when the enteric-coated pellets reach the highly vascular mucosa of the jejunum and proximal ileum, and is essentially completed within the ileum, with a significant portion absorbed in the medial-to-distal ileum; 2) confirms that acceptable therapeutic plasma levels of erythromycin are attained in nonfasting subjects (Cmax = 0.94 microgram/mL) and that superior plasma erythromycin concentrations (Cmax = 1.64 micrograms/mL) are achieved by administration of the dose on an empty stomach 1 to 2 hours before or after meals; 3) corroborates other comparative studies reporting greater

  19. General Information about Osteosarcoma and Malignant Fibrous Histiocytoma of Bone (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  20. Treatment Option Overview (Osteosarcoma and Malignant Fibrous Histiocytoma of Bone) (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  1. Maximum Permissible Concentrations and Negligible Concentrations for Rare Earth Elements (REEs)

    NARCIS (Netherlands)

    Sneller FEC; Kalf DF; Weltje L; Wezel AP van; CSR


    In dit rapport worden maximaal toelaatbare risiconiveaus (MTR) en verwaarloosbare risiconiveaus (VR) afgeleid voor zeldzame aardmetalen (ZAM). De geselecteerde ZAMs zijn Yttrium (Y), Lanthanum (La), Cerium (Ce), Praseodymium (Pr), Neodymium (Nd), Samarium (Sm), Gadolinium (Gd), en Dysprosium

  2. Bulletin of the Chemical Society of Ethiopia - Vol 31, No 3 (2017)

    African Journals Online (AJOL)

    A novel samarium complex with interesting photoluminescence and semiconductive properties · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. D. W. Zhang, W. T. Chen, Y. F.Wang, 435-444 ...

  3. Specialty Metals: DOD Dissemination of National Security Waiver Information Could Enhance Awareness and Compliance with Restrictions (United States)


    Restrictions Why GAO Did This Study Specialty metals—such as titanium, certain steel alloys , and samarium- cobalt alloy magnets—are essential to DOD...highly magnetic, lightweight, corrosion resistant, or having high durability. Among these metals are samarium- cobalt alloy magnets used to make radar...the following elements: aluminum, chromium , cobalt , columbium, molybdenum, nickel, titanium, tungsten, or vanadium. Specialty metals were added

  4. Development of a methodology for the separation of europium and samarium from a mixture of rare earth oxides by electroreduction/ precipitation; Desenvolvimento de uma metodologia para a separacao de samario e europio a partir de mistura de oxidos de terras raras por reducao eletroquimica/precipitacao

    Energy Technology Data Exchange (ETDEWEB)

    Chepcanoff, Vera


    The rare earths (RE) were first used in 1903, when Welsbach developed a lighter that is still used today. Nowadays, the RE are employed in many different fields, as in the production of super-alloys , as catalysts for petroleum industry, in the manufacture of non-ferrous alloys, color television tubes, x-ray screens, special glasses, ceramics, computer industries, nuclear medicine, lasers, pigments, etc., moving, in the last decade , a market of US$ 2 billions per year. Due to their similar properties, the RE elements are very difficult to separate, requiring complex processes, what make the products very expensive. Elements like Eu and Sm, which contents in the minerals are low (0.05% and 2.0%, respectively, in monazite) are extremely expensive, but their field of application justifies the research for looking for other processes, more simple and/or more effective. Trivalent state is a characteristic of all RE, but some of them presents oxidation state +2, like Ce, Eu, Sm and Yb. In the case of Eu and Sm, the focus of the present work, the divalent state is achieved by electro-reduction in the potentials -0.65 and -1.55 (SCE), respectively. This makes possible the separation of these elements from the other rare earths and from each other. Thus, making use of this characteristic, a process for the individual separation of Eu and Sm in (NH{sub 4}){sub 2}SO{sub 4} solution by electro-reduction/precipitation is proposed, where Sm is first separated from the solution as sulfate, and Eu, that remains in the solution, is precipitated after the decrease of temperature and potential applied. The process developed from a synthetic Eu and Sm solution was applied to a mixture of semi-heavy RE oxide, produced at IPEN-CNEN/SP, obtaining the separation of Sm. This product was analyzed by spectrophotometry, showing high purity. (author)

  5. Tetrakis[μ-2-(3,4-dimethoxyphenylacetato]-κ4O:O′;κ3O,O′:O;κ3O:O,O′-bis{[2-(3,4-dimethoxyphenylacetato-κ2O,O′](1,10-phenanthroline-κ2N,N′samarium(III}

    Directory of Open Access Journals (Sweden)

    Jia-Lu Liu


    Full Text Available In the centrosymmetric dinuclear title complex, [Sm2(C10H11O46(C12H8N22], the SmIII ion is nine-coordinated by seven O atoms of five 2-(3,4-dimethoxyphenylacetate (DMPA ligands and two N atoms of one bis-chelating 1,10-phenanthroline (phen ligand, forming a distorted tricapped trigonal-prismatic environment. The DMPA ligands coordinate in bis-chelate, bridging and bridging tridentate modes. An intramolecular C—H...O hydrogen bond occurs. Intermolecular C—H...O interactions are also present in the crystal.

  6. Preparation, and Luminescence Properties of SiO2@Sm(MABA-Siphen Core-Shell Structure Nanometer Composite

    Directory of Open Access Journals (Sweden)

    Feng Li-Na


    Full Text Available A novel ternary samarium complex was prepared using HOOCC6H4N(CONH(CH23Si- (OCH2CH332 (MABA-Si as first ligand, and phen as second ligand. The corresponding SiO2@Sm(MABA-Siphen core-shell structure nanometer composite was synthesized as well, and the silica spheres was the core, and the ternary samarium complex was the shell layer. The ternary samarium complex has been characterized by element analysis, molar conductivity and IR spectra. The results show that the chemical formula of the complex is Sm(MABA-Si(phen2(ClO43·2H2O. The fluorescent spectra illustrat that the luminescence properties of the samarium complex are superior. The core-shell structure of SiO2@Sm(MABA-Siphen nanometer composite is characterized by SEM, TEM and IR spectra. The SiO2@Sm(MABA-Siphen core-shell structure composites exhibit stronger emission intensity than the ternary samarium complex. The fluorescence lifetime of the complex and core-shell structure composite is measured as well.

  7. The dynamics of questing ticks collected for 164 consecutive months off the vegetation of two landscape zones in the Kruger National Park (1988–2002. Part III. The less commonly collected species

    Directory of Open Access Journals (Sweden)

    Gordon J. Gallivan


    Full Text Available Despite many studies regarding tick ecology, limited information on long-term changes in tick populations exist. This study assessed the long-term population dynamics of the less frequently collected questing ixodid ticks in the Kruger National Park (KNP. From 1988 to 2002, monthly dragging of the vegetation was performed in three habitats (grassland, woodland and gully at two sites in the KNP (Nhlowa Road, Landscape Zone 17, and Skukuza, Landscape Zone 4. Amblyomma marmoreum and Rhipicephalus evertsi evertsi were collected as larvae most commonly. Most A. marmoreum larvae were collected at Skukuza and numbers peaked from March to July. More R. evertsi evertsi larvae were collected at Nhlowa Road and numbers peaked in summer and in winter, while at Skukuza there was a single peak in spring. Haemaphysalis elliptica, Rhipicephalus simus and Rhipicephalus turanicus were collected as adults most commonly. More Ha. elliptica and R. turanicus were collected at Nhlowa Road than at Skukuza, while R. simus numbers from the two sites were approximately equal. Ha. elliptica were collected most often between February and June, and R. simus and R. turanicus during February and March. All three species were collected more frequently in gullies than in grassland or woodland. Their numbers increased in 1994/1995 following an eruption of rodents, the preferred hosts of the immature stages. The different host-seeking strategies of ticks largely determine the development stage at which they are likely to be collected during vegetation dragging and reflect a complex interaction between ticks, their hosts and the environment.

  8. The dynamics of questing ticks collected for 164 consecutive months off the vegetation of two landscape zones in the Kruger National Park (1988–2002. Part II. Rhipicephalus appendiculatus and Rhipicephalus zambeziensis

    Directory of Open Access Journals (Sweden)

    Arthur M. Spickett


    Full Text Available The study aimed to assess the long-term population dynamics of questing Rhipicephalus appendiculatus and Rhipicephalus zambeziensis in two landscape zones of the Kruger National Park (KNP. Ticks were collected by dragging the vegetation monthly in three habitats (grassland, woodland and gully at two sites in the KNP (Nhlowa Road and Skukuza from August 1988 to March 2002. Larvae were the most commonly collected stage of both species. More R. appendiculatus were collected at Nhlowa Road than at Skukuza, with larvae being most abundant from May to August, while nymphs were most abundant from August to December. Larvae were most commonly collected in the gullies from 1991 to 1994, but in the grassland and woodland habitats from 1998 onwards. Nymphs were most commonly collected in the grassland and woodland. More R. zambeziensis were collected at Skukuza than at Nhlowa Road, with larvae being most abundant from May to September, while nymphs were most abundant from August to November. Larvae and nymphs were most commonly collected in the woodland and gullies and least commonly in the grassland (p < 0.01. The lowest numbers of R. appendiculatus were collected in the mid-1990s after the 1991/1992 drought. Rhipicephalus zambeziensis numbers declined after 1991 and even further after 1998, dropping to their lowest levels during 2002. The changes in numbers of these two species reflected changes in rainfall and the populations of several of their large herbivore hosts, as well as differences in the relative humidity between the two sites over time.

  9. CRED Ocean Data Platform (ODP), Temperature and Conductivity Recorder (SBE37); NWHI, NEC; Long: -164.71215, Lat: 23.56792 (WGS84); Sensor Depth: 24.90m; Data Range: 20050416-20060903. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  10. Compte rendu de : La vallée électrique,Foëx E. (photographies) et Broennimann T. (textes), 2006, Paris, InFolio éditions, 164 p., 210 photographies en noir et blanc


    Buisson, André


    Réunies sous le titre La vallée électrique, 210 photographies en noir et blanc du photographe Emmanuel Foëx illustrent l’architecture industrielle, l’urbanisme et le paysage dans l’Arc alpin. Comme un ouvrage classique, l’album est divisé en trois parties : La centrale, le réseau, le transformateur. L’auteur est parti de l’évidence qu’à travers l’arc alpin, les sillons des vallées sont constellés d’usines consacrées à la fabrication de l’électricité (La centrale). La montagne, telle un châtea...

  11. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20030714-20030825. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  12. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20050410-20060108. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  13. CRED Sea Surface Temperature (SST) Buoy; NWHI, NEC; Long: -164.69775, Lat: 23.57152 (WGS84); Sensor Depth: 0.33m; Data Range: 20020911-20030713. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  14. O câncer na perspectiva de cuidadores familiares e suas representações sociais doi: 10.12662/2317-3076jhbs.v3i3.159.p159-164.2015

    Directory of Open Access Journals (Sweden)

    Silvio Eder Dias da Silva


    Full Text Available Introdução: O câncer presente no indivíduo pode gerar diversas sensações na família, como medo, angústia e dor. O familiar cuidador em geral não está preparado para assumir tal dever, porém exerce um papel essencial na prática de cuidados ao paciente. Objetivo: A pesquisa objetivou identificar as representações sociais de cuidadores familiares de pacientes com câncer fora de possibilidades terapêuticas; e analisar suas implicações para o cuidado à saúde. Métodos: Trata-se de uma pesquisa descritiva com abordagem qualitativa. Foram entrevistados 30 cuidadores familiares que acompanhavam seus parentes internados na clínica de cuidados paliativos no Hospital Ophir Loyola, em Belém do Pará. Os dados foram obtidos por meio de uma entrevista semiestruturada e associação livre de palavras. Na análise do material, aplicou-se a análise temática. A pesquisa foi submetida ao Comitê de Ética da Escola de Enfermagem “Magalhães Barata” da Universidade do Estado do Pará sob protocolo CAAE–0048.0.321.000.11 de acordo com os preceitos da Resolução nº 196/96/CNS/MS. Resultados: Da análise das entrevistas emergiram quatro temas: Câncer uma doença silenciosa; A prevenção do câncer por exames; O câncer no cotidiano do cuidador; A experiência do familiar com câncer influenciando a maneira do cuidador ver a doença: o cuidado com a saúde. Conclusão: O cuidado ao indivíduo em estado terminal foi apresentado como uma tarefa árdua e exaustiva pelos cuidadores. Logo, a Enfermagem tem papel relevante nessa relação com esses cuidadores, seja na realização de orientações, seja proporcionando-lhes um cuidado mais adequado.

  15. Samia Naïm (dir., Yemen, d’un itinéraire à l’autre. Paris : Maison Neuve et Larose, 2001, 164p. + 16 p. de photos.

    Directory of Open Access Journals (Sweden)

    Catherine Miller


    Full Text Available Voici un petit livre érudit et élégant qui, tel un carnet de voyage savant, choisit de nous faire partager des itinéraires à travers quelques villes yéménites (Sana‘a, Zabîd, Aden, Shihr en partant de descriptions ethnographiques contemporaines, de récits historiques ou littéraires. Le thème central étant la ville parcourue, perçue et décrite dans ses mutations, son quotidien, ses rythmes masculins et féminins, ses évocations littéraires. Quelques objets et plantes hautement symboliques ponc...

  16. Mangrove cover in the Red Sea (1972-2013), supplement to: Almahasheer, Hanan; Aljowair, Abdulaziz; Duarte, Carlos M; Irigoien, Xabier (2016): Decadal Stability of Red Sea Mangroves. Estuarine, Coastal and Shelf Science, 169, 164-172

    KAUST Repository

    Almahasheer, Hanan


    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 km**2 along the African shore and 51 km**2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29%/y. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  17. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); NWHI, NEC; Long: -164.71215, Lat: 23.56792 (WGS84); Sensor Depth: 24.90m; Data Range: 20050411-20060903. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  18. Aurélien Bernier, 2008, Le climat otage de la finance ou comment le marché boursicote avec les droits à polluer, Essai, Mille et une nuits, Paris, 164 p.

    Directory of Open Access Journals (Sweden)

    Béatrice Quenault


    Full Text Available Dans cet essai, au titre provocateur « Le climat otage de la finance ou comment le marché boursicote avec les droits à polluer », l’auteur, Aurélien Bernier, ancien membre d’Attac France et chargé de mission dans le domaine de l’environnement, décrypte le fonctionnement d’un nouveau compartiment de la finance internationale, la « finance carbone » constituée d’un ensemble de marchés où s’échangent les permis d’émission négociables ou les unités de réduction d’émissions, communément appelés « ...

  19. Reply to ‘Comment on ‘To stack or not to stack: Performance of a new density functional for the uracil and thymine dimers’ [Chem. Phys. Lett. 459 (2008) 164]’ (United States)

    Gu, Jiande; Wang, Jing; Leszczynski, Jerzy; Xie, Yaoming; Schaefer, Henry F., III


    In this Letter, we want to address that the conclusions of the letter by Gu et al. have been misunderstood by Mourik in the comment. In our Letter (CPLETT-08-419R1), the good performance of the new functional M06-2X is concluded based on the comparison with the results based on the CCSD(T) studies. Also, we confirm here our previous assumption related to the nature of the stationary points on the MP2 potential energy surface.

  20. Udvikling af materialer til brintpermeable membraner

    DEFF Research Database (Denmark)

    Bentzer, Henrik Karnøe

    Due to global warming as well as other factors, it is necessary to find alternatives to the current consumption of fossil fuels. Oxide materials with high protonic conductivity can potentially find application within many different technological fields in a society that is based on renewable energy...... doped samarium titanate, lanthanum magnesium titanate and strontium cerate doped with yttrium and nickel. Concentration cell measurements were used to estimate transport numbers for protons and oxide ions in yttrium doped strontium cerate and calcium doped samarium titanate. Furthermore, the voltage...

  1. {6,6′-Dimethoxy-2,2′-[ethane-1,2-diylbis(nitrilomethylidyne]diphenolato-1κ4O1,O1′,O6,O6′:2κ4O1,N,N′,O1′}(ethanol-1κO-μ-nitrato-1:2κ2O:O′-dinitrato-1κ4O,O′-samarium(IIIzinc(II

    Directory of Open Access Journals (Sweden)

    Qiang Huang


    Full Text Available In the title heteronuclear ZnII–SmIII complex, [SmZn(C18H18N2O4(NO33(CH3CH2OH], with the hexadentate Schiff base compartmental ligand N,N′-bis(3-methoxysalicylideneethylenediamine (H2L, the SmIII and ZnII ions are triply bridged by two phenolate O atoms from the Schiff base ligand and one nitrate anion. The five-coordinate ZnII ion is in a square-pyramidal geometry formed by the donor centers of two imine N atoms, two phenolate O atoms and one of the bridging nitrate O atoms. The SmIII center is in a ten-fold coordination of O atoms, involving the phenolate O atoms, two methoxy O atoms, one ethanol O atom, and two O atoms from two nitrate anions and one from the bridging nitrate anion. In the crystal, intermolecular O—H...O and C—H...O interactions generate a layer structure extending parallel to (101.

  2. Performance Characterization of a Novel Plasma Thruster to Provide a Revolutionary Operationally Responsive Space Capability with Micro- and Nano-Satellites (United States)


    Einstein Spontaneous Emission Rate Coefficient Electrical Utilization Efficiency Electron Electron Density...0.135 Tesla samarium cobalt (SmCo) permanent magnet from Electron Energy Corp. in Landisville, PA. Encapsulating the assembly is a simple aluminum...unlike some well-developed technologies, such as solid fueled rocket motors , an electric propulsion system could simultaneously contribute to all three

  3. Xe-135 and Sm-149 Isotopic Evolution Analysis Xesamo code; Analisis de la Evolucion Isotopica del Xe-135 y Sm-149. Programa Xesamo

    Energy Technology Data Exchange (ETDEWEB)

    Caro, R.; Gallego, J.; Martinez Fanegas, R.


    In this report the time evolution analysis of the nuclides concentration Xe-135 and Sm-149 as a function of the neutron flux is carried out. The neutron flux may be any function of time. It is analyzed as well the reactivity changes associated with the xenon and samarium concentration variations. (Author) 5 refs.

  4. Thermoluminescence characteristics of Sm doped NaYF4 crystals

    Indian Academy of Sciences (India)


    Jun 28, 2006 ... temperature peaks also vary in relation to the Sm3+ con- centration in NaYF4. This indicates a probable change in the trap structure of NaYF4 with the doping concentration of samarium impurity. This observation is in conformity with the earlier studies (Narasimha Reddy et al 1987;. Gopal Reddy et al 1988; ...

  5. Multiplet effects in the electronic structure of light rare-earth metals

    NARCIS (Netherlands)

    Lebegue, S.; Svane, A.; Katsnelson, M.I.; Lichtenstein, A.I.; Eriksson, O.


    The excited-state properties of the light rare-earth elemental metals praseodymium, neodymium, and samarium are studied within the Hubbard-I formalism. This method describes the multiplets of the rare-earth f shell by an exact diagonalization of the two-body part of the Hamiltonian. Subsequently,

  6. Structural, dielectric and electrical properties of Sm-modified Pb ...

    Indian Academy of Sciences (India)

    It is observed that. the dielectric permittivity () and loss tangent (tan ) are dependent on frequency,; the temperature of dielectric permittivity maximum shifts toward lower temperature side with the increase of samarium ion (Sm+3) concentration at the Pb sites, and; observed and calculated -values of XRD patterns show ...

  7. Ironless-armature brushless motor (United States)

    Fisher, R. L.


    Device uses 12-pole samarium cobalt permanent-magnet rotor and three Hall-effect sensors for commutation. In prototype motor, torque constant (3-phase delta) is 65 oz-in/amp; electrical time constant (L/R) is 0.2 x 0.001 sec, and armature resistance is 20 ohms.

  8. Measurement of total angular momentum values of high-lying even ...

    Indian Academy of Sciences (India)

    Measurement of total angular momentum values of high-lying even-parity atomic states of samarium by spectrally resolved laser-induced fluorescence technique. A K PULHANI∗, M L SHAH, G P GUPTA and B M SURI. Laser and Plasma Technology Division, Bhabha Atomic Research Centre,. Mumbai 400 085, India.

  9. Measurement of total angular momentum values of high-lying even ...

    Indian Academy of Sciences (India)

    Spectrally resolved laser-induced fluorescence technique was used to uniquely assign total angular momentum () values to high-lying even-parity energy levels of atomic samarium. Unique value assignment was done for seven energy levels in the energy region 34,800–36,200 cm-1 , recently observed and reported in ...

  10. X-Ray studies reveal lanthanide binding sites at the A/B5 interface of E. coli heat labile enterotoxin

    NARCIS (Netherlands)

    Sixma, Titia K.; Terwisscha van Scheltinga, Anke C.; Kalk, Kor H.; Zhou, Kangjing; Wartna, Ellen S.; Hol, Wim G.J.


    The crystal structure determination of heat labile enterotoxin (LT) bound to two different lanthanide ions, erbium and samarium, revealed two distinct ion binding sites in the interface of the A subunit and the B pentamer of the toxin. One of the interface sites is conserved in the very similar


    NARCIS (Netherlands)



    The crystal structure determination of heat labile enterotoxin (LT) bound to two different lanthanide ions, erbium and samarium, revealed two distinct ion binding sites in the interface of the A subunit and the B pentamer of the toxin. One of the interface sites is conserved in the very similar

  12. Author Details

    African Journals Online (AJOL)

    Prasad, T.N.V.K.. Vol 12, No 2 (2003) - Articles Pyroelectric Ferroelectric and Resistivity Studies on Samarium Modified Barium Strontium Sodium Niobate Ceramics Abstract. ISSN: 1019-1593. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL ...

  13. Thermoluminescent coactivated rare earth oxyhalide phosphors and X-ray image converters utilizing said phosphors

    Energy Technology Data Exchange (ETDEWEB)

    Rabatin, J.G.


    Oxyhalides of lanthanum, gadolinium and lutetium coactivated with a first activator selected from bismuth and samarium to provide the color of light emission and a second coactivator which increases the amount of stored energy in a stored radiographic latent image are found to be superior in their conversion efficiency of x-rays to visible light.

  14. Interactions between exogenous rare earth elements and phosphorus leaching in packed soil columns (United States)

    Rare earth elements (REEs) increasingly used in agriculture as an amendment for crop growth may help to lessen environmental losses of phosphorus (P) from heavily fertilized soils. The vertical transport characteristics of P and REEs, lanthanum (La), neodymium (Nd), samarium (Sm), and cerium (Ce), w...

  15. Simplified syntheses of the water-soluble chiral shift reagents Sm-(R)-pdta and Sm-(S)-pdta

    Czech Academy of Sciences Publication Activity Database

    Hrubá, L.; Buděšínský, Miloš; Pícha, Jan; Jiráček, Jiří; Vaněk, Václav


    Roč. 54, č. 47 (2013), s. 6296-6297 ISSN 0040-4039 Institutional support: RVO:61388963 Keywords : NMR * chiral shift reagents * Sm-pdta * PDTA * samarium * 1,2-diaminopropane Subject RIV: CC - Organic Chemistry Impact factor: 2.391, year: 2013

  16. Perovskite catalysts for oxidative coupling (United States)

    Campbell, Kenneth D.


    Perovskites of the structure A.sub.2 B.sub.2 C.sub.3 O.sub.10 are useful as catalysts for the oxidative coupling of lower alkane to heavier hydrocarbons. A is alkali metal; B is lanthanide or lanthanum, cerium, neodymium, samarium, praseodymium, gadolinium or dysprosium; and C is titanium.

  17. Lanthanide(III) complexes with tridentate Schiff base ligand ...

    African Journals Online (AJOL)

    The tridentate N4-type Schiff base was synthesized from the condensation reaction of 2-hydrazinopyridine and pyridine-2-carbaldehyde. Neodymium and Samarium complexes were isolated when the corresponding nitrate salt was added to the solution of the ligand. The isolated compounds were characterized by ...

  18. Author Details

    African Journals Online (AJOL)

    T. Chen, W. Vol 31, No 3 (2017) - Articles A novel samarium complex with interesting photoluminescence and semiconductive properties. Abstract PDF. ISSN: 1726-801X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms ...

  19. The effect of rare-earth filtration on organ doses in intraoral radiography

    Energy Technology Data Exchange (ETDEWEB)

    Asako, Satoshi; Satoh, Kenji; Furumoto, Keiichi (Nippon Dental Univ., Tokyo (Japan))


    Filters of rare-earth elements such as lanthanum (La, Z=57), samarium (Sm, Z=62), gadolinium (Gd, Z=64) and erbium (Er, Z=68) are frequently used in radiography for the purpose of reducing the patient dose by eliminating low-energy and high-energy X-rays which are not involved in imaging. It is useful to evaluate the dose reduction achieved by these rare-earth filters in terms of organ dose, and the effective dose equivalent, which is used for evaluating carcinogenic risks and hereditary effects of X-ray irradiation, for the purpose of optimizing the radiographic technique and radiation protection. Therefore, we calculated the organ dose and effective dose equivalent during intraoral radiography of the maxillary incisor region by simulation using samarium or erbium, typical rare-earth elements, in filtration. We evaluated the effects of these metals in dose reduction. When samarium or erbium, 0.1 mm thick, was used in added filtration at tube voltage of 60, 70, 80 and 90 kV, the time required for radiography almost doubled, respectively. The organ dose at each tube voltage was the largest in the parathyroid and thyroid glands, followed by bone surfaces and the optic lenses, skin, red bone marrow and salivary glands, larynx, and brain, in that order. The organ dose at sites other than the larynx and brain decreased as the quality of the incident X-ray beam was hardened. When samarium or erbium was added at each voltage, the effective dose equivalent was reduced by about 20% to 45%. Erbium was more effective than samarium in reducing the effective dose equivalent, and either of the two elements decreased its effectiveness with an increase in tube voltage. (author) 43 refs.

  20. ORF Alignment: NC_006449 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. ORF Alignment: NC_005296 [GENIUS II[Archive

    Lifescience Database Archive (English)


  3. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)


  4. Acute and Short-Term Inhalation Toxicity Study of FT Fuel (United States)


    diameter ( MMAD ) of 2.7 µm with a geometric standard deviation (GSD) of 1.6. The aerosol was respirable, and well within the target range of 1 to 4 µm MMAD ...114 1.32 1.64 158 1.32 1.64 169 1.32 1.64 211 1.33 1.64 222 1.32 1.64 Average 1.31 1.64 SD 0.02 0.00 MMAD 2.7 GSD 1.6 Notes: GSD...geometric standard deviation; min = minutes; MMAD = mass median aerodynamic diameter; SD=standard deviation; MMAD was calculated from the geometric

  5. Phase equilibria in a ternary fullerenol-d(C60(OH)22-24)-SmCl3-H2O system at 25°C (United States)

    Yur'ev, G. O.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.


    The solubility in a ternary fullerenol-d (C60(OH)22-24)-SmCl3-H2O system at 25°C is studied via isothermal saturation in ampules. The solubility diagram is shown to be a simple eutonic one that consists of two branches corresponding to the crystallization of fullerenol-d (C60(OH)22-24 · 30H2O) and samarium(III) chloride SmCl3 · 6H2O crystallohydrates and contains one nonvariant eutonic point corresponding to saturation with both crystallohydrates. The long branch of C60(OH)22-24 · 30H2O crystallization shows the effect of fullerenol-d salting out of saturated solutions; in contrast, the short branch of SmCl3 · 6H2O crystallization shows the pronounced salting-in effect of samarium(III) chloride.

  6. Alkaline and alkaline earth metal phosphate halides and phosphors (United States)

    Lyons, Robert Joseph; Setlur, Anant Achyut; Cleaver, Robert John


    Compounds, phosphor materials and apparatus related to nacaphite family of materials are presented. Potassium and rubidium based nacaphite family compounds and phosphors designed by doping divalent rare earth elements in the sites of alkaline earth metals in the nacaphite material families are descried. An apparatus comprising the phosphors based on the nacaphite family materials are presented herein. The compounds presented is of formula A.sub.2B.sub.1-yR.sub.yPO.sub.4X where the elements A, B, R, X and suffix y are defined such that A is potassium, rubidium, or a combination of potassium and rubidium and B is calcium, strontium, barium, or a combination of any of calcium, strontium and barium. X is fluorine, chlorine, or a combination of fluorine and chlorine, R is europium, samarium, ytterbium, or a combination of any of europium, samarium, and ytterbium, and y ranges from 0 to about 0.1.

  7. Reductive trapping of [(OC){sub 5}W-W(CO){sub 5}]{sup 2-} in a mixed-valent Sm{sup II/III} calix[4]pyrrolide sandwich

    Energy Technology Data Exchange (ETDEWEB)

    Deacon, Glen B.; Guo, Zhifang [School of Chemistry, Monash University, VIC (Australia); Junk, Peter C.; Wang, Jun [College of Science and Engineering, James Cook University, Townsville, QLD (Australia)


    Reduction of tungsten hexacarbonyl by the divalent samarium(II) complex [Sm{sub 2}(N{sub 4}Et{sub 8})(thf){sub 4}] ((N{sub 4}Et{sub 8}){sup 4-}=meso-octaethylcalix[4]pyrrolide) in toluene at ambient temperature gave the remarkable heteronuclear mixed-valent samarium(II/III)/tungsten complex [{(thf)_2Sm"I"I(N_4Et_8)Sm"I"I"I(thf)}{sub 2}{(μ-OC)_2W_2(CO)_8}], which features the trapping of a rare [W{sub 2}(CO){sub 10}]{sup 2-} anion with an unsupported W-W bond. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Preparation and dosimetry of radiotherapeutic particles for arthropaties; Preparacion y dosimetria de particulas radioterapeuticas para artropatias

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Z, M.A. [Departamento de Medicina Nuclear, Instituto Nacional de Pediatria (Mexico); Ferro F, G. [Departamento de Materiales Radiactivos, Instituto nacional de Investigaciones Nucleares, Salazar, Estado de Mexico C.P. 52045 (Mexico); Rivera M, T.; Azorin N, J. [Departamento de Fisica, UAM Iztapalapa, Mexico D.F. (Mexico)


    It was developed a new formulation of macro aggregates of Samarium 153 ({sup 153} Sm-MH) for the arthropaties treatment. The radio pharmaceutic was prepared by reaction of Samarium 153 chloride (SmCl{sub 3}) in aqueous environment with sodium boron hydride in NaOH 0.5 N. The microscopic analysis shown that the particles have an average size of 4% m (range 1-14 {mu} m). The velocity of sedimentation was 0.008 cm/min with high stability in vitro in human serum. The biological studies in healthy rabbits, shown that the complex is retained inside the articulation still eight days after of the administration of the radiopharmaceutical. Likewise, it is presented the data of absorbed dose in the different target organs, which was determined by thermoluminescent dosimetry (TLD) through the use of a REMCAL phantom (radiation equivalent manikin calibration). (Author)

  9. Ion-exchange separation of the rare earth elements by means of solution of ammonium phthalate and chloride

    Energy Technology Data Exchange (ETDEWEB)

    Hubicki, W.; Ozga, W. (Uniwersytet Marii Curie-Sklodowskiej, Lublin (Poland))


    A new method of ion exchange separation of lanthanons by the use of equimolar solution of ammonium phthalate and ammonium chloride as an eluent was elaborated. This method allows to separate light lanthanons and to obtain concentrate of samarium and heavy lanthanons. 99.99% Y/sub 2/O/sub 3/ was obtained from non-neodymium concentration with 47.4% efficiency. The influence of change in concentration and pH of eluent on the effectiveness of separation was examined. It was found that an increase in concentration of eluent and pH leads to quick separation of yttrium from samarium and heavy lanthanons. However, the efficiency of pure Y/sub 2/O/sub 3/ decreases distinctly.

  10. Large directional optical anisotropy in multiferroic ferroborate (United States)

    Kuzmenko, A. M.; Dziom, V.; Shuvaev, A.; Pimenov, Anna; Schiebl, M.; Mukhin, A. A.; Ivanov, V. Yu.; Gudim, I. A.; Bezmaternykh, L. N.; Pimenov, A.


    One of the most fascinating and counterintuitive recent effects in multiferroics is directional anisotropy, the asymmetry of light propagation with respect to the direction of propagation. In such case the absorption in a material can be different for opposite directions. Besides absorption, different velocities of light for different directions of propagation may be also expected, which is termed directional birefringence. In this work, we demonstrate large directional anisotropy in multiferroic samarium ferroborate. The effect is observed for linear polarization of light in the range of millimeter wavelengths, and it survives down to low frequencies. The dispersion and absorption close to the electromagnon resonance can be controlled by external magnetic field and are fully suppressed in one direction. By changing the geometry of the external field, samarium ferroborate shows giant optical activity, which makes this material a universal tool for optical control: with a magnetic field as an external parameter it allows switching between two functionalities: polarization rotation and directional anisotropy.

  11. Ionic liquid technology for recovery and separation of rare earths


    Binnemans, Koen


    End-of-life neodymium-iron-boron and samarium-cobalt permanent magnets, fluorescent lamps and metal hydride batteries are valuable secondary resources of rare earths. These resources are characterised by relatively small volumes, but high concentrations of rare earths [1]. On the other hand, industrial process residues such as bauxite residue (red mud) and phosphogypsum contain low concentrations of rare earths, but are available in huge volumes [2]. Recovery of rare earths from end-of-life c...

  12. Ternary rare earth-lanthanide sulfides (United States)

    Takeshita, Takuo; Gschneidner, Jr., Karl A.; Beaudry, Bernard J.


    A new ternary rare earth sulfur compound having the formula: La.sub.3-x M.sub.x S.sub.4 where M is a rare earth element selected from the group europium, samarium and ytterbium and x=0.15 to 0.8. The compound has good high-temperature thermoelectric properties and exhibits long-term structural stability up to C.

  13. Structural and physical properties of Sm doped magnesium zinc ...

    Indian Academy of Sciences (India)


    Sep 22, 2017 ... Abstract. Samarium (Sm3+) doped magnesium zinc sulfophosphate glass system of composition (60–x)P2O5–20MgO–. 20ZnSO4–xSm2O3 (x = 0.0, 0.5, 1.0, 1.5 and 2.0 mol%) were synthesized using melt-quenching technique. The structure and physical properties of prepared glass samples were ...

  14. Structural aspects of displacive transformations: what can optical microscopy contribute? Dehydration of Sm2(C2O4)3·10H2O as a case study. (United States)

    Matvienko, Alexander A; Maslennikov, Daniel V; Zakharov, Boris A; Sidelnikov, Anatoly A; Chizhik, Stanislav A; Boldyreva, Elena V


    For martensitic transformations the macroscopic crystal strain is directly related to the corresponding structural rearrangement at the microscopic level. In situ optical microscopy observations of the interface migration and the change in crystal shape during a displacive single crystal to single crystal transformation can contribute significantly to understanding the mechanism of the process at the atomic scale. This is illustrated for the dehydration of samarium oxalate decahydrate in a study combining optical microscopy and single-crystal X-ray diffraction.

  15. The growth and reactivity of the {Sm}/{Si(100)} interface (United States)

    Onsgaard, J.; Christiansen, M.; Ørskov, F.; Godowski, P. J.


    The growth of the {Sm}/{Si(100)} interface is described and discussed in the context of the increasing experimental insight into lanthanide/semiconductor interfaces. Silicide formation takes place in the 1 to 5 monolayers coverage region. Different ordered structures, dependent on the initial coverage and temperature treatment, are observed. Oxygen adsorption and binding is strongly promoted, both when Sm is present at the surface and when oxygen reacts with a samarium-suicide film.

  16. Installation of electric generators on turbine engines (United States)

    Demel, H. F.


    The installation of generators on turbine aircraft is discussed. Emphasis is placed on the use of the samarium cobalt generator. Potential advantages of an electric secondary power system at the engine level are listed. The integrated generator and the externally mounted generator are discussed. It is concluded that the integrated generator is best used in turbojet and low bypass ratio engines where there is no easy way of placing generators externally without influencing frontal areas.

  17. Fabrication of Material and Devices for Very High Density Information Storage. (United States)


    crystal bismuth doped garnets , having properties equivalent to IPE grown materials,,’., onto gadolinium gallium garnet substrates. There was speculation... LPE onto0 (111)-.""’’ oriented calcium-, magnesium- or zirconium-substituted gadolinium, samarium or neodymium gallium /’’’ garnet substrates. Garnet of LPE garnetmusesit favor garnets a s a t arting poiut. ref og Vmagnetic and m g e-optical po et s o a- , pae d m u , alu inu-%, li

  18. Macrocyclic aminophosphonic acid complexes, their preparation, formulations and use; Fremgangsmaate for fremstilling av et makrocyklisk aminofosfonsyrekompleks eller et fysiologisk akseptabelt salt derav

    Energy Technology Data Exchange (ETDEWEB)

    Simon, J.; Wilson, D.A.; Garlich, J.R.; Troutner, D.E.


    Particle emitting radionuclides, e.g. Samarium-153, have been complexed with certain macrocyclic aminophosphonic acids wherein the nitrogen and phosphorus are interconnected by an alkylene group or substituted alkylene group. A composition is now disclosed which comprises a complex having a macrocyclic aminophosphonic acid, containing 1,4,7,10-tetraazycyclododecane as the macrocyclic moiety, or a physiologically, acceptable salt thereof, wherein the nitrogen and phosphorus are interconnected by an alkylene or substituted alkylene radical. 10 tabs.

  19. Effect of Flake Thickness on Coercivity of Nanocrystalline SmCo5 Bulk Prepared from Anisotropic Nanoflake Powder (Postprint) (United States)


    flake thickness. 15. SUBJECT TERMS rare earth magnets , samarium cobalt magnets , permanent magnets 16. SECURITY CLASSIFICATION OF: 17...nanoflakes have attractive magnetic properties ; coercivity of up to 21 kOe and maximum energy product of up to 22 MGOe.9 Thus, the nanoflake powders...less reported on correlation between nanoflake morphology and final properties of the SmCo5 bulk magnets . In this study, we prepared SmCo5 nanoflakes

  20. Cross sections of deuteron induced reactions on $^{nat}$Sm for production of the therapeutic radionuclide $^{145}$Sm and $^{153}$Sm


    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.


    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them $^{145}$Sm and $^{153}$Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the $^{nat}$Sm(d,x)$^{145153}$Sm reactions were determined for deuteron energies up to 50 MeV using the st...

  1. ORF Alignment: NC_002936 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. PDB: CBRC-MMUR-01-1549 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MMUR-01-1549 1HLL,1HO9,1HOD,1HOF, Region:133-164(Identity=100%) PDB:1HLL Chain:A (NMR...),Region:133-164(Identity=100%) PDB:1HO9 Chain:A (NMR),Region:133-164(Identity=100%) PDB:1HOD Chain:A (NMR),Region:133-164(Identity=100%) PDB:1HOF Chain:A (NMR), ...

  3. 40 CFR 161.290 - Environmental fate data requirements. (United States)


    ... adsorption/desorption R R R R R TGAI or PAIRA TGAI or PAIRA 163-1 Volatility: (Lab) (2) CR CR CR TEP TEP 163-2 (Field) (2) CR CR CR TEP TEP 163-3 Dissipation studies-field Soil R R R TEP TEP 164-1 Aquatic (sediment) R R TEP TEP 164-2 Forestry R TEP TEP 164-3 Combination and tank mixes (2) 164-4 Soil, long-term...

  4. ORF Alignment: NC_005823 [GENIUS II[Archive

    Lifescience Database Archive (English)


  5. A statistical analysis of the initial biodistribution of {sup 153}Sm-EDTMP in a canine

    Energy Technology Data Exchange (ETDEWEB)

    Galiano, Eduardo [Department of Physics, Laurentian University, Ramsey Lake Road, Sudbury, Ont., P3E 2C6 (Canada)]. E-mail:; Stradiotto, Marco [Department of Physics, Laurentian University, Ramsey Lake Road, Sudbury, Ont., P3E 2C6 (Canada)


    {sup 153}Sm (t{sub 1/2}=46h) emits a 103keV gamma photon and two medium-energy beta particles. Five mCi of Samarium-153 ethylenediaminetetramethylenephosphonic acid ({sup 153}Sm-EDTMP) were administered to a clinically normal dog and whole body scans were obtained at 15min, 2h, and 24h post-injection (PI). Regions of interest (ROIs) were drawn representing abdomen, knee, rib, vertebral bodies, bladder, kidney, and liver, in each image. For each ROI, the mean intensity and standard deviation were computed, and a histogram was created. Clinically significant increased uptakes were found in liver and kidney.

  6. Coprecipitation experiment with Sm hydroxide using a multitracer produced by nuclear spallation reaction: A tool for chemical studies with superheavy elements. (United States)

    Kasamatsu, Yoshitaka; Yokokita, Takuya; Toyomura, Keigo; Shigekawa, Yudai; Haba, Hiromitsu; Kanaya, Jumpei; Huang, Minghui; Ezaki, Yutaka; Yoshimura, Takashi; Morita, Kosuke; Shinohara, Atsushi


    To establish a new methodology for superheavy element chemistry, the coprecipitation behaviors of 34 elements with samarium hydroxide were investigated using multitracer produced by a spallation of Ta. The chemical reactions were rapidly equilibrated within 10s for many elements. In addition, these elements exhibited individual coprecipitation behaviors, and the behaviors were qualitatively related to their hydroxide precipitation behaviors. It was demonstrated that the ammine and hydroxide complex formations of superheavy elements could be investigated using the established method. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Radiological response of lanthanum guiding seeds in brachytherapy implants; Resposta radiologica de sementes guia de lantanio em implantes braquiterapicos

    Energy Technology Data Exchange (ETDEWEB)

    Silva, L.S.R.; Machado, E.D.P., E-mail: [Centro Federal de Educacao Tecnologica de Minas Gerais, Belo Horizonte, MG (Brazil). Departamento de Engenharia de Materiais; Campos, T.P.R. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Roberto, W.S. [Centro Federal de Educacao Tecnologica de Minas Gerais, Belo Horizonte, MG (Brazil). Departamento de Fisica e Matematica


    Ceramic seeds with La-139 incorporated were synthesized to be used as radiological guides in brachytherapy implants. The synthesis was performed based on the sol-gel method. The seeds were subjected to characterization by Scanning Electron Microscopy, X-ray diffraction and Energy-Dispersive X-ray Spectroscopy. Furthermore, the contrast from a radiographic film was evaluated to lanthanum, samarium and holmium seeds. Radiological response on a phantom at different depths with lanthanum seeds and metal seeds was also investigated. Based on the values of contrast, the synthesized lanthanum seeds can be considered efficient as radiological guides when implanted together with pure Ho-165 and Sm-152 seeds. (author)

  8. Understanding the photoluminescence characteristics of Eu{sup 3+}-doped double-perovskite by electronic structure calculation

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Binita [St. Paul’s Cathedral Mission College, 33/1Raja Rammohan Roy Road, Kolkata 700009 (India); Halder, Saswata; Sinha, T. P. [Department of Physics, Bose Institute, 93/1 Acharya Prafulla Chandra Road, Kolkata 700009 (India); Das, Sayantani [Department of Physics, University of Calcutta, 92 Acharya Prafulla Chandra Road, Kolkata 700009 (India)


    Europium-doped luminescent barium samarium tantalum oxide Ba{sub 2}SmTaO{sub 6} (BST) has been investigated by first-principles calculation, and the crystal structure, electronic structure, and optical properties of pure BST and Eu-doped BST have been examined and compared. Based on the calculated results, the luminescence properties and mechanism of Eu-doped BST has been discussed. In the case of Eu-doped BST, there is an impurity energy band at the Fermi level, which is formed by seven spin up energy levels of Eu and act as the luminescent centre, which is evident from the band structure calculations.

  9. Geochronology and structuring of the Ceara State: Borborema Province northwestern part, NE Brazil; Geocronologia e estruturacao do estado do Ceara: NW da provincia Borborema, NE, Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Fetter, A.; Van Schmus, W.R. [Kansas Univ., Lawrence, KS (United States). Dept. of Geology; Santos, Ticiano J. Saraiva dos [UNESP, Rio Claro, SP (Brazil). Inst. de Geociencias e Ciencias Exatas; Arthaud, M.; Nogueira Neto, J. [Ceara Univ., Fortaleza, CE (Brazil). Dept. de Geologia


    The work confirms that the geochronological new data U/Pb in zircon and Samarium/Neodymium from the Ceara State furnished a refined chronology of the geological activity in the NW part of the Borborema Province, indicating an evolutive history since 2,78 Ga and 532 Ma. Furthermore, these data facilitated the different crust domain outlines in the region, putting age maximum limits in the pre-brasilianas supracrusts rocks deposition, and evidencing the epoch and duration of the Brasiliano magmatism and metamorphism in the northwest part of the State

  10. Structural aspects of displacive transformations: what can optical microscopy contribute? Dehydration of Sm2(C2O43·10H2O as a case study

    Directory of Open Access Journals (Sweden)

    Alexander A. Matvienko


    Full Text Available For martensitic transformations the macroscopic crystal strain is directly related to the corresponding structural rearrangement at the microscopic level. In situ optical microscopy observations of the interface migration and the change in crystal shape during a displacive single crystal to single crystal transformation can contribute significantly to understanding the mechanism of the process at the atomic scale. This is illustrated for the dehydration of samarium oxalate decahydrate in a study combining optical microscopy and single-crystal X-ray diffraction.

  11. Synthesis and application of a new fluorous-tagged ammonia equivalent

    DEFF Research Database (Denmark)

    Nielsen, Simon Dalsgaard; Smith, Garrick; Begtrup, Mikael


    A novel fluorous-tagged ammonia equivalent has been developed. It is based on a nitrogen-oxygen bond, which can be cleaved in a traceless manner by a molybdenum complex or samarium diiodide. The application in the synthesis of ureas, amides, sulfonamides, and carbamates is described. The scope of...... of the fluorous N--O linker is exemplified by the synthesis of itopride, a drug used for the treatment of functional dyspepsia. Itopride was synthesized with the aid of fluorous purification methods and the product was isolated in good overall yield, with high purity....

  12. Synthesis and application of a new fluorous-tagged ammonia equivalent. (United States)

    Nielsen, Simon D; Smith, Garrick; Begtrup, Mikael; Kristensen, Jesper L


    A novel fluorous-tagged ammonia equivalent has been developed. It is based on a nitrogen-oxygen bond, which can be cleaved in a traceless manner by a molybdenum complex or samarium diiodide. The application in the synthesis of ureas, amides, sulfonamides, and carbamates is described. The scope of the fluorous N-O linker is exemplified by the synthesis of itopride, a drug used for the treatment of functional dyspepsia. Itopride was synthesized with the aid of fluorous purification methods and the product was isolated in good overall yield, with high purity. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Jaderné kolektivní stupně volnosti a Skyrme funkcionál


    Božík, Daniel


    Title: Energy functional theories in nuclear physics Author: Daniel Božík Department: Institute of Particle and Nuclear Physics of Charles University Supervisor: prof. RNDr. Jan Kvasil, DrSc. Supervisor's e-mail address: Abstract: In the present work we study the giant resonances of the chain of even-even samarium nuclei 144−154 Sm. The numerical calculations are provided by a chain of numer- ical codes. Mean field is calculated by the HFB method for the Skyrme d...

  14. Geochronology Intermediary Laboratory implantation at the Rio Grande do Norte Federal University: the dating of the Serrinha Granitoid (RN) and the correlate Brasiliana extensional deformation; Implantacao do Laboratorio Intermediario de Geocronologia na UFRN: a datacao do granitoide de Serrinha (RN) e da deformacao extensional brasiliana correlata

    Energy Technology Data Exchange (ETDEWEB)

    Macedo, Maria Helena F.; Sa, Emanuel F. Jardim de; Souza, Zorano S. [Pernambuco Univ., Recife, PE (Brazil). Nucleo de Pesquisa em Geodinamica e Geofisica; Mendes, Franklin S. [Pernambuco Univ., Recife, PE (Brazil). Curso de Quimica; Ramalho, Karlos A.C. [Pernambuco Univ., Recife, PE (Brazil). Curso de Geologia


    The article describes the activities developed by the Geochronology Intermediary Laboratory at the Federal University of the Rio Grande do Norte, a Brazilian university, where there were the preoccupation of establishing strategies for a geochronological development. It relates the Rubidium-Strontium (Rb/Sr) and Samarium-Neodymium (Sm/Nd) methods, describing the analysis realized in these methodologies. Afterward, it presents the geological and petrographic situation of the Granitoide de Serrinha, located at Rio Grande do Norte State, Brazil and its geochronological data 8 refs., 2 figs.

  15. ACR-ASTRO practice guideline for the performance of therapy with unsealed radiopharmaceutical sources. (United States)

    Henkin, Robert E; Del Rowe, John D; Grigsby, Perry W; Hartford, Alan C; Jadvar, Hossein; Macklis, Roger M; Parker, J Anthony; Wong, Jeffrey Y C; Rosenthal, Seth A


    This guideline is intended to guide appropriately trained and licensed physicians performing therapy with unsealed radiopharmaceutical sources. Adherence to this guideline should help to maximize the efficacious use of these procedures, maintain safe conditions, and ensure compliance with applicable regulations. The topics dealt with in this guideline include indications for the use of iodine-131, both for the treatment of hyperthyroidism and thyroid carcinoma. In addition, indications for other less common procedures include those for the use of phosphorous-32 in its liquid and colloidal forms, strontium-89, samarium-153, and the use of Y-90 antibodies.

  16. Accumulation of rare earth elements by siderophore-forming Arthrobacter luteolus isolated from rare earth environment of Chavara, India. (United States)

    Emmanuel, E S Challaraj; Ananthi, T; Anandkumar, B; Maruthamuthu, S


    In this study, Arthrobacter luteolus, isolated from rare earth environment of Chavara (Quilon district, Kerala, India), were found to produce catechol-type siderophores. The bacterial strain accumulated rare earth elements such as samarium and scandium. The siderophores may play a role in the accumulation of rare earth elements. Catecholate siderophore and low-molecular-weight organic acids were found to be present in experiments with Arthrobacter luteolus. The influence of siderophore on the accumulation of rare earth elements by bacteria has been extensively discussed.

  17. Synthesis of 2-(9,10-Dihydro-9,10-propanoanthracen-9-yl-N-methylethanamine via a [4+2] Cycloaddition

    Directory of Open Access Journals (Sweden)

    Usama Karama


    Full Text Available The synthesis of the tetracyclic molecule 2-(9,10-dihydro-9,10-propano-anthracen-9-yl-N-methylethanamine(2as a homologue of the antidepressant 1-(9,10-dihydro-9,10-ethanoanthracen-9-yl-N-methylmethaneamine (1 was described. The key intermediate 9-(prop-2-en-1-yl-9,10-dihydro-9,10-propanoanthracen-12-one (7was successfully synthesized via a [4+2] cycloaddition of α-bromoacrolein and 9-allyl-anthracene, followed by ring expansion and samarium diiodide deoxygenation.

  18. Synthesis of 2-(9,10-dihydro-9,10-propanoanthracen-9-yl)-N-methylethanaminevia a [4+2] cycloaddition. (United States)

    Karama, Usama; Al-Saidey, Adel; Al-Othman, Zeid; Almansour, Abdel Rahman


    The synthesis of the tetracyclic molecule 2-(9,10-dihydro-9,10-propano-anthracen-9-yl)-N-methylethanamine (2) as a homologue of the antidepressant 1-(9,10-dihydro-9,10-ethanoanthracen-9-yl)-N-methylmethaneamine (1) was described. The key intermediate 9-(prop-2-en-1-yl)-9,10-dihydro-9,10-propanoanthracen-12-one (7) was successfully synthesized via a [4+2] cycloaddition of alpha-bromoacrolein and 9-allyl-anthracene, followed by ring expansion and samarium diiodide deoxygenation.


    Directory of Open Access Journals (Sweden)

    Sergiy Smola


    Full Text Available Four new heteronuclear lanthanide complexes with general formula [Ge(OH(μ-HDTPALnGe(OH (μ-DTPA] (Ln = Sm – Dy were synthesized and subsequently characterized by different physico- chemical methods. The structures of new compounds have been proposed. In considered complexes the 4f-luminescence of three-charged ions of samarium, europium, terbium and dysprosium is realized at UV-excitation. It is noteworthy that it is the first observation of 4f-luminescence in water solutions of heteronuclear f-p-complexes. The comparison of luminescent characteristics of hetero- and homonuclear landthanide complexes is described and discussed as well.

  20. Die selfverstaan van die Samaritane soos dit uit- drukking vind in die feesliturgie צלות מוצד השמיני

    Directory of Open Access Journals (Sweden)

    J. Beyers


    Full Text Available The self-understanding of the Samaritans, as expressed in the liturgy of the צלות מוצד השמיני festivalThis study is concerned with the identity and religion of the Samaritans. The way in which the Samaritans understood their identity is highlighted by their perception of God, by the traditions they adhered to and by the selection of texts from the Pentateuch they used in their liturgy. The beliefs and rituals of the Samarium faith found their way into the Samaritan Liturgy. The study of a part of the Samaritan Liturgy shows that the Samaritans are heirs to the religion of the northern tibes of Israel.

  1. Development of atomic spectroscopy technology -Development of ultrasensitive spectroscopic analysis technology

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Hyung Kee; Song Kyoo Suk; Kim, Duk Hyun; Hong, Suk Kyung; Lee, Yong Joo; Lee, Jong Hoon; Yang, Kee Hoh [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)


    For the resonance ionization spectroscopy experiment, erbium and samarium were chosen as test elements and their optimum photoionization schemes for trace analysis have been investigated by using multiphoton spectroscopic techniques. With the optimum scheme, the detection limit of various atoms were measured. For the test of laser induced fluorescence system, calibration curves obtained from lead and cadmium standard solutions were made and Pb concentrations of various unknown solutions were determined. By using the developed differential absorption lidar system, backscattering signals from aerosol and ozone have been measured. Error source, error calibration and data interpretation techniques have been also studied. 60 figs, 8 pix, 28 tabs, 30 refs. (Author).

  2. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  3. Giant magneto resistance and temperature coefficient of resistance in Sm0.55Sr0.30Ag0.15MnO3 perovskite


    Bhat, Masroor Ahmad; Zargar, Rayees A.; Modi, Anchit; Arora, Manju; Gaur, N K


    Silver ions substituted samarium strontium manganite (Sm0.55Sr0.30Ag0.15MnO3) pervoskite was synthesized by using respective oxides in stoichiometric ratio through solid state reaction. The as-prepared sample was characterized by various analytical techniques to confirm its formation and understand the effect of monovalent silver ions in pervoskite lattice. X-ray diffraction pattern confirms the single phase formation while grain morphology in SEM image indicates good connectivity among the g...

  4. Functional analysis of promoter variants in the microsomal triglyceride transfer protein (MTTP) gene. (United States)

    Rubin, Diana; Schneider-Muntau, Alexandra; Klapper, Maja; Nitz, Inke; Helwig, Ulf; Fölsch, Ulrich R; Schrezenmeir, Jürgen; Döring, Frank


    The microsomal triglyceride transfer protein (MTTP) is required for the assembly and secretion of apolipoprotein B (apoB)-containing lipoproteins from the intestine and liver. According to this function, polymorphic sites in the MTTP gene showed associations to low-density lipoprotein (LDL) cholesterol and related traits of the metabolic syndrome. Here we studied the functional impact of common MTTP promoter polymorphisms rs1800804:T>C (-164T>C), rs1800803:A>T (-400A>T), and rs1800591:G>T (-493G>T) using gene-reporter assays in intestinal Caco-2 and liver Huh-7 cells. Significant results were obtained in Huh-7 cells. The common MTTP promoter haplotype -164T/-400A/-493G showed about two-fold lower activity than the rare haplotype -164C/-400T/-493T. MTTP promoter mutant constructs -164T/-400A/-493T and -164T/-400T/-493T exhibited similar activity than the common haplotype. Activities of mutants -164C/-400A/-493G and -164C/-400A/-493T resembled the rare MTTP promoter haplotype. Electrophoretic mobility shift assays (EMSAs) revealed higher binding capacity of the transcriptional factor Sterol regulatory element binding protein1a (SREBP1a) to the -164T probe in comparison to the -164C probe. In conclusion, our study indicates that the polymorphism -164T>C mediates different activities of common MTTP promoter haplotypes via SREBP1a. This suggested that the already described SREBP-dependent modulation of MTTP expression by diet is more effective in -164T than in -164C carriers. (c) 2007 Wiley-Liss, Inc.

  5. ORF Alignment: NC_005296 [GENIUS II[Archive

    Lifescience Database Archive (English)


  6. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)


  7. ORF Alignment: NC_006274 [GENIUS II[Archive

    Lifescience Database Archive (English)


  8. Synergistic Effects of Sm and C Co-Doped Mixed Phase Crystalline TiO₂ for Visible Light Photocatalytic Activity. (United States)

    Peng, Fuchang; Gao, Honglin; Zhang, Genlin; Zhu, Zhongqi; Zhang, Jin; Liu, Qingju


    Mixed phase TiO₂ nanoparticles with element doping by Sm and C were prepared via a facile sol-gel procedure. The UV-Vis light-diffuse reflectance spectroscopy analysis showed that the absorption region of co-doped TiO₂ was shifted to the visible-light region, which was attributed to incorporation of samarium and carbon into the TiO₂ lattice during high-temperature reaction. Samarium effectively decreased the anatase-rutile phase transformation. The grain size can be controlled by Sm doping to achieve a large specific surface area useful for the enhancement of photocatalytic activity. The photocatalytic activities under visible light irradiation were evaluated by photocatalytic degradation of methylene blue (MB). The degradation rate of MB over the Sm-C co-doped TiO₂ sample was the best. Additionally, first-order apparent rate constants increased by about 4.3 times compared to that of commercial Degusssa P25 under the same experimental conditions. Using different types of scavengers, the results indicated that the electrons, holes, and •OH radicals are the main active species for the MB degradation. The high visible-light photocatalytic activity was attributed to low recombination of the photo-generated electrons and holes which originated from the synergistic effect of the co-doped ions and the heterostructure.

  9. Molecular electrophosphorescence in (Sm, Gd)-{beta}-diketonate complex blend for OLED applications

    Energy Technology Data Exchange (ETDEWEB)

    Reyes, R., E-mail: [Facultad de Ingenieria Quimica y Textil, Universidad Nacional de Ingenieria, UNI, Av. Tupac Amaru 210, Lima 31, Peru (Peru); Cremona, M. [DIMAT - Divisao de Metrologia de Materiais, Instituto Nacional de Metrologia, Normalizacao e Qualidade Industrial, INMETRO, Duque de Caxias, RJ (Brazil); Departamento de Fisica, Pontificia Universidade Catolica do Rio de Janeiro, PUC-Rio, C.P. 38071, Rio de Janeiro, RJ, CEP 22453-970 (Brazil); Teotonio, E.E.S. [Departamento de Quimica, CCEN, Universidade Federal da Paraiba, UFPB, C.P. 5093, Joao Pessoa, PB, CEP 5805-970 (Brazil); Brito, H.F. [Instituto de Quimica, Universidade de Sao Paulo, USP, C.P. 26077, Sao Paulo, SP, CEP 05599-970 (Brazil); Malta, O.L. [Departamento de Quimica Fundamental, CCEN, Universidade Federal de Pernambuco, Cidade Universitaria, Recife, PE, CEP 50670-901 (Brazil)


    In this work the preparation and characterization of the triple-layer organic light-emitting diode (OLED) using a mixture of the samarium and gadolinium {beta}-diketonate complexes [Sm{sub 0.5}Gd{sub 0.5}(TTA){sub 3}(TPPO){sub 2}] as emitting layer is reported. The OLED's devices contain 1-(3-methylphenyl)-1,2,3,4-tetrahydroquinoline-6-carboxyaldehyde-1, 1'-diphenylhydrazone (MTCD) as hole-transporting layer and tris(8-hydroxyquinoline aluminum) (Alq{sub 3}) as electron transporting layer. The electroluminescence spectrum present emission narrow bands from the {sup 4}G{sub 5/2}{yields}{sup 6}H{sub J} transitions (where J=5/2, 7/2 and 9/2) characteristic of the Sm{sup 3+} ion. These sharp lines are overlapped with a broad band attributed to the electrophosphorescence from the T{sub 1}{yields}S{sub 0} transition in the ligand TTA. The intramolecular energy transfer is discussed and applied on the change of the emission color of the organic LEDs at different bias voltages. - Highlights: Black-Right-Pointing-Pointer Samarium and gadolinium complexes. Black-Right-Pointing-Pointer OLED with complex blend (Sm,Gd). Black-Right-Pointing-Pointer Electrophosphorescence emission detection. Black-Right-Pointing-Pointer Application in OLED changing the color emission.

  10. Spontaneous and stimulated emission in Sm{sup 3+}-doped YAl{sub 3}(BO{sub 3}){sub 4} single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Ryba-Romanowski, Witold [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okólna 2, 50-422 Wrocław (Poland); Lisiecki, Radosław, E-mail: [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okólna 2, 50-422 Wrocław (Poland); Beregi, Elena [Research Institute for Solid State Physics and Optics, Hungarian Academy of Sciences, Budapest (Hungary); Martín, I.R. [Departamento de Física, Instituto de Materiales y Nanotecnología (IMN), Universidad de La Laguna, 38206 S/C de Tenerife, Laguna (Spain)


    Single crystals of YAl{sub 3}(BO{sub 3}){sub 4} doped with trivalent samarium were grown by the top-seeded high temperature solution method and their absorption and emission spectra were investigated. Optical pumping into prominent absorption band around 405 nm feeds the {sup 4}G{sub 5/2} metastable level giving rise to intense visible luminescence distributed in several spectral lines with the most intense line around 600 nm characterized by a branching ratio of 0.42 and peak emission cross section of 0.25×10{sup −20} cm{sup 2}. Optical amplification at 600 nm with a gain coefficient of 2.9 cm{sup −1} was achieved during a pump-and-probe experiment. - Highlights: • YAB:Sm crystal grown by the top-seeded high temperature solution method. • Spectroscopic qualities relevant for visible laser operation. • YAB:Sm single crystal used in a pump-and-probe experiment. • Optical amplification properties of samarium doped YAl{sub 3}(BO{sub 3}){sub 4}.

  11. Synthesis of Sm2(WO4)3 nanocrystals via a statistically optimized route and their photocatalytic behavior (United States)

    Mahdi Pourmortazavi, Seied; Rahimi-Nasrabadi, Mehdi; Aghazadeh, Mustafa; Ganjali, Mohammad Reza; Sadeghpour Karimi, Meisam; Norouzi, Parviz


    The application of a Taguchi approach to the optimization of the precipitation reaction between Sm3+ and {{{{WO}}}{{4}}}2- as a rapid procedure for the preparation of Sm2(WO4)3 nanoparticles as a photocatalyst is evaluated. The effect of the prominent operating factors on the product are evaluated so as to yield the best synthesis conditions, leading to the finest product particles of the desired morphologies, which can turn the rather primitive precipitation reaction into a powerful tool for the preparation of nanostructured crystals of insoluble salts. The effects of the alteration of the studied factors on the final properties of the product are further evaluated through characterization techniques, including x-ray diffraction, energy-dispersive x-ray analysis, scanning electron microscopy, transmission electron microscopy and Fourier transform infrared spectroscopy. The results of the study, together with the analysis of variance operations, revealed that through the control of samarium and tungstate concentrations, and temperature, considerable results can be achieved in terms of the product dimensions, morphology, purity and structure. Moreover, the photocatalytic behavior of the synthesized samarium tungstate nanoparticles for the photocatalytic degradation of methylene blue under ultraviolet light is investigated and compared with titanium dioxide as a well-known photocatalyst.

  12. High-pressure synthesis and exotic heavy-fermion behaviour of the filled skutterudite SmPt{sub 4}Ge{sub 12}

    Energy Technology Data Exchange (ETDEWEB)

    Gumeniuk, R; Leithe-Jasper, A; Schnelle, W; Nicklas, M; Rosner, H; Ormeci, A; Burkhardt, U; Schmidt, M; Schwarz, U; Grin, Yu [Max-Planck-Institut fuer Chemische Physik fester Stoffe, Noethnitzer Strasse 40, 01187 Dresden (Germany); Schoeneich, M; Ruck, M, E-mail: schnelle@cpfs.mpg.d [Anorganische Chemie, Technische Universitaet Dresden, 01062 Dresden (Germany)


    Ternary samarium-filled platinum-germanium skutterudite SmPt{sub 4}Ge{sub 12} was prepared at a pressure of 5.0(0.5) GPa and a temperature of 1070(70) K. The compound crystallizes in the cubic space group Im 3-bar (a=8.6069(4) A) and is isotypic with LaFe{sub 4}P{sub 12}. X-ray absorption spectroscopy measurements show that samarium in SmPt{sub 4}Ge{sub 12} has a temperature-independent intermediate valence ({nu}=2.90{+-}0.03). Magnetization data reveal Van Vleck paramagnetism above {approx}50 K. The low-temperature specific heat displays a broad anomaly centred at 2.9 K and a large linear coefficient {gamma} ' =450 mJ mol{sup -1} K{sup -2} suggesting heavy-fermion behaviour. Low-temperature electrical resistivity shows a temperature dependence reminiscent of the Kondo effect. Density functional calculations result in an electronic structure that is, apart from the Sm 4f contributions, very similar to LaPt{sub 4}Ge{sub 12}.

  13. Ni-Zn-Sm nanopowder ferrites: Morphological aspects and magnetic properties (United States)

    Costa, A. C. F. M.; Diniz, A. P. A.; de Melo, A. G. B.; Kiminami, R. H. G. A.; Cornejo, D. R.; Costa, A. A.; Gama, L.

    Ni-Zn ferrites have been widely used in components for high-frequency range applications due to their high electrical resistivity, mechanical strength and chemical stability. Ni-Zn ferrite nanopowders doped with samarium with a nominal composition of Ni 0.5Zn 0.5Fe 2-xSm xO 4 ( x=0.0, 0.05, and 0.1 mol) were obtained by combustion synthesis using nitrates and urea as fuel. The morphological aspects of Ni-Zn-Sm ferrite nanopowders were investigated by X-ray diffraction, nitrogen adsorption by BET, sedimentation, scanning electron microscopy and magnetic properties. The results indicated that the Ni-Zn-Sm ferrite nanopowders were composed of soft agglomerates of nanoparticles with a high surface area (55.8-64.8 m 2/g), smaller particles (18-20 nm) and nanocrystallite size particles. The addition of samarium resulted in a reduction of all the magnetic parameters evaluated, namely saturation magnetization (24-40 emu/g), remanent magnetization (2.2-3.5 emu/g) and coercive force (99.3-83.3 Oe).

  14. Magnetic and magnetoelastic properties of epitaxial SmFe{sub 2} thin film

    Energy Technology Data Exchange (ETDEWEB)

    Fuente, C de la; Arnaudas, J I; Ciria, M; Del Moral, A [Departamento de Magnetismo de Solidos and Departamento de Fisica de la Materia Condensada, Instituto de Ciencia de los Materiales de Aragon and Universidad de Zaragoza, 50071, Zaragoza (Spain); Dufour, C; Dumesnil, K, E-mail: cesar@unizar.e [Laboratoire de Metallurgie Physique et de Science des Materiaux, Universite Henry Poincare, Nancy 1, BP 239, 54506 (France)


    We report on magnetic and magnetoelastic measurements for a 5000 A (110) SmFe{sub 2} thin film, which was successfully analyzed by means of a point charge model for describing the effect of the epitaxial growth in this kind of system. Some of the main conclusions of the Moessbauer and magnetoelastic results and the new magnetization results up to 5 T allow us to get a full description of the crystal electric field, exchange, and magnetoelastic behavior in this compound. So, new single-ion parameters are obtained for the crystal field interaction of samarium ions, A{sub 4}(r{sup 4}) = +755 K/ion and A{sub 6}(r{sup 6}) = -180 K/ion, and new single-ion magnetoelastic coupling B{sup gamma}{sup ,2}approx =-200 MPa and B{sup epsilon}{sup ,2}approx =800 MPa, which represent the tetragonal and the in-plane shear deformations, respectively. Moreover, the new thermal behavior of the samarium magnetic moment, the exchange coupling parameter, and the magnetocrystalline anisotropy of the iron sublattice are obtained too. From these, the softening of the spin reorientation transition with respect to the bulk case could be accounted for.

  15. Synergistic Effects of Sm and C Co-Doped Mixed Phase Crystalline TiO2 for Visible Light Photocatalytic Activity

    Directory of Open Access Journals (Sweden)

    Fuchang Peng


    Full Text Available Mixed phase TiO2 nanoparticles with element doping by Sm and C were prepared via a facile sol-gel procedure. The UV-Vis light-diffuse reflectance spectroscopy analysis showed that the absorption region of co-doped TiO2 was shifted to the visible-light region, which was attributed to incorporation of samarium and carbon into the TiO2 lattice during high-temperature reaction. Samarium effectively decreased the anatase-rutile phase transformation. The grain size can be controlled by Sm doping to achieve a large specific surface area useful for the enhancement of photocatalytic activity. The photocatalytic activities under visible light irradiation were evaluated by photocatalytic degradation of methylene blue (MB. The degradation rate of MB over the Sm-C co-doped TiO2 sample was the best. Additionally, first-order apparent rate constants increased by about 4.3 times compared to that of commercial Degusssa P25 under the same experimental conditions. Using different types of scavengers, the results indicated that the electrons, holes, and •OH radicals are the main active species for the MB degradation. The high visible-light photocatalytic activity was attributed to low recombination of the photo-generated electrons and holes which originated from the synergistic effect of the co-doped ions and the heterostructure.

  16. Viability of biocompatible and biodegradable seeds production with incorporated radionuclides; Viabilidade da producao de sementes biocompativeis e biodegradaveis com radionuclideos incorporados

    Energy Technology Data Exchange (ETDEWEB)

    Roberto, W.S. [Centro Federal de Educacao Tecnologica de Ouro Preto (CEFET/OP), MG (Brazil); Pereira, M.M.; Vasconcelos, W.L.; Campos, T.P.R. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)], e-mail:


    The present work aims the development of radioactive seeds, biocompatible and biodegradable, with the objective of adding options in the cancer treatment. The work focus on the production of seeds biodegradable that incorporate radioisotopes with half life inferior than the degradation time of the material. The idea of producing devices with biodegradable materials impregnated with radioisotopes of short half life will offer new possibilities in the cancer treatment, since they can be used following the same procedures of the permanent interstitial brachytherapy, but using degradable materials compatible with the physiological environment. It will be discussed in particular the possible application of these seeds in the treatment of prostate cancer. A review of the subject and a preliminary evaluation of the viability of production of the seeds will be presented. The method of production of the seeds is based on the incorporation of Iodine and Samarium in glass matrixes obtained by sol-gel processing. X-ray fluorescence was done in the samples produced and the incorporation of Iodine and Samarium atoms was confirmed. (author)

  17. Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets. (United States)

    Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun


    Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

  18. Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b. (United States)

    Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A; Semrau, Jeremy D


    It is well known that Methylosinus trichosporium OB3b has two forms of methane monooxygenase (MMO) responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase and a membrane-associated (particulate) methane monooxygenase, and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-type MeDH (Mxa-MeDH) and Xox-type MeDH (Xox-MeDH), and the expression of these two forms is regulated by the availability of the rare earth element (REE), cerium. Here, we extend these studies and show that lanthanum, praseodymium, neodymium and samarium also regulate expression of alternative forms of MeDH. The effect of these REEs on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b, where the Mxa-MeDH was knocked out, was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. Collectively, these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b, but that copper overrides the effect of other metals by an as yet unknown mechanism. © FEMS 2016. All rights reserved. For permissions, please e-mail:

  19. Threshold sensitivity of quartz variometers with negative feedback (United States)

    Odintsov, V. I.; Petrov, V. G.


    The maximum achievable parameters of magnetometers based on optomechanical quartz variometers are studied in connection with the planned transition of the international network Intermagnet to 1-s recording and the need to provide the network of Russian geomagnetic observatories with domestic magnetometers that satisfy Intermagnet requirements. The mechanism of negative feedback effect on the sensitivity threshold of a variometer with an optoelectronic angle transducer is shown. The optimization criterion for the size and shape of the magnets made of different magnetic materials is defined by the maximum ratio of the magnetic moment to the inertial moment. Theoretical and experimental evaluation of the variometer noise level is based on vicalloy and samarium-cobalt. It is shown that the frequency range of magnetometers with variometers based on vicalloy and samarium-cobalt will be bounded from above by frequencies of 1.6 and 6.4 Hz, respectively, at a threshold sensitivity of about 1 pT. These ratios of the frequency and threshold sensitivity for the given magnetic materials are probably limited for quartz variometers with an optoelectronic angle transducer.

  20. Measurement of solubility of plutonium trifluoride and rare-earth fluorides in molten LiF-BeF{sub 2}-ZrF{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Naumov, V.S.; Bychkov, A.V.; Kormilitsyn, M.V. [and others


    Data on behavior of plutonium fluoride and fission products (FP) dissolved in fuel composition are needed to calculate the duration of an operating cycle of the ADTT facility (Accelerator-Driver Transmutation Technologies) and to determine the effect of their equilibrium concentrations on nuclear-physical characteristics of reactor operation. The data on the FP fluoride solubility in the molten salts are of great important for some industrial processes (electrolytical metal deposition, development of physical-chemical mean for processes of chemical technology, etc.) As noted above, some information on this question is given in monography and articles. Data concerning fluoride salts are given in reports. However, it was impossible to make the substantial analysis of mutual solubility of fluoride melts. The primary investigation of CeF{sub 3} and neodymium, samarium and lanthanum fluorides showed that the solubility of the melt LiF-BeF{sub 2} and LiF-BeF{sub 2}-ThF{sub 4} was a linear function of reverse temperature and increases from lanthanum to samarium in the row of rare-earth elements. Disagreement in estimation of plutonium trifluoride solubility and incomplete data on the solubility of rare-earth elements prompted this study.